Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
Suppression of Bedbug’s Reproduction by RNA Interference of Vitellogenin
Moriyama, Minoru; Hosokawa, Takahiro; Tanahashi, Masahiko; Nikoh, Naruo; Fukatsu, Takema
2016-01-01
Recent resurgence of the bedbug Cimex lectularius is a global problem on the public health. On account of the worldwide rise of insecticide-resistant bedbug populations, exploration of new approaches to the bedbug control and management is anticipated. In this context, gene silencing by RNA interference (RNAi) has been considered for its potential application to pest control and management, because RNAi enables specific suppression of target genes and thus flexible selection of target traits to be disrupted. In this study, in an attempt to develop a control strategy targeting reproduction of the bedbug, we investigated RNAi-mediated gene silencing of vitellogenin (Vg), a major yolk protein precursor essential for oogenesis. From the bedbug transcriptomes, we identified a typical Vg gene and a truncated Vg gene, which were designated as ClVg and ClVg-like, respectively. ClVg gene was highly expressed mainly in the fat body of adult females, which was more than 100 times higher than the expression level of ClVg-like gene, indicating that ClVg gene is the primary functional Vg gene in the bedbug. RNAi-mediated suppression of ClVg gene expression in adult females resulted in drastically reduced egg production, atrophied ovaries, and inflated abdomen due to hypertrophied fat bodies. These phenotypic consequences are expected not only to suppress the bedbug reproduction directly but also to deteriorate its feeding and survival indirectly via behavioral modifications. These results suggest the potential of ClVg gene as a promising target for RNAi-based population management of the bedbug. PMID:27096422
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha
2015-05-01
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.
Ethical Perspectives on RNA Interference Therapeutics
Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou
2008-01-01
RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370
Flavivirus RNAi suppression: decoding non-coding RNA.
Pijlman, Gorben P
2014-08-01
Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.
A Re-Examination of Global Suppression of RNA Interference by HIV-1
Sanghvi, Viraj R.; Steel, Laura F.
2011-01-01
The nature of the interaction between replicating HIV-1 and the cellular RNAi pathway has been controversial, but it is clear that it can be complex and multifaceted. It has been proposed that the interaction is bi-directional, whereby cellular silencing pathways can restrict HIV-1 replication, and in turn, HIV-1 can suppress silencing pathways. Overall suppression of RNAi has been suggested to occur via direct binding and inhibition of Dicer by the HIV-1 Tat protein or through sequestration of TRBP, a Dicer co-factor, by the structured TAR element of HIV-1 transcripts. The role of Tat as an inhibitor of Dicer has been questioned and our results support and extend the conclusion that Tat does not inhibit RNAi that is mediated by either exogenous or endogenous miRNAs. Similarly, we find no suppression of silencing pathways in cells with replicating virus, suggesting that viral products such as the TAR RNA elements also do not reduce the efficacy of cellular RNA silencing. However, knockdown of Dicer does allow increased viral replication and this occurs at a post-transcriptional level. These results support the idea that although individual miRNAs can act to restrict HIV-1 replication, the virus does not counter these effects through a global suppression of RNAi synthesis or processing. PMID:21386885
Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors
Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József
2006-01-01
RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105
Study on Interference Suppression Algorithms for Electronic Noses: A Review
Liang, Zhifang; Zhang, Ci; Sun, Hao; Liu, Tao
2018-01-01
Electronic noses (e-nose) are composed of an appropriate pattern recognition system and a gas sensor array with a certain degree of specificity and broad spectrum characteristics. The gas sensors have their own shortcomings of being highly sensitive to interferences which has an impact on the detection of target gases. When there are interferences, the performance of the e-nose will deteriorate. Therefore, it is urgent to study interference suppression techniques for e-noses. This paper summarizes the sources of interferences and reviews the advances made in recent years in interference suppression for e-noses. According to the factors which cause interference, interferences can be classified into two types: interference caused by changes of operating conditions and interference caused by hardware failures. The existing suppression methods were summarized and analyzed from these two aspects. Since the interferences of e-noses are uncertain and unstable, it can be found that some nonlinear methods have good effects for interference suppression, such as methods based on transfer learning, adaptive methods, etc. PMID:29649152
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
Tsutsumida, Hideaki; Swanson, Benjamin J; Singh, Pankaj K; Caffrey, Thomas C; Kitajima, Shinichi; Goto, Masamichi; Yonezawa, Suguru; Hollingsworth, Michael A
2006-05-15
MUC1 is a highly glycosylated, type I transmembrane protein expressed by normal ductal epithelial cells of the pancreas, breast, lung, and gastrointestinal tract, and overexpressed in many cases of adenocarcinoma. We down-regulated MUC1 expression by RNA interference and investigated the effects on malignant and metastatic potential of a human pancreatic cancer cell line, S2-013. MUC1-suppressed clones, S2-013.MTII.C1 and S2-013.MTII.C2, were established by targeting a sequence 3,151 bp from the initiation codon and characterized in vitro for proliferation, invasion, and adhesion. We evaluated the effects of MUC1 suppression in vivo on tumor growth and metastatic properties following implantation into the cecum or pancreas of athymic mice. MUC1-suppressed clones showed significantly decreased proliferation in vitro and in vivo. Global gene expression was evaluated by oligonucleotide microarray analysis. Surprisingly, genes predicted to increase doubling times (cyclin B1 and cyclin D3) were overexpressed in MUC1-suppressed clones. There were alterations in expression of several genes that may affect the malignant properties of pancreatic cancer. Adhesion of MUC1-suppressed cells in vitro to type IV collagen and fibronectin was slightly increased, and adhesion was slightly decreased to type I collagen and laminin. Results of implantation to cecum and pancreas showed significant reduction of metastasis to lymph nodes, lung, or peritoneal sites compared with S2-013.gfp-neo control cells. These results support the hypothesis that MUC1 contributes significantly to growth and metastasis, and that down-regulation of MUC1 protein expression decreases the metastatic potential of pancreatic adenocarcinoma.
Interfering RNA with multi-targets for efficient gene suppression in HCC cells.
Li, Tiejun; Zhu, York Yuanyuan; Ji, Yi; Zhou, Songfeng
2018-06-01
RNA interference (RNAi) technology has been widely used in therapeutics development, especially multiple targeted RNAi strategy, which is a better method for multiple gene suppression. In the study, interfering RNAs (iRNAs) were designed for carrying two or three different siRNA sequences in different secondary structure formats (loop or cloverleaf). By using these types of iRNAs, co-inhibition of survivin and B-cell lymphoma-2 (Bcl-2) was investigated in hepatocellular carcinoma (HCC) cells, and we obtained promising gene silencing effects without showing undesirable interferon response. Furthermore, suppression effects on proliferation, invasion, and induced apoptosis in HCC cells were validated. The results suggest that long iRNAs with secondary structure may be a preferred strategy for multigenic disease therapy, especially for cancer and viral gene therapy and their iRNA drug development.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of
47 CFR 80.217 - Suppression of interference aboard ships.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 47 Telecommunication 5 2012-10-01 2012-10-01 false Suppression of interference aboard ships. 80.217 Section 80.217 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL... interference aboard ships. (a) A voluntarily equipped ship station receiver must not cause harmful interference...
47 CFR 80.217 - Suppression of interference aboard ships.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 47 Telecommunication 5 2014-10-01 2014-10-01 false Suppression of interference aboard ships. 80.217 Section 80.217 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL... interference aboard ships. (a) A voluntarily equipped ship station receiver must not cause harmful interference...
47 CFR 80.217 - Suppression of interference aboard ships.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 47 Telecommunication 5 2013-10-01 2013-10-01 false Suppression of interference aboard ships. 80.217 Section 80.217 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL... interference aboard ships. (a) A voluntarily equipped ship station receiver must not cause harmful interference...
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Park, Jong-Beom; Park, Chanjoo
2017-10-01
In vitro cell culture model. To investigate the effect of small interfering RNA (siRNA) on Fas expression, apoptosis, and proliferation in serum-deprived rat disc cells. Synthetic siRNA can trigger an RNA interference (RNAi) response in mammalian cells and precipitate the inhibition of specific gene expression. However, the potential utility of siRNA technology in downregulation of specific genes associated with disc cell apoptosis remains unclear. Rat disc cells were isolated and cultured in the presence of either 10% fetal bovine serum (FBS) (normal control) or 0% FBS (serum deprivation to induce apoptosis) for 48 hours. Fas expression, apoptosis, and proliferation were determined. Additionally, siRNA oligonucleotides against Fas (Fas siRNA) were transfected into rat disc cells to suppress Fas expression. Changes in Fas expression were assessed by reverse transcription-polymerase chain reaction and semiquantitatively analyzed using densitometry. The effect of Fas siRNA on apoptosis and proliferation of rat disc cells were also determined. Negative siRNA and transfection agent alone (Mock) were used as controls. Serum deprivation increased apoptosis by 40.3% ( p <0.001), decreased proliferation by 45.3% ( p <0.001), and upregulated Fas expression. Additionally, Fas siRNA suppressed Fas expression in serum-deprived cultures, with 68.5% reduction at the mRNA level compared to the control cultures ( p <0.001). Finally, Fas siRNA-mediated suppression of Fas expression significantly inhibited apoptosis by 9.3% and increased proliferation by 21% in serum-deprived cultures ( p <0.05 for both). The observed dual positive effect of Fas siRNA might be a powerful therapeutic approach for disc degeneration by suppression of harmful gene expression.
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
Widespread suppression of huntingtin with convection-enhanced delivery of siRNA.
Stiles, David K; Zhang, Zhiming; Ge, Pei; Nelson, Brian; Grondin, Richard; Ai, Yi; Hardy, Peter; Nelson, Peter T; Guzaev, Andrei P; Butt, Mark T; Charisse, Klaus; Kosovrasti, Verbena; Tchangov, Lubomir; Meys, Michael; Maier, Martin; Nechev, Lubomir; Manoharan, Muthiah; Kaemmerer, William F; Gwost, Douglas; Stewart, Gregory R; Gash, Don M; Sah, Dinah W Y
2012-01-01
Huntington's disease is an autosomal dominant neurodegenerative disease caused by a toxic gain of function mutation in the huntingtin gene (Htt). Silencing of Htt with RNA interference using direct CNS delivery in rodent models of Huntington's disease has been shown to reduce pathology and promote neuronal recovery. A key translational step for this approach is extension to the larger non-human primate brain, achieving sufficient distribution of small interfering RNA targeting Htt (siHtt) and levels of Htt suppression that may have therapeutic benefit. We evaluated the potential for convection enhanced delivery (CED) of siHtt to provide widespread and robust suppression of Htt in nonhuman primates. siHtt was infused continuously for 7 or 28 days into the nonhuman primate putamen to analyze effects of infusion rate and drug concentration on the volume of effective suppression. Distribution of radiolabeled siHtt and Htt suppression were quantified by autoradiography and PCR, respectively, in tissue punches. Histopathology was evaluated and Htt suppression was also visualized in animals treated for 28 days. Seven days of CED led to widespread distribution of siHtt and significant Htt silencing throughout the nonhuman primate striatum in an infusion rate and dose dependent manner. Htt suppression at therapeutic dose levels was well tolerated by the brain. A model developed from these results predicts that continuous CED of siHtt can achieve significant coverage of the striatum of Huntington's disease patients. These findings suggest that this approach may provide an important therapeutic strategy for treating Huntington's disease. Copyright © 2011 Elsevier Inc. All rights reserved.
RNA virus interference via CRISPR/Cas13a system in plants.
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
Stroop interference and negative priming (NP) suppression in normal aging.
Mayas, J; Fuentes, L J; Ballesteros, S
2012-01-01
Age-related differences in the reduction of Stroop interference were explored by comparing the performance of 18 younger (of mean age: 30.0±3.9 years) and 18 older healthy adults (of mean age: 75±7.2 years) in a color-word Stroop task. The aim of this study was to determine whether a decrease in the efficiency of inhibitory mechanisms associated with aging could account for age-related differences in the ability to suppress a pre-potent response. Participants performed a Stroop task to assess Stroop interference and NP suppression concurrently. Results showed a greater Stroop interference in older than in young adults. On the other hand, the NP effect was only reliable in the younger group, the older group not showing NP suppression. These findings suggest that the slowing hypothesis alone cannot explain this pattern of results and that the age-related differences must also involve an inhibitory breakdown during aging. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.
Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K
1995-01-01
We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
Mimicry technology: suppressing small RNA activity in plants.
Rubio-Somoza, Ignacio; Manavella, Pablo Andrés
2011-01-01
Small RNA suppression constitutes one of the major difficulties for a full molecular characterization of their specific roles in plants. Taking advantage of the latest insights into the new post-biogenesis layer of regulation in microRNA (miRNA) activity, it is possible to overcome the above-mentioned limitation (Nat Genet 39:1033-1037, 2007). We engineered the IPS1 non-coding RNA to bear a complementary sequence to a given miRNA family, resulting in specific sequestration of RISC complexes. MIMIC technology allows for the constitutive release of all of the potential targets of a miRNA family as well as tissue-specific and inducible suppression of its activity.
Healey, M Karl; Ngo, K W Joan; Hasher, Lynn
2014-01-01
Resolving interference from competing memories is a critical factor in efficient memory retrieval, and several accounts of cognitive aging suggest that difficulty resolving interference may underlie memory deficits such as those seen in the elderly. Although many researchers have suggested that the ability to suppress competitors is a key factor in resolving interference, the evidence supporting this claim has been the subject of debate. Here, we present a new paradigm and results demonstrating that for younger adults, a single retrieval attempt is sufficient to suppress competitors to below-baseline levels of accessibility even though the competitors are never explicitly presented. The extent to which individual younger adults suppressed competitors predicted their performance on a memory span task. In a second experiment, older adults showed no evidence of suppression, which supports the theory that older adults' memory deficits are related to impaired suppression.
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.
Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M
2018-05-01
Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.
Guo, Hongyan; Song, Xiaoguang; Xie, Chuanmiao; Huo, Yan; Zhang, Fujie; Chen, Xiaoying; Geng, Yunfeng; Fang, Rongxiang
2013-08-01
The P6 protein of Rice yellow stunt rhabdovirus (RYSV) is a virion structural protein that can be phosphorylated in vitro. However its exact function remains elusive. We found that P6 enhanced the virulence of Potato virus X (PVX) in Nicotiana benthamiana and N. tabacum plants, suggesting that it might function as a suppressor of RNA silencing. We examined the mechanism of P6-mediated silencing suppression by transiently expressing P6 in both N. benthamiana leaves and rice protoplasts. Our results showed that P6 could repress the production of secondary siRNAs and inhibit systemic green fluorescent protein RNA silencing but did not interfere with local RNA silencing in N. benthamiana plants or in rice protoplasts. Intriguingly, P6 and RDR6 had overlapping subcellular localization and P6 bound both rice and Arabidopsis RDR6 in vivo. Furthermore, transgenic rice plants expressing P6 showed enhanced susceptibility to infection by Rice stripe virus. Hence, we propose that P6 is part of the RYSV's counter-defense machinery against the plant RNA silencing system and plays a role mainly in affecting RDR6-mediated secondary siRNA synthesis. Our work provides a new perspective on how a plant-infecting nucleorhabdovirus may counteract host RNA silencing-mediated antiviral defense.
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
Ambardekar, Vishakha V; Han, Huai-Yun; Varney, Michelle L; Vinogradov, Serguei V; Singh, Rakesh K; Vetro, Joseph A
2011-02-01
Polymer-siRNA complexes (siRNA polyplexes) are being actively developed to improve the therapeutic application of siRNA. A major limitation for many siRNA polyplexes, however, is insufficient mRNA suppression. Given that modifying the sense strand of siRNA with 3' cholesterol (chol-siRNA) increases the activity of free nuclease-resistant siRNA in vitro and in vivo, we hypothesized that complexation of chol-siRNA can increase mRNA suppression by siRNA polyplexes. In this study, the characteristics and siRNA activity of self assembled polyplexes formed with chol-siRNA or unmodified siRNA were compared using three types of conventional, positively charged polymers: (i) biodegradable, cross-linked nanogels (BDNG) (ii) graft copolymers (PEI-PEG), and (iii) linear block copolymers (PLL10-PEG, and PLL50-PEG). Chol-siRNA did not alter complex formation or the resistance of polyplexes to siRNA displacement by heparin but increased nuclease protection by BDNG, PLL10-PEG, and PLL50-PEG polyplexes over polyplexes with unmodified siRNA. Chol-CYPB siRNA increased suppression of native CYPB mRNA in mammary microvascular endothelial cells (MVEC) by BDNG polyplexes (35%) and PLL10-PEG polyplexes (69%) over comparable CYPB siRNA polyplexes but had no effect on PEI-PEG or PLL50-PEG polyplexes. Overall, these results indicate that complexation of chol-siRNA increases nuclease protection and mRNA suppression by select siRNA polyplexes. These results also suggest that polycationic block length is an important factor in increasing mRNA suppression by PLL-PEG chol-siRNA polyplexes in mammary MVEC. Copyright © 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Chen, Yung-Yu; Huang, Li-Chung; Wang, Wei-Shan; Lin, Yu-Ching; Wu, Tsung-Tsong; Sun, Jia-Hong; Esashi, Masayoshi
2013-04-01
Acoustic interference suppression of quartz crystal microbalance (QCM) sensor arrays utilizing phononic crystals is investigated in this paper. A square-lattice phononic crystal structure is designed to have a complete band gap covering the QCM's resonance frequency. The monolithic sensor array consisting of two QCMs separated by phononic crystals is fabricated by micromachining processes. As a result, 12 rows of phononic crystals with band gap boost insertion loss between the two QCMs by 20 dB and also reduce spurious modes. Accordingly, the phononic crystal is verified to be capable of suppressing the acoustic interference between adjacent QCMs in a sensor array.
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing
Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom
2015-01-01
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.
Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom
2015-05-14
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.
Domain motions of Argonaute, the catalytic engine of RNA interference
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-01-01
Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142
Domain motions of Argonaute, the catalytic engine of RNA interference.
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-11-30
The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Ambardekar, Vishakha V.; Han, Huai-Yun; Varney, Michelle L.; Vinogradov, Serguei V.; Singh, Rakesh K.; Vetro, Joseph A.
2010-01-01
Polymer-siRNA complexes (siRNA polyplexes) are being actively developed to improve the therapeutic application of siRNA. A major limitation for many siRNA polyplexes, however, is insufficient mRNA suppression. Given that modifying the sense strand of siRNA with 3′ cholesterol (chol-siRNA) increases the activity of free nuclease-resistant siRNA in vitro and in vivo, we hypothesized that complexation of chol-siRNA can increase mRNA suppression by siRNA polyplexes. In this study, the characteristics and siRNA activity of self assembled polyplexes formed with chol-siRNA or unmodified siRNA were compared using three types of conventional, positively charged polymers: (i) biodegradable, cross-linked nanogels (BDNG) (ii) graft copolymers (PEI-PEG), and (iii) linear block copolymers (PLL10-PEG, and PLL50-PEG). Chol-siRNA did not alter complex formation or the resistance of polyplexes to siRNA displacement by heparin but increased nuclease protection by BDNG, PLL10-PEG, and PLL50-PEG polyplexes over polyplexes with unmodified siRNA. Chol-CYPB siRNA increased suppression of native CYPB mRNA in mammary microvascular endothelial cells (MVEC) by BDNG polyplexes (35%) and PLL10-PEG polyplexes (69%) over comparable CYPB siRNA polyplexes but had no effect on PEI-PEG or PLL50-PEG polyplexes. Overall, these results indicate that complexation of chol-siRNA increases nuclease protection and mRNA suppression by select siRNA polyplexes. These results also suggest that polycationic block length is an important factor in increasing mRNA suppression by PLL-PEG chol-siRNA polyplexes in mammary MVEC. PMID:21047680
Mueller, Shane T.; Esposito, Alena G.
2015-01-01
We describe the Bivalent Shape Task (BST), software using the Psychology Experiment Building Language (PEBL), for testing of cognitive interference and the ability to suppress interference. The test is available via the GNU Public License, Version 3 (GPLv3), is freely modifiable, and has been tested on both children and adults and found to provide a simple and fast non-verbal measure of cognitive interference and suppression that requires no reading. PMID:26702358
Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2009-11-01
Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.
Feng, Hui; Beck, Jürgen; Nassal, Michael; Hu, Kang-hong
2011-01-01
Background The specific interaction between hepatitis B virus (HBV) polymerase (P protein) and the ε RNA stem-loop on pregenomic (pg) RNA is crucial for viral replication. It triggers both pgRNA packaging and reverse transcription and thus represents an attractive antiviral target. RNA decoys mimicking ε in P protein binding but not supporting replication might represent novel HBV inhibitors. However, because generation of recombinant enzymatically active HBV polymerase is notoriously difficult, such decoys have as yet not been identified. Methodology/Principal Findings Here we used a SELEX approach, based on a new in vitro reconstitution system exploiting a recombinant truncated HBV P protein (miniP), to identify potential ε decoys in two large ε RNA pools with randomized upper stem. Selection of strongly P protein binding RNAs correlated with an unexpected strong enrichment of A residues. Two aptamers, S6 and S9, displayed particularly high affinity and specificity for miniP in vitro, yet did not support viral replication when part of a complete HBV genome. Introducing S9 RNA into transiently HBV producing HepG2 cells strongly suppressed pgRNA packaging and DNA synthesis, indicating the S9 RNA can indeed act as an ε decoy that competitively inhibits P protein binding to the authentic ε signal on pgRNA. Conclusions/Significance This study demonstrates the first successful identification of human HBV ε aptamers by an in vitro SELEX approach. Effective suppression of HBV replication by the S9 aptamer provides proof-of-principle for the ability of ε decoy RNAs to interfere with viral P-ε complex formation and suggests that S9-like RNAs may further be developed into useful therapeutics against chronic hepatitis B. PMID:22125633
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
Cardiovascular RNA interference therapy: the broadening tool and target spectrum.
Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina
2013-08-16
Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-01-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Lan, Yang; Xiao, Xuewei; He, Zhengchi; Luo, Yu; Wu, Chuanfang; Li, Ling; Song, Xu
2018-06-20
Overexpressed in colon carcinoma-1 (OCC-1) is one of the earliest annotated long noncoding RNAs (lncRNAs) in colorectal cancer (CRC); however, its function remains largely unknown. Here, we revealed that OCC-1 plays a tumor suppressive role in CRC. OCC-1 knockdown by RNA interference promotes cell growth both in vitro and in vivo, which is largely due to its ability to inhibit G0 to G1 and G1 to S phase cell cycle transitions. In addition, overexpression of OCC-1 can suppress cell growth in OCC-1 knockdown cells. OCC-1 exerts its function by binding to and destabilizing HuR (ELAVL1), a cancer-associated RNA binding protein (RBP) which can bind to and stabilize thousands of mRNAs. OCC-1 enhances the binding of ubiquitin E3 ligase β-TrCP1 to HuR and renders HuR susceptible to ubiquitination and degradation, thereby reducing the levels of HuR and its target mRNAs, including the mRNAs directly associated with cancer cell growth. These findings reveal that lncRNA OCC-1 can regulate the levels of a large number of mRNAs at post-transcriptional level through modulating RBP HuR stability.
TGF-β Suppression of HBV RNA through AID-Dependent Recruitment of an RNA Exosome Complex
Kitamura, Kouichi; Wang, Zhe; Chowdhury, Sajeda; Monjurul, Ahasan Md; Wakae, Kousho; Koura, Miki; Shimadu, Miyuki; Kinoshita, Kazuo; Muramatsu, Masamichi
2015-01-01
Transforming growth factor (TGF)-β inhibits hepatitis B virus (HBV) replication although the intracellular effectors involved are not determined. Here, we report that reduction of HBV transcripts by TGF-β is dependent on AID expression, which significantly decreases both HBV transcripts and viral DNA, resulting in inhibition of viral replication. Immunoprecipitation reveals that AID physically associates with viral P protein that binds to specific virus RNA sequence called epsilon. AID also binds to an RNA degradation complex (RNA exosome proteins), indicating that AID, RNA exosome, and P protein form an RNP complex. Suppression of HBV transcripts by TGF-β was abrogated by depletion of either AID or RNA exosome components, suggesting that AID and the RNA exosome involve in TGF-β mediated suppression of HBV RNA. Moreover, AID-mediated HBV reduction does not occur when P protein is disrupted or when viral transcription is inhibited. These results suggest that induced expression of AID by TGF-β causes recruitment of the RNA exosome to viral RNP complex and the RNA exosome degrades HBV RNA in a transcription-coupled manner. PMID:25836330
Dotsinsky, Ivan
2005-11-26
Public access defibrillators (PADs) are now available for more efficient and rapid treatment of out-of-hospital sudden cardiac arrest. PADs are used normally by untrained people on the streets and in sports centers, airports, and other public areas. Therefore, automated detection of ventricular fibrillation, or its exclusion, is of high importance. A special case exists at railway stations, where electric power-line frequency interference is significant. Many countries, especially in Europe, use 16.7 Hz AC power, which introduces high level frequency-varying interference that may compromise fibrillation detection. Moving signal averaging is often used for 50/60 Hz interference suppression if its effect on the ECG spectrum has little importance (no morphological analysis is performed). This approach may be also applied to the railway situation, if the interference frequency is continuously detected so as to synchronize the analog-to-digital conversion (ADC) for introducing variable inter-sample intervals. A better solution consists of rated ADC, software frequency measuring, internal irregular re-sampling according to the interference frequency, and a moving average over a constant sample number, followed by regular back re-sampling. The proposed method leads to a total railway interference cancellation, together with suppression of inherent noise, while the peak amplitudes of some sharp complexes are reduced. This reduction has negligible effect on accurate fibrillation detection. The method is developed in the MATLAB environment and represents a useful tool for real time railway interference suppression.
Dotsinsky, Ivan
2005-01-01
Background Public access defibrillators (PADs) are now available for more efficient and rapid treatment of out-of-hospital sudden cardiac arrest. PADs are used normally by untrained people on the streets and in sports centers, airports, and other public areas. Therefore, automated detection of ventricular fibrillation, or its exclusion, is of high importance. A special case exists at railway stations, where electric power-line frequency interference is significant. Many countries, especially in Europe, use 16.7 Hz AC power, which introduces high level frequency-varying interference that may compromise fibrillation detection. Method Moving signal averaging is often used for 50/60 Hz interference suppression if its effect on the ECG spectrum has little importance (no morphological analysis is performed). This approach may be also applied to the railway situation, if the interference frequency is continuously detected so as to synchronize the analog-to-digital conversion (ADC) for introducing variable inter-sample intervals. A better solution consists of rated ADC, software frequency measuring, internal irregular re-sampling according to the interference frequency, and a moving average over a constant sample number, followed by regular back re-sampling. Results The proposed method leads to a total railway interference cancellation, together with suppression of inherent noise, while the peak amplitudes of some sharp complexes are reduced. This reduction has negligible effect on accurate fibrillation detection. Conclusion The method is developed in the MATLAB environment and represents a useful tool for real time railway interference suppression. PMID:16309558
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].
Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente
2010-01-01
RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
Chemical modification: the key to clinical application of RNA interference?
Corey, David R.
2007-01-01
RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019
Suppression in high-order above-threshold ionization: destructive interference from quantum orbits
NASA Astrophysics Data System (ADS)
Lai, Xuan Yang; Quan, Wei; Yu, Shao Gang; Huang, Yi Yi; Liu, Xiao Jun
2018-05-01
We experimentally study the above-threshold ionization (ATI) spectra of noble gas argon in an intense laser field and focus on a novel suppression structure in the high-order ATI (HATI) spectra. It is found that, when a well-documented resonancelike enhancement feature appears in the HATI spectra, a significant suppression structure is followed in a higher energy region of the spectra. The observation is well reproduced by a numerical solution of the time-dependent Schrödinger equation. In terms of quantum-orbit theory, the observed suppression structure can be ascribed to the destructive interference from longer quantum orbits. Furthermore, an intrinsic relation between the ionization suppression and the ionization enhancement in the HATI spectra is well established.
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
RNA interference therapy: a new solution for intracranial atherosclerosis?
Tang, Tao; Wong, Ka-Sing
2014-01-01
Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054
2011-01-01
Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect
Hsu, Shih-Feng; Su, Wen-Chi; Jeng, King-Song
2015-01-01
ABSTRACT Influenza A virus (IAV) depends on cellular factors to complete its replication cycle; thus, investigation of the factors utilized by IAV may facilitate antiviral drug development. To this end, a cellular transcriptional repressor, DR1, was identified from a genome-wide RNA interference (RNAi) screen. Knockdown (KD) of DR1 resulted in reductions of viral RNA and protein production, demonstrating that DR1 acts as a positive host factor in IAV replication. Genome-wide transcriptomic analysis showed that there was a strong induction of interferon-stimulated gene (ISG) expression after prolonged DR1 KD. We found that beta interferon (IFN-β) was induced by DR1 KD, thereby activating the JAK-STAT pathway to turn on ISG expression, which led to a strong inhibition of IAV replication. This result suggests that DR1 in normal cells suppresses IFN induction, probably to prevent undesired cytokine production, but that this suppression may create a milieu that favors IAV replication once cells are infected. Furthermore, biochemical assays of viral RNA replication showed that DR1 KD suppressed viral RNA replication. We also showed that DR1 associated with all three subunits of the viral RNA-dependent RNA polymerase (RdRp) complex, indicating that DR1 may interact with individual components of the viral RdRp complex to enhance viral RNA replication. Thus, DR1 may be considered a novel host susceptibility gene for IAV replication via a dual mechanism, not only suppressing the host defense to indirectly favor IAV replication but also directly facilitating viral RNA replication. IMPORTANCE Investigations of virus-host interactions involved in influenza A virus (IAV) replication are important for understanding viral pathogenesis and host defenses, which may manipulate influenza virus infection or prevent the emergence of drug resistance caused by a high error rate during viral RNA replication. For this purpose, a cellular transcriptional repressor, DR1, was identified from
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Molecular mechanism of RNA silencing suppression mediated by p19 protein of tombusviruses
Lakatos, Lóránt; Szittya, György; Silhavy, Dániel; Burgyán, József
2004-01-01
RNA silencing is an evolutionarily conserved surveillance system that occurs in a broad range of eukaryotic organisms. In plants, RNA silencing acts as an antiviral system; thus, successful virus infection requires suppression of gene silencing. A number of viral suppressors have been identified so far; however, the molecular bases of silencing suppression are still poorly understood. Here we show that p19 of Cymbidium ringspot virus (CymRSV) inhibits RNA silencing via its small RNA-binding activity in vivo. Small RNAs bound by p19 in planta are bona fide double-stranded siRNAs and they are silencing competent in the in vitro RNA-silencing system. p19 also suppresses RNA silencing in the heterologous Drosophila in vitro system by preventing siRNA incorporation into RISC. During CymRSV infection, p19 markedly diminishes the amount of free siRNA in cells by forming p19–siRNA complexes, thus making siRNAs inaccessible for effector complexes of RNA-silencing machinery. Furthermore, the obtained results also suggest that the p19-mediated sequestration of siRNAs in virus-infected cells blocks the spread of the mobile, systemic signal of RNA silencing. PMID:14976549
Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B
2018-06-01
RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
Ilegems, Erwin; Pick, Horst M.; Vogel, Horst
2002-01-01
A reporter assay was developed to detect and quantify nonsense codon suppression by chemically aminoacylated tRNAs in mammalian cells. It is based on the cellular expression of the enhanced green fluorescent protein (EGFP) as a reporter for the site-specific amino acid incorporation in its sequence using an orthogonal suppressor tRNA derived from Escherichia coli. Suppression of an engineered amber codon at position 64 in the EGFP run-off transcript could be achieved by the incorporation of a leucine via an in vitro aminoacylated suppressor tRNA. Microinjection of defined amounts of mutagenized EGFP mRNA and suppressor tRNA into individual cells allowed us to accurately determine suppression efficiencies by measuring the EGFP fluorescence intensity in individual cells using laser-scanning confocal microscopy. Control experiments showed the absence of natural suppression or aminoacylation of the synthetic tRNA by endogenous aminoacyl-tRNA synthetases. This reporter assay opens the way for the optimization of essential experimental parameters for expanding the scope of the suppressor tRNA technology to different cell types. PMID:12466560
Christov, Ivaylo I; Iliev, Georgi L
2005-03-15
A specific problem using the public access defibrillators (PADs) arises at the railway stations. Some countries as Germany, Austria, Switzerland, Norway and Sweden are using AC railroad net power-supply system with rated 16.7 Hz frequency modulated from 15.69 Hz to 17.36 Hz. The power supply frequency contaminates the electrocardiogram (ECG). It is difficult to be suppressed or eliminated due to the fact that it considerably overlaps the frequency spectra of the ECG. The interference impedes the automated decision of the PADs whether a patient should be (or should not be) shocked. The aim of this study is the suppression of the 16.7 Hz interference generated by the power supply of the railway systems. Software solution using adaptive filtering method was proposed for 16.7 Hz interference suppression. The optimal performance of the filter is achieved, embedding a reference channel in the PADs to record the interference. The method was tested with ECGs from AHA database. The method was tested with patients of normal sinus rhythms, symptoms of tachycardia and ventricular fibrillation. Simulated interference with frequency modulation from 15.69 Hz to 17.36 Hz changing at a rate of 2% per second was added to the ECGs, and then processed by the suggested adaptive filtering. The method totally suppresses the noise with no visible distortions of the original signals. The proposed adaptive filter for noise suppression generated by the power supply of the railway systems has a simple structure requiring a low level of computational resources, but a good reference signal as well.
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying
2018-05-02
The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.
Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan
2013-01-01
RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.
NASA Astrophysics Data System (ADS)
Ren, Wenyi; Cao, Qizhi; Wu, Dan; Jiang, Jiangang; Yang, Guoan; Xie, Yingge; Wang, Guodong; Zhang, Sheqi
2018-01-01
Many observers using interference imaging spectrometer were plagued by the fringe-like pattern(FP) that occurs for optical wavelengths in red and near-infrared region. It brings us more difficulties in the data processing such as the spectrum calibration, information retrieval, and so on. An adaptive method based on the bi-dimensional empirical mode decomposition was developed to suppress the nonlinear FP in polarization interference imaging spectrometer. The FP and corrected interferogram were separated effectively. Meanwhile, the stripes introduced by CCD mosaic was suppressed. The nonlinear interferogram background removal and the spectrum distortion correction were implemented as well. It provides us an alternative method to adaptively suppress the nonlinear FP without prior experimental data and knowledge. This approach potentially is a powerful tool in the fields of Fourier transform spectroscopy, holographic imaging, optical measurement based on moire fringe, etc.
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Christov, Ivaylo I; Iliev, Georgi L
2005-01-01
Background A specific problem using the public access defibrillators (PADs) arises at the railway stations. Some countries as Germany, Austria, Switzerland, Norway and Sweden are using AC railroad net power-supply system with rated 16.7 Hz frequency modulated from 15.69 Hz to 17.36 Hz. The power supply frequency contaminates the electrocardiogram (ECG). It is difficult to be suppressed or eliminated due to the fact that it considerably overlaps the frequency spectra of the ECG. The interference impedes the automated decision of the PADs whether a patient should be (or should not be) shocked. The aim of this study is the suppression of the 16.7 Hz interference generated by the power supply of the railway systems. Methods Software solution using adaptive filtering method was proposed for 16.7 Hz interference suppression. The optimal performance of the filter is achieved, embedding a reference channel in the PADs to record the interference. The method was tested with ECGs from AHA database. Results The method was tested with patients of normal sinus rhythms, symptoms of tachycardia and ventricular fibrillation. Simulated interference with frequency modulation from 15.69 Hz to 17.36 Hz changing at a rate of 2% per second was added to the ECGs, and then processed by the suggested adaptive filtering. The method totally suppresses the noise with no visible distortions of the original signals. Conclusion The proposed adaptive filter for noise suppression generated by the power supply of the railway systems has a simple structure requiring a low level of computational resources, but a good reference signal as well. PMID:15766390
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-04-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases
NASA Astrophysics Data System (ADS)
Li, Dong-xia; Ye, Qian-wen
Out-of-band radiation suppression algorithm must be used efficiently for broadband aeronautical communication system in order not to interfere the operation of the existing systems in aviation L-Band. Based on the simple introduction of the broadband aeronautical multi-carrier communication (B-AMC) system model, several sidelobe suppression techniques in orthogonal frequency multiplexing (OFDM) system are presented and analyzed so as to find a suitable algorithm for B-AMC system in this paper. Simulation results show that raise-cosine function windowing can suppress the out-of-band radiation of B-AMC system effectively.
Flanagan, Sheryl A; Cooper, Kristin S; Mannava, Sudha; Nikiforov, Mikhail A; Shewach, Donna S
2012-12-01
To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. shRNA suppression of TS was compared with 5-fluoro-2'-deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. TS shRNA produced profound (≥ 90%) and prolonged (≥ 8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA
Zhang, Yijie; Bao, Mingwei; Dai, Mingyan; Wang, Xin; He, Wenbo; Tan, Tuantuan; Lin, Dandan; Wang, Wei; Wen, Ying; Zhang, Rui
2015-06-03
Fatty acid (FA) catabolism abnormality has been proved to play an important role in obesity-related cardiomyopathy. We hypothesized that cardiospecific suppression of CD36, the predominant membrane FA transporter, would protect against obesity-related cardiomyopathy. Four-wk-old male C57BL/6 J mice were fed with either high-fat-diet (HFD) or control-normal-diet for 2 wk. Then they were subjected to intramyocardial injection with recombinant lentiviral vectors containing short hairpin RNAs to selectively downregulate the expression of either cardiac CD36 or irrelevant gene by RNA interference. After a 10-wk continuation of the diet, biochemical, functional, morphological, histological, metabolic and molecular profiles were assessed. HFD administration elicited obesity, cardiac hypertrophy and systolic dysfunction accompanied with elevated serum levels of blood urea nitrogen (BUN), creatinine, fasting serum glucose (FSG), total cholesterol (TC) and triglyceride. Additionally, HFD consumption promoted lipid accumulation and reactive oxygen species (ROS) generation in the cardiomyocytes. Cardiospecific CD36 inhibition protected against HFD induced cardiac remodeling by decreasing heart/body weight ratio, increasing left ventricular (LV) ejection fraction and fractional shortening as well as normalizing LV diameter, without influencing body weight gain. Inhibition of cardiac CD36 also mitigated obesity induced alteration in BUN, creatinine and triglyceride, but had no effect on FSG or TC. Moreover, cardiospecific CD36 deficiency corrected myocardial lipid overaccumulation and intracellular ROS overproduction that were induced by HFD feeding. Cardiospecific CD36 inhibition protects against the aggravation of cardiac functional and morphological changes associated with HFD induced obesity. CD36 represents a potential therapeutic target for obesity cardiomyopathy.
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Pham, John W; Sontheimer, Erik J
2005-11-25
Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1
Barbie, David A.; Tamayo, Pablo; Boehm, Jesse S.; Kim, So Young; Moody, Susan E.; Dunn, Ian F.; Schinzel, Anna C.; Sandy, Peter; Meylan, Etienne; Scholl, Claudia; Fröhling, Stefan; Chan, Edmond M.; Sos, Martin L.; Michel, Kathrin; Mermel, Craig; Silver, Serena J.; Weir, Barbara A.; Reiling, Jan H.; Sheng, Qing; Gupta, Piyush B.; Wadlow, Raymond C.; Le, Hanh; Hoersch, Sebastian; Wittner, Ben S.; Ramaswamy, Sridhar; Livingston, David M.; Sabatini, David M.; Meyerson, Matthew; Thomas, Roman K.; Lander, Eric S.; Mesirov, Jill P.; Root, David E.; Gilliland, D. Gary; Jacks, Tyler; Hahn, William C.
2009-01-01
The proto-oncogene KRAS is mutated in a wide array of human cancers, most of which are aggressive and respond poorly to standard therapies. Although the identification of specific oncogenes has led to the development of clinically effective, molecularly targeted therapies in some cases, KRAS has remained refractory to this approach. A complementary strategy for targeting KRAS is to identify gene products that, when inhibited, result in cell death only in the presence of an oncogenic allele1,2. Here we have used systematic RNA interference (RNAi) to detect synthetic lethal partners of oncogenic KRAS and found that the non-canonical IκB kinase, TBK1, was selectively essential in cells that harbor mutant KRAS. Suppression of TBK1 induced apoptosis specifically in human cancer cell lines that depend on oncogenic KRAS expression. In these cells, TBK1 activated NF-κB anti-apoptotic signals involving cREL and BCL-XL that were essential for survival, providing mechanistic insights into this synthetic lethal interaction. These observations identify TBK1 and NF-κB signaling as essential in KRAS mutant tumors and establish a general approach for the rational identification of co-dependent pathways in cancer. PMID:19847166
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Chen, Yuan; Sun, Yin; Rao, Qun; Xu, Hua; Li, Lei; Chang, Chawnshang
2015-01-01
Mutational inactivation of the VHL tumor suppressor plays key roles in the development of renal cell carcinoma (RCC), and mutated VHL-mediated VEGF induction has become the main target for the current RCC therapy. Here we identified a signal pathway of VEGF induction by androgen receptor (AR)/miRNA-145 as a new target to suppress RCC progression. Mechanism dissection revealed that AR might function through binding to the androgen receptor element (ARE) located on the promoter region of miRNA-145 to suppress p53's ability to induce expression of miRNA-145 that normally suppresses expression of HIF2α/VEGF/MMP9/CCND1. Suppressing AR with AR-shRNA or introducing exogenous miRNA-145 mimic can attenuate RCC progression independent of VHL status. MiR-145 mimic in preclinical RCC orthotopic xenograft mouse model revealed its efficacy in suppression of RCC progression. These results together identified signals by AR-suppressed miRNA-145 as a key player in the RCC progression via regulating HIF2α/VEGF/MMP9/CCND1 expression levels. Blockade of the newly identified signal by AR inhibition or miRNA-145 mimics has promising therapeutic benefit to suppress RCC progression. PMID:26304926
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
Xiong, Hailiang; Zhang, Wensheng; Xu, Hongji; Du, Zhengfeng; Tang, Huaibin; Li, Jing
2017-05-25
With the rapid development of wireless communication systems and electronic techniques, the limited frequency spectrum resources are shared with various wireless devices, leading to a crowded and challenging coexistence circumstance. Cognitive radio (CR) and ultra-wide band (UWB), as sophisticated wireless techniques, have been considered as significant solutions to solve the harmonious coexistence issues. UWB wireless sensors can share the spectrum with primary user (PU) systems without harmful interference. The in-band interference of UWB systems should be considered because such interference can severely affect the transmissions of UWB wireless systems. In order to solve the in-band interference issues for UWB wireless sensor networks (WSN), a novel in-band narrow band interferences (NBIs) elimination scheme is proposed in this paper. The proposed narrow band interferences suppression scheme is based on a novel complex-coefficient adaptive notch filter unit with a single constrained zero-pole pair. Moreover, in order to reduce the computation complexity of the proposed scheme, an adaptive complex-coefficient iterative method based on two-order Taylor series is designed. To cope with multiple narrow band interferences, a linear cascaded high order adaptive filter and a cyclic cascaded high order matrix adaptive filter (CCHOMAF) interference suppression algorithm based on the basic adaptive notch filter unit are also presented. The theoretical analysis and numerical simulation results indicate that the proposed CCHOMAF algorithm can achieve better performance in terms of average bit error rate for UWB WSNs. The proposed in-band NBIs elimination scheme can significantly improve the reception performance of low-cost and low-power UWB wireless systems.
Xiong, Hailiang; Zhang, Wensheng; Xu, Hongji; Du, Zhengfeng; Tang, Huaibin; Li, Jing
2017-01-01
With the rapid development of wireless communication systems and electronic techniques, the limited frequency spectrum resources are shared with various wireless devices, leading to a crowded and challenging coexistence circumstance. Cognitive radio (CR) and ultra-wide band (UWB), as sophisticated wireless techniques, have been considered as significant solutions to solve the harmonious coexistence issues. UWB wireless sensors can share the spectrum with primary user (PU) systems without harmful interference. The in-band interference of UWB systems should be considered because such interference can severely affect the transmissions of UWB wireless systems. In order to solve the in-band interference issues for UWB wireless sensor networks (WSN), a novel in-band narrow band interferences (NBIs) elimination scheme is proposed in this paper. The proposed narrow band interferences suppression scheme is based on a novel complex-coefficient adaptive notch filter unit with a single constrained zero-pole pair. Moreover, in order to reduce the computation complexity of the proposed scheme, an adaptive complex-coefficient iterative method based on two-order Taylor series is designed. To cope with multiple narrow band interferences, a linear cascaded high order adaptive filter and a cyclic cascaded high order matrix adaptive filter (CCHOMAF) interference suppression algorithm based on the basic adaptive notch filter unit are also presented. The theoretical analysis and numerical simulation results indicate that the proposed CCHOMAF algorithm can achieve better performance in terms of average bit error rate for UWB WSNs. The proposed in-band NBIs elimination scheme can significantly improve the reception performance of low-cost and low-power UWB wireless systems. PMID:28587085
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission
Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.
2016-01-01
ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding
Modulation of alpha oscillations is required for the suppression of semantic interference.
Melnik, Natalia; Mapelli, Igor; Özkurt, Tolga Esat
2017-10-01
Recent findings on alpha band oscillations suggest their important role in memory consolidation and suppression of external distractors such as environmental noise. However, less attention was given to the phenomenon of internal distracting information being solely inherent to the stimuli content. Human memory may be prone to internal distractions caused by semantic relatedness between the meaning of words (e.g., atom, neutron, nucleus, etc.) to be encoded, i.e., semantic interference. Our study investigates the brain oscillatory dynamics behind the semantic interference phenomenon, whose possible outcome is known as false memories. In this direction, Deese-Roediger-McDermott word lists were appropriated for a modified Sternberg paradigm in auditory modality. Participants received semantically related and unrelated word lists via headphones while EEG data were acquired. Semantic interference triggered the false memory rates to be higher than those of other types of memory errors. Analysis demonstrated that the upper part of alpha band (∼10-12Hz) power decreases on parieto-occipital channels in the retention interval, prior to the probe item for semantically related condition. Our study elucidates the oscillatory mechanisms behind semantic interference by relying on alpha functional inhibition theory. Copyright © 2017 Elsevier Inc. All rights reserved.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin
2012-12-01
To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.
Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro
2005-12-01
In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
Hemmes, Hans; Lakatos, Lóránt; Goldbach, Rob; Burgyán, József; Prins, Marcel
2007-01-01
RNA silencing plays a key role in antiviral defense as well as in developmental processes in plants and insects. Negative strand RNA viruses such as the plant virus Rice hoja blanca tenuivirus (RHBV) replicate in plants and in their insect transmission vector. Like most plant-infecting viruses, RHBV encodes an RNA silencing suppressor, the NS3 protein, and here it is demonstrated that this protein is capable of suppressing RNA silencing in both plants and insect cells. Biochemical analyses showed that NS3 efficiently binds siRNA as well as miRNA molecules. Binding of NS3 is greatly influenced by the size of small RNA molecules, as 21 nucleotide (nt) siRNA molecules are bound > 100 times more efficiently than 26 nt species. Competition assays suggest that the activity of NS3 is based on binding to siRNAs prior to strand separation during the assembly of the RNA-induced silencing complex. In addition, NS3 has a high affinity for miRNA/miRNA* duplexes, indicating that its activity might also interfere with miRNA-regulated gene expression in both insects and plants. PMID:17513697
Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon
2012-01-01
Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs
2015-01-01
Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637
Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome
NASA Astrophysics Data System (ADS)
Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei
2004-11-01
Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression
Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong
2013-01-01
A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762
Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.
Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong
2013-01-01
A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.
Proteomics for understanding miRNA biology
Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh
2013-01-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
Special Issue: Gene Therapy with Emphasis on RNA Interference
Lundstrom, Kenneth
2015-01-01
Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Van den Eynde, Eva; Quer, Josep; Cubero, María; Curran, Adriá; Homs, María; Garcia-Cehic, Damir; Falco, Vicenç; Ribera, Esteban; Esteban, Juan I; Pahissa, Albert; Crespo, Manuel
2011-01-01
HCV is a major cause of morbidity and mortality in HIV-coinfected patients. Several observational studies have suggested that HCV response to pegylated interferon and ribavirin is lower in HIV-coinfected patients treated with abacavir. It has been postulated that abacavir could compete with ribavirin to be phosphorylated, leading to a reduction in the active form of the drug (triphosphorylated ribavirin). Here, we studied the effect of abacavir, tenofovir or lamivudine addition on the suppressive activity of ribavirin in an HCV RNA replicon system. We used the human hepatoma HuH-7 cell clone 9B containing the HCV genotype 1b replicon I389/NS3-3'. Cells were treated for 24 h with ribavirin (0, 10 and 50 μM) plus abacavir, tenofovir or lamivudine at doses of 0, 10 and 50 μM and HCV RNA production was quantified by real-time PCR in triplicate assays. Results were expressed as mean±SD of the HCV RNA produced per cell (log(10) IU/cell). Means were compared using the Student's t-test. Ribavirin treatment produced a dose-dependent suppression of HCV RNA production by the replicon system. Combination of ribavirin and interferon resulted in an additive antiviral activity. The addition of abacavir did not modify the suppressive activity of ribavirin on the replicon HCV RNA expression. Similar results were obtained when ribavirin was used in combination with tenofovir or lamivudine. In a subgenomic HCV RNA replicon system, the antiviral effect of ribavirin was not modified by the addition of abacavir, tenofovir or lamivudine. © 2011 International Medical Press
Chan, Chi-Ping; Yuen, Chun-Kit; Cheung, Pak-Hin Hinson; Fung, Sin-Yee; Lui, Pak-Yin; Chen, Honglin; Kok, Kin-Hang; Jin, Dong-Yan
2018-03-07
PACT is a double-stranded RNA-binding protein that has been implicated in host-influenza A virus (IAV) interaction. PACT facilitates the action of RIG-I in the activation of the type I IFN response, which is suppressed by the viral nonstructural protein NS1. PACT is also known to interact with the IAV RNA polymerase subunit PA. Exactly how PACT exerts its antiviral activity during IAV infection remains to be elucidated. In the current study, we demonstrated the interplay between PACT and IAV polymerase. Induction of IFN-β by the IAV RNP complex was most robust when both RIG-I and PACT were expressed. PACT-dependent activation of IFN-β production was suppressed by the IAV polymerase subunits, polymerase acidic protein, polymerase basic protein 1 (PB1), and PB2. PACT associated with PA, PB1, and PB2. Compromising PACT in IAV-infected A549 cells resulted in the augmentation of viral RNA (vRNA) transcription and replication and IFN-β production. Furthermore, vRNA replication was boosted by knockdown of PACT in both A549 cells and IFN-deficient Vero cells. Thus, the antiviral activity of PACT is mediated primarily via its interaction with and inhibition of IAV polymerase. Taken together, our findings reveal a new facet of the host-IAV interaction in which the interplay between PACT and IAV polymerase affects the outcome of viral infection and antiviral response.-Chan, C.-P., Yuen, C.-K., Cheung, P.-H. H., Fung, S.-Y., Lui, P.-Y., Chen, H., Kok, K.-H., Jin, D.-Y. Antiviral activity of double-stranded RNA-binding protein PACT against influenza A virus mediated via suppression of viral RNA polymerase.
NASA Astrophysics Data System (ADS)
Watanabe, Atom O.; Raj, Pulugurtha Markondeya; Wong, Denny; Mullapudi, Ravi; Tummala, Rao
2018-05-01
Control of electromagnetic interference (EMI) represents a major challenge for emerging consumer electronics, the Internet of Things, automotive electronics, and wireless communication systems. This paper discusses innovative EMI shielding materials and structures that offer higher shielding effectiveness compared with copper. To create high shielding effectiveness in the frequency range of 1 MHz to 100 MHz, multilayered shielding topologies with electrically conductive and nanomagnetic materials were modeled, designed, fabricated, and characterized. In addition, suppression of out-of-plane and in-plane magnetic-field coupling noise with these structures is compared with that of traditional single-layer copper or nickel-iron films. Compared with single-layered copper shields, multilayered structures consisting of copper, nickel-iron, and titanium showed a 3.9 times increase in shielding effectiveness in suppressing out-of-plane or vertically coupled noise and 1.3 times increase in lateral coupling. The superiority of multilayered thin-film shields over conventional shielding enables greater design flexibility, higher shielding effectiveness, and further miniaturization of emerging radiofrequency (RF) and power modules.
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Dravid, Ameet N; Natrajan, Kartik; Kulkarni, Milind M; Saraf, Chinmay K; Mahajan, Uma S; Kore, Sachin D; Rathod, Niranjan M; Mahajan, Umakant S; Wadia, Rustom S
2018-02-01
Aim of this study was to estimate the prevalence of cerebrospinal fluid (CSF)/Plasma HIV-1 RNA discordance in virologically suppressed individuals presenting with incident neurologic symptoms.In this retrospective cohort study conducted between March 1, 2009, and March 1, 2017, HIV-1 infected adults exposed to atleast 12 months of antiretroviral therapy (ART) and having plasma viral load (VL) <1000 copies/mL (virologically suppressed) were included. Among these, individuals presenting with neurologic symptoms during follow-up were assessed for CSF/Plasma HIV-1 RNA discordance by measuring HIV-1 RNA in collected plasma and CSF samples. CSF/plasma HIV-1 RNA discordance was defined as either detectable CSF HIV-1 RNA (VL > 20 copies/mL) with an undetectable plasma RNA (complete viral suppression, VL ≤20 copies/mL) or CSF HIV-1 RNA ≥ 0.5 log10 higher than plasma RNA when plasma VL was between 20 and 1000 copies/mL (low-level viremia, LLV).Out of 1584 virologically suppressed patients, 71 (4.4%) presented with incident neurologic symptoms. Twenty out of 71 (28.2%) patients were diagnosed with CSF/Plasma HIV-1 discordance. Median plasma and CSF VL in patients with discordance was 120 [interquartile range (IQR): <20 to 332.5] and 4250 (IQR: 2550.0- 9615.0) copies/mL, respectively. All 9 individuals in which CSF HIV-1 genotypic resistance testing was done showed mutations that would compromise efficacy of prescribed ART regimen. Prevalence of CSF/plasma HIV-1 RNA discordance was higher among neurologically symptomatic patients with plasma LLV as compared with those with complete viral suppression (70% vs 11.8%, P < .001). The risk of discordance was also greater in patients who received protease inhibitor (PI) containing ART (P < .001) and those on ART regimens with central nervous system (CNS) penetration effectiveness (CPE) value <6 (P = .006).CSF/plasma HIV-1 RNA discordance indicates replication of HIV-1 that has adapted to the CNS or has
Proteomics for understanding miRNA biology.
Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh
2013-02-01
MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Role of RNA interference in plant improvement
NASA Astrophysics Data System (ADS)
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
Clements, Justin; Schoville, Sean; Peterson, Nathan; Huseth, Anders S; Lan, Que; Groves, Russell L
2017-01-01
The Colorado potato beetle, Leptinotarsa decemlineata (Say), is a major agricultural pest of potatoes in the Central Sands production region of Wisconsin. Previous studies have shown that populations of L. decemlineata have become resistant to many classes of insecticides, including the neonicotinoid insecticide, imidacloprid. Furthermore, L. decemlineata has multiple mechanisms of resistance to deal with a pesticide insult, including enhanced metabolic detoxification by cytochrome p450s and glutathione S-transferases. With recent advances in the transcriptomic analysis of imidacloprid susceptible and resistant L. decemlineata populations, it is possible to investigate the role of candidate genes involved in imidacloprid resistance. A recently annotated transcriptome analysis of L. decemlineata was obtained from select populations of L. decemlineata collected in the Central Sands potato production region, which revealed a subset of mRNA transcripts constitutively up-regulated in resistant populations. We hypothesize that a portion of the up-regulated transcripts encoding for genes within the resistant populations also encode for pesticide resistance and can be suppressed to re-establish a susceptible phenotype. In this study, a discrete set of three up-regulated targets were selected for RNA interference experiments using a resistant L. decemlineata population. Following the successful suppression of transcripts encoding for a cytochrome p450, a cuticular protein, and a glutathione synthetase protein in a select L. decemlineata population, we observed reductions in measured resistance to imidacloprid that strongly suggest these genes control essential steps in imidacloprid metabolism in these field populations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
NASA Astrophysics Data System (ADS)
Huang, Xiaolei; Dong, Hui; Qiu, Yang; Li, Bo; Tao, Quan; Zhang, Yi; Krause, Hans-Joachim; Offenhäusser, Andreas; Xie, Xiaoming
2018-01-01
Power-line harmonic interference and fixed-frequency noise peaks may cause stripe-artifacts in ultra-low field (ULF) magnetic resonance imaging (MRI) in an unshielded environment and in a conductively shielded room. In this paper we describe an adaptive suppression method to eliminate these artifacts in MRI images. This technique utilizes spatial correlation of the interference from different positions, and is realized by subtracting the outputs of the reference channel(s) from those of the signal channel(s) using wavelet analysis and the least squares method. The adaptive suppression method is first implemented to remove the image artifacts in simulation. We then experimentally demonstrate the feasibility of this technique by adding three orthogonal superconducting quantum interference device (SQUID) magnetometers as reference channels to compensate the output of one 2nd-order gradiometer. The experimental results show great improvement in the imaging quality in both 1D and 2D MRI images at two common imaging frequencies, 1.3 kHz and 4.8 kHz. At both frequencies, the effective compensation bandwidth is as high as 2 kHz. Furthermore, we examine the longitudinal relaxation times of the same sample before and after compensation, and show that the MRI properties of the sample did not change after applying adaptive suppression. This technique can effectively increase the imaging bandwidth and be applied to ULF MRI detected by either SQUIDs or Faraday coil in both an unshielded environment and a conductively shielded room.
Liu, Xijing; Chen, Hongqin; Kong, Weiqi; Zhang, Yanping; Cao, Liyuan; Gao, Linbo; Zhou, Rong
2017-01-01
Preeclampsia is a pregnancy-specific syndrome and is one of the main causes of maternal, fetal, and neonatal morbidity and mortality. Inadequate trophoblast invasion and failure of uterine spiral artery remodeling exert a major role in the development of preeclampsia, especially the early-onset one. LncRNA-ATB is verified to be aberrantly expressed in many cancers and promote the invasion-metastasis and proliferation cascades. But little is known of lncRNA-ATB's role in preeclampsia. The aim of current study is to identify the changes of lncRNA-ATB in preeclampsia and its effects on trophoblast. The lncRNA-ATB levels were decreased in placental samples collected from preeclampsia women (n = 51) compared to those of healthy pregnant women (n = 40) by qRT-PCR analysis. Besides, it is demonstrated that lncRNA-ATB was intense stained in the trophoblast of the placenta by performing in-situ hybridization. By designing RNA interference species to suppress lncRNA-ATB and specific plasmids designed to overexpress lncRNA-ATB, we identify the role of lncRNA-ATB on the functions of trophoblast cell-line, HTR-8/SVneo. Inhibition of endogenous lncRNA-ATB decreased migration, proliferation, tube-formation of HTR-8/SVneo cells. In addition, overexpression of lncRNA-ATB promoted migration, proliferation, and tube-formation of HTR-8/SVneo cells. Therefore, lncRNA-ATB might be involved in the pathogenesis of preeclampsia by regulating the process of trophoblast invasion and endovascular formation. Copyright © 2016 Elsevier Ltd. All rights reserved.
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
NASA Astrophysics Data System (ADS)
Jolie, Wouter; Lux, Jonathan; Pörtner, Mathias; Dombrowski, Daniela; Herbig, Charlotte; Knispel, Timo; Simon, Sabina; Michely, Thomas; Rosch, Achim; Busse, Carsten
2018-03-01
We study chemically gated bilayer graphene using scanning tunneling microscopy and spectroscopy complemented by tight-binding calculations. Gating is achieved by intercalating Cs between bilayer graphene and Ir(111), thereby shifting the conduction band minima below the chemical potential. Scattering between electronic states (both intraband and interband) is detected via quasiparticle interference. However, not all expected processes are visible in our experiment. We uncover two general effects causing this suppression: first, intercalation leads to an asymmetrical distribution of the states within the two layers, which significantly reduces the scanning tunneling spectroscopy signal of standing waves mainly present in the lower layer; second, forward scattering processes, connecting points on the constant energy contours with parallel velocities, do not produce pronounced standing waves due to destructive interference. We present a theory to describe the interference signal for a general n -band material.
Jolie, Wouter; Lux, Jonathan; Pörtner, Mathias; Dombrowski, Daniela; Herbig, Charlotte; Knispel, Timo; Simon, Sabina; Michely, Thomas; Rosch, Achim; Busse, Carsten
2018-03-09
We study chemically gated bilayer graphene using scanning tunneling microscopy and spectroscopy complemented by tight-binding calculations. Gating is achieved by intercalating Cs between bilayer graphene and Ir(111), thereby shifting the conduction band minima below the chemical potential. Scattering between electronic states (both intraband and interband) is detected via quasiparticle interference. However, not all expected processes are visible in our experiment. We uncover two general effects causing this suppression: first, intercalation leads to an asymmetrical distribution of the states within the two layers, which significantly reduces the scanning tunneling spectroscopy signal of standing waves mainly present in the lower layer; second, forward scattering processes, connecting points on the constant energy contours with parallel velocities, do not produce pronounced standing waves due to destructive interference. We present a theory to describe the interference signal for a general n-band material.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takata, Akemi; Otsuka, Motoyuki, E-mail: otsukamo-tky@umin.ac.jp; Kojima, Kentaro
2011-08-12
Highlights: {yields} miRNAs were screened for their ability to regulate NF-{kappa}B activity. {yields} miRNA-22 and miRNA-140-3p suppress NF-{kappa}B activity by regulating coactivators. {yields} miRNA-22 targets nuclear receptor coactivator 1 (NCOA1). {yields} miRNA-140-3p targets nuclear receptor-interacting protein 1 (NRIP1). -- Abstract: Nuclear factor {kappa}B (NF-{kappa}B) is a transcription factor that regulates a set of genes that are critical to many biological phenomena, including liver tumorigenesis. To identify microRNAs (miRNAs) that regulate NF-{kappa}B activity in the liver, we screened 60 miRNAs expressed in hepatocytes for their ability to modulate NF-{kappa}B activity. We found that miRNA-22 and miRNA-140-3p significantly suppressed NF-{kappa}B activity bymore » regulating the expression of nuclear receptor coactivator 1 (NCOA1) and nuclear receptor-interacting protein 1 (NRIP1), both of which are NF-{kappa}B coactivators. Our results provide new information about the roles of miRNAs in the regulation of NF-{kappa}B activity.« less
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
Lee, Jung-Bok; Kim, Hyun Soo; Park, Youngjin
2017-02-01
Chitin synthase (CHS) is an important enzymatic component, which is required for chitin formation in the cuticles and cuticular linings of other tissues in insects. CHSs have been divided into two classes, classes A and B, based on their amino acid sequence similarities and functions. Class A CHS (CHS-A) is specifically expressed in the epidermis and related ectodermal cells such as tracheal cells, while class B CHS (CHS-B) is expressed in gut epithelial cells that produce peritrophic matrices. In this study, we cloned the CHS-A gene from the beet armyworm, Spodoptera exigua (SeCHS-A). The SeCHS-A contains an open reading frame of 4,698 nucleotides, encoding a protein of 1,565 amino acids with a predicted molecular mass of approximately 177.8 kDa. The SeCHS-A mRNA was expressed in all developmental stages and specifically in the epidermis and tracheae tissue by quantitative real-time-PCR analysis. Expression of SeCHS-A gene was suppressed by feeding double-stranded RNA (dsCHS-A, 400 ng/larva) in the third instar larvae of S. exigua. Suppression of the SeCHS-A gene expression significantly increased 35% of mortality on pupation of S. exigua. Also, the third instar larvae fed with dsCHS-A significantly increased susceptibility to entomopathogenic fungi, Beauveria bassiana ANU1 at 3 days after treatment. These results suggest that the SeCHS-A gene plays an important role in development of S. exigua and RNA interference may apply to effective pest control with B. bassiana. © 2017 Wiley Periodicals, Inc.
ABCE1 Is a Highly Conserved RNA Silencing Suppressor
Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia
2015-01-01
ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Smith, Justin D; Suresh, Sundari; Schlecht, Ulrich; Wu, Manhong; Wagih, Omar; Peltz, Gary; Davis, Ronald W; Steinmetz, Lars M; Parts, Leopold; St Onge, Robert P
2016-03-08
Genome-scale CRISPR interference (CRISPRi) has been used in human cell lines; however, the features of effective guide RNAs (gRNAs) in different organisms have not been well characterized. Here, we define rules that determine gRNA effectiveness for transcriptional repression in Saccharomyces cerevisiae. We create an inducible single plasmid CRISPRi system for gene repression in yeast, and use it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identifies previously described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments using gRNA libraries allows us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility are clearly more effective. We also find that the best region to target gRNAs is between the transcription start site (TSS) and 200 bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, the specificity of truncated gRNAs (18 nt of complementarity to the target) is not clearly superior to full-length gRNAs (20 nt of complementarity), as truncated gRNAs are generally less potent against both mismatched and perfectly matched targets. Our results establish a powerful functional and chemical genomics screening method and provide guidelines for designing effective gRNAs, which consider chromatin state and position relative to the target gene TSS. These findings will enable effective library design and genome-wide programmable gene repression in many genetic backgrounds.
Pu, Wenchen; Li, Jiao; Zheng, Yuanyuan; Shen, Xianyan; Fan, Xin; Zhou, Jian-Kang; He, Juan; Deng, Yulan; Liu, Xuesha; Wang, Chun; Yang, Shengyong; Chen, Qiang; Liu, Lunxu; Zhang, Guolin; Wei, Yu-Quan; Peng, Yong
2018-01-30
Hepatocellular carcinoma (HCC) is a leading cause of cancer death worldwide, but there are few effective treatments. Aberrant microRNA (miRNA) biogenesis is correlated with HCC development. We previously demonstrated that peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 (Pin1) participates in miRNA biogenesis and is a potential HCC treatment target. However, how Pin1 modulates miRNA biogenesis remains obscure. Here, we present in vivo evidence that Pin1 overexpression is directly linked to the development of HCC. Administration with the Pin1 inhibitor (API-1), a specific small molecule targeting Pin1 peptidyl-prolyl isomerase domain and inhibiting Pin1 cis-trans isomerizing activity, suppresses in vitro cell proliferation and migration of HCC cells. But API-1-induced Pin1 inhibition is insensitive to HCC cells with low Pin1 expression and/or low exportin-5 (XPO5) phosphorylation. Mechanistically, Pin1 recognizes and isomerizes the phosphorylated serine-proline motif of phosphorylated XPO5 and passivates phosphorylated XPO5. Pin1 inhibition by API-1 maintains the active conformation of phosphorylated XPO5 and restores XPO5-driven precursor miRNA nuclear-to-cytoplasm export, activating anticancer miRNA biogenesis and leading to both in vitro HCC suppression and HCC suppression in xenograft mice. Experimental evidence suggests that Pin1 inhibition by API-1 up-regulates miRNA biogenesis by retaining active XPO5 conformation and suppresses HCC development, revealing the mechanism of Pin1-mediated miRNA biogenesis and unequivocally supporting API-1 as a drug candidate for HCC therapy, especially for Pin1-overexpressing, extracellular signal-regulated kinase-activated HCC. (Hepatology 2018). © 2018 by the American Association for the Study of Liver Diseases.
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Basnet, Sanjay; Kamble, Shripat T
2018-05-01
Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
Huang, Xiaolei; Dong, Hui; Qiu, Yang; Li, Bo; Tao, Quan; Zhang, Yi; Krause, Hans-Joachim; Offenhäusser, Andreas; Xie, Xiaoming
2018-01-01
Power-line harmonic interference and fixed-frequency noise peaks may cause stripe-artifacts in ultra-low field (ULF) magnetic resonance imaging (MRI) in an unshielded environment and in a conductively shielded room. In this paper we describe an adaptive suppression method to eliminate these artifacts in MRI images. This technique utilizes spatial correlation of the interference from different positions, and is realized by subtracting the outputs of the reference channel(s) from those of the signal channel(s) using wavelet analysis and the least squares method. The adaptive suppression method is first implemented to remove the image artifacts in simulation. We then experimentally demonstrate the feasibility of this technique by adding three orthogonal superconducting quantum interference device (SQUID) magnetometers as reference channels to compensate the output of one 2nd-order gradiometer. The experimental results show great improvement in the imaging quality in both 1D and 2D MRI images at two common imaging frequencies, 1.3 kHz and 4.8 kHz. At both frequencies, the effective compensation bandwidth is as high as 2 kHz. Furthermore, we examine the longitudinal relaxation times of the same sample before and after compensation, and show that the MRI properties of the sample did not change after applying adaptive suppression. This technique can effectively increase the imaging bandwidth and be applied to ULF MRI detected by either SQUIDs or Faraday coil in both an unshielded environment and a conductively shielded room. Copyright © 2017 Elsevier Inc. All rights reserved.
Chen, Y; Redinbaugh, M G; Michel, A P
2015-06-01
Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.
Therapeutic synergy between microRNA and siRNA in ovarian cancer treatment.
Nishimura, Masato; Jung, Eun-Jung; Shah, Maitri Y; Lu, Chunhua; Spizzo, Riccardo; Shimizu, Masayoshi; Han, Hee Dong; Ivan, Cristina; Rossi, Simona; Zhang, Xinna; Nicoloso, Milena S; Wu, Sherry Y; Almeida, Maria Ines; Bottsford-Miller, Justin; Pecot, Chad V; Zand, Behrouz; Matsuo, Koji; Shahzad, Mian M; Jennings, Nicholas B; Rodriguez-Aguayo, Cristian; Lopez-Berestein, Gabriel; Sood, Anil K; Calin, George A
2013-11-01
Development of improved RNA interference-based strategies is of utmost clinical importance. Although siRNA-mediated silencing of EphA2, an ovarian cancer oncogene, results in reduction of tumor growth, we present evidence that additional inhibition of EphA2 by a microRNA (miRNA) further "boosts" its antitumor effects. We identified miR-520d-3p as a tumor suppressor upstream of EphA2, whose expression correlated with favorable outcomes in two independent patient cohorts comprising 647 patients. Restoration of miR-520d-3p prominently decreased EphA2 protein levels, and suppressed tumor growth and migration/invasion both in vitro and in vivo. Dual inhibition of EphA2 in vivo using 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes loaded with miR-520d-3p and EphA2 siRNA showed synergistic antitumor efficiency and greater therapeutic efficacy than either monotherapy alone. This synergy is at least in part due to miR-520d-3p targeting EphB2, another Eph receptor. Our data emphasize the feasibility of combined miRNA-siRNA therapy, and will have broad implications for innovative gene silencing therapies for cancer and other diseases. This study addresses a new concept of RNA inhibition therapy by combining miRNA and siRNA in nanoliposomal particles to target oncogenic pathways altered in ovarian cancer. Combined targeting of the Eph pathway using EphA2-targeting siRNA and the tumor suppressor miR-520d-3p exhibits remarkable therapeutic synergy and enhanced tumor suppression in vitro and in vivo compared with either monotherapy alone. ©2013 AACR.
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
Short hairpin RNA interference therapy for ischemic heart disease.
Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C
2008-09-30
During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors
Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro
2012-01-01
We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
Suppression of hepatic stellate cell activation by microRNA-29b
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sekiya, Yumiko; Ogawa, Tomohiro; Liver Research Center, Graduate School of Medicine, Osaka City University, Osaka
Highlights: {yields} Expression of miR-29b was found to be down-regulated during the activation of hepatic stellate cells in primary culture. {yields} Transfection of a miR-29b precursor markedly attenuated the expression of Col1a1 and Col1a2 mRNAs. {yields} It blunted the increased expression of {alpha}-SMA, DDR2, FN1, ITGB1, and PDGFR-b mRNAs essential for stellate cell activation. {yields} miR-29b overexpression led stellate cells to remain in a quiescent state, as evidenced by their star-like morphology. {yields} miR-29b overexpression suppressed the expression of c-fos mRNA. -- Abstract: MicroRNAs (miRNAs) participate in the regulation of cellular functions including proliferation, apoptosis, and migration. It has beenmore » previously shown that the miR-29 family is involved in regulating type I collagen expression by interacting with the 3'UTR of its mRNA. Here, we investigated the roles of miR-29b in the activation of mouse primary-cultured hepatic stellate cells (HSCs), a principal collagen-producing cell in the liver. Expression of miR-29b was found to be down-regulated during HSC activation in primary culture. Transfection of a miR-29b precursor markedly attenuated the expression of Col1a1 and Col1a2 mRNAs and additionally blunted the increased expression of {alpha}-SMA, DDR2, FN1, ITGB1, and PDGFR-{beta}, which are key genes involved in the activation of HSCs. Further, overexpression of miR-29b led HSCs to remain in a quiescent state, as evidenced by their quiescent star-like cell morphology. Although phosphorylation of FAK, ERK, and Akt, and the mRNA expression of c-jun was unaffected, miR-29b overexpression suppressed the expression of c-fos mRNA. These results suggested that miR-29b is involved in the activation of HSCs and could be a candidate molecule for suppressing their activation and consequent liver fibrosis.« less
RNA viruses can hijack vertebrate microRNAs to suppress innate immunity
NASA Astrophysics Data System (ADS)
Trobaugh, Derek W.; Gardner, Christina L.; Sun, Chengqun; Haddow, Andrew D.; Wang, Eryu; Chapnik, Elik; Mildner, Alexander; Weaver, Scott C.; Ryman, Kate D.; Klimstra, William B.
2014-02-01
Currently, there is little evidence for a notable role of the vertebrate microRNA (miRNA) system in the pathogenesis of RNA viruses. This is primarily attributed to the ease with which these viruses mutate to disrupt recognition and growth suppression by host miRNAs. Here we report that the haematopoietic-cell-specific miRNA miR-142-3p potently restricts the replication of the mosquito-borne North American eastern equine encephalitis virus in myeloid-lineage cells by binding to sites in the 3' non-translated region of its RNA genome. However, by limiting myeloid cell tropism and consequent innate immunity induction, this restriction directly promotes neurologic disease manifestations characteristic of eastern equine encephalitis virus infection in humans. Furthermore, the region containing the miR-142-3p binding sites is essential for efficient virus infection of mosquito vectors. We propose that RNA viruses can adapt to use antiviral properties of vertebrate miRNAs to limit replication in particular cell types and that this restriction can lead to exacerbation of disease severity.
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L.
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development. PMID:25330026
An RNA isolation system for plant tissues rich in secondary metabolites
2011-01-01
Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767
Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.
2009-01-01
Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E
2018-05-04
Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Voskresenskaia, E P; Miroshnichenko, O I; Ponamareva, T I; Savich, O M; Tikhonenko, T I
1993-01-01
The possibility of suppression of porcine parvovirus (PPV) reproduction in the culture of thyroid gland cells of a swine that contain the integrated genes for asRNA against the nonstructural proteins of the virus has been studied. 10 cell lines with the asRNA genes have been obtained. The line with the maximal number of integrated gene copies was used to inflict with the parvovirus. The expression of asRNA in this cell line was shown to lead to 95% suppression of PPV replication as compared with the control cell line.
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
Orthogonal on-off control of radar pulses for the suppression of mutual interference
NASA Astrophysics Data System (ADS)
Kim, Yong Cheol
1998-10-01
Intelligent vehicles of the future will be guided by radars and other sensors to avoid obstacles. When multiple vehicles move simultaneously in autonomous navigational mode, mutual interference among car radars becomes a serious problem. An obstacle is illuminated with electromagnetic pulses from several radars. The signal at a radar receiver is actually a mixture of the self-reflection and the reflection of interfering pulses emitted by others. When standardized pulse- type radars are employed on vehicles for obstacle avoidance and so self-pulse and interfering pulses have identical pulse repetition interval, this SI (synchronous Interference) is very difficult to separate from the true reflection. We present a method of suppressing such a synchronous interference. By controlling the pulse emission of a radar in a binary orthogonal ON, OFF pattern, the true self-reflection can be separated from the false one. Two range maps are generated, TRM (true-reflection map) and SIM (synchronous- interference map). TRM is updated for every ON interval and SIM is updated for every OFF interval of the self-radar. SIM represents the SI of interfering radars while TRM keeps a record of a mixture of the true self-reflection and SI. Hence the true obstacles can be identified by the set subtraction operation. The performance of the proposed method is compared with that of the conventional M of N method. Bayesian analysis shows that the probability of false alarm is improved by order of 103 to approximately 106 while the deterioration in the probability of detection is negligible.
Chen, Zihao; Ju, Hongping; Yu, Shan; Zhao, Ting; Jing, Xiaojie; Li, Ping; Jia, Jing; Li, Nan; Tan, Bibo; Li, Yong
2018-05-23
Gastric cancer (GC) is one of the major global health problems, especially in Asia. Nowadays, long non-coding RNA (lncRNA) has gained significant attention in the current research climate such as carcinogenesis. This research desires to explore the mechanism of Prader-Willi region non-protein coding RNA 1 (PWRN1) on regulating GC process. Differentially expressed lncRNAs in GC tissues were screened out through microarray analysis. The RNA and protein expression level were detected by quantitative real-time PCR (qRT-PCR) and Western blot. Cell proliferation, apoptosis rate, metastasis abilities were respectively determined by cell counting kit 8 (CCK8), flow cytometry, wound healing, and transwell assay. The luciferase reporter system was used to verify the targetting relationships between PWRN1, miR-425-5p , and phosphatase and tensin homolog ( PTEN ). RNA-binding protein immunoprecipitation (RIP) assay was performed to prove whether PWRN1 acted as a competitive endogenous RNA (ceRNA) of miR-425-5p Tumor xenograft model and immunohistochemistry (IHC) were developed to study the influence of PWRN1 on tumor growth in vivo Microarray analysis determined that PWRN1 was differently expressed between GC tissues and adjacent tissues. qRT-PCR revealed PWRN1 low expression in GC tissues and cells. Up-regulated PWRN1 could reduce proliferation and metastasis and increase apoptosis in GC cells, while miR-425-5p had reverse effects. The RIP assay indicated that PWRN1 may target an oncogene, miR-425-5p The tumor xenograft assay found that up-regulated PWRN1 suppressed the tumor growth. The bioinformatics analysis, luciferase assay, and Western blot indicated that PWRN1 affected PTEN / Akt / MDM2 / p53 axis via suppressing miR-425-5p Our findings suggested that PWRN1 functioned as a ceRNA targetting miR-425-5p and suppressed GC development via p53 signaling pathway. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral
RNA-Interference Pathways Display High Rates of Adaptive Protein Evolution in Multiple Invertebrates
Palmer, William H.; Hadfield, Jarrod D.; Obbard, Darren J.
2018-01-01
Conflict between organisms can lead to a reciprocal adaptation that manifests as an increased evolutionary rate in genes mediating the conflict. This adaptive signature has been observed in RNA-interference (RNAi) pathway genes involved in the suppression of viruses and transposable elements in Drosophila melanogaster, suggesting that a subset of Drosophila RNAi genes may be locked in an arms race with these parasites. However, it is not known whether rapid evolution of RNAi genes is a general phenomenon across invertebrates, or which RNAi genes generally evolve adaptively. Here we use population genomic data from eight invertebrate species to infer rates of adaptive sequence evolution, and to test for past and ongoing selective sweeps in RNAi genes. We assess rates of adaptive protein evolution across species using a formal meta-analytic framework to combine data across species and by implementing a multispecies generalized linear mixed model of mutation counts. Across species, we find that RNAi genes display a greater rate of adaptive protein substitution than other genes, and that this is primarily mediated by positive selection acting on the genes most likely to defend against viruses and transposable elements. In contrast, evidence for recent selective sweeps is broadly spread across functional classes of RNAi genes and differs substantially among species. Finally, we identify genes that exhibit elevated adaptive evolution across the analyzed insect species, perhaps due to concurrent parasite-mediated arms races. PMID:29437826
Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V
2018-06-01
The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.
Baroncelli, Silvia; Pirillo, Maria F; Tamburrini, Enrica; Guaraldi, Giovanni; Pinnetti, Carmela; Degli Antoni, Anna; Galluzzo, Clementina M; Stentarelli, Chiara; Amici, Roberta; Floridia, Marco
2015-07-01
There is limited information on full viral suppression and low-level HIV-RNA viremia in HIV-infected women at the end of pregnancy. We investigated HIV-RNA levels close to delivery in women on antiretroviral treatment in order to define rates of complete suppression, low-level viremia, and quantifiable HIV-RNA, exploring as potential determinants some clinical and viroimmunological variables. Plasma samples from a national study in Italy, collected between 2003 and 2012, were used. According to plasma HIV-RNA levels, three groups were defined: full suppression (target not detected), low-level viremia (target detected but <37 copies/ml), and quantifiable HIV-RNA (≥37 copies/ml). Multivariable logistic regression was used to define determinants of full viral suppression and of quantifiable HIV-RNA. Among 107 women evaluated at a median gestational age of 35 weeks, 90 (84.1%) had HIV-RNA <37 copies/ml. Most of them (59/90, 65.6%) had full suppression, with the remaining (31/90, 34.4%) showing low-level viremia (median: 11.9 copies/ml; IQR 7.4-16.3). Among the 17 women with quantifiable viral load, median HIV-RNA was 109 copies/ml (IQR 46-251), with only one case showing resistance (mutation M184V; rate: 9.1%). In multivariable analyses, women with higher baseline HIV-RNA levels and with hepatitis C virus (HCV) coinfection were significantly more likely to have quantifiable HIV-RNA in late pregnancy. Full viral suppression was significantly more likely with nonnucleoside reverse transcriptase inhibitor (NNRTI)-based regimens and significantly less likely with higher HIV-RNA in early pregnancy. No cases of HIV transmission occurred. In conclusion, HIV-infected pregnant women showed a high rate of viral suppression and a low resistance rate before delivery. In most cases no target HIV-RNA was detected in plasma, suggesting a low risk of subsequent virological rebound and development of resistance. Women with high levels of HIV-RNA in early pregnancy and those who have
Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.
2016-01-01
RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Lee, Dae-Weon; Shrestha, Sony; Kim, A Young; Park, Seok Joo; Yang, Chang Yeol; Kim, Yonggyun; Koh, Young Ho
2011-04-01
Sex pheromone production is regulated by pheromone biosynthesis-activating neuropeptide (PBAN) in many lepidopteran species. We cloned a PBAN receptor (Plx-PBANr) gene from the female pheromone gland of the diamondback moth, Plutella xylostella (L.). Plx-PBANr encodes 338 amino acids and has conserved structural motifs implicating in promoting G protein coupling and tyrosine-based sorting signaling along with seven transmembrane domains, indicating a typical G protein-coupled receptor. The expression of Plx-PBANr was found only in the pheromone gland of female adults among examined tissues and developmental stages. Heterologous expression in human uterus cervical cancer cells revealed that Plx-PBANr induced significant calcium elevation when challenged with Plx-PBAN. Female P. xylostella injected with double-stranded RNA specific to Plx-PBANr showed suppression of the receptor gene expression and exhibited significant reduction in pheromone biosynthesis, which resulted in loss of male attractiveness. Taken together, the identified PBAN receptor is functional in PBAN signaling via calcium secondary messenger, which leads to activation of pheromone biosynthesis and male attraction. Copyright © 2011 Elsevier Ltd. All rights reserved.
Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong
2015-01-01
The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.
Smith, Jarrett; Calidas, Deepika; Schmidt, Helen; Lu, Tu; Rasoloson, Dominique; Seydoux, Geraldine
2016-01-01
RNA granules are non-membrane bound cellular compartments that contain RNA and RNA binding proteins. The molecular mechanisms that regulate the spatial distribution of RNA granules in cells are poorly understood. During polarization of the C. elegans zygote, germline RNA granules, called P granules, assemble preferentially in the posterior cytoplasm. We present evidence that P granule asymmetry depends on RNA-induced phase separation of the granule scaffold MEG-3. MEG-3 is an intrinsically disordered protein that binds and phase separates with RNA in vitro. In vivo, MEG-3 forms a posterior-rich concentration gradient that is anti-correlated with a gradient in the RNA-binding protein MEX-5. MEX-5 is necessary and sufficient to suppress MEG-3 granule formation in vivo, and suppresses RNA-induced MEG-3 phase separation in vitro. Our findings suggest that MEX-5 interferes with MEG-3’s access to RNA, thus locally suppressing MEG-3 phase separation to drive P granule asymmetry. Regulated access to RNA, combined with RNA-induced phase separation of key scaffolding proteins, may be a general mechanism for controlling the formation of RNA granules in space and time. DOI: http://dx.doi.org/10.7554/eLife.21337.001 PMID:27914198
Ko, Jae-hyeong; Llopis, Paula Montero; Heinritz, Jennifer; Jacobs-Wagner, Christine; Söll, Dieter
2013-01-01
While translational read-through of stop codons by suppressor tRNAs is common in many bacteria, archaea and eukaryotes, this phenomenon has not yet been observed in the α-proteobacterium Caulobacter crescentus. Based on a previous report that C. crescentus and Escherichia coli tRNAHis have distinctive identity elements, we constructed E. coli tRNAHis CUA, a UAG suppressor tRNA for C. crescentus. By examining the expression of three UAG codon- containing reporter genes (encoding a β-lactamase, the fluorescent mCherry protein, or the C. crescentus xylonate dehydratase), we demonstrated that the E. coli histidyl-tRNA synthetase/tRNAHis CUA pair enables in vivo UAG suppression in C. crescentus. E. coli histidyl-tRNA synthetase (HisRS) or tRNAHis CUA alone did not achieve suppression; this indicates that the E. coli HisRS/tRNAHis CUA pair is orthogonal in C. crescentus. These results illustrate that UAG suppression can be achieved in C. crescentus with an orthogonal aminoacyl-tRNA synthetase/suppressor tRNA pair. PMID:24386240
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
RNA interference tools for the western flower thrips, Frankliniella occidentalis.
Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E
2015-05-01
The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced
Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.
Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li
2007-04-01
Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.
Super Resolution and Interference Suppression Technique applied to SHARAD Radar Data
NASA Astrophysics Data System (ADS)
Raguso, M. C.; Mastrogiuseppe, M.; Seu, R.; Piazzo, L.
2017-12-01
We will present a super resolution and interference suppression technique applied to the data acquired by the SHAllow RADar (SHARAD) on board the NASA's 2005 Mars Reconnaissance Orbiter (MRO) mission, currently operating around Mars [1]. The algorithms allow to improve the range resolution roughly by a factor of 3 and the Signal to Noise Ratio (SNR) by a several decibels. Range compression algorithms usually adopt conventional Fourier transform techniques, which are limited in the resolution by the transmitted signal bandwidth, analogous to the Rayleigh's criterion in optics. In this work, we investigate a super resolution method based on autoregressive models and linear prediction techniques [2]. Starting from the estimation of the linear prediction coefficients from the spectral data, the algorithm performs the radar bandwidth extrapolation (BWE), thereby improving the range resolution of the pulse-compressed coherent radar data. Moreover, the EMIs (ElectroMagnetic Interferences) are detected and the spectra is interpolated in order to reconstruct an interference free spectrum, thereby improving the SNR. The algorithm can be applied to the single complex look image after synthetic aperture processing (SAR). We apply the proposed algorithm to simulated as well as to real radar data. We will demonstrate the effective enhancement on vertical resolution with respect to the classical spectral estimator. We will show that the imaging of the subsurface layered structures observed in radargrams is improved, allowing additional insights for the scientific community in the interpretation of the SHARAD radar data, which will help to further our understanding of the formation and evolution of known geological features on Mars. References: [1] Seu et al. 2007, Science, 2007, 317, 1715-1718 [2] K.M. Cuomo, "A Bandwidth Extrapolation Technique for Improved Range Resolution of Coherent Radar Data", Project Report CJP-60, Revision 1, MIT Lincoln Laboratory (4 Dec. 1992).
IL-1β directly suppress ghrelin mRNA expression in ghrelin-producing cells.
Bando, Mika; Iwakura, Hiroshi; Ueda, Yoko; Ariyasu, Hiroyuki; Inaba, Hidefumi; Furukawa, Yasushi; Furuta, Hiroto; Nishi, Masahiro; Akamizu, Takashi
2017-05-15
In animal models, ghrelin production is suppressed by LPS administration. To elucidate the detailed molecular mechanisms involved in the phenomenon, we investigated the effects of LPS and LPS-inducible cytokines, including TNF-α, IL-1β, and IL-6, on the expression of ghrelin in the ghrelin-producing cell line MGN3-1. These cells expressed IL-1R, and IL-1β significantly suppressed ghrelin mRNA levels. The suppressive effects of IL-1β were attenuated by knockdown of IKKβ, suggesting the involvement of the NF-κB pathway. These results suggested that IL-1β is a major regulator of ghrelin expression during inflammatory processes. Copyright © 2017 Elsevier B.V. All rights reserved.
RNA interference (RNAI) as a tool to engineer high nutritional value in chicory (Chicorium intybus).
Asad, M
2006-01-01
The major component of chicory (Chicorium intybus) root is inulin, which is a polymer of fructose. Inulin production from chicory is hampered by the enzyme fructan 1-exohydrolase (1-FEH) that degrades inulin and limits its yield. Increased FEH activity results in massive breakdown of fructan and production of Fructose and inulo-n-oses. The latter phenomena are to be avoided for industrial fructan production. RNA silencing, which is termed post-transcriptional gene silencing (PTGS) in plants, is an RNA degradation process through sequence specific nucleotide interactions induced by double-stranded RNA. For genetic improvement of crop plants, RNAi has advantages over antisense-mediated gene silencing and co-suppression, in terms of its efficiency and stability. We are generating a transgenic chicory plants with suppressed FEH (exohydrolas) genes using RNAi resulting in supressed inulin degradation. A small but important part of the construct is a sequence unique for the target gene (exons) or genes,which were cloned. The hairpin constructs were made and chicory was transformed by Agrobacterium tumifaciense, strain (C58C1). The transgenics should be select and check by means of molecular techniques.
Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.
Miri-Moghaddam, E; Deezagi, A; Soheili, Z S
2009-12-01
Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.
Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A. J.; Wu, Hui-Wen; Yeh, Shyi-Dong
2015-01-01
The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) (109KFTMHNQ117), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif (397IYFL400) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism. PMID:25993336
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tag-to-Tag Interference Suppression Technique Based on Time Division for RFID.
Khadka, Grishma; Hwang, Suk-Seung
2017-01-01
Radio-frequency identification (RFID) is a tracking technology that enables immediate automatic object identification and rapid data sharing for a wide variety of modern applications using radio waves for data transmission from a tag to a reader. RFID is already well established in technical areas, and many companies have developed corresponding standards and measurement techniques. In the construction industry, effective monitoring of materials and equipment is an important task, and RFID helps to improve monitoring and controlling capabilities, in addition to enabling automation for construction projects. However, on construction sites, there are many tagged objects and multiple RFID tags that may interfere with each other's communications. This reduces the reliability and efficiency of the RFID system. In this paper, we propose an anti-collision algorithm for communication between multiple tags and a reader. In order to suppress interference signals from multiple neighboring tags, the proposed algorithm employs the time-division (TD) technique, where tags in the interrogation zone are assigned a specific time slot so that at every instance in time, a reader communicates with tags using the specific time slot. We present representative computer simulation examples to illustrate the performance of the proposed anti-collision technique for multiple RFID tags.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
Eichhorn, Pieter J. A; Creyghton, Menno P; Wilhelmsen, Kevin; van Dam, Hans; Bernards, René
2007-01-01
Protein Phosphatase type 2A (PP2A) represents a family of holoenzyme complexes with diverse biological activities. Specific holoenzyme complexes are thought to be deregulated during oncogenic transformation and oncogene-induced signaling. Since most studies on the role of this phosphatase family have relied on the use of generic PP2A inhibitors, the contribution of individual PP2A holoenzyme complexes in PP2A-controlled signaling pathways is largely unclear. To gain insight into this, we have constructed a set of shRNA vectors targeting the individual PP2A regulatory subunits for suppression by RNA interference. Here, we identify PR55γ and PR55δ as inhibitors of c-Jun NH2-terminal kinase (JNK) activation by UV irradiation. We show that PR55γ binds c-SRC and modulates the phosphorylation of serine 12 of c-SRC, a residue we demonstrate to be required for JNK activation by c-SRC. We also find that the physical interaction between PR55γ and c-SRC is sensitive to UV irradiation. Our data reveal a novel mechanism of c-SRC regulation whereby in response to stress c-SRC activity is regulated, at least in part, through loss of the interaction with its inhibitor, PR55γ. PMID:18069897
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.
Huang, Mei; Wu, Joseph C
2011-01-01
Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.
Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia
Huang, Mei; Wu, Joseph C.
2011-01-01
Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Kubota, Kenji; Ng, James C K
2016-06-01
RNA silencing functions as an antivirus defense strategy in plants, one that plant viruses counter by producing viral suppressors of RNA silencing (VSRs). VSRs have been identified in three members of the genus Crinivirus but they do not all share identical suppression mechanisms. Here, we used Agrobacterium co-infiltration assays to investigate the suppressor activity of proteins encoded by Lettuce chlorosis virus (LCV). Of 7 LCV proteins (1b, P23, HSP70 homolog, P60, CP, CPm, and P27) tested for the suppression of silencing of green fluorescent protein (GFP) expression in wild-type Nicotiana benthamiana plants, only P23 suppressed the onset of local silencing. Small-interfering (si)RNA accumulation was reduced in leaves co-infiltrated with P23, suggesting that P23 inhibited the accumulation or enhanced the degradation of siRNA. P23 also inhibited the cell-to-cell and systemic movement of RNA silencing in GFP-expressing transgenic N. benthamiana plants. Expression of P23 via agroinfiltration of N. benthamiana leaves induced local necrosis that increased in severity at elevated temperatures, a novelty given that a direct temperature effect on necrosis severity has not been reported for the other crinivirus VSRs. These results further affirm the sophistication of crinivirus VSRs in mediating the evasion of host's antiviral defenses and in symptom modulation.
Electromagnetic interference modeling and suppression techniques in variable-frequency drive systems
NASA Astrophysics Data System (ADS)
Yang, Le; Wang, Shuo; Feng, Jianghua
2017-11-01
Electromagnetic interference (EMI) causes electromechanical damage to the motors and degrades the reliability of variable-frequency drive (VFD) systems. Unlike fundamental frequency components in motor drive systems, high-frequency EMI noise, coupled with the parasitic parameters of the trough system, are difficult to analyze and reduce. In this article, EMI modeling techniques for different function units in a VFD system, including induction motors, motor bearings, and rectifierinverters, are reviewed and evaluated in terms of applied frequency range, model parameterization, and model accuracy. The EMI models for the motors are categorized based on modeling techniques and model topologies. Motor bearing and shaft models are also reviewed, and techniques that are used to eliminate bearing current are evaluated. Modeling techniques for conventional rectifierinverter systems are also summarized. EMI noise suppression techniques, including passive filter, Wheatstone bridge balance, active filter, and optimized modulation, are reviewed and compared based on the VFD system models.
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds
Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.
2012-01-01
Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571
Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin
2006-04-01
Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.
Yoshida, Ayako; Yamada, Kiyoshi; Yamazaki, Yasumasa; Sashihara, Toshihiro; Ikegami, Shuuji; Shimizu, Makoto; Totsuka, Mamoru
2011-08-01
Recent studies have shown that probiotics are beneficial in prevention and improvement of inflammatory diseases. Accumulating evidence indicates that probiotics can modulate immune cell responses, although the specific molecular mechanism by which probiotics work remains elusive. Because T cells express receptors for microbial components, we examined whether the probiotic strain Lactobacillus gasseri OLL2809 (LG2809) and its components regulate murine CD4(+) T-cell activation. LG2809, as well as two other Lactobacillus strains, inhibited proliferation of CD4(+) T cells; LG2809 had the strongest suppressive activity among them. RNA isolated from LG2809 was also shown to have suppressive activity. We observed this suppressive effect in the culture of CD4(+) T cells stimulated with anti-CD3/CD28 treatment, suggesting a direct effect on CD4(+) T cells. In contrast, the suppressive effect was not observed for CD4(+) T cells from myeloid differentiation primary response gene 88 (MyD88) protein-deficient mice, and was abrogated in the presence of an anti-oxidant reagent, N-acetyl-cysteine (NAC). These results demonstrate that the suppressive effect of LG2809 and its RNA occurred through a MyD88-dependent signalling pathway and suggest involvement of a reactive oxygen species-dependent mechanism. LG2809 RNA injected subcutaneously suppressed delayed-type-hypersensitivity response in DO11.10 mice, and the suppression was abrogated by treatment with NAC. Collectively, these results suggest that suppression of T-cell proliferation by RNA may be one of the mechanisms when a probiotic bacterial strain exerts suppressive effects on inflammatory responses. © 2011 The Authors. Immunology © 2011 Blackwell Publishing Ltd.
IETS and quantum interference: Propensity rules in the presence of an interference feature
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lykkebo, Jacob; Solomon, Gemma C., E-mail: gsolomon@nano.ku.dk; Gagliardi, Alessio
2014-09-28
Destructive quantum interference in single molecule electronics is an intriguing phenomenon; however, distinguishing quantum interference effects from generically low transmission is not trivial. In this paper, we discuss how quantum interference effects in the transmission lead to either low current or a particular line shape in current-voltage curves, depending on the position of the interference feature. Second, we consider how inelastic electron tunneling spectroscopy can be used to probe the presence of an interference feature by identifying vibrational modes that are selectively suppressed when quantum interference effects dominate. That is, we expand the understanding of propensity rules in inelastic electronmore » tunneling spectroscopy to molecules with destructive quantum interference.« less
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
Kong, Jing; Liu, Xiaoping; Jia, Jianbo; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang
2015-10-01
Hepatocellular carcinoma (HCC) is a deadly human malignant tumor that is among the most common cancers in the world, especially in Asia. Hepatitis B virus (HBV) infection has been well established as a high risk factor for hepatic malignance. Studies have shown that Pokemon is a master oncogene for HCC growth, suggesting it as an ideal therapeutic target. However, efficient delivery system is still lacking for Pokemon targeting treatment. In this study, we used core proteins of HBV, which is modified with RGD peptides, to construct a biomimetic vector for the delivery of Pokemon siRNAs (namely, RGD-HBc-Pokemon siRNA). Quantitative PCR and Western blot assays revealed that RGD-HBc-Pokemon siRNA possessed the highest efficiency of Pokemon suppression in HCC cells. In vitro experiments further indicated that RGD-HBc-Pokemon-siRNA exerted a higher tumor suppressor activity on HCC cell lines, evidenced by reduced proliferation and attenuated invasiveness, than Pokemon-siRNA or RGD-HBc alone. Finally, animal studies demonstrated that RGD-HBc-Pokemon siRNA suppressed the growth of HCC xenografts in mice by a greater extent than Pokemon-siRNA or RGD-HBc alone. Based on the above results, Pokemon siRNA delivery mediated by RGD-modified HBV core protein was shown to be an effective strategy of HCC gene therapy.
Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei
2017-04-01
Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Biomimetic RNA-silencing nanocomplexes: overcoming multidrug resistance in cancer cells.
Wang, Zhongliang; Wang, Zhe; Liu, Dingbin; Yan, Xuefeng; Wang, Fu; Niu, Gang; Yang, Min; Chen, Xiaoyuan
2014-02-10
RNA interference (RNAi) is an RNA-dependent gene silencing approach controlled by an RNA-induced silencing complex (RISC). Herein, we present a synthetic RISC-mimic nanocomplex, which can actively cleave its target RNA in a sequence-specific manner. With high enzymatic stability and efficient self-delivery to target cells, the designed nanocomplex can selectively and potently induce gene silencing without cytokine activation. These nanocomplexes, which target multidrug resistance, are not only able to bypass the P-glycoprotein (Pgp) transporter, due to their nano-size effect, but also effectively suppress Pgp expression, thus resulting in successful restoration of drug sensitivity of OVCAR8/ADR cells to Pgp-transportable cytotoxic agents. This nanocomplex approach has the potential for both functional genomics and cancer therapy. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
Palanca-Wessels, Maria C.; Booth, Garrett C.; Convertine, Anthony J.; Lundy, Brittany B.; Berguig, Geoffrey Y.; Press, Michael F.; Stayton, Patrick S.; Press, Oliver W.
2016-01-01
The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5′ RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5′ RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy. PMID:26840082
Palanca-Wessels, Maria C; Booth, Garrett C; Convertine, Anthony J; Lundy, Brittany B; Berguig, Geoffrey Y; Press, Michael F; Stayton, Patrick S; Press, Oliver W
2016-02-23
The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5' RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5' RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy.
MicroRNA-1908 functions as a glioblastoma oncogene by suppressing PTEN tumor suppressor pathway.
Xia, Xuewei; Li, Yong; Wang, Wenbo; Tang, Fang; Tan, Jie; Sun, Liyuan; Li, Qinghua; Sun, Li; Tang, Bo; He, Songqing
2015-08-12
We aimed to investigate whether miRNA-1908 is an oncogene in human glioblastoma and find the possible mechanism of miR-1908. We investigated the growth potentials of miRNA-1908-overexpressing SW-1783 cells in vitro and in vivo. In order to identify the target molecule of miRNA-1908, a luciferase reporter assay was performed, and the corresponding downstream signaling pathway was examined using immunohistochemistry of human glioblastoma tissues. We also investigated the miRNA-1908 expression in 34 patients according to the postoperative risk of recurrence. The overexpression of miRNA-1908 significantly promoted anchorage-independent growth in vitro and significantly increased the tumor forming potential in vivo. MiRNA-1908 significantly suppressed the luciferase activity of mRNA combined with the PTEN 3'-UTR. Furthermore, the expression levels of miRNA-1908 were significantly increased in the patients with a high risk of recurrence compared to that observed in the low-risk patients, and this higher expression correlated with a poor survival. miRNA-1908 functions as an oncogene in glioblastoma by repressing the PTEN pathway. MiR-1908 is a potential new molecular marker for predicting the risk of recurrence and prognosis of glioblastoma.
Yang, Xiao-Yan; Sun, Bin; Zhang, Liang; Li, Nan; Han, Junlong; Zhang, Jing; Sun, Xuesong; He, Qing-Yu
2014-01-01
Iron is an essential nutrient for the growth of most bacteria. To obtain iron, bacteria have developed specific iron-transport systems located on the membrane surface to uptake iron and iron complexes such as ferrichrome. Interference with the iron-acquisition systems should be therefore an efficient strategy to suppress bacterial growth and infection. Based on the chemical similarity of iron and ruthenium, we used a Ru(II) complex R-825 to compete with ferrichrome for the ferrichrome-transport pathway in Streptococcus pneumoniae. R-825 inhibited the bacterial growth of S. pneumoniae and stimulated the expression of PiuA, the iron-binding protein in the ferrichrome-uptake system on the cell surface. R-825 treatment decreased the cellular content of iron, accompanying with the increase of Ru(II) level in the bacterium. When the piuA gene (SPD_0915) was deleted in the bacterium, the mutant strain became resistant to R-825 treatment, with decreased content of Ru(II). Addition of ferrichrome can rescue the bacterial growth that was suppressed by R-825. Fluorescence spectral quenching showed that R-825 can bind with PiuA in a similar pattern to the ferrichrome-PiuA interaction in vitro. These observations demonstrated that Ru(II) complex R-825 can compete with ferrichrome for the ferrichrome-transport system to enter S. pneumoniae, reduce the cellular iron supply, and thus suppress the bacterial growth. This finding suggests a novel antimicrobial approach by interfering with iron-uptake pathways, which is different from the mechanisms used by current antibiotics.
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less
Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng
2013-11-01
Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.
Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping
2014-01-01
In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
Interference resolution in major depression.
Joormann, Jutta; Nee, Derek Evan; Berman, Marc G; Jonides, John; Gotlib, Ian H
2010-03-01
In two experiments, we investigated individual differences in the ability to resolve interference in participants diagnosed with major depressive disorder (MDD). Participants were administered the "Ignore/Suppress" task, a short-term memory task composed of two steps. In Step 1 ("ignore"), participants were instructed to memorize a set of stimuli while ignoring simultaneously presented irrelevant material. In Step 2 ("suppress"), participants were instructed to forget a subset of the previously memorized material. The ability to resolve interference was indexed by response latencies on two recognition tasks in which participants decided whether a probe was a member of the target set. In Step 1, we compared response latencies to probes from the to-be-ignored list with response latencies to nonrecently presented items. In Step 2, we compared response latencies to probes from the to-be-suppressed list with response latencies to nonrecently presented items. The results indicate that, compared with control participants, depressed participants exhibited increased interference in the "suppress" but not in the "ignore" step of the task, when the stimuli were negative words. No group differences were obtained when we presented letters instead of emotional words. These findings indicate that depression is associated with difficulty in removing irrelevant negative material from short-term memory.
NASA Astrophysics Data System (ADS)
Wang, Zhen; Zheng, Yi; Mao, Yu-feng; Wang, Ya-zhou; Yu, Yan-ting; Liu, Hong-ning
2018-03-01
In the disturbance of unsteady flow field under the sea, the monitoring accuracy and precision of the bottom-mounted acoustic monitoring platform will decrease. In order to reduce the hydrodynamic interference, the platform wrapped with fairing structure and separated from the retrieval unit is described. The suppression effect evaluation based on the correlation theory of sound pressure and particle velocity for spherical wave in infinite homogeneous medium is proposed and the difference value between them is used to evaluate the hydrodynamic restraining performance of the bottom-mounted platform under far field condition. Through the sea test, it is indicated that the platform with sparse layers fairing structure (there are two layers for the fairing, in which the inside layer is 6-layers sparse metal net, and the outside layer is 1-layer polyester cloth, and then it takes sparse layers for short) has no attenuation in the sound pressure response to the sound source signal, but obvious suppression in the velocity response to the hydrodynamic noise. The effective frequency of the fairing structure is decreased below 10 Hz, and the noise magnitude is reduced by 10 dB. With the comparison of different fairing structures, it is concluded that the tighter fairing structure can enhance the performance of sound transmission and flow restraining.
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Influenza A viruses suppress cyclooxygenase-2 expression by affecting its mRNA stability.
Dudek, Sabine Eva; Nitzsche, Katja; Ludwig, Stephan; Ehrhardt, Christina
2016-06-06
Infection with influenza A viruses (IAV) provokes activation of cellular defence mechanisms contributing to the innate immune and inflammatory response. In this process the cyclooxygenase-2 (COX-2) plays an important role in the induction of prostaglandin-dependent inflammation. While it has been reported that COX-2 is induced upon IAV infection, in the present study we observed a down-regulation at later stages of infection suggesting a tight regulation of COX-2 by IAV. Our data indicate the pattern-recognition receptor RIG-I as mediator of the initial IAV-induced COX-2 synthesis. Nonetheless, during on-going IAV replication substantial suppression of COX-2 mRNA and protein synthesis could be detected, accompanied by a decrease in mRNA half-life. Interestingly, COX-2 mRNA stability was not only imbalanced by IAV replication but also by stimulation of cells with viral RNA. Our results reveal tristetraprolin (TTP), which is known to bind COX-2 mRNA and promote its rapid degradation, as regulator of COX-2 expression in IAV infection. During IAV replication and viral RNA accumulation TTP mRNA synthesis was induced, resulting in reduced COX-2 levels. Accordingly, the down-regulation of TTP resulted in increased COX-2 protein expression after IAV infection. These findings indicate a novel IAV-regulated cellular mechanism, contributing to the repression of host defence and therefore facilitating viral replication.
Walker, William B; Allen, Margaret L
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.
Walker, William B.; Allen, Margaret L.
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
Chimeric peptide-mediated siRNA transduction to inhibit HIV-1 infection.
Bivalkar-Mehla, Shalmali; Mehla, Rajeev; Chauhan, Ashok
2017-04-01
Persistent human immunodeficiency virus 1 (HIV-1) infection provokes immune activation and depletes CD4 + lymphocytes, leading to acquired immunodeficiency syndrome. Uninterrupted administration of combination antiretroviral therapy (cART) in HIV-infected patients suppresses viral replication to below the detectable level and partially restores the immune system. However, cART-unresponsive residual HIV-1 infection and elusive transcriptionally silent but reactivatable viral reservoirs maintain a permanent viral DNA blue print. The virus rebounds within a few weeks after interruption of suppressive therapy. Adjunct gene therapy to control viral replication by ribonucleic acid interference (RNAi) is a post-transcriptional gene silencing strategy that could suppress residual HIV-1 burden and overcome viral resistance. Small interfering ribonucleic acids (siRNAs) are efficient transcriptional inhibitors, but need delivery systems to reach inside target cells. We investigated the potential of chimeric peptide (FP-PTD) to deliver specific siRNAs to HIV-1-susceptible and permissive cells. Chimeric FP-PTD peptide was designed with an RNA binding domain (PTD) to bind siRNA and a cell fusion peptide domain (FP) to enter cells. FP-PTD-siRNA complex entered and inhibited HIV-1 replication in susceptible cells, and could be a candidate for in vivo testing.
Independent suppression of ribosomal +1 frameshifts by different tRNA anticodon loop modifications.
Klassen, Roland; Bruch, Alexander; Schaffrath, Raffael
2017-09-02
Recently, a role for the anticodon wobble uridine modification 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U) has been revealed in the suppression of translational +1 frameshifts in Saccharomyces cerevisiae. Loss of either the mcm 5 U or s 2 U parts of the modification elevated +1 frameshift rates and results obtained with reporters involving a tRNA Lys UUU dependent frameshift site suggested these effects are caused by reduced ribosomal A-site binding of the hypomodified tRNA. Combined loss of mcm 5 U and s 2 U leads to increased ribosome pausing at tRNA Lys UUU dependent codons and synergistic growth defects but effects on +1 frameshift rates remained undefined to this end. We show in here that simultaneous removal of mcm 5 U and s 2 U results in synergistically increased +1 frameshift rates that are suppressible by extra copies of tRNA Lys UUU . Thus, two distinct chemical modifications of the same wobble base independently contribute to reading frame maintenance, loss of which may cause or contribute to observed growth defects. Since the thiolation pathway is sensitive to moderately elevated temperatures in yeast, we observe a heat-induced increase of +1 frameshift rates in wild type cells that depends on the sulfur transfer protein Urm1. Furthermore, we find that temperature-induced frameshifting is kept in check by the dehydration of N6-threonylcarbamoyladenosine (t 6 A) to its cyclic derivative (ct 6 A) at the anticodon adjacent position 37. Since loss of ct 6 A in elp3 or urm1 mutant cells is detrimental for temperature stress resistance we assume that conversion of t 6 A to ct 6 A serves to limit deleterious effects on translational fidelity caused by hypomodified states of wobble uridine bases.
Bitko, Vira; Musiyenko, Alla; Bayfield, Mark A; Maraia, Richard J; Barik, Sailen
2008-08-01
The La antigen (SS-B) associates with a wide variety of cellular and viral RNAs to affect gene expression in multiple systems. We show that La is the major cellular protein found to be associated with the abundant 44-nucleotide viral leader RNA (leRNA) early after infection with respiratory syncytial virus (RSV), a nonsegmented negative-strand RNA virus. Consistent with this, La redistributes from the nucleus to the cytoplasm in RSV-infected cells. Upon RNA interference knockdown of La, leRNA is redirected to associate with the RNA-binding protein RIG-I, a known activator of interferon (IFN) gene expression, and this is accompanied by the early induction of IFN mRNA. These results suggest that La shields leRNA from RIG-I, abrogating the early viral activation of type I IFN. We mapped the leRNA binding function to RNA recognition motif 1 of La and showed that while wild-type La greatly enhanced RSV growth, a La mutant defective in RSV leRNA binding also did not support RSV growth. Comparative studies of RSV and Sendai virus and the use of IFN-negative Vero cells indicated that La supports the growth of nonsegmented negative-strand RNA viruses by both IFN suppression and a potentially novel IFN-independent mechanism.
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
Near-Field Noise Source Localization in the Presence of Interference
NASA Astrophysics Data System (ADS)
Liang, Guolong; Han, Bo
In order to suppress the influence of interference sources on the noise source localization in the near field, the near-field broadband source localization in the presence of interference is studied. Oblique projection is constructed with the array measurements and the steering manifold of interference sources, which is used to filter the interference signals out. 2D-MUSIC algorithm is utilized to deal with the data in each frequency, and then the results of each frequency are averaged to achieve the positioning of the broadband noise sources. The simulations show that this method suppresses the interference sources effectively and is capable of locating the source which is in the same direction with the interference source.
Comas, Michelle; Valentino, Kristin; Johnson, Anne F; Gibson, Bradley S; Taylor, Courtney
2018-06-12
Overgeneral memory (OGM), difficulty in retrieving specific autobiographical memories, is a robust phenomenon related to the onset and course of depressive and posttraumatic stress disorders. Inhibitory mechanisms are theorized to underlie OGM; however, empirical support for this link is equivocal. The current study examines the differential roles of two aspects of inhibitory control in association with OGM: suppression of prepotent responses and resistance to proactive interference (PI). Only resistance to PI was expected to be negatively related to OGM, whereby individuals with greater ability to resist PI would have reduced OGM. Participants (n = 49) completed a self-report measure of depressive symptoms and engaged in two tasks aimed at assessing resistance to PI and suppression of prepotent responses. Participants also completed a task assessing overgeneral autobiographical memory. As hypothesized, resistance to PI, but not suppression of prepotent responses negatively predicted OGM above and beyond the influence of depressive symptoms. Because a double dissociation was not examined, we cannot address the potential independence of the submechanisms of inhibitory control that we assessed. Results exemplify the differential associations of two components of inhibition and OGM, suggesting that resistance to PI, in particular, may contribute to the development and/or maintenance of OGM and associated depressive disorders. Directions for future research are discussed. Copyright © 2018. Published by Elsevier Ltd.
McCAIN, JACK
2004-01-01
Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488
Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.
Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong
2016-01-01
We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.
Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S
2012-03-01
Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.
Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system
Ross, Joseph A.; Ellis, Michael J.; Hossain, Shahan; Haniford, David B.
2013-01-01
Hfq functions in post-transcriptional gene regulation in a wide range of bacteria, usually by promoting base-pairing of mRNAs and trans-encoded sRNAs that share partial sequence complementarity. It is less clear if Hfq is required for pairing of cis-encoded RNAs (i.e., antisense RNAs) with their target mRNAs. In the current work, we have characterized the interactions between Escherichia coli Hfq and the components of the Tn10/IS10 antisense system, RNA-IN and RNA-OUT. We show that Hfq interacts with RNA-OUT through its proximal RNA-binding surface, as is typical for Hfq and trans-encoded sRNAs. In contrast, RNA-IN binds both proximal and distal RNA-binding surfaces in Hfq with a higher affinity for the latter, as is typical for mRNA interactions in canonical sRNA-mRNA pairs. Importantly, an amino acid substitution in Hfq that interferes with RNA binding to the proximal site negatively impacts RNA-IN:OUT pairing in vitro and suppresses the ability of Hfq to negatively regulate IS10 transposition in vivo. We also show that Hfq binding to RNA-IN and RNA-OUT alters secondary structure elements in both of these RNAs and speculate that this could be important in how Hfq facilitates RNA-IN:OUT pairing. Based on the results presented here, we suggest that Hfq could be involved in regulating RNA pairing in other antisense systems, including systems encoded by other transposable elements. PMID:23510801
Chen, Hong; Shen, Hai-Xiang; Lin, Yi-Wei; Mao, Ye-Qing; Liu, Ben; Xie, Li-Ping
2018-06-12
Small RNAs play an important role in gene regulatory networks. The gene suppressive effect of small RNAs was previously the dominant focus of studies, but during the recent decade, small RNA-induced gene activation has been reported and has become a notable gene manipulation technique. In this study, a putative tumor suppressor, INTS6, was activated by introducing a promoter-targeted small RNA (dsRNA-915) into castration-resistant prostate cancer (CRPC) cells. Unique dynamics associated with the gene upregulation phenomenon was observed. Following gene activation, cell proliferation and motility were suppressed in vitro. Downregulation of Wnt/β-catenin signaling was observed during the activation period, and the impairment of β-catenin degradation reversed the tumor suppressor effects of INTS6. These results suggest the potential application of small activating RNAs in targeted gene therapy for CRPC.
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
MicroRNA-33 promotes the replicative senescence of mouse embryonic fibroblasts by suppressing CDK6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Shun; Huang, Haijiao; Li, Nanhong
2016-05-13
MicroRNAs are a large class of tiny noncoding RNAs, which have emerged as critical regulators of gene expression, and thus are involved in multiple cellular processes, including cellular senescence. MicroRNA-33 has previously been established to exert crucial effect on cell proliferation, lipid metabolism and cholesterol metabolism. Nonetheless, the association between microRNA-33 and cellular senescence and its underlying molecular mechanism are far to be elucidated. The present study has attempted to probe into the effect of microRNA-33 on MEFs senescence. Our data unveiled that microRNA-33 was dramatically down-regulated in senescent MEFs compared to the young MEFs, and ectopic expression of microRNA-33more » promoted MEFs senescence, while knock-down of microRNA-33 exhibited a protective effect against senescence phenotype. Moreover, we verified CDK6 as a direct target of microRNA-33 in mouse. Silencing of CDK6 induced the premature senescence phenotype of MEFs similarly as microRNA-33, while enforced expression of CDK6 significantly reverse the senescence-induction effect of microRNA-33. Taken together, our results suggested that microRNA-33 enhanced the replicative senescence of MEFs potentially by suppressing CDK6 expression. -- Highlights: •MicroRNA-33 was dramatically down-regulated in senescent MEF cells. •Altered expression of microRNA-33 exerted a critical role in MEFs senescence. •MicroRNA-33 promoted the replicative senescence of MEFs via targeting of CDK6.« less
2012-01-01
Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894
Guermandi, Marco; Bigucci, Alessandro; Franchi Scarselli, Eleonora; Guerrieri, Roberto
2015-01-01
We present a system for the acquisition of EEG signals based on active electrodes and implementing a Driving Right Leg circuit (DgRL). DgRL allows for single-ended amplification and analog-to-digital conversion, still guaranteeing a common mode rejection in excess of 110 dB. This allows the system to acquire high-quality EEG signals essentially removing network interference for both wet and dry-contact electrodes. The front-end amplification stage is integrated on the electrode, minimizing the system's sensitivity to electrode contact quality, cable movement and common mode interference. The A/D conversion stage can be either integrated in the remote back-end or placed on the head as well, allowing for an all-digital communication to the back-end. Noise integrated in the band from 0.5 to 100 Hz is comprised between 0.62 and 1.3 μV, depending on the configuration. Current consumption for the amplification and A/D conversion of one channel is 390 μA. Thanks to its low noise, the high level of interference suppression and its quick setup capabilities, the system is particularly suitable for use outside clinical environments, such as in home care, brain-computer interfaces or consumer-oriented applications.
Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly
2012-01-01
Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
Anema, Aranka; Kerr, Thomas; Milloy, M-J; Feng, Cindy; Montaner, Julio S G; Wood, Evan
2014-04-01
Food insecurity may be a barrier to achieving optimal HIV treatment-related outcomes among illicit drug users. This study therefore, aimed to assess the impact of severe food insecurity, or hunger, on plasma HIV RNA suppression among illicit drug users receiving antiretroviral therapy (ART). A cross-sectional Multivariate logistic regression model was used to assess the potential relationship between hunger and plasma HIV RNA suppression. A sample of n = 406 adults was derived from a community-recruited open prospective cohort of HIV-positive illicit drug users, in Vancouver, British Columbia (BC), Canada. A total of 235 (63.7%) reported "being hungry and unable to afford enough food," and 241 (59.4%) had plasma HIV RNA < 50 copies/ml. In unadjusted analyses, self-reported hunger was associated with lower odds of plasma HIV RNA suppression (Odds Ratio = 0.59, 95% confidence interval [CI]: 0.39-0.90, p = 0.015). In multivariate analyses, this association was no longer significant after controlling for socio-demographic, behavioral, and clinical characteristics, including 95% adherence (Adjusted Odds Ratio [AOR] = 0.65, 95% CI: 0.37-1.10, p = 0.105). Multivariate models stratified by 95% adherence found that the direction and magnitude of this association was not significantly altered by the adherence level. Hunger was common among illicit drug users in this setting. Although, there was an association between hunger and lower likelihood of plasma HIV RNA suppression, this did not persist in adjusted analyses. Further research is warranted to understand the social-structural, policy, and physical factors shaping the HIV outcomes of illicit drug users.
RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.
Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M
2018-06-01
The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
NASA Astrophysics Data System (ADS)
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.
2015-01-01
Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-07-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Zhiyong; Wu, Shuwen; Lv, Shouzheng
2015-06-05
Liver receptor homolog-1 (LRH-1) plays an important role in the onset and progression of many cancer types. However, the role of LRH-1 in osteosarcoma has not been well investigated. In this study, the critical role of LRH-1 in osteosarcoma cells was described. Quantitative polymerase chain reaction and Western blot analysis results revealed that LRH-1 was highly overexpressed in osteosarcoma cells. LRH-1 was knocked down by small interfering RNA (siRNA), and this phenomenon significantly inhibited osteosarcoma cell proliferation. Bioinformatics analysis results showed that LRH-1 contained putative binding sites of microRNA-451 (miR-451); this result was further validated through a dual-luciferase activity reportermore » assay. miR-451 was overexpressed in osteosarcoma cells through transfection of miR-451 mimics; miR-451 overexpression then significantly inhibited LRH-1 expression and cell proliferation. The loss of LRH-1 by siRNA or miR-451 mimics significantly impaired Wnt/β-catenin activity, leading to G0/G1 cell cycle arrest. Results showed that LRH-1 is implicated in osteosarcoma. Therefore, miR-451-induced suppression of LRH-1 can be a novel therapy to treat osteosarcoma. - Highlights: • LRH-1 was highly overexpressed in osteosarcoma cells. • Knockdown of LRH-1 inhibited osteosarcoma cell proliferation. • miR-451 directly targeted and regulated LRH-1 expression. • Overexpression of miR-451 suppressed Wnt activity.« less
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth
Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong
2017-08-01
Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscure. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In cell culture-based models for HBV infection and in liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 on cccDNA was a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered symmetric dimethylation of arginine 3 on H4 on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based human SWI/SNF chromatin remodeler, which resulted in down-regulation of the binding of RNA polymerase II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independently of its methyltransferase activity. Further study revealed that PRMT5 interfered with pregenomic RNA encapsidation by preventing its interaction with viral polymerase protein through binding to the reverse transcriptase-ribonuclease H region of polymerase, which is crucial for the polymerase-pregenomic RNA interaction. PRMT5 restricts HBV replication through a two-part mechanism including epigenetic suppression of cccDNA transcription and interference with pregenomic RNA encapsidation; these findings improve the understanding of epigenetic regulation of HBV transcription and host
Gomez, Javier A; Rutkowski, D Thomas
2016-01-01
Endoplasmic reticulum (ER) stress is implicated in many chronic diseases, but very little is known about how the unfolded protein response (UPR) responds to persistent ER stress in vivo. Here, we experimentally reconstituted chronic ER stress in the mouse liver, using repeated injection of a low dose of the ER stressor tunicamycin. Paradoxically, this treatment led to feedback-mediated suppression of a select group of mRNAs, including those encoding the ER chaperones BiP and GRP94. This suppression was due to both silencing of the ATF6α pathway of UPR-dependent transcription and enhancement of mRNA degradation, possibly via regulated IRE1-dependent decay (RIDD). The suppression of mRNA encoding BiP was phenocopied by ectopic overexpression of BiP protein, and was also observed in obese mice. Our findings suggest that persistent cycles of UPR activation and deactivation create an altered, quasi-stable setpoint for UPR-dependent transcriptional regulation—an outcome that could be relevant to conditions such as metabolic syndrome. DOI: http://dx.doi.org/10.7554/eLife.20390.001 PMID:27938665
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
Wang, Jun; Lei, Zeng-jie; Guo, Yan; Wang, Tao; Qin, Zhong-yi; Xiao, Hua-liang; Fan, Li-lin; Chen, Dong-feng; Bian, Xiu-wu; Liu, Jia; Wang, Bin
2015-11-10
Cancer stem cells (CSCs) are key cellular targets for effective cancer therapy, due to their critical roles in cancer progression and chemo/radio-resistance. Emerging evidence demonstrates that long non-coding RNAs (lncRNAs) are important players in the biology of cancers. However, it remains unknown whether lncRNAs could be exploited to target CSCs. We report that large intergenic non-coding RNA p21 (lincRNA-p21) is a potent suppressor of stem-like traits of CSCs purified from both primary colorectal cancer (CRC) tissues and cell lines. A novel lincRNA-p21-expressing adenoviral vector, which was armed with miRNA responsive element (MRE) of miR-451 (Ad-lnc-p21-MRE), was generated to eliminate CRC CSCs. Integration of miR-451 MREs into the adenovirus efficiently delivered lincRNA-p21 into CSCs that contained low levels of miR-451. Moreover, lincRNA-p21 inhibited the activity of β-catenin signaling, thereby attenuating the viability, self-renewal, and glycolysis of CSCs in vitro. By limiting dilution and serial tumor formation assay, we demonstrated that Ad-lnc-p21-MRE significantly suppressed the self-renewal potential and tumorigenicity of CSCs in nude mice. Importantly, application of miR-451 MREs appeared to protect normal liver cells from off-target expression of lincRNA-p21 in both tumor-bearing and naïve mice. Taken together, these findings suggest that lncRNAs may be promising therapeutic molecules to eradicate CSCs and MREs of tumor-suppressor miRNAs, such as miR-451, may be exploited to ensure the specificity of CSC-targeting strategies.
Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference
Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant
2015-01-01
The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
RISC-Target Interaction: Cleavage and Translational Suppression
van den Berg, Arjen; Mols, Johann; Han, Jiahuai
2008-01-01
Summary Small RNA molecules have been known and utilized to suppress gene expression for more than a decade. The discovery that these small RNA molecules are endogenously expressed in many organisms and have a critical role in controlling gene expression have led to the arising of a whole new field of research. Termed small interfering RNA (siRNA) or microRNA (miRNA) these ~22 nt RNA molecules have the capability to suppress gene expression through various mechanisms once they are incorporated in the multi-protein RNA-Induced Silencing Complex (RISC) and interact with their target mRNA. This review introduces siRNAs and microRNAs in a historical perspective and focuses on the key molecules in RISC, structural properties and mechanisms underlying the process of small RNA regulated post-transcriptional suppression of gene expression. PMID:18692607
Experimental generalized quantum suppression law in Sylvester interferometers
NASA Astrophysics Data System (ADS)
Viggianiello, Niko; Flamini, Fulvio; Innocenti, Luca; Cozzolino, Daniele; Bentivegna, Marco; Spagnolo, Nicolò; Crespi, Andrea; Brod, Daniel J.; Galvão, Ernesto F.; Osellame, Roberto; Sciarrino, Fabio
2018-03-01
Photonic interference is a key quantum resource for optical quantum computation, and in particular for so-called boson sampling devices. In interferometers with certain symmetries, genuine multiphoton quantum interference effectively suppresses certain sets of events, as in the original Hong–Ou–Mandel effect. Recently, it was shown that some classical and semi-classical models could be ruled out by identifying such suppressions in Fourier interferometers. Here we propose a suppression law suitable for random-input experiments in multimode Sylvester interferometers, and verify it experimentally using 4- and 8-mode integrated interferometers. The observed suppression occurs for a much larger fraction of input–output combinations than what is observed in Fourier interferometers of the same size, and could be relevant to certification of boson sampling machines and other experiments relying on bosonic interference, such as quantum simulation and quantum metrology.
Small interfering RNA targeting nuclear factor kappa B to prevent vein graft stenosis in rat models.
Meng, X B; Bi, X L; Zhao, H L; Feng, J B; Zhang, J P; Song, G M; Sun, W Y; Bi, Y W
2013-01-01
Intimal hyperplasia plays an important role in vein graft stenosis. Inflammatory injury, especially nuclear factor kappaB (NF-κB) gene activation, is highly involved in stenosis progression. We examined whether neointimal hyperplasia and vein graft stenosis could be inhibited by silencing the NF-κB gene with small interference RNA (siRNA). Sixty adult male Sprague-Dawley rats were randomly divided into a normal vein group, a vein graft group, a scrambled siRNA group, and an NF-κB siRNA group. We performed reverse interpositional grafting of the autologous external jugular vein to the abdominal aorta. Vein grafts were treated with liposome and gel complexes containing NF-κB siRNA or scrambled siRNA. The levels of monocyte chemoattractant protein -1, tumor necrosis factor-α, and NF-κB p65 in vessel tissues were evaluated after surgery for content of proliferating cell nuclear antigen (PCNA) and vascular wall thickness. NF-κB siRNA treated vein graft showed less neointimal formation and fewer positive PCNA cells (P < .05). In addition there were lower levels of, NF-κB p65 protein and of inflammatory mediators (P < .05) compared with the vein graft group. Our study suggested that siRNA transfection suppressed NF-κB expression, reduced inflammatory factors, lessened neointimal proliferation, and suppressed PCNA. Copyright © 2013 Elsevier Inc. All rights reserved.
Yao, Yilong; Ma, Jun; Xue, Yixue; Wang, Ping; Li, Zhen; Liu, Jing; Chen, Liangyu; Xi, Zhuo; Teng, Hao; Wang, Zhenhua; Li, Zhiqing; Liu, Yunhui
2015-04-01
Glioblastoma (GBM) is the most common and aggressive primary brain tumor. Great interest persists in useful therapeutic targets in GBM. Aberrant expression of long non-coding RNAs (lncRNAs) has been functionally associated with many cancers. Here, we elucidated the function and the possible molecular mechanisms of lncRNA XIST in human glioblastoma stem cells (GSCs). Our results proved that XIST expression was up-regulated in glioma tissues and GSCs. Functionally, knockdown of XIST exerted tumor-suppressive functions by reducing cell proliferation, migration and invasion as well as inducing apoptosis. The in vivo studies also showed that knockdown of XIST suppressed tumor growth and produced high survival in nude mice. Further, there was reciprocal repression between XIST and miR-152. Mechanistic investigations defined the direct binding ability of the predicted miR-152 binding site on the XIST. In addition, XIST and miR-152 are probably in the same RNA induced silencing complex (RISC). Finally, miR-152 mediated the tumor-suppressive effects that knockdown of XIST exerted. Taken together, these results provided a comprehensive analysis of XIST in GSCs and important clues for understanding the key roles of lncRNA-miRNA functional network in human glioma. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period
2012-01-01
Background Recent evidence proposes a novel concept that mammalian natural antisense RNAs play important roles in cellular homeostasis by regulating the expression of several genes. Identification and characterization of retroviral antisense RNA would provide new insights into mechanisms of replication and pathogenesis. HIV-1 encoded-antisense RNAs have been reported, although their structures and functions remain to be studied. We have tried to identify and characterize antisense RNAs of HIV-1 and their function in viral infection. Results Characterization of transcripts of HEK293T cells that were transiently transfected with an expression plasmid with HIV-1NL4–3 DNA in the antisense orientation showed that various antisense transcripts can be expressed. By screening and characterizing antisense RNAs in HIV-1NL4–3-infected cells, we defined the primary structure of a major form of HIV-1 antisense RNAs, which corresponds to a variant of previously reported ASP mRNA. This 2.6 kb RNA was transcribed from the U3 region of the 3′ LTR and terminated at the env region in acutely or chronically infected cell lines and acutely infected human peripheral blood mononuclear cells. Reporter assays clearly demonstrated that the HIV-1 LTR harbours promoter activity in the reverse orientation. Mutation analyses suggested the involvement of NF-κΒ binding sites in the regulation of antisense transcription. The antisense RNA was localized in the nuclei of the infected cells. The expression of this antisense RNA suppressed HIV-1 replication for more than one month. Furthermore, the specific knockdown of this antisense RNA enhanced HIV-1 gene expression and replication. Conclusions The results of the present study identified an accurate structure of the major form of antisense RNAs expressed from the HIV-1NL4–3 provirus and demonstrated its nuclear localization. Functional studies collectively demonstrated a new role of the antisense RNA in viral replication. Thus, we suggest
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
LIANG, XUE; XU, ZHAO; YUAN, MENG; ZHANG, YUE; ZHAO, BO; WANG, JUNQIAN; ZHANG, AIXUE; LI, GUANGPING
2016-01-01
Programmed cell death 4 (PDCD4) is involved in a number of bioprocesses, such as apoptosis and inflammation. However, its regulatory mechanisms in atherosclerosis remain unclear. In this study, we investigated the role and mechanisms of action of PDCD4 in high-fat diet-induced atherosclerosis in mice and in foam cells (characteristic pathological cells in atherosclerotic lesions) derived from ox-LDL-stimulated macrophages. MicroRNA (miR)-16 was predicted to bind PDCD4 by bioinformatics analysis. In the mice with atherosclerosis and in the foam cells, PDCD4 protein expression (but not the mRNA expression) was enhanced, while that of miR-16 was reduced. Transfection with miR-16 mimic decreased the activity of a luciferase reporter containing the 3′ untranslated region (3′UTR) of PDCD4 in the macrophage-derived foam cells. Conversely, treatment with miR-16 inhibitor enhanced the luciferase activity. However, by introducing mutations in the predicted binding site located in the 3′UTR of PDCD4, the miR-16 mimic and inhibitor were unable to alter the level of PDCD4, suggesting that miR-16 is a direct negative regulator of PDCD4 in atherosclerosis. Furthermore, transfection wtih miR-16 mimic and siRNA targeting PDCD4 suppressed the secretion and mRNA expression of pro-inflammatory factors, such as interleukin (IL)-6 and tumor necrosis factor-α (TNF-α), whereas it enhanced the secretion and mRNA expression of the anti-inflammatory factor, IL-10. Treatment with miR-16 inhibitor exerted the opposite effects. In addition, the phosphorylation of p38 and extracellular signal-regulated kinase (ERK), and nuclear factor-κB (NF-κB) expression were altered by miR-16. In conclusion, our data demonstrate that the targeting of PDCD4 by miR-16 may suppress the activation of inflammatory macrophages though mitogen-activated protein kinase (MAPK) and NF-κB signaling in atherosclerosis; thus, PDCD4 may prove to be a potential therapeutic target in the treatment of
Liu, Yuanshun; Jiang, Hua; Zhou, Hongbin; Ying, Xiwang; Wang, Zhehua; Yang, Yang; Xu, Wulin; He, Xujun; Li, Yaqing
2018-03-01
Secondary resistance is a major limitation in the efficacy of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor treatment of lung cancer. Previous studies have shown that expression of the long non-coding RNA HOX transcript antisense RNA (HOTAIR) is upregulated in lung cancer, which is correlated with metastasis and poor prognosis. However, the precise role of HOTAIR and its effects on gefitinib resistance in human lung adenocarcinoma are not known. To address this issue, in the present study we established a gefitinib-resistant (R)PC-9 human lung adenocarcinoma cell line and examined cell viability with the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay. We found that gefitinib concentrations <10 µM inhibited the viability of PC-9 but not RPC-9 cells in a dose-dependent manner. Lentivirus-mediated HOTAIR RNA interference induced cell apoptosis and S-phase arrest, as determined by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling and flow cytometry. Consistent with these observations, HOTAIR suppression was associated with tumor shrinkage and restoration of gefitinib sensitivity in RPC-9 xenograft mice. Immunohistochemical analyses and western blot revealed that HOTAIR silencing resulted in the upregulation of B cell lymphoma 2-associated X protein (Bax), Caspase-3 and transforming growth factor α (TGF-α) and downregulation of EGFR and B cell lymphoma 2 (Bcl-2) levels. These results indicate that HOTAIR normally prevents the activation of Bax/Caspase-3 while inducing TGF-α/EGFR signaling. Thus, targeting HOTAIR may be a novel therapeutic strategy for treating gefitinib-resistant lung adenocarcinoma.
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J
2015-01-01
MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Kino, T; Rice, K C; Chrousos, G P
2007-05-01
Interleukin-6 and downstream liver effectors acute phase reactants are implicated in the systemic inflammatory reaction. Peroxisome proliferator-activated receptor delta (PPARdelta), which binds to and is activated by a variety of fatty acids, was recently shown to have anti-inflammatory actions. We examined the ability of the synthetic PPARdelta agonist GW501516 to suppress interleukin-6-induced expression of acute phase proteins in human hepatoma HepG2 cells and rat primary hepatocytes. Results GW501516 dose-dependently suppressed interleukin-6-induced mRNA expression of the acute phase protein alpha1-antichymotrypsin in HepG2 cells. The compound also suppressed interleukin-6-induced mRNA expression of alpha2-acid glycoprotein, beta-fibrinogen and alpha2-macroglobulin in and the secretion of C-reactive protein by rat primary hepatocytes. Depletion of the PPARdelta receptor, but not of PPARalpha or gamma, attenuated the suppressive effect of GW501516 on interleukin-6-induced alpha1-antichymotrypsin mRNA expression, indicating that PPARdelta specifically mediated this effect. Since interleukin-6 stimulates the transcriptional activity of the alpha1-antichymotrypsin promoter by activating the signal transducer and activator of transcription (STAT) 3, we examined functional interaction of this transcription factor and PPARdelta on this promoter. Overexpression of PPARdelta enhanced the suppressive effect of GW501516 on STAT3-activated transcriptional activity of the alpha1-antichymotrypsin promoter, while GW501516 suppressed interleukin-6-induced binding of this transcription factor to this promoter. These findings indicate that agonist-activated PPARdelta interferes with interleukin-6-induced acute phase reaction in the liver by inhibiting the transcriptional activity of STAT3. PPARdelta agonists might be useful for the suppression of systemic inflammatory reactions in which IL-6 plays a central role.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
Hacke, Katrin; Falahati, Rustom; Flebbe-Rehwaldt, Linda; Kasahara, Noriyuki; Gaensler, Karin M. L.
2010-01-01
Current approaches for hematopoietic stem cell (HSC) and organ transplantation are limited by donor and host-mediated immune responses to allo-antigens. Application of these therapies is limited by the toxicity of preparative and post-transplant immunosuppressive regimens and a shortage of appropriate HLA-matched donors. We have been exploring two complementary approaches for genetically modifying donor cells that achieve long-term suppression of cellular proteins that elicit host immune responses to mismatched donor antigens, and provide a selective advantage to genetically engineered donor cells after transplantation. The first approach is based on recent advances that make feasible targeted down-regulation of HLA expression. Suppression of HLA expression could help to overcome limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors. Accordingly, we have recently investigated whether knockdown of HLA by RNA interference (RNAi) enables allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors that integrate into genomic DNA, thereby permanently modifying transduced donor cells. Lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA achieved efficient and dose-dependent reduction in surface expression of HLA in human cells, and enhanced resistance to allo-reactive T lymphocyte-mediated cytotoxicity, while avoiding non-MHC restricted killing. Complementary strategies for genetic engineering of HSC that would provide a selective advantage for transplanted donor cells and enable successful engraftment with less toxic preparative and immunosuppressive regimens would increase the numbers of individuals to whom HLA suppression therapy could be offered. Our second strategy is to provide a mechanism for in vivo selection of genetically modified HSC and other donor cells. We have
New basic approach to treat non-small cell lung cancer based on RNA-interference.
Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias
2014-03-01
To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.
Runo, Steven
2011-01-01
RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
Courtney, S C; Scherbik, S V; Stockman, B M; Brinton, M A
2012-04-01
West Nile virus (WNV) recently became endemic in the United States and is a significant cause of human morbidity and mortality. Natural WNV strain infections do not induce stress granules (SGs), while W956IC (a lineage 2/1 chimeric WNV infectious clone) virus infections produce high levels of early viral RNA and efficiently induce SGs through protein kinase R (PKR) activation. Additional WNV chimeric viruses made by replacing one or more W956IC genes with the lineage 1 Eg101 equivalent in the W956IC backbone were analyzed. The Eg-NS4b+5, Eg-NS1+3+4a, and Eg-NS1+4b+5 chimeras produced low levels of viral RNA at early times of infection and inefficiently induced SGs, suggesting the possibility that interactions between viral nonstructural proteins and/or between viral nonstructural proteins and cell proteins are involved in suppressing early viral RNA synthesis and membrane remodeling during natural WNV strain infections. Detection of exposed viral double-stranded RNA (dsRNA) in W956IC-infected cells suggested that the enhanced early viral RNA synthesis surpassed the available virus-induced membrane protection and allowed viral dsRNA to activate PKR.
The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.
Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin
2013-06-01
Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.
Lee, Soo Hyeon; Chung, Bong Hyun; Park, Tae Gwan; Nam, Yoon Sung; Mok, Hyejung
2012-07-17
Because of RNA's ability to encode structure and functional information, researchers have fabricated diverse geometric structures from this polymer at the micro- and nanoscale. With their tunable structures, rigidity, and biocompatibility, novel two-dimensional and three-dimensional RNA structures can serve as a fundamental platform for biomedical applications, including engineered tissues, biosensors, and drug delivery vehicles. The discovery of the potential of small-interfering RNA (siRNA) has underscored the applications of RNA-based micro- and nanostructures in medicine. Small-interfering RNA (siRNA), synthetic double-stranded RNA consisting of approximately 21 base pairs, suppresses problematic target genes in a sequence-specific manner via inherent RNA interference (RNAi) processing. As a result, siRNA offers a potential strategy for treatment of many human diseases. However, due to inefficient delivery to cells and off-target effects, the clinical application of therapeutic siRNA has been very challenging. To address these issues, researchers have studied a variety of nanocarrier systems for siRNA delivery. In this Account, we describe several strategies for efficient siRNA delivery and selective gene silencing. We took advantage of facile chemical conjugation and complementary hybridization to design novel siRNA-based micro- and nanostructures. Using chemical crosslinkers and hydrophobic/hydrophilic polymers at the end of siRNA, we produced various RNA-based structures, including siRNA block copolymers, micelles, linear siRNA homopolymers, and microhydrogels. Because of their increased charge density and flexibility compared with conventional siRNA, these micro- and nanostructures can form polyelectrolyte complexes with poorly charged and biocompatible cationic carriers that are both more condensed and more homogenous than the complexes formed in other carrier systems. In addition, the fabricated siRNA-based structures are linked by cleavable disulfide
Systemic delivery of siRNA with cationic lipid assisted PEG-PLA nanoparticles for cancer therapy.
Yang, Xian-Zhu; Dou, Shuang; Sun, Tian-Meng; Mao, Cheng-Qiong; Wang, Hong-Xia; Wang, Jun
2011-12-10
Delivery of small interfering RNA (siRNA) has been one of the major hurdles for the application of RNA interference in therapeutics. Here, we describe a cationic lipid assisted polymeric nanoparticle system with stealthy property for efficient siRNA encapsulation and delivery, which was fabricated with poly(ethylene glycol)-b-poly(d,l-lactide), siRNA and a cationic lipid, using a double emulsion-solvent evaporation technique. By incorporation of the cationic lipid, the encapsulation efficiency of siRNA into the nanoparticles could be above 90% and the siRNA loading weight ratio was up to 4.47%, while the diameter of the nanoparticles was around 170 to 200nm. The siRNA retained its integrity within the nanoparticles, which were effectively internalized by cancer cells and escaped from the endosome, resulting in significant gene knockdown. This effect was demonstrated by significant down-regulation of luciferase expression in HepG2-luciferase cells which stably express luciferase, and suppression of polo-like kinase 1 (Plk1) expression in HepG2 cells, following delivery of specific siRNAs by the nanoparticles. Furthermore, the nanoparticles carrying siRNA targeting the Plk1 gene were found to induce remarkable apoptosis in both HepG2 and MDA-MB-435s cancer cells. Systemic delivery of specific siRNA by nanoparticles significantly inhibited luciferase expression in an orthotopic murine liver cancer model and suppressed tumor growth in a MDA-MB-435s murine xenograft model, suggesting its therapeutic promise in disease treatment. Copyright © 2011 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran
2015-12-01
A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.
Deas, Tia S; Binduga-Gajewska, Iwona; Tilgner, Mark; Ren, Ping; Stein, David A; Moulton, Hong M; Iversen, Patrick L; Kauffman, Elizabeth B; Kramer, Laura D; Shi, Pei-Yong
2005-04-01
RNA elements within flavivirus genomes are potential targets for antiviral therapy. A panel of phosphorodiamidate morpholino oligomers (PMOs), whose sequences are complementary to RNA elements located in the 5'- and 3'-termini of the West Nile (WN) virus genome, were designed to anneal to important cis-acting elements and potentially to inhibit WN infection. A novel Arg-rich peptide was conjugated to each PMO for efficient cellular delivery. These PMOs exhibited various degrees of antiviral activity upon incubation with a WN virus luciferase-replicon-containing cell line. Among them, PMOs targeting the 5'-terminal 20 nucleotides (5'End) or targeting the 3'-terminal element involved in a potential genome cyclizing interaction (3'CSI) exhibited the greatest potency. When cells infected with an epidemic strain of WN virus were treated with the 5'End or 3'CSI PMO, virus titers were reduced by approximately 5 to 6 logs at a 5 muM concentration without apparent cytotoxicity. The 3'CSI PMO also inhibited mosquito-borne flaviviruses other than WN virus, and the antiviral potency correlated with the conservation of the targeted 3'CSI sequences of specific viruses. Mode-of-action analyses showed that the 5'End and 3'CSI PMOs suppressed viral infection through two distinct mechanisms. The 5'End PMO inhibited viral translation, whereas the 3'CSI PMO did not significantly affect viral translation but suppressed RNA replication. The results suggest that antisense PMO-mediated blocking of cis-acting elements of flavivirus genomes can potentially be developed into an anti-flavivirus therapy. In addition, we report that although a full-length WN virus containing a luciferase reporter (engineered at the 3' untranslated region of the genome) is not stable, an early passage of this reporting virus can be used to screen for inhibitors against any step of the virus life cycle.
Morcillo, Rafael Jorge León; Navarrete, María Isabel Tamayo; Bote, Juan Antonio Ocampo; Monguio, Salomé Prat; García-Garrido, José Manuel
2016-01-15
Arbuscular mycorrhizal (AM) is a mutually beneficial interaction among higher plants and soil fungi of the phylum Glomeromycota. Numerous studies have pointed that jasmonic acid plays an important role in the development of the intraradical fungus. This compound belongs to a group of biologically active compounds known as oxylipins which are derived from the oxidative metabolism of polyunsaturated fatty acids. Studies of the regulatory role played by oxylipins in AM colonization have generally focused on jasmonates, while few studies exist on the 9-LOX pathway of oxylipins during AM formation. Here, the cDNA of Allene oxide synthase 3 (AOS3), a key enzyme in the 9-LOX pathway, was used in the RNA interference (RNAi) system to transform potato plants in order to suppress its expression. Results show increases in AOS3 gene expression and 9-LOX products in roots of wild type potato mycorrhizal plants. The suppression of AOS3 gene expression increases the percentage of root with mycorrhizal colonization at early stages of AM formation. AOS3 RNA interference lead to an induction of LOXA and 13-LOX genes, a reduction in AOS3 derived 9-LOX oxylipin compounds and an increase in jasmonic acid content, suggesting compensation between 9 and 13-LOX pathways. The results in a whole support the hypothesis of a regulatory role for the 9-LOX oxylipin pathway during mycorrhization. Copyright © 2015 Elsevier GmbH. All rights reserved.
Gumireddy, Kiranmai; Li, Anping; Kossenkov, Andrew V.; Sakurai, Masayuki; Yan, Jinchun; Li, Yan; Xu, Hua; Wang, Jian; Zhang, Paul J.; Zhang, Lin; Showe, Louise C.; Nishikura, Kazuko; Huang, Qihong
2016-01-01
Metastasis is a critical event affecting breast cancer patient survival. To identify molecules contributing to the metastatic process, we analysed The Cancer Genome Atlas (TCGA) breast cancer data and identified 41 genes whose expression is inversely correlated with survival. Here we show that GABAA receptor alpha3 (Gabra3), normally exclusively expressed in adult brain, is also expressed in breast cancer, with high expression of Gabra3 being inversely correlated with breast cancer survival. We demonstrate that Gabra3 activates the AKT pathway to promote breast cancer cell migration, invasion and metastasis. Importantly, we find an A-to-I RNA-edited form of Gabra3 only in non-invasive breast cancers and show that edited Gabra3 suppresses breast cancer cell invasion and metastasis. A-to-I-edited Gabra3 has reduced cell surface expression and suppresses the activation of AKT required for cell migration and invasion. Our study demonstrates a significant role for mRNA-edited Gabra3 in breast cancer metastasis. PMID:26869349
Gumireddy, Kiranmai; Li, Anping; Kossenkov, Andrew V; Sakurai, Masayuki; Yan, Jinchun; Li, Yan; Xu, Hua; Wang, Jian; Zhang, Paul J; Zhang, Lin; Showe, Louise C; Nishikura, Kazuko; Huang, Qihong
2016-02-12
Metastasis is a critical event affecting breast cancer patient survival. To identify molecules contributing to the metastatic process, we analysed The Cancer Genome Atlas (TCGA) breast cancer data and identified 41 genes whose expression is inversely correlated with survival. Here we show that GABAA receptor alpha3 (Gabra3), normally exclusively expressed in adult brain, is also expressed in breast cancer, with high expression of Gabra3 being inversely correlated with breast cancer survival. We demonstrate that Gabra3 activates the AKT pathway to promote breast cancer cell migration, invasion and metastasis. Importantly, we find an A-to-I RNA-edited form of Gabra3 only in non-invasive breast cancers and show that edited Gabra3 suppresses breast cancer cell invasion and metastasis. A-to-I-edited Gabra3 has reduced cell surface expression and suppresses the activation of AKT required for cell migration and invasion. Our study demonstrates a significant role for mRNA-edited Gabra3 in breast cancer metastasis.
2006-06-15
because its suppression should lead to a nearly total loss of all RNA synthesis , but also because of the absence of similar proteins in mammalian cells...protects mice from fulminant hepatitis. Nat Med 2003; 9:347–51. 12. Ge Q, Filip L, Bai A, Nguyen T, Eisen HN, Chen J. Inhibition of influenza virus...human beta interferon gene in simian cells defective in interferon synthesis . Mol Cell Biol 1986; 6:2279–83. 21. Spann KM, Tran KC, Collins PL
Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko
2018-01-01
Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.
Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong
2009-03-01
To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung
2018-05-01
The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium
Interferences in electrochemical hydride generation of hydrogen selenide
NASA Astrophysics Data System (ADS)
Bolea, E.; Laborda, F.; Belarra, M. A.; Castillo, J. R.
2001-12-01
Interferences from Cu(II), Zn(II), Pt(IV), As(III) and nitrate on electrochemical hydride generation of hydrogen selenide were studied using a tubular flow-through generator, flow injection sample introduction and quartz tube atomic absorption spectrometry. Comparison with conventional chemical generation using tetrahydroborate was also performed. Lead and reticulated vitreous carbon (RVC), both in particulate form, were used as cathode materials. Signal supressions up to 60-75%, depending on the cathode material, were obtained in the presence of up to 200 mg l-1 of nitrate due to the competitive reduction of the anion. Interference from As(III) was similar in electrochemical and chemical generation, being related to the quartz tube atomization process. Zinc did not interfere up to Se/Zn ratios 1:100, whereas copper and platinum showed suppression levels up to 50% for Se/interferent ratios 1:100. Total signal suppression was observed in presence of Se/Cu ratios 1:100 when RVC cathodes were used. No memory effects were observed in any case. Scanning electron microscopy and squared wave voltametry studies supported the interference mechanism based on the decomposition of the hydride on the dispersed particles of the reduced metal.
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
2013-01-01
Background During reverse transcription, retroviruses duplicate the long terminal repeats (LTRs). These identical LTRs carry both promoter regions and functional polyadenylation sites. To express full-length transcripts, retroviruses have to suppress polyadenylation in the 5′LTR and activate polyadenylation in the 3′LTR. Foamy viruses have a unique LTR structure with respect to the location of the major splice donor (MSD), which is located upstream of the polyadenylation signal. Results Here, we describe the mechanisms of foamy viruses regulating polyadenylation. We show that binding of the U1 small nuclear ribonucleoprotein (U1snRNP) to the MSD suppresses polyadenylation at the 5′LTR. In contrast, polyadenylation at the 3′LTR is achieved by adoption of a different RNA structure at the MSD region, which blocks U1snRNP binding and furthers RNA cleavage and subsequent polyadenylation. Conclusion Recently, it was shown that U1snRNP is able to suppress the usage of intronic cryptic polyadenylation sites in the cellular genome. Foamy viruses take advantage of this surveillance mechanism to suppress premature polyadenylation at the 5’end of their RNA. At the 3’end, Foamy viruses use a secondary structure to presumably block access of U1snRNP and thereby activate polyadenylation at the end of the genome. Our data reveal a contribution of U1snRNP to cellular polyadenylation site selection and to the regulation of gene expression. PMID:23718736
Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-04-01
Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.
Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-01-01
Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493
Zhang, Mingting; Xu, Qingli; Yan, Shufen; Li, Zhigang; Yan, Wei; Jia, Xiaojing
2016-05-01
MicroRNAs (miRNAs) play a pivotal role in cancer progression and development, representing novel therapeutic tools for cancer therapy. Forkhead box Q1 (FOXQ1) functions as an oncogene in various cancer types. However, the functional significance of FOXQ1 in cervical cancer remains unknown. In this study, we investigated the biological function of FOXQ1 in cervical cancer and tested whether or not FOXQ1 can be targeted and regulated by specific miRNAs. We found that FOXQ1 was highly expressed in cervical cancer cell lines. Knockdown of FOXQ1 by small interfering RNA (siRNA) significantly suppressed the proliferation and epithelial-mesenchymal transition (EMT) of cervical cancer cells. FOXQ1 was predicted as a target gene of microRNA-506 (miR-506), and this prediction was validated by dual-luciferase reporter assay. Quantitative real-time PCR and western blot analyses demonstrated that mRNA and protein expression was negatively regulated by miR-506. The expression of miR-506 was downregulated in cervical cancer tissues, and miR-506 expression was inversely correlated with FOXQ1 expression in cervical cancer. The overexpression of miR-506 dramatically suppressed the proliferation and EMT of cervical cancer cells that mimicked the suppression of FOXO1 siRNA. Furthermore, the restoration of FOXQ1 expression significantly reversed the inhibitory effect of miR-506. Overall, our study demonstrated that miR-506 inhibited the proliferation and EMT of cervical cancer cells by targeting FOXQ1 and provided evidence that the miR-506/FOXQ1 axis plays an important role in the pathogenesis of cervical cancer, representing potential molecular targets for the development of anticancer agents for cervical cancer treatment.
Optical interference fringe reduction in frequency-modulation spectroscopy experiments
NASA Astrophysics Data System (ADS)
Hjelme, Dag Roar; Neegard, Steinar; Vartdal, Erling
1995-08-01
We show both theoretically and experimentally that interference fringe signals can always be suppressed to improve the signal-to-noise ratio, provided that the modulation frequency is of the order of the absorption linewidth or higher. Suppression of optical interference fringes by more than 1 order of magnitude and signal-to-noise ratio enhancement of more than 13 dB is demonstrated by use of a proper choice of laser modulation frequency. A further fringe reduction of 10 dB is possible by adjustment of the local oscillator phase.
Suppression of biodynamic interference in head-tracked teleoperation
NASA Technical Reports Server (NTRS)
Lifshitz, S.; Merhav, S. J.; Grunwald, A. J.; Tucker, G. E.; Tischler, M. B.
1991-01-01
The utility of helmet-tracked sights to provide pointing commands for teleoperation of cameras, lasers, or antennas in aircraft is degraded by the presence of uncommanded, involuntary heat motion, referred to as biodynamic interference. This interference limits the achievable precision required in pointing tasks. The noise contributions due to biodynamic interference consists of an additive component which is correlated with aircraft vibration and an uncorrelated, nonadditive component, referred to as remnant. An experimental simulation study is described which investigated the improvements achievable in pointing and tracking precision using dynamic display shifting in the helmet-mounted display. The experiment was conducted in a six degree of freedom motion base simulator with an emulated helmet-mounted display. Highly experienced pilot subjects performed precision head-pointing tasks while manually flying a visual flight-path tracking task. Four schemes using adaptive and low-pass filtering of the head motion were evaluated to determine their effects on task performance and pilot workload in the presence of whole-body vibration characteristic of helicopter flight. The results indicate that, for tracking tasks involving continuously moving targets, improvements of up to 70 percent can be achieved in percent on-target dwelling time and of up to 35 percent in rms tracking error, with the adaptive plus low-pass filter configuration. The results with the same filter configuration for the task of capturing randomly-positioned, stationary targets show an increase of up to 340 percent in the number of targets captured and an improvement of up to 24 percent in the average capture time. The adaptive plus low-pass filter combination was considered to exhibit the best overall display dynamics by each of the subjects.
Dan Cullen
2004-01-01
In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...
Wang, Yingying; Cao, Zhijun; Zhu, Zijian; Cai, Huaqian; Wu, Yanhong
2015-10-01
People are able to intentionally forget unwanted memories through voluntary suppression, as revealed by the Think/No-think (TNT) paradigm. However, the nature of intentional forgetting is controversial. Findings that forgetting is independent of retrieval cues suggest that inhibitory control underlies intentional forgetting, but this result is also in line with an interference account. To resolve this controversy, we have directly contrasted the cue-independent characteristic of suppression versus interference. A double-cue paradigm was used, in which two different cues were associated with the same target during initial memory formation. Only one cue-target association received further interference/suppression training. In the test phase, when both cues were used to retrieve the target, we found that interference caused memory impairment that was restricted to the trained cue-target association, while suppression induced forgetting that generalized to the independent cue-target association. Therefore, the effect of suppression differs from that of interference. The cue-independent forgetting by voluntary suppression indicates that the target memory itself is inhibited, providing evidence that the underlying mechanism of suppression-induced forgetting is inhibitory control. Copyright © 2015 Elsevier B.V. All rights reserved.
Bu, Xiancong; Zhang, Xiangyan; Xu, Jinhong; Yang, Heping; Zhou, Xiangdong; Wang, Haijing; Gong, Liang
2018-06-01
Epigenetic modifications serve important roles in non-small cell lung cancer (NSCLC) tumorigenesis; however, the role of DNA methyltransferase 1 (DNMT1) in lung cancer progression remains unclear. In the present study, the expression of DNMT1 in the human NSCLC cell lines 95D (high invasive ability) and 95C (low invasive ability) was analyzed by western blotting. The results demonstrated that the expression of DNMT1 in 95D cells was significantly higher, compared with in 95C cells and small airway epithelial cells. To further define the role of DNMT1 in tumor migration and invasion in NSCLC cells, RNA interference was used to silence DNMT1 expression. Depletion of DNMT1 significantly inhibited 95D cell invasion and migration. In addition, treatment with DNMT1 small interfering RNA resulted in compact cell morphology and significantly increased epithelial marker E-cadherin expression whilst also decreasing the expression of certain mesenchymal markers, including vimentin and fibronectin. Suppression of DNMT1 increased cytoplasmic β-catenin levels while downregulating nuclear β-catenin and Snail, an important regulator of EMT. The results from the present study suggest that the inhibition of DNMT1 reverses the epithelial-mesenchymal transition partly via the inhibition of the Wnt/β-catenin signaling pathway, and therefore inhibits cell migration and invasion. These results indicate that targeting DNMT1 may inhibit tumor metastasis and that DNMT1 is a promising target for the novel treatment of lung cancer.
RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells
Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V
2006-01-01
Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456
de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard
2014-02-01
Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.
The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.
Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique
2007-09-18
Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.
Li, Yin-Ji; Kukita, Akiko; Kyumoto-Nakamura, Yukari; Kukita, Toshio
2016-09-01
Wilms' tumor 1 (WT1), a zinc-finger transcription regulator of the early growth response family, identified as the product of a tumor suppressor gene of Wilms' tumors, bears potential ability to induce macrophage differentiation in blood cell differentiation. Herein, we examined the involvement of WT1 in the regulation of osteoclastogenesis. We detected a high level of WT1 protein expression in osteoclast precursors; however, WT1 expression was markedly suppressed during osteoclastogenesis. We examined expression of WT1 transcripts in bone tissue by RNA in situ hybridization. We found a high level of antisense transcripts in osteoclasts actively resorbing bone in mandible of newborn rats. Expression of antisense WT1 RNA in mandible was also confirmed by Northern blot analysis and strand-specific RT-PCR. Overexpression of antisense WT1 RNA in RAW-D cells, an osteoclast precursor cell line, resulted in a marked enhancement of osteoclastogenesis, suggesting that antisense WT1 RNA functions to suppress expression of WT1 protein in osteoclastogenesis. High level expression of antisense WT1 RNA may contribute to commitment to osteoclastogenesis, and may allow osteoclasts to maintain or stabilize their differentiation state. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will
Meng, Zhu; Song, Mei-Yan; Li, Chuan-Fang; Zhao, Jia-Qi
2017-12-16
remarkably suppressed by NLRP3 KO. Taken together, our study indicated that shRNA interference of NLRP3 inflammasome attenuated myocardial I/R injury via autophagy activation. These findings demonstrated that NLRP3 KO may a promising therapy in myocardial I/R injury. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Qiu, Jing-Xin; Kim, Edward J.; Yu, Ai-Ming
2016-01-01
Pancreatic cancer is the fourth leading cause of cancer death in the United States. Better understanding of pancreatic cancer biology may help identify new oncotargets towards more effective therapies. This study investigated the mechanistic actions of microRNA-1291 (miR-1291) in the suppression of pancreatic tumorigenesis. Our data showed that miR-1291 was downregulated in a set of clinical pancreatic carcinoma specimens and human pancreatic cancer cell lines. Restoration of miR-1291 expression inhibited pancreatic cancer cell proliferation, which was associated with cell cycle arrest and enhanced apoptosis. Furthermore, miR-1291 sharply suppressed the tumorigenicity of PANC-1 cells in mouse models. A proteomic profiling study revealed 32 proteins altered over 2-fold in miR-1291-expressing PANC-1 cells that could be assembled into multiple critical pathways for cancer. Among them anterior gradient 2 (AGR2) was reduced to the greatest degree. Through computational and experimental studies we further identified that forkhead box protein A2 (FOXA2), a transcription factor governing AGR2 expression, was a direct target of miR-1291. These results connect miR-1291 to the FOXA2-AGR2 regulatory pathway in the suppression of pancreatic cancer cell proliferation and tumorigenesis, providing new insight into the development of miRNA-based therapy to combat pancreatic cancer. PMID:27322206
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
Translation Repression in Human Cells by MicroRNA-Induced Gene Silencing Requires RCK/p54
Chu, Chia-ying
2006-01-01
RNA interference is triggered by double-stranded RNA that is processed into small interfering RNAs (siRNAs) by Dicer enzyme. Endogenously, RNA interference triggers are created from small noncoding RNAs called microRNAs (miRNAs). RNA-induced silencing complexes (RISC) in human cells can be programmed by exogenously introduced siRNA or endogenously expressed miRNA. siRNA-programmed RISC (siRISC) silences expression by cleaving a perfectly complementary target mRNA, whereas miRNA-induced silencing complexes (miRISC) inhibits translation by binding imperfectly matched sequences in the 3′ UTR of target mRNA. Both RISCs contain Argonaute2 (Ago2), which catalyzes target mRNA cleavage by siRISC and localizes to cytoplasmic mRNA processing bodies (P-bodies). Here, we show that RCK/p54, a DEAD box helicase, interacts with argonaute proteins, Ago1 and Ago2, in affinity-purified active siRISC or miRISC from human cells; directly interacts with Ago1 and Ago2 in vivo, facilitates formation of P-bodies, and is a general repressor of translation. Disrupting P-bodies by depleting Lsm1 did not affect RCK/p54 interactions with argonaute proteins and its function in miRNA-mediated translation repression. Depletion of RCK/p54 disrupted P-bodies and dispersed Ago2 throughout the cytoplasm but did not significantly affect siRNA-mediated RNA functions of RISC. Depleting RCK/p54 released general, miRNA-induced, and let-7-mediated translational repression. Therefore, we propose that translation repression is mediated by miRISC via RCK/p54 and its specificity is dictated by the miRNA sequence binding multiple copies of miRISC to complementary 3′ UTR sites in the target mRNA. These studies also suggest that translation suppression by miRISC does not require P-body structures, and location of miRISC to P-bodies is the consequence of translation repression. PMID:16756390
HIV-1 Rev protein specifies the viral RNA export pathway by suppressing TAP/NXF1 recruitment
Taniguchi, Ichiro; Mabuchi, Naoto; Ohno, Mutsuhito
2014-01-01
Nuclear RNA export pathways in eukaryotes are often linked to the fate of a given RNA. Therefore, the choice of export pathway should be well-controlled to avoid an unfavorable effect on gene expression. Although some RNAs could be exported by more than one pathway, little is known about how the choice is regulated. This issue is highlighted when the human immunodeficiency virus type 1 (HIV-1) Rev protein induces the export of singly spliced and unspliced HIV-1 transcripts. How these RNAs are exported is not well understood because such transcripts should have the possibility of utilizing CRM1-dependent export via Rev or cellular TAP/NXF1-dependent export via the transcription/export (TREX) complex, or both. Here we found that Rev suppressed TAP/NXF1-dependent export of model RNA substrates that recapitulated viral transcripts. In this effect, Rev interacted with the cap-binding complex and inhibited the recruitment of the TREX complex. Thus, Rev controls the identity of the factor occupying the cap-proximal region that determines the RNA export pathway. This ribonucleoprotein remodeling activity of Rev may favor viral gene expression. PMID:24753416
The role of suppression in figurative language comprehension✩
Gemsbacher, Morton Ann; Robertson, Rachel R.W.
2014-01-01
In this paper, we describe the crucial role that suppression plays in many aspects of language comprehension. We define suppression as a general, cognitive mechanism, the purpose of which is to attenuate the interference caused by the activation of extraneous, unnecessary, or inappropriate information. We illustrate the crucial role that suppression plays in general comprehension by reviewing numerous experiments. These experiments demonstrate that suppression attenuates interference during lexical access (how word meanings are ‘accessed’), anaphoric reference (how referents for anaphors, like pronouns, are computed), cataphoric reference (how concepts that are marked by devices, such as spoken stress, gain a privileged status), syntactic parsing (how grammatical forms of sentences are decoded), and individual differences in (adult) language comprehension skill. We also review research that suggests that suppression plays a crucial role in the understanding of figurative language, in particular, metaphors, idioms, and proverbs. PMID:25520540
The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.
Gonzalez-Alegre, Pedro
2007-04-01
RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yimeng; Zhou, Jianhong; Du, Yuchun, E-mail: ydu@uark.edu
The NS1 protein of influenza viruses is a major virulence factor and exerts its function through interacting with viral/cellular RNAs and proteins. In this study, we identified heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1) as an interacting partner of NS1 proteins by a proteomic method. Knockdown of hnRNP A2/B1 by small interfering RNA (siRNA) resulted in higher levels of NS vRNA, NS1 mRNA, and NS1 protein in the virus-infected cells. In addition, we demonstrated that hnRNP A2/B1 proteins are associated with NS1 and NS2 mRNAs and that knockdown of hnRNP A2/B1 promotes transport of NS1 mRNA from the nucleus to themore » cytoplasm in the infected cells. Lastly, we showed that knockdown of hnRNP A2/B1 leads to enhanced virus replication. Our results suggest that hnRNP A2/B1 plays an inhibitory role in the replication of influenza A virus in host cells potentially through suppressing NS1 RNA/protein levels and NS1 mRNA nucleocytoplasmic translocation. - Highlights: • Cellular protein hnRNP A2/B1 interacts with influenza viral protein NS1. • hnRNP A2/B1 suppresses the levels of NS1 protein, vRNA and mRNA in infected cells. • hnRNP A2/B1 protein is associated with NS1 and NS2 mRNAs. • hnRNP A2/B1 inhibits the nuclear export of NS1 mRNAs. • hnRNP A2/B1 inhibits influenza virus replication.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
Design and cloning strategies for constructing shRNA expression vectors
McIntyre, Glen J; Fanning, Gregory C
2006-01-01
Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676
Ty3 Retrotransposon Hijacks Mating Yeast RNA Processing Bodies to Infect New Genomes
Kaake, Robyn; Dawson, Anthony R.; Matheos, Dina; Nagashima, Kunio; Sitlani, Parth; Patterson, Kurt; Chang, Ivan; Huang, Lan; Sandmeyer, Suzanne
2015-01-01
Retrotransposition of the budding yeast long terminal repeat retrotransposon Ty3 is activated during mating. In this study, proteins that associate with Ty3 Gag3 capsid protein during virus-like particle (VLP) assembly were identified by mass spectrometry and screened for roles in mating-stimulated retrotransposition. Components of RNA processing bodies including DEAD box helicases Dhh1/DDX6 and Ded1/DDX3, Sm-like protein Lsm1, decapping protein Dcp2, and 5’ to 3’ exonuclease Xrn1 were among the proteins identified. These proteins associated with Ty3 proteins and RNA, and were required for formation of Ty3 VLP retrosome assembly factories and for retrotransposition. Specifically, Dhh1/DDX6 was required for normal levels of Ty3 genomic RNA, and Lsm1 and Xrn1 were required for association of Ty3 protein and RNA into retrosomes. This role for components of RNA processing bodies in promoting VLP assembly and retrotransposition during mating in a yeast that lacks RNA interference, contrasts with roles proposed for orthologous components in animal germ cell ribonucleoprotein granules in turnover and epigenetic suppression of retrotransposon RNAs. PMID:26421679
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
mRNA Cap Methyltransferase, RNMT-RAM, Promotes RNA Pol II-Dependent Transcription.
Varshney, Dhaval; Lombardi, Olivia; Schweikert, Gabriele; Dunn, Sianadh; Suska, Olga; Cowling, Victoria H
2018-05-01
mRNA cap addition occurs early during RNA Pol II-dependent transcription, facilitating pre-mRNA processing and translation. We report that the mammalian mRNA cap methyltransferase, RNMT-RAM, promotes RNA Pol II transcription independent of mRNA capping and translation. In cells, sublethal suppression of RNMT-RAM reduces RNA Pol II occupancy, net mRNA synthesis, and pre-mRNA levels. Conversely, expression of RNMT-RAM increases transcription independent of cap methyltransferase activity. In isolated nuclei, recombinant RNMT-RAM stimulates transcriptional output; this requires the RAM RNA binding domain. RNMT-RAM interacts with nascent transcripts along their entire length and with transcription-associated factors including the RNA Pol II subunits SPT4, SPT6, and PAFc. Suppression of RNMT-RAM inhibits transcriptional markers including histone H2BK120 ubiquitination, H3K4 and H3K36 methylation, RNA Pol II CTD S5 and S2 phosphorylation, and PAFc recruitment. These findings suggest that multiple interactions among RNMT-RAM, RNA Pol II factors, and RNA along the transcription unit stimulate transcription. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Zhang, Xin-Tian; Li, Min; Li, Yao; Pang, Jing; Dong, Stephanie; Strauss-Soukup, Juliane K; Chen, Xian-Ming
2018-05-01
Intestinal infection by Cryptosporidium parvum causes significant alterations in the gene expression profile in host epithelial cells. Previous studies demonstrate that a panel of parasite RNA transcripts of low protein-coding potential are delivered into infected host cells and may modulate host gene transcription. Using in vitro models of human intestinal cryptosporidiosis, we report here that trans-suppression of the cadherin 3 (CDH3) and lysyl oxidase like 4 (LOXL4) genes in human intestinal epithelial cells following C. parvum infection involves host delivery of the Cdg7_FLc_1000 RNA, a C. parvum RNA that has been previously demonstrated to be delivered into the nuclei of infected host cells. Downregulation of CDH3 and LOXL4 genes was detected in host epithelial cells following C. parvum infection or in cells expressing the parasite Cdg7_FLc_1000 RNA. Knockdown of Cdg7_FLc_1000 attenuated the trans-suppression of CDH3 and LOXL4 genes in host cells induced by infection. Interestingly, Cdg7_FLc_1000 was detected to be recruited to the promoter regions of both CDH3 and LOXL4 gene loci in host cells following C. parvum infection. Host delivery of Cdg7_FLc_1000 promoted the PH domain zinc finger protein 1 (PRDM1)-mediated H3K9 methylation associated with trans-suppression in the CDH3 gene locus, but not the LOXL4 gene. Therefore, our data suggest that host delivery of Cdg7_FLc_1000 causes CDH3 trans-suppression in human intestinal epithelial cells following C. parvum infection through PRDM1-mediated H3K9 methylation in the CDH3 gene locus, whereas Cdg7_FLc_1000 induces trans-suppression of the host LOXL4 gene through H3K9/H3K27 methylation-independent mechanisms. Copyright © 2018 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.
The Role of the Left Head of Caudate in Suppressing Irrelevant Words
ERIC Educational Resources Information Center
Ali, Nilufa; Green, David W.; Kherif, Ferath; Devlin, Joseph T.; Price, Cathy J.
2010-01-01
Suppressing irrelevant words is essential to successful speech production and is expected to involve general control mechanisms that reduce interference from task-unrelated processing. To investigate the neural mechanisms that suppress visual word interference, we used fMRI and a Stroop task, using a block design with an event-related analysis.…
Intersystem Interference Reduction for Overlaid HAPS-Terrestrial CDMA System
NASA Astrophysics Data System (ADS)
Huang, Jeng-Ji; Wang, Wei-Ting; Li, Mingfu; Shiung, David; Ferng, Huei-Wen
In this letter, we propose that directional antennas, combined with power management, be incorporated to reduce intersystem interference in a shared band overlaid high altitude platform station (HAPS)-terrestrial code division multiple access (CDMA) system. To eliminate the HAPS to terrestrial interference, the HAPS is accessed only via directional antennas under the proposed scheme. By doing so, the uplink power to the HAPS can accordingly be increased, so that the terrestrial to HAPS interference is also effectively suppressed.
Koguchi, Takashi; Nakajima, Hisao; Koguchi, Hiromi; Wada, Masahiro; Yamamoto, Yuji; Innami, Satoshi; Maekawa, Akio; Tadokoro, Tadahiro
2003-10-01
This study was performed to clarify how dietary fiber (DF) with different viscosities would be associated with dietary RNA metabolism. Male Wistar strain rats, four weeks old, were fed diets containing a 3% (w/w) yeast RNA and a 5% (w/w) viscous DF for five days. Viscosity of DF samples used, in order of strength, were xanthan gum (XG) > guar gum (GG) > locust bean gum (LBG) > karaya gum (KG) > pectin (PE) = arabic gum (AG) > CM-cellulose (CMC) = inulin (IN). The serum uric acid concentration in the viscous DF groups significantly decreased as compared with that in the cellulose (CL) group. The urinary excretions of uric acid and allantoin in the respective groups given AG, GG, IN, KG, PE, and XG were significantly suppressed as compared with those in the CL group. The fecal RNA excretion was markedly increased in the IN, KG, PE, and XG groups in comparison to the CL group. The DF with high viscosity significantly suppressed RNA digestion by RNase A and decreased uptakes of 14C-labeled adenosine and adenosine 5'-monophosphate (5'-AMP) in rat jejunum. The results reveal that the suppressive effect of DF on elevation of serum uric acid concentration induced by dietary RNA in rats is associated with the strength of DF viscosity. The mechanism by which this is accomplished is suggested to be attributed to the inhibitions of digestion for dietary RNA and/or absorption of the hydrolyzed compounds.
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Language-motor interference reflected in MEG beta oscillations.
Klepp, Anne; Niccolai, Valentina; Buccino, Giovanni; Schnitzler, Alfons; Biermann-Ruben, Katja
2015-04-01
The involvement of the brain's motor system in action-related language processing can lead to overt interference with simultaneous action execution. The aim of the current study was to find evidence for this behavioural interference effect and to investigate its neurophysiological correlates using oscillatory MEG analysis. Subjects performed a semantic decision task on single action verbs, describing actions executed with the hands or the feet, and abstract verbs. Right hand button press responses were given for concrete verbs only. Therefore, longer response latencies for hand compared to foot verbs should reflect interference. We found interference effects to depend on verb imageability: overall response latencies for hand verbs did not differ significantly from foot verbs. However, imageability interacted with effector: while response latencies to hand and foot verbs with low imageability were equally fast, those for highly imageable hand verbs were longer than for highly imageable foot verbs. The difference is reflected in motor-related MEG beta band power suppression, which was weaker for highly imageable hand verbs compared with highly imageable foot verbs. This provides a putative neuronal mechanism for language-motor interference where the involvement of cortical hand motor areas in hand verb processing interacts with the typical beta suppression seen before movements. We found that the facilitatory effect of higher imageability on action verb processing time is perturbed when verb and motor response relate to the same body part. Importantly, this effect is accompanied by neurophysiological effects in beta band oscillations. The attenuated power suppression around the time of movement, reflecting decreased cortical excitability, seems to result from motor simulation during action-related language processing. This is in line with embodied cognition theories. Copyright © 2015. Published by Elsevier Inc.
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying
2016-01-01
RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174
Matthews, Lynn T; Ribaudo, Heather B; Kaida, Angela; Bennett, Kara; Musinguzi, Nicholas; Siedner, Mark J; Kabakyenga, Jerome; Hunt, Peter W; Martin, Jeffrey N; Boum, Yap; Haberer, Jessica E; Bangsberg, David R
2016-04-01
HIV-infected women risk sexual and perinatal HIV transmission during conception, pregnancy, childbirth, and breastfeeding. We compared HIV-1 RNA suppression and medication adherence across periconception, pregnancy, and postpartum periods, among women on antiretroviral therapy (ART) in Uganda. We analyzed data from women in a prospective cohort study, aged 18-49 years, enrolled at ART initiation and with ≥1 pregnancy between 2005 and 2011. Participants were seen quarterly. The primary exposure of interest was pregnancy period, including periconception (3 quarters before pregnancy), pregnancy, postpartum (6 months after pregnancy outcome), or nonpregnancy related. Regression models using generalized estimating equations compared the likelihood of HIV-1 RNA ≤400 copies per milliliter, <80% average adherence based on electronic pill caps (medication event monitoring system), and likelihood of 72-hour medication gaps across each period. One hundred eleven women contributed 486 person-years of follow-up. Viral suppression was present at 89% of nonpregnancy, 97% of periconception, 93% of pregnancy, and 89% of postpartum visits, and was more likely during periconception (adjusted odds ratio, 2.15) compared with nonpregnant periods. Average ART adherence was 90% [interquartile range (IQR), 70%-98%], 93% (IQR, 82%-98%), 92% (IQR, 72%-98%), and 88% (IQR, 63%-97%) during nonpregnant, periconception, pregnant, and postpartum periods, respectively. Average adherence <80% was less likely during periconception (adjusted odds ratio, 0.68), and 72-hour gaps per 90 days were less frequent during periconception (adjusted relative risk, 0.72) and more frequent during postpartum (adjusted relative risk, 1.40). Women with pregnancy were virologically suppressed at most visits, with an increased likelihood of suppression and high adherence during periconception follow-up. Increased frequency of 72-hour gaps suggests a need for increased adherence support during postpartum periods.
Majerciak, Vladimir; Lu, Mathew; Li, Xiaofan
2014-01-01
Kaposi sarcoma–associated herpesvirus (KSHV) ORF57 is a multifunctional post-transcriptional regulator essential for viral gene expression during KSHV lytic infection. ORF57 requires interactions with various cellular proteins for its function. Here, we identified serine/arginine-rich splicing factor 3 (SRSF3, formerly known as SRp20) as a cellular cofactor involved in ORF57-mediated splicing of KSHV K8β RNA. In the absence of ORF57, SRSF3 binds to a suboptimal K8β intron and inhibits K8β splicing. Knockdown of SRSF3 promotes K8β splicing, mimicking the effect of ORF57. The N-terminal half of ORF57 binds to the RNA recognition motif of SRSF3, which prevents SRSF3 from associating with the K8β intron RNA and therefore attenuates the suppressive effect of SRSF3 on K8β splicing. ORF57 also promotes splicing of heterologous non-KSHV transcripts that are negatively regulated by SRSF3, indicating that the effect of ORF57 on SRSF3 activity is independent of RNA target. SPEN proteins, previously identified as ORF57-interacting partners, suppress ORF57 splicing activity by displacing ORF57 from SRSF3–RNA complexes. In summary, we have identified modulation of SRSF3 activity as the molecular mechanism by which ORF57 promotes RNA splicing. PMID:25234929
Majerciak, Vladimir; Lu, Mathew; Li, Xiaofan; Zheng, Zhi-Ming
2014-11-01
Kaposi sarcoma-associated herpesvirus (KSHV) ORF57 is a multifunctional post-transcriptional regulator essential for viral gene expression during KSHV lytic infection. ORF57 requires interactions with various cellular proteins for its function. Here, we identified serine/arginine-rich splicing factor 3 (SRSF3, formerly known as SRp20) as a cellular cofactor involved in ORF57-mediated splicing of KSHV K8β RNA. In the absence of ORF57, SRSF3 binds to a suboptimal K8β intron and inhibits K8β splicing. Knockdown of SRSF3 promotes K8β splicing, mimicking the effect of ORF57. The N-terminal half of ORF57 binds to the RNA recognition motif of SRSF3, which prevents SRSF3 from associating with the K8β intron RNA and therefore attenuates the suppressive effect of SRSF3 on K8β splicing. ORF57 also promotes splicing of heterologous non-KSHV transcripts that are negatively regulated by SRSF3, indicating that the effect of ORF57 on SRSF3 activity is independent of RNA target. SPEN proteins, previously identified as ORF57-interacting partners, suppress ORF57 splicing activity by displacing ORF57 from SRSF3-RNA complexes. In summary, we have identified modulation of SRSF3 activity as the molecular mechanism by which ORF57 promotes RNA splicing. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.
Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli
2014-01-01
The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.
Gong, Baolan; Yue, Yan; Wang, Renxiao; Zhang, Yi; Jin, Quanfang; Zhou, Xi
2017-06-01
The epithelial-mesenchymal transition is the key process driving cancer metastasis. MicroRNA-194 inhibits epithelial-mesenchymal transition in several cancers and its downregulation indicates a poor prognosis in human endometrial carcinoma. Self-renewal factor Sox3 induces epithelial-mesenchymal transition at gastrulation and is also involved epithelial-mesenchymal transition in several cancers. We intended to determine the roles of Sox3 in inducing epithelial-mesenchymal transition in endometrial cancer stem cells and the possible role of microRNA-194 in controlling Sox3 expression. Firstly, we found that Sox3 and microRNA-194 expressions were associated with the status of endometrial cancer stem cells in a panel of endometrial carcinoma tissue, the CD133+ cell was higher in tumorsphere than in differentiated cells, and overexpression of microRNA-194 would decrease CD133+ cell expression. Silencing of Sox3 in endometrial cancer stem cell upregulated the epithelial marker E-cadherin, downregulated the mesenchymal marker vimentin, and significantly reduced cell invasion in vitro; overexpression of Sox3 reversed these phenotypes. Furthermore, we discovered that the expression of Sox3 was suppressed by microRNA-194 through direct binding to the Sox3 3'-untranslated region. Ectopic expression of microRNA-194 in endometrial cancer stem cells induced a mesenchymal-epithelial transition by restoring E-cadherin expression, decreasing vimentin expression, and inhibiting cell invasion in vitro. Moreover, overexpression of microRNA-194 inhibited endometrial cancer stem cell invasion or metastasis in vivo by injection of adenovirus microRNA-194. These findings demonstrate the novel mechanism by which Sox3 contributes to endometrial cancer stem cell invasion and suggest that repression of Sox3 by microRNA-194 may have therapeutic potential to suppress endometrial carcinoma metastasis. The cancer stem cell marker, CD133, might be the surface marker of endometrial cancer stem
Zhang, Haiyang; Wang, Yi; Bai, Ming; Wang, Junyi; Zhu, Kegan; Liu, Rui; Ge, Shaohua; Li, JiaLu; Ning, Tao; Deng, Ting; Fan, Qian; Li, Hongli; Sun, Wu; Ying, Guoguang; Ba, Yi
2018-03-01
Exosomes derived from cells have been found to mediate signal transduction between cells and to act as efficient carriers to deliver drugs and small RNA. Hepatocyte growth factor (HGF) is known to promote the growth of both cancer cells and vascular cells, and the HGF-cMET pathway is a potential clinical target. Here, we characterized the inhibitory effect of HGF siRNA on tumor growth and angiogenesis in gastric cancer. In addition, we showed that HGF siRNA packed in exosomes can be transported into cancer cells, where it dramatically downregulates HGF expression. A cell co-culture model was used to show that exosomes loaded with HGF siRNA suppress proliferation and migration of both cancer cells and vascular cells. Moreover, exosomes were able to transfer HGF siRNA in vivo, decreasing the growth rates of tumors and blood vessels. The results of our study demonstrate that exosomes have potential for use in targeted cancer therapy by delivering siRNA. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
The right posterior paravermis and the control of language interference.
Filippi, Roberto; Richardson, Fiona M; Dick, Frederic; Leech, Robert; Green, David W; Thomas, Michael S C; Price, Cathy J
2011-07-20
Auditory and written language in humans' comprehension necessitates attention to the message of interest and suppression of interference from distracting sources. Investigating the brain areas associated with the control of interference is challenging because it is inevitable that activation of the brain regions that control interference co-occurs with activation related to interference per se. To isolate the mechanisms that control verbal interference, we used a combination of structural and functional imaging techniques in Italian and German participants who spoke English as a second language. First, we searched structural MRI images of Italian participants for brain regions in which brain structure correlated with the ability to suppress interference from the unattended dominant language (Italian) while processing heard sentences in their weaker language (English). This revealed an area in the posterior paravermis of the right cerebellum in which gray matter density was higher in individuals who were better at controlling verbal interference. Second, we found functional activation in the same region when our German participants made semantic decisions on written English words in the presence of interference from unrelated words in their dominant language (German). This combination of structural and functional imaging therefore highlights the contribution of the right posterior paravermis to the control of verbal interference. We suggest that the importance of this region for language processing has previously been missed because most fMRI studies limit the field of view to increase sensitivity, with the lower part of the cerebellum being the region most likely to be excluded.
MicroRNA-340 suppresses osteosarcoma tumor growth and metastasis by directly targeting ROCK1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Xin; Wei, Min; Wang, Wei, E-mail: rjwangwei@126.com
2013-08-09
Highlights: •miR-340 is downregulated in OS cell lines and tissues. •miR-340 suppresses OS cell proliferation, migration and invasion. •miR-340 suppresses tumor growth and metastasis of OS cells in nude mice. •ROCK1 is a target gene of miR-340. •ROCK1 is involved in miR-340-induced suppression of OS cell proliferation, migration and invasion. -- Abstract: MicroRNAs (miRNAs) play key roles in cancer development and progression. In the present study, we investigated the role of miR-340 in the progression and metastasis of osteosarcoma (OS). Our results showed that miR-340 was frequently downregulated in OS tumors and cell lines. Overexpression of miR-340 in OS cellmore » lines significantly inhibited cell proliferation, migration, and invasion in vitro, and tumor growth and metastasis in a xenograft mouse model. ROCK1 was identified as a target of miR-340, and ectopic expression of miR-340 downregulated ROCK1 by direct binding to its 3′ untranslated region. siRNA-mediated silencing of ROCK1 phenocopied the effects of miR-340 overexpression, whereas restoration of ROCK1 in miR-340-overexpressing OS cells reversed the suppressive effects of miR-340. Together, these findings indicate that miR-340 acts as a tumor suppressor and its downregulation in tumor tissues may contribute to the progression and metastasis of OS through a mechanism involving ROCK1, suggesting miR-340 as a potential new diagnostic and therapeutic target for the treatment of OS.« less
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.
Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance. PMID:26275304
Suppression of SOX18 by siRNA inhibits cell growth and invasion of breast cancer cells.
Zhang, Jianxiang; Ma, Yanmei; Wang, Shoujun; Chen, Fu; Gu, Yuanting
2016-06-01
Breast cancer is the most common malignancy in women around the world, and its incidence and mortality rates are still rising. An increasing number of studies have reported that SOX18 plays an important role in various cancers. However, the role of SOX18 in breast cancer remains poorly understood. In this study, we aimed to investigate the biological role and potential molecular mechanism of SOX18 in breast cancer. We found that the mRNA and protein expression levels of SOX18 were prevalently and significantly overexpressed in human breast cancer cell lines. Next, we performed loss-of-function experiments by transfection of two breast cancer cell lines, BT-474 and MCF-7, with SOX18 small interfering RNAs (siRNA). Results showed that SOX18 siRNA transfection significantly suppressed mRNA and protein expression of SOX18 in breast cancer cells. Furthermore, knockdown of SOX18 significantly inhibited cell proliferation and invasion, but promoted apoptosis in breast cancer cells. Importantly, several oncogenic proteins, including the Ras homolog gene family member A (RhoA), platelet-derived growth factor B (PDGFB), Insulin-like growth factor 1 receptor (IGF-1R), and matrix metalloproteinase-7 (MMP-7), were markedly decreased by SOX18 siRNA. Taken together, the results of our study suggest that knockdown of SOX18 inhibits breast cancer cell growth and invasion, possibly by downregulating downstream oncogenic proteins, providing novel insights into the development of breast cancer therapy through targeting of SOX18.
Suppression of Biodynamic Interference by Adaptive Filtering
NASA Technical Reports Server (NTRS)
Velger, M.; Merhav, S. J.; Grunwald, A. J.
1984-01-01
Preliminary experimental results obtained in moving base simulator tests are presented. Both for pursuit and compensatory tracking tasks, a strong deterioration in tracking performance due to biodynamic interference is found. The use of adaptive filtering is shown to substantially alleviate these effects, resulting in a markedly improved tracking performance and reduction in task difficulty. The effect of simulator motion and of adaptive filtering on human operator describing functions is investigated. Adaptive filtering is found to substantially increase pilot gain and cross-over frequency, implying a more tight tracking behavior. The adaptive filter is found to be effective in particular for high-gain proportional dynamics, low display forcing function power and for pursuit tracking task configurations.
Wei, Min; Zhang, Yan-Ling; Chen, Lan; Cai, Cui-Xia; Wang, Han-Duo
2016-02-20
To explore the effects of silencing HERC4 on the proliferation, apoptosis, and migration of cervical cancer cell line Hela and the possible molecular mechanisms. Three HERC4-specific small interfering RNAs (siRNAs) were transfected into Hela cells, and HERC4 expression in the cells was examined with Western blotting. CCK-8 assay, annexin V-FITC/PI assay, and wound healing assay were used to assess the effect of HERC4 silencing on the proliferation, apoptosis and migration ability of Hela cells. The expression levels of cyclin D1 and Bcl-2 in the cells were detected using Western blotting. Transfection of siRNA-3 resulted in significantly decreased HERC4 protein expression (P<0.01). HERC4 silencing by siRNA-3 markedly suppressed the proliferation and migration of Hela cells, increased the apoptosis rate (P<0.01) and reduced the expression levels of cyclin D1 and Bcl-2 (P<0.01). Silencing of HERC4 efficiently inhibits the proliferation, migration, and invasion of Hela cells in vitro, and the underlying mechanisms may involve the down-regulation of cyclin D1 and Bcl-2.
Kai, Yoshiro; Tomoda, Koichi; Yoneyama, Hiroyuki; Yoshikawa, Masanori; Kimura, Hiroshi
2015-12-09
Chondroitin sulfate proteoglycans are an important mediators in inflammation and leukocyte trafficking. However, their roles in pulmonary emphysema have not been explored. In a murine model of elastase-induced pulmonary emphysema, we found increased carbohydrate sulfotransferase 3 (CHST3), a specific enzyme that synthesizes chondroitin 6-sulfate proteoglycan (C6SPG). To elucidate the role of C6SPG, we investigated the effect of small interfering RNA (siRNA) targeting CHST3 that inhibits C6SPG-synthesis on the pathogenesis of pulmonary emphysema. Mice were intraperitoneally injected with CHST3 siRNA or negative control siRNA on day0 and 7 after intratracheal instillation of elastase. Histology, respiratory function, glycosaminoglycans (GAGs) content, bronchoalveolar lavage (BAL), elastin staining and gene expressions of tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMP)-9 mRNA were evaluated on day7 and/or day21. CHST3 mRNA increased at day 7 and decreased thereafter in lung. CHST3 siRNA successfully inhibited the expression of CHST3 mRNA throughout the study and this was associated with significant reduction of GAGs and C6SPG. Airway destruction and respiratory function were improved by the treatment with CHST3 siRNA. CHST3 siRNA reduced the number of macrophages both in BAL and lung parenchyma and also suppressed the increased expressions of TNF-α and MMP-9 mRNA. Futhermore, CHST3 siRNA improved the reduction of the elastin in the alveolar walls. CHST3 siRNA diminishes accumulation of excessive macrophages and the mediators, leading to accelerate the functional recovery from airway damage by repair of the elastin network associated with pulmonary emphysema.
Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.
2010-01-01
The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014
Nanavaty, Vishal; Sandhu, Ranjodh; Jehi, Sanaa E; Pandya, Unnati M; Li, Bibo
2017-06-02
Trypanosoma brucei causes human African trypanosomiasis and regularly switches its major surface antigen, VSG, thereby evading the host's immune response. VSGs are monoallelically expressed from subtelomeric expression sites (ESs), and VSG switching exploits subtelomere plasticity. However, subtelomere integrity is essential for T. brucei viability. The telomeric transcript, TERRA, was detected in T. brucei previously. We now show that the active ES-adjacent telomere is transcribed. We find that TbRAP1, a telomere protein essential for VSG silencing, suppresses VSG gene conversion-mediated switching. Importantly, TbRAP1 depletion increases the TERRA level, which appears to result from longer read-through into the telomere downstream of the active ES. Depletion of TbRAP1 also results in more telomeric RNA:DNA hybrids and more double strand breaks (DSBs) at telomeres and subtelomeres. In TbRAP1-depleted cells, expression of excessive TbRNaseH1, which cleaves the RNA strand of the RNA:DNA hybrid, brought telomeric RNA:DNA hybrids, telomeric/subtelomeric DSBs and VSG switching frequency back to WT levels. Therefore, TbRAP1-regulated appropriate levels of TERRA and telomeric RNA:DNA hybrid are fundamental to subtelomere/telomere integrity. Our study revealed for the first time an important role of a long, non-coding RNA in antigenic variation and demonstrated a link between telomeric silencing and subtelomere/telomere integrity through TbRAP1-regulated telomere transcription. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Morphological Modifications in Myofibrils by Suppressing Tropomyosin 4α in Chicken Cardiac Myocytes.
Toyota, Naoji; Fujitsuka, Chiaki; Ishibashi, Goushi; S Yoshida, Lucia; Takano-Ohmuro, Hiromi
2016-01-01
Tropomyosin (TPM) localizes along F-actin and, together with troponin T (TnT) and other components, controls calcium-sensitive muscle contraction. The role of the TPM isoform (TPM4α) that is expressed in embryonic and adult cardiac muscle cells in chicken is poorly understood. To analyze the function of TPM4α in myofibrils, the effects of TPM4α-suppression were examined in embryonic cardiomyocytes by small interference RNA transfection. Localization of myofibril proteins such as TPM, actin, TnT, α-actinin, myosin and connectin was examined by immunofluorescence microscopy on day 5 when almost complete TPM4α-suppression occurred in culture. A unique large structure was detected, consisting of an actin aggregate bulging from the actin bundle, and many curved filaments projecting from the aggregate. TPM, TnT and actin were detected on the large structure, but myosin, connectin, α-actinin and obvious myofibril striations were undetectable. It is possible that TPM4α-suppressed actin filaments are sorted and excluded at the place of the large structure. This suggests that TPM4α-suppression significantly affects actin filament, and that TPM4α plays an important role in constructing and maintaining sarcomeres and myofibrils in cardiac muscle.
Guo, Yanqiong; Wu, Haihua; Zhang, Xueyao; Ma, Enbo; Guo, Yaping; Zhu, Kun Yan; Zhang, Jianzhen
2016-11-01
Many insect cytochrome P450s (CYPs) play critical roles in detoxification of insecticides. The CYP6 family is unique to the class Insecta, and its biochemical function has essentially been associated with the metabolism of xenobiotics. In this study, we sequenced and characterised the full-length cDNAs of five CYP genes from Locusta migratoria, a highly destructive agricultural pest worldwide. The five genes were predominantly expressed in brain, guts, fat bodies or Malpighian tubules. CYP6FE1, CYP6FF1 and CYP6FG1 were expressed at higher levels in fourth-instar nymphs than in other developmental stages. CYPFD2 is specifically expressed in adults, whereas CYP6FD1, CYP6FD2 and CYP6FE1 showed significantly lower expression in eggs than in other developmental stages. Deltamethrin suppressed CYP6FD1 expression in third-instar nymphs and upregulated the expression level of CYP6FD2, CYP6FF1 and CYP6FG1 at the dose of LD 10 . Efficient RNA interference-mediated gene silencing was established for four of the five CYP genes. Silencing of CYP6FF1 increased the nymphal mortality from 23 to 50% in response to deltamethrin. Silencing of CYP6FD2 and CYP6FE1 increased the nymphal mortality from 32 to 72 and 66%, respectively, to carbaryl. Three of the four CYP6F subfamily genes in L. migratoria were associated with the detoxification of deltamethrin or carbaryl. The role of CYPs in insecticide detoxification appears to be both gene and insecticide specific. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Merritt, Ethan A; Arakaki, Tracy L; Gillespie, J Robert; Larson, Eric T; Kelley, Angela; Mueller, Natascha; Napuli, Alberto J; Kim, Jessica; Zhang, Li; Verlinde, Christophe L M J; Fan, Erkang; Zucker, Frank; Buckner, Frederick S; Van Voorhis, Wesley C; Hol, Wim G J
2010-01-01
Crystal structures of histidyl-tRNA synthetase from the eukaryotic parasites Trypanosoma brucei and Trypanosoma cruzi provide a first structural view of a eukaryotic form of this enzyme, and reveal differences from bacterial homologs. Histidyl-tRNA synthetases in general contain an extra domain inserted between conserved motifs 2 and 3 of the Class II aminoacyl-tRNA synthetase catalytic core. The current structures show that the three dimensional topology of this domain is very different in bacterial and archaeal/eukaryotic forms of the enzyme. Comparison of apo and histidine-bound trypanosomal structures indicates substantial active site rearrangement upon histidine binding, but relatively little subsequent rearrangement after reaction of histidine with ATP to form the enzyme’s first reaction product, histidyladenylate. The specific residues involved in forming the binding pocket for the adenine moiety differ substantially both from the previously characterized binding site in bacterial structures and from the homologous residues in human histidyl-tRNA synthetases. The essentiality of the single histidyl-tRNA synthetase gene in T. brucei is shown by a severe depression of parasite growth rate that results from even partial suppression of expression by RNA interference. PMID:20132829
A Comparative Study of Co-Channel Interference Suppression Techniques
NASA Technical Reports Server (NTRS)
Hamkins, Jon; Satorius, Ed; Paparisto, Gent; Polydoros, Andreas
1997-01-01
We describe three methods of combatting co-channel interference (CCI): a cross-coupled phase-locked loop (CCPLL); a phase-tracking circuit (PTC), and joint Viterbi estimation based on the maximum likelihood principle. In the case of co-channel FM-modulated voice signals, the CCPLL and PTC methods typically outperform the maximum likelihood estimators when the modulation parameters are dissimilar. However, as the modulation parameters become identical, joint Viterbi estimation provides for a more robust estimate of the co-channel signals and does not suffer as much from "signal switching" which especially plagues the CCPLL approach. Good performance for the PTC requires both dissimilar modulation parameters and a priori knowledge of the co-channel signal amplitudes. The CCPLL and joint Viterbi estimators, on the other hand, incorporate accurate amplitude estimates. In addition, application of the joint Viterbi algorithm to demodulating co-channel digital (BPSK) signals in a multipath environment is also discussed. It is shown in this case that if the interference is sufficiently small, a single trellis model is most effective in demodulating the co-channel signals.
Multifunctional RNA Nanoparticles
2015-01-01
Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi
Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less
Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe
2018-01-01
Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260
Singh, Ajeet; Permar, Vipin; Jain, R K; Goswami, Suneha; Kumar, Ranjeet Ranjan; Canto, Tomas; Palukaitis, Peter; Praveen, Shelly
2017-08-01
Groundnut bud necrosis virus induces necrotic symptoms in different hosts. Previous studies showed reactive oxygen species-mediated programmed cell death (PCD) resulted in necrotic symptoms. Transgenic expression of viral protein NSs mimics viral symptoms. Here, we showed a role for NSs in influencing oxidative burst in the cell, by analyzing H 2 O 2 accumulation, activities of antioxidant enzymes and expression levels of vacuolar processing enzymes, H 2 O 2 -responsive microRNA 319a.2 plus its possible target metacaspase-8. The role of NSs in PCD, was shown using two NSs mutants: one in the Trp/GH3 motif (a homologue of pro-apototic domain) (NSs S189R ) and the other in a non-Trp/GH3 motif (NSs L172R ). Tobacco rattle virus (TRV) expressing NSs S189R enhanced the PCD response, but not TRV-NSs L172R , while RNA silencing suppression activity was lost in TRV-NSs L172R , but not in TRV-NSs S189R . Therefore, we propose dual roles of NSs in RNA silencing suppression and induction of cell death, controlled by different motifs. Copyright © 2017 Elsevier Inc. All rights reserved.
Sathyanarayanan, Anusha; Chandrasekaran, Karthik Subramanian; Karunagaran, Devarajan
2017-04-01
Previously, it has been reported that microRNA-145 (miR-145) is lowly expressed in human cervical cancers and that its putative tumour suppressive role may be attributed to epithelial-mesenchymal transition (EMT) regulation. Here, we aimed to assess whether miR-145 may affect EMT-associated markers/genes and suppress cervical cancer growth and motility, and to provide a mechanistic basis for these phenomena. The identification of the SMAD-interacting protein 1 (SIP1) mRNA as putative miR-145 target was investigated using a 3' untranslated region (3'UTR) luciferase assay and Western blotting, respectively. The functional effects of exogenous miR-145 expression, miR-145 suppression or siRNA-mediated SIP1 expression down-regulation in cervical cancer-derived C33A and SiHa cells were analysed using Western blotting, BrdU incorporation (proliferation), transwell migration and invasion assays. In addition, the expression levels of miR-145 and SIP1 were determined in primary human cervical cancer and non-cancer tissue samples using qRT-PCR. We found that miR-145 binds to the wild-type 3'UTR of SIP1, but not to its mutant counterpart, and that, through this binding, miR-145 can effectively down-regulate SIP1 expression. In addition, we found that exogenous miR-145 expression or siRNA-mediated down-regulation of SIP1 expression attenuates the proliferation, migration and invasion of C33A and SiHa cells and alters the expression of the EMT-associated markers CDH1, VIM and SNAI1, whereas inhibition of endogenous miR-145 expression elicited the opposite effects. The expression of miR-145 in cervical cancer tissue samples was found to be low, while that of SIP1 was found to be high compared to non-cancerous cervical tissues. An inverse expression correlation between the two was substantiated through the anlaysis of data deposited in the TCGA database. Our data indicate that low miR-145 expression levels in conjunction with elevated SIP1 expression levels may contribute to
RNA Interference Screen to Identify Kinases That Suppress Rescue of ΔF508-CFTR.
Trzcińska-Daneluti, Agata M; Chen, Anthony; Nguyen, Leo; Murchie, Ryan; Jiang, Chong; Moffat, Jason; Pelletier, Lawrence; Rotin, Daniela
2015-06-01
Cystic Fibrosis (CF) is an autosomal recessive disorder caused by mutations in the gene encoding the Cystic fibrosis transmembrane conductance regulator (CFTR). ΔF508-CFTR, the most common disease-causing CF mutant, exhibits folding and trafficking defects and is retained in the endoplasmic reticulum, where it is targeted for proteasomal degradation. To identify signaling pathways involved in ΔF508-CFTR rescue, we screened a library of endoribonuclease-prepared short interfering RNAs (esiRNAs) that target ∼750 different kinases and associated signaling proteins. We identified 20 novel suppressors of ΔF508-CFTR maturation, including the FGFR1. These were subsequently validated by measuring channel activity by the YFP halide-sensitive assay following shRNA-mediated knockdown, immunoblotting for the mature (band C) ΔF508-CFTR and measuring the amount of surface ΔF508-CFTR by ELISA. The role of FGFR signaling on ΔF508-CFTR trafficking was further elucidated by knocking down FGFRs and their downstream signaling proteins: Erk1/2, Akt, PLCγ-1, and FRS2. Interestingly, inhibition of FGFR1 with SU5402 administered to intestinal organoids (mini-guts) generated from the ileum of ΔF508-CFTR homozygous mice resulted in a robust ΔF508-CFTR rescue. Moreover, combination of SU5402 and VX-809 treatments in cells led to an additive enhancement of ΔF508-CFTR rescue, suggesting these compounds operate by different mechanisms. Chaperone array analysis on human bronchial epithelial cells harvested from ΔF508/ΔF508-CFTR transplant patients treated with SU5402 identified altered expression of several chaperones, an effect validated by their overexpression or knockdown experiments. We propose that FGFR signaling regulates specific chaperones that control ΔF508-CFTR maturation, and suggest that FGFRs may serve as important targets for therapeutic intervention for the treatment of CF. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Klocko, Amy L.; Borejsza-Wysocka, Ewa; Brunner, Amy M.; Shevchenko, Olga; Aldwinckle, Herb; Strauss, Steven H.
2016-01-01
We investigated the ability of RNA interference (RNAi) directed against two co-orthologs of AGAMOUS (AG) from Malus domestica (domestic apple, MdAG) to reduce the risks of invasiveness and provide genetic containment of transgenes, while also promoting the attractiveness of flowers for ornamental usage. Suppression of two MdAG-like genes, MdMADS15 and MdMADS22, led to the production of trees with highly showy, polypetalous flowers. These “double-flowers” had strongly reduced expression of both MdAG-like genes. Members of the two other clades within in the MdAG subfamily showed mild to moderate differences in gene expression, or were unchanged, with the level of suppression approximately proportional to the level of sequence identity between the gene analyzed and the RNAi fragment. The double-flowers also exhibited reduced male and female fertility, had few viable pollen grains, a decreased number of stigmas, and produced few viable seeds after cross-pollination. Despite these floral alterations, RNAi-AG trees with double-flowers set full-sized fruit. Suppression or mutation of apple AG-like genes appears to be a promising method for combining genetic containment with improved floral attractiveness. PMID:27500731
Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A
Watanabe, Mariko; Iwakawa, Hiro-oki; Tadakuma, Hisashi
2017-01-01
Abstract Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts’ RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)—the core of the RNA-induced silencing complex (RISC)—in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. PMID:28977639
Cellular microRNA-miR-548g-3p modulates the replication of dengue virus.
Wen, Weitao; He, Zhenjian; Jing, Qinlong; Hu, Yiwen; Lin, Cuiji; Zhou, Rui; Wang, Xiaoqun; Su, Yangfan; Yuan, Jiehao; Chen, Zhenxin; Yuan, Jie; Wu, Jueheng; Li, Jun; Zhu, Xun; Li, Mengfeng
2015-06-01
It has been well recognized that microRNA plays a role in the host-pathogen interaction network. The significance of microRNA in the regulation of dengue virus (DENV) replication, however, remains unknown. The objective of our study was to determine the biological function of miR-548g-3p in modulating the replication of dengue virus. Here we report that employment of a microRNA target search algorithm to analyze the 5' untranslated region (5'UTR) consensus sequences of DENV (DENV serotypes 1-4) led to a discovery that miR-548g-3p directly targets the stem loop A promoter element within the 5'UTR, a region essential for DENV replication. Real-time PCR was used to measure the expression levels of miR-548g-3p under DENV infection. We performed overexpression and inhibition assays to test the role of miR-548g-3p on DENV replication. The protein and mRNA levels of interferon were measured by ELISA and real-time PCR respectively. We found that overexpression of miR-548g-3p suppressed multiplication of DENV 1, 2, 3 and 4, and that miR-548g-3p was also found to interfere with DENV translation, thereby suppressing the expression of viral proteins. Our results suggest that miR-548g-3p directly regulates DENV replication and warrant further study to investigate the feasibility of microRNA-based anti-DENV approaches. Copyright © 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Zhang, Xin-Tian; Li, Min; Dolata, Courtney E; Chen, Xian-Ming
2018-03-01
To counteract host immunity, Cryptosporidium parvum has evolved multiple strategies to suppress host antimicrobial defense. One such strategy is to reduce the production of the antimicrobial peptide beta-defensin 1 (DEFB1) by host epithelial cells but the underlying mechanisms remain unclear. Recent studies demonstrate that a panel of parasite RNA transcripts of low protein-coding potential are delivered into infected host cells and may modulate host gene transcription. Using in vitro models of intestinal cryptosporidiosis, in this study, we analyzed the expression profile of host beta-defensin genes in host cells following infection. We found that C. parvum infection caused a significant downregulation of the DEFB1 gene. Interestingly, downregulation of DEFB1 gene was associated with host delivery of Cdg7_FLc_1000 RNA transcript, a C. parvum RNA that has previously demonstrated to be delivered into the nuclei of infected host cells. Knockdown of Cdg7_FLc_1000 in host cells could attenuate the trans-suppression of host DEFB1 gene and decreased the parasite burden. Therefore, our data suggest that trans-suppression of DEFB1 gene in intestinal epithelial cells following C. parvum infection involves host delivery of parasite Cdg7_FLc_1000 RNA, a process that may be relevant to the epithelial defense evasion by C. parvum at the early stage of infection.
NASA Astrophysics Data System (ADS)
Zhang, Y.; Shi, M.; Sun, J.; Yang, C.; Zhang, Yajuan; Scopesi, F.; Makobore, P.; Chin, C.; Serra, G.; Wickramasinghe, Y. A. B. D.; Rolfe, P.
2015-02-01
Brain activity can be monitored non-invasively by functional near-infrared spectroscopy (fNIRS), which has several advantages in comparison with other methods, such as flexibility, portability, low cost and fewer physical restrictions. However, in practice fNIRS measurements are often contaminated by physiological interference arising from cardiac contraction, breathing and blood pressure fluctuations, thereby severely limiting the utility of the method. Hence, further improvement is necessary to reduce or eliminate such interference in order that the evoked brain activity information can be extracted reliably from fNIRS data. In the present paper, the multi-distance fNIRS probe configuration has been adopted. The short-distance fNIRS measurement is treated as the virtual channel and the long-distance fNIRS measurement is treated as the measurement channel. Independent component analysis (ICA) is employed for the fNIRS recordings to separate the brain signals and the interference. Least-absolute deviation (LAD) estimator is employed to recover the brain activity signals. We also utilized Monte Carlo simulations based on a five-layer model of the adult human head to evaluate our methodology. The results demonstrate that the ICA algorithm has the potential to separate physiological interference in fNIRS data and the LAD estimator could be a useful criterion to recover the brain activity signals.
Peng, Haiying; Zou, Lifang; Xie, Jinyan; Wu, Hong; Wu, Bing; Zhu, Gaochun; Lv, Qiulan; Zhang, Xi; Liu, Shuangmei; Li, Guilin; Xu, Hong; Gao, Yun; Xu, Changshui; Zhang, Chunping; Wang, Shouyu; Xue, Yun; Liang, Shangdong
2017-01-01
Long noncoding RNAs (lncRNAs) participate in physiological and pathophysiological processes. Type 2 diabetes mellitus (T2DM) accounts for more than 90 % of all cases of diabetes mellitus (DM). Diabetic neuropathic pain (DNP) is a common complication of T2DM. The aim of this study was to investigate the effects of lncRNA NONRATT021972 small interference RNA (siRNA) on DNP mediated by the P2X 3 receptor in dorsal root ganglia (DRG). These experiments showed that the expression levels of NONRATT021972 in DRG were increased in the T2DM rat model (intraperitoneal injection of STZ with 30 mg/kg). The concentration of NONRATT021972 in T2DM patient serum was higher compared to control healthy subjects. The mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL) in T2DM rats were lower compared to control rats. MWT and TWL in T2DM rats treated with NONRATT021972 siRNA were higher compared with those in T2DM rats. The expression levels of the P2X 3 protein and messenger RNA (mRNA) of T2DM rat DRG were higher compared to the control, while those in T2DM rats treated with NONRATT021972 siRNA were significantly lower compared to T2DM rats. The level of tumor necrosis factor-α (TNF-α) in the serum of T2DM rats treated with NONRATT021972 siRNA was significantly decreased compared with T2DM rats. NONRATT021972 siRNA inhibited the phosphorylation and activation of ERK1/2 in T2DM DRG. Thus, NONRATT021972 siRNA treatment may suppress the upregulated expression and activation of the P2X 3 receptor and reduce the hyperalgesia potentiated by the pro-inflammatory cytokine TNF-α in T2DM rats.
RNA-protein interactions in plant disease: hackers at the dinner table.
Spanu, Pietro D
2015-09-01
Plants are the source of most of our food, whether directly or as feed for the animals we eat. Our dinner table is a trophic level we share with the microbes that also feed on the primary photosynthetic producers. Microbes that enter into close interactions with plants need to evade or suppress detection and host immunity to access nutrients. They do this by deploying molecular tools - effectors - which target host processes. The mode of action of effector proteins in these events is varied and complex. Recent data from diverse systems indicate that RNA-interacting proteins and RNA itself are delivered by eukaryotic microbes, such as fungi and oomycetes, to host plants and contribute to the establishment of successful interactions. This is evidence that pathogenic microbes can interfere with the host software. We are beginning to see that pathogenic microbes are capable of hacking into the plants' immunity programs. © 2015 The Author. New Phytologist © 2015 New Phytologist Trust.
Chan, H L; Lin, J L; Huang, H H; Wu, C P
1997-09-01
A new technique for interference-term suppression in Wigner-Ville distribution (WVD) is proposed for the signal with 1/f spectrum shape. The spectral characteristic of the signal is altered by f alpha filtering before time-frequency analysis and compensated after analysis. With the utilization of the proposed technique in smoothed pseudo Wigner-Ville distribution, an excellent suppression of interference component can be achieved.
Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.
Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar
2015-01-01
The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.
RNA interference: Applications and advances in insect toxicology and insect pest management.
Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan
2015-05-01
Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.
Kim, Dae Sung; Kim, Nak Hyun; Hwang, Byung Kook
2015-01-01
Plants use a variety of innate immune regulators to trigger cell death and defense responses against pathogen attack. We identified pepper (Capsicum annuum) GLYCINE-RICH RNA-BINDING PROTEIN1 (CaGRP1) as a RECEPTOR-LIKE CYTOPLASMIC PROTEIN KINASE1 (CaPIK1)-interacting partner, based on bimolecular fluorescence complementation and coimmunoprecipitation analyses as well as gene silencing and transient expression analysis. CaGRP1 contains an N-terminal RNA recognition motif and a glycine-rich region at the C-terminus. The CaGRP1 protein had DNA- and RNA-binding activity in vitro. CaGRP1 interacted with CaPIK1 in planta. CaGRP1 and CaGRP1-CaPIK1 complexes were localized to the nucleus in plant cells. CaPIK1 phosphorylated CaGRP1 in vitro and in planta. Transient coexpression of CaGRP1 with CaPIK1 suppressed the CaPIK1-triggered cell death response, accompanied by a reduced CaPIK1-triggered reactive oxygen species (ROS) burst. The RNA recognition motif region of CaGRP1 was responsible for the nuclear localization of CaGRP1 as well as the suppression of the CaPIK1-triggered cell death response. CaGRP1 silencing in pepper conferred enhanced resistance to Xanthomonas campestris pv vesicatoria (Xcv) infection; however, CaPIK1-silenced plants were more susceptible to Xcv. CaGRP1 interacts with CaPIK1 and negatively regulates CaPIK1-triggered cell death and defense responses by suppressing ROS accumulation. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Guoxing; Shi, Hui; Li, Jiong
Aberrant microRNA expression has been shown to be characteristic of many cancers. It has been reported that the expression levels of miR-30e are decreased in liver cancer tissues. However, the role of miR-30e in hepatocellular carcinoma remains poorly understood. In the present study, we investigated the significance of miR-30e in hepatocarcinogenesis. Bioinformatics analysis reveals a putative target site of miR-30e in the 3′-untranslated region (3′UTR) of prolyl 4-hydroxylase subunit alpha-1 (P4HA1) mRNA. Moreover, luciferase reporter gene assays verified that miR-30e directly targeted 3′UTR of P4HA1 mRNA. Then, we demonstrated that miR-30e was able to reduce the expression of P4HA1 atmore » the levels of mRNA and protein using reverse transcription-polymerase chain reaction and Western blot analysis. Enforced expression of miR-30e suppressed proliferation of HepG2 cells by 5-ethynyl-2-deoxyuridine (EdU) assay and reduced colony formation of these cells by colony formation analysis. Conversely, anti-miR-30e enhanced the proliferation of hepatoma cells in vitro. Interestingly, the ectopic expression of P4HA1 could efficiently rescue the inhibition of cell proliferation mediated by miR-30e in HepG2 cells. Meanwhile, silencing of P4HA1 abolished the anti-miR-30e-induced proliferation of cells. Clinically, quantitative real-time PCR showed that miR-30e was down-regulated in liver tumor tissues relative to their peritumor tissues. The expression levels of miR-30e were negatively correlated to those of P4HA1 mRNA in clinical liver tumor tissues. Thus, we conclude that miR-30e suppresses proliferation of hepatoma cells through targeting P4HA1 mRNA. Our finding provides new insights into the mechanism of hepatocarcinogenesis. - Highlights: • P4HA1 is a novel target gene of miR-30e. • P4HA1 is increased in clinical HCC tissues. • MiR-30e is negatively correlated with P4HA1 in clinical HCC tissues. • MiR-30e suppresses the proliferation of HCC cells
Csorba, Tibor; Lózsa, Rita; Hutvágner, György; Burgyán, József
2010-05-01
RNA silencing plays an important role in plants in defence against viruses. To overcome this defence, plant viruses encode suppressors of RNA silencing. The most common mode of silencing suppression is sequestration of double-stranded RNAs involved in the antiviral silencing pathways. Viral suppressors can also overcome silencing responses through protein-protein interaction. The poleroviral P0 silencing suppressor protein targets ARGONAUTE (AGO) proteins for degradation. AGO proteins are the core component of the RNA-induced silencing complex (RISC). We found that P0 does not interfere with the slicer activity of pre-programmed siRNA/miRNA containing AGO1, but prevents de novo formation of siRNA/miRNA containing AGO1. We show that the AGO1 protein is part of a high-molecular-weight complex, suggesting the existence of a multi-protein RISC in plants. We propose that P0 prevents RISC assembly by interacting with one of its protein components, thus inhibiting formation of siRNA/miRNA-RISC, and ultimately leading to AGO1 degradation. Our findings also suggest that siRNAs enhance the stability of co-expressed AGO1 in both the presence and absence of P0.
MiR-506 suppresses liver cancer angiogenesis through targeting sphingosine kinase 1 (SPHK1) mRNA.
Lu, Zhanping; Zhang, Weiying; Gao, Shan; Jiang, Qiulei; Xiao, Zelin; Ye, Lihong; Zhang, Xiaodong
MicroRNAs acting as oncogenes or tumor suppressor genes play crucial roles in human cancers. Sphingosine kinase 1 (SPHK1) and its metabolite sphingosine 1-phosphate (S1P) contribute to tumor angiogenesis. We have reported that the down-regulation of miR-506 targeting YAP mRNA results in the hepatocarcinogenesis. In the present study, we report a novel function of miR-506, which suppresses tumor angiogenesis through targeting SPHK1 mRNA in liver cancer. Bioinformatics analysis showed that miR-506 might target 3'-untranslated region (3'UTR) of SPHK1 mRNA. Then, we validated that by luciferase reporter gene assays. MiR-506 was able to reduce the expression of SPHK1 at the levels of mRNA and protein using reverse transcription-polymerase chain reaction and Western blot analysis in hepatoma HepG2 cells. Functionally, human umbilical vein endothelial cell (HUVEC) tube formation assays demonstrated that the forced miR-506 expression remarkably inhibited the production of S1P in the supernatant of hepatoma cells. The supernatant resulted in the inhibition of tumor angiogenesis. Interestingly, the supernatant with overexpression of SPHK1 could rescue the inhibition of angiogenesis of liver cancer mediated by miR-506. Anti-miR-506 increased the production of S1P in the supernatant of hepatoma cells, but the supernatant with silencing of SPHK1 abolished anti-miR-506-induced acceleration of tumor angiogenesis. Clinically, we observed that the levels of miR-506 were negatively related to those of SPHK1 mRNA in liver cancer tissues. Thus, we conclude that miR-506 depresses the angiogenesis of liver cancer through targeting 3'UTR of SPHK1 mRNA. Our finding provides new insights into the mechanism of tumor angiogenesis. Copyright © 2015 Elsevier Inc. All rights reserved.
Plant RNA Regulatory Network and RNA Granules in Virus Infection.
Mäkinen, Kristiina; Lõhmus, Andres; Pollari, Maija
2017-01-01
Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and their individual
van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel
2004-01-01
Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288
Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.
Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide
2017-10-13
Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang
2014-01-01
Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes.
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui
2017-09-01
At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ye, Ping; Hu, Qichen; Liu, Hedi; Yan, Yun; D'ercole, A Joseph
2010-07-01
By promoting cell proliferation, survival and maturation insulin-like growth factor (IGF)-I is essential to the normal growth and development of the central nervous system. It is clear that IGF-I actions are primarily mediated by the type I IGF receptor (IGF1R), and that phosphoinositide 3 (PI3)-Akt kinases and MAP kinases signal many of IGF-I-IGF1R actions in neural cells, including oligodendrocyte lineage cells. The precise downstream targets of these signaling pathways, however, remain to be defined. We studied oligodendroglial cells to determine whether beta-catenin, a molecule that is a downstream target of glycogen synthase kinase-3beta (GSK3beta) and plays a key role in the Wnt canonical signaling pathway, mediates IGF-I actions. We found that IGF-I increases beta-catenin protein abundance within an hour after IGF-I-induced phosphorylation of Akt and GSK3beta. Inhibiting the PI3-Akt pathway suppressed IGF-I-induced increases in beta-catenin and cyclin D1 mRNA, while suppression of GSK3beta activity simulated IGF-I actions. Knocking-down beta-catenin mRNA by RNA interference suppressed IGF-I-stimulated increases in the abundance of cyclin D1 mRNA, cell proliferation, and cell survival. Our data suggest that beta-catenin is an important downstream molecule in the PI3-Akt-GSK3beta pathway, and as such it mediates IGF-I upregulation of cyclin D1 mRNA and promotion of cell proliferation and survival in oligodendroglial cells. Copyright 2010 Wiley-Liss, Inc.
Syringyl lignin is unaltered by severe sinapyl alcohol dehydrogenase suppression in tobacco.
Barakate, Abdellah; Stephens, Jennifer; Goldie, Alison; Hunter, William N; Marshall, David; Hancock, Robert D; Lapierre, Catherine; Morreel, Kris; Boerjan, Wout; Halpin, Claire
2011-12-01
The manipulation of lignin could, in principle, facilitate efficient biofuel production from plant biomass. Despite intensive study of the lignin pathway, uncertainty exists about the enzyme catalyzing the last step in syringyl (S) monolignol biosynthesis, the reduction of sinapaldehyde to sinapyl alcohol. Traditional schemes of the pathway suggested that both guaiacyl (G) and S monolignols are produced by a single substrate-versatile enzyme, cinnamyl alcohol dehydrogenase (CAD). This was challenged by the discovery of a novel sinapyl alcohol dehydrogenase (SAD) that preferentially uses sinapaldehyde as a substrate and that was claimed to regulate S lignin biosynthesis in angiosperms. Consequently, most pathway schemes now show SAD (or SAD and CAD) at the sinapaldehyde reduction step, although functional evidence is lacking. We cloned SAD from tobacco (Nicotiana tabacum) and suppressed it in transgenic plants using RNA interference-inducing vectors. Characterization of lignin in the woody stems shows no change to content, composition, or structure, and S lignin is normal. By contrast, plants additionally suppressed in CAD have changes to lignin structure and S:G ratio and have increased sinapaldehyde in lignin, similar to plants suppressed in CAD alone. These data demonstrate that CAD, not SAD, is the enzyme responsible for S lignin biosynthesis in woody angiosperm xylem.
Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.
2014-01-01
RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428
Splice isoform-specific suppression of the Cav2.1 variant underlying spinocerebellar ataxia type 6.
Tsou, Wei-Ling; Soong, Bing-Wen; Paulson, Henry L; Rodríguez-Lebrón, Edgardo
2011-09-01
Spinocerebellar ataxia type 6 (SCA6) is an inherited neurodegenerative disease caused by a polyglutamine (polyQ) expansion in the Ca(V)2.1 voltage-gated calcium channel subunit (CACNA1A). There is currently no treatment for this debilitating disorder and thus a pressing need to develop preventative therapies. RNA interference (RNAi) has proven effective at halting disease progression in several models of spinocerebellar ataxia (SCA), including SCA types 1 and 3. However, in SCA6 and other dominantly inherited neurodegenerative disorders, RNAi-based strategies that selectively suppress expression of mutant alleles may be required. Using a Ca(V)2.1 mini-gene reporter system, we found that pathogenic CAG expansions in Ca(V)2.1 enhance splicing activity at the 3'end of the transcript, leading to a CAG repeat length-dependent increase in the levels of a polyQ-encoding Ca(V)2.1 mRNA splice isoform and the resultant disease protein. Taking advantage of this molecular phenomenon, we developed a novel splice isoform-specific (SIS)-RNAi strategy that selectively targets the polyQ-encoding Ca(V)2.1 splice variant. Selective suppression of transiently expressed and endogenous polyQ-encoding Ca(V)2.1 splice variants was achieved in a variety of cell-based models including a human neuronal cell line, using a new artificial miRNA-like delivery system. Moreover, the efficacy of gene silencing correlated with effective intracellular recognition and processing of SIS-RNAi miRNA mimics. These results lend support to the preclinical development of SIS-RNAi as a potential therapy for SCA6 and other dominantly inherited diseases. Copyright © 2011 Elsevier Inc. All rights reserved.
Solana, Jordi; Kao, Damian; Mihaylova, Yuliana; Jaber-Hijazi, Farah; Malla, Sunir; Wilson, Ray; Aboobaker, Aziz
2012-01-01
Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology.
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Lee, Jee Hoon; Kim, Hyunmi; Woo, Joo Hong; Joe, Eun-hye; Jou, Ilo
2012-02-18
The peroxisome proliferator-activated receptor (PPAR)-α activator, 5,8,11,14-eicosatetraynoic acid (ETYA), is an arachidonic acid analog. It is reported to inhibit up-regulation of pro-inflammatory genes; however, its underlying mechanism of action is largely unknown. In the present study, we focused on the inhibitory action of ETYA on the expression of the chemokine, CCL2/MCP-1, which plays a key role in the initiation and progression of inflammation. To determine the effect of ETYA, primary cultured rat astrocytes and microglia were stimulated with IFN-γ in the presence of ETYA and then, expression of CCL2/MCP-1 and MAPK phosphatase (MKP-1) were determined using RT-PCR and ELISA. MKP-1 mRNA stability was evaluated by treating actinomycin D. The effect of MKP-1 and human antigen R (HuR) was analyzed by using specific siRNA transfection system. The localization of HuR was analyzed by immunocytochemistry and subcellular fractionation experiment. We found that ETYA suppressed CCL2/MCP-1 transcription and secretion of CCL2/MCP-1 protein through up-regulation of MKP-1mRNA levels, resulting in suppression of c-Jun N-terminal kinase (JNK) phosphorylation and activator protein 1 (AP1) activity in IFN-γ-stimulated brain glial cells. Moreover, these effects of ETYA were independent of PPAR-α. Experiments using actinomycin D revealed that the ETYA-induced increase in MKP-1 mRNA levels reflected an increase in transcript stability. Knockdown experiments using small interfering RNA demonstrated that this increase in MKP-1 mRNA stability depended on HuR, an RNA-binding protein known to promote enhanced mRNA stability. Furthermore, ETYA-induced, HuR-mediated mRNA stabilization resulted from HuR-MKP-1 nucleocytoplasmic translocation, which served to protect MKP-1 mRNA from the mRNA degradation machinery. ETYA induces MKP-1 through HuR at the post-transcriptional level in a receptor-independent manner. The mechanism revealed here suggests eicosanoids as potential therapeutic
Qiu, Zhicheng R; Schwer, Beate; Shuman, Stewart
2015-04-24
The trimethylguanosine (TMG) caps of small nuclear (sn) RNAs are synthesized by the enzyme Tgs1 via sequential methyl additions to the N2 atom of the m(7)G cap. Whereas TMG caps are inessential for Saccharomyces cerevisiae vegetative growth at 25° to 37°, tgs1∆ cells that lack TMG caps fail to thrive at 18°. The cold-sensitive defect correlates with ectopic stoichiometric association of nuclear cap-binding complex (CBC) with the residual m(7)G cap of the U1 snRNA and is suppressed fully by Cbc2 mutations that weaken cap binding. Here, we show that normal growth of tgs1∆ cells at 18° is also restored by a C-terminal deletion of 77 amino acids from the Snp1 subunit of yeast U1 snRNP. These results underscore the U1 snRNP as a focal point for TMG cap function in vivo. Casting a broader net, we conducted a dosage suppressor screen for genes that allowed survival of tgs1∆ cells at 18°. We thereby recovered RPO26 (encoding a shared subunit of all three nuclear RNA polymerases) and RPO31 (encoding the largest subunit of RNA polymerase III) as moderate and weak suppressors of tgs1∆ cold sensitivity, respectively. A structure-guided mutagenesis of Rpo26, using rpo26∆ complementation and tgs1∆ suppression as activity readouts, defined Rpo26-(78-155) as a minimized functional domain. Alanine scanning identified Glu89, Glu124, Arg135, and Arg136 as essential for rpo26∆ complementation. The E124A and R135A alleles retained tgs1∆ suppressor activity, thereby establishing a separation-of-function. These results illuminate the structure activity profile of an essential RNA polymerase component. Copyright © 2015 Qiu et al.
Antisense transcriptional interference mediates condition-specific gene repression in budding yeast.
Nevers, Alicia; Doyen, Antonia; Malabat, Christophe; Néron, Bertrand; Kergrohen, Thomas; Jacquier, Alain; Badis, Gwenael
2018-05-18
Pervasive transcription generates many unstable non-coding transcripts in budding yeast. The transcription of such noncoding RNAs, in particular antisense RNAs (asRNAs), has been shown in a few examples to repress the expression of the associated mRNAs. Yet, such mechanism is not known to commonly contribute to the regulation of a given class of genes. Using a mutant context that stabilized pervasive transcripts, we observed that the least expressed mRNAs during the exponential phase were associated with high levels of asRNAs. These asRNAs also overlapped their corresponding gene promoters with a much higher frequency than average. Interrupting antisense transcription of a subset of genes corresponding to quiescence-enriched mRNAs restored their expression. The underlying mechanism acts in cis and involves several chromatin modifiers. Our results convey that transcription interference represses up to 30% of the 590 least expressed genes, which includes 163 genes with quiescence-enriched mRNAs. We also found that pervasive transcripts constitute a higher fraction of the transcriptome in quiescence relative to the exponential phase, consistent with gene expression itself playing an important role to suppress pervasive transcription. Accordingly, the HIS1 asRNA, normally only present in quiescence, is expressed in exponential phase upon HIS1 mRNA transcription interruption.
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound
McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
SIRT1 suppresses adipogenesis by activating Wnt/β-catenin signaling in vivo and in vitro
Zhou, Yuanfei; Song, Tongxing; Peng, Jie; Zhou, Zheng; Wei, Hongkui; Zhou, Rui; Jiang, Siwen; Peng, Jian
2016-01-01
Sirtuin 1 (SIRT1) regulates adipocyte and osteoblast differentiation. However, the underlying mechanism should be investigated. This study revealed that SIRT1 acts as a crucial repressor of adipogenesis. RNA-interference-mediated SIRT1 knockdown or genetic ablation enhances adipogenic potential, whereas SIRT1 overexpression inhibits adipogenesis in mesenchymal stem cells (MSCs). SIRT1 also deacetylates the histones of sFRP1, sFRP2, and Dact1 promoters; inhibits the mRNA expression of sFRP1, sFRP2, and Dact1; activates Wnt signaling pathways; and suppresses adipogenesis. SIRT1 deacetylates β-catenin to promote its accumulation in the nucleus and thus induces the transcription of genes that block MSC adipogenesis. In mice, the partial absence of SIRT1 promotes the formation of white adipose tissues without affecting the development of the body of mice. Our study described the regulatory role of SIRT1 in Wnt signaling and proposed a regulatory mechanism of adipogenesis. PMID:27776347
Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy
2011-02-01
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.
CCD filter and transform techniques for interference excision
NASA Technical Reports Server (NTRS)
Borsuk, G. M.; Dewitt, R. N.
1976-01-01
The theoretical and some experimental results of a study aimed at applying CCD filter and transform techniques to the problem of interference excision within communications channels were presented. Adaptive noise (interference) suppression was achieved by the modification of received signals such that they were orthogonal to the recently measured noise field. CCD techniques were examined to develop real-time noise excision processing. They were recursive filters, circulating filter banks, transversal filter banks, an optical implementation of the chirp Z transform, and a CCD analog FFT.
Fang, Wei; Fan, Yibin; Fa, Zhenzong; Xu, Jinhua; Yu, Hongyu; Li, Pu; Gu, Julin
2017-02-21
Dysregulated microRNA (miR)-625 expression has been observed in several kinds of cancer. MicroRNAs are important factors in the development and progression of malignant melanoma, though the clinical significance and function of miR-625 in human malignant melanoma remain unclear. Levels of miR-625 expression were therefore determined in 36 pairs of malignant melanoma and adjacent non-tumor tissue using qPCR. The effects of miR-625 dysregulation on malignant melanoma cell proliferation, wound healing, migration and invasion in vitro and tumorigenicity in vivo were investigated using CCK-8, transwell assays, and a nude mouse subcutaneous tumor model. Bioinformatics analysis and luciferase reporter system were used to predict and confirm the target gene of miR-625. miR-625 levels were frequently decreased in malignant melanoma. Ectopic expression of miR-625 suppressed proliferation, wound healing, migration, and tumorgenicity in malignant melanoma. Moreover, miR-625 acted, at least in part, by suppressing potential target SOX2. These results show that miR-625 is a tumor suppressor that inhibits the development and progression of malignant melanoma, which suggests miR-625 is potentially a new diagnostic marker and therapeutic target of malignant melanoma.
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
SUMOylation of TARBP2 regulates miRNA/siRNA efficiency
Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu
2015-01-01
Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366
Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan
2015-01-01
Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
Mittasch, Juliane; Böttcher, Christoph; Frolov, Andrej; Strack, Dieter; Milkowski, Carsten
2013-04-01
As a result of the phenylpropanoid pathway, many Brassicaceae produce considerable amounts of soluble hydroxycinnamate conjugates, mainly sinapate esters. From oilseed rape (Brassica napus), we cloned two orthologs of the Arabidopsis (Arabidopsis thaliana) gene reduced epidermal fluorescence1 (REF1) encoding a coniferaldehyde/sinapaldehyde dehydrogenase. The enzyme is involved in the formation of ferulate and sinapate from the corresponding aldehydes, thereby linking lignin and hydroxycinnamate biosynthesis as a potential branch-point enzyme. We used RNA interference to silence REF1 genes in seeds of oilseed rape. Nontargeted metabolite profiling showed that BnREF1-suppressing seeds produced a novel chemotype characterized by reduced levels of sinapate esters, the appearance of conjugated monolignols, dilignols, and trilignols, altered accumulation patterns of kaempferol glycosides, and changes in minor conjugates of caffeate, ferulate, and 5-hydroxyferulate. BnREF1 suppression affected the level of minor sinapate conjugates more severely than that of the major component sinapine. Mapping of the changed metabolites onto the phenylpropanoid metabolic network revealed partial redirection of metabolic sequences as a major impact of BnREF1 suppression.
Borisenko, A S; Kotus, E V; Kaloshin, A A
2008-01-01
Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.
Qu, Rongfeng; Sun, Yan; Li, Yarong; Hu, Chunmei; Shi, Guang; Tang, Yan; Guo, Dongrui
2017-01-01
Incidence of nasopharyngeal carcinoma (NPC) has remained high worldwide, posing a serious health problem. MicroRNAs (miRNAs) are a family of about 20-23 nucleotides small non-coding molecules, which play a significant role in NPC. In this study, we explored the molecular mechanisms of miR-130a-3p in inhibiting viability, proliferation, migration and invasion of NPC cells by suppressing CXCL12 . The relative expression of miR-130a-3p and CXCL12 mRNA expression in tissues and cells was measured by qRT-PCR. NPC cell line CNE-2Z was transfected with miR-130a-3p mimics, CXCL12 siRNA, cDNA- CXCL12 and negative control. Western Blot was performed to detect CXCL12 expression. The MTT assay was performed to study cell viability. The colony formation assay was done to test cell growth. Flow cytometry was conducted to analyze cell cycle and apoptosis. The Transwell assay was used to investigate cell migration and invasion. The results found that the up-regulation of miR-130a-3p or down-regulation of CXCL12 could inhibit viability, proliferation, migration and invasion of CNE-2Z cells. Luciferase-reporting system assay was performed to investigate miR-130a-3p could bind to the 3'UTR region of CXCL12 and the overexpression of miR-130a-3p could suppress CXCL12 expression. Collectively, our finding suggested demonstrated that miR-130a-3p could prohibit the progression of NPC by suppressing CXCL12 , which might serve as potential therapeutic targets for NPC.
Hwang, Su Jin; Lee, Hye Won; Kim, Hye Ree; Song, Hye Jin; Lee, Dong Heon; Lee, Hong; Shin, Chang Hoon; Joung, Je-Gun; Kim, Duk-Hwan; Joo, Kyeung Min; Kim, Hyeon Ho
2015-08-21
Despite great efforts to improve survival rates, the prognosis of lung cancer patients is still very poor, mainly due to high invasiveness. We developed brain metastatic PC14PE6/LvBr4 cells through intracardiac injection of lung adenocarcinoma PC14PE6 cells. Western blot and RT-qPCR analyses revealed that PC14PE6/LvBr4 cells had mesenchymal characteristics and higher invasiveness than PC14PE6 cells. We found that cyclin D1 was upregulated, miR-95-3p was inversely downregulated, and pri-miR-95 and its host gene, ABLIM2, were consistently decreased in PC14PE6/LvBr4 cells. MiR-95-3p suppressed cyclin D1 expression through direct binding to the 3' UTR of cyclin D1 mRNA and suppressed invasiveness, proliferation, and clonogenicity of PC14PE6/LvBr4 cells. Ectopic cyclin D1 reversed miR-95-3p-mediated inhibition of invasiveness and clonogenicity, demonstrating cyclin D1 downregulation is involved in function of miR-95-3p. Using bioluminescence imaging, we found that miR-95-3p suppressed orthotopic tumorigenicity and brain metastasis in vivo and increased overall survival and brain metastasis-free survival. Consistent with in vitro metastatic cells, the levels of miR-95-3p, pri-miR-95, and ABLIM2 mRNA were decreased in brain metastatic tissues compared with lung cancer tissues and higher cyclin D1 expression was involved in poor prognosis. Taken together, our results demonstrate that miR-95-3p is a potential therapeutic target for brain metastasis of lung adenocarcinoma cells.
He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi
2009-02-01
The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight
Li, Feng; Wang, Feiran; Zhu, Changlai; Wei, Qun; Zhang, Tianyi; Zhou, You Lang
2018-01-01
MicroRNA-221(miR-221) is frequently dysregulated in cancer. The purpose of this study was to explore whether miR-221 can be used as a potential diagnostic marker or therapeutic target for hepatocellular carcinoma (HCC). In this study, we investigated whether miR-221 expression was associated with clini-copathological characteristics and prognosis in HCC patients, and we developed a nanoparticle-based miRNA delivery system and detected its therapeutic efficacy in vitro and in vivo. We found that miR-221 was upregulated in HCC tissues, cell lines and blood of HCC patients. Upregulated miR-221 was associated with clinical TNM stage and tumor capsular infiltration, and showed poor prognosis, suggesting that its suppression could serve as an effective approach for hepatocellular carcinoma therapy. Treatment of HCC cells with nanoparticle/miR-221 inhibitor complexes suppressed their growth, colony formation ability, migration and invasion. In vivo, the growth of the tumors treated by the nanoparticle/miR-221 inhibitor complexes were significantly less than those treated by the nanoparticle/miRNA scramble complexes. In addition, circulating miR-221 may act as a potential tumor biomarker for early diagnosis of HCC, and combined serum miR-221 and AFP detection gave a better performance than individual detection in early diagnosis of HCC. These findings suggest that a nanoparticle-based miRNA delivery system could potentially serve as a safe and effective treatment and miR-221 could also be a potential diagnostic marker for HCC.
Pérez-Cañamás, Miryam; Hernández, Carmen
2018-05-21
Despite replication of plus strand RNA viruses takes place in the cytoplasm of host cells, different proteins encoded by these infectious agents have been shown to localize in the nucleus, with high accumulation at the nucleolus. In most cases, the molecular determinants and/or biological significance of such subcellular localization remain elusive. Recently, we reported that protein p37 encoded by Pelargonium line pattern virus (family Tombusviridae) acts in both RNA packaging and RNA silencing suppression. Connsistently with these functions, p37 was detected in the cytoplasm of plant cells though it was also present in the nucleus and, particularly, in the nucleolus. Here, we have aimed to gain further insights into factors influencing p37 nucleolar localization and into its potential relevance for viral infection. Besides mapping the protein region containing the nucleolar localization signal, we have found that p37 interacts with distinct members of the importin alpha family -main cellular transporters for nucleo-cytoplasmic traffic of proteins-, and that these interactions are crucial for nucleolar targeting of p37. Impairment of p37 nucleolar localization through down-regulation of importin alpha expression resulted in a reduction of viral accumulation, suggesting that sorting of the protein to the major subnuclear compartment is advantageous for the infection process.
Perceptual Load-Dependent Neural Correlates of Distractor Interference Inhibition
Xu, Jiansong; Monterosso, John; Kober, Hedy; Balodis, Iris M.; Potenza, Marc N.
2011-01-01
Background The load theory of selective attention hypothesizes that distractor interference is suppressed after perceptual processing (i.e., in the later stage of central processing) at low perceptual load of the central task, but in the early stage of perceptual processing at high perceptual load. Consistently, studies on the neural correlates of attention have found a smaller distractor-related activation in the sensory cortex at high relative to low perceptual load. However, it is not clear whether the distractor-related activation in brain regions linked to later stages of central processing (e.g., in the frontostriatal circuits) is also smaller at high rather than low perceptual load, as might be predicted based on the load theory. Methodology/Principal Findings We studied 24 healthy participants using functional magnetic resonance imaging (fMRI) during a visual target identification task with two perceptual loads (low vs. high). Participants showed distractor-related increases in activation in the midbrain, striatum, occipital and medial and lateral prefrontal cortices at low load, but distractor-related decreases in activation in the midbrain ventral tegmental area and substantia nigra (VTA/SN), striatum, thalamus, and extensive sensory cortices at high load. Conclusions Multiple levels of central processing involving midbrain and frontostriatal circuits participate in suppressing distractor interference at either low or high perceptual load. For suppressing distractor interference, the processing of sensory inputs in both early and late stages of central processing are enhanced at low load but inhibited at high load. PMID:21267080
Perceptual load-dependent neural correlates of distractor interference inhibition.
Xu, Jiansong; Monterosso, John; Kober, Hedy; Balodis, Iris M; Potenza, Marc N
2011-01-18
The load theory of selective attention hypothesizes that distractor interference is suppressed after perceptual processing (i.e., in the later stage of central processing) at low perceptual load of the central task, but in the early stage of perceptual processing at high perceptual load. Consistently, studies on the neural correlates of attention have found a smaller distractor-related activation in the sensory cortex at high relative to low perceptual load. However, it is not clear whether the distractor-related activation in brain regions linked to later stages of central processing (e.g., in the frontostriatal circuits) is also smaller at high rather than low perceptual load, as might be predicted based on the load theory. We studied 24 healthy participants using functional magnetic resonance imaging (fMRI) during a visual target identification task with two perceptual loads (low vs. high). Participants showed distractor-related increases in activation in the midbrain, striatum, occipital and medial and lateral prefrontal cortices at low load, but distractor-related decreases in activation in the midbrain ventral tegmental area and substantia nigra (VTA/SN), striatum, thalamus, and extensive sensory cortices at high load. Multiple levels of central processing involving midbrain and frontostriatal circuits participate in suppressing distractor interference at either low or high perceptual load. For suppressing distractor interference, the processing of sensory inputs in both early and late stages of central processing are enhanced at low load but inhibited at high load.
Splice isoform-specific suppression of the CaV2.1 variant underlying Spinocerebellar ataxia type 6
Tsou, Wei-Ling; Soong, Bing-Wen; Paulson, Henry L.; Rodríguez-Lebrón, Edgardo
2011-01-01
Spinocerebellar ataxia type 6 (SCA6) is an inherited neurodegenerative disease caused by a polyglutamine (polyQ) expansion in the CaV2.1 voltage-gated calcium channel subunit (CACNA1A). There is currently no treatment for this debilitating disorder and thus a pressing need to develop preventative therapies. RNA interference (RNAi) has proven effective at halting disease progression in several models of spinocerebellar ataxia (SCA), including SCA types 1 and 3. However, in SCA6 and other dominantly inherited neurodegenerative disorders, RNAi-based strategies that selectively suppress expression of mutant alleles may be required. Using a CaV2.1 mini-gene reporter system, we found that pathogenic CAG expansions in CaV2.1 enhance splicing activity at the 3′end of the transcript, leading to a CAG repeat length-dependent increase in the levels of a polyQ-encoding CaV2.1 mRNA splice isoform and the resultant disease protein. Taking advantage of this molecular phenomenon, we developed a novel splice isoform-specific (SIS)-RNAi strategy that selectively targets the polyQ-encoding CaV2.1 splice variant. Selective suppression of transiently expressed and endogenous polyQ-encoding CaV2.1 splice variants was achieved in a variety of cell-based models including a human neuronal cell line, using a new artificial miRNA-like delivery system. Moreover, the efficacy of gene silencing correlated with effective intracellular recognition and processing of SIS-RNAi miRNA mimics. These results lend support to the preclinical development of SIS-RNAi as a potential therapy for SCA6 and other dominantly inherited diseases. PMID:21550405
High-Throughput RNA Interference Screening: Tricks of the Trade
Nebane, N. Miranda; Coric, Tatjana; Whig, Kanupriya; McKellip, Sara; Woods, LaKeisha; Sosa, Melinda; Sheppard, Russell; Rasmussen, Lynn; Bjornsti, Mary-Ann; White, E. Lucile
2016-01-01
The process of validating an assay for high-throughput screening (HTS) involves identifying sources of variability and developing procedures that minimize the variability at each step in the protocol. The goal is to produce a robust and reproducible assay with good metrics. In all good cell-based assays, this means coefficient of variation (CV) values of less than 10% and a signal window of fivefold or greater. HTS assays are usually evaluated using Z′ factor, which incorporates both standard deviation and signal window. A Z′ factor value of 0.5 or higher is acceptable for HTS. We used a standard HTS validation procedure in developing small interfering RNA (siRNA) screening technology at the HTS center at Southern Research. Initially, our assay performance was similar to published screens, with CV values greater than 10% and Z′ factor values of 0.51 ± 0.16 (average ± standard deviation). After optimizing the siRNA assay, we got CV values averaging 7.2% and a robust Z′ factor value of 0.78 ± 0.06 (average ± standard deviation). We present an overview of the problems encountered in developing this whole-genome siRNA screening program at Southern Research and how equipment optimization led to improved data quality. PMID:23616418
Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K
1999-01-01
We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070
Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu
2005-07-20
Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.
Mittasch, Juliane; Böttcher, Christoph; Frolov, Andrej; Strack, Dieter; Milkowski, Carsten
2013-01-01
As a result of the phenylpropanoid pathway, many Brassicaceae produce considerable amounts of soluble hydroxycinnamate conjugates, mainly sinapate esters. From oilseed rape (Brassica napus), we cloned two orthologs of the Arabidopsis (Arabidopsis thaliana) gene REDUCED EPIDERMAL FLUORESCENCE1 (REF1) encoding a coniferaldehyde/sinapaldehyde dehydrogenase. The enzyme is involved in the formation of ferulate and sinapate from the corresponding aldehydes, thereby linking lignin and hydroxycinnamate biosynthesis as a potential branch-point enzyme. We used RNA interference to silence REF1 genes in seeds of oilseed rape. Nontargeted metabolite profiling showed that BnREF1-suppressing seeds produced a novel chemotype characterized by reduced levels of sinapate esters, the appearance of conjugated monolignols, dilignols, and trilignols, altered accumulation patterns of kaempferol glycosides, and changes in minor conjugates of caffeate, ferulate, and 5-hydroxyferulate. BnREF1 suppression affected the level of minor sinapate conjugates more severely than that of the major component sinapine. Mapping of the changed metabolites onto the phenylpropanoid metabolic network revealed partial redirection of metabolic sequences as a major impact of BnREF1 suppression. PMID:23424250
Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José
2017-12-01
Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.
The N Terminus of Andes Virus L Protein Suppresses mRNA and Protein Expression in Mammalian Cells
Heinemann, Patrick; Schmidt-Chanasit, Jonas
2013-01-01
Little is known about the structure and function of the 250-kDa L protein of hantaviruses, although it plays a central role in virus genome transcription and replication. When attempting to study Andes virus (ANDV) L protein in mammalian cells, we encountered difficulties. Even in a strong overexpression system, ANDV L protein could not be detected by immunoblotting. Deletion analysis revealed that the 534 N-terminal amino acid residues determine the low-expression phenotype. Inhibition of translation due to RNA secondary structures around the start codon, rapid proteasomal degradation, and reduced half-life time were excluded. However, ANDV L protein expression could be rescued upon mutation of the catalytic PD-E-K motif and further conserved residues of the putative endonuclease at the N terminus of the protein. In addition, wild-type ANDV L rather than expressible L mutants suppressed the level of L mRNA, as well as reporter mRNAs. Wild-type L protein also reduced the synthesis of cellular proteins in the high-molecular-weight range. Using expressible ANDV L mutants as a tool for localization studies, we show that L protein colocalizes with ANDV N and NSs but not Gc protein. A fraction of L protein also colocalized with the cellular processing (P) body component DCP1a. Overall, these data suggest that ANDV L protein possesses a highly active endonuclease at the N terminus suppressing the level of its own as well as heterologous mRNAs upon recombinant expression in mammalian cells. PMID:23576516
Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo
2017-04-01
RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role
Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G
2010-04-01
Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for
MicroRNA-320a suppresses human colon cancer cell proliferation by directly targeting {beta}-catenin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Jian-Yong; State Key Laboratory of Cancer Biology, Xijing Hospital of Digestive Diseases, Fourth Military Medical University, 710032 Xi'an; Huang, Yi
2012-04-20
Highlights: Black-Right-Pointing-Pointer miR-320a is downregulated in human colorectal carcinoma. Black-Right-Pointing-Pointer Overexpression of miR-320a inhibits colon cancer cell proliferation. Black-Right-Pointing-Pointer {beta}-Catenin is a direct target of miR-320a in colon cancer cells. Black-Right-Pointing-Pointer miR-320a expression inversely correlates with mRNA expression of {beta}-catenin's target genes in human colon carcinoma. -- Abstract: Recent profile studies of microRNA (miRNA) expression have documented a deregulation of miRNA (miR-320a) in human colorectal carcinoma. However, its expression pattern and underlying mechanisms in the development and progression of colorectal carcinoma has not been elucidated clearly. Here, we performed real-time PCR to examine the expression levels of miR-320a in colonmore » cancer cell lines and tumor tissues. And then, we investigated its biological functions in colon cancer cells by a gain of functional strategy. Further more, by the combinational approaches of bioinformatics and experimental validation, we confirmed target associations of miR-320a in colorectal carcinoma. Our results showed that miR-320a was frequently downregulated in cancer cell lines and colon cancer tissues. And we demonstrated that miR-320a restoration inhibited colon cancer cell proliferation and {beta}-catenin, a functionally oncogenic molecule was a direct target gene of miR-320a. Finally, the data of real-time PCR showed the reciprocal relationship between miR-320a and {beta}-catenin's downstream genes in colon cancer tissues. These findings indicate that miR-320a suppresses the growth of colon cancer cells by directly targeting {beta}-catenin, suggesting its application in prognosis prediction and cancer treatment.« less
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
Gupta, Adarsh K; Hein, Gary L; Graybosch, Robert A; Tatineni, Satyanarayana
2018-05-01
High Plains wheat mosaic virus (HPWMoV, genus Emaravirus; family Fimoviridae), transmitted by the wheat curl mite (Aceria tosichella Keifer), harbors a monocistronic octapartite single-stranded negative-sense RNA genome. In this study, putative proteins encoded by HPWMoV genomic RNAs 2-8 were screened for potential RNA silencing suppression activity by using a green fluorescent protein-based reporter agroinfiltration assay. We found that proteins encoded by RNAs 7 (P7) and 8 (P8) suppressed silencing induced by single- or double-stranded RNAs and efficiently suppressed the transitive pathway of RNA silencing. Additionally, a Wheat streak mosaic virus (WSMV, genus Tritimovirus; family Potyviridae) mutant lacking the suppressor of RNA silencing (ΔP1) but having either P7 or P8 from HPWMoV restored cell-to-cell and long-distance movement in wheat, thus indicating that P7 or P8 rescued silencing suppressor-deficient WSMV. Furthermore, HPWMoV P7 and P8 substantially enhanced the pathogenicity of Potato virus X in Nicotiana benthamiana. Collectively, these data demonstrate that the octapartite genome of HPWMoV encodes two suppressors of RNA silencing. Published by Elsevier Inc.
Shu, Dan; Li, Hui; Shu, Yi; Xiong, Gaofeng; Carson, William E; Haque, Farzin; Xu, Ren; Guo, Peixuan
2015-10-27
MicroRNAs play important roles in regulating the gene expression and life cycle of cancer cells. In particular, miR-21, an oncogenic miRNA is a major player involved in tumor initiation, progression, invasion and metastasis in several cancers, including triple negative breast cancer (TNBC). However, delivery of therapeutic miRNA or anti-miRNA specifically into cancer cells in vivo without collateral damage to healthy cells remains challenging. We report here the application of RNA nanotechnology for specific and efficient delivery of anti-miR-21 to block the growth of TNBC in orthotopic mouse models. The 15 nm therapeutic RNA nanoparticles contains the 58-nucleotide (nt) phi29 pRNA-3WJ as a core, a 8-nt sequence complementary to the seed region of miR-21, and a 39-nt epidermal growth factor receptor (EGFR) targeting aptamer for internalizing RNA nanoparticles into cancer cells via receptor mediated endocytosis. The RNase resistant and thermodynamically stable RNA nanoparticles remained intact after systemic injection into mice and strongly bound to tumors with little or no accumulation in healthy organs 8 h postinjection, and subsequently repressed tumor growth at low doses. The observed specific cancer targeting and tumor regression is a result of several key attributes of RNA nanoparticles: anionic charge which disallows nonspecific passage across negatively charged cell membrane; "active" targeting using RNA aptamers which increases the homing of RNA nanoparticles to cancer cells; nanoscale size and shape which avoids rapid renal clearance and engulfment by lung macrophages and liver Kupffer cells; favorable biodistribution profiles with little accumulation in healthy organs, which minimizes nonspecific side effects; and favorable pharmacokinetic profiles with extended in vivo half-life. The results demonstrate the clinical potentials of RNA nanotechnology based platform to deliver miRNA based therapeutics for cancer treatment.
2015-01-01
MicroRNAs play important roles in regulating the gene expression and life cycle of cancer cells. In particular, miR-21, an oncogenic miRNA is a major player involved in tumor initiation, progression, invasion and metastasis in several cancers, including triple negative breast cancer (TNBC). However, delivery of therapeutic miRNA or anti-miRNA specifically into cancer cells in vivo without collateral damage to healthy cells remains challenging. We report here the application of RNA nanotechnology for specific and efficient delivery of anti-miR-21 to block the growth of TNBC in orthotopic mouse models. The 15 nm therapeutic RNA nanoparticles contains the 58-nucleotide (nt) phi29 pRNA-3WJ as a core, a 8-nt sequence complementary to the seed region of miR-21, and a 39-nt epidermal growth factor receptor (EGFR) targeting aptamer for internalizing RNA nanoparticles into cancer cells via receptor mediated endocytosis. The RNase resistant and thermodynamically stable RNA nanoparticles remained intact after systemic injection into mice and strongly bound to tumors with little or no accumulation in healthy organs 8 h postinjection, and subsequently repressed tumor growth at low doses. The observed specific cancer targeting and tumor regression is a result of several key attributes of RNA nanoparticles: anionic charge which disallows nonspecific passage across negatively charged cell membrane; “active” targeting using RNA aptamers which increases the homing of RNA nanoparticles to cancer cells; nanoscale size and shape which avoids rapid renal clearance and engulfment by lung macrophages and liver Kupffer cells; favorable biodistribution profiles with little accumulation in healthy organs, which minimizes nonspecific side effects; and favorable pharmacokinetic profiles with extended in vivo half-life. The results demonstrate the clinical potentials of RNA nanotechnology based platform to deliver miRNA based therapeutics for cancer treatment. PMID:26387848
ERIC Educational Resources Information Center
Lever, Anne G.; Ridderinkhof, K. Richard; Marsman, Maarten; Geurts, Hilde M.
2017-01-01
As a large heterogeneity is observed across studies on interference control in autism spectrum disorder (ASD), research may benefit from the use of a cognitive framework that models specific processes underlying reactive and proactive control of interference. Reactive control refers to the expression and suppression of responses and proactive…
Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil
2017-11-01
The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin
Suppression of cell division by pKi-67 antisense-RNA and recombinant protein.
Duchrow, M; Schmidt, M H; Zingler, M; Anemüller, S; Bruch, H P; Broll, R
2001-01-01
The human antigen defined by the monoclonal antibody Ki-67 (pKi-67) is a human nuclear protein strongly associated with cell proliferation and found in all tissues studied. It is widely used as a marker of proliferating cells, yet its function is unknown. To investigate its function we suppressed pKi-67 expression by antisense RNA and overexpressed a partial structure of pKi-67 in HeLa cells. A BrdU-incorporation assay showed a significant decrease in DNA synthesis after antisense inhibition. Cell cycle analysis indicated a higher proportion of cells in G1 phase and a lower proportion of cells in S phase while the number of G(2)/M phase cells remained constant. Overexpression of a recombinant protein encoding three of the repetitive elements from exon 13 of pKi-67 had a similar effect to that obtained by antisense inhibition. The similarity of the effect of expressing 'Ki-67 repeats' and pKi-67 antisense RNA could be explained by a negative effect on the folding of the endogenous protein in the endoplasmatic reticulum. Furthermore excessive self-association of pKi-67 via the repeat structure could inhibit its nuclear transport, preventing it from getting to its presumptive site of action. We conclude that the Ki-67 protein has an important role in the regulation of the cell cycle, which is mediated in part by its repetitive elements. Copyright 2001 S. Karger AG, Basel
Padi, Sathish K.R.; Zhang, Qunshu; Rustum, Youcef M; Morrison, Carl; Guo, Bin
2013-01-01
Background & Aims Vitamin D protects against colorectal cancer by unclear mechanisms. We investigated the effects of calcitriol (1α,25-dihydroxyvitamin D3, the active form of vitamin D) on levels of different microRNAs (miRs) in colorectal cancer (CRC) cells from humans and xenograft tumors in mice. Methods Expression of microRNAs in CRC cell lines was examined using the Ambion mirVana miRNA Bioarray. The effects of calcitriol on expression of miR-627 and cell proliferation were determined by real-time PCR and WST-1 assay, respectively; growth of colorectal xenograft tumors was examined in nude mice. Real-time PCR was used to analyze levels of miR-627 in human colon adenocarcinoma samples and non-tumor colon mucosa tissues (controls). Results In HT-29 cells, miR-627 was the only microRNA significantly upregulated by calcitriol. Jumonji domain containing 1A (JMJD1A), which encodes a histone demethylase, was found to be a target of miR-627. By downregulating JMJD1A, miR-627 increased methylation of histone H3K9 and suppressed expression of proliferative factors such as GDF15. Calcitriol induced expression of miR-627, which downregulated JMJD1A and suppressed growth of xenograft tumors from HCT-116 cells in nude mice. Overexpression of miR-627 prevented proliferation of CRC cell lines in culture and growth of xenograft tumors in mice. Conversely, blocking the activity of miR-627 inhibited the tumor suppressive effects of calcitriol in cultured CRC cells and in mice. Levels of miR-627 were decreased in human colon adenocarcinoma samples, compared with controls. Conclusions miR-627 mediates tumor-suppressive epigenetic activities of vitamin D on CRC cells and xenograft tumors in mice. The mRNA that encodes the histone demethylase JMJD1A is a direct target of miR-627. Reagents designed to target JMJD1A or its mRNA, or increase the function of miR-627, might have the same antitumor activities of vitamin D without the hypercalcemic side effects. PMID:23619147
MicroRNA-188 suppresses G1/S transition by targeting multiple cyclin/CDK complexes.
Wu, Jiangbin; Lv, Qing; He, Jie; Zhang, Haoxiang; Mei, Xueshuang; Cui, Kai; Huang, Nunu; Xie, Weidong; Xu, Naihan; Zhang, Yaou
2014-10-11
Accelerated cell cycle progression is the common feature of most cancers. MiRNAs can act as oncogenes or tumor suppressors by directly modulating cell cycle machinery. It has been shown that miR-188 is upregulated in UVB-irradiated mouse skin and human nasopharyngeal carcinoma CNE cells under hypoxic stress. However, little is known about the function of miR-188 in cell proliferation and growth control. Overexpression of miR-188 inhibits cell proliferation, tumor colony formation and G1/S cell cycle transition in human nasopharyngeal carcinoma CNE cells. Using bioinformatics approach, we identify a series of genes regulating G1/S transition as putative miR-188 targets. MiR-188 inhibits both mRNA and protein expression of CCND1, CCND3, CCNE1, CCNA2, CDK4 and CDK2, suppresses Rb phosphorylation and downregulates E2F transcriptional activity. The expression level of miR-188 also inversely correlates with the expression of miR-188 targets in human nasopharyngeal carcinoma (NPC) tissues. Moreover, studies in xenograft mouse model reveal that miR-188 is capable of inhibiting tumor initiation and progression by suppressing target genes expression and Rb phosphorylation. This study demonstrates that miR-188 exerts anticancer effects, via downregulation of multiple G1/S related cyclin/CDKs and Rb/E2F signaling pathway.
Some further clarifications on age-related differences in Stroop interference.
Augustinova, Maria; Clarys, David; Spatola, Nicolas; Ferrand, Ludovic
2018-04-01
Both the locus and processes underlying the age-related differences in Stroop interference are usually inferred from changes in magnitudes of standard (i.e., overall) Stroop interference. Therefore, this study addressed these still-open issues directly. To this end, a sample of younger (18-26 years old) and healthy older (72-97 years old) was administered the semantic Stroop paradigm (that assesses the relative contribution of semantic compared to response conflict both of which contribute to overall Stroop interference) combined with a single-letter coloring and cuing (SLCC) procedure. Independently of an increased attentional focus on the relevant color dimension of Stroop words induced by SLCC (as compared to all letters colored and cued, ALCC), greater magnitudes of standard Stroop interference were observed in older (as compared to younger) adults. These differences were due to greater magnitudes of response conflict whereas magnitudes of semantic conflict remained significant and unchanged by healthy aging and SLCC. Thus, this direct evidence places the locus of age-related differences in Stroop interference at the level of response conflict (as opposed to semantic and/or both conflicts). In terms of processes underlying these differences, the reported evidence shows that both age-groups are equally (in)efficient in (a) focusing on the relevant color dimension and (b) suppressing the meaning of the irrelevant word-dimension of Stroop words. Healthy older adults are simply less efficient in suppressing the (pre-)response activity primed by the fully processed meaning of the irrelevant word-dimension. Standard interpretations of age-related differences in Stroop interference and a more general issue of how attentional selectivity actually operates in the Stroop task are therefore reconsidered in this paper.
A Cognitive Framework for Understanding and Improving Interference Resolution in the Brain
Mishra, Jyoti; Anguera, Joaquin A.; Ziegler, David A.; Gazzaley, Adam
2014-01-01
All of us are familiar with the negative impact of interference on achieving our task goals. We are referring to interference by information, which either impinges on our senses from an external environmental source or is internally generated by our thoughts. Informed by more than a decade of research on the cognitive and neural processing of interference, we have developed a framework for understanding how interference impacts our neural systems and especially how it is regulated and suppressed during efficient on-task performance. Importantly, externally and internally generated interferences have distinct neural signatures, and further, distinct neural processing emerges depending on whether individuals must ignore and suppress the interference, as for distractions, or engage with them in a secondary task, as during multitasking. Here, we elaborate on this cognitive framework and how it changes throughout the human lifespan, focusing mostly on research evidence from younger adults and comparing these findings to data from older adults, children, and cognitively impaired populations. With insights gleaned from our growing understanding, we then describe three novel translational efforts in our lab directed at improving distinct aspects of interference resolution using cognitive training. Critically, these training approaches were specifically developed to target improved interference resolution based on neuroplasticity principles and have shown much success in randomized controlled first version evaluations in healthy aging. Our results show not only on-task training improvements but also robust generalization of benefit to other cognitive control abilities. This research showcases how an in-depth understanding of neural mechanisms can then inform the development of effective deficit-targeted interventions, which can in turn benefit both healthy and cognitively impaired populations. PMID:24309262