Science.gov

Sample records for rnas controlling outer

  1. PGC-Enriched miRNAs Control Germ Cell Development

    PubMed Central

    Bhin, Jinhyuk; Jeong, Hoe-Su; Kim, Jong Soo; Shin, Jeong Oh; Hong, Ki Sung; Jung, Han-Sung; Kim, Changhoon; Hwang, Daehee; Kim, Kye-Seong

    2015-01-01

    Non-coding microRNAs (miRNAs) regulate the translation of target messenger RNAs (mRNAs) involved in the growth and development of a variety of cells, including primordial germ cells (PGCs) which play an essential role in germ cell development. However, the target mRNAs and the regulatory networks influenced by miRNAs in PGCs remain unclear. Here, we demonstrate a novel miRNAs control PGC development through targeting mRNAs involved in various cellular pathways. We reveal the PGC-enriched expression patterns of nine miRNAs, including miR-10b, -18a, -93, -106b, -126-3p, -127, -181a, -181b, and -301, using miRNA expression analysis along with mRNA microarray analysis in PGCs, embryonic gonads, and postnatal testes. These miRNAs are highly expressed in PGCs, as demonstrated by Northern blotting, miRNA in situ hybridization assay, and miRNA qPCR analysis. This integrative study utilizing mRNA microarray analysis and miRNA target prediction demonstrates the regulatory networks through which these miRNAs regulate their potential target genes during PGC development. The elucidated networks of miRNAs disclose a coordinated molecular mechanism by which these miRNAs regulate distinct cellular pathways in PGCs that determine germ cell development. PMID:26442865

  2. Hypothalamic miRNAs: emerging roles in energy balance control

    PubMed Central

    Schneeberger, Marc; Gomez-Valadés, Alicia G.; Ramirez, Sara; Gomis, Ramon; Claret, Marc

    2015-01-01

    The hypothalamus is a crucial central nervous system area controlling appetite, body weight and metabolism. It consists in multiple neuronal types that sense, integrate and generate appropriate responses to hormonal and nutritional signals partly by fine-tuning the expression of specific batteries of genes. However, the mechanisms regulating these neuronal gene programmes in physiology and pathophysiology are not completely understood. MicroRNAs (miRNAs) are key regulators of gene expression that recently emerged as pivotal modulators of systemic metabolism. In this article we will review current evidence indicating that miRNAs in hypothalamic neurons are also implicated in appetite and whole-body energy balance control. PMID:25729348

  3. Optogenetic Control of Mouse Outer Hair Cells.

    PubMed

    Wu, Tao; Ramamoorthy, Sripriya; Wilson, Teresa; Chen, Fangyi; Porsov, Edward; Subhash, Hrebesh; Foster, Sarah; Zhang, Yuan; Omelchenko, Irina; Bateschell, Michael; Wang, Lingyan; Brigande, John V; Jiang, Zhi-Gen; Mao, Tianyi; Nuttall, Alfred L

    2016-01-19

    Normal hearing in mammals depends on sound amplification by outer hair cells (OHCs) presumably by their somatic motility and force production. However, the role of OHC force production in cochlear amplification and frequency tuning are not yet fully understood. Currently, available OHC manipulation techniques for physiological or clinical studies are limited by their invasive nature, lack of precision, and poor temporal-spatial resolution. To overcome these limitations, we explored an optogenetic approach based on channelrhodopsin 2 (ChR-2), a direct light-activated nonselective cation channel originally discovered in Chlamydomonas reinhardtii. Three approaches were compared: 1) adeno-associated virus-mediated in utero transfer of the ChR-2 gene into the developing murine otocyst, 2) expression of ChR-2(H134R) in an auditory cell line (HEI-OC1), and 3) expression of ChR-2 in the OHCs of a mouse line carrying a ChR-2 conditional allele. Whole cell recording showed that blue light (470 nm) elicited the typical nonselective cation current of ChR-2 with reversal potential around zero in both mouse OHCs and HEI-OC1 cells and generated depolarization in both cell types. In addition, pulsed light stimulation (10 Hz) elicited a 1:1 repetitive depolarization and ChR-2 currents in mouse OHCs and HEI-OC1 cells, respectively. The time constant of depolarization in OHCs, 1.45 ms, is 10 times faster than HEI-OC1 cells, which allowed light stimulation up to rates of 10/s to elicit corresponding membrane potential changes. Our study demonstrates that ChR-2 can successfully be expressed in mouse OHCs and HEI-OC1 cells and that these present a typical light-sensitive current and depolarization. However, the amount of ChR-2 current induced in our in vivo experiments was insufficient to result in measurable cochlear effects. PMID:26789771

  4. Differentially expressed lncRNAs and mRNAs identified by microarray analysis in GBS patients vs healthy controls

    PubMed Central

    Xu, Jing; Gao, Chao; Zhang, Fang; Ma, Xiaofeng; Peng, Xiaolin; Zhang, Rongxin; Kong, Dexin; Simard, Alain R.; Hao, Junwei

    2016-01-01

    The aim of our present study was to determine whether message RNAs (mRNAs) and long noncoding RNAs (lncRNAs) are expressed differentially in patients with Guillain-Barré syndrome (GBS) compared with healthy controls. The mRNA and lncRNA profiles of GBS patients and healthy controls were generated by using microarray analysis. From microarray analysis, we listed 310 mRNAs and 114 lncRNAs with the mRMR software classed into two sample groups, GBS patients and healthy controls. KEGG mapping demonstrated that the top seven signal pathways may play important roles in GBS development. Several GO terms, such as cytosol, cellular macromolecular complex assembly, cell cycle, ligase activity, protein catabolic process, etc., were enriched in gene lists, suggesting a potential correlation with GBS development. Co-expression network analysis indicated that 113 lncRNAs and 303 mRNAs were included in the co-expression network. Our present study showed that these differentially expressed mRNAs and lncRNAs may play important roles in GBS development, which provides basic information for defining the mechanism(s) that promote GBS. PMID:26898505

  5. Controlling Laser Spot Size in Outer Space

    NASA Technical Reports Server (NTRS)

    Bennett, Harold E.

    2005-01-01

    Three documents discuss a method of controlling the diameter of a laser beam projected from Earth to any altitude ranging from low orbit around the Earth to geosynchronous orbit. Such laser beams are under consideration as means of supplying power to orbiting spacecraft at levels of the order of tens of kilowatts apiece. Each such beam would be projected by use of a special purpose telescope having an aperture diameter of 15 m or more. Expanding the laser beam to such a large diameter at low altitude would prevent air breakdown and render the laser beam eyesafe. Typically, the telescope would include an adaptive-optics concave primary mirror and a convex secondary mirror. The laser beam transmitted out to the satellite would remain in the near field on the telescope side of the beam waist, so that the telescope focal point would remain effective in controlling the beam width. By use of positioning stages having submicron resolution and repeatability, the relative positions of the primary and secondary mirrors would be adjusted to change the nominal telescope object and image distances to obtain the desired beam diameter (typically about 6 m) at the altitude of the satellite. The limiting distance D(sub L) at which a constant beam diameter can be maintained is determined by the focal range of the telescope 4 lambda f(sup 2) where lambda is the wavelength and f the f/number of the primary mirror. The shorter the wavelength and the faster the mirror, the longer D(sub L) becomes.

  6. MicroRNAs: Control and Loss of Control in Human Physiology and Disease

    PubMed Central

    Li, Min; Marin-Muller, Christian; Bharadwaj, Uddalak; Chow, Kwong-Hon; Yao, Qizhi; Chen, Changyi

    2010-01-01

    Analysis of the human genome indicated that a large fraction of the genome sequences are RNAs that do not encode any proteins, also known as non-coding RNAs. MicroRNAs (miRNAs) are a group of small non-coding RNA molecules, with 20–22-nucleotide (nt) in length, and are predicted to control the activity of approximately 30% of all protein-coding genes in mammals. miRNAs play important roles in many diseases including cancer, cardiovascular disease, and immune disorders. The expression of miRNAs can be regulated by epigenetic modification, DNA copy number change, and genetic mutations. miRNAs can serve as a valuable therapeutic target for a large number of diseases. For miRNAs with oncogenic capabilities, potential therapies include miRNA silencing, antisense blocking, and miRNA modifications. For miRNAs with tumor suppression functions, over-expression of those miRNAs might be a useful strategy to inhibit tumor growth. In this review, we discuss the current progress of miRNA research, regulation of miRNA expression, prediction of miRNA targets, and regulatory role of miRNAs in human physiology and diseases, with a specific focus on miRNAs in pancreatic cancer, liver cancer, colon rectal cancer, cardiovascular disease, immune system, and infectious disease. This review provides valuable information for clinicians and researchers who want to recognize the newest advances in this new field and identify possible lines of investigation in miRNAs as important mediators in human physiology and diseases. PMID:19030926

  7. Transcription control by long non-coding RNAs

    PubMed Central

    Faust, Tyler

    2012-01-01

    Non-coding RNAs have been found to regulate many cellular processes and thus expand the functional genetic repertoire contained within the genome. With the recent advent of genomic tools, it is now evident that these RNA molecules play central regulatory roles in many transcriptional programs. Here we discuss how they are targeted to promoters in several cases and how they operate at specific points in the transcription cycle to precisely control gene expression. PMID:22414755

  8. Control of mitochondrial activity by miRNAs

    PubMed Central

    Li, Peifeng; Jiao, Jianqing; Gao, Guifeng; Prabhakar, Bellur S.

    2012-01-01

    Mitochondria supply energy for physiological function and they participate in the regulation of other cellular events including apoptosis, calcium homeostasis and production of reactive oxygen species. Thus, mitochondria play a critical role in the cells. However, dysfunction of mitochondria is related to a variety of pathological processes and diseases. MicroRNAs (miRNAs) are a class of small noncoding RNAs about 22 nucleotides long, and they can bind to the 3′ un-translated region (3′UTR) of mRNAs, thereby inhibiting mRNA translation or promoting mRNA degradation. We summarize the molecular regulation of mitochondrial metabolism, structure and function by miRNAs. Modulation of miRNAs levels may provide a new therapeutic approach for the treatment of mitochondria-related diseases. PMID:22135235

  9. Dynamic features of gene expression control by small regulatory RNAs.

    PubMed

    Mitarai, Namiko; Benjamin, Julie-Anna M; Krishna, Sandeep; Semsey, Szabolcs; Csiszovszki, Zsolt; Massé, Eric; Sneppen, Kim

    2009-06-30

    Small regulatory RNAs (sRNAs) in eukaryotes and bacteria play an important role in the regulation of gene expression either by binding to regulatory proteins or directly to target mRNAs. Two of the best-characterized bacterial sRNAs, Spot42 and RyhB, form a complementary pair with the ribosome binding region of their target mRNAs, thereby inhibiting translation or promoting mRNA degradation. To investigate the steady-state and dynamic potential of such sRNAs, we examine the 2 key parameters characterizing sRNA regulation: the capacity to overexpress the sRNA relative to its target mRNA and the speed at which the target mRNA is irreversibly inactivated. We demonstrate different methods to determine these 2 key parameters, for Spot42 and RyhB, which combine biochemical and genetic experiments with computational analysis. We have developed a mathematical model that describes the functional properties of sRNAs with various characteristic parameters. We observed that Spot42 and RyhB function in distinctive parameter regimes, which result in divergent mechanisms. PMID:19541626

  10. Environmental control of microRNAs in the nervous system: Implications in plasticity and behavior.

    PubMed

    Codocedo, Juan F; Inestrosa, Nibaldo C

    2016-01-01

    The discovery of microRNAs (miRNAs) a little over 20 years ago was revolutionary given that miRNAs are essential to numerous physiological and physiopathological processes. Currently, several aspects of the biogenic process of miRNAs and of the translational repression mechanism exerted on their targets mRNAs are known in detail. In fact, the development of bioinformatics tools for predicting miRNA targets has established that miRNAs have the potential to regulate almost all known biological processes. Therefore, the identification of the signals and molecular mechanisms that regulate miRNA function is relevant to understanding the role of miRNAs in both pathological and adaptive processes. Recently, a series of studies has focused on miRNA expression in the brain, establishing that their levels are altered in response to various environmental factors (EFs), such as light, sound, odorants, nutrients, drugs and stress. In this review, we discuss how exposure to various EFs modulates the expression and function of several miRNAs in the nervous system and how this control determines adaptation to their environment, behavior and disease state. PMID:26593111

  11. lincRNAs act in the circuitry controlling pluripotency and differentiation

    PubMed Central

    Guttman, Mitchell; Donaghey, Julie; Carey, Bryce W.; Garber, Manuel; Grenier, Jennifer K.; Munson, Glen; Young, Geneva; Lucas, Anne Bergstrom; Ach, Robert; Bruhn, Laurakay; Yang, Xiaoping; Amit, Ido; Meissner, Alexander; Regev, Aviv; Rinn, John L.; Root, David E.; Lander, Eric S.

    2011-01-01

    While thousands of large intergenic non-coding RNAs (lincRNAs) have been identified in mammals, few have been functionally characterized, leading to debate about their biological role. To address this, we performed loss-of-function studies on most lincRNAs expressed in mouse embryonic stem cells (ESC) and characterized the effects on gene expression. Here we show that knockdown of lincRNAs has major consequences on gene expression patterns, comparable to knockdown of well-known ESC regulators. Notably, lincRNAs primarily affect gene expression in trans. Knockdown of dozens of lincRNAs causes either exit from the pluripotent state or upregulation of lineage commitment programs. We integrate lincRNAs into the molecular circuitry of ESCs and show that lincRNA genes are regulated by key transcription factors and that lincRNA transcripts bind to multiple chromatin regulatory proteins to affect shared gene expression programs. Together, the results demonstrate that lincRNAs have key roles in the circuitry controlling ESC state. PMID:21874018

  12. Control of competence by related non-coding csRNAs in Streptococcus pneumoniae R6

    PubMed Central

    Laux, Anke; Sexauer, Anne; Sivaselvarajah, Dineshan; Kaysen, Anne; Brückner, Reinhold

    2015-01-01

    The two-component regulatory system CiaRH of Streptococcus pneumoniae is involved in β-lactam resistance, maintenance of cell integrity, bacteriocin production, host colonization, virulence, and competence. The response regulator CiaR controls, among other genes, expression of five highly similar small non-coding RNAs, designated csRNAs. These csRNAs control competence development by targeting comC, encoding the precursor of the competence stimulating peptide, which is essential to initiate the regulatory cascade leading to competence. In addition, another gene product of the CiaR regulon, the serine protease HtrA, is also involved in competence control. In the absence of HtrA, five csRNAs could suppress competence, but one csRNA alone was not effective. To determine if all csRNAs are needed, reporter gene fusions to competence genes were used to monitor competence gene expression in the presence of different csRNAs. These experiments showed that two csRNAs were not enough to prevent competence, but combinations of three csRNAs, csRNA1,2,3, or csRNA1,2,4 were sufficient. In S. pneumoniae strains expressing only csRNA5, a surprising positive effect was detected on the level of early competence gene expression. Hence, the role of the csRNAs in competence regulation is more complex than anticipated. Mutations in comC (comC8) partially disrupting predicted complementarity to the csRNAs led to competence even in the presence of all csRNAs. Reconstitution of csRNA complementarity to comC8 restored competence suppression. Again, more than one csRNA was needed. In this case, even two mutated csRNAs complementary to comC8, csRNA1–8 and csRNA2–8, were suppressive. In conclusion, competence in S. pneumoniae is additively controlled by the csRNAs via post-transcriptional regulation of comC. PMID:26257773

  13. Identification of Stably Expressed lncRNAs as Valid Endogenous Controls for Profiling of Human Glioma

    PubMed Central

    Kraus, Theo F. J.; Greiner, Andrea; Guibourt, Virginie; Lisec, Kristina; Kretzschmar, Hans A.

    2015-01-01

    Background: Recent research indicates that long non-coding RNAs (lncRNA) represent a new family of RNAs that is of fundamental importance for controlling transcription and translation. Thereby, there is increasing evidence that lncRNAs are also important in tumourigenesis. Thereby valid expression profiling using quantitative PCR requires suitable, stably expressed normalisers to achieve reliable and reproducible data. However, no systematic analysis of suitable references in lncRNA studies in human glioma has been performed yet. Methods: In this study, we investigated 90 lncRNAs in 30 tissue specimen for the expression stability in human diffuse astrocytoma (WHO-Grade II), anaplastic astrocytoma (WHO-Grade III) and glioblastoma (WHO-Grade IV) both alone as well as in comparison with normal white matter. Our identification procedure included a rigorous bioinformatical selection process that resulted in the inclusion of only highly abundant, equally expressed lncRNAs for further analysis. Additionally, lncRNAs were classified according to their stability value using the NormFinder algorithm. Results: We identified 24 appropriate normalisers suitable for studies in diffuse astrocytoma, 22 for studies in anaplastic astrocytoma and 12 for studies in glioblastoma. Comparing all three glioma entities 7 lncRNAs showed stable expression levels. Addition of normal brain tissue resulted in only 4 suitable lncRNAs. Conclusions: Our findings indicate that 4 lncRNAs (HOXA6as, H19 upstream conserved 1 and 2, Zfhx2as and BC200) are suitable as normalisers in glioma and normal brain. These lncRNAs may thus be regarded as universal references being applicable for the accurate normalisation of lncRNA expression profiling in various glioma (WHO-Grades II-IV) alone and in combination with brain tissue. This enables to perform valid longitudinal studies, e.g. of glioma before and after malignisation to identify changes of lncRNA expressions probably driving malignant transformation

  14. Determining Associations between Human Diseases and non-coding RNAs with Critical Roles in Network Control

    NASA Astrophysics Data System (ADS)

    Kagami, Haruna; Akutsu, Tatsuya; Maegawa, Shingo; Hosokawa, Hiroshi; Nacher, Jose C.

    2015-10-01

    Deciphering the association between life molecules and human diseases is currently an important task in systems biology. Research over the past decade has unveiled that the human genome is almost entirely transcribed, producing a vast number of non-protein-coding RNAs (ncRNAs) with potential regulatory functions. More recent findings suggest that many diseases may not be exclusively linked to mutations in protein-coding genes. The combination of these arguments poses the question of whether ncRNAs that play a critical role in network control are also enriched with disease-associated ncRNAs. To address this question, we mapped the available annotated information of more than 350 human disorders to the largest collection of human ncRNA-protein interactions, which define a bipartite network of almost 93,000 interactions. Using a novel algorithmic-based controllability framework applied to the constructed bipartite network, we found that ncRNAs engaged in critical network control are also statistically linked to human disorders (P-value of P = 9.8 × 10-109). Taken together, these findings suggest that the addition of those genes that encode optimized subsets of ncRNAs engaged in critical control within the pool of candidate genes could aid disease gene prioritization studies.

  15. Determining Associations between Human Diseases and non-coding RNAs with Critical Roles in Network Control.

    PubMed

    Kagami, Haruna; Akutsu, Tatsuya; Maegawa, Shingo; Hosokawa, Hiroshi; Nacher, Jose C

    2015-01-01

    Deciphering the association between life molecules and human diseases is currently an important task in systems biology. Research over the past decade has unveiled that the human genome is almost entirely transcribed, producing a vast number of non-protein-coding RNAs (ncRNAs) with potential regulatory functions. More recent findings suggest that many diseases may not be exclusively linked to mutations in protein-coding genes. The combination of these arguments poses the question of whether ncRNAs that play a critical role in network control are also enriched with disease-associated ncRNAs. To address this question, we mapped the available annotated information of more than 350 human disorders to the largest collection of human ncRNA-protein interactions, which define a bipartite network of almost 93,000 interactions. Using a novel algorithmic-based controllability framework applied to the constructed bipartite network, we found that ncRNAs engaged in critical network control are also statistically linked to human disorders (P-value of P = 9.8 × 10(-109)). Taken together, these findings suggest that the addition of those genes that encode optimized subsets of ncRNAs engaged in critical control within the pool of candidate genes could aid disease gene prioritization studies. PMID:26459019

  16. VlincRNAs controlled by retroviral elements are a hallmark of pluripotency and cancer

    PubMed Central

    2013-01-01

    Background The function of the non-coding portion of the human genome remains one of the most important questions of our time. Its vast complexity is exemplified by the recent identification of an unusual and notable component of the transcriptome - very long intergenic non-coding RNAs, termed vlincRNAs. Results Here we identify 2,147 vlincRNAs covering 10 percent of our genome. We show they are present not only in cancerous cells, but also in primary cells and normal human tissues, and are controlled by canonical promoters. Furthermore, vlincRNA promoters frequently originate from within endogenous retroviral sequences. Strikingly, the number of vlincRNAs expressed from endogenous retroviral promoters strongly correlates with pluripotency or the degree of malignant transformation. These results suggest a previously unknown connection between the pluripotent state and cancer via retroviral repeat-driven expression of vlincRNAs. Finally, we show that vlincRNAs can be syntenically conserved in humans and mouse and their depletion using RNAi can cause apoptosis in cancerous cells. Conclusions These intriguing observations suggest that vlincRNAs could create a framework that combines many existing short ESTs and lincRNAs into a landscape of very long transcripts functioning in the regulation of gene expression in the nucleus. Certain types of vlincRNAs participate at specific stages of normal development and, based on analysis of a limited set of cancerous and primary cell lines, they appear to be co-opted by cancer-associated transcriptional programs. This provides additional understanding of transcriptome regulation during the malignant state, and could lead to additional targets and options for its reversal. PMID:23876380

  17. Dual-spin attitude control for outer planet missions

    NASA Technical Reports Server (NTRS)

    Ward, R. S.; Tauke, G. J.

    1977-01-01

    The applicability of dual-spin technology to a Jupiter orbiter with probe mission was investigated. Basic mission and system level attitude control requirements were established and preliminary mechanization and control concepts developed. A comprehensive 18-degree-of-freedom digital simulation was utilized extensively to establish control laws, study dynamic interactions, and determined key sensitivities. Fundamental system/subsystem constraints were identified, and the applicability of dual-spin technology to a Jupiter orbiter with probe mission was validated.

  18. Toggle involving cis-interfering noncoding RNAs controls variegated gene expression in yeast

    PubMed Central

    Bumgarner, Stacie L.; Dowell, Robin D.; Grisafi, Paula; Gifford, David K.; Fink, Gerald R.

    2009-01-01

    The identification of specific functional roles for the numerous long noncoding (nc)RNAs found in eukaryotic transcriptomes is currently a matter of intense study amid speculation that these ncRNAs have key regulatory roles. We have identified a pair of cis-interfering ncRNAs in yeast that contribute to the control of variegated gene expression at the FLO11 locus by implementing a regulatory circuit that toggles between two stable states. These capped, polyadenylated ncRNAs are transcribed across the large intergenic region upstream of the FLO11 ORF. As with mammalian long intervening (li)ncRNAs, these yeast ncRNAs (ICR1 and PWR1) are themselves regulated by transcription factors (Sfl1 and Flo8) and chromatin remodelers (Rpd3L) that are key elements in phenotypic transitions in yeast. The mechanism that we describe explains the unanticipated role of a histone deacetylase complex in activating gene expression, because Rpd3L mutants force the ncRNA circuit into a state that silences the expression of the adjacent variegating gene. PMID:19805129

  19. Multiple small RNAs act additively to integrate sensory information and control quorum sensing in Vibrio harveyi

    PubMed Central

    Tu, Kimberly C.; Bassler, Bonnie L.

    2007-01-01

    Quorum sensing is a cell–cell communication mechanism that bacteria use to collectively regulate gene expression and, at a higher level, to coordinate group behavior. In the bioluminescent marine bacterium Vibrio harveyi, sensory information from three independent quorum-sensing systems converges on the shared response regulator LuxO. When LuxO is phosphorylated, it activates the expression of a putative repressor that destabilizes the mRNA encoding the master quorum-sensing transcriptional regulator LuxR. In the closely related species Vibrio cholerae, this repressor was revealed to be the RNA chaperone Hfq together with four small regulatory RNAs (sRNAs) called Qrr1–4 (quorum regulatory RNA). Here, we identify five Qrr sRNAs that control quorum sensing in V. harveyi. Mutational analysis reveals that only four of the five Qrrs are required for destabilization of the luxR mRNA. Surprisingly, unlike in V. cholerae where the sRNAs act redundantly, in V. harveyi, the Qrr sRNAs function additively to control quorum sensing. This latter mechanism produces a gradient of LuxR that, in turn, enables differential regulation of quorum-sensing target genes. Other regulators appear to be involved in control of V. harveyi qrr expression, allowing the integration of additional sensory information into the regulation of quorum-sensing gene expression. PMID:17234887

  20. Translational control and target recognition by Escherichia coli small RNAs in vivo

    PubMed Central

    Urban, Johannes H.; Vogel, Jörg

    2007-01-01

    Small non-coding RNAs (sRNAs) are an emerging class of regulators of bacterial gene expression. Most of the regulatory Escherichia coli sRNAs known to date modulate translation of trans-encoded target mRNAs. We studied the specificity of sRNA target interactions using gene fusions to green fluorescent protein (GFP) as a novel reporter of translational control by bacterial sRNAs in vivo. Target sequences were selected from both monocistronic and polycistronic mRNAs. Upon expression of the cognate sRNA (DsrA, GcvB, MicA, MicC, MicF, RprA, RyhB, SgrS and Spot42), we observed highly specific translation repression/activation of target fusions under various growth conditions. Target regulation was also tested in mutants that lacked Hfq or RNase III, or which expressed a truncated RNase E (rne701). We found that translational regulation by these sRNAs was largely independent of full-length RNase E, e.g. despite the fact that ompA fusion mRNA decay could no longer be promoted by MicA. This is the first study in which multiple well-defined E.coli sRNA target pairs have been studied in a uniform manner in vivo. We expect our GFP fusion approach to be applicable to sRNA targets of other bacteria, and also demonstrate that Vibrio RyhB sRNA represses a Vibrio sodB fusion when co-expressed in E.coli. PMID:17264113

  1. Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs.

    PubMed

    Pirouz, Mehdi; Du, Peng; Munafò, Marzia; Gregory, Richard I

    2016-08-16

    Mutations in the 3'-5' exonuclease DIS3L2 are associated with Perlman syndrome and hypersusceptibility to Wilms tumorigenesis. Previously, we found that Dis3l2 specifically recognizes and degrades uridylated pre-let-7 microRNA. However, the widespread relevance of Dis3l2-mediated decay of uridylated substrates remains unknown. Here, we applied an unbiased RNA immunoprecipitation strategy to identify Dis3l2 targets in mouse embryonic stem cells. The disease-associated long noncoding RNA (lncRNA) Rmrp, 7SL, as well as several other Pol III-transcribed noncoding RNAs (ncRNAs) were among the most highly enriched Dis3l2-bound RNAs. 3'-Uridylated Rmrp, 7SL, and small nuclear RNA (snRNA) species were highly stabilized in the cytoplasm of Dis3l2-depleted cells. Deep sequencing analysis of Rmrp 3' ends revealed extensive oligouridylation mainly on transcripts with imprecise ends. We implicate the terminal uridylyl transferases (TUTases) Zcchc6/11 in the uridylation of these ncRNAs, and biochemical reconstitution assays demonstrate the sufficiency of TUTase-Dis3l2 for Rmrp decay. This establishes Dis3l2-mediated decay (DMD) as a quality-control pathway that eliminates aberrant ncRNAs. PMID:27498873

  2. Competing Interactions of RNA-Binding Proteins, MicroRNAs, and Their Targets Control Neuronal Development and Function

    PubMed Central

    Gardiner, Amy S.; Twiss, Jeffery L.; Perrone-Bizzozero, Nora I.

    2015-01-01

    Post-transcriptional mechanisms play critical roles in the control of gene expression during neuronal development and maturation as they allow for faster responses to environmental cues and provide spatially-restricted compartments for local control of protein expression. These mechanisms depend on the interaction of cis-acting elements present in the mRNA sequence and trans-acting factors, such as RNA-binding proteins (RBPs) and microRNAs (miRNAs) that bind to those cis-elements and regulate mRNA stability, subcellular localization, and translation. Recent studies have uncovered an unexpected complexity in these interactions, where coding and non-coding RNAs, termed competing endogenous RNAs (ceRNAs), compete for binding to miRNAs. This competition can, thereby, control a larger number of miRNA target transcripts. However, competing RNA networks also extend to competition between target mRNAs for binding to limited amounts of RBPs. In this review, we present evidence that competitions between target mRNAs for binding to RBPs also occur in neurons, where they affect transcript stability and transport into axons and dendrites as well as translation. In addition, we illustrate the complexity of these mechanisms by demonstrating that RBPs and miRNAs also compete for target binding and regulation. PMID:26512708

  3. Evaluation of an Outer Loop Retrofit Architecture for Intelligent Turbofan Engine Thrust Control

    NASA Technical Reports Server (NTRS)

    Litt, Jonathan S.; Sowers, T. Shane

    2006-01-01

    The thrust control capability of a retrofit architecture for intelligent turbofan engine control and diagnostics is evaluated. The focus of the study is on the portion of the hierarchical architecture that performs thrust estimation and outer loop thrust control. The inner loop controls fan speed so the outer loop automatically adjusts the engine's fan speed command to maintain thrust at the desired level, based on pilot input, even as the engine deteriorates with use. The thrust estimation accuracy is assessed under nominal and deteriorated conditions at multiple operating points, and the closed loop thrust control performance is studied, all in a complex real-time nonlinear turbofan engine simulation test bed. The estimation capability, thrust response, and robustness to uncertainty in the form of engine degradation are evaluated.

  4. Control by a hair’s breadth: the role of microRNAs in the skin

    PubMed Central

    Ning, Matthew S.; Andl, Thomas

    2012-01-01

    microRNAs have continued to attract enormous interest in the scientific community ever since their discovery. Their allure stems from their unique role in posttranscriptional gene expression control as well as their potential application as therapeutic targets in various disease pathologies. While much is known concerning their general biological function, such as their interaction with RNA-Induced Silencing Complexes (RISC), many important questions still remain unanswered, especially regarding their functions in the skin. In this review, we summarize our current knowledge of the role of microRNAs in the skin in order to shine new light on our understanding of cutaneous biology and emphasize the significance of these small, single-stranded RNA molecules in the largest organ of the human body. Key events in epidermal and hair follicle biology, including differentiation, proliferation, and pigmentation, all involve microRNAs. We explore the role of microRNAs in several cutaneous processes, such as appendage formation, wound-healing, epithelial-mesenchymal transition, carcinogenesis, immune response, and aging. In addition, we discuss current trends in research and offer suggestions for future studies. PMID:22983383

  5. A late-acting quality control process for mature eukaryotic rRNAs.

    PubMed

    LaRiviere, Frederick J; Cole, Sarah E; Ferullo, Daniel J; Moore, Melissa J

    2006-11-17

    Ribosome biogenesis is a multifaceted process involving a host of trans-acting factors mediating numerous chemical reactions, RNA conformational changes, and RNA-protein associations. Given this high degree of complexity, tight quality control is likely crucial to ensure structural and functional integrity of the end products. We demonstrate that ribosomal RNAs (rRNAs) containing individual point mutations, in either the 25S peptidyl transferase center or 18S decoding site, that adversely affect ribosome function are strongly downregulated in Saccharomyces cerevisiae. This downregulation occurs via decreased stability of the mature rRNA contained in fully assembled ribosomes and ribosomal subunits. Thus, eukaryotes possess a quality-control mechanism, nonfunctional rRNA decay (NRD), capable of detecting and eliminating the rRNA component of mature ribosomes. PMID:17188037

  6. Role of MicroRNAs in Controlling Gene Expression in Different Segments of the Human Epididymis

    PubMed Central

    Belleannée, Clémence; Calvo, Ezéquiel; Thimon, Véronique; Cyr, Daniel G.; Légaré, Christine; Garneau, Louis; Sullivan, Robert

    2012-01-01

    Background The molecular mechanisms implicated in regionalized gene expression in the human epididymis have not yet been fully elucidated. Interestingly, more than 200 microRNAs (miRNAs) have been identified in the human epididymis and could be involved in the regulation of mRNA stability and post-transcriptional expression in this organ. Methods Using a miRNA microarray approach, we investigated the correlation between miRNA signatures and gene expression profiles found in three distinct regions (caput, corpus and cauda) of human epididymides from 3 donors. In silico prediction of transcript miRNA targets was performed using TargetScan and Miranda software's. FHCE1 immortalized epididymal cell lines were cotransfected with mimic microRNAs and plasmid constructs containing the 3′UTR of predicted target genes downstream of the luciferase gene. Results We identified 35 miRNAs differentially expressed in the distinct segments of the epididymis (fold change ≥2, P-value≤0.01). Among these miRNAs, miR-890, miR-892a, miR-892b, miR-891a, miR-891b belonging to the same epididymis-enriched cluster located on the X chromosome, are significantly more expressed in the corpus and cauda regions than in the caput. Interestingly, a strong negative correlation (r = −0,89, P-value≤0.001) was found between the pattern of expression of miR-892b and its potential mRNA target Esrrg (Estrogen Related Receptor Gamma) and with miR-145 and Cldn10 mRNA (r = −0,92, P-value≤0.001). We confirmed that miR-145 and miR-892b inhibit the expression of the luciferase reporter via Cldn10 and Esrrg 3′ UTRs, respectively. Conclusion Our study shows that the expression of miRNAs is segmented along the human epididymis and correlates with the pattern of target gene expression in different regions. Therefore, epididymal miRNAs may be in control of the maintenance of gene expression profile in the epididymis, which dictates segment-specific secretion of proteins and establishes

  7. Control of mitochondrial metabolism and systemic energy homeostasis by microRNAs 378 and 378*

    PubMed Central

    Carrer, Michele; Liu, Ning; Grueter, Chad E.; Williams, Andrew H.; Frisard, Madlyn I.; Hulver, Matthew W.; Bassel-Duby, Rhonda; Olson, Eric N.

    2012-01-01

    Obesity and metabolic syndrome are associated with mitochondrial dysfunction and deranged regulation of metabolic genes. Peroxisome proliferator-activated receptor γ coactivator 1β (PGC-1β) is a transcriptional coactivator that regulates metabolism and mitochondrial biogenesis through stimulation of nuclear hormone receptors and other transcription factors. We report that the PGC-1β gene encodes two microRNAs (miRNAs), miR-378 and miR-378*, which counterbalance the metabolic actions of PGC-1β. Mice genetically lacking miR-378 and miR-378* are resistant to high-fat diet-induced obesity and exhibit enhanced mitochondrial fatty acid metabolism and elevated oxidative capacity of insulin-target tissues. Among the many targets of these miRNAs, carnitine O-acetyltransferase, a mitochondrial enzyme involved in fatty acid metabolism, and MED13, a component of the Mediator complex that controls nuclear hormone receptor activity, are repressed by miR-378 and miR-378*, respectively, and are elevated in the livers of miR-378/378* KO mice. Consistent with these targets as contributors to the metabolic actions of miR-378 and miR-378*, previous studies have implicated carnitine O-acetyltransferase and MED13 in metabolic syndrome and obesity. Our findings identify miR-378 and miR-378* as integral components of a regulatory circuit that functions under conditions of metabolic stress to control systemic energy homeostasis and the overall oxidative capacity of insulin target tissues. Thus, these miRNAs provide potential targets for pharmacologic intervention in obesity and metabolic syndrome. PMID:22949648

  8. MicroRNAs control transcription factor NF-kB (p65) expression in human ovarian cells.

    PubMed

    Sirotkin, Alexander V; Alexa, Richard; Kišová, Gabriela; Harrath, Abdel Halim; Alwasel, Saleh; Ovcharenko, Dmitriy; Mlynček, Miloš

    2015-05-01

    MicroRNAs (miRNAs) are known to influence ovarian cell proliferation, apoptosis and hormone release, but it remains unknown whether miRNAs affect ovarian functions via transcription factors. We examined the effect of miRNAs on nuclear factor-κappaB (NF-kB) (p65) expression in human ovarian luteinized granulosa cells. We transfected cultured primary human ovarian luteinized granulosa cells with 80 different constructs encoding human pre-miRNAs and then evaluated NF-kB (p65) expression (percentage of cells containing p65) by immunocytochemistry. We found that 21 of the constructs stimulated NF-kB (p65) expression and 18 of the constructs inhibited NF-kB (p65) expression. This is the first direct demonstration that miRNAs affect NF-kB (p65) expression and the first genome-scale miRNA screen to identify upregulation and downregulation of NF-kB accumulation by miRNAs in the ovary. Novel miRNAs that affect the NF-kB signalling pathway could be useful for the control of NF-kB-dependent reproductive processes and the treatment of NF-kB-dependent reproductive disorders. PMID:25403593

  9. Taylor-Couette flow control using the outer cylinder cross-section variation strategy

    NASA Astrophysics Data System (ADS)

    Oualli, Hamid; Lalaoua, Adel; Hanchi, Samir; Bouabdallah, Ahcene

    2013-01-01

    A numerical study of a controlled flow evolving in a Taylor-Couette system is presented in this paper. The study is devoted to investigate the effect of the outer cylinder cross-section variation on the flow behavior. It is aimed to make assessment of the flow response in terms of the criticality of the early transitional flow regimes and the accompanying flow topology alterations. The numerical simulations are carried out on the Fluent software package for a three-dimensional incompressible flow. The basic system is characterized by a height H = 200 mm, a ratio of the inner to the outer cylinders radii η = 0.9, an aspect ratio corresponding to the cylinders height reported to the gap length Г = 40 and a ratio of the gap to the radius of the inner cylinder δ = 0.1. The numerical deformation of the outer cylinder is executed using the dynamic mesh program according to a predefined function implemented in a homemade program as an UDF (user defined function). It is established that the first instability mode of transition is retarded from Tac1 = 41.33, corresponding to the first Taylor number critical value, to Tac1 = 70 when the deforming amplitude is equal to 15% the external cylinder diameter value. This flow relaminarization process is accompanied by substantial modifications in the flow behavior and configuration.

  10. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  11. Identification of microRNAs by small RNA deep sequencing for synthetic microRNA mimics to control Spodoptera exigua.

    PubMed

    Zhang, Yu Liang; Huang, Qi Xing; Yin, Guo Hua; Lee, Samantha; Jia, Rui Zong; Liu, Zhi Xin; Yu, Nai Tong; Pennerman, Kayla K; Chen, Xin; Guo, An Ping

    2015-02-25

    Beet armyworm, Spodoptera exigua, is a major pest of cotton around the world. With the increase of resistance to Bacillus thuringiensis (Bt) toxin in transgenic cotton plants, there is a need to develop an alternative control approach that can be used in combination with Bt transgenic crops as part of resistance management strategies. MicroRNAs (miRNAs), a non-coding small RNA family (18-25 nt), play crucial roles in various biological processes and over-expression of miRNAs has been shown to interfere with the normal development of insects. In this study, we identified 127 conserved miRNAs in S. exigua by using small RNA deep sequencing technology. From this, we tested the effects of 11 miRNAs on larval development. We found three miRNAs, Sex-miR-10-1a, Sex-miR-4924, and Sex-miR-9, to be differentially expressed during larval stages of S. exigua. Oral feeding experiments using synthetic miRNA mimics of Sex-miR-10-1a, Sex-miR-4924, and Sex-miR-9 resulted in suppressed growth of S. exigua and mortality. Over-expression of Sex-miR-4924 caused a significant reduction in the expression level of chitinase 1 and caused abortive molting in the insects. Therefore, we demonstrated a novel approach of using miRNA mimics to control S. exigua development. PMID:25528266

  12. Negative Feedback Loops Involving Small Regulatory RNAs Precisely Control the Vibrio harveyi Quorum-Sensing Response

    PubMed Central

    Tu, Kimberly C.; Long, Tao; Svenningsen, Sine L.; Wingreen, Ned S.; Bassler, Bonnie L.

    2010-01-01

    Summary Quorum sensing (QS) bacteria assess population density through secretion and detection of molecules called autoinducers (AIs). We identify and characterize two Vibrio harveyi negative feedback loops that facilitate precise transitions between low-cell-density (LCD) and high-cell-density (HCD) states. The QS central regulator LuxO autorepresses its own transcription and the Qrr small regulatory RNAs (sRNAs) posttranscriptionally repress luxO. Disrupting feedback increases the concentration of AIs required for cells to transit from LCD to HCD QS modes. Thus, the two cooperative negative feedback loops determine the point at which V. harveyi has reached a quorum and control the range of AIs over which the transition occurs. Negative feedback regulation also constrains the range of QS output – by preventing sRNA levels from becoming too high and preventing luxO mRNA levels from reaching zero. We suggest that sRNA-mediated feedback regulation is a network design feature that permits fine-tuning of gene regulation and maintenance of homeostasis. PMID:20188674

  13. Local structural controls on outer-rise faulting, hydration, and seismicity in the Alaska subduction zone

    NASA Astrophysics Data System (ADS)

    Shillington, D. J.; Becel, A.; Nedimovic, M. R.; Kuehn, H.; Webb, S. C.; Li, J.; Keranen, K. M.; Abers, G. A.

    2013-12-01

    We present evidence from marine geophysical data that pre-existing structures in the incoming oceanic plate off the Alaska Peninsula control bending faulting and hydration at the outer rise, which in turn correlate to changes in the abundance of interplate and intermediate-depth earthquakes within the subduction zone. Thus, pre-existing heterogeneities in the downgoing plate can result in significant variations in plate hydration over relatively small distances and may in part explain the observed global diversity of seismicity in subduction zones. ALEUT MCS and bathymetry data reveal large changes in the style and amount of bending in the incoming plate. To the west, outboard of the Shumagin Gap, there is significant bending faulting, with fault offsets up to ~250 m at the seafloor and larger offsets at depth. Faults create rugged topography at the seafloor, and sediment cover is thin (~0.5 km). Most faults have strikes within ~25 degrees of the trench. In contrast, the downgoing plate outboard of the Semidi segment to the east exhibits less dramatic bending faulting, with maximum offsets at the seafloor of 30 m, and the sediment cover is thicker (>1 km). These along-strike changes in faulting correlate with changes in the expected orientation of pre-existing structures in the incoming oceanic crust, which is nearly parallel to the trench near the Shumagin Gap, but highly oblique to the trench near the Semidi segment. This implies that more favorably-oriented pre-existing structures may facilitate bending faulting. P-wave velocity models from wide-angle seismic data reveal that along-strike changes in faulting are accompanied by variations in the velocity structure of the incoming plate. Mantle velocities are reduced by ~0.5 km/s at the outer rise off the Shumagin Gap, where significant bending faulting is observed. We interpret decreased velocities to represent serpentinization of the upper mantle. In contrast, the velocity structure is more variable off the

  14. Regulatory RNAs controlling vascular (dys)function by affecting TGF-ß family signalling

    PubMed Central

    Kurakula, Kondababu; Goumans, Marie-Jose; ten Dijke, Peter

    2015-01-01

    Cardiovascular disease (CVD) is a leading cause of morbidity and mortality worldwide. Over the last few years, microRNAs (miRNAs) have emerged as master regulators of gene expression in cardiovascular biology and disease. miRNAs are small endogenous non-coding RNAs that usually bind to 3′ untranslated region (UTR) of their target mRNAs and inhibit mRNA stability or translation of their target genes. miRNAs play a dynamic role in the pathophysiology of many CVDs through their effects on target mRNAs in vascular cells. Recently, numerous miRNAs have been implicated in the regulation of the transforming growth factor-β (TGF-β)/bone morphogenetic protein (BMP) signalling pathway which plays crucial roles in diverse biological processes, and is involved in pathogenesis of many diseases including CVD. This review gives an overview of current literature on the role of miRNAs targeting TGF-β/BMP signalling in vascular cells, including endothelial cells and smooth muscle cells. We also provide insight into how this miRNA-mediated regulation of TGF-β/BMP signalling might be used to harness CVD. PMID:26862319

  15. RNase-L control of cellular mRNAs: roles in biologic functions and mechanisms of substrate targeting.

    PubMed

    Brennan-Laun, Sarah E; Ezelle, Heather J; Li, Xiao-Ling; Hassel, Bret A

    2014-04-01

    RNase-L is a mediator of type 1 interferon-induced antiviral activity that has diverse and critical cellular roles, including the regulation of cell proliferation, differentiation, senescence and apoptosis, tumorigenesis, and the control of the innate immune response. Although RNase-L was originally shown to mediate the endonucleolytic cleavage of both viral and ribosomal RNAs in response to infection, more recent evidence indicates that RNase-L also functions in the regulation of cellular mRNAs as an important mechanism by which it exerts its diverse biological functions. Despite this growing body of work, many questions remain regarding the roles of mRNAs as RNase-L substrates. This review will survey known and putative mRNA substrates of RNase-L, propose mechanisms by which it may selectively cleave these transcripts, and postulate future clinical applications. PMID:24697205

  16. RNase-L Control of Cellular mRNAs: Roles in Biologic Functions and Mechanisms of Substrate Targeting

    PubMed Central

    Brennan-Laun, Sarah E.; Ezelle, Heather J.; Li, Xiao-Ling

    2014-01-01

    RNase-L is a mediator of type 1 interferon-induced antiviral activity that has diverse and critical cellular roles, including the regulation of cell proliferation, differentiation, senescence and apoptosis, tumorigenesis, and the control of the innate immune response. Although RNase-L was originally shown to mediate the endonucleolytic cleavage of both viral and ribosomal RNAs in response to infection, more recent evidence indicates that RNase-L also functions in the regulation of cellular mRNAs as an important mechanism by which it exerts its diverse biological functions. Despite this growing body of work, many questions remain regarding the roles of mRNAs as RNase-L substrates. This review will survey known and putative mRNA substrates of RNase-L, propose mechanisms by which it may selectively cleave these transcripts, and postulate future clinical applications. PMID:24697205

  17. Characterization of Small RNAs Derived from tRNAs, rRNAs and snoRNAs and Their Response to Heat Stress in Wheat Seedlings

    PubMed Central

    Sun, Qixin; Yao, Yingyin

    2016-01-01

    Small RNAs (sRNAs) derived from non-coding RNAs (ncRNAs), such as tRNAs, rRNAs and snoRNAs, have been identified in various organisms. Several observations have indicated that cleavage of tRNAs and rRNAs is induced by various stresses. To clarify whether sRNAs in wheat derived from tRNAs (stRNAs), rRNAs (srRNAs) and snoRNAs (sdRNAs) are produced specifically in association with heat stress responses, we carried out a bioinformatic analysis of sRNA libraries from wheat seedlings and performed comparisons between control and high-temperature-treated samples to measure the differential abundance of stRNAs, srRNAs and sdRNAs. We found that the production of sRNAs from tRNAs, 5.8S rRNAs, and 28S rRNAs was more specific than that from 5S rRNAs and 18S rRNAs, and more than 95% of the stRNAs were processed asymmetrically from the 3’ or 5’ ends of mature tRNAs. We identified 333 stRNAs and 8,822 srRNAs that were responsive to heat stress. Moreover, the expression of stRNAs derived from tRNA-Val-CAC, tRNA-Thr-UGU, tRNA-Tyr-GUA and tRNA-Ser-UGA was not only up-regulated under heat stress but also induced by osmotic stress, suggesting that the increased cleavage of tRNAs might be a mechanism that developed in wheat seedlings to help them cope with adverse environmental conditions. PMID:26963812

  18. A Shigella flexneri virulence plasmid encoded factor controls production of outer membrane vesicles.

    PubMed

    Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R

    2014-12-01

    Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474

  19. A Shigella flexneri Virulence Plasmid Encoded Factor Controls Production of Outer Membrane Vesicles

    PubMed Central

    Sidik, Saima; Kottwitz, Haila; Benjamin, Jeremy; Ryu, Julie; Jarrar, Ameer; Garduno, Rafael; Rohde, John R.

    2014-01-01

    Shigella spp. use a repertoire of virulence plasmid-encoded factors to cause shigellosis. These include components of a Type III Secretion Apparatus (T3SA) that is required for invasion of epithelial cells and many genes of unknown function. We constructed an array of 99 deletion mutants comprising all genes encoded by the virulence plasmid (excluding those known to be required for plasmid maintenance) of Shigella flexneri. We screened these mutants for their ability to bind the dye Congo red: an indicator of T3SA function. This screen focused our attention on an operon encoding genes that modify the cell envelope including virK, a gene of partially characterized function. We discovered that virK is required for controlled release of proteins to the culture supernatant. Mutations in virK result in a temperature-dependent overproduction of outer membrane vesicles (OMVs). The periplasmic chaperone/protease DegP, a known regulator of OMV production in Escherichia coli (encoded by a chromosomal gene), was found to similarly control OMV production in S. flexneri. Both virK and degP show genetic interactions with mxiD, a structural component of the T3SA. Our results are consistent with a model in which VirK and DegP relieve the periplasmic stress that accompanies assembly of the T3SA. PMID:25378474

  20. Processes controlling the characteristics of the surficial sand sheet, U.S. Atlantic outer continental shelf

    USGS Publications Warehouse

    Knebel, H. J.

    1981-01-01

    A review of recent data on the velocity of bottom currents, the frequency of bottom-sediment movement, the kinds and amounts of suspended sediments in near-bottom waters, and the acoustic and sedimentary features of subbottom strata indicates that the characteristics of the ubiquitous sand sheet on the Atlantic outer continental shelf of the United States have been controlled by a variety of past and present processes. Although these processes collectively have had a widespread effect on the characteristics of the sand sheet, the relative importance of each process changes geographically. On Georges Bank, late Pleistocene glaciations along with modern tidal currents and the regional circulation pattern have played a dominant role. On the Middle Atlantic shelf, ancestral rivers, former near-shore processes, and modern wind- and wave-generated currents are important factors. On the South Atlantic shelf, the sediments reflect subaerial weathering, erosion or nondeposition over or near hardgrounds, and the production of biogenic carbonate. Other processes such as the movement of water masses, bioturbation, and bottom fishing probably have affected the sediments in all areas. A knowledge of the various factors affecting the sand sheet is fundamental to an understanding of its general geologic history and to the paleoenvironmental interpretation of ancient sand strata. ?? 1981.

  1. [Non-coding RNAs and diseases].

    PubMed

    Huang, Y; Wang, J P; Yu, X L; Wang, Z V; Xu, T S; Cheng, X C

    2013-01-01

    With the completion of large scale genomic sequencing, a great number of non-conding RNAs (ncRNAs) have been discovered and capture the attention of the biological sciences community. All known ncRNAs may be divided into two groups, namely: i) small ncRNAs, which comprise microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs) and short interfering RNAs (siRNAs), and ii) several thousands of long ncRNAs (IncRNAs). NcRNAs were shown to be involved in eukaryotic growth and development, cell proliferation and differentiation, apoptosis, epigenetic modifications, and also the complex control and pathogenesis of various diseases. In this paper, knowledge on the ncRNAs, which functioning is associated with human diseases, has been summarized. PMID:24466743

  2. Bicaudal-C spatially controls translation of vertebrate maternal mRNAs

    PubMed Central

    Zhang, Yan; Cooke, Amy; Park, Sookhee; Dewey, Colin N.; Wickens, Marvin; Sheets, Michael D.

    2013-01-01

    The Xenopus Cripto-1 protein is confined to the cells of the animal hemisphere during early embryogenesis where it regulates the formation of anterior structures. Cripto-1 protein accumulates only in animal cells because cripto-1 mRNA in cells of the vegetal hemisphere is translationally repressed. Here, we show that the RNA binding protein, Bicaudal-C (Bic-C), functioned directly in this vegetal cell-specific repression. While Bic-C protein is normally confined to vegetal cells, ectopic expression of Bic-C in animal cells repressed a cripto-1 mRNA reporter and associated with endogenous cripto-1 mRNA. Repression by Bic-C required its N-terminal domain, comprised of multiple KH motifs, for specific binding to relevant control elements within the cripto-1 mRNA and a functionally separable C-terminal translation repression domain. Bic-C-mediated repression required the 5′ CAP and translation initiation factors, but not a poly(A) tail or the conserved SAM domain within Bic-C. Bic-C-directed immunoprecipitation followed by deep sequencing of associated mRNAs identified multiple Bic-C-regulated mRNA targets, including cripto-1 mRNA, providing new insights and tools for understanding the role of Bic-C in vertebrate development. PMID:24062572

  3. A Multi-RNAi Microsponge Platform for Simultaneous Controlled Delivery of Multiple Small Interfering RNAs.

    PubMed

    Roh, Young Hoon; Deng, Jason Z; Dreaden, Erik C; Park, Jae Hyon; Yun, Dong Soo; Shopsowitz, Kevin E; Hammond, Paula T

    2016-03-01

    Packaging multiple small interfering RNA (siRNA) molecules into nanostructures at precisely defined ratios is a powerful delivery strategy for effective RNA interference (RNAi) therapy. We present a novel RNA nanotechnology based approach to produce multiple components of polymerized siRNA molecules that are simultaneously self-assembled and densely packaged into composite sponge-like porous microstructures (Multi-RNAi-MSs) by rolling circle transcription. The Multi-RNAi-MSs were designed to contain a combination of multiple polymeric siRNA molecules with precisely controlled stoichiometry within a singular microstructure by manipulating the types and ratios of the circular DNA templates. The Multi-RNAi-MSs were converted into nanosized complexes by polyelectrolyte condensation to manipulate their physicochemical properties (size, shape, and surface charge) for favorable delivery, while maintaining the multifunctional properties of the siRNAs for combined therapeutic effects. These Multi-RNAi-MS systems have great potential in RNAi-mediated biomedical applications, for example, for the treatment of cancer, genetic disorders, and viral infections. PMID:26695874

  4. TUT7 controls the fate of precursor microRNAs by using three different uridylation mechanisms

    PubMed Central

    Kim, Boseon; Ha, Minju; Loeff, Luuk; Chang, Hyeshik; Simanshu, Dhirendra K; Li, Sisi; Fareh, Mohamed; Patel, Dinshaw J; Joo, Chirlmin; Kim, V Narry

    2015-01-01

    Terminal uridylyl transferases (TUTs) function as integral regulators of microRNA (miRNA) biogenesis. Using biochemistry, single-molecule, and deep sequencing techniques, we here investigate the mechanism by which human TUT7 (also known as ZCCHC6) recognizes and uridylates precursor miRNAs (pre-miRNAs) in the absence of Lin28. We find that the overhang of a pre-miRNA is the key structural element that is recognized by TUT7 and its paralogues, TUT4 (ZCCHC11) and TUT2 (GLD2/PAPD4). For group II pre-miRNAs, which have a 1-nt 3′ overhang, TUT7 restores the canonical end structure (2-nt 3′ overhang) through mono-uridylation, thereby promoting miRNA biogenesis. For pre-miRNAs where the 3′ end is further recessed into the stem (as in 3′ trimmed pre-miRNAs), TUT7 generates an oligo-U tail that leads to degradation. In contrast to Lin28-stimulated oligo-uridylation, which is processive, a distributive mode is employed by TUT7 for both mono- and oligo-uridylation in the absence of Lin28. The overhang length dictates the frequency (but not duration) of the TUT7-RNA interaction, thus explaining how TUT7 differentiates pre-miRNA species with different overhangs. Our study reveals dual roles and mechanisms of uridylation in repair and removal of defective pre-miRNAs. PMID:25979828

  5. Rbfox3 Controls the Biogenesis of a Subset of MicroRNAs

    PubMed Central

    Kim, Kee K.; Yang, Yanqin; Zhu, Jun; Adelstein, Robert S.; Kawamoto, Sachiyo

    2014-01-01

    RNA-binding proteins (RBPs) regulate numerous aspects of gene expression, thus identification of endogenous targets of RBPs is important for understanding their functions in cells. Here we identified transcriptome-wide targets of Rbfox3 in neuronally differentiated P19 cells and mouse brain using Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation (PAR-CLIP). Although Rbfox3 is known to regulate pre-mRNA splicing through binding to the UGCAUG motif, PAR-CLIP analysis revealed diverse Rbfox3 targets including primary-microRNAs (pri-miRNAs) which lack the UGCAUG motif. Induced expression and depletion of Rbfox3 led to changes in the expression levels of a subset of PAR-CLIP-detected miRNAs. In vitro analyses revealed that Rbfox3 functions as a positive and a negative regulator at the stage of pri-miRNA processing to precursor-miRNA. Rbfox3 binds directly to pri-miRNAs and regulates the recruitment of the microprocessor complex to pri-miRNAs. Our study proposes a novel function for Rbfox3 in miRNA biogenesis. PMID:25240799

  6. New Neurons in Aging Brains: Molecular Control by Small Non-Coding RNAs

    PubMed Central

    Schouten, Marijn; Buijink, M. Renate; Lucassen, Paul J.; Fitzsimons, Carlos P.

    2012-01-01

    Adult neurogenesis generates functional neurons from neural stem cells present in specific brain regions. It is largely confined to two main regions: the subventricular zone of the lateral ventricle, and the subgranular zone of the dentate gyrus (DG), in the hippocampus. With age, the function of the hippocampus and particularly the DG is impaired. For instance, adult neurogenesis is decreased with aging, in both proliferating and differentiation of newborn cells, while in parallel an age-associated decline in cognitive performance is often seen. Surprisingly, the synaptogenic potential of adult-born neurons is only marginally influenced by aging. Therefore, although proliferation, differentiation, and synaptogenesis of adult-born new neurons in the DG are closely related to each other, they are differentially affected by aging. In this review we discuss the crucial roles of a novel class of recently discovered modulators of gene expression, the small non-coding RNAs, in the regulation of adult neurogenesis. Multiple small non-coding RNAs are differentially expressed in the hippocampus. In particular a subgroup of the small non-coding RNAs, the microRNAs, fine-tune the progression of adult neurogenesis. This makes small non-coding RNAs appealing candidates to orchestrate the functional alterations in adult neurogenesis and cognition associated with aging. Finally, we summarize observations that link changes in circulating levels of steroid hormones with alterations in adult neurogenesis, cognitive decline, and vulnerability to psychopathology in advanced age, and discuss a potential interplay between steroid hormone receptors and microRNAs in cognitive decline in aging individuals. PMID:22363255

  7. Kinetochore function is controlled by a phospho-dependent coexpansion of inner and outer components

    PubMed Central

    Wynne, David J.

    2015-01-01

    It is widely accepted that the kinetochore is built on CENP-A–marked centromeric chromatin in a hierarchical order from inner to outer kinetochore. Recruitment of many kinetochore proteins depends on microtubule attachment status, but it remains unclear how their assembly/disassembly is orchestrated. Applying 3D structured illumination microscopy to Xenopus laevis egg extracts, here we reveal that in the absence of microtubule attachment, proteins responsible for lateral attachment and spindle checkpoint signaling expand to form micrometer-scale fibrous structures over CENP-A–free chromatin, whereas a core module responsible for end-on attachment (CENP-A, CENP-T, and Ndc80) does not. Both outer kinetochore proteins (Bub1, BubR1, Mad1, and CENP-E) and the inner kinetochore component CENP-C are integral components of the expandable module, whose assembly depends on multiple mitotic kinases (Aurora B, Mps1, and Plx1) and is suppressed by protein phosphatase 1. We propose that phospho-dependent coexpansion of CENP-C and outer kinetochore proteins promotes checkpoint signal amplification and lateral attachment, whereas their selective disassembly enables the transition to end-on attachment. PMID:26347137

  8. Kinetochore function is controlled by a phospho-dependent coexpansion of inner and outer components.

    PubMed

    Wynne, David J; Funabiki, Hironori

    2015-09-14

    It is widely accepted that the kinetochore is built on CENP-A-marked centromeric chromatin in a hierarchical order from inner to outer kinetochore. Recruitment of many kinetochore proteins depends on microtubule attachment status, but it remains unclear how their assembly/disassembly is orchestrated. Applying 3D structured illumination microscopy to Xenopus laevis egg extracts, here we reveal that in the absence of microtubule attachment, proteins responsible for lateral attachment and spindle checkpoint signaling expand to form micrometer-scale fibrous structures over CENP-A-free chromatin, whereas a core module responsible for end-on attachment (CENP-A, CENP-T, and Ndc80) does not. Both outer kinetochore proteins (Bub1, BubR1, Mad1, and CENP-E) and the inner kinetochore component CENP-C are integral components of the expandable module, whose assembly depends on multiple mitotic kinases (Aurora B, Mps1, and Plx1) and is suppressed by protein phosphatase 1. We propose that phospho-dependent coexpansion of CENP-C and outer kinetochore proteins promotes checkpoint signal amplification and lateral attachment, whereas their selective disassembly enables the transition to end-on attachment. PMID:26347137

  9. LncRNAs and cancer

    PubMed Central

    Zhang, Rui; Xia, Li Qiong; Lu, Wen Wen; Zhang, Jing; Zhu, Jin-Shui

    2016-01-01

    Long non-coding RNAs (lncRNAs) are a group of non-coding RNAs composed of >200 nucleotides. Recent studies have revealed that lncRNAs exert an important role in the development and progression of cancer. In this review, the involvement of the most extensively investigated lncRNAs in cancers of the digestive, respiratory, reproductive, urinary and central nervous systems are discussed. LncRNAs function via molecular and biochemical mechanisms that include cis- and trans-regulation of gene expression, epigenetic modulation in the nucleus and post-transcriptional control in the cytoplasm. Although the detailed biological functions and molecular mechanisms of the majority of lncRNAs remain to be elucidated, this review aims to provide a novel insight into the diagnosis and treatment of cancer using lncRNAs. PMID:27446422

  10. Riboswitch RNAs

    PubMed Central

    Smith, Angela M.; Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2016-01-01

    Riboswitches are cis-encoded, cis-acting RNA elements that directly sense a physiological signal. Signal response results in a change in RNA structure that impacts gene expression. Elements of this type play an important role in bacteria, where they regulate a variety of fundamental cellular pathways. Riboswitch-mediated gene regulation most commonly occurs by effects on transcription attenuation, to control whether a full-length transcript is synthesized, or on translation initiation, in which case the transcript is constitutively synthesized but binding of the translation initiation complex is modulated. An overview of the role of riboswitch RNAs in bacterial gene expression will be provided, and a few examples are described in more detail to illustrate the types of mechanisms that have been uncovered. PMID:20061810

  11. MicroRNAs Control Macrophage Formation and Activation: The Inflammatory Link between Obesity and Cardiovascular Diseases

    PubMed Central

    Chang, Richard Cheng-An; Ying, Wei; Bazer, Fuller W.; Zhou, Beiyan

    2014-01-01

    Activation and recruitment of resident macrophages in tissues in response to physiological stress are crucial regulatory processes in promoting the development of obesity-associated metabolic disorders and cardiovascular diseases. Recent studies have provided compelling evidence that microRNAs play important roles in modulating monocyte formation, macrophage maturation, infiltration into tissues and activation. Macrophage-dependent systemic physiological and tissue-specific responses also involve cell-cell interactions between macrophages and host tissue niche cell components, including other tissue-resident immune cell lineages, adipocytes, vascular smooth muscle and others. In this review, we highlight the roles of microRNAs in regulating the development and function of macrophages in the context of obesity, which could provide insights into the pathogenesis of obesity-related metabolic syndrome and cardiovascular diseases. PMID:25014161

  12. Two Virus-Induced MicroRNAs Known Only from Teleost Fishes Are Orthologues of MicroRNAs Involved in Cell Cycle Control in Humans

    PubMed Central

    Schyth, Brian Dall; Bela-ong, Dennis Berbulla; Jalali, Seyed Amir Hossein; Kristensen, Lasse Bøgelund Juel; Einer-Jensen, Katja; Pedersen, Finn Skou; Lorenzen, Niels

    2015-01-01

    MicroRNAs (miRNAs) are ~22 base pair-long non-coding RNAs which regulate gene expression in the cytoplasm of eukaryotic cells by binding to specific target regions in mRNAs to mediate transcriptional blocking or mRNA cleavage. Through their fundamental roles in cellular pathways, gene regulation mediated by miRNAs has been shown to be involved in almost all biological phenomena, including development, metabolism, cell cycle, tumor formation, and host-pathogen interactions. To address the latter in a primitive vertebrate host, we here used an array platform to analyze the miRNA response in rainbow trout (Oncorhynchus mykiss) following inoculation with the virulent fish rhabdovirus Viral hemorrhagic septicaemia virus. Two clustered miRNAs, miR-462 and miR-731 (herein referred to as miR-462 cluster), described only in teleost fishes, were found to be strongly upregulated, indicating their involvement in fish-virus interactions. We searched for homologues of the two teleost miRNAs in other vertebrate species and investigated whether findings related to ours have been reported for these homologues. Gene synteny analysis along with gene sequence conservation suggested that the teleost fish miR-462 and miR-731 had evolved from the ancestral miR-191 and miR-425 (herein called miR-191 cluster), respectively. Whereas the miR-462 cluster locus is found between two protein-coding genes (intergenic) in teleost fish genomes, the miR-191 cluster locus is found within an intron of a protein-coding gene (intragenic) in the human genome. Interferon (IFN)-inducible and immune-related promoter elements found upstream of the teleost miR-462 cluster locus suggested roles in immune responses to viral pathogens in fish, while in humans, the miR-191 cluster functionally associated with cell cycle regulation. Stimulation of fish cell cultures with the IFN inducer poly I:C accordingly upregulated the expression of miR-462 and miR-731, while no stimulatory effect on miR-191 and miR-425

  13. Small RNAs in the control of RpoS, CsgD, and biofilm architecture of Escherichia coli

    PubMed Central

    Mika, Franziska; Hengge, Regine

    2014-01-01

    Amyloid curli fibers and cellulose are extracellular matrix components produced in the stationary phase top layer of E. coli macrocolonies, which confer physical protection, strong cohesion, elasticity, and wrinkled morphology to these biofilms. Curli and cellulose synthesis is controlled by a three-level transcription factor (TF) cascade with the RpoS sigma subunit of RNA polymerase at the top, the MerR-like TF MlrA, and the biofilm regulator CsgD, with two c-di-GMP control modules acting as key switching devices. Additional signal input and fine-tuning is provided by an entire series of small RNAs—ArcZ, DsrA, RprA, McaS, OmrA/OmrB, GcvB, and RydC—that differentially control all three TF modules by direct mRNA interaction. This review not only summarizes the mechanisms of action of these sRNAs, but also addresses the question of how these sRNAs and the regulators they target contribute to building the intriguing three-dimensional microarchitecture and macromorphology of these biofilms. PMID:25028968

  14. Neuronal BC RNAs cooperate with eIF4B to mediate activity-dependent translational control

    PubMed Central

    Eom, Taesun; Muslimov, Ilham A.; Tsokas, Panayiotis; Berardi, Valerio; Zhong, Jun; Sacktor, Todd C.

    2014-01-01

    In neurons, translational regulation of gene expression has been implicated in the activity-dependent management of synapto-dendritic protein repertoires. However, the fundamentals of stimulus-modulated translational control in neurons remain poorly understood. Here we describe a mechanism in which regulatory brain cytoplasmic (BC) RNAs cooperate with eukaryotic initiation factor 4B (eIF4B) to control translation in a manner that is responsive to neuronal activity. eIF4B is required for the translation of mRNAs with structured 5′ untranslated regions (UTRs), exemplified here by neuronal protein kinase Mζ (PKMζ) mRNA. Upon neuronal stimulation, synapto-dendritic eIF4B is dephosphorylated at serine 406 in a rapid process that is mediated by protein phosphatase 2A. Such dephosphorylation causes a significant decrease in the binding affinity between eIF4B and BC RNA translational repressors, enabling the factor to engage the 40S small ribosomal subunit for translation initiation. BC RNA translational control, mediated via eIF4B phosphorylation status, couples neuronal activity to translational output, and thus provides a mechanistic basis for long-term plastic changes in nerve cells. PMID:25332164

  15. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids.

    PubMed

    Zhang, Jiang; Khan, Sher Afzal; Hasse, Claudia; Ruf, Stephanie; Heckel, David G; Bock, Ralph

    2015-02-27

    Double-stranded RNAs (dsRNAs) targeted against essential genes can trigger a lethal RNA interference (RNAi) response in insect pests. The application of this concept in plant protection is hampered by the presence of an endogenous plant RNAi pathway that processes dsRNAs into short interfering RNAs. We found that long dsRNAs can be stably produced in chloroplasts, a cellular compartment that appears to lack an RNAi machinery. When expressed from the chloroplast genome, dsRNAs accumulated to as much as 0.4% of the total cellular RNA. Transplastomic potato plants producing dsRNAs targeted against the β-actin gene of the Colorado potato beetle, a notorious agricultural pest, were protected from herbivory and were lethal to its larvae. Thus, chloroplast expression of long dsRNAs can provide crop protection without chemical pesticides. PMID:25722411

  16. Noncoding Regulatory RNAs in Hematopoiesis.

    PubMed

    Jeong, M; Goodell, M A

    2016-01-01

    Hematopoiesis is a dynamic process in which blood cells are continuously generated from hematopoietic stem cells (HSCs). The regulatory mechanisms controlling HSC fate have been studied extensively over the past several decades. Although many protein-coding genes have been shown to regulate hematopoietic differentiation, additional levels of HSC regulation are not well studied. Advances in deep sequencing have revealed many new classes of regulatory noncoding RNAs (ncRNAs), such as enhancer RNAs and antisense ncRNAs. Functional analysis of some of these ncRNAs has provided insights into the molecular mechanisms that regulate hematopoietic development and disease. In this review, we summarize recent advances in our understanding of functional regulatory ncRNAs associated with hematopoietic self-renewal and differentiation, as well as those dysregulated ncRNAs involved in hematologic malignancies. PMID:27137659

  17. TSPO, a Mitochondrial Outer Membrane Protein, Controls Ethanol-Related Behaviors in Drosophila

    PubMed Central

    Lin, Ran; Rittenhouse, Danielle; Sweeney, Katelyn; Potluri, Prasanth; Wallace, Douglas C.

    2015-01-01

    The heavy consumption of ethanol can lead to alcohol use disorders (AUDs) which impact patients, their families, and societies. Yet the genetic and physiological factors that predispose humans to AUDs remain unclear. One hypothesis is that alterations in mitochondrial function modulate neuronal sensitivity to ethanol exposure. Using Drosophila genetics we report that inactivation of the mitochondrial outer membrane translocator protein 18kDa (TSPO), also known as the peripheral benzodiazepine receptor, affects ethanol sedation and tolerance in male flies. Knockdown of dTSPO in adult male neurons results in increased sensitivity to ethanol sedation, and this effect requires the dTSPO depletion-mediated increase in reactive oxygen species (ROS) production and inhibition of caspase activity in fly heads. Systemic loss of dTSPO in male flies blocks the development of tolerance to repeated ethanol exposures, an effect that is not seen when dTSPO is only inactivated in neurons. Female flies are naturally more sensitive to ethanol than males, and female fly heads have strikingly lower levels of dTSPO mRNA than males. Hence, mitochondrial TSPO function plays an important role in ethanol sensitivity and tolerance. Since a large array of benzodiazepine analogues have been developed that interact with the peripheral benzodiazepine receptor, the mitochondrial TSPO might provide an important new target for treating AUDs. PMID:26241038

  18. HALL EFFECT CONTROLLED GAS DYNAMICS IN PROTOPLANETARY DISKS. II. FULL 3D SIMULATIONS TOWARD THE OUTER DISK

    SciTech Connect

    Bai, Xue-Ning

    2015-01-10

    We perform three-dimensional stratified shearing-box magnetohydrodynamic (MHD) simulations on the gas dynamics of protoplanetary disks with a net vertical magnetic flux of B {sub z0}. All three nonideal MHD effects, Ohmic resistivity, the Hall effect, and ambipolar diffusion, are included in a self-consistent manner based on equilibrium chemistry. We focus on regions toward outer disk radii, from 5 to 60 AU, where Ohmic resistivity tends to become negligible, ambipolar diffusion dominates over an extended region across the disk height, and the Hall effect largely controls the dynamics near the disk midplane. We find that at around R = 5 AU the system launches a laminar or weakly turbulent magnetocentrifugal wind when the net vertical field B {sub z0} is not too weak. Moreover, the wind is able to achieve and maintain a configuration with reflection symmetry at the disk midplane. The case with anti-aligned field polarity (Ω⋅B{sub z0}<0) is more susceptible to the magnetorotational instability (MRI) when B {sub z0} decreases, leading to an outflow oscillating in radial directions and very inefficient angular momentum transport. At the outer disk around and beyond R = 30 AU, the system shows vigorous MRI turbulence in the surface layer due to far-UV ionization, which efficiently drives disk accretion. The Hall effect affects the stability of the midplane region to the MRI, leading to strong/weak Maxwell stress for aligned/anti-aligned field polarities. Nevertheless, the midplane region is only very weakly turbulent in both cases. Overall, the basic picture is analogous to the conventional layered accretion scenario applied to the outer disk. In addition, we find that the vertical magnetic flux is strongly concentrated into thin, azimuthally extended shells in most of our simulations beyond 15 AU, leading to enhanced radial density variations know as zonal flows. Theoretical implications and observational consequences are briefly discussed.

  19. MicroRNAs as biomarkers of hepatotoxicity in a randomized placebo-controlled study of simvastatin and ubiquinol supplementation.

    PubMed

    Pek, Sharon Lt; Tavintharan, Subramaniam; Woon, Kaing; Lin, Lifang; Ong, Choon Nam; Lim, Su Chi; Sum, Chee Fang

    2016-02-01

    Statins are potent cholesterol-lowering drugs and are generally well tolerated. Hepatotoxicity is a rare but serious adverse effect of statins; however, its mechanisms are not clear. Coenzyme Q10 deficiency has been suggested, and supplementation of reduced coenzyme Q10 (ubiquinol) has been shown to have hepatoprotective effects. MicroRNAs (miRNAs) are small nucleotides that have been shown to be up-regulated in drug-induced liver injury. We hypothesized that circulating miRNAs may be differentially regulated after simvastatin treatment and by comparing with that of simvastatin and ubiquinol supplementation could potentially uncover signatory miRNA profile for simvastatin-induced liver injury. In this double-blind, prospective, randomized-controlled trial, miRNA profiles and liver enzymes were compared between simvastatin-treated patients, with and without ubiquinol supplementation, over 12 weeks compared to baseline. miRNA expression was further validated in HepG2 liver cell lines by real-time PCR. Changes in miR-192, miR-146a, miR-148a, miR-15a, and miR-21 were positively correlated (p<0.05) with alanine aminotransferase in simvastatin-only treated patients. In ubiquinol supplementation group, alanine aminotransferase and alkaline phosphatase were significantly down-regulated after 12 weeks and changes in miR-15a, miR-21 and miR-33a were negatively correlated with alkaline phosphatase (p < 0.05). Bioinformatics analyses predicted that miRNA regulation in simvastatin group was related to reduce proliferation and adenosine triphosphate-binding cassette transporters. Ubiquinol supplementation additionally regulated miRNAs that inhibit apoptotic and inflammatory pathways, suggesting potential hepatoprotective effects. Our results suggest that 20 mg/day of simvastatin does not have significant risk of hepatotoxicity and ubiquinol supplementation may, at the miRNA level, provide potential beneficial changes to reduce the effects of coenzyme Q10 deficiency in the

  20. Oceanographic controls on sedimentary and geochemical facies on the Peru outer shelf and upper slope

    USGS Publications Warehouse

    Arthur, Michael A.; Dean, Walter E.

    2013-01-01

    Concentrations and characteristics of organic matter in surface sediments deposited under an intense oxygen-minimum zone (OMZ) on the Peru margin were mapped and studied in samples from deck-deployed box cores and push cores acquired by submersible on two east-west transects spanning depths of 75 to 1,000 meters (m) at 12°S and 13.5°S. On the basis of sampling and analyses of the top 1–2 centimeters (cm) of available cores, three main belts of sediments were identified on each transect with increasing depth: (1) muds rich in organic carbon (OC); (2) authigenic phosphatic mineral crusts and pavements; and (3) glaucony facies. Sediments rich in OC on the 12°S transect were mainly located on the outer shelf and upper slope (150–350 m), but they occurred in much shallower water (approximately 100 m) on the 13.5°S transect. The organic matter is almost entirely marine as confirmed by Rock-Eval pyrolysis and isotopic composition of OC. Concentrations of OC are highest (up to 18 percent) in sediments within the OMZ where dissolved oxygen (DO) concentrations are 3+,Al,Mg)2(Si,Al)4O10(OH)2. The glaucony on the 13.5°S transect forms by alteration of one or more original “framework” minerals (carbonate and [or] aluminosilicates) to form pellital aggregates of Fe-, K-, and Mg-rich clay minerals. Because Fe, K, and Mg are derived from seawater, sedimentation rates must be extremely slow in order for the original framework minerals to remain in contact with seawater. The close association of glaucony and phosphorite indicates a delicate balance between the slightly oxidizing conditions at the base of the OMZ that form glaucony and the slightly reducing conditions that mobilize iron and phosphate to form phosphorite.

  1. MicroRNAs and oncogenic transcriptional regulatory networks controlling metabolic reprogramming in cancers.

    PubMed

    Pinweha, Pannapa; Rattanapornsompong, Khanti; Charoensawan, Varodom; Jitrapakdee, Sarawut

    2016-01-01

    Altered cellular metabolism is a fundamental adaptation of cancer during rapid proliferation as a result of growth factor overstimulation. We review different pathways involving metabolic alterations in cancers including aerobic glycolysis, pentose phosphate pathway, de novo fatty acid synthesis, and serine and glycine metabolism. Although oncoproteins, c-MYC, HIF1α and p53 are the major drivers of this metabolic reprogramming, post-transcriptional regulation by microRNAs (miR) also plays an important role in finely adjusting the requirement of the key metabolic enzymes underlying this metabolic reprogramming. We also combine the literature data on the miRNAs that potentially regulate 40 metabolic enzymes responsible for metabolic reprogramming in cancers, with additional miRs from computational prediction. Our analyses show that: (1) a metabolic enzyme is frequently regulated by multiple miRs, (2) confidence scores from prediction algorithms might be useful to help narrow down functional miR-mRNA interaction, which might be worth further experimental validation. By combining known and predicted interactions of oncogenic transcription factors (TFs) (c-MYC, HIF1α and p53), sterol regulatory element binding protein 1 (SREBP1), 40 metabolic enzymes, and regulatory miRs we have established one of the first reference maps for miRs and oncogenic TFs that regulate metabolic reprogramming in cancers. The combined network shows that glycolytic enzymes are linked to miRs via p53, c-MYC, HIF1α, whereas the genes in serine, glycine and one carbon metabolism are regulated via the c-MYC, as well as other regulatory organization that cannot be observed by investigating individual miRs, TFs, and target genes. PMID:27358718

  2. Alterations of prefrontal cortical microRNAs in methamphetamine self-administering rats: From controlled drug intake to escalated drug intake.

    PubMed

    Du, Hao-Yue; Cao, Dan-Ni; Chen, Ying; Wang, Lv; Wu, Ning; Li, Jin

    2016-01-12

    Drug addiction is a process that transits from recreative and regular drug use into compulsive drug use. The two patterns of drug use, controlled drug intake and escalated drug intake, represent different stages in the development of drug addiction; and escalation of drug use is a hallmark of addiction. Accumulating studies indicate that microRNAs (miRNAs) play key regulatory roles in drug addiction. However, the molecular adaptations in escalation of drug use, as well as the difference in the adaptations between escalated and controlled drug use, remain unclear. In the present study, 28 altered miRNAs in the prefrontal cortex (PFC) were found in the groups of controlled methamphetamine self-administration (1h/session) and escalated self-administration (6h/session), and some of them were validated. Compared with saline control group, miR-186 was verified to be up-regulated while miR-195 and miR-329 were down-regulated in the rats with controlled methamphetamine use. In the rats with escalated drug use, miR-127, miR-186, miR-222 and miR-24 were verified to be up-regulated while miR-329 was down-regulated compared with controls. Furthermore, bioinformatic analysis indicated that the predicted targets of these verified miRNAs involved in the processes of neuronal apoptosis and synaptic plasticity. However, the putative regulated molecules may be different between controlled and escalated drug use groups. Taken together, we detected the altered miRNAs in rat PFC under the conditions of controlled methamphetamine use and escalated use respectively, which may extend our understanding of the molecular adaptations underlying the transition from controlled drug use to addiction. PMID:26592480

  3. MicroRNAs and atherosclerosis

    PubMed Central

    Madrigal-Matute, Julio; Rotllan, Noemi; Aranda, Juan F.; Fernández-Hernando, Carlos

    2014-01-01

    MicroRNAs (miRNAs) are small (~22nucleotide) sequences of RNA that regulate gene expression at posttranscriptional level. MiRNA/mRNA base pairing complementarity provokes mRNA decay and consequent gene silencing. These endogenous gene expression inhibitors were primarily described in cancer but recent exciting findings have also demonstrated a key role in cardiovascular diseases (CVDs) including atherosclerosis. MiRNAs controls endothelial cell (EC), vascular smooth muscle cell (VSMC) and macrophage functions, and thereby regulate the progression of atherosclerosis. MiRNAs expression is modulated by different stimuli involved in every stage of atherosclerosis and conversely miRNAs modulates several pathways implicated in plaque development such as cholesterol metabolism. In the present review, we focus on the importance of miRNAs in atherosclerosis and we further discuss their potential use as biomarkers and therapeutic targets in CVDs. PMID:23512606

  4. Non-coding RNAs and atherosclerosis

    PubMed Central

    Fernández-Hernando, Carlos

    2014-01-01

    Non-coding RNAs (ncRNAs) represent a class of RNA molecules that typically do not code for proteins. Emerging data suggest that ncRNAs play an important role in several physiological and pathological conditions such as cancer and cardiovascular diseases (CVDs) including atherosclerosis. The best-characterized ncRNAs are the microRNAs (miRNAs), which are small, ~22 nucleotide (nt) sequences of RNA that regulate gene expression at the posttranscriptional level through transcript degradation or translational repression. MiRNAs control several aspects of atherosclerosis including endothelial cell, vascular smooth cell, and macrophage functions as well as lipoprotein metabolism. Apart from miRNAs, recently ncRNAs, especially long ncRNAs (lncRNAs), have emerged as important potential regulators of the progression of atherosclerosis. However, the molecular mechanism of their regulation and function as well as significance of other ncRNAs such as small nucleolar RNAs (snoRNAs) during atherogenesis is largely unknown. In this review, we summarize the recent findings in the field, highlighting the importance of ncRNAs in atherosclerosis and discuss their potential use as therapeutic targets in CVDs. PMID:24623179

  5. Powerful inner/outer controlled multi-target magnetic nanoparticle drug carrier prepared by liquid photo-immobilization

    PubMed Central

    Guan, Yan-Qing; Zheng, Zhe; Huang, Zheng; Li, Zhibin; Niu, Shuiqin; Liu, Jun-Ming

    2014-01-01

    Nanomagnetic materials offer exciting avenues for advancing cancer therapies. Most researches have focused on efficient delivery of drugs in the body by incorporating various drug molecules onto the surface of nanomagnetic particles. The challenge is how to synthesize low toxic nanocarriers with multi-target drug loading. The cancer cell death mechanisms associated with those nanocarriers remain unclear either. Following the cell biology mechanisms, we develop a liquid photo-immobilization approach to attach doxorubicin, folic acid, tumor necrosis factor-α, and interferon-γ onto the oleic acid molecules coated Fe3O4 magnetic nanoparticles to prepare a kind of novel inner/outer controlled multi-target magnetic nanoparticle drug carrier. In this work, this approach is demonstrated by a variety of structural and biomedical characterizations, addressing the anti-cancer effects in vivo and in vitro on the HeLa, and it is highly efficient and powerful in treating cancer cells in a valuable programmed cell death mechanism for overcoming drug resistance. PMID:24845203

  6. Powerful inner/outer controlled multi-target magnetic nanoparticle drug carrier prepared by liquid photo-immobilization

    NASA Astrophysics Data System (ADS)

    Guan, Yan-Qing; Zheng, Zhe; Huang, Zheng; Li, Zhibin; Niu, Shuiqin; Liu, Jun-Ming

    2014-05-01

    Nanomagnetic materials offer exciting avenues for advancing cancer therapies. Most researches have focused on efficient delivery of drugs in the body by incorporating various drug molecules onto the surface of nanomagnetic particles. The challenge is how to synthesize low toxic nanocarriers with multi-target drug loading. The cancer cell death mechanisms associated with those nanocarriers remain unclear either. Following the cell biology mechanisms, we develop a liquid photo-immobilization approach to attach doxorubicin, folic acid, tumor necrosis factor-α, and interferon-γ onto the oleic acid molecules coated Fe3O4 magnetic nanoparticles to prepare a kind of novel inner/outer controlled multi-target magnetic nanoparticle drug carrier. In this work, this approach is demonstrated by a variety of structural and biomedical characterizations, addressing the anti-cancer effects in vivo and in vitro on the HeLa, and it is highly efficient and powerful in treating cancer cells in a valuable programmed cell death mechanism for overcoming drug resistance.

  7. Translational control by 5'-untranslated regions of eukaryotic mRNAs.

    PubMed

    Hinnebusch, Alan G; Ivanov, Ivaylo P; Sonenberg, Nahum

    2016-06-17

    The eukaryotic 5' untranslated region (UTR) is critical for ribosome recruitment to the messenger RNA (mRNA) and start codon choice and plays a major role in the control of translation efficiency and shaping the cellular proteome. The ribosomal initiation complex is assembled on the mRNA via a cap-dependent or cap-independent mechanism. We describe various mechanisms controlling ribosome scanning and initiation codon selection by 5' upstream open reading frames, translation initiation factors, and primary and secondary structures of the 5'UTR, including particular sequence motifs. We also discuss translational control via phosphorylation of eukaryotic initiation factor 2, which is implicated in learning and memory, neurodegenerative diseases, and cancer. PMID:27313038

  8. Novel primate miRNAs co-evolved with ancient target genes in germinal zone specific expression patterns

    PubMed Central

    Arcila, Mary L; Betizeau, Marion; Cambronne, Xiaolu A; Guzman, Elmer; Doerflinger, Nathalie; Bouhallier, Frantz; Zhou, Hongjun; Wu, Bian; Rani, Neha; Bassett, Dani S; Borello, Ugo; Huissoud, Cyril; Goodman, Richard H; Dehay, Colette; Kosik, Kenneth S

    2014-01-01

    Summary Major non primate-primate differences in corticogenesis include the dimensions, precursor lineages and developmental timing of the germinal zones (GZ). microRNAs (miRNAs) of laser dissected GZ compartments and cortical plate (CP) from embryonic E80 macaque visual cortex were deep sequenced. The CP and the GZ including Ventricular Zone (VZ), outer and inner subcompartments of the Outer SubVentricular Zone (OSVZ) in area 17 displayed unique miRNA profiles. miRNAs present in primate, but absent in rodent, contributed disproportionately to the differential expression between GZ sub-regions. Prominent among the validated targets of these miRNAs were cell-cycle and neurogenesis regulators. Co-evolution between the emergent miRNAs and their targets suggested that novel miRNAs became integrated into ancient gene circuitry to exert additional control over proliferation. We conclude that multiple cell-cycle regulatory events contribute to the emergence of primate-specific cortical features, including the OSVZ, generated enlarged supragranular layers, largely responsible for the increased primate cortex computational abilities. PMID:24583023

  9. Novel primate miRNAs coevolved with ancient target genes in germinal zone-specific expression patterns.

    PubMed

    Arcila, Mary L; Betizeau, Marion; Cambronne, Xiaolu A; Guzman, Elmer; Doerflinger, Nathalie; Bouhallier, Frantz; Zhou, Hongjun; Wu, Bian; Rani, Neha; Bassett, Danielle S; Borello, Ugo; Huissoud, Cyril; Goodman, Richard H; Dehay, Colette; Kosik, Kenneth S

    2014-03-19

    Major nonprimate-primate differences in cortico-genesis include the dimensions, precursor lineages, and developmental timing of the germinal zones (GZs). microRNAs (miRNAs) of laser-dissected GZ compartments and cortical plate (CP) from embryonic E80 macaque visual cortex were deep sequenced. The CP and the GZ including ventricular zone (VZ) and outer and inner subcompartments of the outer subventricular zone (OSVZ) in area 17 displayed unique miRNA profiles. miRNAs present in primate, but absent in rodent, contributed disproportionately to the differential expression between GZ subregions. Prominent among the validated targets of these miRNAs were cell-cycle and neurogenesis regulators. Coevolution between the emergent miRNAs and their targets suggested that novel miRNAs became integrated into ancient gene circuitry to exert additional control over proliferation. We conclude that multiple cell-cycle regulatory events contribute to the emergence of primate-specific cortical features, including the OSVZ, generated enlarged supragranular layers, largely responsible for the increased primate cortex computational abilities. PMID:24583023

  10. microRNAs in cancer

    PubMed Central

    Di Leva, Gianpiero; Garofalo, Michela; Croce, Carlo M.

    2014-01-01

    MicroRNAs are small non coding RNAs that typically inhibit the translation and stability of messanger RNAs (mRNAs), controlling genes involved in cellular processes such as inflammation, cell cycle regulation, stress response, differentiation, apoptosis, and migration. Thus, miRNAs have been implicated in the regulation of virtually all signaling circuits within a cell and their dysregulation has been shown to play an essential role in the development and progression of cancer. Here, after a brief description of the miRNA genomics, biogenesis and function, we discuss the effects of miRNA deregulation in the cellular pathways that lead to the progressive conversion of normal cells into cancer cells and the potential to develop new molecular miRNA-targeted therapies. PMID:24079833

  11. Long noncoding RNAs in innate immunity

    PubMed Central

    Zhang, Yuan; Cao, Xuetao

    2016-01-01

    Long noncoding RNAs (lncRNAs) have been shown to play important roles in immune cell development and immune responses through different mechanisms, such as dosage compensation, imprinting, enhancer function, and transcriptional regulation. Although the functions of most lncRNAs are unclear, some lncRNAs have been found to control transcriptional or post-transcriptional regulation of the innate and adaptive immune responses via new methods of protein–protein interactions or pairing with DNA and RNA. Interestingly, increasing evidence has elucidated the importance of lncRNAs in the interaction between hosts and pathogens. In this review, an overview of the lncRNAs modes of action, as well as the important and diversified roles of lncRNAs in immunity, are provided, and an emerging paradigm of lncRNAs in regulating innate immune responses is highlighted. PMID:26277893

  12. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants

    PubMed Central

    Khraiwesh, Basel; Zhu, Jian-Kang; Zhu, Jianhua

    2011-01-01

    Small, non-coding RNAs are a distinct class of regulatory RNAs in plants and animals that control a variety of biological processes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved through a series of pathways. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs control the expression of cognate target genes by binding to reverse complementary sequences, resulting in cleavage or translational inhibition of the target RNAs. siRNAs have a similar structure, function, and biogenesis as miRNAs but are derived from long double-stranded RNAs and can often direct DNA methylation at target sequences. Besides their roles in growth and development and maintenance of genome integrity, small RNAs are also important components in plant stress responses. One way in which plants respond to environmental stress is by modifying their gene expression through the activity of small RNAs. Thus, understanding how small RNAs regulate gene expression will enable researchers to explore the role of small RNAs in biotic and abiotic stress responses. This review focuses on the regulatory roles of plant small RNAs in the adaptive response to stresses. PMID:21605713

  13. Post-Transcriptional Control of the Hypoxic Response by RNA-Binding Proteins and MicroRNAs.

    PubMed

    Gorospe, Myriam; Tominaga, Kumiko; Wu, Xue; Fähling, Michael; Ivan, Mircea

    2011-01-01

    Mammalian gene expression patterns change profoundly in response to low oxygen levels. These changes in gene expression programs are strongly influenced by post-transcriptional mechanisms mediated by mRNA-binding factors: RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we review the RBPs and miRNAs that modulate mRNA turnover and translation in response to hypoxic challenge. RBPs such as HuR (human antigen R), PTB (polypyrimidine tract-binding protein), heterogeneous nuclear ribonucleoproteins (hnRNPs), tristetraprolin, nucleolin, iron-response element-binding proteins (IRPs), and cytoplasmic polyadenylation-element-binding proteins (CPEBs), selectively bind to numerous hypoxia-regulated transcripts and play a major role in establishing hypoxic gene expression patterns. MiRNAs including miR-210, miR-373, and miR-21 associate with hypoxia-regulated transcripts and further modulate the levels of the encoded proteins to implement the hypoxic gene expression profile. We discuss the potent regulation of hypoxic gene expression by RBPs and miRNAs and their integrated actions in the cellular hypoxic response. PMID:21747757

  14. Characterization of Circular RNAs.

    PubMed

    Zhang, Yang; Yang, Li; Chen, Ling-Ling

    2016-01-01

    Accumulated lines of evidence reveal that a large number of circular RNAs are produced in transcriptomes from fruit fly to mouse and human. Unlike linear RNAs shaped with 5' cap and 3' tail, circular RNAs are characterized by covalently closed loop structures without open terminals, thus requiring specific treatments for their identification and validation. Here, we describe a detailed pipeline for the characterization of circular RNAs. It has been successfully applied to the study of circular intronic RNAs derived from intron lariats (ciRNAs) and circular RNAs produced from back spliced exons (circRNAs) in human. PMID:26721494

  15. Dicer-like 3 produces transposable element-associated 24-nt siRNAs that control agricultural traits in rice.

    PubMed

    Wei, Liya; Gu, Lianfeng; Song, Xianwei; Cui, Xiekui; Lu, Zhike; Zhou, Ming; Wang, Lulu; Hu, Fengyi; Zhai, Jixian; Meyers, Blake C; Cao, Xiaofeng

    2014-03-11

    Transposable elements (TEs) and repetitive sequences make up over 35% of the rice (Oryza sativa) genome. The host regulates the activity of different TEs by different epigenetic mechanisms, including DNA methylation, histone H3K9 methylation, and histone H3K4 demethylation. TEs can also affect the expression of host genes. For example, miniature inverted repeat TEs (MITEs), dispersed high copy-number DNA TEs, can influence the expression of nearby genes. In plants, 24-nt small interfering RNAs (siRNAs) are mainly derived from repeats and TEs. However, the extent to which TEs, particularly MITEs associated with 24-nt siRNAs, affect gene expression remains elusive. Here, we show that the rice Dicer-like 3 homolog OsDCL3a is primarily responsible for 24-nt siRNA processing. Impairing OsDCL3a expression by RNA interference caused phenotypes affecting important agricultural traits; these phenotypes include dwarfism, larger flag leaf angle, and fewer secondary branches. We used small RNA deep sequencing to identify 535,054 24-nt siRNA clusters. Of these clusters, ∼82% were OsDCL3a-dependent and showed significant enrichment of MITEs. Reduction of OsDCL3a function reduced the 24-nt siRNAs predominantly from MITEs and elevated expression of nearby genes. OsDCL3a directly targets genes involved in gibberellin and brassinosteroid homeostasis; OsDCL3a deficiency may affect these genes, thus causing the phenotypes of dwarfism and enlarged flag leaf angle. Our work identifies OsDCL3a-dependent 24-nt siRNAs derived from MITEs as broadly functioning regulators for fine-tuning gene expression, which may reflect a conserved epigenetic mechanism in higher plants with genomes rich in dispersed repeats or TEs. PMID:24554078

  16. Clueless is a conserved ribonucleoprotein that binds the ribosome at the mitochondrial outer membrane

    PubMed Central

    Sen, Aditya; Cox, Rachel T.

    2016-01-01

    ABSTRACT Mitochondrial function is tied to the nucleus, in that hundreds of proteins encoded by nuclear genes must be imported into mitochondria. While post-translational import is fairly well understood, emerging evidence supports that mitochondrial site-specific import, or co-translational import, also occurs. However, the mechanism and the extent to which it is used are not fully understood. We have previously shown Clueless (Clu), a conserved multi-domain protein, associates with mitochondrial outer membrane proteins, including Translocase of outer membrane 20, and genetically and physically interacts with the PINK1–Parkin pathway. The human ortholog of Clu, Cluh, was shown to bind nuclear-encoded mitochondrially destined mRNAs. Here we identify the conserved tetratricopeptide domain of Clu as predominantly responsible for binding mRNA. In addition, we show Clu interacts with the ribosome at the mitochondrial outer membrane. Taken together, these data support a model whereby Clu binds to and mitochondrially targets mRNAs to facilitate mRNA localization to the outer mitochondrial membrane, potentially for site-specific or co-translational import. This role may link the presence of efficient mitochondrial protein import to mitochondrial quality control through the PINK1–Parkin pathway. PMID:26834020

  17. Long noncoding RNAs in hematopoiesis

    PubMed Central

    Zhang, Xu; Hu, Wenqian

    2016-01-01

    Mammalian development is under tight control to ensure precise gene expression. Recent studies reveal a new layer of regulation of gene expression mediated by long noncoding RNAs. These transcripts are longer than 200nt that do not have functional protein coding capacity. Interestingly, many of these long noncoding RNAs are expressed with high specificity in different types of cells, tissues, and developmental stages in mammals, suggesting that they may have functional roles in diverse biological processes. Here, we summarize recent findings of long noncoding RNAs in hematopoiesis, which is one of the best-characterized mammalian cell differentiation processes. Then we provide our own perspectives on future studies of long noncoding RNAs in this field. PMID:27508063

  18. Role of Small RNAs in Trypanosomatid Infections

    PubMed Central

    Linhares-Lacerda, Leandra; Morrot, Alexandre

    2016-01-01

    Trypanosomatid parasites survive and replicate in the host by using mechanisms that aim to establish a successful infection and ensure parasite survival. Evidence points to microRNAs as new players in the host-parasite interplay. MicroRNAs are small non-coding RNAs that control proteins levels via post-transcriptional gene down-regulation, either within the cells where they were produced or in other cells via intercellular transfer. These microRNAs can be modulated in host cells during infection and are among the growing group of small regulatory RNAs, for which many classes have been described, including the transfer RNA-derived small RNAs. Parasites can either manipulate microRNAs to evade host-driven damage and/or transfer small RNAs to host cells. In this mini-review, we present evidence for the involvement of small RNAs, such as microRNAs, in trypanosomatid infections which lack RNA interference. We highlight both microRNA profile alterations in host cells during those infections and the horizontal transfer of small RNAs and proteins from parasites to the host by membrane-derived extracellular vesicles in a cell communication mechanism. PMID:27065454

  19. In vitro and ex vivo delivery of short hairpin RNAs for control of hepatitis C viral transcript expression.

    PubMed

    Lonze, Bonnie E; Holzer, Horatio T; Knabel, Matthew K; Locke, Jayme E; DiCamillo, Gregory A; Karhadkar, Sunil S; Montgomery, Robert A; Sun, Zhaoli; Warren, Daniel S; Cameron, Andrew M

    2012-04-01

    Recurrent hepatitis C virus (HCV) infection is the most common cause of graft loss and patient death after transplantation for HCV cirrhosis. Transplant surgeons have access to uninfected explanted livers before transplantation and an opportunity to deliver RNA interference-based protective gene therapy to uninfected grafts. Conserved HCV sequences were used to design short interfering RNAs and test their ability to knockdown HCV transcript expression in an in vitro model, both by transfection and when delivered via an adeno-associated viral vector. In a rodent model of liver transplantation, portal venous perfusion of explanted grafts with an adeno-associated viral vector before transplantation produced detectable short hairpin RNA transcript expression after transplantation. The ability to deliver anti-HCV short hairpin RNAs to uninfected livers before transplantation and subsequent exposure to HCV offers hope for the possibility of preventing the currently inevitable subsequent infection of liver grafts with HCV. PMID:22508787

  20. MicroRNAs and cell cycle of malignant glioma.

    PubMed

    Ouyang, Qing; Xu, Lunshan; Cui, Hongjuan; Xu, Minhui; Yi, Liang

    2016-01-01

    The control of malignant glioma cell cycle by microRNAs (miRNAs) is well established. The deregulation of miRNAs in glioma may contribute to tumor proliferation by directly targeting the critical cell-cycle regulators. Tumor suppressive miRNAs inhibit cell cycle through repressing the expression of positive cell-cycle regulators. However, oncogenic miRNAs promote the cell-cycle progression by targeting cell-cycle negative regulators. Recent studies have identified that transcription factors had involved in the expression of miRNAs. Transcription factors and miRNAs are implicated in regulatory network of glioma cell cycle, the deregulation of these transcription factors might be a cause of the deregulation of miRNAs. Abnormal versions of miRNAs have been implicated in the cell cycle of glioma. Based on those, miRNAs are excellent biomarker candidates and potential targets for therapeutic intervention in glioma. PMID:26000816

  1. Structure and Gene-Silencing Mechanisms of Small Noncoding RNAs

    NASA Astrophysics Data System (ADS)

    Chu, Chia-Ying; Rana, Tariq M.

    Small (19-31-nucleotides) noncoding RNAs were identified in the past 10 years for their distinct function in gene silencing. The best known gene-silencing phenomenon, RNA interference (RNAi), is triggered in a sequence-specific manner by endogenously produced or exogenously introduced small doubled-stranded RNAs. As knowledge of the structure and function of the RNAi machinery has expanded, this phenomenon has become a powerful tool for biochemical research; it has enormous potential for therapeutics. This chapter summarizes significant aspects of three major classes of small noncoding, regulatory RNAs: small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). Here, we focus on the biogenesis of these small RNAs, their structural features and coupled effectors as well as the mechanisms of each small regulatory RNA pathway which reveal fascinating ways by which gene silencing is controlled and fine-tuned at an epigenetic level.

  2. Horizontal Transfer of Small RNAs to and from Plants

    PubMed Central

    Han, Lu; Luan, Yu-Shi

    2015-01-01

    Genetic information is traditionally thought to be transferred from parents to offspring. However, there is evidence indicating that gene transfer can also occur from microbes to higher species, such as plants, invertebrates, and vertebrates. This horizontal transfer can be carried out by small RNAs (sRNAs). sRNAs have been recently reported to move across kingdoms as mobile signals, spreading silencing information toward targeted genes. sRNAs, especially microRNAs (miRNAs) and small interfering RNAs (siRNAs), are non-coding molecules that control gene expression at the transcriptional or post-transcriptional level. Some sRNAs act in a cross-kingdom manner between animals and their parasites, but little is known about such sRNAs associated with plants. In this report, we provide a brief introduction to miRNAs that are transferred from plants to mammals/viruses and siRNAs that are transferred from microbes to plants. Both miRNAs and siRNAs can exert corresponding functions in the target organisms. Additionally, we provide information concerning a host-induced gene silencing system as a potential application that utilizes the transgenic trafficking of RNA molecules to silence the genes of interacting organisms. Moreover, we lay out the controversial views regarding cross-kingdom miRNAs and call for better methodology and experimental design to confirm this unique function of miRNAs. PMID:26697056

  3. Horizontal Transfer of Small RNAs to and from Plants.

    PubMed

    Han, Lu; Luan, Yu-Shi

    2015-01-01

    Genetic information is traditionally thought to be transferred from parents to offspring. However, there is evidence indicating that gene transfer can also occur from microbes to higher species, such as plants, invertebrates, and vertebrates. This horizontal transfer can be carried out by small RNAs (sRNAs). sRNAs have been recently reported to move across kingdoms as mobile signals, spreading silencing information toward targeted genes. sRNAs, especially microRNAs (miRNAs) and small interfering RNAs (siRNAs), are non-coding molecules that control gene expression at the transcriptional or post-transcriptional level. Some sRNAs act in a cross-kingdom manner between animals and their parasites, but little is known about such sRNAs associated with plants. In this report, we provide a brief introduction to miRNAs that are transferred from plants to mammals/viruses and siRNAs that are transferred from microbes to plants. Both miRNAs and siRNAs can exert corresponding functions in the target organisms. Additionally, we provide information concerning a host-induced gene silencing system as a potential application that utilizes the transgenic trafficking of RNA molecules to silence the genes of interacting organisms. Moreover, we lay out the controversial views regarding cross-kingdom miRNAs and call for better methodology and experimental design to confirm this unique function of miRNAs. PMID:26697056

  4. Role of plasma MicroRNAs in the early diagnosis of non-small-cell lung cancers: a case-control study

    PubMed Central

    Wang, Xin; Zhi, Xiuyi; Zhang, Yi; An, Guangyu

    2016-01-01

    Background Lung cancer is a leading cause of cancer death worldwide. Early diagnosis is essential for improvements of prognosis and survival of the patients. Altered expressions in many cancer types including lung cancer and stable existence in plasma make microRNAs (miRNAs) a group of potentially useful biomarkers for clinical assessments of patients with lung cancer. In this study, we evaluate the potential values of miRNAs as plasma biomarkers for early diagnosis in non-small-cell lung cancers (NSCLC) by comparing with other typical plasma biomarkers. Methods We analyzed the clinical and laboratory characteristics of 59 early-staged NSCLC (I–IIIA) patients and non-cancer controls by 1:1 matching age and gender from January 2012 to February 2014 in Xuanwu Hospital, Beijing, China. Peripheral blood samples from patients and controls before surgery were collected, and plasma was separated. Expression of ten miRNAs in the plasma of the patients and controls was detected by quantitative real-time polymerase chain reaction. Other typical markers, such as SCC, CEA, and CYFRA21-1 in plasma were also detected. The early diagnostic ability of miRNAs and other markers were evaluated by receiver-operating-characteristic (ROC) curve analysis. The sensitivity, specificity, and area under the curve were calculated for the cut-off value. Results Plasma CYFRA21-1, miRNA-486 and miRNA-210 levels were significantly different in patients with NSCLC than those in controls (CYFRA21-1: 8.896±7.681 vs. 5.892±6.028, P=0.020; miR-486: 2.778±0.778 vs. 1.746±0.892, P<0.001; miR-210: 4.836±3.374 vs. 2.829±2.503, P<0.001). Area under ROC curve of CYFRA21-1, miR-486 and miR-210 were 0.624 (sensitivity: 0.576, specificity: 0.797), 0.848 (sensitivity: 0.831, specificity: 0.780) and 0.751 (sensitivity: 0.746, specificity: 0.746), respectively. The optimal cut-off value of CYFRA21-1, miRNA-486 and miRNA-210 were 6.595, 1.988 and 3.341, respectively to discriminate patients from controls

  5. Synoptic controls of outer mesoscale convective systems with high impact rainfall in western north pacific tropical cyclones

    NASA Astrophysics Data System (ADS)

    Chen, Buo-Fu; Elsberry, Russell L.; Lee, Cheng-Shang

    2016-02-01

    The generality of our conceptual model of Outer Mesoscale Convective System (OMCS) formation in western North Pacific Tropical Cyclones (TCs) that was based on a case study of Typhoon Fengshen (2008) is examined with a data base of 80 OMCSs during 1999-2009. Formations of 41 "Intersection type (Itype)" OMCSs are similar to our conceptual model in that the key feature is an elongated moisture band in the northerly TC circulation that interacts with the southwest monsoon flow. Two subtypes of these I-type OMCSs are defined based on different formation locations relative to the TC center, and relative to the monsoon flow, that lead to either outward or more cyclonic propagation of the OMCSs. Twenty-five "Upstream type (U-type)" OMCSs form in a similar moisture band, but upstream of the intersection of the outer TC circulation with the monsoon flow. Another 12 "Monsoon type (Mtype)" OMCSs are different from our conceptual model as the formation locations are within the monsoon flow south to the confluence region of TC northerly circulation with the monsoon flow. In all of these OMCSs, the monsoon flow is an important contributor to their climatology and synoptic environment. Expanded conceptual models of where the threat of heavy rainfall associated with the four types of OMCSs may be expected are provided based on different OMCS formation locations relative to the TC center and different propagation vectors in a storm-relative coordinate system.

  6. Progress and prospects of long noncoding RNAs in lipid homeostasis

    PubMed Central

    Chen, Zheng

    2015-01-01

    Background Long noncoding RNAs (lncRNAs) are a novel group of universally present, non-coding RNAs (>200 nt) that are increasingly recognized as key regulators of many physiological and pathological processes. Scope of review Recent publications have shown that lncRNAs influence lipid homeostasis by controlling lipid metabolism in the liver and by regulating adipogenesis. lncRNAs control lipid metabolism-related gene expression by either base-pairing with RNA and DNA or by binding to proteins. Major conclusions The recent advances and future prospects in understanding the roles of lncRNAs in lipid homeostasis are discussed. PMID:26977388

  7. Phase variation of the opacity outer membrane protein controls invasion by Neisseria gonorrhoeae into human epithelial cells.

    PubMed Central

    Makino, S; van Putten, J P; Meyer, T F

    1991-01-01

    Neisseria gonorrhoeae is a facultative intracellular bacterium capable of penetrating into certain human epithelial cell types. In order to identify gonococcal factors essential for invading Chang human conjunctiva cells, a gentamicin selection assay for the quantification of viable intracellular bacteria was used in conjunction with microscopy. The results demonstrate a correlation between the invasive behaviour of gonococci and the expression of Opa proteins, a family of variable outer membrane proteins present in all pathogenic Neisseria species. However, only particular Opa proteins supported invasion into Chang cells as indicated by the use of two unrelated gonococcal strains. Invasion was sensitive to cytochalasin D, and strong adherence mediated by the Opa proteins appeared to be essential for the internalization of gonococci. In contrast pili, which also conferred binding to Chang conjunctiva cells, did not support cellular invasion but rather were inhibitory. Images PMID:1673923

  8. Two conserved arginine residues from the SK3 potassium channel outer vestibule control selectivity of recognition by scorpion toxins.

    PubMed

    Feng, Jing; Hu, Youtian; Yi, Hong; Yin, Shijin; Han, Song; Hu, Jun; Chen, Zongyun; Yang, Weishan; Cao, Zhijian; De Waard, Michel; Sabatier, Jean-Marc; Li, Wenxin; Wu, Yingliang

    2013-05-01

    Potassium channel functions are often deciphered by using selective and potent scorpion toxins. Among these toxins, only a limited subset is capable of selectively blocking small conductance Ca(2+)-activated K(+) (SK) channels. The structural bases of this selective SK channel recognition remain unclear. In this work, we demonstrate the key role of the electric charges of two conserved arginine residues (Arg-485 and Arg-489) from the SK3 channel outer vestibule in the selective recognition by the SK3-blocking BmP05 toxin. Indeed, individually substituting these residues with histidyl or lysyl (maintaining the positive electric charge partially or fully), although decreasing BmP05 affinity, still preserved the toxin sensitivity profile of the SK3 channel (as evidenced by the lack of recognition by many other types of potassium channel-sensitive charybdotoxin). In contrast, when Arg-485 or Arg-489 of the SK3 channel was mutated to an acidic (Glu) or alcoholic (Ser) amino acid residue, the channel lost its sensitivity to BmP05 and became susceptible to the "new" blocking activity by charybdotoxin. In addition to these SK3 channel basic residues important for sensitivity, two acidic residues, Asp-492 and Asp-518, also located in the SK3 channel outer vestibule, were identified as being critical for toxin affinity. Furthermore, molecular modeling data indicate the existence of a compact SK3 channel turret conformation (like a peptide screener), where the basic rings of Arg-485 and Arg-489 are stabilized by strong ionic interactions with Asp-492 and Asp-518. In conclusion, the unique properties of Arg-485 and Arg-489 (spatial orientations and molecular interactions) in the SK3 channel account for its toxin sensitivity profile. PMID:23511633

  9. Thermoelectric Outer Planets Spacecraft (TOPS)

    NASA Technical Reports Server (NTRS)

    1973-01-01

    The research and advanced development work is reported on a ballistic-mode, outer planet spacecraft using radioisotope thermoelectric generator (RTG) power. The Thermoelectric Outer Planet Spacecraft (TOPS) project was established to provide the advanced systems technology that would allow the realistic estimates of performance, cost, reliability, and scheduling that are required for an actual flight mission. A system design of the complete RTG-powered outer planet spacecraft was made; major technical innovations of certain hardware elements were designed, developed, and tested; and reliability and quality assurance concepts were developed for long-life requirements. At the conclusion of its active phase, the TOPS Project reached its principal objectives: a development and experience base was established for project definition, and for estimating cost, performance, and reliability; an understanding of system and subsystem capabilities for successful outer planets missions was achieved. The system design answered long-life requirements with massive redundancy, controlled by on-board analysis of spacecraft performance data.

  10. Non-coding RNAs: Classification, Biology and Functioning.

    PubMed

    Hombach, Sonja; Kretz, Markus

    2016-01-01

    One of the long-standing principles of molecular biology is that DNA acts as a template for transcription of messenger RNAs, which serve as blueprints for protein translation. A rapidly growing number of exceptions to this rule have been reported over the past decades: they include long known classes of RNAs involved in translation such as transfer RNAs and ribosomal RNAs, small nuclear RNAs involved in splicing events, and small nucleolar RNAs mainly involved in the modification of other small RNAs, such as ribosomal RNAs and transfer RNAs. More recently, several classes of short regulatory non-coding RNAs, including piwi-associated RNAs, endogenous short-interfering RNAs and microRNAs have been discovered in mammals, which act as key regulators of gene expression in many different cellular pathways and systems. Additionally, the human genome encodes several thousand long non-protein coding RNAs >200 nucleotides in length, some of which play crucial roles in a variety of biological processes such as epigenetic control of chromatin, promoter-specific gene regulation, mRNA stability, X-chromosome inactivation and imprinting. In this chapter, we will introduce several classes of short and long non-coding RNAs, describe their diverse roles in mammalian gene regulation and give examples for known modes of action. PMID:27573892

  11. The Bicoid Stability Factor Controls Polyadenylation and Expression of Specific Mitochondrial mRNAs in Drosophila melanogaster

    PubMed Central

    Grönke, Sebastian; Stewart, James B.; Mourier, Arnaud; Ruzzenente, Benedetta; Kukat, Christian; Wibom, Rolf; Habermann, Bianca; Partridge, Linda; Larsson, Nils-Göran

    2011-01-01

    The bicoid stability factor (BSF) of Drosophila melanogaster has been reported to be present in the cytoplasm, where it stabilizes the maternally contributed bicoid mRNA and binds mRNAs expressed from early zygotic genes. BSF may also have other roles, as it is ubiquitously expressed and essential for survival of adult flies. We have performed immunofluorescence and cell fractionation analyses and show here that BSF is mainly a mitochondrial protein. We studied two independent RNAi knockdown fly lines and report that reduced BSF protein levels lead to a severe respiratory deficiency and delayed development at the late larvae stage. Ubiquitous knockdown of BSF results in a severe reduction of the polyadenylation tail lengths of specific mitochondrial mRNAs, accompanied by an enrichment of unprocessed polycistronic RNA intermediates. Furthermore, we observed a significant reduction in mRNA steady state levels, despite increased de novo transcription. Surprisingly, mitochondrial de novo translation is increased and abnormal mitochondrial translation products are present in knockdown flies, suggesting that BSF also has a role in coordinating the mitochondrial translation in addition to its role in mRNA maturation and stability. We thus report a novel function of BSF in flies and demonstrate that it has an important intra-mitochondrial role, which is essential for maintaining mtDNA gene expression and oxidative phosphorylation. PMID:22022283

  12. EBV Noncoding RNAs.

    PubMed

    Skalsky, Rebecca L; Cullen, Bryan R

    2015-01-01

    EBV expresses a number of viral noncoding RNAs (ncRNAs) during latent infection, many of which have known regulatory functions and can post-transcriptionally regulate viral and/or cellular gene expression. With recent advances in RNA sequencing technologies, the list of identified EBV ncRNAs continues to grow. EBV-encoded RNAs (EBERs) , the BamHI-A rightward transcripts (BARTs) , a small nucleolar RNA (snoRNA) , and viral microRNAs (miRNAs) are all expressed during EBV infection in a variety of cell types and tumors. Recently, additional novel EBV ncRNAs have been identified. Viral miRNAs, in particular, have been under extensive investigation since their initial identification over ten years ago. High-throughput studies to capture miRNA targets have revealed a number of miRNA-regulated viral and cellular transcripts that tie into important biological networks. Functions for many EBV ncRNAs are still unknown; however, roles for many EBV miRNAs in latency and in tumorigenesis have begun to emerge. Ongoing mechanistic studies to elucidate the functions of EBV ncRNAs should unravel additional roles for ncRNAs in the viral life cycle. In this chapter, we will discuss our current knowledge of the types of ncRNAs expressed by EBV, their potential roles in viral latency, and their potential involvement in viral pathogenesis. PMID:26428375

  13. Two promoters and two translation start sites control the expression of the Shigella flexneri outer membrane protease IcsP

    PubMed Central

    Hensley, Christopher T.; Kamneva, Olga K.; Levy, Karen M.; Labahn, Stephanie K.; Africa, Lia A.; Wing, Helen J.

    2011-01-01

    The Shigella flexneri outer membrane protease IcsP proteolytically cleaves the actin-based motility protein IcsA from the bacterial surface. The icsP gene is monocistronic and lies downstream of an unusually large intergenic region on the Shigella virulence plasmid. In silico analysis of this region predicts a second transcription start site 84 bp upstream of the first. Primer extension analyses and beta-galactosidase assays demonstrate that both transcription start sites are used. Both promoters are regulated by the Shigella virulence gene regulator VirB and both respond similarly to conditions known to influence Shigella virulence gene expression (iron concentration, pH, osmotic pressure, and phase of growth). The newly identified promoter lies upstream of a Shine-Dalgarno sequence and second 5’-ATG-3’, which is in frame with the annotated icsP gene. The use of either translation start site leads to the production of IcsP capable of proteolytically cleaving IcsA. A bioinformatic scan of the Shigella genome reveals multiple occurrences of in-frame translation start sites associated with putative Shine –Dalgarno sequences, immediately upstream and downstream of annotated open reading frames. Taken together, our observations support the possibility that the use of in-frame translation start sites may generate different protein isoforms, thereby expanding the proteome encoded by bacterial genomes. PMID:21225241

  14. Specific Localization of the Drosophila Telomere Transposon Proteins and RNAs, Give Insight in Their Behavior, Control and Telomere Biology in This Organism

    PubMed Central

    López-Panadès, Elisenda; Gavis, Elizabeth R.; Casacuberta, Elena

    2015-01-01

    Drosophila telomeres constitute a remarkable exception to the telomerase mechanism. Although maintaining the same cytological and functional properties as telomerase maintain telomeres, Drosophila telomeres embed the telomere retrotransposons whose specific and highly regulated terminal transposition maintains the appropriate telomere length in this organism. Nevertheless, our current understanding of how the mechanism of the retrotransposon telomere works and which features are shared with the telomerase system is very limited. We report for the first time a detailed study of the localization of the main components that constitute the telomeres in Drosophila, HeT-A and TART RNAs and proteins. Our results in wild type and mutant strains reveal localizations of HeT-A Gag and TART Pol that give insight in the behavior of the telomere retrotransposons and their control. We find that TART Pol and HeT-A Gag only co-localize at the telomeres during the interphase of cells undergoing mitotic cycles. In addition, unexpected protein and RNA localizations with a well-defined pattern in cells such as the ovarian border cells and nurse cells, suggest possible strategies for the telomere transposons to reach the oocyte, and/or additional functions that might be important for the correct development of the organism. Finally, we have been able to visualize the telomere RNAs at different ovarian stages of development in wild type and mutant lines, demonstrating their presence in spite of being tightly regulated by the piRNA mechanism. PMID:26068215

  15. Expanding the RpoS/σS-Network by RNA Sequencing and Identification of σS-Controlled Small RNAs in Salmonella

    PubMed Central

    Lévi-Meyrueis, Corinne; Monteil, Véronique; Sismeiro, Odile; Dillies, Marie-Agnès; Monot, Marc; Jagla, Bernd; Coppée, Jean-Yves; Dupuy, Bruno; Norel, Françoise

    2014-01-01

    The RpoS/σS sigma subunit of RNA polymerase (RNAP) controls a global adaptive response that allows many Gram-negative bacteria to survive starvation and various stresses. σS also contributes to biofilm formation and virulence of the food-borne pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium). In this study, we used directional RNA-sequencing and complementary assays to explore the σS-dependent transcriptome of S. Typhimurium during late stationary phase in rich medium. This study confirms the large regulatory scope of σS and provides insights into the physiological functions of σS in Salmonella. Extensive regulation by σS of genes involved in metabolism and membrane composition, and down-regulation of the respiratory chain functions, were important features of the σS effects on gene transcription that might confer fitness advantages to bacterial cells and/or populations under starving conditions. As an example, we show that arginine catabolism confers a competitive fitness advantage in stationary phase. This study also provides a firm basis for future studies to address molecular mechanisms of indirect regulation of gene expression by σS. Importantly, the σS-controlled downstream network includes small RNAs that might endow σS with post-transcriptional regulatory functions. Of these, four (RyhB-1/RyhB-2, SdsR, SraL) were known to be controlled by σS and deletion of the sdsR locus had a competitive fitness cost in stationary phase. The σS-dependent control of seven additional sRNAs was confirmed in Northern experiments. These findings will inspire future studies to investigate molecular mechanisms and the physiological impact of post-transcriptional regulation by σS. PMID:24810289

  16. Expanding the RpoS/σS-network by RNA sequencing and identification of σS-controlled small RNAs in Salmonella.

    PubMed

    Lévi-Meyrueis, Corinne; Monteil, Véronique; Sismeiro, Odile; Dillies, Marie-Agnès; Monot, Marc; Jagla, Bernd; Coppée, Jean-Yves; Dupuy, Bruno; Norel, Françoise

    2014-01-01

    The RpoS/σS sigma subunit of RNA polymerase (RNAP) controls a global adaptive response that allows many Gram-negative bacteria to survive starvation and various stresses. σS also contributes to biofilm formation and virulence of the food-borne pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium). In this study, we used directional RNA-sequencing and complementary assays to explore the σS-dependent transcriptome of S. Typhimurium during late stationary phase in rich medium. This study confirms the large regulatory scope of σS and provides insights into the physiological functions of σS in Salmonella. Extensive regulation by σS of genes involved in metabolism and membrane composition, and down-regulation of the respiratory chain functions, were important features of the σS effects on gene transcription that might confer fitness advantages to bacterial cells and/or populations under starving conditions. As an example, we show that arginine catabolism confers a competitive fitness advantage in stationary phase. This study also provides a firm basis for future studies to address molecular mechanisms of indirect regulation of gene expression by σS. Importantly, the σS-controlled downstream network includes small RNAs that might endow σS with post-transcriptional regulatory functions. Of these, four (RyhB-1/RyhB-2, SdsR, SraL) were known to be controlled by σS and deletion of the sdsR locus had a competitive fitness cost in stationary phase. The σS-dependent control of seven additional sRNAs was confirmed in Northern experiments. These findings will inspire future studies to investigate molecular mechanisms and the physiological impact of post-transcriptional regulation by σS. PMID:24810289

  17. MicroRNAs regulate osteogenesis and chondrogenesis

    SciTech Connect

    Dong, Shiwu; Yang, Bo; Guo, Hongfeng; Kang, Fei

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer To focus on the role of miRNAs in chondrogenesis and osteogenesis. Black-Right-Pointing-Pointer Involved in the regulation of miRNAs in osteoarthritis. Black-Right-Pointing-Pointer To speculate some therapeutic targets for bone diseases. -- Abstract: MicroRNAs (miRNAs) are a class of small molecules and non-coding single strand RNAs that regulate gene expression at the post-transcriptional level by binding to specific sequences within target genes. miRNAs have been recognized as important regulatory factors in organism development and disease expression. Some miRNAs regulate the proliferation and differentiation of osteoblasts, osteoclasts and chondrocytes, eventually influencing metabolism and bone formation. miRNAs are expected to provide potential gene therapy targets for the clinical treatment of metabolic bone diseases and bone injuries. Here, we review the recent research progress on the regulation of miRNAs in bone biology, with a particular focus on the miRNA-mediated control mechanisms of bone and cartilage formation.

  18. Creating small transcription activating RNAs.

    PubMed

    Chappell, James; Takahashi, Melissa K; Lucks, Julius B

    2015-03-01

    We expanded the mechanistic capability of small RNAs by creating an entirely synthetic mode of regulation: small transcription activating RNAs (STARs). Using two strategies, we engineered synthetic STAR regulators to disrupt the formation of an intrinsic transcription terminator placed upstream of a gene in Escherichia coli. This resulted in a group of four highly orthogonal STARs that had up to 94-fold activation. By systematically modifying sequence features of this group, we derived design principles for STAR function, which we then used to forward engineer a STAR that targets a terminator found in the Escherichia coli genome. Finally, we showed that STARs could be combined in tandem to create previously unattainable RNA-only transcriptional logic gates. STARs provide a new mechanism of regulation that will expand our ability to use small RNAs to construct synthetic gene networks that precisely control gene expression. PMID:25643173

  19. Investigation, development and application of optimal output feedback theory. Volume 2: Development of an optimal, limited state feedback outer-loop digital flight control system for 3-D terminal area operation

    NASA Technical Reports Server (NTRS)

    Broussard, J. R.; Halyo, N.

    1984-01-01

    This report contains the development of a digital outer-loop three dimensional radio navigation (3-D RNAV) flight control system for a small commercial jet transport. The outer-loop control system is designed using optimal stochastic limited state feedback techniques. Options investigated using the optimal limited state feedback approach include integrated versus hierarchical control loop designs, 20 samples per second versus 5 samples per second outer-loop operation and alternative Type 1 integration command errors. Command generator tracking techniques used in the digital control design enable the jet transport to automatically track arbitrary curved flight paths generated by waypoints. The performance of the design is demonstrated using detailed nonlinear aircraft simulations in the terminal area, frequency domain multi-input sigma plots, frequency domain single-input Bode plots and closed-loop poles. The response of the system to a severe wind shear during a landing approach is also presented.

  20. Growth Hormone-Regulated mRNAs and miRNAs in Chicken Hepatocytes

    PubMed Central

    Wang, Huijuan; Shao, Fang; Yu, JianFeng; Jiang, Honglin; Han, Yaoping; Gong, Daoqing; Gu, Zhiliang

    2014-01-01

    Growth hormone (GH) is a key regulatory factor in animal growth, development and metabolism. Based on the expression level of the GH receptor, the chicken liver is a major target organ of GH, but the biological effects of GH on the chicken liver are not fully understood. In this work we identified mRNAs and miRNAs that are regulated by GH in primary hepatocytes from female chickens through RNA-seq, and analyzed the functional relevance of these mRNAs and miRNAs through GO enrichment analysis and miRNA target prediction. A total of 164 mRNAs were found to be differentially expressed between GH-treated and control chicken hepatocytes, of which 112 were up-regulated and 52 were down-regulated by GH. A total of 225 chicken miRNAs were identified by the RNA-Seq analysis. Among these miRNAs 16 were up-regulated and 1 miRNA was down-regulated by GH. The GH-regulated mRNAs were mainly involved in growth and metabolism. Most of the GH-upregulated or GH-downregulated miRNAs were predicted to target the GH-downregulated or GH-upregulated mRNAs, respectively, involved in lipid metabolism. This study reveals that GH regulates the expression of many mRNAs involved in metabolism in female chicken hepatocytes, which suggests that GH plays an important role in regulating liver metabolism in female chickens. The results of this study also support the hypothesis that GH regulates lipid metabolism in chicken liver in part by regulating the expression of miRNAs that target the mRNAs involved in lipid metabolism. PMID:25386791

  1. The roles of microRNAs and siRNAs in mammalian spermatogenesis.

    PubMed

    Hilz, Stephanie; Modzelewski, Andrew J; Cohen, Paula E; Grimson, Andrew

    2016-09-01

    MicroRNAs and siRNAs, both of which are AGO-bound small RNAs, are essential for mammalian spermatogenesis. Although their precise germline roles remain largely uncharacterized, recent discoveries suggest that they function in mechanisms beyond microRNA-mediated post-transcriptional control, playing roles in DNA repair and transcriptional regulation within the nucleus. Here, we discuss the latest findings regarding roles for AGO proteins and their associated small RNAs in the male germline. We integrate genetic, clinical and genomics data, and draw upon findings from non-mammalian models, to examine potential roles for AGO-bound small RNAs during spermatogenesis. Finally, we evaluate the emerging and differing roles for AGOs and AGO-bound small RNAs in the male and female germlines, suggesting potential reasons for these sexual dimorphisms. PMID:27578177

  2. Small RNAs meet their targets: When methylation defends miRNAs from uridylation

    PubMed Central

    Ren, Guodong; Chen, Xuemei; Yu, Bin

    2014-01-01

    Small RNAs are incorporated into Argonaute protein-containing complexes to guide the silencing of target RNAs in both animals and plants. The abundance of endogenous small RNAs is precisely controlled at multiple levels including transcription, processing and Argonaute loading. In addition to these processes, 3′ end modification of small RNAs, the topic of a research area that has rapidly evolved over the last several years, adds another layer of regulation of their abundance, diversity and function. Here, we review our recent understanding of small RNA 3′ end methylation and tailing. PMID:25483033

  3. MicroRNAs tune cerebral cortical neurogenesis

    PubMed Central

    Volvert, M-L; Rogister, F; Moonen, G; Malgrange, B; Nguyen, L

    2012-01-01

    MicroRNAs (miRNAs) are non-coding RNAs that promote post-transcriptional silencing of genes involved in a wide range of developmental and pathological processes. It is estimated that most protein-coding genes harbor miRNA recognition sequences in their 3′ untranslated region and are thus putative targets. While functions of miRNAs have been extensively characterized in various tissues, their multiple contributions to cerebral cortical development are just beginning to be unveiled. This review aims to outline the evidence collected to date demonstrating a role for miRNAs in cerebral corticogenesis with a particular emphasis on pathways that control the birth and maturation of functional excitatory projection neurons. PMID:22858543

  4. Non coding RNAs in aortic aneurysmal disease

    PubMed Central

    Duggirala, Aparna; Delogu, Francesca; Angelini, Timothy G.; Smith, Tanya; Caputo, Massimo; Rajakaruna, Cha; Emanueli, Costanza

    2015-01-01

    An aneurysm is a local dilatation of a vessel wall which is >50% its original diameter. Within the spectrum of cardiovascular diseases, aortic aneurysms are among the most challenging to treat. Most patients present acutely after aneurysm rupture or dissection from a previous asymptomatic condition and are managed by open surgical or endovascular repair. In addition, patients may harbor concurrent disease contraindicating surgical intervention. Collectively, these factors have driven the search for alternative methods of identifying, monitoring and treating aortic aneurisms using less invasive approaches. Non-coding RNA (ncRNAs) are emerging as new fundamental regulators of gene expression. The small microRNAs have opened the field of ncRNAs capturing the attention of basic and clinical scientists for their potential to become new therapeutic targets and clinical biomarkers for aortic aneurysm. More recently, long ncRNAs (lncRNAs) have started to be actively investigated, leading to first exciting reports, which further suggest their important and yet largely unexplored contribution to vascular physiology and disease. This review introduces the different ncRNA types and focus at ncRNA roles in aorta aneurysms. We discuss the potential of therapeutic interventions targeting ncRNAs and we describe the research models allowing for mechanistic studies and clinical translation attempts for controlling aneurysm progression. Furthermore, we discuss the potential role of microRNAs and lncRNAs as clinical biomarkers. PMID:25883602

  5. miRNAs in human cancer

    PubMed Central

    Farazi, Thalia A.; Spitzer, Jessica I.; Morozov, Pavel; Tuschl, Thomas

    2010-01-01

    Mature microRNAs (miRNAs) are single-stranded RNA molecules of 20- to 23-nucleotide (nt) length that control gene expression in many cellular processes. These molecules typically reduce the stability of mRNAs, including those of genes that mediate processes in tumorigenesis, such as inflammation, cell cycle regulation, stress response, differentiation, apoptosis, and invasion. miRNA targeting is mostly achieved through specific base-pairing interactions between the 5′ end (“seed” region) of the miRNA and sites within coding and untranslated regions (UTRs) of mRNAs; target sites in the 3′ UTR lead to more effective mRNA destabilization. Since miRNAs frequently target hundreds of mRNAs, miRNA regulatory pathways are complex. To provide a critical overview of miRNA dysregulation in cancer we first discuss the methods currently available for studying the role of miRNAs in cancer and then review miRNA genomic organization, biogenesis, and mechanism of target recognition examining how these processes are altered in tumorigenesis. Given the critical role miRNAs play in tumorigenesis processes and their disease specific expression, they hold potential as therapeutic targets and novel biomarkers. PMID:21125669

  6. Target activation by regulatory RNAs in bacteria

    PubMed Central

    Papenfort, Kai; Vanderpool, Carin K.

    2015-01-01

    Bacterial small regulatory RNAs (sRNAs) are commonly known to repress gene expression by base pairing to target mRNAs. In many cases, sRNAs base pair with and sequester mRNA ribosome-binding sites, resulting in translational repression and accelerated transcript decay. In contrast, a growing number of examples of translational activation and mRNA stabilization by sRNAs have now been documented. A given sRNA often employs a conserved region to interact with and regulate both repressed and activated targets. However, the mechanisms underlying activation differ substantially from repression. Base pairing resulting in target activation can involve sRNA interactions with the 5′ untranslated region (UTR), the coding sequence or the 3′ UTR of the target mRNAs. Frequently, the activities of protein factors such as cellular ribonucleases and the RNA chaperone Hfq are required for activation. Bacterial sRNAs, including those that function as activators, frequently control stress response pathways or virulence-associated functions required for immediate responses to changing environments. This review aims to summarize recent advances in knowledge regarding target mRNA activation by bacterial sRNAs, highlighting the molecular mechanisms and biological relevance of regulation. PMID:25934124

  7. Non coding RNAs in aortic aneurysmal disease.

    PubMed

    Duggirala, Aparna; Delogu, Francesca; Angelini, Timothy G; Smith, Tanya; Caputo, Massimo; Rajakaruna, Cha; Emanueli, Costanza

    2015-01-01

    An aneurysm is a local dilatation of a vessel wall which is >50% its original diameter. Within the spectrum of cardiovascular diseases, aortic aneurysms are among the most challenging to treat. Most patients present acutely after aneurysm rupture or dissection from a previous asymptomatic condition and are managed by open surgical or endovascular repair. In addition, patients may harbor concurrent disease contraindicating surgical intervention. Collectively, these factors have driven the search for alternative methods of identifying, monitoring and treating aortic aneurisms using less invasive approaches. Non-coding RNA (ncRNAs) are emerging as new fundamental regulators of gene expression. The small microRNAs have opened the field of ncRNAs capturing the attention of basic and clinical scientists for their potential to become new therapeutic targets and clinical biomarkers for aortic aneurysm. More recently, long ncRNAs (lncRNAs) have started to be actively investigated, leading to first exciting reports, which further suggest their important and yet largely unexplored contribution to vascular physiology and disease. This review introduces the different ncRNA types and focus at ncRNA roles in aorta aneurysms. We discuss the potential of therapeutic interventions targeting ncRNAs and we describe the research models allowing for mechanistic studies and clinical translation attempts for controlling aneurysm progression. Furthermore, we discuss the potential role of microRNAs and lncRNAs as clinical biomarkers. PMID:25883602

  8. Methanotroph outer membrane preparation.

    PubMed

    Karlsen, Odd A; Berven, Frode S; Jensen, Harald B; Fjellbirkeland, Anne

    2011-01-01

    All presently known methanotrophs are gram-negative bacteria suggesting that they are surrounded by a two-layered membrane: an inner or cytoplasmic membrane and an outer membrane. In the methanotroph Methylococcus capsulatus (Bath), separation of the two membranes has allowed studies on protein and lipid composition of the outer membrane. Its outer membrane can be isolated from purified cell envelopes by selective solubilization of the inner membranes with the detergent Triton X-100. The proteins associated with the outer membrane can further be fractionated into integral and tightly associated proteins and peripheral loosely associated proteins. We present here protocols for this fractionation and show how the proteins associated with the outer leaflet of the outer membrane can be isolated and identified by whole-cell biotin surface labeling. PMID:21419921

  9. Flux control exerted by mitochondrial outer membrane carnitine palmitoyltransferase over beta-oxidation, ketogenesis and tricarboxylic acid cycle activity in hepatocytes isolated from rats in different metabolic states.

    PubMed Central

    Drynan, L; Quant, P A; Zammit, V A

    1996-01-01

    The Flux Control Coefficients of mitochondrial outer membrane carnitine palmitoyltransferase (CPT I) with respect to the overall rates of beta-oxidation, ketogenesis and tricarboxylic acid cycle activity were measured in hepatocytes isolated from rats in different metabolic states (fed, 24 h-starved, starved-refed and starved/insulin-treated). These conditions were chosen because there is controversy as to whether, when significant control ceases to be exerted by CPT I over the rate of fatty oxidation [Moir and Zammit (1994) Trends Biochem. Sci. 19, 313-317], this is transferred to one or more steps proximal to acylcarnitine synthesis (e.g. decreased delivery of fatty acids to the liver) or to the reaction catalysed by mitochondrial 3-hydroxy-3-methyl-glutaryl-CoA synthase [Hegardt (1995) Biochem. Soc. Trans. 23, 486-490]. Therefore isolated hepatocytes were used in the present study to exclude the involvement of changes in the rate of delivery of non-esterified fatty acids (NEFA) to the liver, such as occur in vivo, and to ascertain whether, under conditions of constant supply of NEFA, CPT I retains control over the relevant fluxes of fatty acid oxidation to ketones and carbon dioxide, or whether control is transferred to another (intrahepatocytic) site. The results clearly show that the Flux Control Coefficients of CPT I with respect to overall beta-oxidation and ketogenesis are very high under all conditions investigated, indicating that control is not lost to another intrahepatic site during the metabolic transitions studied. The control of CPT I over tricarboxylic acid cycle activity was always very low. The significance of these findings for the integration of fatty acid and carbohydrate metabolism in the liver is discussed. PMID:8760364

  10. Adenovirus Virus-Associated RNA Is Processed to Functional Interfering RNAs Involved in Virus Production

    PubMed Central

    Aparicio, Oscar; Razquin, Nerea; Zaratiegui, Mikel; Narvaiza, Iñigo; Fortes, Puri

    2006-01-01

    Posttranscriptional gene silencing allows sequence-specific control of gene expression. Specificity is guaranteed by small antisense RNAs such as microRNAs (miRNAs) or small interfering RNAs (siRNAs). Functional miRNAs derive from longer double-stranded RNA (dsRNA) molecules that are cleaved to pre-miRNAs in the nucleus and are transported by exportin 5 (Exp 5) to the cytoplasm. Adenovirus-infected cells express virus-associated (VA) RNAs, which are dsRNA molecules similar in structure to pre-miRNAs. VA RNAs are also transported by Exp 5 to the cytoplasm, where they accumulate. Here we show that small RNAs derived from VA RNAs (svaRNAs), similar to miRNAs, can be found in adenovirus-infected cells. VA RNA processing to svaRNAs requires neither viral replication nor viral protein expression, as evidenced by the fact that svaRNA accumulation can be detected in cells transfected with VA sequences. svaRNAs are efficiently bound by Argonaute 2, the endonuclease of the RNA-induced silencing complex, and behave as functional siRNAs, in that they inhibit the expression of reporter genes with complementary sequences. Blocking svaRNA-mediated inhibition affects efficient adenovirus production, indicating that svaRNAs are required for virus viability. Thus, svaRNA-mediated silencing could represent a novel mechanism used by adenoviruses to control cellular or viral gene expression. PMID:16415015

  11. Viral miRNAs.

    PubMed

    Plaisance-Bonstaff, Karlie; Renne, Rolf

    2011-01-01

    Since 2004, more than 200 microRNAs (miRNAs) have been discovered in double-stranded DNA viruses, mainly herpesviruses and polyomaviruses (Nucleic Acids Res 32:D109-D111, 2004). miRNAs are short 22  ±  3 nt RNA molecules that posttranscriptionally regulate gene expression by binding to 3'-untranslated regions (3'UTR) of target mRNAs, thereby inducing translational silencing and/or transcript degradation (Nature 431:350-355, 2004; Cell 116:281-297, 2004). Since miRNAs require only limited complementarity for binding, miRNA targets are difficult to determine (Mol Cell 27:91-105, 2007). To date, targets have only been experimentally verified for relatively few viral miRNAs, which either target viral or host cellular gene expression: For example, SV40 and related polyomaviruses encode miRNAs which target viral large T antigen expression (Nature 435:682-686, 2005; J Virol 79:13094-13104, 2005; Virology 383:183-187, 2009; J Virol 82:9823-9828, 2008) and miRNAs of α-, β-, and γ-herpesviruses have been implicated in regulating the transition from latent to lytic gene expression, a key step in the herpesvirus life cycle. Viral miRNAs have also been shown to target various host cellular genes. Although this field is just beginning to unravel the multiple roles of viral miRNA in biology and pathogenesis, the current data strongly suggest that virally encoded miRNAs are able to regulate fundamental biological processes such as immune recognition, promotion of cell survival, angiogenesis, proliferation, and cell differentiation. This chapter aims to summarize our current knowledge of viral miRNAs, their targets and function, and the challenges lying ahead to decipher their role in viral biology, pathogenesis, and for γ-herepsvirus-encoded miRNAs, potentially tumorigenesis. PMID:21431678

  12. Estrogen Receptor α Controls a Gene Network in Luminal-Like Breast Cancer Cells Comprising Multiple Transcription Factors and MicroRNAs

    PubMed Central

    Cicatiello, Luigi; Mutarelli, Margherita; Grober, Oli M.V.; Paris, Ornella; Ferraro, Lorenzo; Ravo, Maria; Tarallo, Roberta; Luo, Shujun; Schroth, Gary P.; Seifert, Martin; Zinser, Christian; Luisa Chiusano, Maria; Traini, Alessandra; De Bortoli, Michele; Weisz, Alessandro

    2010-01-01

    Luminal-like breast tumor cells express estrogen receptor α (ERα), a member of the nuclear receptor family of ligand-activated transcription factors that controls their proliferation, survival, and functional status. To identify the molecular determinants of this hormone-responsive tumor phenotype, a comprehensive genome-wide analysis was performed in estrogen stimulated MCF-7 and ZR-75.1 cells by integrating time-course mRNA expression profiling with global mapping of genomic ERα binding sites by chromatin immunoprecipitation coupled to massively parallel sequencing, microRNA expression profiling, and in silico analysis of transcription units and receptor binding regions identified. All 1270 genes that were found to respond to 17β-estradiol in both cell lines cluster in 33 highly concordant groups, each of which showed defined kinetics of RNA changes. This hormone-responsive gene set includes several direct targets of ERα and is organized in a gene regulation cascade, stemming from ligand-activated receptor and reaching a large number of downstream targets via AP-2γ, B-cell activating transcription factor, E2F1 and 2, E74-like factor 3, GTF2IRD1, hairy and enhancer of split homologue-1, MYB, SMAD3, RARα, and RXRα transcription factors. MicroRNAs are also integral components of this gene regulation network because miR-107, miR-424, miR-570, miR-618, and miR-760 are regulated by 17β-estradiol along with other microRNAs that can target a significant number of transcripts belonging to one or more estrogen-responsive gene clusters. PMID:20348243

  13. Apple miRNAs and tasiRNAs with novel regulatory networks

    Technology Transfer Automated Retrieval System (TEKTRAN)

    MiRNAs, negatively affecting gene expression at the post-transcriptional levels, have been shown to control numerous genes involved in various biological and metabolic processes. To date, the identification of miRNAs in plants focused on certain model plants, such as Arabidopsis and rice. Investig...

  14. MicroRNAs and photocarcinogenesis.

    PubMed

    Syed, Deeba N; Lall, Rahul K; Mukhtar, Hasan

    2015-01-01

    As a new class of sequence-specific regulators of gene expression, the microRNAs (miRNA) form a regulatory network with growth factors and transcription factors participating in various biological processes. It is now being recognized that the various key processes involved in cancer induction are under the control of these small noncoding RNAs, which regulate ~30% of all human genes by targeting sequences in their 3'-untranslated regions. Photocarcinogenesis is a complex interplay of signaling events in the UV exposed human skin including DNA damage and repair, apoptosis, cell survival, mutations and the immune system. In this review, we have scrutinized the role of miRNAs in skin cancer biology focusing on the three most common types of skin cancer namely the basal cell carcinoma, squamous cell carcinoma and cutaneous malignant melanoma. An overview of these studies will be useful in gaining insights into the mechanisms of cancer development in the human skin. A better understanding of the functionality of miRNAs will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis. PMID:25227270

  15. RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

    PubMed

    Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

    2016-02-01

    Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation. PMID:26580233

  16. RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes

    PubMed Central

    Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

    2016-01-01

    ABSTRACT Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation. PMID:26580233

  17. The Outer Limits: English.

    ERIC Educational Resources Information Center

    Tyler, Barbara R.; Biesekerski, Joan

    The Quinmester course "The Outer Limits" involves an exploration of unknown worlds, mental and physical, through fiction and nonfiction. Its purpose is to focus attention on the ongoing conquest of the frontiers of the mind, the physical world, and outer space. The subject matter includes identification and investigation of unknown worlds in the…

  18. The non-coding RNAs as riboregulators

    PubMed Central

    Erdmann, Volker A.; Barciszewska, Miroslawa Z.; Szymanski, Maciej; Hochberg, Abraham; Groot, Nathan de; Barciszewski, Jan

    2001-01-01

    The non-coding RNAs database (http://biobases.ibch.poznan.pl/ncRNA/) contains currently available data on RNAs, which do not have long open reading frames and act as riboregulators. Non-coding RNAs are involved in the specific recognition of cellular nucleic acid targets through complementary base pairing to control cell growth and differentiation. Some of them are connected with several well known developmental and neuro­behavioral disorders. We have divided them into four groups. This paper is a short introduction to the database and presents its latest, updated edition. PMID:11125087

  19. Transcriptome-wide investigation of circular RNAs in rice

    PubMed Central

    Lu, Tingting; Cui, Lingling; Zhou, Yan; Zhu, Chuanrang; Fan, Danlin; Gong, Hao; Zhao, Qiang; Zhou, Congcong; Zhao, Yan; Lu, Danfeng; Luo, Jianghong; Wang, Yongchun; Tian, Qilin; Feng, Qi; Huang, Tao; Han, Bin

    2015-01-01

    Various stable circular RNAs (circRNAs) are newly identified to be the abundance of noncoding RNAs in Archaea, Caenorhabditis elegans, mice, and humans through high-throughput deep sequencing coupled with analysis of massive transcriptional data. CircRNAs play important roles in miRNA function and transcriptional controlling by acting as competing endogenous RNAs or positive regulators on their parent coding genes. However, little is known regarding circRNAs in plants. Here, we report 2354 rice circRNAs that were identified through deep sequencing and computational analysis of ssRNA-seq data. Among them, 1356 are exonic circRNAs. Some circRNAs exhibit tissue-specific expression. Rice circRNAs have a considerable number of isoforms, including alternative backsplicing and alternative splicing circularization patterns. Parental genes with multiple exons are preferentially circularized. Only 484 circRNAs have backsplices derived from known splice sites. In addition, only 92 circRNAs were found to be enriched for miniature inverted-repeat transposable elements (MITEs) in flanking sequences or to be complementary to at least 18-bp flanking intronic sequences, indicating that there are some other production mechanisms in addition to direct backsplicing in rice. Rice circRNAs have no significant enrichment for miRNA target sites. A transgenic study showed that overexpression of a circRNA construct could reduce the expression level of its parental gene in transgenic plants compared with empty-vector control plants. This suggested that circRNA and its linear form might act as a negative regulator of its parental gene. Overall, these analyses reveal the prevalence of circRNAs in rice and provide new biological insights into rice circRNAs. PMID:26464523

  20. Transcriptome-wide investigation of circular RNAs in rice.

    PubMed

    Lu, Tingting; Cui, Lingling; Zhou, Yan; Zhu, Chuanrang; Fan, Danlin; Gong, Hao; Zhao, Qiang; Zhou, Congcong; Zhao, Yan; Lu, Danfeng; Luo, Jianghong; Wang, Yongchun; Tian, Qilin; Feng, Qi; Huang, Tao; Han, Bin

    2015-12-01

    Various stable circular RNAs (circRNAs) are newly identified to be the abundance of noncoding RNAs in Archaea, Caenorhabditis elegans, mice, and humans through high-throughput deep sequencing coupled with analysis of massive transcriptional data. CircRNAs play important roles in miRNA function and transcriptional controlling by acting as competing endogenous RNAs or positive regulators on their parent coding genes. However, little is known regarding circRNAs in plants. Here, we report 2354 rice circRNAs that were identified through deep sequencing and computational analysis of ssRNA-seq data. Among them, 1356 are exonic circRNAs. Some circRNAs exhibit tissue-specific expression. Rice circRNAs have a considerable number of isoforms, including alternative backsplicing and alternative splicing circularization patterns. Parental genes with multiple exons are preferentially circularized. Only 484 circRNAs have backsplices derived from known splice sites. In addition, only 92 circRNAs were found to be enriched for miniature inverted-repeat transposable elements (MITEs) in flanking sequences or to be complementary to at least 18-bp flanking intronic sequences, indicating that there are some other production mechanisms in addition to direct backsplicing in rice. Rice circRNAs have no significant enrichment for miRNA target sites. A transgenic study showed that overexpression of a circRNA construct could reduce the expression level of its parental gene in transgenic plants compared with empty-vector control plants. This suggested that circRNA and its linear form might act as a negative regulator of its parental gene. Overall, these analyses reveal the prevalence of circRNAs in rice and provide new biological insights into rice circRNAs. PMID:26464523

  1. Plant subviral RNAs as a long noncoding RNA (lncRNA): Analogy with animal lncRNAs in host-virus interactions.

    PubMed

    Shimura, Hanako; Masuta, Chikara

    2016-01-01

    Satellite RNAs (satRNAs) and viroids belong to the group called subviral agents and are the smallest pathogens of plants. In general, small satRNAs and viroids are 300-400 nt in size and do not encode any functional proteins; they are thus regarded as so-called long noncoding RNAs (lncRNAs). These lncRNAs are receiving great attention as a new RNA class involved in gene regulation to control important biological processes such as gene transcription and epigenetic regulation. A substantial number of lncRNAs in animal cells have been found to play important roles in the interactions between a virus and its host. We here discuss the pathogenicity of subviral RNAs (especially satRNAs) in plant cells and their functions as lncRNAs associated with viral diseases, using animal lncRNAs as an analogy. Because, unlike animal lncRNAs, plant subviral RNAs can replicate and accumulate at very high levels in infected cells, we here considered the unique possibility that the RNA silencing machinery of plants, an important defense mechanism against virus infection, may have brought about the replication ability of subviral molecules. In addition, we also discuss the possibility that satRNAs may have arisen from plant-virus interactions in virus-infected cells. Understanding the molecular functions of these unique lncRNAs in plants will enable us to reveal the most plausible origins of these subviral RNAs. PMID:26116900

  2. MicroRNAs in Rice Innate Immunity.

    PubMed

    Baldrich, Patricia; San Segundo, Blanca

    2016-12-01

    MicroRNAs (miRNAs) are short regulatory non-coding RNAs that guide gene silencing in most eukaryotes. They regulate gene expression by triggering sequence-specific cleavage or translational repression of target transcripts. Plant miRNAs are known to play important roles in a wide range of developmental processes. Increasing evidence also supports that the modulation of miRNA levels plays an important role in reprogramming plant responses to abiotic stress (drought, cold, salinity and nutrient deficiency) and biotic stress (antibacterial resistance). Most of these studies were carried out in the model plant Arabidopsis thaliana. During the last years, the adoption of high-throughput sequencing technologies has significantly contributed to uncover multiple miRNAs while allowing miRNA profiling in plants. However, although a plethora of rice miRNAs have been shown to be regulated by pathogen infection, the biological function remains largely unknown for most of them. In this review, we summarize our current understanding on the contribution of miRNAs to rice immunity and discuss their potential applications in rice biotechnology. A better understanding of the miRNA species controlling rice immunity may lead to practical biotechnological applications leading to the development of appropriate strategies for rice protection. PMID:26897721

  3. Circulating microRNAs in Sera Correlate with Soluble Biomarkers of Immune Activation but Do Not Predict Mortality in ART Treated Individuals with HIV-1 Infection: A Case Control Study

    PubMed Central

    Murray, Daniel D.; Suzuki, Kazuo; Law, Matthew; Trebicka, Jonel; Neuhaus, Jacquie; Wentworth, Deborah; Johnson, Margaret; Vjecha, Michael J.; Kelleher, Anthony D.; Emery, Sean

    2015-01-01

    Introduction The use of anti-retroviral therapy (ART) has dramatically reduced HIV-1 associated morbidity and mortality. However, HIV-1 infected individuals have increased rates of morbidity and mortality compared to the non-HIV-1 infected population and this appears to be related to end-organ diseases collectively referred to as Serious Non-AIDS Events (SNAEs). Circulating miRNAs are reported as promising biomarkers for a number of human disease conditions including those that constitute SNAEs. Our study sought to investigate the potential of selected miRNAs in predicting mortality in HIV-1 infected ART treated individuals. Materials and Methods A set of miRNAs was chosen based on published associations with human disease conditions that constitute SNAEs. This case: control study compared 126 cases (individuals who died whilst on therapy), and 247 matched controls (individuals who remained alive). Cases and controls were ART treated participants of two pivotal HIV-1 trials. The relative abundance of each miRNA in serum was measured, by RTqPCR. Associations with mortality (all-cause, cardiovascular and malignancy) were assessed by logistic regression analysis. Correlations between miRNAs and CD4+ T cell count, hs-CRP, IL-6 and D-dimer were also assessed. Results None of the selected miRNAs was associated with all-cause, cardiovascular or malignancy mortality. The levels of three miRNAs (miRs -21, -122 and -200a) correlated with IL-6 while miR-21 also correlated with D-dimer. Additionally, the abundance of miRs -31, -150 and -223, correlated with baseline CD4+ T cell count while the same three miRNAs plus miR-145 correlated with nadir CD4+ T cell count. Discussion No associations with mortality were found with any circulating miRNA studied. These results cast doubt onto the effectiveness of circulating miRNA as early predictors of mortality or the major underlying diseases that contribute to mortality in participants treated for HIV-1 infection. PMID:26465293

  4. Noncoding RNAs and Cancer

    PubMed Central

    Naeini, Mozhgan Moslemi; Ardekani, Ali M.

    2009-01-01

    The eukaryotic complexity involves the expression and regulation of genes via RNA-DNA, RNA-RNA, DNA-protein and RNA-protein interactions. Recently, the role of RNA molecules in the regulation of genes in higher organisms has become more evident, especially with the discovery that about 97% of the transcriptional output in higher organisms are represented as noncoding RNAs: rRNA, snoRNAs, tRNA, transposable elements, 5’ and 3’ untranslated regions, introns, intergenic regions and microRNAs. MicroRNAs function by negatively regulating gene expression via degradation or translational inhibition of their target mRNAs and thus participate in a wide variety of physiological and pathological cellular processes including: development, cell proliferation, differentiation, and apoptosis pathways. MicroRNA expression profiles in many types of cancers have been identified. Recent reports have revealed that the expression profiles of microRNAs change in various human cancers and appear to function as oncogenes or tumor suppressors. Abnormal microRNA expression has increasingly become a common feature of human cancers. In this review, we summarize the latest progress on the involvement of microRNAs in different types of cancer and their potential use as potential diagnostic and prognostic tumor biomarkers in the future. PMID:23407615

  5. MicroRNAs Are Part of the Regulatory Network that Controls EGF Induced Apoptosis, Including Elements of the JAK/STAT Pathway, in A431 Cells

    PubMed Central

    Alanazi, Ibrahim; Hoffmann, Peter; Adelson, David L.

    2015-01-01

    MiRNAs are known to regulate gene expression and in the context of cancer have been shown to regulate metastasis, cell proliferation and cell death. In this report we describe potential miRNA regulatory roles with respect to induction of cell death by pharmacologic dose of Epidermal Growth Factor (EGF). Our previous work suggested that multiple pathways are involved in the induction of apoptosis, including interferon induced genes, cytokines, cytoskeleton and cell adhesion and TP53 regulated genes. Using miRNA time course expression profiling of EGF treated A431 cells and coupling this to our previous gene expression and proteomic data, we have been able to implicate a number of additional miRNAs in the regulation of apoptosis. Specifically we have linked miR-134, miR-145, miR-146b-5p, miR-432 and miR-494 to the regulation of both apoptotic and anti-apoptotic genes expressed as a function of EGF treatment. Whilst additional miRNAs were differentially expressed, these had the largest number of apoptotic and anti-apoptotic targets. We found 5 miRNAs previously implicated in the regulation of apoptosis and our results indicate that an additional 20 miRNAs are likely to be involved based on their correlated expression with targets. Certain targets were linked to multiple miRNAs, including PEG10, BTG1, ID1, IL32 and NCF2. Some miRNAs that target the interferon pathway were found to be down regulated, consistent with a novel layer of regulation of interferon pathway components downstream of JAK/STAT. We have significantly expanded the repertoire of miRNAs that may regulate apoptosis in cancer cells as a result of this work. PMID:25781916

  6. Noncoding RNAs in breast cancer.

    PubMed

    Lo, Pang-Kuo; Wolfson, Benjamin; Zhou, Xipeng; Duru, Nadire; Gernapudi, Ramkishore; Zhou, Qun

    2016-05-01

    The mammalian transcriptome has recently been revealed to encompass a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. MicroRNAs (miRNAs), the best studied of the short noncoding RNAs (sncRNAs), have been extensively characterized with regard to their biogenesis, function and importance in tumorigenesis. Another class of sncRNAs called piwi-interacting RNAs (piRNAs) has also gained attention recently in cancer research owing to their critical role in stem cell regulation. Long noncoding RNAs (lncRNAs) of >200 nucleotides in length have recently emerged as key regulators of developmental processes, including mammary gland development. lncRNA dysregulation has also been implicated in the development of various cancers, including breast cancer. In this review, we describe and discuss the roles of sncRNAs (including miRNAs and piRNAs) and lncRNAs in the initiation and progression of breast tumorigenesis, with a focus on outlining the molecular mechanisms of oncogenic and tumor-suppressor ncRNAs. Moreover, the current and potential future applications of ncRNAs to clinical breast cancer research are also discussed, with an emphasis on ncRNA-based diagnosis, prognosis and future therapeutics. PMID:26685283

  7. Outer planet satellites

    SciTech Connect

    Schenk, P.M. )

    1991-01-01

    Recent findings on the outer-planet satellites are presented, with special consideration given to data on the rheologic properties of ice on icy satellites, the satellite surfaces and exogenic processes, cratering on dead cratered satellites, volcanism, and the interiors of outer-planet satellites. Particular attention is given to the state of Titan's surface and the properties of Triton, Pluto, and Charon. 210 refs.

  8. Long noncoding RNAs in aging and age-related diseases.

    PubMed

    Kour, Sukhleen; Rath, Pramod C

    2016-03-01

    Aging is the universal, intrinsic, genetically-controlled, evolutionarily-conserved and time-dependent intricate biological process characterised by the cumulative decline in the physiological functions and their coordination in an organism after the attainment of adulthood resulting in the imbalance of neurological, immunological and metabolic functions of the body. Various biological processes and mechanisms along with altered levels of mRNAs and proteins have been reported to be involved in the progression of aging. It is one of the major risk factors in the patho-physiology of various diseases and disorders. Recently, the discovery of pervasive transcription of a vast pool of heterogeneous regulatory noncoding RNAs (ncRNAs), including small ncRNAs (sncRNAs) and long ncRNAs (lncRNAs), in the mammalian genome have provided an alternative way to study and explore the missing links in the aging process, its mechanism(s) and related diseases in a whole new dimension. The involvement of small noncoding RNAs in aging and age-related diseases have been extensively studied and recently reviewed. However, lncRNAs, whose function is far less explored in relation to aging, have emerged as a class of major regulators of genomic functions. Here, we have described some examples of known as well as novel lncRNAs that have been implicated in the progression of the aging process and age-related diseases. This may further stimulate research on noncoding RNAs and the aging process. PMID:26655093

  9. Circulating miRNAs as Potential Marker for Pulmonary Hypertension

    PubMed Central

    Wei, Chuanyu; Henderson, Heather; Spradley, Christopher; Li, Li; Kim, Il-Kwon; Kumar, Sandeep; Hong, Nayeon; Arroliga, Alejandro C.; Gupta, Sudhiranjan

    2013-01-01

    MircoRNAs (miRNAs) are small non-coding RNAs that govern the gene expression and, play significant role in the pathogenesis of heart failure. The detection of miRNAs in circulation of pulmonary hypertensive (PH) human subjects remains elusive. In the current study, we determined the pattern of miRNAs of mild-to-severe human PH subjects and, compared them with the control subjects by miRNA array. Blood was obtained using fluoroscopic and waveform guided catheterization from the distal (pulmonary artery) port of the catheter. A total 40 human subjects were included in the study and, the degree of PH was determined by mean pulmonary arterial pressure. Among several miRNAs in the array, we validated 14 miRNAs and, the data were consistent with the array profile. We identified several novel downregulated miRNAs (miR-451, miR-1246) and upregulated miRNAs (miR-23b, miR-130a and miR-191) in the circulation of PH subjects. Our study showed novel set of miRNAs which are dysregulated in PH and, are directly proportional to the degree of PH. These miRNAs may be considered as potential biomarker for early detection of PH. PMID:23717609

  10. Expression Signatures of Long Noncoding RNAs in Adolescent Idiopathic Scoliosis

    PubMed Central

    Liu, Xiao-Yang; Wang, Liang; Yu, Bin; Zhuang, Qian-yu; Wang, Yi-Peng

    2015-01-01

    Purpose. Adolescent idiopathic scoliosis (AIS), the most common pediatric spinal deformity, is considered a complex genetic disease. Causing genes and pathogenesis of AIS are still unclear. This study was designed to identify differentially expressed long noncoding RNAs (lncRNAs) involving the pathogenesis of AIS. Methods. We first performed comprehensive screening of lncRNA and mRNA in AIS patients and healthy children using Agilent human lncRNA + mRNA Array V3.0 microarray. LncRNAs expression in different AIS patients was further evaluated using quantitative PCR. Results. A total of 139 lncRNAs and 546 mRNAs were differentially expressed between AIS patients and healthy control. GO and Pathway analysis showed that these mRNAs might be involved in bone mineralization, neuromuscular junction, skeletal system morphogenesis, nucleotide and nucleic acid metabolism, and regulation of signal pathway. Four lncRNAs (ENST00000440778.1, ENST00000602322.1, ENST00000414894.1, and TCONS_00028768) were differentially expressed between different patients when grouped according to age, height, classification, severity of scoliosis, and Risser grade. Conclusions. This study demonstrates the abnormal expression of lncRNAs and mRNAs in AIS, and the expression of some lncRNAs was related to clinical features. This study is helpful for further understanding of lncRNAs in pathogenesis, treatment, and prognosis of AIS. PMID:26421281

  11. Noncoding RNAs, Emerging Regulators in Root Endosymbioses.

    PubMed

    Lelandais-Brière, Christine; Moreau, Jérémy; Hartmann, Caroline; Crespi, Martin

    2016-03-01

    Endosymbiosis interactions allow plants to grow in nutrient-deficient soil environments. The arbuscular mycorrhizal (AM) symbiosis is an ancestral interaction between land plants and fungi, whereas nitrogen-fixing symbioses are highly specific for certain plants, notably major crop legumes. The signaling pathways triggered by specific lipochitooligosaccharide molecules involved in these interactions have common components that also overlap with plant root development. These pathways include receptor-like kinases, transcription factors (TFs), and various intermediate signaling effectors, including noncoding (nc)RNAs. These latter molecules have emerged as major regulators of gene expression and small ncRNAs, composed of micro (mi)RNAs and small interfering (si)RNAs, are known to control gene expression at transcriptional (chromatin) or posttranscriptional levels. In this review, we describe exciting recent data connecting variants of conserved si/miRNAs with the regulation of TFs, such as NSP2, NFY-A1, auxin-response factors, and AP2-like proteins, known to be involved in symbiosis. The link between hormonal regulations and these si- and miRNA-TF nodes is proposed in a model in which different feedback loops or regulations controlling endosymbiosis signaling are integrated. The diversity and emerging regulatory networks of young legume miRNAs are also highlighted. PMID:26894282

  12. High throughput sequencing of two celery varieties small RNAs identifies microRNAs involved in temperature stress response

    PubMed Central

    2014-01-01

    Background MicroRNAs (miRNAs) are small, non-coding RNAs of 20 to 24 nucleotides that regulate gene expression and responses to biotic and abiotic stress. Till now, no reports have previously been published concerning miRNAs in celery. Results Two small RNAs libraries were constructed from two celery varieties, ‘Jinnan Shiqin’ and ‘Ventura’, and characterized by deep sequencing. A total of 431 (418 known and 13 novel) and 346 (341 known and five novel) miRNAs were identified in celery varieties ‘Jinnan Shiqin’ and ‘Ventura’, respectively. Potential miRNA-target genes were predicted and annotated by screening diverse protein databases, including Gene Ontology, Cluster of Orthologous Groups and Kyoto Encyclopedia of Genes and Genomes. Significant differential expression between the two varieties was seen for 221 miRNAs. qRT-PCR was used to analyze the abundance of six miRNAs under cold and heat stress conditions. The results showed that miRNAs may have important functions in controlling temperature stress in celery. Conclusion A large number of miRNAs were identified in celery, and their target genes, functional annotations, and gene expression patterns have been explored. These findings provide the first information on celery miRNAs and enhance understanding of celery miRNA regulatory mechanisms under extreme temperature stress. PMID:24673837

  13. Regulatory RNAs in Bacteria

    PubMed Central

    Waters, Lauren S.; Storz, Gisela

    2011-01-01

    RNA regulators in bacteria are a heterogenous group of molecules that act by various mechanisms to modulate a wide range of physiological responses. One class comprises riboswitches, which are parts of the mRNAs they regulate. These leader sequences fold into structures amenable to conformational changes upon the binding of small molecules. Riboswitches thus sense and respond to the availability of various nutrients in the cell. Other small transcripts bind to proteins, among them global regulators, and antagonize their functions. The largest and most extensively studied set of small RNA regulators act through base pairing with RNAs, usually modulating the translation and stability of mRNAs. The majority of these small RNAs regulate responses to changes in environmental conditions. Finally, a recently discovered group of RNA regulators, known as the CRISPR RNAs, contain short regions of homology to bacteriophage and plasmid sequences. CRISPR RNAs interfere with bacteriophage infection and plasmid conjugation by targeting the homologous foreign DNA through an unknown mechanism. Here we discuss what is known about these RNA regulators, as well as the many intriguing questions that remain to be addressed. PMID:19239884

  14. Integrated analysis of noncoding RNAs and mRNAs reveals their potential roles in the biological activities of the growth hormone receptor.

    PubMed

    Chang, Lei; Qi, Haolong; Xiao, Yusha; Li, Changsheng; Wang, Yitao; Guo, Tao; Liu, Zhisu; Liu, Quanyan

    2016-08-01

    Accumulating evidence has indicated that noncoding RNAs (ncRNAs) have important regulatory potential in various biological processes. The molecular mechanisms by which growth hormone receptor (GHR) deficiency protects against age-related pathologies, reduces the incidence and delays the occurrence of fatal neoplasms are unclear. The aim of this study was to investigate miRNA, lncRNA and mRNA expression profiles and the potential functional roles of these RNA molecules in GHR knockout (GHR-KO) mice. Microarray expression profiles of miRNAs, lncRNAs and mRNAs were determined in wild type control mice and in GHR-KO mice. Differential expression, pathway and gene network analyses were developed to identify the possible biological roles of functional RNA molecules. Compared to wild type control mice, 1695 lncRNAs, 914 mRNAs and 9 miRNAs were upregulated and 1747 lncRNAs, 786 mRNAs and 21 miRNAs were downregulated in female GHR-KO mice. Moreover, 1265 lncRNAs, 724 mRNAs and 41 miRNAs were upregulated and 1377 lncRNAs, 765 mRNAs and 16 miRNAs were downregulated in male GHR-KO mice compared to wild type mice. Co-expression analysis of mRNAs, lncRNAs, and miRNAs showed that mRNAs including Hemxi2, Ero1Ib, 4933434i20RIK, Pde7a and Lgals1, lncRNAs including ASMM9PARTA014848, EL605414-P1, ASMM9PARTA051724, ASMM9PARTA045378 and ASMM9PARTA049185, and miRNAs including miR-188-3p, miR-690, miR-709 and miR-710 are situated at the core position of a three-dimensional lncRNA-mRNA-miRNA regulatory network. KEGG analysis showed that the most significantly regulated pathway was steroid hormone biosynthesis. We identified a set of lncRNAs, miRNAs and mRNAs that were aberrantly expressed in GHR-KO mice. Our results provide a foundation and an expansive view of the biological activities of the GHR. PMID:27064376

  15. EXPRESSION PROFILES OF MICRO-RNAS IN SWINE MUSCLE DEVELOPMENT

    Technology Transfer Automated Retrieval System (TEKTRAN)

    MicroRNAs (miRs) are small ~18-22 nucleotide-long non-coding RNAs that have been shown to control gene expression by inhibiting translation or targeting messenger RNA for degradation. MiRs have been implicated in control of development, tissue homeostasis, and immune response. We examined the expr...

  16. Noncoding RNAs in Endocrine Malignancy

    PubMed Central

    Kentwell, Jessica; Gundara, Justin S.

    2014-01-01

    Only recently has it been uncovered that the mammalian transcriptome includes a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. Among numerous kinds of ncRNAs, short noncoding RNAs, such as microRNAs, have been extensively investigated with regard to their biogenesis, function, and importance in carcinogenesis. Long noncoding RNAs (lncRNAs) have only recently been implicated in playing a key regulatory role in cancer biology. The deregulation of ncRNAs has been demonstrated to have important roles in the regulation and progression of cancer development. In this review, we describe the roles of both short noncoding RNAs (including microRNAs, small nuclear RNAs, and piwi-interacting RNAs) and lncRNAs in carcinogenesis and outline the possible underlying genetic mechanisms, with particular emphasis on clinical applications. The focus of our review includes studies from the literature on ncRNAs in traditional endocrine-related cancers, including thyroid, parathyroid, adrenal gland, and gastrointestinal neuroendocrine malignancies. The current and potential future applications of ncRNAs in clinical cancer research is also discussed, with emphasis on diagnosis and future treatment. PMID:24718512

  17. The implication of microRNAs and endo-siRNAs in animal germline and early development.

    PubMed

    Dallaire, Alexandra; Simard, Martin J

    2016-08-01

    Germ cells provide maternal mRNAs that are stored in the oocyte, and later translated at a specific time of development. In this context, gene regulation depends mainly on post-transcriptional mechanisms that contribute to keep maternal transcripts in a stable and translationally silent state. In recent years, small non-coding RNAs, such as microRNAs have emerged as key post-transcriptional regulators of gene expression. microRNAs control the translation efficiency and/or stability of targeted mRNAs. microRNAs are present in animal germ cells and maternally inherited microRNAs are abundant in early embryos. However, it is not known how microRNAs control the stability and translation of maternal transcripts. In this review, we will discuss the implication of germline microRNAs in regulating animal oogenesis and early embryogenesis as well as compare their roles with endo-siRNAs, small RNA species that share key molecular components with the microRNA pathway. PMID:27287880

  18. Outer Planet Flagship Mission

    NASA Astrophysics Data System (ADS)

    Cutts, James; Niebur, C.; Dudzinski, L.; Coradini, M.; Lebreton, J.

    2008-09-01

    Studies for Outer Planet Missions have been ongoing for many years, but in 2007 NASA commissioned four specific studies to be considered for further examination; the Europa Explorer, Titan Explorer, Enceladus Mission and Jupiter Science Orbiter. During the same time frame ESA invited Outer Planet proposals under the Cosmic Vision call. Two were submitted, TandEm and LaPlace, which focused on Titan/Enceladus and Jupiter System science respectively. In 2008, NASA selected two of the missions, Europa Explorer and Titan Explorer, and ESA selected the two outer planet proposals for further study. This poster describes the process by which NASA and ESA are collaborating on the current studies which are now named the Titan/Saturn (TSSM) and Europa/Jupiter Missions (EJSM). We provide an update on the background, organization and schedule for these two mission studies.

  19. Outer Planet Flagship Missions

    NASA Astrophysics Data System (ADS)

    Niebur, C.; Dudzinski, L.; Coradini, M.; Lebreton, J.; Cutts, J. A.

    2008-05-01

    Studies for Outer Planet Missions have been ongoing for many years, but in 2007 NASA commissioned four specific studies to be considered for further examination; the Europa Explorer, Titan Explorer, Enceladus Mission and Jupiter Science Orbiter. During the same time frame ESA invited Outer Planet proposals under the Cosmic Vision call. Two were submitted, TandEM and LaPlace, which focused on Titan/Enceladus and Jupiter System science respectively. In 2008, NASA selected two of the missions, Europa Explorer and Titan Explorer, and ESA selected the two outer planet proposals for further study. This poster describes the process by which NASA and ESA are collaborating on the current studies which are now named the Titan/Saturn and Europa/Jupiter Missions. We provide the background, organization and schedule that are presently envisaged for these two mission studies.

  20. Outer Planets Flagship Mission

    NASA Astrophysics Data System (ADS)

    Niebur, C.; Dudzinski, L.; Coradini, M.; Lebreton, J. P.; Cutts, J. A.

    2008-09-01

    Studies for Outer Planet Missions have been ongoing for many years, but in 2007 NASA commissioned four specific studies to be considered for further examination; the Europa Explorer, Titan Explorer, Enceladus Mission and Jupiter Science Orbiter. During the same time frame ESA invited Outer Planet proposals under the Cosmic Vision call. Two were submitted, TandEm and LaPlace, which focused on Titan/Enceladus and Jupiter System science respectively. In 2008, NASA selected two of the missions, Europa Explorer and Titan Explorer, and ESA selected the two outer planet proposals for further study. This poster describes the process by which NASA and ESA are collaborating on the current studies which are now named the Titan/Saturn (TSSM) and Europa/Jupiter Missions (EJSM). We provide an update on the background, organization and schedule for these two mission studies.

  1. Saturn's outer magnetosphere

    NASA Technical Reports Server (NTRS)

    Schardt, A. W.; Behannon, K. W.; Carbary, J. F.; Eviatar, A.; Lepping, R. P.; Siscoe, G. L.

    1983-01-01

    Similarities between the Saturnian and terrestrial outer magnetosphere are examined. Saturn, like Earth, has a fully developed magnetic tail, 80 to 100 RS in diameter. One major difference between the two outer magnetospheres is the hydrogen and nitrogen torus produced by Titan. This plasma is, in general, convected in the corotation direction at nearly the rigid corotation speed. Energies of magnetospheric particles extend to above 500 keV. In contrast, interplanetary protons and ions above 2 MeV have free access to the outer magnetosphere to distances well below the Stormer cutoff. This access presumably occurs through the magnetotail. In addition to the H+, H2+, and H3+ ions primarily of local origin, energetic He, C, N, and O ions are found with solar composition. Their flux can be substantially enhanced over that of interplanetary ions at energies of 0.2 to 0.4 MeV/nuc.

  2. Outer membrane protein purification.

    PubMed

    Arigita, C; Jiskoot, W; Graaf, M R; Kersten, G F

    2001-01-01

    The major outer membrane proteins (OMPs) from Neisseria meningitidis, which are expressed at high levels, are subdivided in five classes based on molecular weight (1,2) (see Table 1). Table 1 Major Meningococcal Outer-Membrane Proteins Outer-membrane proteins Name Molecular maass Function/characteristics Class 1 PorA 44-47 kDa Porin Class 2/3 PorB 37-42 kDa Porin Class 4 Rmp Reductionmodifiableprotein, unknown Class 5 Opa 26-30 kDa Adhesion,opacity protein Opc 25 kDa Invasion, opacity protein Iron-regulated proteins Mirp 37 kDa Iron acquisition (?);majoriron-regulatedprotein FrpB 70 kDa Ferric enterobactin receptor (also FetA) Adapted from ref. (1). PMID:21336748

  3. MicroRNAs in rheumatoid arthritis.

    PubMed

    Salehi, Eisa; Eftekhari, Rahil; Oraei, Mona; Gharib, Alvand; Bidad, Katayoon

    2015-04-01

    The role of genetic and epigenetic factors in the development of rheumatic diseases has been an interesting field of research over the past decades all around the world. Research on the role of microRNAs (miRNAs) in rheumatoid arthritis (RA) has been active and ongoing, and investigations have attempted to use miRNAs as biomarkers in disease diagnosis, prognosis, and treatment. This review focuses on experimental researches in the field of miRNAs and RA to present the data available up to this date and includes researches searched by keywords "microRNA" and "rheumatoid arthritis" in PubMed from 2008 to January 2015. All references were also searched for related papers. miRNAs are shown to act as proinflammatory or anti-inflammatory agents in diverse cell types, and their role seems to be regulatory in most instances. Researchers have evaluated miRNAs in patients compared to controls or have investigated their role by overexpressing or silencing them. Multiple targets have been identified in vivo, in vitro, or in silico, and the researches still continue to show their efficacy in clinical settings. PMID:25736037

  4. A Comprehensive Expression Profile of MicroRNAs and Other Classes of Non-Coding Small RNAs in Barley Under Phosphorous-Deficient and -Sufficient Conditions

    PubMed Central

    Hackenberg, Michael; Huang, Po-Jung; Huang, Chun-Yuan; Shi, Bu-Jun; Gustafson, Perry; Langridge, Peter

    2013-01-01

    Phosphorus (P) is essential for plant growth. MicroRNAs (miRNAs) play a key role in phosphate homeostasis. However, little is known about P effect on miRNA expression in barley (Hordeum vulgare L.). In this study, we used Illumina's next-generation sequencing technology to sequence small RNAs (sRNAs) in barley grown under P-deficient and P-sufficient conditions. We identified 221 conserved miRNAs and 12 novel miRNAs, of which 55 were only present in P-deficient treatment while 32 only existed in P-sufficient treatment. Total 47 miRNAs were significantly differentially expressed between the two P treatments (|log2| > 1). We also identified many other classes of sRNAs, including sense and antisense sRNAs, repeat-associated sRNAs, transfer RNA (tRNA)-derived sRNAs and chloroplast-derived sRNAs, and some of which were also significantly differentially expressed between the two P treatments. Of all the sRNAs identified, antisense sRNAs were the most abundant sRNA class in both P treatments. Surprisingly, about one-fourth of sRNAs were derived from the chloroplast genome, and a chloroplast-encoded tRNA-derived sRNA was the most abundant sRNA of all the sRNAs sequenced. Our data provide valuable clues for understanding the properties of sRNAs and new insights into the potential roles of miRNAs and other classes of sRNAs in the control of phosphate homeostasis. PMID:23266877

  5. Expression of microRNAs in fibroblast of pterygium

    PubMed Central

    Lee, Joon H.; Jung, Sun-Ah; Kwon, Young-A; Chung, Jae-Lim; Kim, Ungsoo Samuel

    2016-01-01

    AIM To screen microRNAs (miRNAs) and set up target miRNAs in pterygium. METHODS Primary fibroblasts were isolated from pterygium and Tenon's capsule and cultured. Immunocytochemical analysis and Western blotting were performed to confirm the culture of fibroblasts. In all, 1733 miRNAs were screened in the first step by using GeneChip® miRNA3.0 Array. Specific miRNAs involved in the pathogenesis of pterygium were subsequently determined using the following criteria: 1) high reproducibility in a repetitive test; 2) base log value of >7.0 for both control and pterygial fibroblasts; and 3) log ratio of >1.0 between pterygial fibroblasts and control fibroblasts. RESULTS Primary screening showed that 887/1733 miRNAs were up-regulated and 846/1733 miRNAs were down-regulated in pterygial fibroblasts compared with those in control fibroblasts. Of the 1733 miRNAs screened, 4 miRNAs, namely, miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p, met the above-mentioned criteria. Primary screening showed that these 4 miRNAs were up-regulated in pterygial fibroblasts compared with control fibroblasts and that miRNA-143a-3p had the highest mean ratio compared with the miRNAs in control fibroblasts. CONCLUSION miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p are up-regulated in pterygial fibroblasts compared with control fibroblasts, suggesting their involvement in the pathogenesis of pterygium. PMID:27500101

  6. Epstein-Barr viral microRNAs target caspase 3.

    PubMed

    Harold, Cecelia; Cox, Diana; Riley, Kasandra J

    2016-01-01

    The Epstein-Barr virus (EBV) is a ubiquitous herpesvirus that transforms B cells and causes several malignancies including Burkitt's lymphoma. EBV differentially expresses at least 49 mature microRNAs (miRNAs) during latency in various infected epithelial and B cells. Recent high-throughput studies and functional assays have begun to reveal the function of the EBV miRNAs suggesting roles in latency, cell cycle control, and apoptosis. In particular, the central executioner of apoptosis, Caspase 3 (CASP3), was proposed as a target of select EBV miRNAs. However, whether CASP3 is truly a target of EBV miRNAs, and if so, which specific miRNAs target CASP3 is still under debate. Based on previously published high-throughput biochemical data and a bioinformatic analysis of the entire CASP3 3'-UTR, we identified 12 EBV miRNAs that have one or more seed binding sites in the CASP3 3'-UTR. We individually tested all 12 miRNAs for repression of CASP3 in luciferase reporter assays, and nine showed statistically significant (P < 0.001) repression of a full-length CASP3 reporter. Further, three EBV miRNAs, including BART22, exhibited repression of endogenous CASP3 protein. These data confirm that CASP3 is a direct target of specific EBV BART miRNAs. PMID:27565721

  7. Transposon Defense by Endo-siRNAs, piRNAs and Somatic pilRNAs in Drosophila: Contributions of Loqs-PD and R2D2

    PubMed Central

    Mirkovic-Hösle, Milijana; Förstemann, Klaus

    2014-01-01

    Transposable elements are a serious threat for genome integrity and their control via small RNA mediated silencing pathways is an ancient strategy. The fruit fly Drosophila melanogaster has two silencing activities that target transposons: endogenous siRNAs (esiRNAs or endo-siRNAs) and Piwi-interacting small RNAs (piRNAs). The biogenesis of endo-siRNAs involves the Dicer-2 co-factors Loqs-PD, which acts predominantly during processing of dsRNA by Dcr-2, and R2D2, which primarily helps to direct siRNAs into the RNA interference effector Ago2. Nonetheless, loss of either protein is not sufficient to produce a phenotype comparable with a dcr-2 mutation. We provide further deep sequencing evidence supporting the notion that R2D2 and Loqs-PD have partially overlapping function. Certain transposons display a preference for either dsRBD-protein during production or loading; this appeared to correlate neither with overall abundance, classification of the transposon or a specific site of genomic origin. The endo-siRNA biogenesis pathway in germline operates according to the same principles as the existing model for the soma, and its impairment does not significantly affect piRNAs. Expanding the analysis, we confirmed the occurrence of somatic piRNA-like RNAs (pilRNAs) that show a ping-pong signature. We detected expression of the Piwi-family protein mRNAs only barely above background, indicating that the somatic pilRNAs may arise from a small sub-population of somatic cells that express a functional piRNA pathway. PMID:24454776

  8. Law in Outer Space.

    ERIC Educational Resources Information Center

    Schmidt, William G.

    1997-01-01

    Provides an overview of the current practice and fascinating future of legal issues involved in outer space exploration and colonization. Current space law, by necessity, addresses broad principles rather than specific incidents. Nonetheless, it covers a variety of issues including commercial development, rescue agreements, object registration,…

  9. Dysregulated expression of microRNAs and mRNAs in myocardial infarction

    PubMed Central

    Wang, Yaping; Pan, Xiaohong; Fan, Youqi; Hu, Xinyang; Liu, Xianbao; Xiang, Meixiang; Wang, Jian’an

    2015-01-01

    Acute myocardial infarction (AMI) is a major cause of mortality in the general population. However, the molecular phenotypes and therapeutic targets of AMI patients remain unclear. By profiling genome-wide transcripts and microRNAs (miRNAs) in a cohort of 23 AMI patients and 23 non-AMI patients, we found 218 dysregulated genes identified in the infarcted heart tissues from AMI patients relative to non-AMI controls. Pathway enrichment analysis of the dysregulated genes pointed to cell signaling/communication, cell/organism defense and cell structure/motility. We next compared the expression profiles of potential regulating miRNAs, suggesting that dysregulation of a number of AMI-associated genes (e.g., IL12A, KIF1A, HIF1α and CDK13) may be attributed to the dysregulation of their respective regulating miRNAs. One potentially pathogenic miRNA-mRNA pair, miR-210-HIF1α, was confirmed in a mouse model of myocardial infarction (MI). Inhibition of miR-210 expression improved the survival and cardiac function of MI mice. In conclusion, we presented the pathologic relationships between miRNAs and their gene targets in AMI. Such deregulated microRNAs and mRNAs like miR-210 serve as novel therapeutic targets of AMI. PMID:26807177

  10. Non-coding RNAs including miRNAs, piRNAs, and tRNAs in human cancer

    PubMed Central

    Heyns, Mieke; Kovalchuk, Olga

    2015-01-01

    Over 98% of our genes code for RNA transcripts that will never become translated into protein. Numerous non-coding RNA (ncRNA) transcripts are structurally and functionally diverse. In particular, micro RNAs (miRNAs), piwi-interacting RNAs (piRNAs), and, more recently, transfer RNAs (tRNAs) are implicated as regulators of key genes and processes that are involved in various human diseases, including cancer. Here, we summarize the recent findings and perspectives in the small RNA and cancer research. PMID:26405161

  11. Circular RNAs are abundant, conserved, and associated with ALU repeats

    PubMed Central

    Jeck, William R.; Sorrentino, Jessica A.; Wang, Kai; Slevin, Michael K.; Burd, Christin E.; Liu, Jinze; Marzluff, William F.; Sharpless, Norman E.

    2013-01-01

    Circular RNAs composed of exonic sequence have been described in a small number of genes. Thought to result from splicing errors, circular RNA species possess no known function. To delineate the universe of endogenous circular RNAs, we performed high-throughput sequencing (RNA-seq) of libraries prepared from ribosome-depleted RNA with or without digestion with the RNA exonuclease, RNase R. We identified >25,000 distinct RNA species in human fibroblasts that contained non-colinear exons (a “backsplice”) and were reproducibly enriched by exonuclease degradation of linear RNA. These RNAs were validated as circular RNA (ecircRNA), rather than linear RNA, and were more stable than associated linear mRNAs in vivo. In some cases, the abundance of circular molecules exceeded that of associated linear mRNA by >10-fold. By conservative estimate, we identified ecircRNAs from 14.4% of actively transcribed genes in human fibroblasts. Application of this method to murine testis RNA identified 69 ecircRNAs in precisely orthologous locations to human circular RNAs. Of note, paralogous kinases HIPK2 and HIPK3 produce abundant ecircRNA from their second exon in both humans and mice. Though HIPK3 circular RNAs contain an AUG translation start, it and other ecircRNAs were not bound to ribosomes. Circular RNAs could be degraded by siRNAs and, therefore, may act as competing endogenous RNAs. Bioinformatic analysis revealed shared features of circularized exons, including long bordering introns that contained complementary ALU repeats. These data show that ecircRNAs are abundant, stable, conserved and nonrandom products of RNA splicing that could be involved in control of gene expression. PMID:23249747

  12. The role of microRNAs in bone remodeling

    PubMed Central

    Jing, Dian; Hao, Jin; Shen, Yu; Tang, Ge; Li, Mei-Le; Huang, Shi-Hu; Zhao, Zhi-He

    2015-01-01

    Bone remodeling is balanced by bone formation and bone resorption as well as by alterations in the quantities and functions of seed cells, leading to either the maintenance or deterioration of bone status. The existing evidence indicates that microRNAs (miRNAs), known as a family of short non-coding RNAs, are the key post-transcriptional repressors of gene expression, and growing numbers of novel miRNAs have been verified to play vital roles in the regulation of osteogenesis, osteoclastogenesis, and adipogenesis, revealing how they interact with signaling molecules to control these processes. This review summarizes the current knowledge of the roles of miRNAs in regulating bone remodeling as well as novel applications for miRNAs in biomaterials for therapeutic purposes. PMID:26208037

  13. Bioinformatics of prokaryotic RNAs

    PubMed Central

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  14. Bioinformatics of prokaryotic RNAs.

    PubMed

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  15. Noncoding RNAs and pancreatic cancer

    PubMed Central

    Peng, Juan-Fei; Zhuang, Yan-Yan; Huang, Feng-Ting; Zhang, Shi-Neng

    2016-01-01

    Noncoding RNAs (ncRNAs) represent a class of RNA molecules that typically do not code for proteins. Emerging data suggest that ncRNAs play an important role in several physiological and pathological conditions such as cancer. The best-characterized ncRNAs are the microRNAs (miRNAs), which are short, approximately 22-nucleotide sequences of RNA of approximately 22-nucleotide in length that regulate gene expression at the posttranscriptional level, through transcript degradation or translational repression. MiRNAs can function as master gene regulators, impacting a variety of cellular pathways important to normal cellular functions as well as cancer development and progression. In addition to miRNAs, long ncRNAs, which are transcripts longer than 200 nucleotides, have recently emerged as novel drivers of tumorigenesis. However, the molecular mechanisms of their regulation and function, and the significance of other ncRNAs such as piwi-interacting RNAs in pancreas carcinogenesis are largely unknown. This review summarizes the growing body of evidence supporting the vital roles of ncRNAs in pancreatic cancer, focusing on their dysregulation through both genetic and epigenetic mechanisms, and highlighting the promise of ncRNAs in diagnostic and therapeutic applications of pancreatic cancer. PMID:26811626

  16. Satellite RNAs and Satellite Viruses.

    PubMed

    Palukaitis, Peter

    2016-03-01

    Satellite RNAs and satellite viruses are extraviral components that can affect either the pathogenicity, the accumulation, or both of their associated viruses while themselves being dependent on the associated viruses as helper viruses for their infection. Most of these satellite RNAs are noncoding RNAs, and in many cases, have been shown to alter the interaction of their helper viruses with their hosts. In only a few cases have the functions of these satellite RNAs in such interactions been studied in detail. In particular, work on the satellite RNAs of Cucumber mosaic virus and Turnip crinkle virus have provided novel insights into RNAs functioning as noncoding RNAs. These effects are described and potential roles for satellite RNAs in the processes involved in symptom intensification or attenuation are discussed. In most cases, models describing these roles involve some aspect of RNA silencing or its suppression, either directly or indirectly involving the particular satellite RNA. PMID:26551994

  17. Frontotemporal Lobar Degeneration and MicroRNAs

    PubMed Central

    Piscopo, Paola; Albani, Diego; Castellano, Anna E.; Forloni, Gianluigi; Confaloni, Annamaria

    2016-01-01

    Frontotemporal lobar degeneration (FTLD) includes a spectrum of disorders characterized by changes of personality and social behavior and, often, a gradual and progressive language dysfunction. In the last years, several efforts have been fulfilled in identifying both genetic mutations and pathological proteins associated with FTLD. The molecular bases undergoing the onset and progression of the disease remain still unknown. Recent literature prompts an involvement of RNA metabolism in FTLD, particularly microRNAs (miRNAs). Dysregulation of miRNAs in several disorders, including neurodegenerative diseases, and increasing importance of circulating miRNAs in different pathologies has suggested to implement the study of their possible application as biological markers and new therapeutic targets; moreover, miRNA-based therapy is becoming a powerful tool to deepen the function of a gene, the mechanism of a disease, and validate therapeutic targets. Regarding FTLD, different studies showed that miRNAs are playing an important role. For example, several reports have evaluated miRNA regulation of the progranulin gene suggesting that it is under their control, as described for miR-29b, miR-107, and miR-659. More recently, it has been demonstrated that TMEM106B gene, which protein is elevated in FTLD-TDP brains, is repressed by miR-132/212 cluster; this post-transcriptional mechanism increases intracellular levels of progranulin, affecting its pathways. These findings if confirmed could suggest that these microRNAs have a role as potential targets for some related-FTLD genes. In this review, we focus on the emerging roles of the miRNAs in the pathogenesis of FTLD. PMID:26903860

  18. MicroRNAs and Drug Addiction

    PubMed Central

    Bali, Purva; Kenny, Paul J.

    2012-01-01

    Drug addiction is considered a disorder of neuroplasticity in brain reward and cognition systems resulting from aberrant activation of gene expression programs in response to prolonged drug consumption. Non-coding RNAs (ncRNAs) are key regulators of almost all aspects of cellular physiology. MicroRNAs (miRNAs) are small (∼21–23 nucleotides) ncRNAs transcripts that regulate gene expression at the post-transcriptional level. Recently, miRNAs were shown to play key roles in the drug-induced remodeling of brain reward systems that likely drives the emergence of addiction. Here, we review evidence suggesting that one particular miRNA, miR-212, plays a particularly prominent role in vulnerability to cocaine addiction. We review evidence showing that miR-212 expression is increased in the dorsal striatum of rats that show compulsive-like cocaine-taking behaviors. Increases in miR-212 expression appear to protect against cocaine addiction, as virus-mediated striatal miR-212 overexpression decreases cocaine consumption in rats. Conversely, disruption of striatal miR-212 signaling using an antisense oligonucleotide increases cocaine intake. We also review data that identify two mechanisms by which miR-212 may regulate cocaine intake. First, miR-212 has been shown to amplify striatal cAMP response element binding protein (CREB) signaling through a mechanism involving activation of Raf1 kinase. Second, miR-212 was also shown to regulate cocaine intake by repressing striatal expression of methyl CpG binding protein 2 (MeCP2), consequently decreasing protein levels of brain-derived neurotrophic factor (BDNF). The concerted actions of miR-212 on striatal CREB and MeCP2/BDNF activity greatly attenuate the motivational effects of cocaine. These findings highlight the unique role for miRNAs in simultaneously controlling multiple signaling cascades implicated in addiction. PMID:23717324

  19. Expression Profiles of Long Noncoding RNAs and Messenger RNAs in Mn-Exposed Hippocampal Neurons of Sprague–Dawley Rats Ascertained by Microarray: Implications for Mn-Induced Neurotoxicity

    PubMed Central

    Yang, Xiaobo; Liang, Guiqiang; Zhang, Li’e; Li, Qin; Xiong, Feng; Peng, Suwan; Ma, Yifei; Huang, Xiaowei; Zou, Yunfeng

    2016-01-01

    Manganese (Mn) is an essential trace element, while excessive expose may induce neurotoxicity. Recently, lncRNAs have been extensively studied and it has been confirmed that lncRNAs participate in neural functions and aberrantly expressed lncRNAs are involved in neurological diseases. However, the pathological effects of lncRNAs on Mn-induced neurotoxicity remain unclear. In this study, the expression profiles of lncRNAs and messenger RNAs (mRNAs) were identified in Mn-treated hippocampal neurons and control neurons via microarray. Bioinformatic methods and intersection analysis were also employed. Results indicated that 566, 1161, and 1474 lncRNAs meanwhile 1848, 3228, and 4022 mRNAs were aberrantly expressed in low, intermediate, and high Mn-exposed groups compared with the control group, respectively. Go analysis determined that differentially expressed mRNAs were targeted to biological processes, cellular components, and molecular functions. Pathway analysis indicated that these mRNAs were enriched in insulin secretion, cell cycle, and DNA replication. Intersection analysis denominated that 135 lncRNAs and 373 mRNAs were consistently up-regulated while 150 lncRNAs and 560 mRNAs were consistently down-regulated. Meanwhile, lncRNA BC079195 was significantly up-regulated while lncRNAs uc.229- and BC089928 were significantly down-regulated in three comparison groups. The relative expression levels of 3 lncRNAs and 4 mRNAs were validated through qRT-PCR. To the best of our knowledge, this study is the first to identify the expression patterns of lncRNAs and mRNAs in hippocampal neurons of Sprague–Dawley rats. The results may provide evidence on underlying mechanisms of Mn-induced neurotoxicity, and aberrantly expressed lncRNAs/mRNAs may be useful in further investigations to detect early symptoms of Mn-induced neuropsychiatric disorders in the central nervous system. PMID:26745496

  20. Circular RNAs in Eukaryotic Cells

    PubMed Central

    Chen, Liang; Huang, Chuan; Wang, Xiaolin; Shan, Ge

    2015-01-01

    Circular RNAs (circRNAs) are now recognized as large species of transcripts in eukaryotic cells. From model organisms such as C. elegans, Drosophila, mice to human beings, thousands of circRNAs formed from back-splicing of exons have been identified. The known complexity of transcriptome has been greatly expanded upon the discovery of these RNAs. Studies about the biogenesis and physiological functions have yielded substantial knowledge for the circRNAs, and they are now more likely to be viewed as regulatory elements coded by the genome rather than unavoidable noise of gene expression. Certain human diseases may also relate to circRNAs. These circRNAs show diversifications in features such as sequence composition and cellular localization, and thus we propose that they may be divided into subtypes such as cytoplasmic circRNAs, nuclear circRNAs, and exon-intron circRNAs (EIciRNAs). Here we summarize and discuss knowns and unknowns for these RNAs, and we need to keep in mind that the whole field is still at the beginning of exciting explorations. PMID:27047251

  1. Grapevine microRNAs responsive to exogenous gibberellin

    PubMed Central

    2014-01-01

    Background MicroRNAs (miRNAs), involving in various biological and metabolic processes, have been discovered and analyzed in quite a number of plants species, such as Arabidopsis, rice and other plants. However, there have been few reports about grapevine miRNAs in response to gibberelline (GA3). Results Solexa technology was used to sequence small RNA libraries constructed from grapevine berries treated with GA3 and the control. A total of 122 known and 90 novel grapevine miRNAs (Vvi-miRNAs) were identified. Totally, 137 ones were found to be clearly responsive to GA3, among which 58 were down-regulated, 51 were up-regulated, 21 could only be detected in the control, and seven were only detected in the treatment. Subsequently, we found that 28 of them were differentially regulated by GA3, with 12 conserved and 16 novel Vvi-miRNAs, based on the analysis of qRT-PCR essays. There existed some consistency in expression levels of GA3-responsive Vvi-miRNAs between high throughput sequencing and qRT-PCR essays. In addition, 117 target genes for 29 novel miRNAs were predicted. Conclusions Deep sequencing of short RNAs from grapevine berries treated with GA3 and the control identified 137 GA3-responsive miRNAs, among which 28 exhibited different expression profiles of response to GA3 in the diverse developmental stages of grapevine berries. These identified Vvi-miRNAs might be involved in the grapevine berry development and response to environmental stresses. PMID:24507455

  2. Regulation of Skeletal Muscle by microRNAs.

    PubMed

    Diniz, Gabriela Placoná; Wang, Da-Zhi

    2016-01-01

    MicroRNAs (miRNAs) are a class of small noncoding RNAs highly conserved across species. miRNAs regulate gene expression posttranscriptionally by base pairing to complementary sequences mainly in the 3'-untranslated region of their target mRNAs to induce mRNA cleavage and translational repression. Thousands of miRNAs have been identified in human and their function has been linked to the regulation of both physiological and pathological processes. The skeletal muscle is the largest human organ responsible for locomotion, posture, and body metabolism. Several conditions such as aging, immobilization, exercise, and diet are associated with alterations in skeletal muscle structure and function. The genetic and molecular pathways that regulate muscle development, function, and regeneration as well as muscular disease have been well established in past decades. In recent years, numerous studies have underlined the importance of miRNAs in the control of skeletal muscle development and function, through its effects on several biological pathways critical for skeletal muscle homeostasis. Furthermore, it has become clear that alteration of the expression of many miRNAs or genetic mutations of miRNA genes is associated with changes on myogenesis and on progression of several skeletal muscle diseases. The present review provides an overview of the current studies and recent progress in elucidating the complex role exerted by miRNAs on skeletal muscle physiology and pathology. © 2016 American Physiological Society. Compr Physiol 6:1279-1294, 2016. PMID:27347893

  3. Noncoding RNAs in Tumor Epithelial-to-Mesenchymal Transition

    PubMed Central

    Lin, Ching-Wen; Lin, Pei-Ying; Yang, Pan-Chyr

    2016-01-01

    Epithelial-derived tumor cells acquire the capacity for epithelial-to-mesenchymal transition (EMT), which enables them to invade adjacent tissues and/or metastasize to distant organs. Cancer metastasis is the main cause of cancer-related death. Molecular mechanisms involved in the switch from an epithelial phenotype to mesenchymal status are complicated and are controlled by a variety of signaling pathways. Recently, a set of noncoding RNAs (ncRNAs), including miRNAs and long noncoding RNAs (lncRNAs), were found to modulate gene expressions at either transcriptional or posttranscriptional levels. These ncRNAs are involved in EMT through their interplay with EMT-related transcription factors (EMT-TFs) and EMT-associated signaling. Reciprocal regulatory interactions between lncRNAs and miRNAs further increase the complexity of the regulation of gene expression and protein translation. In this review, we discuss recent findings regarding EMT-regulating ncRNAs and their associated signaling pathways involved in cancer progression. PMID:26989421

  4. MicroRNAs as novel regulators of stem cell fate

    PubMed Central

    Choi, Eunhyun; Choi, Eunmi; Hwang, Ki-Chul

    2013-01-01

    Mounting evidence in stem cell biology has shown that microRNAs (miRNAs) play a crucial role in cell fate specification, including stem cell self-renewal, lineage-specific differentiation, and somatic cell reprogramming. These functions are tightly regulated by specific gene expression patterns that involve miRNAs and transcription factors. To maintain stem cell pluripotency, specific miRNAs suppress transcription factors that promote differentiation, whereas to initiate differentiation, lineage-specific miRNAs are upregulated via the inhibition of transcription factors that promote self-renewal. Small molecules can be used in a similar manner as natural miRNAs, and a number of natural and synthetic small molecules have been isolated and developed to regulate stem cell fate. Using miRNAs as novel regulators of stem cell fate will provide insight into stem cell biology and aid in understanding the molecular mechanisms and crosstalk between miRNAs and stem cells. Ultimately, advances in the regulation of stem cell fate will contribute to the development of effective medical therapies for tissue repair and regeneration. This review summarizes the current insights into stem cell fate determination by miRNAs with a focus on stem cell self-renewal, differentiation, and reprogramming. Small molecules that control stem cell fate are also highlighted. PMID:24179605

  5. Interspecies Regulation of MicroRNAs and Their Targets

    PubMed Central

    Ha, Misook; Pang, Mingxiong; Agarwal, Vikram; Chen, Z. Jeffrey

    2008-01-01

    MicroRNAs (miRNAs) are 20−24 nucleotide RNA molecules that play essential roles in posttranscriptional regulation of target genes. In animals, miRNAs bind to target mRNA through imperfect complementary sequences that are usually located at the 3’ untranslated regions (UTRs), leading to translational repression or transcript degradation. In plants, miRNAs predominately mediate degradation of target mRNAs via perfect or near-perfect complementary sequences. MicroRNA targets include a large number of transcription factors, suggesting a role of miRNAs in the control of regulatory networks and cellular growth and development. Many miRNAs and their targets are conserved among plants or animals, whereas some are specific to a few plant or animal lineages. Conserved miRNAs do not necessarily exhibit the same expression levels or patterns in different species or at different stages within a species. Therefore, sequence and expression divergence in miRNAs between species may affect miRNA accumulation and target regulation in interspecific hybrids and allopolyploids that contain two or more divergent genomes, leading to developmental changes and phenotypic variation in the new species. PMID:18407843

  6. Identification of Cassava MicroRNAs under Abiotic Stress.

    PubMed

    Ballén-Taborda, Carolina; Plata, Germán; Ayling, Sarah; Rodríguez-Zapata, Fausto; Becerra Lopez-Lavalle, Luis Augusto; Duitama, Jorge; Tohme, Joe

    2013-01-01

    The study of microRNAs (miRNAs) in plants has gained significant attention in recent years due to their regulatory role during development and in response to biotic and abiotic stresses. Although cassava (Manihot esculenta Crantz) is tolerant to drought and other adverse conditions, most cassava miRNAs have been predicted using bioinformatics alone or through sequencing of plants challenged by biotic stress. Here, we use high-throughput sequencing and different bioinformatics methods to identify potential cassava miRNAs expressed in different tissues subject to heat and drought conditions. We identified 60 miRNAs conserved in other plant species and 821 potential cassava-specific miRNAs. We also predicted 134 and 1002 potential target genes for these two sets of sequences. Using real time PCR, we verified the condition-specific expression of 5 cassava small RNAs relative to a non-stress control. We also found, using publicly available expression data, a significantly lower expression of the predicted target genes of conserved and nonconserved miRNAs under drought stress compared to other cassava genes. Gene Ontology enrichment analysis along with condition specific expression of predicted miRNA targets, allowed us to identify several interesting miRNAs which may play a role in stress-induced posttranscriptional regulation in cassava and other plants. PMID:24328029

  7. Identification of Cassava MicroRNAs under Abiotic Stress

    PubMed Central

    Ballén-Taborda, Carolina; Plata, Germán; Ayling, Sarah; Rodríguez-Zapata, Fausto; Tohme, Joe

    2013-01-01

    The study of microRNAs (miRNAs) in plants has gained significant attention in recent years due to their regulatory role during development and in response to biotic and abiotic stresses. Although cassava (Manihot esculenta Crantz) is tolerant to drought and other adverse conditions, most cassava miRNAs have been predicted using bioinformatics alone or through sequencing of plants challenged by biotic stress. Here, we use high-throughput sequencing and different bioinformatics methods to identify potential cassava miRNAs expressed in different tissues subject to heat and drought conditions. We identified 60 miRNAs conserved in other plant species and 821 potential cassava-specific miRNAs. We also predicted 134 and 1002 potential target genes for these two sets of sequences. Using real time PCR, we verified the condition-specific expression of 5 cassava small RNAs relative to a non-stress control. We also found, using publicly available expression data, a significantly lower expression of the predicted target genes of conserved and nonconserved miRNAs under drought stress compared to other cassava genes. Gene Ontology enrichment analysis along with condition specific expression of predicted miRNA targets, allowed us to identify several interesting miRNAs which may play a role in stress-induced posttranscriptional regulation in cassava and other plants. PMID:24328029

  8. Processing of intronic microRNAs

    PubMed Central

    Kim, Young-Kook; Kim, V Narry

    2007-01-01

    The majority of human microRNA (miRNA) loci are located within intronic regions and are transcribed by RNA polymerase II as part of their hosting transcription units. The primary transcripts are cleaved by Drosha to release ∼70 nt pre-miRNAs that are subsequently processed by Dicer to generate mature ∼22 nt miRNAs. It is generally believed that intronic miRNAs are released by Drosha from excised introns after the splicing reaction has occurred. However, our database searches and experiments indicate that intronic miRNAs can be processed from unspliced intronic regions before splicing catalysis. Intriguingly, cleavage of an intron by Drosha does not significantly affect the production of mature mRNA, suggesting that a continuous intron may not be required for splicing and that the exons may be tethered to each other. Hence, Drosha may cleave intronic miRNAs between the splicing commitment step and the excision step, thereby ensuring both miRNA biogenesis and protein synthesis from a single primary transcript. Our study provides a novel example of eukaryotic gene organization and RNA-processing control. PMID:17255951

  9. Untranslated regions of mRNAs

    PubMed Central

    Mignone, Flavio; Gissi, Carmela; Liuni, Sabino; Pesole, Graziano

    2002-01-01

    Gene expression is finely regulated at the post-transcriptional level. Features of the untranslated regions of mRNAs that control their translation, degradation and localization include stem-loop structures, upstream initiation codons and open reading frames, internal ribosome entry sites and various cis-acting elements that are bound by RNA-binding proteins. PMID:11897027

  10. Identification of novel drought-responsive microRNAs and trans-acting siRNAs from Sorghum bicolor (L.) Moench by high-throughput sequencing analysis

    PubMed Central

    Katiyar, Amit; Smita, Shuchi; Muthusamy, Senthilkumar K.; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.

    2015-01-01

    Small non-coding RNAs (sRNAs) namely microRNAs (miRNAs) and trans-acting small interfering RNAs (tasi-RNAs) play a crucial role in post-transcriptional regulation of gene expression and thus the control plant development and stress responses. In order to identify drought-responsive miRNAs and tasi-RNAs in sorghum, we constructed small RNA libraries from a drought tolerant (M35-1) and susceptible (C43) sorghum genotypes grown under control and drought stress conditions, and sequenced by Illumina Genome Analyzer IIx. Ninety seven conserved and 526 novel miRNAs representing 472 unique miRNA families were identified from sorghum. Ninety-six unique miRNAs were found to be regulated by drought stress, of which 32 were up- and 49 were down-regulated (fold change ≥ 2 or ≤ −2) at least in one genotype, while the remaining 15 miRNAs showed contrasting drought-regulated expression pattern between genotypes. A maximum of 17 and 18 miRNAs was differentially regulated under drought stress condition in the sensitive and tolerant genotypes, respectively. These results suggest that genotype dependent stress responsive regulation of miRNAs may contribute, at least in part, to the differential drought tolerance of sorghum genotypes. We also identified two miR390-directed TAS3 gene homologs and the auxin response factors as tasi-RNA targets. We predicted more than 1300 unique target genes for the novel and conserved miRNAs. These target genes were predicted to be involved in different cellular, metabolic, response to stimulus, biological regulation, and developmental processes. Genome-wide identification of stress-responsive miRNAs, tasi-RNAs and their targets identified in this study will be useful in unraveling the molecular mechanisms underlying drought stress responses and genetic improvement of biomass production and stress tolerance in sorghum. PMID:26236318

  11. Reciprocal regulation of long noncoding RNAs THBS4-003 and THBS4 control migration and invasion in prostate cancer cell lines

    PubMed Central

    Liu, Jinliang; Cheng, Gong; Yang, Haiwei; Deng, Xiaheng; Qin, Chao; Hua, Lixin; Yin, Changjun

    2016-01-01

    Increasing evidence implicates long noncoding RNAs (lncRNAs), a class of noncoding RNAs >200 nucleotides in length, in the development of cancer. However, the mechanism underlying the effects of lncRNAs in prostate cancer (PCa) remains to be elucidated. The present study aimed to investigate the role of lncRNA-THBS4-003 in the pathogensis of PCa. In the present study, a microarray containing 8,277 lncRNA probes and 32,207 mRNA probes were used to identify dysregulated mRNAs in three patients with PCa, and reverse transcription-quantitative polymerase chain reaction was used to determine the expression levels of thrombospondin 4 (THBS4) and lncRNA-THBS4-003 in 46 primary PCa and adjacent non-tumor tissue samples. The expression levels of THBS4 were determined in six samples of PCa and adjacent non-tumor tissues using Western blot analysis. The effects of forced THBS4 knockdown and lncRNA-THBS4-003 knockdown in the two PCa cell lines, DU145 and PC-3, were evaluated using cell migration and invasion assays, as well as using Western blot analysis. Of the 40,484 probes in the microarray, 354 were significantly upregulated (P<0.05; fold-change >2). The most significantly upregulated mRNA was THBS4. The expression levels of THBS4 and lncRNA-THBS4-003 in the 46 primary PCa samples was significantly higher, compared with that in the adjacent non-tumor tissue samples. Patients with Gleason scores >7 exhibited higher expression levels of lncRNA-THBS4-003, compared with patients with lower scores. Knockdown of THBS4 or lncRNA-THBS4-003 significantly reduced the migratory and invasive abilities of the PCa cells in vitro, and decreased the expression levels of p38 and matrix metal-loproteinase (MMP)-9. These findings suggested that the reciprocal regulation of lncRNA-THBS4-003 and THBS4 contributed to the pathogenesis of PCa. Therefore silencing lncRNA-THBS4-003 or THBS4 may inhibit PCa cell migration and invasion, and regulate the levels of MMP-9 through the mitogen

  12. Long-noncoding RNAs in basal cell carcinoma.

    PubMed

    Sand, Michael; Bechara, Falk G; Sand, Daniel; Gambichler, Thilo; Hahn, Stephan A; Bromba, Michael; Stockfleth, Eggert; Hessam, Schapoor

    2016-08-01

    Long noncoding RNAs (lncRNAs) are fundamental regulators of pre- and post-transcriptional gene regulation. Over 35,000 different lncRNAs have been described with some of them being involved in cancer formation. The present study was initiated to describe differentially expressed lncRNAs in basal cell carcinoma (BCC). Patients with BCC (n = 6) were included in this study. Punch biopsies were harvested from the tumor center and nonlesional epidermal skin (NLES, control, n = 6). Microarray-based lncRNA and mRNA expression profiles were identified through screening for 30,586 lncRNAs and 26,109 protein-coding transcripts (mRNAs). The microarray data were validated by RT-PCR in a second set of BCC versus control samples. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of mRNAs were performed to assess biologically relevant pathways. A total of 1851 lncRNAs were identified as being significantly up-regulated, whereas 2165 lncRNAs were identified as being significantly down-regulated compared to nonlesional skin (p < 0.05). Oncogenic and/or epidermis-specific lncRNAs, such as CASC15 or ANRIL, were among the differentially expressed sequences. GO analysis showed that the highest enriched GO targeted by up-regulated transcripts was "extracellular matrix." KEGG pathway analysis showed the highest enrichment scores in "Focal adhesion." BCC showed a significantly altered lncRNA and mRNA expression profile. Dysregulation of previously described lncRNAs may play a role in the molecular pathogenesis of BCC and should be subject of further analysis. PMID:26861560

  13. Getting to PTI of bacterial RNAs: Triggering plant innate immunity by extracellular RNAs from bacteria.

    PubMed

    Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min

    2016-07-01

    Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions. PMID:27301792

  14. Utility of MicroRNAs and siRNAs in Cervical Carcinogenesis

    PubMed Central

    Díaz-González, Sacnite del Mar; Benítez-Boijseauneau, Odelia; Gómez-Cerón, Claudia; Bermúdez-Morales, Victor Hugo; Rodríguez-Dorantes, Mauricio; Pérez-Plasencia, Carlos; Peralta-Zaragoza, Oscar

    2015-01-01

    MicroRNAs and siRNAs belong to a family of small noncoding RNAs which bind through partial sequence complementarity to 3′-UTR regions of mRNA from target genes, resulting in the regulation of gene expression. MicroRNAs have become an attractive target for genetic and pharmacological modulation due to the critical function of their target proteins in several signaling pathways, and their expression profiles have been found to be altered in various cancers. A promising technology platform for selective silencing of cell and/or viral gene expression using siRNAs is currently in development. Cervical cancer is the most common cancer in women in the developing world and sexually transmitted infection with HPV is the cause of this malignancy. Therefore, a cascade of abnormal events is induced during cervical carcinogenesis, including the induction of genomic instability, reprogramming of cellular metabolic pathways, deregulation of cell proliferation, inhibition of apoptotic mechanisms, disruption of cell cycle control mechanisms, and alteration of gene expression. Thus, in the present review article, we highlight new research on microRNA expression profiles which may be utilized as biomarkers for cervical cancer. Furthermore, we discuss selective silencing of HPV E6 and E7 with siRNAs which represents a potential gene therapy strategy against cervical cancer. PMID:25874209

  15. Utility of microRNAs and siRNAs in cervical carcinogenesis.

    PubMed

    Díaz-González, Sacnite del Mar; Deas, Jessica; Benítez-Boijseauneau, Odelia; Gómez-Cerón, Claudia; Bermúdez-Morales, Victor Hugo; Rodríguez-Dorantes, Mauricio; Pérez-Plasencia, Carlos; Peralta-Zaragoza, Oscar

    2015-01-01

    MicroRNAs and siRNAs belong to a family of small noncoding RNAs which bind through partial sequence complementarity to 3'-UTR regions of mRNA from target genes, resulting in the regulation of gene expression. MicroRNAs have become an attractive target for genetic and pharmacological modulation due to the critical function of their target proteins in several signaling pathways, and their expression profiles have been found to be altered in various cancers. A promising technology platform for selective silencing of cell and/or viral gene expression using siRNAs is currently in development. Cervical cancer is the most common cancer in women in the developing world and sexually transmitted infection with HPV is the cause of this malignancy. Therefore, a cascade of abnormal events is induced during cervical carcinogenesis, including the induction of genomic instability, reprogramming of cellular metabolic pathways, deregulation of cell proliferation, inhibition of apoptotic mechanisms, disruption of cell cycle control mechanisms, and alteration of gene expression. Thus, in the present review article, we highlight new research on microRNA expression profiles which may be utilized as biomarkers for cervical cancer. Furthermore, we discuss selective silencing of HPV E6 and E7 with siRNAs which represents a potential gene therapy strategy against cervical cancer. PMID:25874209

  16. Most mammalian mRNAs are conserved targets of microRNAs

    PubMed Central

    Friedman, Robin C.; Farh, Kyle Kai-How; Burge, Christopher B.; Bartel, David P.

    2009-01-01

    MicroRNAs (miRNAs) are small endogenous RNAs that pair to sites in mRNAs to direct post-transcriptional repression. Many sites that match the miRNA seed (nucleotides 2–7), particularly those in 3′ untranslated regions (3′UTRs), are preferentially conserved. Here, we overhauled our tool for finding preferential conservation of sequence motifs and applied it to the analysis of human 3′UTRs, increasing by nearly threefold the detected number of preferentially conserved miRNA target sites. The new tool more efficiently incorporates new genomes and more completely controls for background conservation by accounting for mutational biases, dinucleotide conservation rates, and the conservation rates of individual UTRs. The improved background model enabled preferential conservation of a new site type, the “offset 6mer,” to be detected. In total, >45,000 miRNA target sites within human 3′UTRs are conserved above background levels, and >60% of human protein-coding genes have been under selective pressure to maintain pairing to miRNAs. Mammalian-specific miRNAs have far fewer conserved targets than do the more broadly conserved miRNAs, even when considering only more recently emerged targets. Although pairing to the 3′ end of miRNAs can compensate for seed mismatches, this class of sites constitutes less than 2% of all preferentially conserved sites detected. The new tool enables statistically powerful analysis of individual miRNA target sites, with the probability of preferentially conserved targeting (PCT) correlating with experimental measurements of repression. Our expanded set of target predictions (including conserved 3′-compensatory sites), are available at the TargetScan website, which displays the PCT for each site and each predicted target. PMID:18955434

  17. Outer Solar System Nomenclature

    NASA Technical Reports Server (NTRS)

    Owen, Tobias C.

    1998-01-01

    The Principal Investigator's responsibilities on this grant fell into two categories according to his participation. In the nomenclature work of the International Astronomical Union (IAU). Owen is chair of the Task Group for the Outer Solar System. He is also a member of the IAU's Working Group on Planetary and Satellite Nomenclature (WGPSN) which is composed of the chairs of the several Task Groups plus the presidents of two IAU Commissions and several outside consultants. The WGPSN is presided over by its President, Professor Kaare Aksnes from the Rosseland Institute for Theoretical Astrophysics in Oslo, Norway.

  18. Jupiter's outer atmosphere.

    NASA Technical Reports Server (NTRS)

    Brice, N. M.

    1973-01-01

    The current state of the theory of Jupiter's outer atmosphere is briefly reviewed. The similarities and dissimilarities between the terrestrial and Jovian upper atmospheres are discussed, including the interaction of the solar wind with the planetary magnetic fields. Estimates of Jovian parameters are given, including magnetosphere and auroral zone sizes, ionospheric conductivity, energy inputs, and solar wind parameters at Jupiter. The influence of the large centrifugal force on the cold plasma distribution is considered. The Jovian Van Allen belt is attributed to solar wind particles diffused in toward the planet by dynamo electric fields from ionospheric neutral winds, and the consequences of this theory are indicated.

  19. RNAs with multiple personalities.

    PubMed

    Maute, Roy L; Dalla-Favera, Riccardo; Basso, Katia

    2014-01-01

    In the last decade, advances in sequencing technology and a renewed focus on the regulatory potential of RNA molecules have combined to stimulate an enormous expansion in the catalog of known eukaryotic RNAs. Beyond the sheer numerical diversity of RNA species, recent studies have begun to uncover hints of even greater functional complexity. An increasing number of RNA molecules, including those from classic, well-studied classes, have been found to act in previously unanticipated regulatory roles, or as substrate for the biogenesis of functionally distinct RNA molecules, or both. Thus, these molecules can fulfill multiple, parallel functions, compounding the already rich landscape of RNA biology, and potentially connecting disparate biological regulatory networks in unexpected ways. In this article, we review recently discovered instances of RNA multifunctionality, with a particular focus on regulatory small RNAs. PMID:24039180

  20. Small regulatory RNAs in Archaea

    PubMed Central

    Babski, Julia; Maier, Lisa-Katharina; Heyer, Ruth; Jaschinski, Katharina; Prasse, Daniela; Jäger, Dominik; Randau, Lennart; Schmitz, Ruth A; Marchfelder, Anita; Soppa, Jörg

    2014-01-01

    Small regulatory RNAs (sRNAs) are universally distributed in all three domains of life, Archaea, Bacteria, and Eukaryotes. In bacteria, sRNAs typically function by binding near the translation start site of their target mRNAs and thereby inhibit or activate translation. In eukaryotes, miRNAs and siRNAs typically bind to the 3′-untranslated region (3′-UTR) of their target mRNAs and influence translation efficiency and/or mRNA stability. In archaea, sRNAs have been identified in all species investigated using bioinformatic approaches, RNomics, and RNA-Seq. Their size can vary significantly between less than 50 to more than 500 nucleotides. Differential expression of sRNA genes has been studied using northern blot analysis, microarrays, and RNA-Seq. In addition, biological functions have been unraveled by genetic approaches, i.e., by characterization of designed mutants. As in bacteria, it was revealed that archaeal sRNAs are involved in many biological processes, including metabolic regulation, adaptation to extreme conditions, stress responses, and even in regulation of morphology and cellular behavior. Recently, the first target mRNAs were identified in archaea, including one sRNA that binds to the 5′-region of two mRNAs in Methanosarcina mazei Gö1 and a few sRNAs that bind to 3′-UTRs in Sulfolobus solfataricus, three Pyrobaculum species, and Haloferax volcanii, indicating that archaeal sRNAs appear to be able to target both the 5′-UTR or the 3′-UTRs of their respective target mRNAs. In addition, archaea contain tRNA-derived fragments (tRFs), and one tRF has been identified as a major ribosome-binding sRNA in H. volcanii, which downregulates translation in response to stress. Besides regulatory sRNAs, archaea contain further classes of sRNAs, e.g., CRISPR RNAs (crRNAs) and snoRNAs. PMID:24755959

  1. Mechanisms of regulation of mature miRNAs.

    PubMed

    Towler, Benjamin P; Jones, Christopher I; Newbury, Sarah F

    2015-12-01

    miRNAs are short RNA molecules of ∼22-nt in length that play important roles in post-transcriptional control of gene expression. miRNAs normally function as negative regulators of mRNA expression by binding complementary sequences in the 3'-UTR of target mRNAs and causing translational repression and/or target degradation. Much research has been undertaken to enhance understanding of the biogenesis, function and targeting of miRNAs. However, until recently, the mechanisms underlying the regulation of the levels of mature miRNAs themselves have been largely overlooked. Although it has generally been assumed that miRNAs are stable molecules, recent evidence indicates that the stability of specific mature miRNAs can be regulated during key cellular and developmental processes in certain cell types. Here we discuss the current knowledge of the mechanisms by which mature miRNAs are regulated in the cell and the factors that contribute to the control of their stability. PMID:26614662

  2. Role of miRNAs and epigenetics in neural stem cell fate determination

    PubMed Central

    Lopez-Ramirez, Miguel Alejandro; Nicoli, Stefania

    2014-01-01

    The regulation of gene expression that determines stem cell fate determination is tightly controlled by both epigenetic and posttranscriptional mechanisms. Indeed, small non-coding RNAs such as microRNAs (miRNAs) are able to regulate neural stem cell fate by targeting chromatin-remodeling pathways. Here, we aim to summarize the latest findings regarding the feedback network of epigenetics and miRNAs during embryonic and adult neurogenesis. PMID:24342893

  3. The role of microRNAs in Epstein-Barr virus latency and lytic reactivation

    PubMed Central

    Forte, Eleonora; Luftig, Micah A.

    2016-01-01

    Oncogenic viruses reprogram host gene expression driving proliferation, ensuring survival, and evading the immune response. The recent appreciation of microRNAs (miRNAs) as small non-coding RNAs that broadly regulate gene expression has provided new insight into this complex scheme of host control. This review highlights the role of viral and cellular miRNAs during the latent and lytic phases of the EBV life cycle. PMID:21835261

  4. The role of microRNAs in Epstein-Barr virus latency and lytic reactivation.

    PubMed

    Forte, Eleonora; Luftig, Micah A

    2011-12-01

    Oncogenic viruses reprogram host gene expression driving proliferation, ensuring survival, and evading the immune response. The recent appreciation of microRNAs (miRNAs) as small non-coding RNAs that broadly regulate gene expression has provided new insight into this complex scheme of host control. This review highlights the role of viral and cellular miRNAs during the latent and lytic phases of the EBV life cycle. PMID:21835261

  5. Outer planets satellites

    NASA Technical Reports Server (NTRS)

    Morrison, D.

    1983-01-01

    The present investigation takes into account the published literature on outer planet satellites for 1979-1982. It is pointed out that all but three (the moon and the two Martian satellites) of the known planetary satellites are found in the outer solar system. Most of these are associated with the three regular satellite systems of Jupiter, Saturn, and Uranus. The largest satellites are Titan in the Saturn system and Ganymede and Callisto in the Jupiter system. Intermediate in size between Mercury and Mars, each has a diameter of about 5000 km. Presumably each has an internal composition about 60 percent rock and 40 ice, and each is differentiated with a dense core extending out about 75 percent of the distance to the surface, with a mantle of high-pressure ice and a crust of ordinary ice perhaps 100 km thick. Attention is also given to Io, Europa, the icy satellites of Saturn, the satellites of Uranus, the small satellites of Jupiter and Saturn, Triton and the Pluto system, and plans for future studies.

  6. MicroRNAs in the Neural Retina

    PubMed Central

    Cooper, Nigel G. F.

    2014-01-01

    The health and function of the visual system rely on a collaborative interaction between diverse classes of molecular regulators. One of these classes consists of transcription factors, which are known to bind to DNA and control the transcription activities of their target genes. For a long time, it was thought that the transcription factors were the only regulators of gene expression. More recently, however, a novel class of regulators emerged. This class consists of a large number of small noncoding endogenous RNAs, namely, miRNAs. The miRNAs compose an essential component of posttranscriptional gene regulation, since they ultimately control the fate of gene transcripts. The retina, as a part of the central nervous system, is a well-established model for unraveling the molecular mechanisms underlying neuronal and glial functions. Numerous recent efforts have been made towards identification of miRNAs and their inferred roles in the visual pathway. In this review, we summarize the current state of our knowledge regarding the expression and function of miRNA in the neural retina and we discuss their potential uses as biomarkers for some retinal disorders. PMID:24745005

  7. Structured RNAs that evade or confound exonucleases: function follows form.

    PubMed

    Akiyama, Benjamin M; Eiler, Daniel; Kieft, Jeffrey S

    2016-02-01

    Cells contain powerful RNA decay machinery to eliminate unneeded RNA from the cell, and this process is an important and regulated part of controlling gene expression. However, certain structured RNAs have been found that can robustly resist degradation and extend the lifetime of an RNA. In this review, we present three RNA structures that use a specific three-dimensional fold to provide protection from RNA degradation, and discuss how the recently-solved structures of these RNAs explain their function. Specifically, we describe the Xrn1-resistant RNAs from arthropod-borne flaviviruses, exosome-resistant long non-coding RNAs associated with lung cancer metastasis and found in Kaposi's sarcoma-associated herpesvirus, and tRNA-like sequences occurring in certain plant viruses. These three structures reveal three different mechanisms to protect RNAs from decay and suggest RNA structure-based nuclease resistance may be a widespread mechanism of regulation. PMID:26797676

  8. Functional regulatory roles of microRNAs in atherosclerosis.

    PubMed

    Gao, Ya; Peng, Juan; Ren, Zhong; He, Ni-Ya; Li, Qing; Zhao, Xue-Shan; Wang, Mei-Mei; Wen, Hong-Yan; Tang, Zhi-Han; Jiang, Zhi-Sheng; Wang, Gui-Xue; Liu, Lu-Shan

    2016-09-01

    MicroRNAs are a group of endogenously small non-coding RNA molecules that downregulate gene expression at the post-transcriptional level through binding to the 3'UTR of target mRNAs. Recent findings have revealed a key role for microRNAs in the pathophysiological processes of atherosclerosis. As a complex disease, atherosclerosis is influenced by a combination of multiple genes and environmental factors. Both of them play a role in atherogenesis by affecting different types of cells (such as endothelial cell, vascular smooth muscle cell and monocyte/macrophage) function. MicroRNAs control the senescence and dysfunction of endothelial cells, proliferation and migration of vascular smooth muscle cells, and macrophage-driven cytokine production and polarization. By these effects, microRNAs can influence the processes of atherosclerosis and may represent new molecular targets for therapy. PMID:27384386

  9. Control of physical properties of carbon nanofibers obtained from coaxial electrospinning of PMMA and PAN with adjustable inner/outer nozzle-ends.

    PubMed

    Kaerkitcha, Navaporn; Chuangchote, Surawut; Sagawa, Takashi

    2016-12-01

    Hollow carbon nanofibers (HCNFs) were prepared by electrospinning method with several coaxial nozzles, in which the level of the inner nozzle-end is adjustable. Core/shell nanofibers were prepared from poly(methyl methacrylate) (PMMA) as a pyrolytic core and polyacrylonitrile (PAN) as a carbon shell with three types of normal (viz. inner and outer nozzle-ends are balanced in the same level), inward, and outward coaxial nozzles. The influence of the applied voltage on these three types of coaxial nozzles was studied. Specific surface area, pore size diameter, crystallinity, and degree of graphitization of the hollow and mesoporous structures of carbon nanofibers obtained after carbonization of the as spun PMMA/PAN nanofibers were characterized by BET analyses, X-ray diffraction, and Raman spectroscopy in addition to the conductivity measurements. It was found that specific surface area, crystallinity, and graphitization degree of the HCNFs affect the electrical conductivity of the carbon nanofibers. PMID:27067734

  10. Control of physical properties of carbon nanofibers obtained from coaxial electrospinning of PMMA and PAN with adjustable inner/outer nozzle-ends

    NASA Astrophysics Data System (ADS)

    Kaerkitcha, Navaporn; Chuangchote, Surawut; Sagawa, Takashi

    2016-04-01

    Hollow carbon nanofibers (HCNFs) were prepared by electrospinning method with several coaxial nozzles, in which the level of the inner nozzle-end is adjustable. Core/shell nanofibers were prepared from poly(methyl methacrylate) (PMMA) as a pyrolytic core and polyacrylonitrile (PAN) as a carbon shell with three types of normal (viz . inner and outer nozzle-ends are balanced in the same level), inward, and outward coaxial nozzles. The influence of the applied voltage on these three types of coaxial nozzles was studied. Specific surface area, pore size diameter, crystallinity, and degree of graphitization of the hollow and mesoporous structures of carbon nanofibers obtained after carbonization of the as spun PMMA/PAN nanofibers were characterized by BET analyses, X-ray diffraction, and Raman spectroscopy in addition to the conductivity measurements. It was found that specific surface area, crystallinity, and graphitization degree of the HCNFs affect the electrical conductivity of the carbon nanofibers.

  11. Noncoding RNAs in the regulation of skeletal muscle biology in health and disease.

    PubMed

    Simionescu-Bankston, Adriana; Kumar, Ashok

    2016-08-01

    Skeletal muscle is composed of multinucleated myofibers that arise from the fusion of myoblasts during development. Skeletal muscle is essential for various body functions such as maintaining posture, locomotion, breathing, and metabolism. Skeletal muscle undergoes remarkable adaptations in response to environmental stimuli leading to atrophy or hypertrophy. Moreover, degeneration of skeletal muscle is a common feature in a number of muscular disorders including muscular dystrophy. Emerging evidence suggests that noncoding RNAs, such as microRNAs (miRNAs) and long noncoding RNAs (lncRNAs), are critical for skeletal muscle physiology. Several miRNAs and lncRNAs have now been found to control skeletal muscle development and regeneration. Noncoding RNAs also play an important role in the regulation of skeletal muscle mass in adults. Furthermore, aberrant expression of miRNAs and lncRNAs has been observed in several muscular disorders. In this article, we discuss the mechanisms of action of miRNAs and lncRNAs in skeletal muscle formation, growth, regeneration, and disease. We further highlight potential therapeutic strategies for utilizing noncoding RNAs to improve skeletal muscle function. PMID:27377406

  12. Controlling proton movement: electrocatalytic oxidation of hydrogen by a nickel( ii ) complex containing proton relays in the second and outer coordination spheres

    SciTech Connect

    Das, Parthapratim; Ho, Ming-Hsun; O'Hagan, Molly; Shaw, Wendy J.; Morris Bullock, R.; Raugei, Simone; Helm, Monte L.

    2014-01-01

    A nickel bis(diphosphine) complex containing proton relays in the second and outer coordination spheres, Ni(PCy2N(CH2)2OMe)2, (PCy2N(CH2)2OMe = 1,5-di(methoxyethyl)-3,7-dicyclohexyl-1,5-diaza-3,7-diphosphacyclooctane), is an electrocatalyst for hydrogen oxidation. The addition of hydrogen to the Ni(II) complex results in rapid formation of three isomers of the doubly protonated Ni(0) complex, [Ni(PCy2N(CH2)2OMe2H)2]2+. The three isomers show fast intramolecular interconversion at 40 °C, unique to this complex in this class of catalysts. Under conditions of 1.0 atm H2 using H2O as a base, catalytic oxidation proceeds at a turnover frequency of 5 s-1 and an overpotential of 720 mV, as determined from the potential at half of the catalytic current. Compared to the previously reported Ni(PCy2NBn)2 complex, the new complex operates at a faster rate and at a lower overpotential. The results of this study indicate that the presence of the pendant methoxy group in the outer coordination sphere of the catalyst plays a key role, facilitating intramolecular proton movement prior to intermolecular proton removal required to complete the catalytic cycle. This research was supported as part of the Center for Molecular Electrocatalysis, an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences. Pacific Northwest National Laboratory is operated by Battelle for the U.S. Department of Energy.

  13. Outer atmospheric research

    NASA Technical Reports Server (NTRS)

    Anderson, John L.

    1988-01-01

    The region above the earth from about 90 km to 150 km is a major part of the upper or outer atmosphere. It is relatively unexplored, being too high for balloons or aircraft and too low for persistent orbiting spacecraft. However, the concept of a tethered subsatellite, deployed downward from an orbiting, more massive craft such as the Space Shuttle, opens the possibility of a research capability that could provide global mapping of this region. The need for research in this thick spherical shell above the earth falls into two major categories: (1) scientific data for understanding and modeling the global atmosphere and thereby determining its role in the earth system, and (2) engineering data for the design of future aerospace vehicles that will operate there. This paper presents an overview and synthesis of the currently perceived research needs and the state-of-the-art of the proposed tethered research capability.

  14. Inner and outer beauty.

    PubMed

    Raymond, Kenneth N; Brown, Casey J

    2012-01-01

    Symmetry and pattern are precious forms of beauty that can be appreciated on both the macroscopic and molecular scales. Crystallographers have long appreciated the intimate connections between symmetry and molecular structure, reflected in their appreciation for the artwork of Escher. This admiration has been applied in the design of highly symmetrical coordination compounds. Two classes of materials are discussed: extended coordination arrays and discrete supramolecular assemblies. Extended coordination polymers have been implemented in gas separation and storage due to the remarkably porosity of these materials, aided by the ability to design ever-larger inner spaces within these frameworks. In the case of discrete symmetrical structures, defined inner and outer space present a unique aesthetic and chemical environment. The consequent host-guest chemistry and applications in catalysis are discussed. PMID:22076081

  15. Control of gene expression at a bacterial leader RNA, the agn43 gene encoding outer membrane protein Ag43 of Escherichia coli.

    PubMed

    Wallecha, Anu; Oreh, Heather; van der Woude, Marjan W; deHaseth, Pieter L

    2014-08-01

    The family of agn alleles in Escherichia coli pathovars encodes autotransporters that have been implicated in biofilm formation, autoaggregation, and attachment to cells. The alleles all have long leader RNAs preceding the Ag43 translation initiation codon. Here we present an analysis of the agn43 leader RNA from E. coli K-12. We demonstrate the presence of a rho-independent transcription terminator just 28 bp upstream of the main translation start codon and show that it is functional in vitro. Our data indicate that an as-yet-unknown mechanism of antitermination of transcription must be operative in earlier phases of growth. However, as bacterial cell cultures mature, progressively fewer transcripts are able to bypass this terminator. In the K-12 leader sequence, two in-frame translation initiation codons have been identified, one upstream and the other downstream of the transcription terminator. For optimal agn43 expression, both codons need to be present. Translation from the upstream start codon leads to increased downstream agn43 expression. Our findings have revealed two novel modes of regulation of agn43 expression in the leader RNA in addition to the previously well-characterized regulation of phase variation at the agn43 promoter. PMID:24837285

  16. MicroRNAs in Liver Health and Disease

    PubMed Central

    Ghoshal, Kalpana

    2013-01-01

    MicroRNAs (miRNAs), a class of short non-coding RNAs, have been studied intensely and extensively in the past decade in every aspect of biological processes, including cell differentiation, proliferation and death. These findings pointed out the pivotal role of miRNA in posttranscriptional control of gene expression in animals and established miRNAs as therapeutic targets for different pathophysiological processes, including liver disease. Here we have discussed the recent advances made in identifying the miRNAs deregulated in different liver diseases such as obesity, hepatitis, alcoholic and nonalcoholic steatohepatitis, cirrhosis and hepatocellular carcinoma, as well as pathophysiological conditions such as developmental abnormality. We have specifically reviewed the role of miRNAs in these diseases and discussed critically potential impacts of these miRNAs as biomarkers and/or therapeutic targets in liver pathobiology in the clinical setting. Finally, we have highlighted the latest techniques or preclinical and/or clinical trials that are being developed to replenish or inhibit the deregulated miRNAs. PMID:23565350

  17. miRNAs in the Pathogenesis of Systemic Lupus Erythematosus

    PubMed Central

    Qu, Bo; Shen, Nan

    2015-01-01

    MicroRNAs (miRNAs) were first discovered as regulatory RNAs that controlled the timing of the larval development of Caenorhabditis elegans. Since then, nearly 30,000 mature miRNA products have been found in many species, including plants, warms, flies and mammals. Currently, miRNAs are well established as endogenous small (~22 nt) noncoding RNAs, which have functions in regulating mRNA stability and translation. Owing to intensive investigations during the last decade, miRNAs were found to play essential roles in regulating many physiological and pathological processes. Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by elevated autoantibodies against nuclear antigens and excessive inflammatory responses affecting multiple organs. Although efforts were taken and theories were produced to elucidate the pathogenesis of SLE, we still lack sufficient knowledge about the disease for developing effective therapies for lupus patients. Recent advances indicate that miRNAs are involved in the development of SLE, which gives us new insights into the pathogenesis of SLE and might lead to the finding of new therapeutic targets. Here, we will review recent discoveries about how miRNAs are involved in the pathogenesis of SLE and how it can promote the development of new therapy. PMID:25927578

  18. Perspectives of Long Non-Coding RNAs in Cancer Diagnostics

    PubMed Central

    Reis, Eduardo M.; Verjovski-Almeida, Sergio

    2012-01-01

    Long non-coding RNAs (lncRNAs) transcribed from intergenic and intronic regions of the human genome constitute a broad class of cellular transcripts that are under intensive investigation. While only a handful of lncRNAs have been characterized, their involvement in fundamental cellular processes that control gene expression highlights a central role in cell homeostasis. Not surprisingly, aberrant expression of regulatory lncRNAs has been increasingly documented in different types of cancer, where they can mediate both oncogenic or tumor suppressor effects. Interaction with chromatin remodeling complexes that promote silencing of specific genes or modulation of splicing factor proteins seem to be two general modes of lncRNA regulation, but it is conceivable that additional mechanisms of action are yet to be unveiled. LncRNAs show greater tissue specificity compared to protein-coding mRNAs making them attractive in the search of novel diagnostics/prognostics cancer biomarkers in body fluid samples. In fact, lncRNA prostate cancer antigen 3 can be detected in urine samples and has been shown to improve diagnosis of prostate cancer. We suggest that an unbiased screening of the presence of RNAs in easily accessible body fluids such as serum and urine might reveal novel circulating lncRNAs as potential biomarkers in many types of cancer. Annotation and functional characterization of the lncRNA complement of the cancer transcriptome will conceivably provide new venues for early diagnosis and treatment of the disease. PMID:22408643

  19. Population genomic analysis of gibberellin-responsive long non-coding RNAs in Populus.

    PubMed

    Tian, Jiaxing; Song, Yuepeng; Du, Qingzhang; Yang, Xiaohui; Ci, Dong; Chen, Jinhui; Xie, Jianbo; Li, Bailian; Zhang, Deqiang

    2016-04-01

    Long non-coding RNAs (lncRNAs) participate in a wide range of biological processes, but lncRNAs in plants remain largely unknown; in particular, we lack a systematic identification of plant lncRNAs involved in hormone responses. Moreover, allelic variation in lncRNAs remains poorly characterized at a large scale. Here, we conducted high-throughput RNA-sequencing of leaves from control and gibberellin (GA)-treated Populus tomentosa and identified 7655 reliably expressed lncRNAs. Among the 7655 lncRNAs, the levels of 410 lncRNAs changed in response to GA. Seven GA-responsive lncRNAs were predicted to be putative targets of 18 miRNAs, and one GA-responsive lncRNA (TCONS_00264314) was predicted to be a target mimic of ptc-miR6459b. Computational analysis predicted 939 potential cis-regulated target genes and 965 potential trans-regulated target genes for GA-responsive lncRNAs. Functional annotation of these potential target genes showed that they participate in many different biological processes, including auxin signal transduction and synthesis of cellulose and pectin, indicating that GA-responsive lncRNAs may influence growth and wood properties. Finally, single nucleotide polymorphism (SNP)-based association analysis showed that 112 SNPs from 52 GA-responsive lncRNAs and 1014 SNPs from 296 potential target genes were significantly associated with growth and wood properties. Epistasis analysis also provided evidence for interactions between lncRNAs and their potential target genes. Our study provides a comprehensive view of P. tomentosa lncRNAs and offers insights into the potential functions and regulatory interactions of GA-responsive lncRNAs, thus forming the foundation for future functional analysis of GA-responsive lncRNAs in P. tomentosa. PMID:26912799

  20. Bacterial transfer RNAs

    PubMed Central

    Shepherd, Jennifer; Ibba, Michael

    2015-01-01

    Transfer RNA is an essential adapter molecule that is found across all three domains of life. The primary role of transfer RNA resides in its critical involvement in the accurate translation of messenger RNA codons during protein synthesis and, therefore, ultimately in the determination of cellular gene expression. This review aims to bring together the results of intensive investigations into the synthesis, maturation, modification, aminoacylation, editing and recycling of bacterial transfer RNAs. Codon recognition at the ribosome as well as the ever-increasing number of alternative roles for transfer RNA outside of translation will be discussed in the specific context of bacterial cells. PMID:25796611

  1. Viral noncoding RNAs: more surprises

    PubMed Central

    Tycowski, Kazimierz T.; Guo, Yang Eric; Lee, Nara; Moss, Walter N.; Vallery, Tenaya K.; Xie, Mingyi

    2015-01-01

    Eukaryotic cells produce several classes of long and small noncoding RNA (ncRNA). Many DNA and RNA viruses synthesize their own ncRNAs. Like their host counterparts, viral ncRNAs associate with proteins that are essential for their stability, function, or both. Diverse biological roles—including the regulation of viral replication, viral persistence, host immune evasion, and cellular transformation—have been ascribed to viral ncRNAs. In this review, we focus on the multitude of functions played by ncRNAs produced by animal viruses. We also discuss their biogenesis and mechanisms of action. PMID:25792595

  2. Changing expression profiles of lncRNAs, mRNAs, circRNAs and miRNAs during osteoclastogenesis

    PubMed Central

    Dou, Ce; Cao, Zhen; Yang, Bo; Ding, Ning; Hou, Tianyong; Luo, Fei; Kang, Fei; Li, Jianmei; Yang, Xiaochao; Jiang, Hong; Xiang, Junyu; Quan, Hongyu; Xu, Jianzhong; Dong, Shiwu

    2016-01-01

    Bone is a dynamic organ continuously undergoing shaping, repairing and remodeling. The homeostasis of bone is maintained by the balance between osteoblastic bone formation and osteoclastic bone resorption. Osteoclasts (OCs) are specialized multinucleated cells derived from hematopoietic stem cells (HSCs) or monocytes/macrophage progenitor cells. There are different stages during osteoclastogenesis, and one of the most important steps to form functional osteoclasts is realized by cell-cell fusion. In our study, microarray was performed to detect the expression profiles of lncRNA, mRNA, circRNA and miRNA at different stages during osteoclastogenesis of RAW264.7 cells. Often changed RNAs were selected and clustered among the four groups with Venn analysis. The results revealed that expressions of 518 lncRNAs, 207 mRNAs, 24 circRNAs and 37 miRNAs were often altered at each stage during OC differentiation. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) biological pathway analysis were performed to predict the functions of differentially expressed lncRNAs and co-expressed potential targeting genes. Co-expression networks of lncRNA-mRNA and circRNA-miRNA were constructed based on the correlation analysis between the differentially expressed RNAs. The present study provided a systematic perspective on the potential function of non-coding RNAs (ncRNAs) during osteoclastogenesis. PMID:26856880

  3. MYCN-targeting miRNAs are predominantly downregulated during MYCN‑driven neuroblastoma tumor formation.

    PubMed

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R; Mets, Evelien; Althoff, Kristina; Cheung, Belamy B; Schulte, Johannes H; Mestdagh, Pieter; Vandesompele, Jo; Marshall, Glenn M; De Preter, Katleen; Speleman, Frank

    2015-03-10

    MYCN is a transcription factor that plays key roles in both normal development and cancer. In neuroblastoma, MYCN acts as a major oncogenic driver through pleiotropic effects regulated by multiple protein encoding genes as well as microRNAs (miRNAs). MYCN activity is tightly controlled at the level of transcription and protein stability through various mechanisms. Like most genes, MYCN is further controlled by miRNAs, but the full complement of all miRNAs implicated in this process has not been determined through an unbiased approach. To elucidate the role of miRNAs in regulation of MYCN, we thus explored the MYCN-miRNA interactome to establish miRNAs controlling MYCN expression levels. We combined results from an unbiased and genome-wide high-throughput miRNA target reporter screen with miRNA and mRNA expression data from patients and a murine neuroblastoma progression model. We identified 29 miRNAs targeting MYCN, of which 12 miRNAs are inversely correlated with MYCN expression or activity in neuroblastoma tumor tissue. The majority of MYCN-targeting miRNAs in neuroblastoma showed a decrease in expression during murine MYCN-driven neuroblastoma tumor development. Therefore, we provide evidence that MYCN-targeting miRNAs are preferentially downregulated in MYCN-driven neuroblastoma, suggesting that MYCN negatively controls the expression of these miRNAs, to safeguard its expression. PMID:25294817

  4. Non-coding RNAs in Mammary Gland Development and Disease.

    PubMed

    Sandhu, Gurveen K; Milevskiy, Michael J G; Wilson, Wesley; Shewan, Annette M; Brown, Melissa A

    2016-01-01

    Non-coding RNAs (ncRNAs) are untranslated RNA molecules that function to regulate the expression of numerous genes and associated biochemical pathways and cellular functions. NcRNAs include small interfering RNAs (siRNAs), microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs) and long non-coding RNAs (lncRNAs). They participate in the regulation of all developmental processes and are frequently aberrantly expressed or functionally defective in disease. This Chapter will focus on the role of ncRNAs, in particular miRNAs and lncRNAs, in mammary gland development and disease. PMID:26659490

  5. Strategy for outer planets exploration

    NASA Technical Reports Server (NTRS)

    1975-01-01

    NASA's Planetary Programs Office formed a number of scientific working groups to study in depth the potential scientific return from the various candidate missions to the outer solar system. The results of these working group studies were brought together in a series of symposia to evaluate the potential outer planet missions and to discuss strategies for exploration of the outer solar system that were consistent with fiscal constraints and with anticipated spacecraft and launch vehicle capabilities. A logical, scientifically sound, and cost effective approach to exploration of the outer solar system is presented.

  6. Cross-talks between microRNAs and mRNAs in pancreatic tissues of streptozotocin-induced type 1 diabetic mice

    PubMed Central

    TIAN, CAIMING; OUYANG, XIAOXI; LV, QING; ZHANG, YAOU; XIE, WEIDONG

    2015-01-01

    Network cross-talks between microRNAs (miRNAs) and mRNAs may be useful to elucidate the pathological mechanisms of pancreatic islet cells in diabetic individuals. The aim of the present study was to investigate the cross-talks between miRNAs and mRNAs in pancreatic tissues of streptozotocin-induced diabetic mice through microarray and bioinformatic methods. Based on the miRNA microarray, 64 upregulated and 72 downregulated miRNAs were observed in pancreatic tissues in diabetic mice compared to the normal controls. Based on the mRNA microarrray, 507 upregulated mRNAs and 570 downregulated mRNAs were identified in pancreatic tissues in diabetic mice compared to the normal controls. Notably, there were 246 binding points between upregulated miRNA and downregulated mRNAs; simultaneously, there were 583 binding points between downregulated miRNA and upregulated mRNAs. These changed mRNA may potentially involve the following signaling pathways: Insulin secretion, pancreatic secretion, mammalian target of rapamycin signaling pathway, forkhead box O signaling pathway and phosphatidylinositol 3-kinase-protein kinase B signaling. The fluctuating effects of miRNAs and matched mRNAs indicated that miRNAs may have wide cross-talks with mRNAs in pancreatic tissues of type 1 diabetic mice. The cross-talks may play important roles in contributing to impaired islet functions and the development of diabetes. However, further functional validation should be conducted in the future. PMID:26137232

  7. Dormancy-associated MADS-box genes and microRNAs jointly control dormancy transition in pear (Pyrus pyrifolia white pear group) flower bud

    PubMed Central

    Niu, Qingfeng; Li, Jianzhao; Cai, Danying; Qian, Minjie; Jia, Huimin; Bai, Songling; Hussain, Sayed; Liu, Guoqin; Teng, Yuanwen; Zheng, Xiaoyan

    2016-01-01

    Bud dormancy in perennial plants is indispensable to survival over winter and to regrowth and development in the following year. However, the molecular pathways of endo-dormancy induction, maintenance, and release are still unclear, especially in fruit crops. To identify genes with roles in regulating endo-dormancy, 30 MIKCC-type MADS-box genes were identified in the pear genome and characterized. The 30 genes were analysed to determine their phylogenetic relationships with homologous genes, genome locations, gene structure, tissue-specific transcript profiles, and transcriptional patterns during flower bud dormancy in ‘Suli’ pear (Pyrus pyrifolia white pear group). The roles in regulating bud dormancy varied among the MIKC gene family members. Yeast one-hybrid and transient assays showed that PpCBF enhanced PpDAM1 and PpDAM3 transcriptional activity during the induction of dormancy, probably by binding to the C-repeat/DRE binding site, while DAM proteins inhibited the transcriptional activity of PpFT2 during dormancy release. In the small RNA-seq analysis, 185 conserved, 24 less-conserved, and 32 pear-specific miRNAs with distinct expression patterns during bud dormancy were identified. Joint analyses of miRNAs and MIKC genes together with degradome data showed that miR6390 targeted PpDAM transcripts and degraded them to release PpFT2. Our data show that cross-talk among PpCBF, PpDAM, PpFT2, and miR6390 played important roles in regulating endo-dormancy. A model for the molecular mechanism of dormancy transition is proposed: short-term chilling in autumn activates the accumulation of CBF, which directly promotes DAM expression; DAM subsequently inhibits FT expression to induce endo-dormancy, and miR6390 degrades DAM genes to release endo-dormancy. PMID:26466664

  8. Genome-wide identification and functional analysis of long noncoding RNAs involved in the response to graphene oxide.

    PubMed

    Wu, Qiuli; Zhou, Xuefeng; Han, Xiaoxiao; Zhuo, Yizhou; Zhu, Siting; Zhao, Yunli; Wang, Dayong

    2016-09-01

    Long noncoding RNAs (lncRNAs), which are defined as noncoding RNAs having at least 200 nucleotides, can potentially regulate various biological processes. However, the roles of lncRNAs in regulating cellular response to engineered nanomaterials (ENMs) are still unclear. Using Hiseq 2000 sequencing technique, we performed a genome-wide screen to identify lncRNAs involved in the control of toxicity of graphene oxide (GO) using in vivo Caenorhabditis elegans assay system. HiSeq 2000 sequencing, followed by quantitative analysis, identified only 34 dysregulated lncRNAs in GO exposed nematodes. Bioinformatics analysis implies the biological processes and signaling pathways mediated by candidate lncRNAs involved in the control of GO toxicity. A lncRNAs-miRNAs network possibly involved in the control of GO toxicity was further raised. Moreover, we identified the shared lncRNAs based on the molecular regulation basis for chemical surface modifications and/or genetic mutations in reducing GO toxicity. We further provide direct evidence that these shared lncRNAs, linc-37 and linc-14, were involved in the control of chemical surface modifications and genetic mutations in reducing GO toxicity. linc-37 binding to transcriptional factor FOXO/DAF-16 might be important for the control of GO toxicity. Our whole-genome identification and functional analysis of lncRNAs highlights the important roles of lncRNAs based molecular mechanisms for cellular responses to ENMs in organisms. PMID:27348851

  9. Non-coding RNAs: Epigenetic regulators of bone development and homeostasis.

    PubMed

    Hassan, Mohammad Q; Tye, Coralee E; Stein, Gary S; Lian, Jane B

    2015-12-01

    Non-coding RNAs (ncRNAs) have evolved in eukaryotes as epigenetic regulators of gene expression. The most abundant regulatory ncRNAs are the 20-24 nt small microRNAs (miRNAs) and long non-coding RNAs (lncRNAs, <200 nt). Each class of ncRNAs operates through distinct mechanisms, but their pathways to regulating gene expression are interrelated in ways that are just being recognized. While the importance of lncRNAs in epigenetic control of transcription, developmental processes and human traits is emerging, the identity of lncRNAs in skeletal biology is scarcely known. However, since the first profiling studies of miRNA at stages during osteoblast and osteoclast differentiation, over 1100 publications related to bone biology and pathologies can be found, as well as many recent comprehensive reviews summarizing miRNA in skeletal cells. Delineating the activities and targets of specific miRNAs regulating differentiation of osteogenic and resorptive bone cells, coupled with in vivo gain- and loss-of-function studies, discovered unique mechanisms that support bone development and bone homeostasis in adults. We present here "guiding principles" for addressing biological control of bone tissue formation by ncRNAs. This review emphasizes recent advances in understanding regulation of the process of miRNA biogenesis that impact on osteogenic lineage commitment, transcription factors and signaling pathways. Also discussed are the approaches to be pursued for an understanding of the role of lncRNAs in bone and the challenges in addressing their multiple and complex functions. Based on new knowledge of epigenetic control of gene expression to be gained for ncRNA regulation of the skeleton, new directions for translating the miRNAs and lncRNAs into therapeutic targets for skeletal disorders are possible. This article is part of a Special Issue entitled Epigenetics and Bone. PMID:26039869

  10. Characterization of Pseudomonas aeruginosa LpxT reveals dual positional lipid A kinase activity and coordinated control of outer membrane modification

    PubMed Central

    Nowicki, Emily M.; O’Brien, John P.; Brodbelt, Jennifer S.; Trent, M. Stephen

    2014-01-01

    Summary Gram-negative bacteria have evolved modification machinery to promote a dynamic outer membrane in response to a continually fluctuating environment. The kinase LpxT, for example, adds a phosphate group to the lipid A moiety of some Gram-negatives including Escherichia coli and Salmonella enterica. LpxT activity is inhibited under conditions that compromise membrane integrity, resulting instead in the addition of positively charged groups to lipid A that increase membrane stability and provide resistance to cationic antimicrobial peptides. We have now identified a functional lpxT ortholog in P. aeruginosa. LpxTPa has unique enzymatic characteristics, as it is able to phosphorylate P. aeruginosa lipid A at two sites of the molecule. Surprisingly, a previously uncharacterized lipid A 4′-dephospho-1-triphosphate species was detected. LpxTPa activity is inhibited by magnesium independently of lpxTPa transcription. Modulation of LpxTPa activity is influenced by transcription of the lipid A aminoarabinose transferase ArnT, known to be activated in response to limiting magnesium. These results demonstrate a divergent activity of LpxTPa, and suggest the existence of a coordinated regulatory mechanism that permits adaptation to a changing environment. PMID:25223756

  11. Non-coding RNAs, the cutting edge of histone messages.

    PubMed

    Köhn, Marcel; Hüttelmaier, Stefan

    2016-04-01

    In metazoan the 3'-end processing of histone mRNAs is a conserved process involving the concerted action of many protein factors and the non-coding U7 snRNA. Recently, we identified that the processing of histone pre-mRNAs is promoted by an additional ncRNA, the Y3-derived Y3** RNA. U7 modulates the association of the U7 snRNP whereas Y3** promotes recruitment of CPSF (cleavage and polyadenylation specific factor) proteins to nascent histone transcripts at histone locus bodies (HLBs) in mammals. This enhances the 3'-end cleavage of nascent histone pre-mRNAs and modulates HLB assembly. Here we discuss new insights in the role of ncRNAs in the spatiotemporal control of histone synthesis. We propose that ncRNAs scaffold the formation of functional protein-RNA complexes and their sequential deposition on nascent histone pre-mRNAs at HLBs. These findings add to the multiple roles of ncRNAs in controlling gene expression and may provide new avenues for targeting histone synthesis in cancer. PMID:26909464

  12. Non-coding RNAs, the cutting edge of histone messages

    PubMed Central

    Köhn, Marcel; Hüttelmaier, Stefan

    2016-01-01

    ABSTRACT In metazoan the 3′-end processing of histone mRNAs is a conserved process involving the concerted action of many protein factors and the non-coding U7 snRNA. Recently, we identified that the processing of histone pre-mRNAs is promoted by an additional ncRNA, the Y3-derived Y3** RNA. U7 modulates the association of the U7 snRNP whereas Y3** promotes recruitment of CPSF (cleavage and polyadenylation specific factor) proteins to nascent histone transcripts at histone locus bodies (HLBs) in mammals. This enhances the 3′-end cleavage of nascent histone pre-mRNAs and modulates HLB assembly. Here we discuss new insights in the role of ncRNAs in the spatiotemporal control of histone synthesis. We propose that ncRNAs scaffold the formation of functional protein-RNA complexes and their sequential deposition on nascent histone pre-mRNAs at HLBs. These findings add to the multiple roles of ncRNAs in controlling gene expression and may provide new avenues for targeting histone synthesis in cancer. PMID:26909464

  13. MicroRNAs and Potential Targets in Osteosarcoma: Review

    PubMed Central

    Sampson, Valerie B.; Yoo, Soonmoon; Kumar, Asmita; Vetter, Nancy S.; Kolb, E. Anders

    2015-01-01

    Osteosarcoma is the most common bone cancer in children and young adults. Surgery and multi-agent chemotherapy are the standard treatment regimens for this disease. New therapies are being investigated to improve overall survival in patients. Molecular targets that actively modulate cell processes, such as cell-cycle control, cell proliferation, metabolism, and apoptosis, have been studied, but it remains a challenge to develop novel, effective-targeted therapies to treat this heterogeneous and complex disease. MicroRNAs (miRNAs) are small non-coding RNAs that play critical roles in regulating cell processes including growth, development, and disease. miRNAs function as oncogenes or tumor suppressors to regulate gene and protein expression. Several studies have demonstrated the involvement of miRNAs in the pathogenesis of osteosarcoma with the potential for development in disease diagnostics and therapeutics. In this review, we discuss the current knowledge on the role of miRNAs and their target genes and evaluate their potential use as therapeutic agents in osteosarcoma. We also summarize the efficacy of inhibition of oncogenic miRNAs or expression of tumor suppressor miRNAs in preclinical models of osteosarcoma. Recent progress on systemic delivery as well as current applications for miRNAs as therapeutic agents has seen the advancement of miR-34a in clinical trials for adult patients with non-resectable primary liver cancer or metastatic cancer with liver involvement. We suggest a global approach to the understanding of the pathogenesis of osteosarcoma may identify candidate miRNAs as promising biomarkers for this rare disease. PMID:26380245

  14. Outer Solar System Nomenclature

    NASA Technical Reports Server (NTRS)

    Owen, Tobias C.; Grant, John (Technical Monitor)

    2003-01-01

    This grant has supported work by T. Owen and B. A. Smith on planetary and satellite nomenclature, carried out under the general auspices of the International Astronomical Union (IAU). The IAU maintains a Working Group on Planetary and Satellite Nomenclature (WGPSN) whose current chair is Prof.Kaare Aksnes of the Rosseland Institute for Theoretical Astrophysics in Oslo, Norway. Both Owen and Smith are members of the WGPSN; Owen as chair of the Outer Solar System Task Group, and Smith as chair of the Mars Task Group. The major activity during the last grant period (2002) was the approval of several new names for features on Mars by Smith's group and features on Jovian satellites plus new names for satellites of Jupiter, Saturn and Uranus by Owen's group. Much of this work was accomplished by e-mail exchanges, but the new nomenclature was formally discussed and approved at a meeting of the WGPSN held in conjunction with the Division for Planetary Sciences meeting in Birmingham, Alabama in October 2002.

  15. 2'Fluoro Modification Differentially Modulates the Ability of RNAs to Activate Pattern Recognition Receptors.

    PubMed

    Lee, Youngju; Urban, Johannes H; Xu, Li; Sullenger, Bruce A; Lee, Jaewoo

    2016-06-01

    Although the use of RNAs has enormous therapeutic potential, these RNA-based therapies can trigger unwanted inflammatory responses by the activation of pattern recognition receptors (PRRs) and cause harmful side effects. In contrast, the immune activation by therapeutic RNAs can be advantageous for treating cancers. Thus, the immunogenicity of therapeutic RNAs should be deliberately controlled depending on the therapeutic applications of RNAs. In this study, we demonstrated that RNAs containing 2'fluoro (2'F) pyrimidines differentially controlled the activation of PRRs. The activity of RNAs that stimulate toll-like receptors 3 and 7 was abrogated by the incorporation of 2'F pyrimidine. By contrast, incorporation of 2'F pyrimidines enhanced the activity of retinoic acid-inducible gene 1-stimulating RNAs. Furthermore, we found that transfection with RNAs containing 2'F pyrimidine and 5' triphosphate (5'ppp) increased cell death and interferon-β expression in human cancer cells compared with transfection with 2'hydroxyl 5'ppp RNAs, whereas RNAs containing 2'O-methyl pyrimidine and 5'ppp completely abolished the induction of cell death and cytokine expression in the cells. Our findings suggest that incorporation of 2'F and 2'O-methyl nucleosides is a facile approach to differentially control the ability of therapeutic RNAs to activate or limit immune and inflammatory responses depending on therapeutic applications. PMID:26789413

  16. Aberrantly Expressed lncRNAs in Primary Varicose Great Saphenous Veins

    PubMed Central

    Wang, Jing; Chen, Guo-Jun; Xu, Liang; Xie, Duan-Yang; Yuan, Tian-You; Zhang, Da-Sheng; Zhang, Hong; Chen, Yi-Han

    2014-01-01

    Long non-coding RNAs (lncRNAs) are key regulatory molecules involved in a variety of biological processes and human diseases. However, the pathological effects of lncRNAs on primary varicose great saphenous veins (GSVs) remain unclear. The purpose of the present study was to identify aberrantly expressed lncRNAs involved in the prevalence of GSV varicosities and predict their potential functions. Using microarray with 33,045 lncRNA and 30,215 mRNA probes, 557 lncRNAs and 980 mRNAs that differed significantly in expression between the varicose great saphenous veins and control veins were identified in six pairs of samples. These lncRNAs were sub-grouped and mRNAs expressed at different levels were clustered into several pathways with six focused on metabolic pathways. Quantitative real-time PCR replication of nine lncRNAs was performed in 32 subjects, validating six lncRNAs (AF119885, AK021444, NR_027830, G36810, NR_027927, uc.345-). A coding-non-coding gene co-expression network revealed that four of these six lncRNAs may be correlated with 11 mRNAs and pathway analysis revealed that they may be correlated with another 8 mRNAs associated with metabolic pathways. In conclusion, aberrantly expressed lncRNAs for GSV varicosities were here systematically screened and validated and their functions were predicted. These findings provide novel insight into the physiology of lncRNAs and the pathogenesis of varicose veins for further investigation. These aberrantly expressed lncRNAs may serve as new therapeutic targets for varicose veins. The Human Ethnics Committee of Shanghai East Hospital, Tongji University School of Medicine approved the study (NO.: 2011-DF-53). PMID:24497937

  17. The role of long non-coding RNAs in genome formatting and expression

    PubMed Central

    Angrand, Pierre-Olivier; Vennin, Constance; Le Bourhis, Xuefen; Adriaenssens, Eric

    2015-01-01

    Long non-coding RNAs (lncRNAs) are transcripts without protein-coding potential but having a pivotal role in numerous biological functions. Long non-coding RNAs act as regulators at different levels of gene expression including chromatin organization, transcriptional regulation, and post-transcriptional control. Misregulation of lncRNAs expression has been found to be associated to cancer and other human disorders. Here, we review the different types of lncRNAs, their mechanisms of action on genome formatting and expression and emphasized on the multifaceted action of the H19 lncRNA. PMID:25972893

  18. MicroRNAs and pharmacogenomics.

    PubMed

    Shomron, Noam

    2010-05-01

    Pharmacogenomics studies the influence of genomics on drug response safety and efficacy. Although research in this field was initiated many years ago, few functional applications are currently in use at the clinic. MicroRNAs (miRNAs) are short noncoding RNAs that bind genes and silence their expression. MiRNAs are encoded by the genome and expressed in all animal cells. MiRNAs are predicted to target approximately half of all human genes, and as a result regulate many cellular processes. The current focus of pharmacogenomics is the identification of polymorphisms in candidate genes coding for drug-metabolizing enzymes, drug transporters and drug targets. Here we call for the evaluation of miRNAs as an additional regulatory layer affecting pharmacogenomics. To illustrate the potential of miRNAs for affecting drug response we performed in silico evaluation of miRNA binding regions in genes known to affect drug response. We suggest that miR-133 and miR-137 may affect VKORC1 expression while miR-22 may affect MTHFR expression. We propose that miRNAs play a central role as a novel regulatory layer affecting drug metabolism and drug targets, and thus should be taken into consideration when conducting pharmacogenomic studies. PMID:20415550

  19. A systematic study on dysregulated microRNAs in cervical cancer development.

    PubMed

    He, Yuqing; Lin, Juanjuan; Ding, Yuanlin; Liu, Guodong; Luo, Yanhong; Huang, Mingyuan; Xu, Chengkai; Kim, Taek-Kyun; Etheridge, Alton; Lin, Mi; Kong, Danli; Wang, Kai

    2016-03-15

    MicroRNAs (miRNAs) are short regulatory RNAs that modulate the transcriptome and proteome at the post-transcriptional level. To obtain a better understanding on the role of miRNAs in the progression of cervical cancer, meta-analysis and gene set enrichment analysis were used to analyze published cervical cancer miRNA studies. From 85 published reports, which include 3,922 cases and 2,099 noncancerous control tissue samples, 63 differentially expressed miRNAs (DEmiRNAs) were identified in different stages of cervical cancer development (CIN 1-3 and CC). It was found that some of the dysregulated miRNAs were associated with specific stages of cervical cancer development. To illustrate the impact of miRNAs on the pathogenesis of cervical cancer, a miRNA-mRNA interaction network on selected pathways was built by integrating viral oncoproteins, dysregulated miRNAs and their predicted/validated targets. The results indicated that the deregulated miRNAs at the different stages of cervical cancer were functionally involved in several key cancer related pathways, such as cell cycle, p53 and Wnt signaling pathways. These dysregulated miRNAs could play an important role in cervical cancer development. Some of the stage-specific miRNAs can also be used as biomarkers for cancer classification and monitoring the progression of cancer development. PMID:26032913

  20. Localized RNAs and their functions.

    PubMed

    Ding, D; Lipshitz, H D

    1993-10-01

    The eukaryotic cell is partitioned by membranes into spatially and functionally discrete subcellular organelles. In addition, the cytoplasm itself is partitioned into discrete subregions that carry out specific functions. Such compartmentation can be achieved by localizing proteins and RNAs to different subcellular regions. This review will focus on localized RNAs, with a particular emphasis on RNA localization mechanisms and on the possible biological functions of localization of these RNAs. In recent years, an increasing number of localized RNAs have been identified in a variety of cell types among many animal species. Emphasis here will be on localized RNAs in the most intensively studied systems-Drosophila and Xenopus eggs and early embryos. PMID:7506023

  1. Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility.

    PubMed

    Hong, Yeting; Wang, Cheng; Fu, Zheng; Liang, Hongwei; Zhang, Suyang; Lu, Meiling; Sun, Wu; Ye, Chao; Zhang, Chen-Yu; Zen, Ke; Shi, Liang; Zhang, Chunni; Chen, Xi

    2016-01-01

    Although piwi-interacting RNAs (piRNAs) play pivotal roles in spermatogenesis, little is known about piRNAs in the seminal plasma of infertile males. In this study, we systematically investigated the profiles of seminal plasma piRNAs in infertile males to identify piRNAs that are altered during infertility and evaluate their diagnostic value. Seminal plasma samples were obtained from 211 infertile patients (asthenozoospermia and azoospermia) and 91 fertile controls. High-throughput sequencing technology was employed to screen piRNA profiles in seminal plasma samples pooled from healthy controls and infertile patients. The results identified 61 markedly altered piRNAs in infertile patient groups compared with control group. Next, a quantitative RT-PCR assay was conducted in the training and validation sets to measure and confirm the concentrations of altered piRNAs. The results identified a panel of 5 piRNAs that were significantly decreased in seminal plasma of infertile patients compared with healthy controls. ROC curve analysis and risk score analysis revealed that the diagnostic potential of these 5 piRNAs to distinguish asthenozoospermic and azoospermic individuals from healthy controls was high. In summary, this study identifies a panel of piRNAs that can accurately distinguish fertile from infertile males. This finding may provide pathophysiological clues about the development of infertility. PMID:27068805

  2. Systematic characterization of seminal plasma piRNAs as molecular biomarkers for male infertility

    PubMed Central

    Hong, Yeting; Wang, Cheng; Fu, Zheng; Liang, Hongwei; Zhang, Suyang; Lu, Meiling; Sun, Wu; Ye, Chao; Zhang, Chen-Yu; Zen, Ke; Shi, Liang; Zhang, Chunni; Chen, Xi

    2016-01-01

    Although piwi-interacting RNAs (piRNAs) play pivotal roles in spermatogenesis, little is known about piRNAs in the seminal plasma of infertile males. In this study, we systematically investigated the profiles of seminal plasma piRNAs in infertile males to identify piRNAs that are altered during infertility and evaluate their diagnostic value. Seminal plasma samples were obtained from 211 infertile patients (asthenozoospermia and azoospermia) and 91 fertile controls. High-throughput sequencing technology was employed to screen piRNA profiles in seminal plasma samples pooled from healthy controls and infertile patients. The results identified 61 markedly altered piRNAs in infertile patient groups compared with control group. Next, a quantitative RT-PCR assay was conducted in the training and validation sets to measure and confirm the concentrations of altered piRNAs. The results identified a panel of 5 piRNAs that were significantly decreased in seminal plasma of infertile patients compared with healthy controls. ROC curve analysis and risk score analysis revealed that the diagnostic potential of these 5 piRNAs to distinguish asthenozoospermic and azoospermic individuals from healthy controls was high. In summary, this study identifies a panel of piRNAs that can accurately distinguish fertile from infertile males. This finding may provide pathophysiological clues about the development of infertility. PMID:27068805

  3. Transfer RNA-derived small RNAs in the cancer transcriptome.

    PubMed

    Green, Darrell; Fraser, William D; Dalmay, Tamas

    2016-06-01

    The cellular lifetime includes stages such as differentiation, proliferation, division, senescence and apoptosis. These stages are driven by a strictly ordered process of transcription dynamics. Molecular disruption to RNA polymerase assembly, chromatin remodelling and transcription factor binding through to RNA editing, splicing, post-transcriptional regulation and ribosome scanning can result in significant costs arising from genome instability. Cancer development is one example of when such disruption takes place. RNA silencing is a term used to describe the effects of post-transcriptional gene silencing mediated by a diverse set of small RNA molecules. Small RNAs are crucial for regulating gene expression and microguarding genome integrity. RNA silencing studies predominantly focus on small RNAs such as microRNAs, short-interfering RNAs and piwi-interacting RNAs. We describe an emerging renewal of interest in a 'larger' small RNA, the transfer RNA (tRNA). Precisely generated tRNA-derived small RNAs, named tRNA halves (tiRNAs) and tRNA fragments (tRFs), have been reported to be abundant with dysregulation associated with cancer. Transfection of tiRNAs inhibits protein translation by displacing eukaryotic initiation factors from messenger RNA (mRNA) and inaugurating stress granule formation. Knockdown of an overexpressed tRF inhibits cancer cell proliferation. Recovery of lacking tRFs prevents cancer metastasis. The dual oncogenic and tumour-suppressive role is typical of functional small RNAs. We review recent reports on tiRNA and tRF discovery and biogenesis, identification and analysis from next-generation sequencing data and a mechanistic animal study to demonstrate their physiological role in cancer biology. We propose tRNA-derived small RNA-mediated RNA silencing is an innate defence mechanism to prevent oncogenic translation. We expect that cancer cells are percipient to their ablated control of transcription and attempt to prevent loss of genome control

  4. Comparative analysis of non-coding RNAs in the antibiotic-producing Streptomyces bacteria

    PubMed Central

    2013-01-01

    Background Non-coding RNAs (ncRNAs) are key regulatory elements that control a wide range of cellular processes in all bacteria in which they have been studied. Taking advantage of recent technological innovations, we set out to fully explore the ncRNA potential of the multicellular, antibiotic-producing Streptomyces bacteria. Results Using a comparative RNA sequencing analysis of three divergent model streptomycetes (S. coelicolor, S. avermitilis and S. venezuelae), we discovered hundreds of novel cis-antisense RNAs and intergenic small RNAs (sRNAs). We identified a ubiquitous antisense RNA species that arose from the overlapping transcription of convergently-oriented genes; we termed these RNA species ‘cutoRNAs’, for convergent untranslated overlapping RNAs. Conservation between different classes of ncRNAs varied greatly, with sRNAs being more conserved than antisense RNAs. Many species-specific ncRNAs, including many distinct cutoRNA pairs, were located within antibiotic biosynthetic clusters, including the actinorhodin, undecylprodigiosin, and coelimycin clusters of S. coelicolor, the chloramphenicol cluster of S. venezuelae, and the avermectin cluster of S. avermitilis. Conclusions These findings indicate that ncRNAs, including a novel class of antisense RNA, may exert a previously unrecognized level of regulatory control over antibiotic production in these bacteria. Collectively, this work has dramatically expanded the ncRNA repertoire of three Streptomyces species and has established a critical foundation from which to investigate ncRNA function in this medically and industrially important bacterial genus. PMID:23947565

  5. Circulating RNAs as new biomarkers for detecting pancreatic cancer

    PubMed Central

    Kishikawa, Takahiro; Otsuka, Motoyuki; Ohno, Motoko; Yoshikawa, Takeshi; Takata, Akemi; Koike, Kazuhiko

    2015-01-01

    Pancreatic cancer remains difficult to treat and has a high mortality rate. It is difficult to diagnose early, mainly due to the lack of screening imaging modalities and specific biomarkers. Consequently, it is important to develop biomarkers that enable the detection of early stage tumors. Emerging evidence is accumulating that tumor cells release substantial amounts of RNA into the bloodstream that strongly resist RNases in the blood and are present at sufficient levels for quantitative analyses. These circulating RNAs are upregulated in the serum and plasma of cancer patients, including those with pancreatic cancer, compared with healthy controls. The majority of RNA biomarker studies have assessed circulating microRNAs (miRs), which are often tissue-specific. There are few reports of the tumor-specific upregulation of other types of small non-coding RNAs (ncRNAs), such as small nucleolar RNAs and Piwi-interacting RNAs. Long ncRNAs (lncRNAs), such as HOTAIR and MALAT1, in the serum/plasma of pancreatic cancer patients have also been reported as diagnostic and prognostic markers. Among tissue-derived RNAs, some miRs show increased expression even in pre-cancerous tissues, and their expression profiles may allow for the discrimination between a chronic inflammatory state and carcinoma. Additionally, some miRs and lncRNAs have been reported with significant alterations in expression according to disease progression, and they may thus represent potential candidate diagnostic or prognostic biomarkers that may be used to evaluate patients once detection methods in peripheral blood are well established. Furthermore, recent innovations in high-throughput sequencing techniques have enabled the discovery of unannotated tumor-associated ncRNAs and tumor-specific alternative splicing as novel and specific biomarkers of cancers. Although much work is required to clarify the release mechanism, origin of tumor-specific circulating RNAs, and selectivity of carrier complexes

  6. Genome-Wide Analysis of Long Noncoding RNAs and Their Responses to Drought Stress in Cotton (Gossypium hirsutum L.).

    PubMed

    Lu, Xuke; Chen, Xiugui; Mu, Min; Wang, Junjuan; Wang, Xiaoge; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Guo, Lixue; Ye, Wuwei

    2016-01-01

    Recent researches on long noncoding RNAs (lncRNAs) have expanded our horizon of gene regulation and the cellular complexity. However, the number, characteristics and expression patterns of lncRNAs remain poorly characterized and how these lncRNAs biogenesis are regulated in response to drought stress in cotton are still largely unclear. In the study, using a reproducibility-based RNA-sequencing and bioinformatics strategy to analyze the lncRNAs of 9 samples under three different environment stresses (control, drought stress and re-watering, three replications), we totally identified 10,820 lncRNAs of high-confidence through five strict steps filtration, of which 9,989 were lincRNAs, 153 were inronic lncRNAs, 678 were anti-sense lncRNAs. Coding function analysis showed 6,470 lncRNAs may have the ability to code proteins. Small RNAs precursor analysis revealed that 196 lncRNAs may be the precursors to small RNAs, most of which (35.7%, 70) were miRNAs. Expression patterns analysis showed that most of lncRNAs were expressed at a low level and most inronic lncRNAs (75.95%) had a consistent expression pattern with their adjacent protein-coding genes. Further analysis of transcriptome data uncovered that lncRNAs XLOC_063105 and XLOC_115463 probably function in regulating two adjacent coding genes CotAD_37096 and CotAD_12502, respectively. Investigations of the content of plant hormones and proteomics analysis under drought stress also complemented the prediction. We analyzed the characteristics and the expression patterns of lncRNAs under drought stress and re-watering treatment, and found lncRNAs may be likely to involve in regulating plant hormones pathway in response to drought stress. PMID:27294517

  7. Genome-Wide Analysis of Long Noncoding RNAs and Their Responses to Drought Stress in Cotton (Gossypium hirsutum L.)

    PubMed Central

    Lu, Xuke; Chen, Xiugui; Mu, Min; Wang, Junjuan; Wang, Xiaoge; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Guo, Lixue; Ye, Wuwei

    2016-01-01

    Recent researches on long noncoding RNAs (lncRNAs) have expanded our horizon of gene regulation and the cellular complexity. However, the number, characteristics and expression patterns of lncRNAs remain poorly characterized and how these lncRNAs biogenesis are regulated in response to drought stress in cotton are still largely unclear. In the study, using a reproducibility-based RNA-sequencing and bioinformatics strategy to analyze the lncRNAs of 9 samples under three different environment stresses (control, drought stress and re-watering, three replications), we totally identified 10,820 lncRNAs of high-confidence through five strict steps filtration, of which 9,989 were lincRNAs, 153 were inronic lncRNAs, 678 were anti-sense lncRNAs. Coding function analysis showed 6,470 lncRNAs may have the ability to code proteins. Small RNAs precursor analysis revealed that 196 lncRNAs may be the precursors to small RNAs, most of which (35.7%, 70) were miRNAs. Expression patterns analysis showed that most of lncRNAs were expressed at a low level and most inronic lncRNAs (75.95%) had a consistent expression pattern with their adjacent protein-coding genes. Further analysis of transcriptome data uncovered that lncRNAs XLOC_063105 and XLOC_115463 probably function in regulating two adjacent coding genes CotAD_37096 and CotAD_12502, respectively. Investigations of the content of plant hormones and proteomics analysis under drought stress also complemented the prediction. We analyzed the characteristics and the expression patterns of lncRNAs under drought stress and re-watering treatment, and found lncRNAs may be likely to involve in regulating plant hormones pathway in response to drought stress. PMID:27294517

  8. Prevention of the Outer Space Weaponization

    NASA Astrophysics Data System (ADS)

    Zhukov, Gennady P.

    2002-01-01

    9 states. The satellites of various functions (early warning, communication, data acquisition, reconnaissance and navigation) were actively used and continue to be used with the purposes of raising efficiency of ground armed forces, especially in fight against international terrorism. At the same time such satellites are not a weapon in the sense of that word since they do not create the threats of armed attack in outer space or from outer space. Moreover, they promote maintaining of stability in the international relations. For this reason the reconnaissance and data acquisition satellites used for the verification of observance by States of the arms limitation agreements are under international protection as national technical means of the control. Similar protection is enjoyed by the early warning satellites. With the help of space communication facilities the more reliable operative connection of the statesmen is organized in the strained situations. By this way the probability of making of the incorrect retaliatory decisions in critical political situations is reduced. At the same time it's necessary to take into consideration that the activities of such satellite systems are tightly connected with ground armed forces of the states. the earth, what from the point of view of international law may be qualified as establishing a partial demilitarization regime in outer space. After the prohibition of anti-satellite weapons (ASAT) and anti-satellite (ASAT) weapons it will be possible to speak about establishing of an international legal regime of complete demilitarization in outer space eliminating any kinds of weapon from outer space. in a peaceful time. weaponization.The main task of this paper is to analyze and to discuss the present binding regime of the outer space deweaponization and particular measures on consolidation and strengthening of this regime. agreements of the Russian Federation and the USA into multilateral Treaties. Such "immunity" would cover

  9. Characterization of transcriptomes of cochlear inner and outer hair cells.

    PubMed

    Liu, Huizhan; Pecka, Jason L; Zhang, Qian; Soukup, Garrett A; Beisel, Kirk W; He, David Z Z

    2014-08-13

    Inner hair cells (IHCs) and outer hair cells (OHCs) are the two types of sensory receptor cells that are critical for hearing in the mammalian cochlea. IHCs and OHCs have different morphology and function. The genetic mechanisms that define their morphological and functional specializations are essentially unknown. The transcriptome reflects the genes that are being actively expressed in a cell and holds the key to understanding the molecular mechanisms of the biological properties of the cell. Using DNA microarray, we examined the transcriptome of 2000 individually collected IHCs and OHCs from adult mouse cochleae. We show that 16,647 and 17,711 transcripts are expressed in IHCs and OHCs, respectively. Of those genes, ∼73% are known genes, 22% are uncharacterized sequences, and 5.0% are noncoding RNAs in both populations. A total of 16,117 transcripts are expressed in both populations. Uniquely and differentially expressed genes account for <15% of all genes in either cell type. The top 10 differentially expressed genes include Slc17a8, Dnajc5b, Slc1a3, Atp2a3, Osbpl6, Slc7a14, Bcl2, Bin1, Prkd1, and Map4k4 in IHCs and Slc26a5, C1ql1, Strc, Dnm3, Plbd1, Lbh, Olfm1, Plce1, Tectb, and Ankrd22 in OHCs. We analyzed commonly and differentially expressed genes with the focus on genes related to hair cell specializations in the apical, basolateral, and synaptic membranes. Eighty-three percent of the known deafness-related genes are expressed in hair cells. We also analyzed genes involved in cell-cycle regulation. Our dataset holds an extraordinary trove of information about the molecular mechanisms underlying hair cell morphology, function, pathology, and cell-cycle control. PMID:25122905

  10. Role of miRNAs in muscle stem cell biology: proliferation, differentiation and death.

    PubMed

    Crippa, Stefania; Cassano, Marco; Sampaolesi, Maurilio

    2012-01-01

    miRNAs are small non-coding RNAs that regulate post-transcriptionally gene expression by degradation or translational repression of specific target mRNAs. In the 90s, lin-4 and let-7 were firstly identified as small regulatory RNAs able to control C. elegans larval development, by specifically targeting the 3'UTR of lin-14 and lin-28, respectively. These findings have introduced a novel and wide layer of complexity in the regulation of mRNA and protein expression. Lin-4 and let-7 are now considered the founding members of an abundant class of small fine-tuned RNAs, called microRNAs (miRNAs), in viruses, green algae, plants, flies, worms, and in mammals. In humans, the estimated number of genes encoding for miRNAs is as high as 1000 and around 30% of the protein-coding genes are post-transcriptionally controlled by miRNAs. This article reviews the role of miRNAs in regulating several biological responses in muscle cells, ranging from proliferation, differentiation and adaptation to stress cues. Cardiac and skeletal muscles are powerful examples to summarize the activity of miRNAs in cell fate specification, lineage differentiation and metabolic pathways. Indeed, specific miRNAs control the number of proliferating muscle progenitors to guarantee the proper formation of the heart and muscle fibers and to assure the self-renewal of muscle progenitors during adult tissue regeneration. On the other side, several other miRNAs promote the differentiation of muscle progenitors into skeletal myofibers or into cardiomyocytes, where metabolic activity, survival and remodeling process in response to stress, injury and chronic diseases are also fine-tuned by miRNAs. PMID:22352753

  11. The Leptospiral Outer Membrane

    PubMed Central

    Haake, David A; Zückert, Wolfram R

    2015-01-01

    The outer membrane (OM) is the front line of leptospiral interactions with their environment and the mammalian host. Unlike most invasive spirochetes, pathogenic leptospires must be able survive in both free-living and host-adapted states. As organisms move from one set of environmental conditions to another, the OM must cope with a series of conflicting challenges. For example, the OM must be porous enough to allow nutrient uptake, yet robust enough to defend the cell against noxious substances. In the host, the OM presents a surface decorated with adhesins and receptors for attaching to, and acquiring, desirable host molecules such as the complement regulator, Factor H. On the other hand, the OM must enable leptospires to evade detection by the host’s immune system on their way from sites of invasion through the bloodstream to the protected niche of the proximal tubule. The picture that is emerging of the leptospiral OM is that, while it shares many of the characteristics of the OMs of spirochetes and Gram-negative bacteria, it is also unique and different in ways that make it of general interest to microbiologists. For example, unlike most other pathogenic spirochetes, the leptospiral OM is rich in lipopolysaccharide (LPS). Leptospiral LPS is similar to that of Gram-negative bacteria but has a number of unique structural features that may explain why it is not recognized by the LPS-specific Toll-like receptor 4 of humans. As in other spirochetes, lipoproteins are major components of the leptospiral OM, though their roles are poorly understood. The functions of transmembrane OMPs in many cases are better understood thanks to homologies with their Gram-negative counterparts and the emergence of improved genetic techniques. This chapter will review recent discoveries involving the leptospiral OM and its role in leptospiral physiology and pathogenesis. Readers are referred to earlier, excellent summaries related to this subject (Adler and de la Peña Moctezuma

  12. Long noncoding RNAs and neuroblastoma

    PubMed Central

    Pandey, Gaurav Kumar; Kanduri, Chandrasekhar

    2015-01-01

    Neuroblastoma is a disease that affects infants and despite intense multimodal therapy, high-risk patients have low survival rates (<50%). In recent years long noncoding RNAs (lncRNAs) have become the cutting edge of cancer research with inroads made in understanding their roles in multiple cancer types, including prostate and breast cancers. The roles of lncRNAs in neuroblastoma have just begun to be elucidated. This review summarises where we are with regards to lncRNAs in neuroblastoma. The known mechanistic roles of lncRNAs during neuroblastoma pathogenesis are discussed, as well as the relationship between lncRNA expression and the differentiation capacity of neuroblastoma cells. We speculate about the use of some of these lncRNAs, such as those mapping to the 6p22 hotspot, as biomarkers for neuroblastoma prognosis and treatment. This novel way of thinking about both neuroblastoma and lncRNAs brings a new perspective to the prognosis and treatment of high-risk patients. PMID:26087192

  13. Stable intronic sequence RNAs (sisRNAs): a new layer of gene regulation.

    PubMed

    Osman, Ismail; Tay, Mandy Li-Ian; Pek, Jun Wei

    2016-09-01

    Upon splicing, introns are rapidly degraded. Hence, RNAs derived from introns are commonly deemed as junk sequences. However, the discoveries of intronic-derived small nucleolar RNAs (snoRNAs), small Cajal body associated RNAs (scaRNAs) and microRNAs (miRNAs) suggested otherwise. These non-coding RNAs are shown to play various roles in gene regulation. In this review, we highlight another class of intron-derived RNAs known as stable intronic sequence RNAs (sisRNAs). sisRNAs have been observed since the 1980 s; however, we are only beginning to understand their biological significance. Recent studies have shown or suggested that sisRNAs regulate their own host's gene expression, function as molecular sinks or sponges, and regulate protein translation. We propose that sisRNAs function as an additional layer of gene regulation in the cells. PMID:27147469

  14. Viruses, microRNAs, and Host Interactions

    PubMed Central

    Skalsky, Rebecca L.; Cullen, Bryan R.

    2013-01-01

    The most significant recent advance in biomedical research has been the discovery of the~22-nt long class of non-coding RNAs designated as microRNAs (miRNAs). These regulatory RNAs provide a unique level of post-transcriptional gene regulation that modulates a range of fundamental cellular processes. Several viruses, including especially herpesviruses, also encode miRNAs and over 200 viral miRNAs have now been identified. Current evidence indicates that viruses use these miRNAs to manipulate both cellular and viral gene expression. Furthermore, viral infection can exert a profound impact on the cellular miRNA expression profile, and several RNA viruses have been reported to interact directly with cellular miRNAs and/or to use these miRNAs to augment their replication potential. Here we discuss our current knowledge of viral miRNAs and virally-influenced cellular miRNAs, and their relationship to viral infection. PMID:20477536

  15. Long noncoding RNAs in hematopoietic malignancies.

    PubMed

    Rodríguez-Malavé, Norma I; Rao, Dinesh S

    2016-05-01

    Recent years have witnessed the discovery of several classes of noncoding RNAs (ncRNAs), which are indispensable for the regulation of cellular processes. Many of these RNAs are regulatory in nature with functions in gene expression regulation such as piwi-interacting RNAs, small interfering RNAs and micro RNAs. Long noncoding RNAs (lncRNAs) comprise the most recently characterized class. LncRNAs are involved in transcriptional regulation, chromatin remodeling, imprinting, splicing, and translation, among other critical functions in the cell. Recent studies have elucidated the importance of lncRNAs in hematopoietic development. Dysregulation of lncRNA expression is a feature of various diseases and cancers, and is also seen in hematopoietic malignancies. This article focuses on lncRNAs that have been implicated in the pathogenesis of hematopoietic malignancies. PMID:26612601

  16. Performance, Stability, and Control Investigation at Mach Numbers from 0.4 to 0.9 of a Model of the "Swallow" with Outer Wing Panels Swept 25 degree with and without Power Simulation

    NASA Technical Reports Server (NTRS)

    Runckel, Jack F.; Schmeer, James W.; Cassetti, Marlowe D.

    1960-01-01

    An investigation of the performance, stability, and control characteristics of a variable-sweep arrow-wing model (the "Swallow") with the outer wing panels swept 25 deg has been conducted in the Langley 16-foot transonic tunnel. The wing was uncambered and untwisted and had RAE 102 airfoil sections with a thickness-to-chord ratio of 0.14 normal to the leading edge. Four outboard engines located above and below the wing provided propulsive thrust, and, by deflecting in the pitch direction and rotating in the lateral plane, also produced control forces. A pair of swept lateral fins and a single vertical fin were mounted on each engine nacelle to provide aerodynamic stability and control. Jets-off data were obtained with flow-through nacelles, stimulating the effects of inlet flow; jet thrust and hot-jet interference effects were obtained with faired-nose nacelles housing hydrogen peroxide gas generators. Six-component force and moment data were obtained through a Mach number range of 0.40 to 0.90 at angles of attack and angles of sideslip from 0 deg to 15 deg. Longitudinal, directional, and lateral control were obtained by deflecting the nacelle-fin combinations as elevators, rudders, and ailerons at several fixed angles for each control.

  17. Role of Osterix and MicroRNAs in Bone Formation and Tooth Development

    PubMed Central

    Wang, Chuan; Liao, Haiqing; Cao, Zhengguo

    2016-01-01

    Osterix (Osx) is an osteoblast-specific transcription factor that is essential for bone formation. MicroRNAs (miRNAs) are ~22-nucleotide-long noncoding RNAs that play important regulatory roles in animals and plants by targeting mRNAs for cleavage or translational repression. They can also control osteoblast-mediated bone formation and osteoclast-related bone remodeling. The vital roles of Osx and miRNAs during bone formation have been well studied, but very few studies have discussed their co-functions and the relationships between them. In this review, we outline the significant functions of Osx and miRNAs on certain cell types during osteogenesis and illustrate their roles during tooth development. More importantly, we discuss the relationship between Osx and miRNAs, which we believe could lead to a new treatment for skeletal and periodontal diseases. PMID:27543160

  18. Small regulatory RNAs from low-GC Gram-positive bacteria

    PubMed Central

    Brantl, Sabine; Brückner, Reinhold

    2014-01-01

    Small regulatory RNAs (sRNAs) that act by base-pairing were first discovered in so-called accessory DNA elements—plasmids, phages, and transposons—where they control replication, maintenance, and transposition. Since 2001, a huge body of work has been performed to predict and identify sRNAs in a multitude of bacterial genomes. The majority of chromosome-encoded sRNAs have been investigated in E. coli and other Gram-negative bacteria. However, during the past five years an increasing number of sRNAs were found in Gram-positive bacteria. Here, we outline our current knowledge on chromosome-encoded sRNAs from low-GC Gram-positive species that act by base-pairing, i.e., an antisense mechanism. We will focus on sRNAs with known targets and defined regulatory mechanisms with special emphasis on Bacillus subtilis. PMID:24576839

  19. Identification and Characterization of MicroRNAs from Tree Peony (Paeonia ostii) and Their Response to Copper Stress

    PubMed Central

    Jin, Qijiang; Xue, Zeyun; Dong, Chunlan; Wang, Yanjie; Chu, Lingling; Xu, Yingchun

    2015-01-01

    MicroRNAs (miRNAs) are a class of non-coding, small RNAs recognized as important regulators of gene expression. Although plant miRNAs have been extensively studied in model systems, less is known in other plants with limited genome sequence data, including Paeonia ostii. In this work, we used high-throughput sequencing to identify conserved and nonconserved miRNAs and other short RNAs in Paeonia ostii under control and copper stressed condition. 102 previously known plant miRNAs were identified and classified into 89 families according to their gene sequence identity. Some miRNAs were highly conserved in the plant kingdom suggesting that these miRNA play important and conserved roles. Combined our transcriptome sequencing data of Paeonia ostii under same conditions, 34 novel potential miRNAs were identified. The potential targets of the identified known and novel miRNAs were also predicted based on sequence homology search. Comparing the two libraries, it was observed that 12 conserved miRNAs and 18 novel miRNAs showed significantly changes in response to copper stress. Some of the new identified potential miRNAs might be involved in Paeonia ostii-specific regulating mechanisms under copper stress. These results provide a framework for further analysis of miRNAs and their role in regulating Paeonia ostii response to copper stress. PMID:25658957

  20. Distinct Expression of Long Non-Coding RNAs in an Alzheimer's Disease Model.

    PubMed

    Lee, Doo Young; Moon, Jangsup; Lee, Soon-Tae; Jung, Keun-Hwa; Park, Dong-Kyu; Yoo, Jung-Seok; Sunwoo, Jun-Sang; Byun, Jung-Ick; Shin, Jung-Won; Jeon, Daejong; Jung, Ki-Young; Kim, Manho; Lee, Sang Kun; Chu, Kon

    2015-01-01

    With the recent advancement in transcriptome-wide profiling approach, numerous non-coding transcripts previously unknown have been identified. Among the non-coding transcripts, long non-coding RNAs (lncRNAs) have received increasing attention for their capacity to modulate transcriptional regulation. Although alterations in the expressions of non-coding RNAs have been studied in Alzheimer's disease (AD), most research focused on the involvement of microRNAs, and comprehensive expression profiling of lncRNAs in AD has been lacking. In this study, microarray analysis was performed to procure the expression profile of lncRNAs dysregulated in a triple transgenic model of AD (3xTg-AD). A total of 4,622 lncRNAs were analyzed: 205 lncRNAs were significantly dysregulated in 3xTg-AD compared with control mice, and 230 lncRNAs were significantly dysregulated within 3xTg-AD in an age-dependent manner (≥2.0-fold, p < 0.05). Among these, 27 and 15 lncRNAs, respectively, had adjacent protein-coding genes whose expressions were also significantly dysregulated. A majority of these lncRNAs and their adjacent genes shared the same direction of dysregulation. For these pairs of lncRNAs and adjacent genes, significant Gene Ontology terms were DNA-dependent regulation of transcription, transcription regulator activity, and embryonic organ morphogenesis. One of the most highly upregulated lncRNAs had a 395 bp core sequence that overlapped with multiple chromosomal regions. This is the first study that comprehensively identified dysregulated lncRNAs in 3xTg-AD mice and will likely facilitate the development of therapeutics targeting lncRNAs in AD. PMID:25624420

  1. Turbine airfoil with outer wall thickness indicators

    DOEpatents

    Marra, John J; James, Allister W; Merrill, Gary B

    2013-08-06

    A turbine airfoil usable in a turbine engine and including a depth indicator for determining outer wall blade thickness. The airfoil may include an outer wall having a plurality of grooves in the outer surface of the outer wall. The grooves may have a depth that represents a desired outer surface and wall thickness of the outer wall. The material forming an outer surface of the outer wall may be removed to be flush with an innermost point in each groove, thereby reducing the wall thickness and increasing efficiency. The plurality of grooves may be positioned in a radially outer region of the airfoil proximate to the tip.

  2. MicroRNAs and oncolytic viruses.

    PubMed

    Ruiz, Autumn J; Russell, Stephen J

    2015-08-01

    MicroRNAs regulate gene expression in mammalian cells and often exhibit tissue-specific expression patterns. Incorporation of microRNA target sequences can be used to control exogenous gene expression and viral tropism in specific tissues to enhance the therapeutic indices of oncolytic viruses expressing therapeutic transgenes. Continued development of this targeting strategy has resulted in the generation of unattenuated oncolytic viruses with enhanced potency, broad species-tropisms and reduced off-target toxicities in multiple-tissues simultaneously. Furthermore, oncolytic viruses have been used to enhance the delivery, duration and therapeutic efficacy of microRNA-based therapeutics designed to either restore or inhibit the function of dysregulated microRNAs in cancer cells. Recent efforts focused on combining oncolytic virotherapy and microRNA regulation have generated increasingly potent and safe cancer therapeutics. PMID:25863717

  3. 6. OUTER BLAST DOOR, WEST REAR. Edwards Air Force ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. OUTER BLAST DOOR, WEST REAR. - Edwards Air Force Base, South Base Sled Track, Firing & Control Blockhouse for 10,000-foot Track, South of Sled Track at midpoint of 20,000-foot track, Lancaster, Los Angeles County, CA

  4. Role of the mTORC1 Complex in Satellite Cell Activation by RNA-Induced Mitochondrial Restoration: Dual Control of Cyclin D1 through MicroRNAs

    PubMed Central

    Jash, Sukanta; Dhar, Gunjan; Ghosh, Utpalendu

    2014-01-01

    During myogenesis, satellite stem cells (SCs) are induced to proliferate and differentiate to myogenic precursors. The role of energy sensors such as the AMP-activated protein kinase (AMPK) and the mammalian Target of Rapamycin (mTOR) in SC activation is unclear. We previously observed that upregulation of ATP through RNA-mediated mitochondrial restoration (MR) accelerates SC activation following skeletal muscle injury. We show here that during regeneration, the AMPK-CRTC2-CREB and Raptor-mTORC-4EBP1 pathways were rapidly activated. The phosho-CRTC2-CREB complex was essential for myogenesis and activated transcription of the critical cell cycle regulator cyclin D1 (Ccnd1). Knockdown (KD) of either mTORC or its subunit Raptor delayed SC activation without influencing the differentiation program. KD of 4EBP1 had no effect on SC activation but enhanced myofiber size. mTORC1 positively regulated Ccnd1 translation but destabilized Ccnd1 mRNA. These antithetical effects of mTORC1 were mediated by two microRNAs (miRs) targeted to the 3′ untranslated region (UTR) of Ccnd1 mRNA: miR-1 was downregulated in mTORC-KD muscle, and depletion of miR-1 resulted in increased levels of mRNA without any effect on Ccnd1 protein. In contrast, miR-26a was upregulated upon mTORC depletion, while anti-miR-26a oligonucleotide specifically stimulated Ccnd1 protein expression. Thus, mTORC may act as a timer of satellite cell proliferation during myogenesis. PMID:25047835

  5. Sperm-borne miRNAs and endo-siRNAs are important for fertilization and preimplantation embryonic development.

    PubMed

    Yuan, Shuiqiao; Schuster, Andrew; Tang, Chong; Yu, Tian; Ortogero, Nicole; Bao, Jianqiang; Zheng, Huili; Yan, Wei

    2016-02-15

    Although it is believed that mammalian sperm carry small noncoding RNAs (sncRNAs) into oocytes during fertilization, it remains unknown whether these sperm-borne sncRNAs truly have any function during fertilization and preimplantation embryonic development. Germline-specific Dicer and Drosha conditional knockout (cKO) mice produce gametes (i.e. sperm and oocytes) partially deficient in miRNAs and/or endo-siRNAs, thus providing a unique opportunity for testing whether normal sperm (paternal) or oocyte (maternal) miRNA and endo-siRNA contents are required for fertilization and preimplantation development. Using the outcome of intracytoplasmic sperm injection (ICSI) as a readout, we found that sperm with altered miRNA and endo-siRNA profiles could fertilize wild-type (WT) eggs, but embryos derived from these partially sncRNA-deficient sperm displayed a significant reduction in developmental potential, which could be rescued by injecting WT sperm-derived total or small RNAs into ICSI embryos. Disrupted maternal transcript turnover and failure in early zygotic gene activation appeared to associate with the aberrant miRNA profiles in Dicer and Drosha cKO spermatozoa. Overall, our data support a crucial function of paternal miRNAs and/or endo-siRNAs in the control of the transcriptomic homeostasis in fertilized eggs, zygotes and two-cell embryos. Given that supplementation of sperm RNAs enhances both the developmental potential of preimplantation embryos and the live birth rate, it might represent a novel means to improve the success rate of assisted reproductive technologies in fertility clinics. PMID:26718009

  6. Alternative Mechanisms to Initiate Translation in Eukaryotic mRNAs

    PubMed Central

    Martínez-Salas, Encarnación; Piñeiro, David; Fernández, Noemí

    2012-01-01

    The composition of the cellular proteome is under the control of multiple processes, one of the most important being translation initiation. The majority of eukaryotic cellular mRNAs initiates translation by the cap-dependent or scanning mode of translation initiation, a mechanism that depends on the recognition of the m7G(5′)ppp(5′)N, known as the cap. However, mRNAs encoding proteins required for cell survival under stress bypass conditions inhibitory to cap-dependent translation; these mRNAs often harbor internal ribosome entry site (IRES) elements in their 5′UTRs that mediate internal initiation of translation. This mechanism is also exploited by mRNAs expressed from the genome of viruses infecting eukaryotic cells. In this paper we discuss recent advances in understanding alternative ways to initiate translation across eukaryotic organisms. PMID:22536116

  7. Performance, Stability, and Control Investigation at Mach Numbers from 0.60 to 1.05 of a Model of the "Swallow" with Outer Wing Panels Swept 75 degree with and without Power Simulations

    NASA Technical Reports Server (NTRS)

    Schmeer, James W.; Cassetti, Marlowe D.

    1960-01-01

    An investigation of the performance, stability, and control characteristics of a variable-sweep arrow-wing model with the outer wing panels swept 75 deg. has been conducted in the Langley 16-foot transonic tunnel. Four outboard engines located above and below the wing provided propulsive thrust, and, by deflecting in the pitch direction and rotating in the lateral plane, also produced control forces. The engine nacelles incorporated swept lateral and vertical fins for aerodynamic stability and control. Jet-off data were obtained with flow-through nacelles, simulating inlet flow; jet thrust and hot-jet interference effects were obtained with faired-nose nacelles housing hydrogen peroxide gas generators. Six-component force and moment data were obtained at Mach numbers from 0.60 to 1.05 through a range of angles of attack and angles of side-slip. Control characteristics were obtained by deflecting the nacelle-fin combinations as elevators, rudders, and ailerons at several fixed angles for each control. The results indicate that the basic wing-body configuration becomes neutrally stable or unstable at a lift coefficient of 0.15; addition of nacelles with fins delayed instability to a lift coefficient of 0.30. Addition of nacelles to the wing-body configuration increased minimum drag from 0.0058 to 0.0100 at a Mach number of 0.60 and from 0.0080 to 0.0190 at a Mach number of 1.05 with corresponding reductions in maximum lift-drag ratio of 12 percent and 33 percent, respectively. The nacelle-fin combinations were ineffective as longitudinal controls but were adequate as directional and lateral controls. The model with nacelles and fins was directionally and laterally stable; the stability generally increased with increasing lift. Jet interference effects on stability and control characteristics were small but the adverse effects on drag were greater than would be expected for isolated nacelles.

  8. microRNAs of parasitic helminths - Identification, characterization and potential as drug targets.

    PubMed

    Britton, Collette; Winter, Alan D; Gillan, Victoria; Devaney, Eileen

    2014-08-01

    microRNAs (miRNAs) are small non-coding RNAs involved in post-transcriptional gene regulation. They were first identified in the free-living nematode Caenorhabditis elegans, where the miRNAs lin-4 and let-7 were shown to be essential for regulating correct developmental progression. The sequence of let-7 was subsequently found to be conserved in higher organisms and changes in expression of let-7, as well as other miRNAs, are associated with certain cancers, indicating important regulatory roles. Some miRNAs have been shown to have essential functions, but the roles of many are currently unknown. With the increasing availability of genome sequence data, miRNAs have now been identified from a number of parasitic helminths, by deep sequencing of small RNA libraries and bioinformatic approaches. While some miRNAs are widely conserved in a range of organisms, others are helminth-specific and many are novel to each species. Here we review the potential roles of miRNAs in regulating helminth development, in interacting with the host environment and in development of drug resistance. Use of fluorescently-labeled small RNAs demonstrates uptake by parasites, at least in vitro. Therefore delivery of miRNA inhibitors or mimics has potential to alter miRNA activity, providing a useful tool for probing the roles of miRNAs and suggesting novel routes to therapeutics for parasite control. PMID:25057458

  9. microRNAs of parasitic helminths – Identification, characterization and potential as drug targets

    PubMed Central

    Britton, Collette; Winter, Alan D.; Gillan, Victoria; Devaney, Eileen

    2014-01-01

    microRNAs (miRNAs) are small non-coding RNAs involved in post-transcriptional gene regulation. They were first identified in the free-living nematode Caenorhabditis elegans, where the miRNAs lin-4 and let-7 were shown to be essential for regulating correct developmental progression. The sequence of let-7 was subsequently found to be conserved in higher organisms and changes in expression of let-7, as well as other miRNAs, are associated with certain cancers, indicating important regulatory roles. Some miRNAs have been shown to have essential functions, but the roles of many are currently unknown. With the increasing availability of genome sequence data, miRNAs have now been identified from a number of parasitic helminths, by deep sequencing of small RNA libraries and bioinformatic approaches. While some miRNAs are widely conserved in a range of organisms, others are helminth-specific and many are novel to each species. Here we review the potential roles of miRNAs in regulating helminth development, in interacting with the host environment and in development of drug resistance. Use of fluorescently-labeled small RNAs demonstrates uptake by parasites, at least in vitro. Therefore delivery of miRNA inhibitors or mimics has potential to alter miRNA activity, providing a useful tool for probing the roles of miRNAs and suggesting novel routes to therapeutics for parasite control. PMID:25057458

  10. Separation of Circulating MicroRNAs Using Apheresis in Patients With Systemic Lupus Erythematosus.

    PubMed

    Kusaoi, Makio; Yamaji, Ken; Ishibe, Yusuke; Murayama, Go; Nemoto, Takuya; Sekiya, Fumio; Kon, Takayuki; Ogasawara, Michihiro; Kempe, Kazuo; Tamura, Naoto; Takasaki, Yoshinari

    2016-08-01

    MicroRNAs (miRNAs), which are important inhibitors of mRNA translation, participate in differentiation, migration, cell proliferation, and cell death. The pathology of miRNAs results in alterations in protein expression. Recently, miRNAs circulating in peripheral blood have been shown to control the synthesis and translation of proteins at distal sites after intake into local cells. A number of studies are currently being conducted to investigate how to use miRNAs in disease treatment, but no studies have attempted to alleviate disease by directly eliminating miRNAs from blood. Therefore, we examined whether the removal or reduction of circulating miRNAs with apheresis improved pathologies caused by miRNAs. After approval of the study by our medical school's ethics committee, we collected blood and separated plasma samples from three patients with systemic lupus erythematosus who were undergoing plasmapheresis at our hospital. Peripheral blood was collected before and after it was passed through a primary membrane, centrifuged, and used to extract circulating miRNAs. A comprehensive expression analysis was then performed with a miRNA array chip. The levels of expression of a large number of circulating miRNAs were measured in the plasma samples separated by the primary membranes from all 3 patients with systemic lupus erythematosus. We present the first report that circulating miRNAs in peripheral blood can be separated and possibly directly removed using membrane separation apheresis. PMID:27523074

  11. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.

    PubMed

    Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  12. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles

    PubMed Central

    Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  13. Regulatory triangle of neurodegeneration, adult neurogenesis and microRNAs.

    PubMed

    Singh, Tanisha; Jauhari, Abhishek; Pandey, Ankita; Singh, Parul; Pant, Aditya B; Parmar, Devendra; Yadav, Sanjay

    2014-02-01

    MicroRNAs (miRNAs) have emerged as a new class of RNA molecules which are short in length, less in number but play bigger role in regulation of cellular events. miRNAs keep cellular homeostasis in tight control by fine tuning expression of protein coding genes at post-transcriptional level. Neurogenesis and neurodegeneration are two complex processes which are regulated by dynamic expression of regulatory proteins like transcription factors and signaling proteins. Evidences are accumulating that expression of miRNAs play major role in fate determination of neuronal cells undergoing neurogenesis or neurodegeneration. Neurodegeneration either induced by genetic factors or environmental chemicals results in development of neurodegenerative disorders like Parkinson's or Alzheimer's. With increasing acceptance of adult neurogenesis, it seems possible that inducing neurogenesis in adult brain can help in fighting with neurodegenerative disorders. Regulatory RNA molecules, like miRNAs are presenting them as potential therapeutic targets for inducing neurogenesis and controlling neurodegeneration. In the current review, we are exploring the link between neurodegeneration and adult neurogenesis regulation by focusing on miRNAs. PMID:24152328

  14. Relation between microRNAs and Apoptosis in Hepatocellular Carcinoma

    PubMed Central

    Kamel, Refaat R.; Amr, Khalda Said; Afify, Mie; Elhosary, Yasser A.; Hegazy, Abdelfattah E.; Fahim, Hoda H.; Ezzat, Wafaa M.

    2016-01-01

    AIM: To determine the relation between serum microRNAs and apoptotic markers as regards development of HCC to understand the underlying mechanism of HCV related hepatocarcinogenesis. PATIENTS AND METHODS: A total of 65 serum samples (25 samples from controls, 20 samples from hepatitis and 20 samples from HCC patients) were collected for miRNAs (mir 21, mir 199-a, and mir 155) detection. Human Programmed cell death protein-4 (PDCD-4) and Human Cytochrome-C (CYT-C) were determined. RESULTS: miRNAs 21 and 155 were over expressed in sera of patients with HCC compared to patients with chronic hepatitis (p < 0.0001). While serum means values of miR 199a was significantly decreased among HCC group patients when compared to patients with chronic hepatitis (p < 0.0001). The serum levels of PCDC4 and CYTC were increased in patients with HCC when compared to chronic hepatitis patients. They were also increased in patients with chronic hepatitis when compared to controls (p < 0.05, significant). There was direct correlations between apoptotic markers and oncomirs miRNAs 21 and 155 while apoptotic markers were inversely correlated with miRNA 199-a. CONCLUSION: Both microRNAs and apoptotic markers have roles in HCC pathogenesis. It seems that oncogenic microRNAs induce liver carcinogenesis in HCV patients irrespective of suppression of apoptosis. PMID:27275325

  15. Noncoding RNAs in Cancer Immunology.

    PubMed

    Li, Qian; Liu, Qiang

    2016-01-01

    Cancer immunology is the study of interaction between cancer cells and immune system by the application of immunology principle and theory. With the recent approval of several new drugs targeting immune checkpoints in cancer, cancer immunology has become a very attractive field of research and is thought to be the new hope to conquer cancer. This chapter introduces the aberrant expression and function of noncoding RNAs, mainly microRNAs and long noncoding RNAs, in tumor-infiltrating immune cells, and their significance in tumor immunity. It also illustrates how noncoding RNAs are shuttled between tumor cells and immune cells in tumor microenvironments via exosomes or other microvesicles to modulate tumor immunity. PMID:27376738

  16. Uridylation and adenylation of RNAs.

    PubMed

    Song, JianBo; Song, Jun; Mo, BeiXin; Chen, XueMei

    2015-11-01

    The posttranscriptional addition of nontemplated nucleotides to the 3' ends of RNA molecules can have a significant impact on their stability and biological function. It has been recently discovered that nontemplated addition of uridine or adenosine to the 3' ends of RNAs occurs in different organisms ranging from algae to humans, and on different kinds of RNAs, such as histone mRNAs, mRNA fragments, U6 snRNA, mature small RNAs and their precursors etc. These modifications may lead to different outcomes, such as increasing RNA decay, promoting or inhibiting RNA processing, or changing RNA activity. Growing pieces of evidence have revealed that such modifications can be RNA sequence-specific and subjected to temporal or spatial regulation in development. RNA tailing and its outcomes have been associated with human diseases such as cancer. Here, we review recent developments in RNA uridylation and adenylation and discuss the future prospects in this research area. PMID:26563174

  17. Structural and Functional Analysis of Viral siRNAs

    PubMed Central

    Szittya, Gyorgy; Moxon, Simon; Pantaleo, Vitantonio; Toth, Gabor; Rusholme Pilcher, Rachel L.; Moulton, Vincent; Burgyan, Jozsef; Dalmay, Tamas

    2010-01-01

    A large amount of short interfering RNA (vsiRNA) is generated from plant viruses during infection, but the function, structure and biogenesis of these is not understood. We profiled vsiRNAs using two different high-throughput sequencing platforms and also developed a hybridisation based array approach. The profiles obtained through the Solexa platform and by hybridisation were very similar to each other but different from the 454 profile. Both deep sequencing techniques revealed a strong bias in vsiRNAs for the positive strand of the virus and identified regions on the viral genome that produced vsiRNA in much higher abundance than other regions. The hybridisation approach also showed that the position of highly abundant vsiRNAs was the same in different plant species and in the absence of RDR6. We used the Terminator 5′-Phosphate-Dependent Exonuclease to study the 5′ end of vsiRNAs and showed that a perfect control duplex was not digested by the enzyme without denaturation and that the efficiency of the Terminator was strongly affected by the concentration of the substrate. We found that most vsiRNAs have 5′ monophosphates, which was also confirmed by profiling short RNA libraries following either direct ligation of adapters to the 5′ end of short RNAs or after replacing any potential 5′ ends with monophosphates. The Terminator experiments also showed that vsiRNAs were not perfect duplexes. Using a sensor construct we also found that regions from the viral genome that were complementary to non-abundant vsiRNAs were targeted in planta just as efficiently as regions recognised by abundant vsiRNAs. Different high-throughput sequencing techniques have different reproducible sequence bias and generate different profiles of short RNAs. The Terminator exonuclease does not process double stranded RNA, and because short RNAs can quickly re-anneal at high concentration, this assay can be misleading if the substrate is not denatured and not analysed in a dilution

  18. Endogenous siRNAs derived from transposons and mRNAs in Drosophila somatic cells.

    PubMed

    Ghildiyal, Megha; Seitz, Hervé; Horwich, Michael D; Li, Chengjian; Du, Tingting; Lee, Soohyun; Xu, Jia; Kittler, Ellen L W; Zapp, Maria L; Weng, Zhiping; Zamore, Phillip D

    2008-05-23

    Small interfering RNAs (siRNAs) direct RNA interference (RNAi) in eukaryotes. In flies, somatic cells produce siRNAs from exogenous double-stranded RNA (dsRNA) as a defense against viral infection. We identified endogenous siRNAs (endo-siRNAs), 21 nucleotides in length, that correspond to transposons and heterochromatic sequences in the somatic cells of Drosophila melanogaster. We also detected endo-siRNAs complementary to messenger RNAs (mRNAs); these siRNAs disproportionately mapped to the complementary regions of overlapping mRNAs predicted to form double-stranded RNA in vivo. Normal accumulation of somatic endo-siRNAs requires the siRNA-generating ribonuclease Dicer-2 and the RNAi effector protein Argonaute2 (Ago2). We propose that endo-siRNAs generated by the fly RNAi pathway silence selfish genetic elements in the soma, much as Piwi-interacting RNAs do in the germ line. PMID:18403677

  19. Sizing up long non-coding RNAs

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2012-01-01

    Long noncoding RNAs (lncRNAs) play a key role in many important areas of epigenetics, stem cell biology, cancer, signaling and brain function. This emerging class of RNAs constitutes a large fraction of the transcriptome, with thousands of new lncRNAs reported each year. The molecular mechanisms of these RNAs are not well understood. Currently, very little structural data exist. We review the available lncRNA sequence and secondary structure data. Since almost no tertiary information is available for lncRNAs, we review crystallographic structures for other RNA systems and discuss the possibilities for lncRNAs in the context of existing constraints. PMID:23267412

  20. Transcriptomic profiling of long non-coding RNAs in dermatomyositis by microarray analysis

    PubMed Central

    Peng, Qing-Lin; Zhang, Ya-Mei; Yang, Han-Bo; Shu, Xiao-Ming; Lu, Xin; Wang, Guo-Chun

    2016-01-01

    Long non-coding RNAs (lncRNAs) are prevalently transcribed in the genome and have been found to be of functional importance. However, the potential roles of lncRNAs in dermatomyositis (DM) remain unknown. In this study, a lncRNA + mRNA microarray analysis was performed to profile lncRNAs and mRNAs from 15 treatment-naive DM patients and 5 healthy controls. We revealed a total of 1198 lncRNAs (322 up-regulated and 876 down-regulated) and 1213 mRNAs (665 up-regulated and 548 down-regulated) were significantly differentially expressed in DM patients compared with the healthy controls (fold change>2, P < 0.05). Subgrouping DM patients according to the presence of interstitial lung disease and anti-Jo-1 antibody revealed different expression patterns of the lncRNAs. Pathway and gene ontology analysis for the differentially expressed mRNAs confirmed that type 1 interferon signaling was the most significantly dysregulated pathway in all DM subgroups. In addition, distinct pathways that uniquely associated with DM subgroup were also identified. Bioinformatics prediction suggested that linc-DGCR6-1 may be a lncRNA that regulates type 1 interferon-inducible gene USP18, which was found highly expressed in the perifascicular areas of the muscle fibers of DM patients. Our findings provide an overview of aberrantly expressed lncRNAs in DM muscle and further broaden the understanding of DM pathogenesis. PMID:27605457

  1. The Roles of Arabidopsis CDF2 in Transcriptional and Posttranscriptional Regulation of Primary MicroRNAs

    PubMed Central

    Sun, Zhenfei; Guo, Tongtong; Liu, Yin; Liu, Qi; Fang, Yuda

    2015-01-01

    The precise regulation of microRNA (miRNA) transcription and processing is important for eukaryotic development. Plant miRNAs are first transcribed as stem-loop primary miRNAs (pri-miRNAs) by RNA polymerase II,then cleaved in the nucleus into mature miRNAs by Dicer-like 1 (DCL1). We identified a cycling DOF transcription factor, CDF2, which interacts with DCL1 and regulates the accumulation of a population of miRNAs. CDF2 binds directly to the promoters of some miRNAs and works as a transcription activator or repressor for these miRNA genes. CDF2 binds preferentially to the pri-miRNAs regulated by itself and affects DCL1-mediated processing of these pri-miRNAs. Genetically, CDF2 works in the same pathway as miR156 or miR172 to control flowering. We conclude that CDF2 regulates a group of pri-miRNAs at both the transcriptional and posttranscriptional levels to maintain proper levels of their mature miRNAs to control plant development. PMID:26473486

  2. MicroRNAs dysregulation in hepatocellular carcinoma: Insights in genomic medicine

    PubMed Central

    Lyra-González, Iván; Flores-Fong, Laura E; González-García, Ignacio; Medina-Preciado, David; Armendáriz-Borunda, Juan

    2015-01-01

    Hepatocellular carcinoma (HCC) is the leading primary liver cancer and its clinical outcome is still poor. MicroRNAs (miRNAs) have demonstrated an interesting potential to regulate gene expression at post-transcriptional level. Current findings suggest that miRNAs deregulation in cancer is caused by genetic and/or epigenetic, transcriptional and post-transcriptional modifications resulting in abnormal expression and hallmarks of malignant transformation: aberrant cell growth, cell death, differentiation, angiogenesis, invasion and metástasis. The important role of miRNAs in the development and progression of HCC has increased the efforts to understand and develop mechanisms of control overt this single-stranded RNAs. Several studies have analyzed tumoral response to the regulation and control of deregulated miRNAs with good results in vitro and in vivo, proving that targeting aberrant expression of miRNAs is a powerful anticancer therapeutic. Identification of up and/or down regulated miRNAs related to HCC has led to the discovery of new potential application for detection of their presence in the affected organism. MiRNAs represent a relevant new target for diagnosis, prognosis and treatment in a wide variety of pathologic entities, including HCC. This manuscript intends to summarize current knowledge regarding miRNAs and their role in HCC development. PMID:26085912

  3. MicroRNAs dysregulation in hepatocellular carcinoma: Insights in genomic medicine.

    PubMed

    Lyra-González, Iván; Flores-Fong, Laura E; González-García, Ignacio; Medina-Preciado, David; Armendáriz-Borunda, Juan

    2015-06-18

    Hepatocellular carcinoma (HCC) is the leading primary liver cancer and its clinical outcome is still poor. MicroRNAs (miRNAs) have demonstrated an interesting potential to regulate gene expression at post-transcriptional level. Current findings suggest that miRNAs deregulation in cancer is caused by genetic and/or epigenetic, transcriptional and post-transcriptional modifications resulting in abnormal expression and hallmarks of malignant transformation: aberrant cell growth, cell death, differentiation, angiogenesis, invasion and metástasis. The important role of miRNAs in the development and progression of HCC has increased the efforts to understand and develop mechanisms of control overt this single-stranded RNAs. Several studies have analyzed tumoral response to the regulation and control of deregulated miRNAs with good results in vitro and in vivo, proving that targeting aberrant expression of miRNAs is a powerful anticancer therapeutic. Identification of up and/or down regulated miRNAs related to HCC has led to the discovery of new potential application for detection of their presence in the affected organism. MiRNAs represent a relevant new target for diagnosis, prognosis and treatment in a wide variety of pathologic entities, including HCC. This manuscript intends to summarize current knowledge regarding miRNAs and their role in HCC development. PMID:26085912

  4. Transcriptomic profiling of long non-coding RNAs in dermatomyositis by microarray analysis.

    PubMed

    Peng, Qing-Lin; Zhang, Ya-Mei; Yang, Han-Bo; Shu, Xiao-Ming; Lu, Xin; Wang, Guo-Chun

    2016-01-01

    Long non-coding RNAs (lncRNAs) are prevalently transcribed in the genome and have been found to be of functional importance. However, the potential roles of lncRNAs in dermatomyositis (DM) remain unknown. In this study, a lncRNA + mRNA microarray analysis was performed to profile lncRNAs and mRNAs from 15 treatment-naive DM patients and 5 healthy controls. We revealed a total of 1198 lncRNAs (322 up-regulated and 876 down-regulated) and 1213 mRNAs (665 up-regulated and 548 down-regulated) were significantly differentially expressed in DM patients compared with the healthy controls (fold change>2, P < 0.05). Subgrouping DM patients according to the presence of interstitial lung disease and anti-Jo-1 antibody revealed different expression patterns of the lncRNAs. Pathway and gene ontology analysis for the differentially expressed mRNAs confirmed that type 1 interferon signaling was the most significantly dysregulated pathway in all DM subgroups. In addition, distinct pathways that uniquely associated with DM subgroup were also identified. Bioinformatics prediction suggested that linc-DGCR6-1 may be a lncRNA that regulates type 1 interferon-inducible gene USP18, which was found highly expressed in the perifascicular areas of the muscle fibers of DM patients. Our findings provide an overview of aberrantly expressed lncRNAs in DM muscle and further broaden the understanding of DM pathogenesis. PMID:27605457

  5. Roles of Circular RNAs in Neurologic Disease

    PubMed Central

    Shao, Yiye; Chen, Yinghui

    2016-01-01

    Circular RNAs (circRNAs) are a novel type of endogenous noncoding RNA receiving increasing attention. They have been shown to act as a natural microRNA sponges that repress the activity of corresponding miRNAs by binding with them, thus regulating target genes. Numerous studies have shown that miRNAs are involved in the pathogenesis of neurological diseases. Therefore, circRNAs may act as important regulatory factors in the occurrence and development processes of neurological disease. PMID:27147959

  6. Sensitivity of quasi-periodic outer rainband activity of tropical cyclones to the surface entropy flux

    NASA Astrophysics Data System (ADS)

    Li, Qingqing; Duan, Yihong

    2013-10-01

    The influence of outer-core surface entropy fluxes (SEFs) on tropical cyclone (TC) outer rainband activity is investigated in this study with a fully compressible, nonhydrostatic model. A control simulation and two sensitivity experiments with the outer-core SEF artificially increased and decreased by 20% respectively were conducted to examine the quasi-periodic outer rainband behavior. Larger negative horizontal advection due to the greater radial wind and the positive contribution by asymmetric eddies leads to a longer period of outerrainband activity in the SEF-enhanced experiment. The well-developed outer rainbands in the control and SEF-reduced simulations significantly limit the TC intensity, whereas such an intensity suppression influence is not pronounced in the SEF-enhanced experiment. As diabatic heating in outer rainbands strengthens the outer-core tangential wind, the quasi-periodic activity of outer rainbands contributes to the quasi-periodic variations of the inner-core size of the TCs.

  7. The role of microRNAs in gallbladder cancer

    PubMed Central

    YANG, GANGHUA; ZHANG, LEI; LI, RUIXIANG; WANG, LIN

    2016-01-01

    MicroRNAs (also referred to as miRNAs or miRs) play a crucial role in post-transcriptional gene regulation and serve as negative gene regulators by controlling a variety of target genes and regulating diverse biological processes, such as cell proliferation, invasion, migration and apoptosis. Aberrant expression of miRNAs is associated with the development and progression of cancer. Recent studies have reported that miRNAs may repress or promote the expression of cancer-related genes via several different signaling pathways in gallbladder cancer (GBC) patients and may function as tumor suppressors or oncogenes, thus providing a promising tool for the diagnosis and therapeutics of GBCs. In this review, we summarize the role of dysregulawted miRNA expression in the signaling pathways implicated in GBC and discuss the significant role of circulating miRNAs in GBC. Therefore, miRNAs may serve as novel therapeutic targets as well as diagnostic or prognostic markers in GBC. PMID:27330755

  8. Global characterization of microRNAs in Trichomonas gallinae

    PubMed Central

    2014-01-01

    Background Trichomonas gallinae is a protozoan parasite causing trichomonosis in many species of domestic poultry and birds world-wide. microRNAs (miRNAs) are a class of small non-coding RNAs that play key roles in gene regulation. However, no miRNAs have been characterized from T. gallinae. Methods Here, we investigated the global miRNA profile of this parasite by high throughput sequencing technology, bioinformatics platform analysis and quantitative RT-PCR. Results Three miRNA candidates, with typical precursor stem-loop structures, were identified from 11.13 million raw sequencing reads. Three miRNAs, Tga-miR-1, Tga-miR-2 and Tga-miR-3 had no homologues in publically available miRNA databases, suggesting that they may be T. gallinae-specific. Tga-miR-2 and Tga-miR-3 occupied only one location each on the reference genome, while Tga-miR-1 was found at 3 locations. Conclusions The results of the present study provided a sound basis for the further understanding of gene regulation in this parasite of animal health significance, with the potential to inform the development of novel control reagents and strategies and also inform a more in-depth understanding of the evolution of miRNAs. PMID:24612519

  9. MicroRNAs as regulators of root development and architecture.

    PubMed

    Khan, Ghazanfar A; Declerck, Marie; Sorin, Céline; Hartmann, Caroline; Crespi, Martin; Lelandais-Brière, Christine

    2011-09-01

    MicroRNAs (miRNAs) are post-transcriptional regulators of growth and development in both plants and animals. In plants, roots play essential roles in their anchorage to the soil as well as in nutrient and water uptake. In this review, we present recent advances made in the identification of miRNAs involved in embryonic root development, radial patterning, vascular tissue differentiation and formation of lateral organs (i.e., lateral and adventitious roots and symbiotic nitrogen-fixing nodules in legumes). Certain mi/siRNAs target members of the Auxin Response Factors family involved in auxin homeostasis and signalling and participate in complex regulatory loops at several crucial stages of root development. Other miRNAs target and restrict the action of various transcription factors that control root-related processes in several species. Finally, because abiotic stresses, which include nutrient or water deficiencies, generally modulate root growth and branching, we summarise the action of certain miRNAs in response to these stresses that may be involved in the adaptation of the root system architecture to the soil environment. PMID:21607657

  10. MicroRNAs: Emerging Novel Clinical Biomarkers for Hepatocellular Carcinomas

    PubMed Central

    Anwar, Sumadi Lukman; Lehmann, Ulrich

    2015-01-01

    The discovery of small non-coding RNAs known as microRNAs has refined our view of the complexity of gene expression regulation. In hepatocellular carcinoma (HCC), the fifth most frequent cancer and the third leading cause of cancer death worldwide, dysregulation of microRNAs has been implicated in all aspects of hepatocarcinogenesis. In addition, alterations of microRNA expression have also been reported in non-cancerous liver diseases including chronic hepatitis and liver cirrhosis. MicroRNAs have been proposed as clinically useful diagnostic biomarkers to differentiate HCC from different liver pathologies and healthy controls. Unique patterns of microRNA expression have also been implicated as biomarkers for prognosis as well as to predict and monitor therapeutic responses in HCC. Since dysregulation has been detected in various specimens including primary liver cancer tissues, serum, plasma, and urine, microRNAs represent novel non-invasive markers for HCC screening and predicting therapeutic responses. However, despite a significant number of studies, a consensus on which microRNA panels, sample types, and methodologies for microRNA expression analysis have to be used has not yet been established. This review focuses on potential values, benefits, and limitations of microRNAs as new clinical markers for diagnosis, prognosis, prediction, and therapeutic monitoring in HCC. PMID:26295264

  11. Adenylation of maternally inherited microRNAs by Wispy.

    PubMed

    Lee, Mihye; Choi, Yeon; Kim, Kijun; Jin, Hua; Lim, Jaechul; Nguyen, Tuan Anh; Yang, Jihye; Jeong, Minsun; Giraldez, Antonio J; Yang, Hui; Patel, Dinshaw J; Kim, V Narry

    2014-12-01

    Early development depends heavily on accurate control of maternally inherited mRNAs, and yet it remains unknown how maternal microRNAs are regulated during maternal-to-zygotic transition (MZT). We here find that maternal microRNAs are highly adenylated at their 3' ends in mature oocytes and early embryos. Maternal microRNA adenylation is widely conserved in fly, sea urchin, and mouse. We identify Wispy, a noncanonical poly(A) polymerase, as the enzyme responsible for microRNA adenylation in flies. Knockout of wispy abrogates adenylation and results in microRNA accumulation in eggs, whereas overexpression of Wispy increases adenylation and reduces microRNA levels in S2 cells. Wispy interacts with Ago1 through protein-protein interaction, which may allow the effective and selective adenylation of microRNAs. Thus, adenylation may contribute to the clearance of maternally deposited microRNAs during MZT. Our work provides mechanistic insights into the regulation of maternal microRNAs and illustrates the importance of RNA tailing in development. PMID:25454948

  12. η Carinae - The outer ejecta

    NASA Astrophysics Data System (ADS)

    Weis, K.

    2009-03-01

    η Carinae is a unique object among the most massive evolved stars in the LBV phase. The central object(s) is(are) surrounded by a complex circumstellar nebula ejected during more than one eruption in the 19th century. Beyond the well-defined edges of its famous bipolar nebula, the Homunculus, are additional nebulous features referred to as the outer ejecta. The outer ejecta contains a large variety of structures of very different sizes and morphologies distributed in a region 0.67 pc in diameter. Individual features in the outer ejecta are moving extremely fast, up to 3200 km/s, in general the expansion velocities are between 400-900 km/s. A consequence of these high velocities is that structures in the outer ejecta interact with the surrounding medium and with each other. The strong shocks that arise from these interactions give rise to soft X-ray emission. The global expansion pattern of the outer ejecta reveals an overall bipolar distribution, giving a symmetric structure to its morphologically more irregular appearance. The long, highly collimated filaments, called strings, are particularly unusual. The material in the strings follows a Hubble-flow and appears to originate at the central object.

  13. MicroRNAs involved in the browning process of adipocytes.

    PubMed

    Arias, N; Aguirre, L; Fernández-Quintela, A; González, M; Lasa, A; Miranda, J; Macarulla, M T; Portillo, M P

    2016-09-01

    The present review focuses on the role of miRNAs in the control of white adipose tissue browning, a process which describes the recruitment of adipocytes showing features of brown adipocytes in white adipose tissue. MicroRNAs (miRNAs) are a class of short non-coding RNAs (19-22 nucleotides) involved in gene regulation. Although the main effect of miRNAs is the inhibition of the translational machinery, thereby preventing the production of the protein product, the activation of protein translation has also been described in the literature. In addition to modifying translation, miRNAs binding to its target mRNAs also trigger the recruitment and association of mRNA decay factors, leading to mRNA destabilization, degradation, and thus to the decrease in expression levels. Although a great number of miRNAs have been reported to potentially regulate genes that play important roles in the browning process, only a reduced number of studies have demonstrated experimentally an effect on this process associated to changes in miRNA expressions, so far. These studies have shown, by using either primary adipocyte cultures or experimental models of mice (KO mice, mice overexpressing a specific miRNA) that miR-196a, miR-26 and miR-30 are needed for browning process development. By contrast, miR-155, miR-133, miR-27b and miR-34 act as negative regulators of this process. Further studies are needed to fully describe the miRNA network-involved white adipose tissue browning regulation. PMID:26695012

  14. Mobile small RNAs regulate genome-wide DNA methylation

    PubMed Central

    Lewsey, Mathew G.; Hardcastle, Thomas J.; Melnyk, Charles W.; Molnar, Attila; Valli, Adrián; Urich, Mark A.; Nery, Joseph R.; Baulcombe, David C.; Ecker, Joseph R.

    2016-01-01

    RNA silencing at the transcriptional and posttranscriptional levels regulates endogenous gene expression, controls invading transposable elements (TEs), and protects the cell against viruses. Key components of the mechanism are small RNAs (sRNAs) of 21–24 nt that guide the silencing machinery to their nucleic acid targets in a nucleotide sequence-specific manner. Transcriptional gene silencing is associated with 24-nt sRNAs and RNA-directed DNA methylation (RdDM) at cytosine residues in three DNA sequence contexts (CG, CHG, and CHH). We previously demonstrated that 24-nt sRNAs are mobile from shoot to root in Arabidopsis thaliana and confirmed that they mediate DNA methylation at three sites in recipient cells. In this study, we extend this finding by demonstrating that RdDM of thousands of loci in root tissues is dependent upon mobile sRNAs from the shoot and that mobile sRNA-dependent DNA methylation occurs predominantly in non-CG contexts. Mobile sRNA-dependent non-CG methylation is largely dependent on the DOMAINS REARRANGED METHYLTRANSFERASES 1/2 (DRM1/DRM2) RdDM pathway but is independent of the CHROMOMETHYLASE (CMT)2/3 DNA methyltransferases. Specific superfamilies of TEs, including those typically found in gene-rich euchromatic regions, lose DNA methylation in a mutant lacking 22- to 24-nt sRNAs (dicer-like 2, 3, 4 triple mutant). Transcriptome analyses identified a small number of genes whose expression in roots is associated with mobile sRNAs and connected to DNA methylation directly or indirectly. Finally, we demonstrate that sRNAs from shoots of one accession move across a graft union and target DNA methylation de novo at normally unmethylated sites in the genomes of root cells from a different accession. PMID:26787884

  15. Controlling the Specificity of Modularly Assembled Small Molecules for RNA via Ligand Module Spacing: Targeting the RNAs that Cause Myotonic Muscular Dystrophy

    PubMed Central

    Lee, Melissa M.; Childs-Disney, Jessica L.; Pushechnikov, Alexei; French, Jonathan M.; Sobczak, Krzysztof; Thornton, Charles A.; Disney, Matthew D.

    2009-01-01

    - × 3-fold). The trimer and tetramer also bind ∼13- and ∼63-fold more tightly to DM1 RNAs than does MBNL1. The modularly assembled compounds are cell permeable and non-toxic as determined by flow cytometry. The results establish that for these two systems: (i) a programmable modular assembly approach can provide synthetic ligands for RNA with affinities and specificities that exceed those of natural proteins; and (ii) the spacing of ligand modules can be used to tune specificity for one RNA target over another. PMID:19904940

  16. Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis

    PubMed Central

    Cao, Mengji; Du, Peng; Wang, Xianbing; Yu, Yun-Qi; Qiu, Yan-Hong; Li, Wanxiang; Gal-On, Amit; Zhou, Changyong; Li, Yi; Ding, Shou-Wei

    2014-01-01

    Antiviral immunity controlled by RNA interference (RNAi) in plants and animals is thought to specifically target only viral RNAs by the virus-derived small interfering RNAs (siRNAs). Here we show that activation of antiviral RNAi in Arabidopsis plants is accompanied by the production of an abundant class of endogenous siRNAs mapped to the exon regions of more than 1,000 host genes and rRNA. These virus-activated siRNAs (vasiRNAs) are predominantly 21 nucleotides long with an approximately equal ratio of sense and antisense strands. Genetically, vasiRNAs are distinct from the known plant endogenous siRNAs characterized to date and instead resemble viral siRNAs by requiring Dicer-like 4 and RNA-dependent RNA polymerase 1 (RDR1) for biogenesis. However, loss of EXORIBONUCLEASE4/THYLENE-INSENSITIVE5 enhances vasiRNA biogenesis and virus resistance without altering the biogenesis of viral siRNAs. We show that vasiRNAs are active in directing widespread silencing of the target host genes and that Argonaute-2 binds to and is essential for the silencing activity of vasiRNAs. Production of vasiRNAs is readily detectable in Arabidopsis after infection by viruses from two distinct supergroups of plant RNA virus families and is targeted for inhibition by the silencing suppressor protein 2b of Cucumber mosaic virus. These findings reveal RDR1 production of Arabidopsis endogenous siRNAs and identify production of vasiRNAs to direct widespread silencing of host genes as a conserved response of plants to infection by diverse viruses. A possible function for vasiRNAs to confer broad-spectrum antiviral activity distinct to the virus-specific antiviral RNAi by viral siRNAs is discussed. PMID:25201959

  17. Chemical design of pH-sensitive nanovalves on the outer surface of mesoporous silicas for controlled storage and release of aromatic amino acid

    SciTech Connect

    Roik, N.V. Belyakova, L.A.

    2014-07-01

    Mesoporous silicas with hexagonally arranged pore channels were synthesized in water–ethanol-ammonia solution using cetyltrimethylammonium bromide as template. Directed modification of silica surface with N-[N′-(N′-phenyl)-2-aminophenyl]-3-aminopropyl groups was realized by postsynthetic activation of halogenoalkylsilicas, which have surface uniformly or selectively distributed 3-chloropropyl groups, with 2-aminodiphenylamine in the liquid phase. Chemical composition of silica materials was estimated by IR spectroscopy and chemical analysis of the surface products of reactions. Characteristics of porous structure of MCM-41-type silicas were determined from X-ray and low-temperature nitrogen ad-desorption measurements. Release ability of synthesized silica carriers was established on encapsulation of 4-aminobenzoic acid in pore channels and subsequent delivery at pH=6.86 and pH=1.00. It was found that N-[N′-(N′-phenyl)-2-aminophenyl]-3-aminopropyl groups block pore entrances at neutral pH preventing 4-aminobenzoic acid release. At pH=1.00 repulsion of positively charged surface aromatic amino groups localized near pore orifices provides unhindered liberation of aromatic amino acid from mesoporous channels. - Graphical abstract: Blocking of pores with N-[N′-(N′-phenyl)-2-aminophenyl]-3-aminopropyl groups at pH=6.86 for storage of ABA and opening of pore entrances at pH=1.00 for unhindered ABA liberation. - Highlights: • Modification of MCM-41 with N-[N′-(N′-phenyl)-2-aminophenyl]-3-aminopropyl groups. • Study of release ability of synthesized silica carriers in relation to amino acid. • Controlled blocking and opening of pores by amino groups at pH change were performed. • Retention of amino acid at pH=6.86 and its liberation at pH=1.00 was proved.

  18. Origin of Outer Solar System

    NASA Technical Reports Server (NTRS)

    Holman, Matthew J.; Lindstrom, David (Technical Monitor)

    2005-01-01

    Our ongoing research program combines extensive deep and wide-field observations using a variety of observational platforms with numerical studies of the dynamics of small bodies in the outer solar system in order to advance the main scientific goals of the community studying the Kuiper belt and the outer solar system. These include: (1) determining the relative populations of the known classes of KBOs as well as other possible classes; ( 2 ) determining the size distributions or luminosity function of the individual populations or the Kuiper belt as a whole; (3) determining the inclinations distributions of these populations; (4) establishing the radial extent of the Kuiper belt; ( 5 ) measuring and relating the physical properties of different types of KBOs to those of other solar system bodies; and, (6) completing our systematic inventory of the satellites of the outer planets.

  19. Dietary RNAs: New Stories Regarding Oral Delivery

    PubMed Central

    Yang, Jian; Hirschi, Kendal D.; Farmer, Lisa M.

    2015-01-01

    microRNAs (miRNAs), a class of small RNAs, are important regulators of various developmental processes in both plants and animals. Several years ago, a report showed the detection of diet-derived plant miRNAs in mammalian tissues and their regulation of mammalian genes, challenging the traditional functions of plant miRNAs. Subsequently, multiple efforts have attempted to replicate these findings, with the results arguing against the uptake of plant dietary miRNAs in healthy consumers. Moreover, several reports suggest the potential for “false positive” detection of plant miRNAs in human tissues. Meanwhile, some research continues to suggest both the presence and function of dietary miRNAs in mammalian tissues. Here we review the recent literature and discuss the strengths and weaknesses of emerging work that suggests the feasibility of dietary delivery of miRNAs. We also discuss future experimental approaches to address this controversial topic. PMID:25942490

  20. Circular RNAs: Novel Regulators of Neuronal Development.

    PubMed

    van Rossum, Daniëlle; Verheijen, Bert M; Pasterkamp, R Jeroen

    2016-01-01

    Circular RNAs (circRNAs) are highly stable, circularized long non-coding RNAs. circRNAs are conserved across species and appear to be specifically enriched in the nervous system. Recent studies show that many circRNAs are expressed in a tissue- and developmental-stage-specific manner, reveal a striking regulation of circRNAs during neuronal development, and detect their presence at synaptic sites. The exact functions of circRNAs remain poorly understood, but evidence from analysis of some circRNA molecules suggests that they could substantially contribute to the regulation of gene expression, particularly in architecturally complex and polarized cells such as neurons. Emerging evidence also indicates that circRNAs are involved in the development and progression of various neurological disorders. In this review, we summarize the molecular characteristics of circRNAs and discuss their proposed functions and mechanism-of-action in developing neurons. PMID:27616979

  1. MicroRNAs: deviants no longer.

    PubMed

    Pasquinelli, Amy E

    2002-04-01

    Almost ten years ago, the Ambros laboratory made the extraordinary discovery that a gene essential for development in Caenorhabditis elegans encoded a 22-nucleotide, untranslated RNA. Further genetic studies in this nematode revealed the existence of a second tiny RNA gene that turned out to be conserved in animals as diverse as flies and humans. Now, the Ambros, Bartel and Tuschl laboratories have proven that those odd RNAs were just the first examples of a large family of RNAs, termed microRNAs (miRNAs). Although untranslated RNA genes, such as transfer RNAs and ribosomal RNAs, perform essential housekeeping roles in all living organisms, growing numbers of other RNAs, some widely conserved across phyla and others limited to certain species, are being uncovered and shown to fulfill specific duties. The discovery of miRNAs establishes a new class of regulatory RNAs and highlights the existence of unexpected RNA genes that, although ancient, are not extinct. PMID:11932009

  2. Exploring the Secrets of Long Noncoding RNAs

    PubMed Central

    Quan, Mingyang; Chen, Jinhui; Zhang, Deqiang

    2015-01-01

    High-throughput sequencing has revealed that the majority of RNAs have no capacity to encode protein. Among these non-coding transcripts, recent work has focused on the roles of long noncoding RNAs (lncRNAs) of >200 nucleotides. Although many of their attributes, such as patterns of expression, remain largely unknown, lncRNAs have key functions in transcriptional, post-transcriptional, and epigenetic gene regulation; Also, new work indicates their functions in scaffolding ribonuclear protein complexes. In plants, genome-wide identification of lncRNAs has been conducted in several species, including Zea mays, and recent research showed that lncRNAs regulate flowering time in the photoperiod pathway, and function in nodulation. In this review, we discuss the basic mechanisms by which lncRNAs regulate key cellular processes, using the large body of knowledge on animal and yeast lncRNAs to illustrate the significance of emerging work on lncRNAs in plants. PMID:25764159

  3. Circular RNAs: Novel Regulators of Neuronal Development

    PubMed Central

    van Rossum, Daniëlle; Verheijen, Bert M.; Pasterkamp, R. Jeroen

    2016-01-01

    Circular RNAs (circRNAs) are highly stable, circularized long non-coding RNAs. circRNAs are conserved across species and appear to be specifically enriched in the nervous system. Recent studies show that many circRNAs are expressed in a tissue- and developmental-stage-specific manner, reveal a striking regulation of circRNAs during neuronal development, and detect their presence at synaptic sites. The exact functions of circRNAs remain poorly understood, but evidence from analysis of some circRNA molecules suggests that they could substantially contribute to the regulation of gene expression, particularly in architecturally complex and polarized cells such as neurons. Emerging evidence also indicates that circRNAs are involved in the development and progression of various neurological disorders. In this review, we summarize the molecular characteristics of circRNAs and discuss their proposed functions and mechanism-of-action in developing neurons. PMID:27616979

  4. miRNAs Related to Skeletal Diseases.

    PubMed

    Seeliger, Claudine; Balmayor, Elizabeth R; van Griensven, Martijn

    2016-09-01

    miRNAs as non-coding, short, double-stranded RNA segments are important for cellular biological functions, such as proliferation, differentiation, and apoptosis. miRNAs mainly contribute to the inhibition of important protein translations through their cleavage or direct repression of target messenger RNAs expressions. In the last decade, miRNAs got in the focus of interest with new publications on miRNAs in the context of different diseases. For many types of cancer or myocardial damage, typical signatures of local or systemically circulating miRNAs have already been described. However, little is known about miRNA expressions and their molecular effect in skeletal diseases. An overview of published studies reporting miRNAs detection linked with skeletal diseases was conducted. All regulated miRNAs were summarized and their molecular interactions were illustrated. This review summarizes the involvement and interaction of miRNAs in different skeletal diseases. Thereby, 59 miRNAs were described to be deregulated in tissue, cells, or in the circulation of osteoarthritis (OA), 23 miRNAs deregulated in osteoporosis, and 107 miRNAs deregulated in osteosarcoma (OS). The molecular influences of miRNAs regarding OA, osteoporosis, and OS were illustrated. Specific miRNA signatures for skeletal diseases are described in the literature. Some overlapped, but also unique ones for each disease exist. These miRNAs may present useful targets for the development of new therapeutic approaches and are candidates for diagnostic evaluations. PMID:27418331

  5. Hydroxytyrosol supplementation modulates the expression of miRNAs in rodents and in humans.

    PubMed

    Tomé-Carneiro, Joao; Crespo, María Carmen; Iglesias-Gutierrez, Eduardo; Martín, Roberto; Gil-Zamorano, Judit; Tomas-Zapico, Cristina; Burgos-Ramos, Emma; Correa, Carlos; Gómez-Coronado, Diego; Lasunción, Miguel A; Herrera, Emilio; Visioli, Francesco; Dávalos, Alberto

    2016-08-01

    Dietary microRNAs (miRNAs) modulation could be important for health and wellbeing. Part of the healthful activities of polyphenols might be due to a modulation of miRNAs' expression. Among the most biologically active polyphenols, hydroxytyrosol (HT) has never been studied for its actions on miRNAs. We investigated whether HT could modulate the expression of miRNAs in vivo. We performed an unbiased intestinal miRNA screening in mice supplemented (for 8 weeks) with nutritionally relevant amounts of HT. HT modulated the expression of several miRNAs. Analysis of other tissues revealed consistent HT-induced modulation of only few miRNAs. Also, HT administration increased triglycerides levels. Acute treatment with HT and in vitro experiments provided mechanistic insights. The HT-induced expression of one miRNA was confirmed in healthy volunteers supplemented with HT in a randomized, double-blind and placebo-controlled trial. HT consumption affects specific miRNAs' expression in rodents and humans. Our findings suggest that the modulation of miRNAs' action through HT consumption might partially explain its healthful activities and might be pharmanutritionally exploited in current therapies targeting endogenous miRNAs. However, the effects of HT on triglycerides warrant further investigations. PMID:27322812

  6. Long Noncoding RNAs as Novel Biomarkers Have a Promising Future in Cancer Diagnostics

    PubMed Central

    Shi, Ting; Gao, Ge; Cao, Yingli

    2016-01-01

    Cancers have a high mortality rate due to lack of suitable specific early diagnosis tumor biomarkers. Emerging evidence is accumulating that lncRNAs (long noncoding RNAs) are involved in tumorigenesis, tumor cells proliferation, invasion, migration, apoptosis, and angiogenesis. Furthermore, extracellular lncRNAs can circulate in body fluids; they can be detected and strongly resist RNases. Many researchers have found that lncRNAs could be good candidates for tumor biomarkers and possessed high specificity, high sensitivity, and noninvasive characteristics. In this review, we summarize the detection methods and possible sources of circulating lncRNAs and outline the biological functions and expression level of the most significant lncRNAs in tissues, cell lines, and body fluids (whole blood, plasma, urine, gastric juice, and saliva) of different kinds of tumors. We evaluate the diagnostic performance of lncRNAs as tumor biomarkers. However, the biological functions and the mechanisms of circulating lncRNAs secretion have not been fully understood. The uniform normalization protocol of sample collection, lncRNAs extraction, endogenous control selection, quality assessment, and quantitative data analysis has not been established. Therefore, we put forward some recommendations that might be investigated in the future if we want to adopt lncRNAs in clinical practice. PMID:27143813

  7. Computational identification of miRNAs that modulate the differentiation of mesenchymal stem cells to osteoblasts

    PubMed Central

    Seenprachawong, Kanokwan; Nuchnoi, Pornlada; Nantasenamat, Chanin; Prachayasittikul, Virapong

    2016-01-01

    MicroRNAs (miRNAs) are small endogenous noncoding RNAs that play an instrumental role in post-transcriptional modulation of gene expression. Genes related to osteogenesis (i.e., RUNX2, COL1A1 and OSX) is important in controlling the differentiation of mesenchymal stem cells (MSCs) to bone tissues. The regulated expression level of miRNAs is critically important for the differentiation of MSCs to preosteoblasts. The understanding of miRNA regulation in osteogenesis could be applied for future applications in bone defects. Therefore, this study aims to shed light on the mechanistic pathway underlying osteogenesis by predicting miRNAs that may modulate this pathway. This study investigates RUNX2, which is a major transcription factor for osteogenesis that drives MSCs into preosteoblasts. Three different prediction tools were employed for identifying miRNAs related to osteogenesis using the 3’UTR of RUNX2 as the target gene. Of the 1,023 miRNAs, 70 miRNAs were found by at least two of the tools. Candidate miRNAs were then selected based on their free energy values, followed by assessing the probability of target accessibility. The results showed that miRNAs 23b, 23a, 30b, 143, 203, 217, and 221 could regulate the RUNX2 gene during the differentiation of MSCs to preosteoblasts. PMID:27168985

  8. Computational identification of miRNAs that modulate the differentiation of mesenchymal stem cells to osteoblasts.

    PubMed

    Seenprachawong, Kanokwan; Nuchnoi, Pornlada; Nantasenamat, Chanin; Prachayasittikul, Virapong; Supokawej, Aungkura

    2016-01-01

    MicroRNAs (miRNAs) are small endogenous noncoding RNAs that play an instrumental role in post-transcriptional modulation of gene expression. Genes related to osteogenesis (i.e., RUNX2, COL1A1 and OSX) is important in controlling the differentiation of mesenchymal stem cells (MSCs) to bone tissues. The regulated expression level of miRNAs is critically important for the differentiation of MSCs to preosteoblasts. The understanding of miRNA regulation in osteogenesis could be applied for future applications in bone defects. Therefore, this study aims to shed light on the mechanistic pathway underlying osteogenesis by predicting miRNAs that may modulate this pathway. This study investigates RUNX2, which is a major transcription factor for osteogenesis that drives MSCs into preosteoblasts. Three different prediction tools were employed for identifying miRNAs related to osteogenesis using the 3'UTR of RUNX2 as the target gene. Of the 1,023 miRNAs, 70 miRNAs were found by at least two of the tools. Candidate miRNAs were then selected based on their free energy values, followed by assessing the probability of target accessibility. The results showed that miRNAs 23b, 23a, 30b, 143, 203, 217, and 221 could regulate the RUNX2 gene during the differentiation of MSCs to preosteoblasts. PMID:27168985

  9. Endogenous microRNAs in human microvascular endothelial cells regulate mRNAs encoded by hypertension-related genes.

    PubMed

    Kriegel, Alison J; Baker, Maria Angeles; Liu, Yong; Liu, Pengyuan; Cowley, Allen W; Liang, Mingyu

    2015-10-01

    The goal of this study was to systematically identify endogenous microRNAs (miRNAs) in endothelial cells that regulate mRNAs encoded by genes relevant to hypertension. Small RNA deep sequencing was performed in cultured human microvascular endothelial cells. Of the 50 most abundant miRNAs identified, 30 had predicted target mRNAs encoded by genes with known involvement in hypertension or blood pressure regulation. The cells were transfected with anti-miR oligonucleotides to inhibit each of the 30 miRNAs and the mRNA abundance of predicted targets was examined. Of 95 miRNA-target pairs examined, the target mRNAs were significantly upregulated in 35 pairs and paradoxically downregulated in 8 pairs. The result indicated significant suppression of the abundance of mRNA encoded by ADM by endogenous miR-181a-5p, ATP2B1 by the miR-27 family, FURIN by miR-125a-5p, FGF5 by the let-7 family, GOSR2 by miR-27a-3p, JAG1 by miR-21-5p, SH2B3 by miR-30a-5p, miR-98, miR-181a-5p, and the miR-125 family, TBX3 by the miR-92 family, ADRA1B by miR-22-3p, ADRA2A by miR-30a-5p and miR-30e-5p, ADRA2B by miR-30e-5p, ADRB1 by the let-7 family and miR-98, EDNRB by the miR-92 family, and NOX4 by the miR-92 family, miR-100-5p, and miR-99b-5p (n=3-9; P<0.05 versus scrambled anti-miR). Treatment with anti-miR-21 decreased blood pressure in mice fed a 4% NaCl diet. Inhibition of the miRNAs targeting NOX4 mRNA increased H2O2 release from endothelial cells. The findings indicate widespread, tonic control of mRNAs encoded by genes relevant to blood pressure regulation by endothelial miRNAs and provide a novel and uniquely informative basis for studying the role of miRNAs in hypertension. PMID:26283043

  10. CLOSURE WELD DEVELOPMENT FOR 3013 OUTER CONTAINERS

    SciTech Connect

    Daugherty, W.; Howard, S.; Peterson, K.; Stokes, M.

    2009-11-10

    Excess plutonium materials in the DOE complex are packaged and stored in accordance with DOE-STD-3013. This standard specifies requirements for the stabilization of such materials and subsequent packaging in dual nested seal-welded containers. Austenitic stainless steels have been selected for container fabrication. The inner 3013 container provides contamination control while the outer 3013 container is the primary containment vessel and is the focus of this paper. Each packaging site chose a process for seal welding the outer 3013 containers in accordance with its needs and expertise. The two processes chosen for weld closure were laser beam welding (LBW) and gas tungsten arc welding (GTAW). Following development efforts, each system was qualified in accordance with DOE-STD-3013 prior to production use. The 3013 outer container closure weld joint was designed to accommodate the characteristics of a laser weld. This aspect of the joint design necessitated some innovative process and equipment considerations in the application of the GTAW process. Details of the weld requirements and the development processes are presented and several potential enhancements for the GTAW system are described.

  11. Small RNAs as Guardians of the Genome

    PubMed Central

    Malone, Colin D.; Hannon, Gregory J.

    2009-01-01

    Transposons populate the landscape of all eukaryotic genomes. Often considered purely genomic parasites, transposons can also benefit their hosts, playing roles in gene regulation and in genome organization and evolution. Peaceful coexistence with mobile elements depends upon adaptive control mechanisms, since unchecked transposon activity can impact long-term fitness and acutely reduce the fertility of progeny. Here, we review the conserved roles played by small RNAs in the adaptation of eukaryotes to coexist with their genomic colonists. An understanding of transposon-defense pathways has uncovered recurring themes in the mechanisms by which genomes distinguish “self” from “non-self” and selectively silence the latter. PMID:19239887

  12. MicroRNAs: new players in IBD

    PubMed Central

    Kalla, R; Ventham, N T; Kennedy, N A; Quintana, J F; Nimmo, E R; Buck, A H; Satsangi, J

    2015-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs, 18–23 nucleotides long, which act as post-transcriptional regulators of gene expression. miRNAs are strongly implicated in the pathogenesis of many common diseases, including IBDs. This review aims to outline the history, biogenesis and regulation of miRNAs. The role of miRNAs in the development and regulation of the innate and adaptive immune system is discussed, with a particular focus on mechanisms pertinent to IBD and the potential translational applications. PMID:25475103

  13. Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus

    PubMed Central

    2011-01-01

    Background MicroRNAs (miRNAs) are small non-coding RNAs that act as regulators of gene expression in eukaryotes modulating a large diversity of biological processes. The discovery of miRNAs has provided new opportunities to understand the biology of a number of species. The cattle tick, Rhipicephalus (Boophilus) microplus, causes significant economic losses in cattle production worldwide and this drives us to further understand their biology so that effective control measures can be developed. To be able to provide new insights into the biology of cattle ticks and to expand the repertoire of tick miRNAs we utilized Illumina technology to sequence the small RNA transcriptomes derived from various life stages and selected organs of R. microplus. Results To discover and profile cattle tick miRNAs we employed two complementary approaches, one aiming to find evolutionary conserved miRNAs and another focused on the discovery of novel cattle-tick specific miRNAs. We found 51 evolutionary conserved R. microplus miRNA loci, with 36 of these previously found in the tick Ixodes scapularis. The majority of the R. microplus miRNAs are perfectly conserved throughout evolution with 11, 5 and 15 of these conserved since the Nephrozoan (640 MYA), Protostomian (620MYA) and Arthropoda (540 MYA) ancestor, respectively. We then employed a de novo computational screening for novel tick miRNAs using the draft genome of I. scapularis and genomic contigs of R. microplus as templates. This identified 36 novel R. microplus miRNA loci of which 12 were conserved in I. scapularis. Overall we found 87 R. microplus miRNA loci, of these 15 showed the expression of both miRNA and miRNA* sequences. R. microplus miRNAs showed a variety of expression profiles, with the evolutionary-conserved miRNAs mainly expressed in all life stages at various levels, while the expression of novel tick-specific miRNAs was mostly limited to particular life stages and/or tick organs. Conclusions Anciently acquired miRNAs

  14. Down but Not Out: The Role of MicroRNAs in Hibernating Bats

    PubMed Central

    Yuan, Lihong; Geiser, Fritz; Lin, Benfu; Sun, Haibo; Chen, Jinping; Zhang, Shuyi

    2015-01-01

    MicroRNAs (miRNAs) regulate many physiological processes through post-transcriptional control of gene expression and are a major part of the small noncoding RNAs (snRNA). As hibernators can survive at low body temperatures (Tb) for many months without suffering tissue damage, understanding the mechanisms that enable them to do so are of medical interest. Because the brain integrates peripheral physiology and white adipose tissue (WAT) is the primary energy source during hibernation, we hypothesized that both of these organs play a crucial role in hibernation, and thus, their activity would be relatively increased during hibernation. We carried out the first genomic analysis of small RNAs, specifically miRNAs, in the brain and WAT of a hibernating bat (Myotis ricketti) by comparing deeply torpid with euthermic individual bats using high-throughput sequencing (Solexa) and qPCR validation of expression levels. A total of 196 miRNAs (including 77 novel bat-specific miRNAs) were identified, and of these, 49 miRNAs showed significant differences in expression during hibernation, including 33 in the brain and 25 in WAT (P≤0.01 &│logFC│≥1). Stem-loop qPCR confirmed the miRNA expression patterns identified by Solexa sequencing. Moreover, 31 miRNAs showed tissue- or state-specific expression, and six miRNAs with counts >100 were specifically expressed in the brain. Putative target gene prediction combined with KEGG pathway and GO annotation showed that many essential processes of both organs are significantly correlated with differentially expressed miRNAs during bat hibernation. This is especially evident with down-regulated miRNAs, indicating that many physiological pathways are altered during hibernation. Thus, our novel findings of miRNAs and Interspersed Elements in a hibernating bat suggest that brain and WAT are active with respect to the miRNA expression activity during hibernation. PMID:26244645

  15. Down but Not Out: The Role of MicroRNAs in Hibernating Bats.

    PubMed

    Yuan, Lihong; Geiser, Fritz; Lin, Benfu; Sun, Haibo; Chen, Jinping; Zhang, Shuyi

    2015-01-01

    MicroRNAs (miRNAs) regulate many physiological processes through post-transcriptional control of gene expression and are a major part of the small noncoding RNAs (snRNA). As hibernators can survive at low body temperatures (Tb) for many months without suffering tissue damage, understanding the mechanisms that enable them to do so are of medical interest. Because the brain integrates peripheral physiology and white adipose tissue (WAT) is the primary energy source during hibernation, we hypothesized that both of these organs play a crucial role in hibernation, and thus, their activity would be relatively increased during hibernation. We carried out the first genomic analysis of small RNAs, specifically miRNAs, in the brain and WAT of a hibernating bat (Myotis ricketti) by comparing deeply torpid with euthermic individual bats using high-throughput sequencing (Solexa) and qPCR validation of expression levels. A total of 196 miRNAs (including 77 novel bat-specific miRNAs) were identified, and of these, 49 miRNAs showed significant differences in expression during hibernation, including 33 in the brain and 25 in WAT (P≤0.01 &│logFC│≥1). Stem-loop qPCR confirmed the miRNA expression patterns identified by Solexa sequencing. Moreover, 31 miRNAs showed tissue- or state-specific expression, and six miRNAs with counts >100 were specifically expressed in the brain. Putative target gene prediction combined with KEGG pathway and GO annotation showed that many essential processes of both organs are significantly correlated with differentially expressed miRNAs during bat hibernation. This is especially evident with down-regulated miRNAs, indicating that many physiological pathways are altered during hibernation. Thus, our novel findings of miRNAs and Interspersed Elements in a hibernating bat suggest that brain and WAT are active with respect to the miRNA expression activity during hibernation. PMID:26244645

  16. Transcriptome-Wide Identification of Hfq-Associated RNAs in Brucella suis by Deep Sequencing

    PubMed Central

    Saadeh, Bashir; Caswell, Clayton C.; Berta, Philippe; Wattam, Alice Rebecca; Roop, R. Martin

    2015-01-01

    ABSTRACT Recent breakthroughs in next-generation sequencing technologies have led to the identification of small noncoding RNAs (sRNAs) as a new important class of regulatory molecules. In prokaryotes, sRNAs are often bound to the chaperone protein Hfq, which allows them to interact with their partner mRNA(s). We screened the genome of the zoonotic and human pathogen Brucella suis 1330 for the presence of this class of RNAs. We designed a coimmunoprecipitation strategy that relies on the use of Hfq as a bait to enrich the sample with sRNAs and eventually their target mRNAs. By deep sequencing analysis of the Hfq-bound transcripts, we identified a number of mRNAs and 33 sRNA candidates associated with Hfq. The expression of 10 sRNAs in the early stationary growth phase was experimentally confirmed by Northern blotting and/or reverse transcriptase PCR. IMPORTANCE Brucella organisms are facultative intracellular pathogens that use stealth strategies to avoid host defenses. Adaptation to the host environment requires tight control of gene expression. Recently, small noncoding RNAs (sRNAs) and the sRNA chaperone Hfq have been shown to play a role in the fine-tuning of gene expression. Here we have used RNA sequencing to identify RNAs associated with the B. suis Hfq protein. We have identified a novel list of 33 sRNAs and 62 Hfq-associated mRNAs for future studies aiming to understand the intracellular lifestyle of this pathogen. PMID:26553849

  17. Functional Studies of microRNAs in Neural Stem Cells: Problems and Perspectives

    PubMed Central

    Åkerblom, Malin; Sachdeva, Rohit; Jakobsson, Johan

    2012-01-01

    In adult mammals, neural stem cells (NSCs) are found in two niches of the brain; the subventricular zone by the lateral ventricles and the subgranular zone of the dentate gyrus in the hippocampus. Neurogenesis is a complex process that is tightly controlled on a molecular level. Recently, microRNAs (miRNAs) have been implicated to play a central role in the regulation of NCSs. miRNAs are small, endogenously expressed RNAs that regulate gene expression at the post-transcriptional level. However, functional studies of miRNAs are complicated due to current technical limitations. In this review we describe recent findings about miRNAs in NSCs looking closely at miR-124, miR-9, and let-7. In addition, we highlight technical strategies used to investigate miRNA function, accentuating limitations, and potentials. PMID:22347160

  18. MicroRNAs: Not “Fine-Tuners” but Key Regulators of Neuronal Development and Function

    PubMed Central

    Davis, Gregory M.; Haas, Matilda A.; Pocock, Roger

    2015-01-01

    MicroRNAs (miRNAs) are a class of short non-coding RNAs that operate as prominent post-transcriptional regulators of eukaryotic gene expression. miRNAs are abundantly expressed in the brain of most animals and exert diverse roles. The anatomical and functional complexity of the brain requires the precise coordination of multilayered gene regulatory networks. The flexibility, speed, and reversibility of miRNA function provide precise temporal and spatial gene regulatory capabilities that are crucial for the correct functioning of the brain. Studies have shown that the underlying molecular mechanisms controlled by miRNAs in the nervous systems of invertebrate and vertebrate models are remarkably conserved in humans. We endeavor to provide insight into the roles of miRNAs in the nervous systems of these model organisms and discuss how such information may be used to inform regarding diseases of the human brain. PMID:26635721

  19. Next-Generation Sequencing of Protein-Coding and Long Non-protein-Coding RNAs in Two Types of Exosomes Derived from Human Whole Saliva.

    PubMed

    Ogawa, Yuko; Tsujimoto, Masafumi; Yanoshita, Ryohei

    2016-01-01

    Exosomes are small extracellular vesicles containing microRNAs and mRNAs that are produced by various types of cells. We previously used ultrafiltration and size-exclusion chromatography to isolate two types of human salivary exosomes (exosomes I, II) that are different in size and proteomes. We showed that salivary exosomes contain large repertoires of small RNAs. However, precise information regarding long RNAs in salivary exosomes has not been fully determined. In this study, we investigated the compositions of protein-coding RNAs (pcRNAs) and long non-protein-coding RNAs (lncRNAs) of exosome I, exosome II and whole saliva (WS) by next-generation sequencing technology. Although 11% of all RNAs were commonly detected among the three samples, the compositions of reads mapping to known RNAs were similar. The most abundant pcRNA is ribosomal RNA protein, and pcRNAs of some salivary proteins such as S100 calcium-binding protein A8 (protein S100-A8) were present in salivary exosomes. Interestingly, lncRNAs of pseudogenes (presumably, processed pseudogenes) were abundant in exosome I, exosome II and WS. Translationally controlled tumor protein gene, which plays an important role in cell proliferation, cell death and immune responses, was highly expressed as pcRNA and pseudogenes in salivary exosomes. Our results show that salivary exosomes contain various types of RNAs such as pseudogenes and small RNAs, and may mediate intercellular communication by transferring these RNAs to target cells as gene expression regulators. PMID:27582331

  20. Missing Pieces in the Puzzle of Plant MicroRNAs.

    PubMed

    Reis, Rodrigo S; Eamens, Andrew L; Waterhouse, Peter M

    2015-11-01

    Plant microRNAs (miRNAs) are important regulatory switches. Recent advances have revealed many regulatory layers between the two essential processes, miRNA biogenesis and function. However, how these multilayered regulatory processes ultimately control miRNA gene regulation and connects miRNAs and plant responses with the surrounding environment is still largely unknown. In this opinion article, we propose that the miRNA pathway is highly dynamic and plastic. The apparent flexibility of the miRNA pathway in plants appears to be controlled by a number recently identified proteins and poorly characterized signaling cascades. We further propose that altered miRNA accumulation can be a direct consequence of the rewiring of interactions between proteins that function in the miRNA pathway, an avenue that remains largely unexplored. PMID:26442682

  1. Circular RNAs and systemic lupus erythematosus.

    PubMed

    Li, Lian-Ju; Huang, Qing; Pan, Hai-Feng; Ye, Dong-Qing

    2016-08-15

    Circular RNAs (circRNAs) are a large class of noncoding RNAs that form covalently closed RNA circles. The discovery of circRNAs discloses a new layer of gene regulation occurred post-transcriptionally. Identification of endogenous circRNAs benefits from the advance in high-throughput RNA sequencing and remains challenging. Many studies probing into the mechanisms of circRNAs formation occurred cotranscriptionally or posttranscriptionally emerge and conclude that canonical splicing mechanism, sequence properties, and certain regulatory factors are at play in the process. Although our knowledge on functions of circRNAs is rather limited, a few circRNAs are shown to sponge miRNA and regulate gene transcription. The clearest case is one circRNA CDR1as that serves as sponge of miR-7. Researches on circRNAs in human diseases such as cancers highlight the function and physical relevance of circRNAs. Given the implication of miRNAs in the initiation and progression of systemic lupus erythematosus (SLE) and the roles of circRNAs in sponging miRNA and gene regulation, it is appealing to speculate that circRNAs may associate with SLE and may be potential therapeutic targets for treatment of SLE. Future studies should attach more importance to the relationship between circRNAs and SLE. This review will concern identification, biogenesis, and function of circRNAs, introduce reports exploring the association of circRNAs with human diseases, and conjecture the potential roles of circRNAs in SLE. PMID:27450756

  2. Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs

    PubMed Central

    2009-01-01

    Background MicroRNAs (miRNAs) are a novel class of gene regulators whose biogenesis involves hairpin structures called precursor miRNAs, or pre-miRNAs. A pre-miRNA is processed to make a miRNA:miRNA* duplex, which is then separated to generate a mature miRNA and a miRNA*. The mature miRNAs play key regulatory roles during embryonic development as well as other cellular processes. They are also implicated in control of viral infection as well as innate immunity. Direct experimental evidence for mosquito miRNAs has been recently reported in anopheline mosquitoes based on small-scale cloning efforts. Results We obtained approximately 130, 000 small RNA sequences from the yellow fever mosquito, Aedes aegypti, by 454 sequencing of samples that were isolated from mixed-age embryos and midguts from sugar-fed and blood-fed females, respectively. We also performed bioinformatics analysis on the Ae. aegypti genome assembly to identify evidence for additional miRNAs. The combination of these approaches uncovered 98 different pre-miRNAs in Ae. aegypti which could produce 86 distinct miRNAs. Thirteen miRNAs, including eight novel miRNAs identified in this study, are currently only found in mosquitoes. We also identified five potential revisions to previously annotated miRNAs at the miRNA termini, two cases of highly abundant miRNA* sequences, 14 miRNA clusters, and 17 cases where more than one pre-miRNA hairpin produces the same or highly similar mature miRNAs. A number of miRNAs showed higher levels in midgut from blood-fed female than that from sugar-fed female, which was confirmed by northern blots on two of these miRNAs. Northern blots also revealed several miRNAs that showed stage-specific expression. Detailed expression analysis of eight of the 13 mosquito-specific miRNAs in four divergent mosquito genera identified cases of clearly conserved expression patterns and obvious differences. Four of the 13 miRNAs are specific to certain lineage(s) within mosquitoes. Conclusion

  3. Serum MicroRNAs as Diagnostic Biomarkers for Macrosomia

    PubMed Central

    Wen, Yang; Hu, Lingmin; Miao, Tingting; Zhang, Ming; Dong, Jing

    2015-01-01

    Background: Macrosomia is defined as an infant’s birth weight of more than 4000 g. Although microRNAs (miRNAs) have been implicated in the pathogenesis of various diseases, the associations between serum miRNAs and macrosomia have been rarely reported. Methodology: We used the Taqman Low Density Array followed by quantitative reverse transcriptase polymerase chain reaction assays to screen for miRNAs associated with macrosomia using serum samples collected 1 week before delivery. Results: Profiling results showed that 1 miRNA was significantly upregulated and 10 miRNAs were significantly downregulated in serum samples of macrosomia (ΔΔCt > 3-fold). The expression levels of miR-21 were significantly decreased in macrosomia as compared to the controls in the third trimester. Receiver operating characteristic (ROC) curve analyses showed that the area under the ROC curve for miR-21 was 67.7% (sensitivity = 66.7% and specificity = 70.0%). Conclusions: miR-21 in maternal serum is differentially expressed between macrosomia and controls, and miR-21 could be used as a candidate biomarker to predict macrosomia. PMID:25519717

  4. Noncanonical microRNAs and endogenous siRNAs in normal and psoriatic human skin

    PubMed Central

    Xia, Jing; Joyce, Cailin E.; Bowcock, Anne M.; Zhang, Weixiong

    2013-01-01

    Noncanonical microRNAs (miRNAs) and endogenous small interfering RNAs (endo-siRNAs) are key gene regulators in eukaryotes. Noncanonical miRNAs, which bypass part of the canonical miRNA biogenesis pathway, can originate from a variety of genomic loci, which include small nucleolar RNAs (snoRNAs), transfer RNAs (tRNAs) and introns, whereas endo-siRNAs can arise from repetitive elements, some of which are transposable. The roles of noncanonical miRNAs and endo-siRNAs in complex diseases have yet to be characterized. To investigate their potential expression and function in psoriasis, we carried out a comprehensive, genome-wide search for noncanonical miRNAs and endo-siRNAs in small RNA deep-sequencing data sets from normal and psoriatic human skin. By analyzing more than 670 million qualified reads from 67 small RNA libraries, we identified 21 novel, noncanonical miRNAs (3 snoRNA-derived and 2 tRNA-derived miRNAs and 16 miRtrons) and 39 novel endo-siRNAs that were expressed in skin. The expression of four novel small RNAs was validated by qRT–PCR in human skin, and their Argonaute association was confirmed by co-immunoprecipitation of ectopic small RNAs in HEK293 cells. Fifteen noncanonical miRNAs or endo-siRNAs were significantly differentially expressed in psoriatic-involved versus normal skin, including an Alu-short interspersed element-derived siRNA which was 17-fold up-regulated in psoriatic-involved skin. These and other differentially expressed small noncoding RNAs may function as regulators of gene expression in skin and potentially play a role in psoriasis pathogenesis. PMID:23175445

  5. Noncanonical microRNAs and endogenous siRNAs in normal and psoriatic human skin.

    PubMed

    Xia, Jing; Joyce, Cailin E; Bowcock, Anne M; Zhang, Weixiong

    2013-02-15

    Noncanonical microRNAs (miRNAs) and endogenous small interfering RNAs (endo-siRNAs) are key gene regulators in eukaryotes. Noncanonical miRNAs, which bypass part of the canonical miRNA biogenesis pathway, can originate from a variety of genomic loci, which include small nucleolar RNAs (snoRNAs), transfer RNAs (tRNAs) and introns, whereas endo-siRNAs can arise from repetitive elements, some of which are transposable. The roles of noncanonical miRNAs and endo-siRNAs in complex diseases have yet to be characterized. To investigate their potential expression and function in psoriasis, we carried out a comprehensive, genome-wide search for noncanonical miRNAs and endo-siRNAs in small RNA deep-sequencing data sets from normal and psoriatic human skin. By analyzing more than 670 million qualified reads from 67 small RNA libraries, we identified 21 novel, noncanonical miRNAs (3 snoRNA-derived and 2 tRNA-derived miRNAs and 16 miRtrons) and 39 novel endo-siRNAs that were expressed in skin. The expression of four novel small RNAs was validated by qRT-PCR in human skin, and their Argonaute association was confirmed by co-immunoprecipitation of ectopic small RNAs in HEK293 cells. Fifteen noncanonical miRNAs or endo-siRNAs were significantly differentially expressed in psoriatic-involved versus normal skin, including an Alu-short interspersed element-derived siRNA which was 17-fold up-regulated in psoriatic-involved skin. These and other differentially expressed small noncoding RNAs may function as regulators of gene expression in skin and potentially play a role in psoriasis pathogenesis. PMID:23175445

  6. Regulation of Small RNAs and Corresponding Targets in Nod Factor-Induced Phaseolus vulgaris Root Hair Cells.

    PubMed

    Formey, Damien; Martín-Rodríguez, José Ángel; Leija, Alfonso; Santana, Olivia; Quinto, Carmen; Cárdenas, Luis; Hernández, Georgina

    2016-01-01

    A genome-wide analysis identified the set of small RNAs (sRNAs) from the agronomical important legume Phaseolus vulgaris (common bean), including novel P. vulgaris-specific microRNAs (miRNAs) potentially important for the regulation of the rhizobia-symbiotic process. Generally, novel miRNAs are difficult to identify and study because they are very lowly expressed in a tissue- or cell-specific manner. In this work, we aimed to analyze sRNAs from common bean root hairs (RH), a single-cell model, induced with pure Rhizobium etli nodulation factors (NF), a unique type of signal molecule. The sequence analysis of samples from NF-induced and control libraries led to the identity of 132 mature miRNAs, including 63 novel miRNAs and 1984 phasiRNAs. From these, six miRNAs were significantly differentially expressed during NF induction, including one novel miRNA: miR-RH82. A parallel degradome analysis of the same samples revealed 29 targets potentially cleaved by novel miRNAs specifically in NF-induced RH samples; however, these novel miRNAs were not differentially accumulated in this tissue. This study reveals Phaseolus vulgaris-specific novel miRNA candidates and their corresponding targets that meet all criteria to be involved in the regulation of the early nodulation events, thus setting the basis for exploring miRNA-mediated improvement of the common bean-rhizobia symbiosis. PMID:27271618

  7. Regulation of Small RNAs and Corresponding Targets in Nod Factor-Induced Phaseolus vulgaris Root Hair Cells

    PubMed Central

    Formey, Damien; Martín-Rodríguez, José Ángel; Leija, Alfonso; Santana, Olivia; Quinto, Carmen; Cárdenas, Luis; Hernández, Georgina

    2016-01-01

    A genome-wide analysis identified the set of small RNAs (sRNAs) from the agronomical important legume Phaseolus vulgaris (common bean), including novel P. vulgaris-specific microRNAs (miRNAs) potentially important for the regulation of the rhizobia-symbiotic process. Generally, novel miRNAs are difficult to identify and study because they are very lowly expressed in a tissue- or cell-specific manner. In this work, we aimed to analyze sRNAs from common bean root hairs (RH), a single-cell model, induced with pure Rhizobium etli nodulation factors (NF), a unique type of signal molecule. The sequence analysis of samples from NF-induced and control libraries led to the identity of 132 mature miRNAs, including 63 novel miRNAs and 1984 phasiRNAs. From these, six miRNAs were significantly differentially expressed during NF induction, including one novel miRNA: miR-RH82. A parallel degradome analysis of the same samples revealed 29 targets potentially cleaved by novel miRNAs specifically in NF-induced RH samples; however, these novel miRNAs were not differentially accumulated in this tissue. This study reveals Phaseolus vulgaris-specific novel miRNA candidates and their corresponding targets that meet all criteria to be involved in the regulation of the early nodulation events, thus setting the basis for exploring miRNA-mediated improvement of the common bean–rhizobia symbiosis. PMID:27271618

  8. Microarray-based approach identifies microRNAs and their target functional patterns in polycystic kidney disease

    PubMed Central

    Pandey, Priyanka; Brors, Benedikt; Srivastava, Prashant K; Bott, Andrea; Boehn, Susanne NE; Groene, Herrmann-Josef; Gretz, Norbert

    2008-01-01

    Background MicroRNAs (miRNAs) play key roles in mammalian gene expression and several cellular processes, including differentiation, development, apoptosis and cancer pathomechanisms. Recently the biological importance of primary cilia has been recognized in a number of human genetic diseases. Numerous disorders are related to cilia dysfunction, including polycystic kidney disease (PKD). Although involvement of certain genes and transcriptional networks in PKD development has been shown, not much is known how they are regulated molecularly. Results Given the emerging role of miRNAs in gene expression, we explored the possibilities of miRNA-based regulations in PKD. Here, we analyzed the simultaneous expression changes of miRNAs and mRNAs by microarrays. 935 genes, classified into 24 functional categories, were differentially regulated between PKD and control animals. In parallel, 30 miRNAs were differentially regulated in PKD rats: our results suggest that several miRNAs might be involved in regulating genetic switches in PKD. Furthermore, we describe some newly detected miRNAs, miR-31 and miR-217, in the kidney which have not been reported previously. We determine functionally related gene sets, or pathways to reveal the functional correlation between differentially expressed mRNAs and miRNAs. Conclusion We find that the functional patterns of predicted miRNA targets and differentially expressed mRNAs are similar. Our results suggest an important role of miRNAs in specific pathways underlying PKD. PMID:19102782

  9. Serum Circulating MicroRNAs as Biomarkers of Osteoporotic Fracture.

    PubMed

    Panach, Layla; Mifsut, Damián; Tarín, Juan J; Cano, Antonio; García-Pérez, Miguel Ángel

    2015-11-01

    Osteoporosis is a common skeletal disorder characterized by increased risk of bone fracture (BF) due to fragility. BFs, particularly hip fracture, are a major concern in health care because of the associated morbidity and mortality, mainly in the elderly. Lately the involvement of epigenetic mechanisms in the pathophysiology of many diseases has been recognized. In this context, the identification of microRNAs (miRNAs) specific to BF should represent a substantial step forward in diagnostics and therapeutics. The present study aimed to identify specific miRNAs in osteoporotic BF patients compared to those in osteoarthritic controls. In the profiling stage, total RNA was extracted from serum, two pools were prepared, and then retro-transcribed in triplicate. Levels of 179 serum miRNAs were analyzed by real-time PCR, and 42 of them showed significance (P < 0.05), and 12 passed the false discovery rate test for multiple comparisons. Six miRNAs were selected for the replication stage and individually analyzed in sera from 15 BF patients and 12 controls. Results showed that 3 miRNAs (miR-122-5p, miR-125b-5p, and miR-21-5p) were valuable upregulated biomarkers in BF with respect to controls and, significantly, their levels were not affected by hemolysis. For miR-21-5p, the difference detected between groups was independent of age (P = 0.005) and its levels correlated to those of CTx (r = 0.76; P < 0.00001), a marker of bone resorption. In conclusion, several miRNAs may be biomarkers of BF, particularly miR-21-5p. Further studies are needed in order to better characterize the levels of these miRNAs in other bone diseases and to elucidate the mechanism involved in the association of these three miRNAs with osteoporotic BF. PMID:26163235

  10. MicroRNAs and Cardiovascular Diseases

    PubMed Central

    Ono, Koh; Kuwabara, Yasuhide; Han, Jiahuai

    2011-01-01

    MicroRNAs (miRNAs) are a class of small noncoding RNAs that have gained status as important regulators of gene expression. Recent studies have demonstrated that miRNAs are aberrantly expressed in the cardiovascular system under some pathological conditions. Gain- and loss-of-function studies using in vitro and in vivo models have revealed distinct roles for specific miRNAs in cardiovascular development and physiological function. The implications of miRNAs in cardiovascular disease have recently been recognized, representing the most rapidly evolving research field. In the present article, the currently relevant findings on the role of miRNAs in cardiac diseases will be updated and the target genes of these miRNAs are summarized. PMID:21395978

  11. MicroRNAs in Heart Development

    PubMed Central

    Espinoza-Lewis, Ramón A.; Wang, Da-Zhi

    2016-01-01

    MicroRNAs (miRNAs) are a class of small noncoding RNAs of ~22 nt in length which are involved in the regulation of gene expression at the posttranscriptional level by degrading their target mRNAs and/or inhibiting their translation. Expressed ubiquitously or in a tissue-specific manner, miRNAs are involved in the regulation of many biological processes such as cell proliferation, differentiation, apoptosis, and the maintenance of normal cellular physiology. Many miRNAs are expressed in embryonic, postnatal, and adult hearts. Aberrant expression or genetic deletion of miRNAs is associated with abnormal cardiac cell differentiation, disruption of heart development, and cardiac dysfunction. This chapter will summarize the history, biogenesis, and processing of miRNAs as well as their function in heart development, remodeling, and disease. PMID:22449848

  12. The expression and functional roles of microRNAs in stem cell differentiation.

    PubMed

    Shim, Jiwon; Nam, Jin-Wu

    2016-01-01

    microRNAs (miRNAs) are key regulators of cell state transition and retention during stem cell proliferation and differentiation by post-transcriptionally downregulating hundreds of conserved target genes via seed-pairing in their 3' untranslated region. In embryonic and adult stem cells, dozens of miRNAs that elaborately control stem cell processes by modulating the transcriptomic context therein have been identified. Some miRNAs accelerate the change of cell state into progenitor cell lineages-such as myoblast, myeloid or lymphoid progenitors, and neuro precursor stem cells-and other miRNAs decelerate the change but induce proliferative activity, resulting in cell state retention. This cell state choice can be controlled by endogenously or exogenously changing miRNA levels or by including or excluding target sites. This control of miRNA-mediated gene regulation could improve our understanding of stem cell biology and facilitate their development as therapeutic tools. PMID:26497582

  13. Structural analysis of aligned RNAs.

    PubMed

    Voss, Björn

    2006-01-01

    The knowledge about classes of non-coding RNAs (ncRNAs) is growing very fast and it is mainly the structure which is the common characteristic property shared by members of the same class. For correct characterization of such classes it is therefore of great importance to analyse the structural features in great detail. In this manuscript I present RNAlishapes which combines various secondary structure analysis methods, such as suboptimal folding and shape abstraction, with a comparative approach known as RNA alignment folding. RNAlishapes makes use of an extended thermodynamic model and covariance scoring, which allows to reward covariation of paired bases. Applying the algorithm to a set of bacterial trp-operon leaders using shape abstraction it was able to identify the two alternating conformations of this attenuator. Besides providing in-depth analysis methods for aligned RNAs, the tool also shows a fairly well prediction accuracy. Therefore, RNAlishapes provides the community with a powerful tool for structural analysis of classes of RNAs and is also a reasonable method for consensus structure prediction based on sequence alignments. RNAlishapes is available for online use and download at http://rna.cyanolab.de. PMID:17020924

  14. Novel Cadmium Responsive MicroRNAs in Daphnia pulex.

    PubMed

    Chen, Shuai; McKinney, Garrett J; Nichols, Krista M; Colbourne, John K; Sepúlveda, Maria S

    2015-12-15

    Daphnia pulex is a widely used toxicological model and is known for its sensitivity to cadmium (Cd). Recent research suggests that microRNAs (miRNAs) play a critical role in animal responses to heavy metals. To investigate the functions of D. pulex miRNAs under Cd exposure, we analyzed the miRNA profiles of D. pulex after 48 h using miRNA microarrays and validated our findings by q-PCR. miRNA dpu-let-7 was identified as a stably expressed gene and used as a reference. We identified 22 and 21 differentially expressed miRNAs under low (20 μg/L CdCl2) and high-exposure (40 μg/L CdCl2) concentrations compared to controls, respectively. Cellular functions of predicted miRNA target Cd-responsive genes included oxidative stress, ion transport, mitochondrial damage, and DNA repair. An insulin-related network was also identified in relation to several Cd-responsive miRNAs. The expression of three predicted target genes for miR-71 and miR-210 were evaluated, and expression of two of them (SCN2A and SLC31A1) was negatively correlated with the expression of their regulator miRNAs. We show miR-210 is hypoxia-responsive in D. pulex and propose Cd and hypoxia induce miR-210 via a same HIF1α modulated pathway. Collectively, this research advances our understanding on the role of miRNAs in response to heavy-metal exposure. PMID:26550707

  15. lncRNAs: Linking RNA to Chromatin

    PubMed Central

    Rinn, John L.

    2014-01-01

    Numerous studies over the past decade have identified increasing numbers of long noncoding RNAs (lncRNAs) across many organisms. Research since has shown that lncRNAs constitute an important layer of genome regulation in diverse biological processes and disease. Here, we discuss the common emerging theme of lncRNAs interfacing with epigenetic machinery. This, in turn, modulates the activity and localization of the epigenetic machinery during cell fate specification. PMID:25085913

  16. Turbine airfoil with a compliant outer wall

    DOEpatents

    Campbell, Christian X.; Morrison, Jay A.

    2012-04-03

    A turbine airfoil usable in a turbine engine with a cooling system and a compliant dual wall configuration configured to enable thermal expansion between inner and outer layers while eliminating stress formation in the outer layer is disclosed. The compliant dual wall configuration may be formed a dual wall formed from inner and outer layers separated by a support structure. The outer layer may be a compliant layer configured such that the outer layer may thermally expand and thereby reduce the stress within the outer layer. The outer layer may be formed from a nonplanar surface configured to thermally expand. In another embodiment, the outer layer may be planar and include a plurality of slots enabling unrestricted thermal expansion in a direction aligned with the outer layer.

  17. Differentially Expressed MicroRNAs in Maternal Plasma for the Noninvasive Prenatal Diagnosis of Down Syndrome (Trisomy 21)

    PubMed Central

    Moftah, Reham Fadl Hassan; Burow, Martin; Thiel, Gundula; Stuke-Sontheimer, Annegret; Chaoui, Rabih; Salama, Abdulgabar

    2014-01-01

    Objectives. Most developmental processes are under the control of small regulatory RNAs called microRNAs (miRNAs). We hypothesize that different fetal developmental processes might be reflected by extracellular miRNAs in maternal plasma and may be utilized as biomarkers for the noninvasive prenatal diagnosis of chromosomal aneuploidies. In this proof-of-concept study, we report on the identification of extracellular miRNAs in maternal plasma of Down syndrome (DS) pregnancies. Methods. Using high-throughput quantitative PCR (HT-qPCR), 1043 miRNAs were investigated in maternal plasma via comparison of seven DS pregnancies with age and fetal sex matched controls. Results. Six hundred and ninety-five miRNAs were identified. Thirty-six significantly differentially expressed mature miRNAs were identified as potential biomarkers. Hierarchical cluster analysis of these miRNAs resulted in the clear discrimination of DS from euploid pregnancies. Gene targets of the differentially expressed miRNAs were enriched in signaling pathways such as mucin type-O-glycans, ECM-receptor interactions, TGF-beta, and endocytosis, which have been previously associated with DS. Conclusions. miRNAs are promising and stable biomarkers for a broad range of diseases and may allow a reliable, cost-efficient diagnostic tool for the noninvasive prenatal diagnosis of DS. PMID:25478570

  18. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  19. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  20. mRNAs Hit a Sticky Wicket.

    PubMed

    Voronina, Ekaterina

    2016-04-01

    Drosophila germ cell specification depends on localization of mRNAs required for patterning to the posterior of the oocyte during oogenesis. In a recent issue of Nature, Vourekas et al. (2016) suggest that Aubergine in complex with piRNAs may provide a low-specificity anchoring mechanism for posterior mRNAs. PMID:27046827

  1. Virus-encoded microRNAs

    PubMed Central

    Grundhoff, Adam; Sullivan, Christopher S.

    2011-01-01

    microRNAs (miRNAs) are the subject of enormous interest. They are small non-coding RNAs that play a regulatory role in numerous and diverse cellular processes such as immune function, apoptosis and tumorigenesis. Several virus families have been shown to encode miRNAs, and an appreciation for their roles in the viral infectious cycle continues to grow. Despite the identification of numerous (>225) viral miRNAs, an in depth functional understanding of most virus-encoded miRNAs is lacking. Here we focus on a few viral miRNAs with well-defined functions. We use these examples to extrapolate general themes of viral miRNA activities including autoregulation of gene expression, avoidance of host defenses, and a likely important role in maintaining latent and persistent infections. We hypothesize that although the molecular mechanisms and machinery are similar, the majority of viral miRNAs may utilize a target strategy that differs from host miRNAs. That is, many viral miRNAs may have evolved to regulate viral-encoded transcripts or networks of host genes that are unique to viral miRNAs. Included in this latter category are a likely abundant class of viral miRNAs that may regulate only one or a few principal host genes. Key steps forward for the field are discussed, including the need for additional functional studies that utilize surgical viral miRNA mutants combined with relevant models of infection. PMID:21277611

  2. Detection of small RNAs in Xylella fastidiosa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Non-coding small RNAs (sRNAs) are regarded as ubiquitous regulatory elements in bacteria. For Xylella fastidiosa, a plant pathogen causing many economically important crop diseases, research attention to sRNAs has been limited. With the availability of whole genome sequences and increasing bioinfor...

  3. Sizing up long non-coding RNAs: do lncRNAs have secondary and tertiary structure?

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2012-01-01

    Long noncoding RNAs (lncRNAs) play a key role in many important areas of epigenetics, stem cell biology, cancer, signaling and brain function. This emerging class of RNAs constitutes a large fraction of the transcriptome, with thousands of new lncRNAs reported each year. The molecular mechanisms of these RNAs are not well understood. Currently, very little structural data exist. We review the available lncRNA sequence and secondary structure data. Since almost no tertiary information is available for lncRNAs, we review crystallographic structures for other RNA systems and discuss the possibilities for lncRNAs in the context of existing constraints. PMID:23267412

  4. Physics of the outer heliosphere

    SciTech Connect

    Gazis, P.R. )

    1991-01-01

    Major advances in the physics of the outer heliosphere are reviewed for the 1987-1990 time frame. Emphasis is placed on five broad topics: the detailed structure of the solar wind at large heliocentric distances, the global structure of the interplanetary field, latidudinal variations and meridional flows, radial and temporal variations, and the interaction of the solar wind with the local interstellar medium. 122 refs.

  5. Origin of Outer Solar System

    NASA Technical Reports Server (NTRS)

    Holman, Matthew J.; Boyce, J. (Technical Monitor)

    2003-01-01

    We feel that at the present moment the available theoretical models of the Kuiper belt are still in advance of the data, and thus our main task has been to conduct observational work guided by theoretical motivations. Our efforts over the past year can be divided into four categories: A) Wide-field Searches for Kuiper Belt Objects; B) Pencil-beam Searches for Kuiper Belt Objects; C) Wide-field Searches for Moons of the Outer Planets; D) Pencil-beam Searches for Faint Uranian and Neptunian Moons; E) Recovery Observations. As of April 2002, we have conducted several searches for Kuiper belt objects using large-format mosaic CCD camera on 4-meter class telescopes. In May 1999, we used the Kitt Peak 4-meter with the NOAO Mosaic camera we attempted a search for KBOs at a range of ecliptic latitudes. In addition to our wide-field searches, we have conducted three 'pencil-beam' searches in the past year. In a pencil-beam search we take repeated integrations of the same field throughout a night. After preprocessing the resulting images we shift and recombine them along a range of rates and directions consistent with the motion of KBOs. Stationary objects then smear out, while objects moving at near the shift rate appear as point sources. In addition to our searches for Kuiper belt objects, we are completing the inventory of the outer solar system by search for faint satellites of the outer planets. In August 2001 we conducted pencil beam searches for faint Uranian and Neptunian satellites at CFHT and CTIO. These searches resulted in the discover of two Neptunian and four Uranian satellite candidates. The discovery of Kuiper belt objects and outer planet satellites is of little use if the discoveries are not followed by systematic, repeated astrometric observations that permit reliable estimates of their orbits.

  6. 76 FR 54787 - Outer Continental Shelf Official Protraction Diagram, Lease Maps, and Supplemental Official Outer...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-02

    ... Bureau of Ocean Energy Management, Regulation and Enforcement Outer Continental Shelf Official Protraction Diagram, Lease Maps, and Supplemental Official Outer Continental Shelf Block Diagrams AGENCY... revised North American Datum of 1927 (NAD 27) Outer Continental Shelf Official Protraction Diagram,...

  7. 76 FR 2919 - Outer Continental Shelf Official Protraction Diagram and Supplemental Official Outer Continental...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-18

    ... Bureau of Ocean Energy Management, Regulation and Enforcement Outer Continental Shelf Official Protraction Diagram and Supplemental Official Outer Continental Shelf Block Diagrams AGENCY: Bureau of Ocean... American Datum of 1983 (NAD 83) Outer Continental Shelf Official Protraction Diagram and...

  8. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana

    PubMed Central

    Rajagopalan, Ramya; Vaucheret, Hervé; Trejo, Jerry; Bartel, David P.

    2006-01-01

    To better understand the diversity of small silencing RNAs expressed in plants, we employed high-throughput pyrosequencing to obtain 887,000 reads corresponding to Arabidopsis thaliana small RNAs. They represented 340,000 unique sequences, a substantially greater diversity than previously obtained in any species. Most of the small RNAs had the properties of heterochromatic small interfering RNAs (siRNAs) associated with DNA silencing in that they were preferentially 24 nucleotides long and mapped to intergenic regions. Their density was greatest in the proximal and distal pericentromeric regions, with only a slightly preferential propensity to match repetitive elements. Also present were 38 newly identified microRNAs (miRNAs) and dozens of other plausible candidates. One miRNA mapped within an intron of DICER-LIKE 1 (DCL1), suggesting a second homeostatic autoregulatory mechanism for DCL1 expression; another defined the phase for siRNAs deriving from a newly identified trans-acting siRNA gene (TAS4); and two depended on DCL4 rather than DCL1 for their accumulation, indicating a second pathway for miRNA biogenesis in plants. More generally, our results revealed the existence of a layer of miRNA-based control beyond that found previously that is evolutionarily much more fluid, employing many newly emergent and diverse miRNAs, each expressed in specialized tissues or at low levels under standard growth conditions. PMID:17182867

  9. Long noncoding RNAs in prostate cancer: mechanisms and applications

    PubMed Central

    Li, Chunlai; Yang, Liuqing; Lin, Chunru

    2014-01-01

    A large proportion of the control of gene expression in humans is mediated by noncoding elements in the genome. Long noncoding RNAs (lncRNAs) have emerged as a new class of pivotal regulatory components, orchestrating extensive cellular processes and connections. LncRNAs play various roles from chromatin modification to alternative splicing and post-transcriptional processing and are involved in almost all aspects of eukaryotic regulation. LncRNA-based mechanisms modulate cell fates during development, and their dysregulation underscores many human disorders, especially cancer, through chromosomal translocation, deletion, and nucleotide expansions. Recent studies demonstrate that multiple prostate cancer risk loci are associated with lncRNAs and that ectopic expression of these transcripts triggers a cascade of cellular events driving tumor initiation and progression. The recent increased rate of discovery of lncRNAs has been leveraged for application in clinical strategies such as novel biomarkers and therapeutic targets. Despite this potential, many issues remain to be addressed in this fast-growing field. PMID:27308347

  10. Small regulatory RNAs in Streptococcus pneumoniae: discovery and biological functions

    PubMed Central

    Wilton, Joana; Acebo, Paloma; Herranz, Cristina; Gómez, Alicia; Amblar, Mónica

    2015-01-01

    Streptococcus pneumoniae is a prominent human pathogen responsible for many severe diseases and the leading cause of childhood mortality worldwide. The pneumococcus is remarkably adept at colonizing and infecting different niches in the human body, and its adaptation to dynamic host environment is a central aspect of its pathogenesis. In the last decade, increasing findings have evidenced small RNAs (sRNAs) as vital regulators in a number of important processes in bacteria. In S. pneumoniae, a small antisense RNA was first discovered in the pMV158 plasmid as a copy number regulator. More recently, genome-wide screens revealed that the pneumococcal genome also encodes multiple sRNAs, many of which have important roles in virulence while some are implicated in competence control. The knowledge of the sRNA-mediated regulation in pneumococcus remains very limited, and future research is needed for better understanding of functions and mechanisms. Here, we provide a comprehensive summary of the current knowledge on sRNAs from S. pneumoniae, focusing mainly on the trans-encoded sRNAs. PMID:25904932

  11. Noncoding RNAs and neurobehavioral mechanisms in psychiatric disease

    PubMed Central

    Dwivedi, Yogesh

    2015-01-01

    The human genome project has revolutionized our understanding of the underlying mechanisms in psychiatric disease. It is now abundantly clear that neurobehavioral phenotypes are epigenetically controlled by noncoding RNAs (ncRNAs). The microRNA (miRNA) class of ncRNAs are ubiquitously expressed throughout the brain and govern all major neuronal pathways. The attractive therapeutic potential of miRNAs is underscored by their pleiotropic capacities, putatively targeting multiple pathways within a single neuron. Many psychiatric diseases stem from a multi-factorial origin, thus conventional drug targeting of single proteins may not prove most effective. In this exciting post-genome sequencing era, many new epigenetic targets are emerging for therapeutic investigation. Here we review the reported roles of miRNAs, as well as other ncRNA classes, in the pathology of psychiatric disorders; there are both common and unique ncRNA mechanisms that influence the various diagnoses. Collectively, these potent epigenetic regulators may clarify the disrupted signaling networks in psychiatric phenotypes. PMID:25824307

  12. Characterization of a set of tumor suppressor microRNAs in T cell acute lymphoblastic leukemia.

    PubMed

    Sanghvi, Viraj R; Mavrakis, Konstantinos J; Van der Meulen, Joni; Boice, Michael; Wolfe, Andrew L; Carty, Mark; Mohan, Prathibha; Rondou, Pieter; Socci, Nicholas D; Benoit, Yves; Taghon, Tom; Van Vlierberghe, Pieter; Leslie, Christina S; Speleman, Frank; Wendel, Hans-Guido

    2014-11-18

    The posttranscriptional control of gene expression by microRNAs (miRNAs) is highly redundant, and compensatory effects limit the consequences of the inactivation of individual miRNAs. This implies that only a few miRNAs can function as effective tumor suppressors. It is also the basis of our strategy to define functionally relevant miRNA target genes that are not under redundant control by other miRNAs. We identified a functionally interconnected group of miRNAs that exhibited a reduced abundance in leukemia cells from patients with T cell acute lymphoblastic leukemia (T-ALL). To pinpoint relevant target genes, we applied a machine learning approach to eliminate genes that were subject to redundant miRNA-mediated control and to identify those genes that were exclusively targeted by tumor-suppressive miRNAs. This strategy revealed the convergence of a small group of tumor suppressor miRNAs on the Myb oncogene, as well as their effects on HBP1, which encodes a transcription factor. The expression of both genes was increased in T-ALL patient samples, and each gene promoted the progression of T-ALL in mice. Hence, our systematic analysis of tumor suppressor miRNA action identified a widespread mechanism of oncogene activation in T-ALL. PMID:25406379

  13. microRNAs: Implications for Air Pollution Research

    EPA Science Inventory

    The purpose of this review is to provide an update of the current understanding on the role of microRNAs in mediating genetic responses to air pollutants and to contemplate on how these responses ultimately control susceptibility to ambient air pollution. Morbidity and mortality ...

  14. The Role of microRNAs in Animal Cell Reprogramming.

    PubMed

    Cruz-Santos, María Concepción; Aragón-Raygoza, Alejandro; Espinal-Centeno, Annie; Arteaga-Vázquez, Mario; Cruz-Hernández, Andrés; Bako, Laszlo; Cruz-Ramírez, Alfredo

    2016-07-15

    Our concept of cell reprogramming and cell plasticity has evolved since John Gurdon transferred the nucleus of a completely differentiated cell into an enucleated Xenopus laevis egg, thereby generating embryos that developed into tadpoles. More recently, induced expression of transcription factors, oct4, sox2, klf4, and c-myc has evidenced the plasticity of the genome to change the expression program and cell phenotype by driving differentiated cells to the pluripotent state. Beyond these milestone achievements, research in artificial cell reprogramming has been focused on other molecules that are different than transcription factors. Among the candidate molecules, microRNAs (miRNAs) stand out due to their potential to control the levels of proteins that are involved in cellular processes such as self-renewal, proliferation, and differentiation. Here, we review the role of miRNAs in the maintenance and differentiation of mesenchymal stem cells, epimorphic regeneration, and somatic cell reprogramming to induced pluripotent stem cells. PMID:27224014

  15. Experimental RNomics and genomic comparative analysis reveal a large group of species-specific small non-message RNAs in the silkworm Bombyx mori

    PubMed Central

    Li, Dandan; Wang, Yanhong; Zhang, Kun; Jiao, Zhujin; Zhu, Xiaopeng; Skogerboe, Geir; Guo, Xiangqian; Chinnusamy, Viswanathan; Bi, Lijun; Huang, Yongping; Dong, Shuanglin; Chen, Runsheng; Kan, Yunchao

    2011-01-01

    Accumulating evidences show that small non-protein coding RNAs (ncRNAs) play important roles in development, stress response and other cellular processes. The silkworm is an important model for studies on insect genetics and control of lepidopterous pests. Here, we have performed the first systematic identification and analysis of intermediate size ncRNAs (50–500 nt) in the silkworm. We identified 189 novel ncRNAs, including 141 snoRNAs, six snRNAs, three tRNAs, one SRP and 38 unclassified ncRNAs. Forty ncRNAs showed significantly altered expression during silkworm development or across specific stage transitions. Genomic comparisons revealed that 123 of these ncRNAs are potentially silkworm-specific. Analysis of the genomic organization of the ncRNA loci showed that 32.62% of the novel snoRNA loci are intergenic, and that all the intronic snoRNAs follow the pattern of one-snoRNA-per-intron. Target site analysis predicted a total of 95 2′-O-methylation and pseudouridylation modification sites of rRNAs, snRNAs and tRNAs. Together, these findings provide new clues for future functional study of ncRNA during insect development and evolution. PMID:21227919

  16. MicroRNAs in Autoimmune Diseases

    PubMed Central

    Qu, Zigang; Li, Wenhui; Fu, Baoquan

    2014-01-01

    Autoimmune diseases (ADs) are featured by body's immune responses being directed towards its own specific target organs or multiple organ systems, causing persistent inflammation and consequent tissue damage. miRNAs are small noncoding RNAs in a size of approximately 22 nt that play important regulatory roles in many organisms by cleavage or translational inhibition of targeted mRNAs. Many miRNAs are reported to be differentially expressed in ADs and may play a pivotal role in regulating immune responses and autoimmunity. In this review, current research progress in the miRNAs in ADs was elucidated. PMID:24991561

  17. LncRNAs in Stem Cells

    PubMed Central

    Hu, Shanshan; Shan, Ge

    2016-01-01

    Noncoding RNAs are critical regulatory factors in essentially all forms of life. Stem cells occupy a special position in cell biology and Biomedicine, and emerging results show that multiple ncRNAs play essential roles in stem cells. We discuss some of the known ncRNAs in stem cells such as embryonic stem cells, induced pluripotent stem cells, mesenchymal stem cells, adult stem cells, and cancer stem cells with a focus on long ncRNAs. Roles and functional mechanisms of these lncRNAs are summarized, and insights into current and future studies are presented. PMID:26880946

  18. An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes.

    PubMed

    Arikit, Siwaret; Xia, Rui; Kakrana, Atul; Huang, Kun; Zhai, Jixian; Yan, Zhe; Valdés-López, Oswaldo; Prince, Silvas; Musket, Theresa A; Nguyen, Henry T; Stacey, Gary; Meyers, Blake C

    2014-12-01

    Small RNAs are ubiquitous, versatile repressors and include (1) microRNAs (miRNAs), processed from mRNA forming stem-loops; and (2) small interfering RNAs (siRNAs), the latter derived in plants by a process typically requiring an RNA-dependent RNA polymerase. We constructed and analyzed an expression atlas of soybean (Glycine max) small RNAs, identifying over 500 loci generating 21-nucleotide phased siRNAs (phasiRNAs; from PHAS loci), of which 483 overlapped annotated protein-coding genes. Via the integration of miRNAs with parallel analysis of RNA end (PARE) data, 20 miRNA triggers of 127 PHAS loci were detected. The primary class of PHAS loci (208 or 41% of the total) corresponded to NB-LRR genes; some of these small RNAs preferentially accumulate in nodules. Among the PHAS loci, novel representatives of TAS3 and noncanonical phasing patterns were also observed. A noncoding PHAS locus, triggered by miR4392, accumulated preferentially in anthers; the phasiRNAs are predicted to target transposable elements, with their peak abundance during soybean reproductive development. Thus, phasiRNAs show tremendous diversity in dicots. We identified novel miRNAs and assessed the veracity of soybean miRNAs registered in miRBase, substantially improving the soybean miRNA annotation, facilitating an improvement of miRBase annotations and identifying at high stringency novel miRNAs and their targets. PMID:25465409

  19. The evolution of RNAs with multiple functions.

    PubMed

    Dinger, Marcel E; Gascoigne, Dennis K; Mattick, John S

    2011-11-01

    Increasing numbers of transcripts have been reported to transmit both protein-coding and regulatory information. Apart from challenging our conception of the gene, this observation raises the question as to what extent this phenomenon occurs across the genome and how and why such dual encoding of function has evolved in the eukaryotic genome. To address this question, we consider the evolutionary path of genes in the earliest forms of life on Earth, where it is generally regarded that proteins evolved from a cellular machinery based entirely within RNA. This led to the domination of protein-coding genes in the genomes of microorganisms, although it is likely that RNA never lost its other capacities and functionalities, as evidenced by cis-acting riboswitches and UTRs. On the basis that the subsequent evolution of a more sophisticated regulatory architecture to provide higher levels of epigenetic control and accurate spatiotemporal expression in developmentally complex organisms is a complicated task, we hypothesize: (i) that mRNAs have been and remain subject to secondary selection to provide trans-acting regulatory capability in parallel with protein-coding functions; (ii) that some and perhaps many protein-coding loci, possibly as a consequence of gene duplication, have lost protein-coding functions en route to acquiring more sophisticated trans-regulatory functions; (iii) that many transcripts have become subject to secondary processing to release different products; and (iv) that novel proteins have emerged within loci that previously evolved functionality as regulatory RNAs. In support of the idea that there is a dynamic flux between different types of informational RNAs in both evolutionary and real time, we review recent observations that have arisen from transcriptomic surveys of complex eukaryotes and reconsider how these observations impact on the notion that apparently discrete loci may express transcripts with more than one function. In conclusion, we

  20. Geometrical interpretation for the outer SU(3) outer multiplicity label

    NASA Technical Reports Server (NTRS)

    Draayer, Jerry P.; Troltenier, D.

    1995-01-01

    A geometrical interpretation for the outer multiplicity rho that occurs in a reduction of the product of two SU(3) representations, (lambda(sub pi), mu(sub pi)) x (lambda(sub nu), mu(sub nu)) approaches sigma(sub rho)(lambda, mu)(sub rho), is introduced. This coupling of proton (pi) and neutron (nu) representations arises, for example, in both boson and fermion descriptions of heavy deformed nuclei. Attributing a geometry to the coupling raises the possibility of introducing a simple interaction that provides a physically meaningful way for distinguishing multiple occurrences of (lambda, mu) values that can arise in such products.

  1. Noncoding RNAs in gastric cancer: Research progress and prospects

    PubMed Central

    Zhang, Meng; Du, Xiang

    2016-01-01

    Noncoding RNAs (ncRNAs) have attracted much attention in cancer research field. They are involved in cellular development, proliferation, differentiation and apoptosis. The dysregulation of ncRNAs has been reported in tumor initiation, progression, invasion and metastasis in various cancers, including gastric cancer (GC). In the past few years, an accumulating body of evidence has deepened our understanding of ncRNAs, and several emerging ncRNAs have been identified, such as PIWI-interacting RNAs (piRNAs) and circular RNAs (circRNAs). The competing endogenous RNA (ceRNA) networks include mRNAs, microRNAs, long ncRNAs (lncRNAs) and circRNAs, which play critical roles in the tumorigenesis of GC. This review summarizes the recent hotspots of ncRNAs involved in GC pathobiology and their potential applications in GC. Finally, we briefly discuss the advances in the ceRNA network in GC. PMID:27547004

  2. Micro RNAs: an arguable appraisal in medicine.

    PubMed

    Voglova, K; Bezakova, J; Herichova, Iveta

    2016-04-01

    Micro RNAs (miRNAs) represent a newly discovered class of regulatory molecules in the human body. miRNA is a short double stranded RNA sequence interfering with mRNA, causing in most cases, inhibition of translation. Synthesis of miRNAs shows an increasing developmental pattern and postnatally miRNAs are synthesized in all cells possessing transcriptional machinery. miRNAs usually target several mRNAs and therefore conclusive evidences proving their functions are not always ease to be acquired. In spite of this difficulty, functions of miRNAs were firmly established in the development, the cardiovascular and neural diseases, and cancer. Many miRNAs have been reported to be associated with physiological state of cells and/or tissues. This finding becomes fundamental, especially when consider that these miRNAs can be released from cell into intracellular space or circulation. Correlation between miRNA production in tissues and its contribution to multisource miRNA pool in the circulation is in a focus of biomarker-oriented researchers. Recently, circulating miRNAs have been suggested to be applicable as biomarkers in several types of cancer, cardiovascular injury, and diabetes. Role of miRNAs in the organism intercellular signaling is still under the broad investigation. Several miRNA mimics, intended for treatment of disease, are being currently tested in the clinical trials. PMID:27560641

  3. Identification of circulating microRNAs for the differential diagnosis of Parkinson's disease and Multiple System Atrophy

    PubMed Central

    Vallelunga, Annamaria; Ragusa, Marco; Di Mauro, Stefania; Iannitti, Tommaso; Pilleri, Manuela; Biundo, Roberta; Weis, Luca; Di Pietro, Cinzia; De Iuliis, Angela; Nicoletti, Alessandra; Zappia, Mario; Purrello, Michele; Antonini, Angelo

    2014-01-01

    Background: Parkinson's disease (PD) is a progressive neurodegenerative disorder which may be misdiagnosed with atypical conditions such as Multiple System Atrophy (MSA), due to overlapping clinical features. MicroRNAs (miRNAs) are small non-coding RNAs with a key role in post-transcriptional gene regulation. We hypothesized that identification of a distinct set of circulating miRNAs (cmiRNAs) could distinguish patients affected by PD from MSA and healthy individuals. Results. Using TaqMan Low Density Array technology, we analyzed 754 miRNAs and found 9 cmiRNAs differentially expressed in PD and MSA patients compared to healthy controls. We also validated a set of 4 differentially expressed cmiRNAs in PD and MSA patients vs. controls. More specifically, miR-339-5p was downregulated, whereas miR-223*, miR-324-3p, and mir-24 were upregulated in both diseases. We found cmiRNAs specifically deregulated in PD (downregulation of miR-30c and miR-148b) and in MSA (upregulation of miR-148b). Finally, comparing MSA and PD, we identified 3 upregulated cmiRNAs in MSA serum (miR-24, miR-34b, miR-148b). Conclusions. Our results suggest that cmiRNA signatures discriminate PD from MSA patients and healthy controls and may be considered specific, non-invasive biomarkers for differential diagnosis. PMID:24959119

  4. Proteome analysis of mitochondrial outer membrane from Neurospora crassa

    SciTech Connect

    Schmitt, Simone; Prokisch, Holger; Schlunk, Tilman; Camp, David G.; Ahting, Uwe; Waizenegger, Thomas; Scharfe, Curt M.; Meitinger, Thomas; Imhof, Axel; Neupert, Walter; Oefner, Peter J.; Rapaport, Doron

    2006-01-01

    The mitochondrial outer membrane mediates numerous interactions between the metabolic and genetic systems of mitochondria and the rest of the eukaryotic cell. We performed a proteomic study to discover novel functions of components of the mitochondrial outer membrane. Proteins of highly pure outer membrane vesicles (OMV) from Neurospora crassa were identified by a combination of liquid chromatography tandem mass spectrometry of tryptic peptide digests and gel electrophoresis of solubilized OMV proteins, followed by their identification using MALDI-MS peptide fingerprinting. Among the 30 proteins found in at least three of four separate analyses were 23 proteins with known functions in the outer membrane. These included components of the import machinery (the TOM and TOB complexes), a pore-forming component (Porin), and proteins that control fusion and fission of the organelle. In addition, proteins playing a role in various biosynthetic pathways, whose intracellular location had not been established previously, could be localized to the mitochondrial outer membrane. Thus, the proteome of the outer membrane can help in identifying new mitochondria-related functions.

  5. Infectious long non-coding RNAs.

    PubMed

    Katsarou, Konstantina; Rao, A L N; Tsagris, Mina; Kalantidis, Kriton

    2015-10-01

    Long non protein coding RNAs (lncRNAs) constitute a large category of the RNA world, able to regulate different biological processes. In this review we are focusing on infectious lncRNAs, their classification, pathogenesis and impact on the infected organisms. Here they are presented in two separate groups: 'dependent lncRNAs' (comprising satellites RNA, Hepatitis D virus and lncRNAs of viral origin) which need a helper virus and 'independent lncRNAs' (viroids) that can self-replicate. Even though these lncRNA do not encode any protein, their structure and/or sequence comprise all the necessary information to drive specific interactions with host factors and regulate several cellular functions. These new data that have emerged during the last few years concerning lncRNAs modify the way we understand molecular biology's 'central dogma' and give new perspectives for applications and potential therapeutic strategies. PMID:25986218

  6. Circular RNAs: diversity of form and function.

    PubMed

    Lasda, Erika; Parker, Roy

    2014-12-01

    It is now clear that there is a diversity of circular RNAs in biological systems. Circular RNAs can be produced by the direct ligation of 5' and 3' ends of linear RNAs, as intermediates in RNA processing reactions, or by "backsplicing," wherein a downstream 5' splice site (splice donor) is joined to an upstream 3' splice site (splice acceptor). Circular RNAs have unique properties including the potential for rolling circle amplification of RNA, the ability to rearrange the order of genomic information, protection from exonucleases, and constraints on RNA folding. Circular RNAs can function as templates for viroid and viral replication, as intermediates in RNA processing reactions, as regulators of transcription in cis, as snoRNAs, and as miRNA sponges. Herein, we review the breadth of circular RNAs, their biogenesis and metabolism, and their known and anticipated functions. PMID:25404635

  7. Roles of small RNAs in tumor formation

    PubMed Central

    Di Leva, Gianpiero; Croce, Carlo M.

    2010-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that act as post-transcriptional repressors of gene expression in organisms ranging from plants to humans. A widespread role for miRNAs in diverse molecular processes driving initiation and progression of various tumor types has recently been described. In this review, we discuss the etiology of aberrant expression of miRNAs in human cancers and their role in tumor metastasis, which may define miRNAs as oncogenes or tumor suppressors. Moreover, we highlight the genomic/epigenetic alterations and transcriptional/post-transcriptional mechanisms associated with misexpression of miRNAs in cancer. A better understanding of miRNA biology may ultimately yield further insight into the molecular mechanisms of tumorigenesis and new therapeutic strategies against cancer. PMID:20493775

  8. Noncanonical MicroRNAs and Endogenous siRNAs in Lytic Infection of Murine Gammaherpesvirus

    PubMed Central

    Xia, Jing; Zhang, Weixiong

    2012-01-01

    MicroRNA (miRNA) and endogenous small interfering RNA (endo-siRNA) are two essential classes of small noncoding RNAs (sncRNAs) in eukaryotes. The class of miRNA is diverse and there exist noncanonical miRNAs that bypass the canonical miRNA biogenesis pathway. In order to identify noncanonical miRNAs and endo-siRNAs responding to virus infection and study their potential function, we sequenced small-RNA species from cells lytically infected with murine gammaherpesvirus 68 (MHV68). In addition to three novel canonical miRNAs in mouse, two antisense miRNAs in virus and 25 novel noncanonical miRNAs, including miRNAs derived from transfer RNAs, small nucleolar RNAs and introns, in the host were identified. These noncanonical miRNAs exhibited features distinct from that of canonical miRNAs in lengths of hairpins, base pairings and first nucleotide preference. Many of the novel miRNAs are conserved in mammals. Besides several known murine endo-siRNAs detected by the sequencing profiling, a novel locus in the mouse genome was identified to produce endo-siRNAs. This novel endo-siRNA locus is comprised of two tandem inverted B4 short interspersed nuclear elements (SINEs). Unexpectedly, the SINE-derived endo-siRNAs were found in a variety of sequencing data and virus-infected cells. Moreover, a murine miRNA was up-regulated more than 35 fold in infected than in mock-treated cells. The putative targets of the viral and the up-regulated murine miRNAs were potentially involved in processes of gene transcription and protein phosphorylation, and localized to membranes, suggesting their potential role in manipulating the host basal immune system during lytic infection. Our results extended the number of noncanonical miRNAs in mammals and shed new light on their potential functions of lytic infection of MHV68. PMID:23110115

  9. Interaction of long noncoding RNAs and microRNAs in the pathogenesis of idiopathic pulmonary fibrosis.

    PubMed

    Huang, Chaoqun; Yang, Ye; Liu, Lin

    2015-10-01

    Long noncoding RNAs (lncRNAs) are transcribed RNAs with more than 200 nucleotides in length. A growing body of evidence supports the notion that lncRNAs act as competitive endogenous RNAs for microRNAs and play roles in physiological and pathological processes. Several studies have demonstrated the roles of microRNAs in the pathogenesis of idiopathic pulmonary fibrosis (IPF). However, it is unknown whether lncRNAs are involved in IPF. To investigate the roles of lncRNAs in IPF, we determined the interaction of lncRNAs and microRNAs by motif search and manual comparison. The sequences of the dysregulated microRNAs in IPF including miR-21, miR-31, miR-101, miR-29, miR-199, and let-7d were used to search NONCODE database containing 33,829 human lncRNAs. A total of 34 lncRNAs with potential binding sites to these microRNAs were identified. We then examined the expression levels of the identified lncRNAs in the lungs of IPF patients by real-time PCR. Of 34 lncRNAs, nine lncRNAs were dysregulated in the IPF lungs. Four of them were inversely correlated to the microRNA expression in IPF. Further studies revealed that silencing the lncRNA CD99 molecule pseudogene 1 (CD99P1) inhibited proliferation and α-smooth muscle actin expression of lung fibroblasts, while knockdown of the lncRNA n341773 increased collagen expression in lung fibroblasts. These results suggest that CD99P1 and n341773 may be involved in the regulation of lung fibroblast proliferation and differentiation. The identification of regulatory functions of lncRNAs in lung fibroblasts may provide new research directions for the therapy of IPF. PMID:26269497

  10. Genome-wide profiling of transfer RNAs and their role as novel prognostic markers for breast cancer.

    PubMed

    Krishnan, Preethi; Ghosh, Sunita; Wang, Bo; Heyns, Mieke; Li, Dongping; Mackey, John R; Kovalchuk, Olga; Damaraju, Sambasivarao

    2016-01-01

    Transfer RNAs (tRNAs, key molecules in protein synthesis) have not been investigated as potential prognostic markers in breast cancer (BC), despite early findings of their dysregulation and diagnostic potential. We aim to comprehensively profile tRNAs from breast tissues and to evaluate their role as prognostic markers (Overall Survival, OS and Recurrence Free Survival, RFS). tRNAs were profiled from 11 normal breast and 104 breast tumor tissues using next generation sequencing. We adopted a Case-control (CC) and Case-Only (CO) association study designs. Risk scores constructed from tRNAs were subjected to univariate and multivariate Cox-proportional hazards regression to investigate their prognostic value. Of the 571 tRNAs profiled, 76 were differentially expressed (DE) and three were significant for OS in the CC approach. We identified an additional 11 tRNAs associated with OS and 14 tRNAs as significant for RFS in the CO approach, indicating that CC alone may not capture all discriminatory tRNAs in prognoses. In both the approaches, the risk scores were significant in the multivariate analysis as independent prognostic factors, and patients belonging to high-risk group were associated with poor prognosis. Our results confirmed global up-regulation of tRNAs in BC and identified tRNAs as potential novel prognostic markers for BC. PMID:27604545

  11. Genome-wide profiling of transfer RNAs and their role as novel prognostic markers for breast cancer

    PubMed Central

    Krishnan, Preethi; Ghosh, Sunita; Wang, Bo; Heyns, Mieke; Li, Dongping; Mackey, John R.; Kovalchuk, Olga; Damaraju, Sambasivarao

    2016-01-01

    Transfer RNAs (tRNAs, key molecules in protein synthesis) have not been investigated as potential prognostic markers in breast cancer (BC), despite early findings of their dysregulation and diagnostic potential. We aim to comprehensively profile tRNAs from breast tissues and to evaluate their role as prognostic markers (Overall Survival, OS and Recurrence Free Survival, RFS). tRNAs were profiled from 11 normal breast and 104 breast tumor tissues using next generation sequencing. We adopted a Case-control (CC) and Case-Only (CO) association study designs. Risk scores constructed from tRNAs were subjected to univariate and multivariate Cox-proportional hazards regression to investigate their prognostic value. Of the 571 tRNAs profiled, 76 were differentially expressed (DE) and three were significant for OS in the CC approach. We identified an additional 11 tRNAs associated with OS and 14 tRNAs as significant for RFS in the CO approach, indicating that CC alone may not capture all discriminatory tRNAs in prognoses. In both the approaches, the risk scores were significant in the multivariate analysis as independent prognostic factors, and patients belonging to high-risk group were associated with poor prognosis. Our results confirmed global up-regulation of tRNAs in BC and identified tRNAs as potential novel prognostic markers for BC. PMID:27604545

  12. The expression pattern of small nucleolar and small Cajal body-specific RNAs characterizes distinct molecular subtypes of multiple myeloma

    PubMed Central

    Ronchetti, D; Todoerti, K; Tuana, G; Agnelli, L; Mosca, L; Lionetti, M; Fabris, S; Colapietro, P; Miozzo, M; Ferrarini, M; Tassone, P; Neri, A

    2012-01-01

    Small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs) are non-coding RNAs involved in the maturation of other RNA molecules and generally located in the introns of host genes. It is now emerging that altered sno/scaRNAs expression may have a pathological role in cancer. This study elucidates the patterns of sno/scaRNAs expression in multiple myeloma (MM) by profiling purified malignant plasma cells from 55 MMs, 8 secondary plasma cell leukemias (sPCLs) and 4 normal controls. Overall, a global sno/scaRNAs downregulation was found in MMs and, even more, in sPCLs compared with normal plasma cells. Whereas SCARNA22 resulted the only sno/scaRNA characterizing the translocation/cyclin D4 (TC4) MM, TC2 group displayed a distinct sno/scaRNA signature overexpressing members of SNORD115 and SNORD116 families located in a region finely regulated by an imprinting center at 15q11, which, however, resulted overall hypomethylated in MMs independently of the SNORD115 and SNORD116 expression levels. Finally, integrative analyses with available gene expression and genome-wide data revealed the occurrence of significant sno/scaRNAs/host genes co-expression and the putative influence of allelic imbalances on specific snoRNAs expression. Our data extend the current view of sno/scaRNAs deregulation in cancer and add novel information to the bio-molecular complexity of plasma cell dyscrasias. PMID:23178508

  13. Construction of an rsmX co-variance model and identification of five rsmX-like ncRNAs in Pseudomonas syringae pv. tomato DC3000

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Non-coding RNAs (ncRNAs) are important components of many regulatory pathways in many Pseudomonad species. In particular, the GacA/S two-component system directly regulates to at least two ncRNAs that act by sequestration of translation repressor proteins to control expression of exproducts. The co...

  14. miRNAs in brain development

    SciTech Connect

    Petri, Rebecca; Malmevik, Josephine; Fasching, Liana; Åkerblom, Malin; Jakobsson, Johan

    2014-02-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the post-transcriptional level. In the brain, a large number of miRNAs are expressed and there is a growing body of evidence demonstrating that miRNAs are essential for brain development and neuronal function. Conditional knockout studies of the core components in the miRNA biogenesis pathway, such as Dicer and DGCR8, have demonstrated a crucial role for miRNAs during the development of the central nervous system. Furthermore, mice deleted for specific miRNAs and miRNA-clusters demonstrate diverse functional roles for different miRNAs during the development of different brain structures. miRNAs have been proposed to regulate cellular functions such as differentiation, proliferation and fate-determination of neural progenitors. In this review we summarise the findings from recent studies that highlight the importance of miRNAs in brain development with a focus on the mouse model. We also discuss the technical limitations of current miRNA studies that still limit our understanding of this family of non-coding RNAs and propose the use of novel and refined technologies that are needed in order to fully determine the impact of specific miRNAs in brain development. - Highlights: • miRNAs are essential for brain development and neuronal function. • KO of Dicer is embryonically lethal. • Conditional Dicer KO results in defective proliferation or increased apoptosis. • KO of individual miRNAs or miRNA families is necessary to determine function.

  15. Plasma microRNAs expression profile in female workers occupationally exposed to mercury

    PubMed Central

    Ding, Enmin; Zhao, Qiuni; Bai, Ying; Xu, Ming; Pan, Liping; Liu, Qingdong; Wang, Bosheng; Song, Xianping; Wang, Jun; Chen, Lin

    2016-01-01

    Background Circulating microRNAs (miRNAs) have attracted interests as non-invasive biomarkers of physiological and pathological conditions. Several studies have examined the potential effects of mercury exposure on miRNAs expression profiles of general population environmentally exposed to mercury. The objective is to identify mercury-related miRNAs of female workers occupationally exposed to mercury. Methods In this case-control study, we used a microarray assay to detect the miRNA expression profiles in pooled plasma samples between (I) chronic mercury poisoning group; (II) mercury absorbing group and (III) control group in the discovery stage. Each group has ten individuals. In addition, we conducted a validation of eight candidate miRNAs in the same 30 workers by quantitative real-time PCR. Results In the discovery stage, eight miRNAs were conformed following our selection criteria. In the validation stage, RT-PCR confirmed up-regulation of miR-92a and miR-486 in the mercury poisoned group (P<0.05) compared to the other two groups. The results were consistent with the microarray analysis. Conclusions Plasma miR-92a-3p and miR-486-5p might prove to be potential biomarkers to indicate responses to mercury exposure. However, further studies are necessary to prove the causal association between miRNAs changes and mercury exposure, and to determine whether these two miRNAs are clear biomarkers to mercury exposure. PMID:27162656

  16. MicroRNAs as regulators of beta-cell function and dysfunction.

    PubMed

    Osmai, Mirwais; Osmai, Yama; Bang-Berthelsen, Claus H; Pallesen, Emil M H; Vestergaard, Anna L; Novotny, Guy W; Pociot, Flemming; Mandrup-Poulsen, Thomas

    2016-05-01

    In the last decade, there has been an explosion in both the number of and knowledge about miRNAs associated with both type 1 and type 2 diabetes. Even though we are presently in the initial stages of understanding how this novel class of posttranscriptional regulators are involved in diabetes, recent studies have demonstrated that miRNAs are important regulators of the islet transcriptome, controlling apoptosis, differentiation and proliferation, as well as regulating unique islet and beta-cell functions and pathways such as insulin expression, processing and secretion. Furthermore, a large number of miRNAs have been linked to diabetogenic processes induced by elevated levels of glucose, free fatty acids and inflammatory cytokines. Thus, miRNAs are novel therapeutic targets with the potential of protecting the beta-cell, and there is proof of principle that miRNA antagonists, so-called antagomirs, are effective in vivo for other disorders. miRNAs are exported out of cells in exosomes, raising the intriguing possibility of cell-to-cell communication between distant tissues via miRNAs and that miRNAs can be used as biomarkers of beta-cell function, mass and survival. The purpose of this review is to provide a status on how miRNAs control beta-cell function and viability in health and disease. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26418758

  17. Viral RNAs Are Unusually Compact

    PubMed Central

    Gopal, Ajaykumar; Egecioglu, Defne E.; Yoffe, Aron M.; Ben-Shaul, Avinoam; Rao, Ayala L. N.; Knobler, Charles M.; Gelbart, William M.

    2014-01-01

    A majority of viruses are composed of long single-stranded genomic RNA molecules encapsulated by protein shells with diameters of just a few tens of nanometers. We examine the extent to which these viral RNAs have evolved to be physically compact molecules to facilitate encapsulation. Measurements of equal-length viral, non-viral, coding and non-coding RNAs show viral RNAs to have among the smallest sizes in solution, i.e., the highest gel-electrophoretic mobilities and the smallest hydrodynamic radii. Using graph-theoretical analyses we demonstrate that their sizes correlate with the compactness of branching patterns in predicted secondary structure ensembles. The density of branching is determined by the number and relative positions of 3-helix junctions, and is highly sensitive to the presence of rare higher-order junctions with 4 or more helices. Compact branching arises from a preponderance of base pairing between nucleotides close to each other in the primary sequence. The density of branching represents a degree of freedom optimized by viral RNA genomes in response to the evolutionary pressure to be packaged reliably. Several families of viruses are analyzed to delineate the effects of capsid geometry, size and charge stabilization on the selective pressure for RNA compactness. Compact branching has important implications for RNA folding and viral assembly. PMID:25188030

  18. Magnetospheres of the outer planets

    SciTech Connect

    Cheng, A.F.

    1986-12-01

    The magnetospheres of the outer planets have been shown by Voyager explorations to strongly interact with the surfaces and atmospheres of their planetary satellites and rings. In the cases of Jupiter, Saturn and Uranus, the processes of charged particle sputtering, neutral gas cloud formation, and rapid plasma injection from the ionization of the neutral clouds, have important implications both for the magnetospheres as a whole and for the surfaces and atmospheres of their satellites. The general methodology employed in these researches has involved comparisons of the planetary magnetospheres in order to identify common physical processes. 16 references.

  19. Phloem-mobile messenger RNAs and root development

    PubMed Central

    Hannapel, David J.; Sharma, Pooja; Lin, Tian

    2013-01-01

    Numerous signal molecules move through the phloem to regulate development, including proteins, secondary metabolites, small RNAs and full-length transcripts. Several full-length mRNAs have been identified that move long distances in a shootward or rootward direction through the plant vasculature to modulate both floral and vegetative processes of growth. Here we discuss two recently discovered examples of long-distance transport of full-length mRNAs into roots and the potential target genes and pathways for these mobile signals. In both cases, the mobile RNAs regulate root growth. Previously, RNA movement assays demonstrated that transcripts of StBEL5, a transcription factor from the three-amino-loop-extension superclass, move through the phloem to stolon tips to enhance tuber formation in potato (Solanum tuberosum L.). StBEL5 mRNA originates in the leaf and its movement to stolons is induced by a short-day photoperiod. Movement of StBEL5 RNA to roots correlated with increased growth and the accumulation of several transcripts associated with hormone metabolism, including GA2-oxidase1, YUCCA1a and -c, several Aux/IAA types, and PIN1, -2, and -4 was observed. In another example, heterografting techniques were used to identify phloem-mobile Aux/IAA transcripts in Arabidopsis. Movement assays confirmed that these Aux/IAA transcripts are transported into the root system where they suppress lateral root formation. Phloem transport of both StBEL5 and Aux/IAA RNAs are linked to hormone metabolism and both target auxin synthesis genes or auxin signaling processes. The mechanisms of transport for these mobile RNAs, the impact they have on controlling root growth, and a potential transcriptional connection between the BEL1/KNOX complex and Aux/IAA genes are discussed. PMID:23882275

  20. Expression Profiling and Structural Characterization of MicroRNAs in Adipose Tissues of Hibernating Ground Squirrels

    PubMed Central

    Wu, Cheng-Wei; Biggar, Kyle K.; Storey, Kenneth B.

    2014-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that are important in regulating metabolic stress. In this study, we determined the expression and structural characteristics of 20 miRNAs in brown (BAT) and white adipose tissue (WAT) during torpor in thirteen-lined ground squirrels. Using a modified stem-loop technique, we found that during torpor, expression of six miRNAs including let-7a, let-7b, miR-107, miR-150, miR-222 and miR-31 was significantly downregulated in WAT (P < 0.05), which was 16%–54% of euthermic non-torpid control squirrels, whereas expression of three miRNAs including miR-143, miR-200a and miR-519d was found to be upregulated by 1.32–2.34-fold. Similarly, expression of more miRNAs was downregulated in BAT during torpor. We detected reduced expression of 6 miRNAs including miR-103a, miR-107, miR-125b, miR-21, miR-221 and miR-31 (48%–70% of control), while only expression of miR-138 was significantly upregulated (2.91 ± 0.8-fold of the control, P < 0.05). Interestingly, miRNAs found to be downregulated in WAT during torpor were similar to those dysregulated in obese humans for increased adipogenesis, whereas miRNAs with altered expression in BAT during torpor were linked to mitochondrial β-oxidation. miRPath target prediction analysis showed that miRNAs downregulated in both WAT and BAT were associated with the regulation of mitogen-activated protein kinase (MAPK) signaling, while the miRNAs upregulated in WAT were linked to transforming growth factor β (TGFβ) signaling. Compared to mouse sequences, no unique nucleotide substitutions within the stem-loop region were discovered for the associated pre-miRNAs for the miRNAs used in this study, suggesting no structure-influenced changes in pre-miRNA processing efficiency in the squirrel. As well, the expression of miRNA processing enzyme Dicer remained unchanged in both tissues during torpor. Overall, our findings suggest that changes of miRNA expression in adipose tissues may be linked

  1. Expression profiling and structural characterization of microRNAs in adipose tissues of hibernating ground squirrels.

    PubMed

    Wu, Cheng-Wei; Biggar, Kyle K; Storey, Kenneth B

    2014-12-01

    MicroRNAs (miRNAs) are small non-coding RNAs that are important in regulating metabolic stress. In this study, we determined the expression and structural characteristics of 20 miRNAs in brown (BAT) and white adipose tissue (WAT) during torpor in thirteen-lined ground squirrels. Using a modified stem-loop technique, we found that during torpor, expression of six miRNAs including let-7a, let-7b, miR-107, miR-150, miR-222 and miR-31 was significantly downregulated in WAT (P<0.05), which was 16%-54% of euthermic non-torpid control squirrels, whereas expression of three miRNAs including miR-143, miR-200a and miR-519d was found to be upregulated by 1.32-2.34-fold. Similarly, expression of more miRNAs was downregulated in BAT during torpor. We detected reduced expression of 6 miRNAs including miR-103a, miR-107, miR-125b, miR-21, miR-221 and miR-31 (48%-70% of control), while only expression of miR-138 was significantly upregulated (2.91±0.8-fold of the control, P<0.05). Interestingly, miRNAs found to be downregulated in WAT during torpor were similar to those dysregulated in obese humans for increased adipogenesis, whereas miRNAs with altered expression in BAT during torpor were linked to mitochondrial β-oxidation. miRPath target prediction analysis showed that miRNAs downregulated in both WAT and BAT were associated with the regulation of mitogen-activated protein kinase (MAPK) signaling, while the miRNAs upregulated in WAT were linked to transforming growth factor β (TGFβ) signaling. Compared to mouse sequences, no unique nucleotide substitutions within the stem-loop region were discovered for the associated pre-miRNAs for the miRNAs used in this study, suggesting no structure-influenced changes in pre-miRNA processing efficiency in the squirrel. As well, the expression of miRNA processing enzyme Dicer remained unchanged in both tissues during torpor. Overall, our findings suggest that changes of miRNA expression in adipose tissues may be linked to distinct

  2. MicroRNAs in nasopharyngeal carcinoma.

    PubMed

    Spence, Tara; Bruce, Jeff; Yip, Kenneth W; Liu, Fei-Fei

    2016-04-01

    It is becoming increasingly evident that aberrantly expressed microRNAs (miRNAs) are responsible for a number of disease processes, including cancer initiation and progression. miRNAs have been implicated as key players in numerous neoplasms, including nasopharyngeal carcinoma (NPC). Functionally, deregulation of miRNAs that act either as tumour suppressors or oncogenes results in numerous cancer-associated phenomena, including changes in proliferation, migration, and cell survival. Furthermore, miRNA expression has been associated with chemoresistant or radioresistant phenotypes; highlighting the importance of miRNAs in mediating oncogenic processes. Prognostic and predictive miRNA signatures have been defined for a variety of cancer types, including NPC, whereby these signatures offer a potentially important clinical tool for assessing the disease state, as well as predicting treatment response and clinical outcome. Therefore, further examination and validation of miRNAs that are deregulated in NPC will provide insight into the fundamental drivers of this disease, which will aid in the identification of novel targeted treatments. This review summarizes recent advances in the study of miRNAs in NPC, with specific discussion on the role of miRNAs in NPC pathogenesis and the potential utility of miRNAs as prognostic biomarkers. Our increasing understanding of the role of miRNAs in NPC tumorigenesis and their application as novel biomarkers will undoubtedly prove useful in the stratification of future patients into clinically relevant treatment classifications, thereby improving and personalizing disease management. PMID:27121877

  3. Genome-wide identification and characterization of Eutrema salsugineum microRNAs for salt tolerance.

    PubMed

    Wu, Ying; Guo, Jing; Cai, Yimei; Gong, Xiaolin; Xiong, Xuemei; Qi, Wenwen; Pang, Qiuying; Wang, Xumin; Wang, Yang

    2016-08-01

    Eutrema salsugineum, a close relative of Arabidopsis thaliana, is a valuable halophytic model plant that has extreme tolerance to salinity. As posttranscriptional gene regulators, microRNAs (miRNAs) control gene expression and a variety of biological processes, including plant-stress responses. To identify salt-stress responsive miRNAs in E. salsugineum and reveal their possible roles in the adaptive response to salt stress, we chose the Solexa sequencing platform to screen the miRNAs in 4-week-old E. salsugineum seedlings under salt treatment. A total of 82 conserved miRNAs belonging to 27 miRNA families and 17 novel miRNAs were identified and 11 conserved miRNA families and 4 novel miRNAs showed a significant response to salt stress. To investigate the possible biological roles of miRNAs, 1060 potential targets were predicted. Moreover, 35 gene ontology (GO) categories and 1 pathway, including a few terms that were directly and indirectly related to salt stress, were significantly enriched in the salt-stress-responsive miRNAs targets. The relative expression analysis of six target genes was analyzed using quantitative real-time polymerase chain reaction (PCR) and showed a negative correlation with their corresponding miRNAs. Many stress regulatory and phytohormone regulatory cis-regulatory elements were widely present in the promoter region of the salt-responsive miRNA precursors. This study describes the large-scale characterization of E. salsugineum miRNAs and provides a useful resource for further understanding of miRNA functions in the regulation of the E. salsugineum salt-stress response. PMID:26806325

  4. Bio-functional surfaces for the immunocapture of AGO2-bound microRNAs.

    PubMed

    Vaghi, V; Potrich, C; Lunelli, L; Facci, P; Pasquardini, L; Vanzetti, L; Pederzolli, C

    2016-10-01

    MicroRNAs (miRNAs) are endogenous, small (18-24nt), non-coding RNAs that regulate gene expression. Among miRNAs, those bound to the AGO2 protein are the functionally active fraction which mediates the cell regulatory processes and regulate messages exchanged by cells. Several methods have been developed to purify this fraction of microRNAs, such as immunoprecipitation and immunoprecipitation-derived techniques. However, all these techniques are generally recognized as technically complicated and time consuming. Here, a new bio-functional surface for the specific capture of AGO2-bound microRNAs is proposed. Starting from a silicon oxide surface, a protein A layer was covalently bound via epoxy chemistry to orient specific anti-AGO2 antibodies on the surface. The anti-AGO2 antibodies captured the AGO2 protein present in cell lysate and in human plasma. The AGO2-bound microRNAs were then released by enzymatic digestion and detected via RT-qPCR. Control surfaces were also prepared and tested. Every step in the preparation of the bio-functional surfaces was fully characterized from the chemical, morphological and functional point of view. The resulting bio-functional surface is able to specifically capture the AGO2-bound miRNAs from biologically-relevant samples, such as cell lysate and human plasma. These samples contain different proportions of AGO2-bound microRNAs, as reliably detected with the immunocapture method here proposed. This work opens new perspectives for a simple and faster method to isolate not only AGO2-bound microRNAs, but also the multiprotein complex containing AGO2 and miRNAs. PMID:27449965

  5. Regulatory RNAs in the Less Studied Streptococcal Species: From Nomenclature to Identification.

    PubMed

    Zorgani, Mohamed A; Quentin, Roland; Lartigue, Marie-Frédérique

    2016-01-01

    Streptococcal species are Gram-positive bacteria involved in severe and invasive diseases in humans and animals. Although, this group includes different pathogenic species involved in life-threatening infections for humans, it also includes beneficial species, such as Streptococcus thermophilus, which is used in yogurt production. In bacteria virulence factors are controlled by various regulatory networks including regulatory RNAs. For clearness and to develop logical thinking, we start this review with a revision of regulatory RNAs nomenclature. Previous reviews are mostly dealing with Streptococcus pyogenes and Streptococcus pneumoniae regulatory RNAs. We especially focused our analysis on regulatory RNAs in Streptococcus agalactiae, Streptococcus mutans, Streptococcus thermophilus and other less studied Streptococcus species. Although, S. agalactiae RNome remains largely unknown, sRNAs (small RNAs) are supposed to mediate regulation during environmental adaptation and host infection. In the case of S. mutans, sRNAs are suggested to be involved in competence regulation, carbohydrate metabolism, and Toxin-Antitoxin systems. A new category of miRNA-size small RNAs (msRNAs) was also identified for the first time in this species. The analysis of S. thermophilus sRNome shows that many sRNAs are associated to the bacterial immune system known as CRISPR-Cas system. Only few of the other different Streptococcus species have been the subject of studies pointed toward the characterization of regulatory RNAs. Finally, understanding bacterial sRNome can constitute one step forward to the elaboration of new strategies in therapy such as substitution of antibiotics in the management of S. agalactiae neonatal infections, prevention of S. mutans dental caries or use of S. thermophilus CRISPR-Cas system in genome editing applications. PMID:27507970

  6. Regulatory RNAs in the Less Studied Streptococcal Species: From Nomenclature to Identification

    PubMed Central

    Zorgani, Mohamed A.; Quentin, Roland; Lartigue, Marie-Frédérique

    2016-01-01

    Streptococcal species are Gram-positive bacteria involved in severe and invasive diseases in humans and animals. Although, this group includes different pathogenic species involved in life-threatening infections for humans, it also includes beneficial species, such as Streptococcus thermophilus, which is used in yogurt production. In bacteria virulence factors are controlled by various regulatory networks including regulatory RNAs. For clearness and to develop logical thinking, we start this review with a revision of regulatory RNAs nomenclature. Previous reviews are mostly dealing with Streptococcus pyogenes and Streptococcus pneumoniae regulatory RNAs. We especially focused our analysis on regulatory RNAs in Streptococcus agalactiae, Streptococcus mutans, Streptococcus thermophilus and other less studied Streptococcus species. Although, S. agalactiae RNome remains largely unknown, sRNAs (small RNAs) are supposed to mediate regulation during environmental adaptation and host infection. In the case of S. mutans, sRNAs are suggested to be involved in competence regulation, carbohydrate metabolism, and Toxin–Antitoxin systems. A new category of miRNA-size small RNAs (msRNAs) was also identified for the first time in this species. The analysis of S. thermophilus sRNome shows that many sRNAs are associated to the bacterial immune system known as CRISPR-Cas system. Only few of the other different Streptococcus species have been the subject of studies pointed toward the characterization of regulatory RNAs. Finally, understanding bacterial sRNome can constitute one step forward to the elaboration of new strategies in therapy such as substitution of antibiotics in the management of S. agalactiae neonatal infections, prevention of S. mutans dental caries or use of S. thermophilus CRISPR-Cas system in genome editing applications. PMID:27507970

  7. Altered expression of miRNAs in a dihydrotestosterone-induced rat PCOS model

    PubMed Central

    2013-01-01

    Background The polycystic ovary syndrome (PCOS) is a complex and heterogeneous endocrine condition characterized by hyperandrogenism, hyperinsulinemia, insulin resistance and chronic anovulation. Regulation and interaction of a multitude of genes required for follicular development are found to be altered in PCOS. MicroRNAs (miRNAs) mediate posttranscriptional gene regulation by binding to the 3´ untranslated region of mRNAs to either inhibit or enhance translation. However, the extent and regulation of miRNA expression in PCOS is poorly understood and the current study is the first to describe altered expression of miRNAs in PCOS. Methods A chronically androgenized [5α-dihydrotestosterone (DHT)-treated] rat model which recapitulates many of the phenotypes of human PCOS, and miRNA PCR array was used to investigate the expression of 349 miRNAs in DHT treated rat ovaries. The ovarian expression of several selected miRNAs was also analyzed by in situ localization experiment. Results DHT-treated rats exhibit increased body weight, disrupted estrus cyclicity, decreased insulin sensitivity and decreased ovarian weight, with the latter phenomenon readily rescued by gonadotropin treatment in vivo. In general, 24% of the 349 miRNAs investigated were found to be differentially expressed between DHT-treated and control rats. Most of the differentially expressed miRNAs were found to be predominantly localized in the theca cells of the follicles. In silico analysis of the potential target genes of dysregulated miRNAs revealed their possible involvement in various pathways in the regulation of ovarian function. Conclusion Our current findings suggest that miRNAs are differentially regulated in hyperandrogenism, a condition possibly involved in the dysregulation of steroid hormone receptors and intra-ovarian factors, and that miRNAs may be involved in the etiology of PCOS. PMID:23675970

  8. Mature microRNAs identified in highly purified nuclei from HCT116 colon cancer cells

    PubMed Central

    Park, Chang Won; Zeng, Yan; Zhang, Xiaoxiao; Subramanian, Subbaya

    2010-01-01

    MicroRNAs (miRNAs) have emerged as one of the major regulatory mechanisms of gene expression. A major function of miRNAs involves the post-transcriptional regulation of target mRNAs, which is reported to occur primarily in the cytoplasm. However, there is a significant amount of evidence demonstrating the existence of small non-coding RNAs, including small-interfering RNA (siRNA), miRNA and Piwi-interacting RNA (piRNA) in the nucleus. In order to elucidate the potential subcellular localizations and functions of miRNAs, we have identified numerous miRNAs that are present in isolated nuclei from human colon cancer HCT116 cells. MicroRNA profiles were compared between cytoplasmic and nuclear fractions of the HCT116 cell line on the basis of multiple microarray analyses. MicroRNA species showing significant existence in isolated and highly purified populations of nuclei were selected and further tested with RT-PCR. The nuclear localization of the mature form of miRNAs was verified again by control RT-PCR excluding the detection of premature forms of miRNA, such as pri-miRNA or pre-miRNA. The elevated levels of representative miRNAs identified in purified nuclei were confirmed by northern blot analysis, supporting the notion that significant numbers of mature miRNAs exist not only in the cytoplasm but also in the nucleus. These results will likely provide a basis for further studies concerning the intracellular trafficking and nuclear location of miRNAs. PMID:20864815

  9. Non-coding RNAs in DNA damage response

    PubMed Central

    Liu, Yunhua; Lu, Xiongbin

    2012-01-01

    Genome-wide studies have revealed that human and other mammalian genomes are pervasively transcribed and produce thousands of regulatory non-protein-coding RNAs (ncRNAs), including miRNAs, siRNAs, piRNAs and long non-coding RNAs (lncRNAs). Emerging evidences suggest that these ncRNAs also play a pivotal role in genome integrity and stability via the regulation of DNA damage response (DDR). In this review, we discuss the recent finding on the interplay of ncRNAs with the canonical DDR signaling pathway, with a particular emphasis on miRNAs and lncRNAs. While the expression of ncRNAs is regulated in the DDR, the DDR is also subjected to regulation by those DNA damage-responsive ncRNAs. In addition, the roles of those Dicer- and Drosha-dependent small RNAs produced in the vicinity of double-strand breaks sites are also described. PMID:23226613

  10. Gene regulation by dietary microRNAs.

    PubMed

    Zempleni, Janos; Baier, Scott R; Howard, Katherine M; Cui, Juan

    2015-12-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow's milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field. PMID:26222444

  11. CncRNAs: RNAs with both coding and non-coding roles in development.

    PubMed

    Sampath, Karuna; Ephrussi, Anne

    2016-04-15

    RNAs are known to regulate diverse biological processes, either as protein-encoding molecules or as non-coding RNAs. However, a third class that comprises RNAs endowed with both protein coding and non-coding functions has recently emerged. Such bi-functional 'coding and non-coding RNAs' (cncRNAs) have been shown to play important roles in distinct developmental processes in plants and animals. Here, we discuss key examples of cncRNAs and review their roles, regulation and mechanisms of action during development. PMID:27095489

  12. Micro-RNAs and High-Density Lipoprotein Metabolism.

    PubMed

    Canfrán-Duque, Alberto; Lin, Chin-Sheng; Goedeke, Leigh; Suárez, Yajaira; Fernández-Hernando, Carlos

    2016-06-01

    Improved prevention and treatment of cardiovascular diseases is one of the challenges in Western societies, where ischemic heart disease and stroke are the leading cause of death. Early epidemiological studies have shown an inverse correlation between circulating high-density lipoprotein-cholesterol (HDL-C) and cardiovascular diseases. The cardioprotective effect of HDL is because of its ability to remove cholesterol from plaques in the artery wall to the liver for excretion by a process known as reverse cholesterol transport. Numerous studies have reported the role that micro-RNAs (miRNA) play in the regulation of the different steps in reverse cholesterol transport, including HDL biogenesis, cholesterol efflux, and cholesterol uptake in the liver and bile acid synthesis and secretion. Because of their ability to control different aspects of HDL metabolism and function, miRNAs have emerged as potential therapeutic targets to combat cardiovascular diseases. In this review, we summarize the recent advances in the miRNA-mediated control of HDL metabolism. We also discuss how HDL particles serve as carriers of miRNAs and the potential use of HDL-containing miRNAs as cardiovascular diseases biomarkers. PMID:27079881

  13. DNA damage modulates interactions between microRNAs and the 26S proteasome

    PubMed Central

    Tsimokha, Anna S; Kulichkova, Valentina A.; Karpova, Elena V.; Zaykova, Julia J.; Aksenov, Nikolai D; Vasilishina, Anastasia A.; Kropotov, Andrei V.; Antonov, Alexey; Barlev, Nikolai A.

    2014-01-01

    26S proteasomes are known as major non-lysosomal cellular machines for coordinated and specific destruction of ubiquitinylated proteins. The proteolytic activities of proteasomes are controlled by various post-translational modifications in response to environmental cues, including DNA damage. Besides proteolysis, proteasomes also associate with RNA hydrolysis and splicing. Here, we extend the functional diversity of proteasomes by showing that they also dynamically associate with microRNAs (miRNAs) both in the nucleus and cytoplasm of cells. Moreover, DNA damage induced by an anti-cancer drug, doxorubicin, alters the repertoire of proteasome-associated miRNAs, enriching the population of miRNAs that target cell cycle checkpoint regulators and DNA repair proteins. Collectively, these data uncover yet another potential mode of action for proteasomes in the cell via their dynamic association with microRNAs. PMID:25004448

  14. The role of microRNAs in synaptic development and function

    PubMed Central

    Corbin, Rachel; Olsson-Carter, Katherine; Slack, Frank

    2015-01-01

    MicroRNAs control gene expression by inhibiting translation or promoting degradation of their target mRNAs. Since the discovery of the first microRNAs, lin-4 and let-7, in C. elegans, hundreds of microRNAs have been identified as key regulators of cell fate determination, lifespan, and cancer in species ranging from plants to humans. However, while microRNAs have been shown to be particularly abundant in the brain, their role in the development and activity of the nervous system is still largely unknown. In this review, we describe recent advances in our understanding of microRNA function at synapses, the specialized structures required for communication between neurons and their targets. We also propose how these advances might inform the molecular model of memory. PMID:19335998

  15. MicroRNAs as diagnostic and prognostic biomarkers in colorectal cancer

    PubMed Central

    Yi, Rui; Li, Yao; Wang, Fei-Liang; Miao, Gang; Qi, Ruo-Mei; Zhao, Yan-Yang

    2016-01-01

    MicroRNAs (miRNAs) are key regulators involved in various tumors. They regulate cell cycle, apoptosis and cancer stemness, metastasis and chemoresistance by controlling their target gene expressions. Here, we mainly discuss the potential uses of miRNAs in colorectal cancer (CRC) diagnosis. We also shed light on the important corresponding miRNA targets and on the major regulators of miRNAs. Furthermore, we discuss miRNA activity in assessing the prognosis and recurrence of CRC as well as in modulating responsiveness to chemotherapy. Based on the various pro-oncogenic/anti-oncogenic roles of miRNAs, the advantages of a therapeutic strategy based on the delivery of miRNA mimics are also mentioned. Together, miRNA seems to be an excellent tool for effectively monitoring and targeting CRC. PMID:27096028

  16. Short Communication: HIV-1 Infection Suppresses Circulating Viral Restriction microRNAs.

    PubMed

    Zhou, Yu; Sun, Li; Wang, Xu; Liang, Hao; Ye, Li; Zhou, Li; Liang, Bing-Yu; Li, Jie-Liang; Liu, Man-Qing; Peng, Jin-Song; Zhou, Dun-Jin; Gui, Xi-En; Ho, Wen-Zhe

    2016-04-01

    MicroRNAs (miRNAs) participate in host innate immunity against HIV-1 infection. We examined the impact of HIV-1 infection on viral restriction miRNAs in plasma of HIV-1-infected subjects. HIV-1-infected subjects had significantly lower plasma levels of HIV-1 restriction miRNAs (miRs-29a, -29b, -125b, -223, -198, and -382) than control subjects. Further in vitro studies showed that HIV-1 infection of macrophages suppressed production of the extracellular miRs-29b, -125b, and -223. These data demonstrate the compelling evidence that HIV-1 infection impairs host innate immunity by inhibiting antiviral miRNAs, which provide a possible mechanism for HIV-1 persistence in the host. PMID:26607272

  17. MicroRNAs in apoptosis, autophagy and necroptosis

    PubMed Central

    2015-01-01

    MicroRNAs (miRNAs) are endogenous 22 nt non-coding RNAs that target mRNAs for cleavage or translational repression. Numerous miRNAs regulate programmed cell death including apoptosis, autophagy and necroptosis. We summarize how miRNAs regulate apoptotic, autophagic and necroptotic pathways and cancer progression. We also discuss how miRNAs link different types of cell death. PMID:25893379

  18. p53-repressed miRNAs are involved with E2F in a feed-forward loop promoting proliferation

    PubMed Central

    Brosh, Ran; Shalgi, Reut; Liran, Atar; Landan, Gilad; Korotayev, Katya; Nguyen, Giang Huong; Enerly, Espen; Johnsen, Hilde; Buganim, Yosef; Solomon, Hilla; Goldstein, Ido; Madar, Shalom; Goldfinger, Naomi; Børresen-Dale, Anne-Lise; Ginsberg, Doron; Harris, Curtis C; Pilpel, Yitzhak; Oren, Moshe; Rotter, Varda

    2008-01-01

    Normal cell growth is governed by a complicated biological system, featuring multiple levels of control, often deregulated in cancers. The role of microRNAs (miRNAs) in the control of gene expression is now increasingly appreciated, yet their involvement in controlling cell proliferation is still not well understood. Here we investigated the mammalian cell proliferation control network consisting of transcriptional regulators, E2F and p53, their targets and a family of 15 miRNAs. Indicative of their significance, expression of these miRNAs is downregulated in senescent cells and in breast cancers harboring wild-type p53. These miRNAs are repressed by p53 in an E2F1-mediated manner. Furthermore, we show that these miRNAs silence antiproliferative genes, which themselves are E2F1 targets. Thus, miRNAs and transcriptional regulators appear to cooperate in the framework of a multi-gene transcriptional and post-transcriptional feed-forward loop. Finally, we show that, similarly to p53 inactivation, overexpression of representative miRNAs promotes proliferation and delays senescence, manifesting the detrimental phenotypic consequence of perturbations in this circuit. Taken together, these findings position miRNAs as novel key players in the mammalian cellular proliferation network. PMID:19034270

  19. Serum microRNAs as novel biomarkers for primary sclerosing cholangitis and cholangiocarcinoma.

    PubMed

    Bernuzzi, F; Marabita, F; Lleo, A; Carbone, M; Mirolo, M; Marzioni, M; Alpini, G; Alvaro, D; Boberg, K M; Locati, M; Torzilli, G; Rimassa, L; Piscaglia, F; He, X-S; Bowlus, C L; Yang, G-X; Gershwin, M E; Invernizzi, P

    2016-07-01

    The diagnosis of primary sclerosing cholangitis (PSC) is difficult due to the lack of sensitive and specific biomarkers, as is the early diagnosis of cholangiocarcinoma (CC), a complication of PSC. The aim of this study was to identify specific serum miRNAs as diagnostic biomarkers for PSC and CC. The levels of 667 miRNAs were evaluated in 90 human serum samples (30 PSC, 30 CC and 30 control subjects) to identify disease-associated candidate miRNAs (discovery phase). The deregulated miRNAs were validated in an independent cohort of 140 samples [40 PSC, 40 CC, 20 primary biliary cirrhosis (PBC) and 40 controls]. Receiver operating characteristic (ROC) curves were established and only miRNAs with an area under the curve (AUC) > 0·70 were considered useful as biomarkers. In the discovery phase we identified the following: 21 miRNAs expressed differentially in PSC, 33 in CC and 26 in both in comparison to control subjects as well as 24 miRNAs expressed differentially between PSC and CC. After the validation phase, miR-200c was found to be expressed differentially in PSC versus controls, whereas miR-483-5p and miR-194 showed deregulated expression in CC compared with controls. We also demonstrate a difference in the expression of miR-222 and miR-483-5p in CC versus PSC. Combination of these specific miRNAs further improved the specificity and accuracy of diagnosis. This study provides a basis for the use of miRNAs as biomarkers for the diagnosis of PSC and CC. PMID:26864161

  20. Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line.

    PubMed

    Lau, Nelson C; Robine, Nicolas; Martin, Raquel; Chung, Wei-Jen; Niki, Yuzo; Berezikov, Eugene; Lai, Eric C

    2009-10-01

    Piwi proteins, a subclass of Argonaute-family proteins, carry approximately 24-30-nt Piwi-interacting RNAs (piRNAs) that mediate gonadal defense against transposable elements (TEs). We analyzed the Drosophila ovary somatic sheet (OSS) cell line and found that it expresses miRNAs, endogenous small interfering RNAs (endo-siRNAs), and piRNAs in abundance. In contrast to intact gonads, which contain mixtures of germline and somatic cell types that express different Piwi-class proteins, OSS cells are a homogenous somatic cell population that expresses only PIWI and primary piRNAs. Detailed examination of its TE-derived piRNAs and endo-siRNAs revealed aspects of TE defense that do not rely upon ping-pong amplification. In particular, we provide evidence that a subset of piRNA master clusters, including flamenco, are specifically expressed in OSS and ovarian follicle cells. These data indicate that the restriction of certain TEs in somatic gonadal cells is largely mediated by a primary piRNA pathway. PMID:19541914

  1. Crosstalk between Long Noncoding RNAs and MicroRNAs in Health and Disease.

    PubMed

    Bayoumi, Ahmed S; Sayed, Amer; Broskova, Zuzana; Teoh, Jian-Peng; Wilson, James; Su, Huabo; Tang, Yao-Liang; Kim, Il-Man

    2016-01-01

    Protein-coding genes account for only a small part of the human genome; in fact, the vast majority of transcripts are comprised of non-coding RNAs (ncRNAs) including long ncRNAs (lncRNAs) and small ncRNAs, microRNAs (miRs). Accumulating evidence indicates that ncRNAs could play critical roles in regulating many cellular processes which are often implicated in health and disease. For example, ncRNAs are aberrantly expressed in cancers, heart diseases, and many other diseases. LncRNAs and miRs are therefore novel and promising targets to be developed into biomarkers for diagnosis and prognosis as well as treatment options. The interaction between lncRNAs and miRs as well as its pathophysiological significance have recently been reported. Mechanistically, it is believed that lncRNAs exert "sponge-like" effects on various miRs, which subsequently inhibits miR-mediated functions. This crosstalk between two types of ncRNAs frequently contributes to the pathogenesis of the disease. In this review, we provide a summary of the recent studies highlighting the interaction between these ncRNAs and the effects of this interaction on disease pathogenesis and regulation. PMID:26978351

  2. Crosstalk between Long Noncoding RNAs and MicroRNAs in Health and Disease

    PubMed Central

    Bayoumi, Ahmed S.; Sayed, Amer; Broskova, Zuzana; Teoh, Jian-Peng; Wilson, James; Su, Huabo; Tang, Yao-Liang; Kim, Il-man

    2016-01-01

    Protein-coding genes account for only a small part of the human genome; in fact, the vast majority of transcripts are comprised of non-coding RNAs (ncRNAs) including long ncRNAs (lncRNAs) and small ncRNAs, microRNAs (miRs). Accumulating evidence indicates that ncRNAs could play critical roles in regulating many cellular processes which are often implicated in health and disease. For example, ncRNAs are aberrantly expressed in cancers, heart diseases, and many other diseases. LncRNAs and miRs are therefore novel and promising targets to be developed into biomarkers for diagnosis and prognosis as well as treatment options. The interaction between lncRNAs and miRs as well as its pathophysiological significance have recently been reported. Mechanistically, it is believed that lncRNAs exert “sponge-like” effects on various miRs, which subsequently inhibits miR-mediated functions. This crosstalk between two types of ncRNAs frequently contributes to the pathogenesis of the disease. In this review, we provide a summary of the recent studies highlighting the interaction between these ncRNAs and the effects of this interaction on disease pathogenesis and regulation. PMID:26978351

  3. Long noncoding RNAs are spatially correlated with transcription factors and regulate lung development

    PubMed Central

    Herriges, Michael J.; Swarr, Daniel T.; Morley, Michael P.; Rathi, Komal S.; Peng, Tien; Stewart, Kathleen M.; Morrisey, Edward E.

    2014-01-01

    Long noncoding RNAs (lncRNAs) are thought to play important roles in regulating gene transcription, but few have well-defined expression patterns or known biological functions during mammalian development. Using a conservative pipeline to identify lncRNAs that have important biological functions, we identified 363 lncRNAs in the lung and foregut endoderm. Importantly, we show that these lncRNAs are spatially correlated with transcription factors across the genome. In-depth expression analyses of lncRNAs with genomic loci adjacent to the critical transcription factors Nkx2.1, Gata6, Foxa2 (forkhead box a2), and Foxf1 mimic the expression patterns of their protein-coding neighbor. Loss-of-function analysis demonstrates that two lncRNAs, LL18/NANCI (Nkx2.1-associated noncoding intergenic RNA) and LL34, play distinct roles in endoderm development by controlling expression of critical developmental transcription factors and pathways, including retinoic acid signaling. In particular, we show that LL18/NANCI acts upstream of Nkx2.1 and downstream from Wnt signaling to regulate lung endoderm gene expression. These studies reveal that lncRNAs play an important role in foregut and lung endoderm development by regulating multiple aspects of gene transcription, often through regulation of transcription factor expression. PMID:24939938

  4. MicroRNAs in Breast Cancer: One More Turn in Regulation.

    PubMed

    Asensio, Pilar E; Martin, Eduardo T; Merlo, Begoña P; Armas, Estefanía E; Hernández, Ana L

    2016-01-01

    MicroRNAs (miRNAs) are small non-coding RNA molecules that critically regulate the expression of genes. MiRNAs are involved in physiological cellular processes; however, their deregulation has been associated with several pathologies, including cancer. In human breast cancer, differently expressed levels of miRNAs have been identified from those in normal breast tissues. Moreover, several miRNAs have been correlated with pathological phenotype, cancer subtype and therapy response in breast cancer. The resistance to therapy is increasingly a problem in patient management, and miRNAs are emerging as novel therapeutic targets and potential predictive biomarkers for treatment. This review provides an overview of the current situation of miRNAs in breast cancer, focusing on their involvement in resistance and the circulating miRNA. The mechanisms of therapeutic resistance regulated by miRNAs, such as the regulation of receptors, the modification of enzymes of drug metabolism, the inhibition of cell cycle control or pro-apoptotic proteins, the alteration of histone activity and the regulation of DNA repair machinery among others, are discussed for breast cancer clinical subtypes. Additionally, in this review, we summarize the recent knowledge that has established miRNA detection in peripheral body fluids as a suitable biomarker. We review the detection of miRNA in liquid biopsies and its implications for the diagnosis and monitoring of breast cancer. This new generation of cancer biomarkers may lead to a significant improvement in patient management. PMID:25694121

  5. Tailor: a computational framework for detecting non-templated tailing of small silencing RNAs

    PubMed Central

    Chou, Min-Te; Han, Bo W.; Hsiao, Chiung-Po; Zamore, Phillip D.; Weng, Zhiping; Hung, Jui-Hung

    2015-01-01

    Small silencing RNAs, including microRNAs, endogenous small interfering RNAs (endo-siRNAs) and Piwi-interacting RNAs (piRNAs), have been shown to play important roles in fine-tuning gene expression, defending virus and controlling transposons. Loss of small silencing RNAs or components in their pathways often leads to severe developmental defects, including lethality and sterility. Recently, non-templated addition of nucleotides to the 3′ end, namely tailing, was found to associate with the processing and stability of small silencing RNAs. Next Generation Sequencing has made it possible to detect such modifications at nucleotide resolution in an unprecedented throughput. Unfortunately, detecting such events from millions of short reads confounded by sequencing errors and RNA editing is still a tricky problem. Here, we developed a computational framework, Tailor, driven by an efficient and accurate aligner specifically designed for capturing the tailing events directly from the alignments without extensive post-processing. The performance of Tailor was fully tested and compared favorably with other general-purpose aligners using both simulated and real datasets for tailing analysis. Moreover, to show the broad utility of Tailor, we used Tailor to reanalyze published datasets and revealed novel findings worth further experimental validation. The source code and the executable binaries are freely available at https://github.com/jhhung/Tailor. PMID:26007652

  6. Aberrantly expressed microRNAs in the context of bladder tumorigenesis

    PubMed Central

    Lee, Jong-Young; Ryu, Dong-Sung; Kim, Wun-Jae

    2016-01-01

    MicroRNAs (miRNAs), small noncoding RNAs 19–22 nucleotides in length, play a major role in negative regulation of gene expression at the posttranscriptional level. Several miRNAs act as tumor suppressors or oncogenes that control cell differentiation, proliferation, apoptosis, or angiogenesis during tumorigenesis. To date, 19 research groups have published large-scale expression profiles that identified 261 miRNAs differentially expressed in bladder cancer, of which 76 were confirmed to have consistent expression patterns by two or more groups. These consistently expressed miRNAs participated in regulation of multiple biological processes and factors, including axon guidance, cancer-associated proteoglycans, and the ErbB and transforming growth factorbeta signaling pathways. Because miRNAs can be released from cancer cells into urine via secreted particles, we propose that miRNAs differentially expressed between tissue and urine could serve as predictors of bladder cancer, and could thus be exploited for noninvasive diagnosis. PMID:27326408

  7. Targeting smooth muscle microRNAs for therapeutic benefit in vascular disease.

    PubMed

    Albinsson, Sebastian; Swärd, Karl

    2013-09-01

    In view of the bioinformatic projection that a third of all protein coding genes and essentially all biological pathways are under control of microRNAs (miRNAs), it is not surprising that this class of small RNAs plays roles in vascular disease progression. MiRNAs have been shown to be involved in cholesterol turnover, thrombosis, glucose homeostasis and vascular function. Some miRNAs appear to be specific for certain cells, and the role that such cell-specific miRNAs play in vascular disease is only beginning to be appreciated. A notable example is the miR-143/145 cluster which is enriched in mature and highly differentiated smooth muscle cells (SMCs). Here we outline and discuss the recent literature on SMC-expressed miRNAs in major vascular diseases, including atherosclerosis, neointima formation, aortic aneurysm formation, and pulmonary arterial hypertension. Forced expression of miR-145 emerges as a promising strategy for reduction and stabilization of atherosclerotic plaques as well as for reducing neointimal hyperplasia. It is concluded that if obstacles in the form of delivery and untoward effects of antimirs and mimics can be overcome, the outlook for targeting of SMC-specific miRNAs for therapeutic benefit in vascular disease is bright. PMID:23611811

  8. The Mechanisms of Virulence Regulation by Small Noncoding RNAs in Low GC Gram-Positive Pathogens

    PubMed Central

    Pitman, Stephanie; Cho, Kyu Hong

    2015-01-01

    The discovery of small noncoding regulatory RNAs (sRNAs) in bacteria has grown tremendously recently, giving new insights into gene regulation. The implementation of computational analysis and RNA sequencing has provided new tools to discover and analyze potential sRNAs. Small regulatory RNAs that act by base-pairing to target mRNAs have been found to be ubiquitous and are the most abundant class of post-transcriptional regulators in bacteria. The majority of sRNA studies has been limited to E. coli and other gram-negative bacteria. However, examples of sRNAs in gram-positive bacteria are still plentiful although the detailed gene regulation mechanisms behind them are not as well understood. Strict virulence control is critical for a pathogen’s survival and many sRNAs have been found to be involved in that process. This review outlines the targets and currently known mechanisms of trans-acting sRNAs involved in virulence regulation in various gram-positive pathogens. In addition, their shared characteristics such as CU interaction motifs, the role of Hfq, and involvement in two-component regulators, riboswitches, quorum sensing, or toxin/antitoxin systems are described. PMID:26694351

  9. FDF-PAGE: a powerful technique revealing previously undetected small RNAs sequestered by complementary transcripts

    PubMed Central

    Harris, C. Jake; Molnar, Attila; Müller, Sebastian Y.; Baulcombe, David C.

    2015-01-01

    Small RNAs, between 18nt and 30nt in length, are a diverse class of non-coding RNAs that mediate a range of cellular processes, from gene regulation to pathogen defense. They guide ribonucleoprotein complexes to their target nucleic acids by Watson–Crick base pairing. We report here that current techniques for small RNA detection and library generation are biased by formation of RNA duplexes. To address this problem, we established FDF-PAGE (fully-denaturing formaldehyde polyacrylamide gel electrophoresis) to prevent annealing of sRNAs to their complement. By applying FDF-PAGE, we provide evidence that both strands of viral small RNA are present in near equimolar ratios, indicating that the predominant precursor is a long double-stranded RNA. Comparing non-denaturing conditions to FDF-PAGE uncovered extensive sequestration of miRNAs in model organisms and allowed us to identify candidate small RNAs under the control of competing endogenous RNAs (ceRNAs). By revealing the full repertoire of small RNAs, we can begin to create a better understanding of small RNA mediated interactions. PMID:26071954

  10. Profiling of differentially expressed microRNAs in arrhythmogenic right ventricular cardiomyopathy

    PubMed Central

    Zhang, Hongliang; Liu, Shenghua; Dong, Tianwei; Yang, Jun; Xie, Yuanyuan; Wu, Yike; Kang, Kang; Hu, Shengshou; Gou, Deming; Wei, Yingjie

    2016-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a kind of primary cardiomyopathy characterized by the fibro-fatty replacement of right ventricular myocardium. Currently, myocardial microRNAs have been reported to play critical role in the pathophysiology of cardiovascular pathophysiology. So far, the profiling of microRNAs in ARVC has not been described. In this study, we applied S-Poly (T) Plus method to investigate the expression profile of microRNAs in 24 ARVC patients heart samples. The tissue levels of 1078 human microRNAs were assessed and were compared with levels in a group of 24 healthy controls. Analysis of the area under the receiver operating characteristic curve (ROC) supported the 21 validated microRNAs to be miRNA signatures of ARVC, eleven microRNAs were significantly increased in ARVC heart tissues and ten microRNAs were significantly decreased. After functional enrichment analysis, miR-21-5p and miR-135b were correlated with Wnt and Hippo pathway, which might involve in the molecular pathophysiology of ARVC. Overall, our data suggested that myocardial microRNAs were involved in the pathophysiology of ARVC, miR-21-5p and miR-135b were significantly associated with both the myocardium adipose and fibrosis, which was a potential disease pathway for ARVC and might to be useful as therapeutic targets for ARVC. PMID:27307080

  11. Role of microRNAs in the modulation of diabetic retinopathy.

    PubMed

    Mastropasqua, Rodolfo; Toto, Lisa; Cipollone, Francesco; Santovito, Donato; Carpineto, Paolo; Mastropasqua, Leonardo

    2014-11-01

    Diabetic retinopathy (DR) is the leading cause of vision loss in the working-age adults. It affects a third of diabetics. Diabetic macular edema, an advanced complication of DR, develops in nearly 7% of diabetic patients. MicroRNAs (miRNAs) are a novel group of non-coding small RNAs that post-transcriptionally control gene expression by promoting either degradation or translational repression of target messenger RNA. They are implicated in a large variety of physiological and pathophysiological processes, including glucose homeostasis, angiogenesis and modulation of inflammatory response. MiRNAs also play a critical role in the pathogenesis of diabetes and the related micro- and macrovascular complications. The purpose of this review is to describe the potential role of miRNAs in diabetes and evaluate their implication in DR. MiRNAs involved in the modulation of glucose metabolism (insulin secretion and sensitivity) and MiRNAs playing a role in the pathogenesis of DR with their potential target genes are reviewed. Understanding MiRNAs implication in DR could be helpful for developing new gain- or loss- of -function strategies in order to establish effective treatments and reduce the rate of visual disability due to progression of retinopathy. PMID:25128741

  12. microRNAs That Promote or Inhibit Memory Formation in Drosophila melanogaster

    PubMed Central

    Busto, Germain U.; Guven-Ozkan, Tugba; Fulga, Tudor A.; Van Vactor, David; Davis, Ronald L.

    2015-01-01

    microRNAs (miRNAs) are small noncoding RNAs that regulate gene expression post-transcriptionally. Prior studies have shown that they regulate numerous physiological processes critical for normal development, cellular growth control, and organismal behavior. Here, we systematically surveyed 134 different miRNAs for roles in olfactory learning and memory formation using “sponge” technology to titrate their activity broadly in the Drosophila melanogaster central nervous system. We identified at least five different miRNAs involved in memory formation or retention from this large screen, including miR-9c, miR-31a, miR-305, miR-974, and miR-980. Surprisingly, the titration of some miRNAs increased memory, while the titration of others decreased memory. We performed more detailed experiments on two miRNAs, miR-974 and miR-31a, by mapping their roles to subpopulations of brain neurons and testing the functional involvement in memory of potential mRNA targets through bioinformatics and a RNA interference knockdown approach. This screen offers an important first step toward the comprehensive identification of all miRNAs and their potential targets that serve in gene regulatory networks important for normal learning and memory. PMID:26088433

  13. Tailor: a computational framework for detecting non-templated tailing of small silencing RNAs.

    PubMed

    Chou, Min-Te; Han, Bo W; Hsiao, Chiung-Po; Zamore, Phillip D; Weng, Zhiping; Hung, Jui-Hung

    2015-09-30

    Small silencing RNAs, including microRNAs, endogenous small interfering RNAs (endo-siRNAs) and Piwi-interacting RNAs (piRNAs), have been shown to play important roles in fine-tuning gene expression, defending virus and controlling transposons. Loss of small silencing RNAs or components in their pathways often leads to severe developmental defects, including lethality and sterility. Recently, non-templated addition of nucleotides to the 3' end, namely tailing, was found to associate with the processing and stability of small silencing RNAs. Next Generation Sequencing has made it possible to detect such modifications at nucleotide resolution in an unprecedented throughput. Unfortunately, detecting such events from millions of short reads confounded by sequencing errors and RNA editing is still a tricky problem. Here, we developed a computational framework, Tailor, driven by an efficient and accurate aligner specifically designed for capturing the tailing events directly from the alignments without extensive post-processing. The performance of Tailor was fully tested and compared favorably with other general-purpose aligners using both simulated and real datasets for tailing analysis. Moreover, to show the broad utility of Tailor, we used Tailor to reanalyze published datasets and revealed novel findings worth further experimental validation. The source code and the executable binaries are freely available at https://github.com/jhhung/Tailor. PMID:26007652

  14. MicroRNAs Involved in Tumor Suppressor and Oncogene Pathways; Implications for Hepatobiliary Neoplasia

    PubMed Central

    Mott, Justin L.

    2009-01-01

    MicroRNAs are a class of small regulatory RNAs that function to modulate protein expression. This control allows for fine-tuning of the cellular phenotype, including regulation of proliferation, cell signaling, and apoptosis; not surprisingly, microRNAs contribute to liver cancer biology. Recent investigations in human liver cancers and tumor-derived cell lines have demonstrated decreased or increased expression of particular microRNAs in hepatobiliary cancer cells. Based on predicted and validated protein targets as well as functional consequences of altered expression, microRNAs with decreased expression in liver tumor cells may normally aid in limiting neoplastic transformation. Conversely, selected microRNAs that are upregulated in liver tumor cells can promote malignant features, contributing to carcinogenesis. In addition, microRNAs themselves are subject to regulated expression, including regulation by tumor suppressor and oncogene pathways. This review will focus on the expression and function of cancer-related microRNAs, including their intimate involvement in tumor suppressor and oncogene signaling networks relevant to hepatobiliary neoplasia. PMID:19585622

  15. Aberrantly expressed microRNAs in the context of bladder tumorigenesis.

    PubMed

    Lee, Jong-Young; Ryu, Dong-Sung; Kim, Wun-Jae; Kim, Seong-Jin

    2016-06-01

    MicroRNAs (miRNAs), small noncoding RNAs 19-22 nucleotides in length, play a major role in negative regulation of gene expression at the posttranscriptional level. Several miRNAs act as tumor suppressors or oncogenes that control cell differentiation, proliferation, apoptosis, or angiogenesis during tumorigenesis. To date, 19 research groups have published large-scale expression profiles that identified 261 miRNAs differentially expressed in bladder cancer, of which 76 were confirmed to have consistent expression patterns by two or more groups. These consistently expressed miRNAs participated in regulation of multiple biological processes and factors, including axon guidance, cancer-associated proteoglycans, and the ErbB and transforming growth factorbeta signaling pathways. Because miRNAs can be released from cancer cells into urine via secreted particles, we propose that miRNAs differentially expressed between tissue and urine could serve as predictors of bladder cancer, and could thus be exploited for noninvasive diagnosis. PMID:27326408

  16. MicroRNAs: newcomers into the ALS picture.

    PubMed

    Volonte, Cinzia; Apolloni, Savina; Parisi, Chiara

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) causes neurodegeneration of both upper and lower motor neurons and progressive muscle impairment, atrophy and death within approximately five years from diagnosis. The aetiology is still not clear but evidence obtained in animal models of the disease indicates a non-cell-autonomous mechanism with the active contribution of non-neuronal cells such as microglia, astrocytes, muscle and T cells, which differently participate to the diverse phases of the disease. Clinically indistinguishable forms of ALS occur as sporadic disease in the absence of known mutation, or can be initiated by genetic mutations. About two-third of familial cases are triggered by mutations of four genes that are chromosome 9 open reading frame 72 (C9ORF72), Cu/Zn superoxide dismutase (SOD1), fused in sarcoma/translocated in liposarcoma (FUS/TLS), TAR-DNA binding protein 43 (TDP43). There is at present no succesfull treatment against ALS and the identification of novel signalling pathways, molecular mechanisms and cellular mediators are still a major task in the search for effective therapies. MiRNAs are conserved, endogenous, non-coding RNAs that post-transcriptionally regulate protein expression. Produced as long primary transcripts, they are exported to the cytoplasm and further modified to obtain the mature miRNAs, with each step of their biogenesis being a potential step of regulation. There are more than 1000 different known human miRNA sequences, and more than 20-30% of all human protein-coding genes are likely controlled by miRNAs. This earns to miRNAs the definition of fine regulators of genetic networks. The discovery of the involvement of ALS mutated proteins TDP43 and FUS/TLS in miRNAs biogenesis strongly suggests a role of miRNA dysregulation also in ALS and many efforts are thus directed toward understanding the role of these small RNA molecules in the pathogenesis of ALS. The overall objective of this review is thus to highlight the emerging

  17. microRNAs in opioid pharmacology

    PubMed Central

    Hwang, Cheol Kyu; Wagley, Yadav; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

    2011-01-01

    MicroRNAs (miRNA), a class of ~22-nucleotide RNA molecules, are important gene regulators that bind to the target sites of mRNAs to inhibit the gene expressions either through translational inhibition or mRNA destabilization. There are growing evidences that miRNAs have played several regulatory roles in opioid pharmacology. Like other research fields such as cancer biology, the area where numerous miRNAs are found to be involved in gene regulation, we assume that in opioid studies including research fields of drug additions and opioid receptor regulation, there may be more miRNAs waiting to be discovered. This review will summarize our current knowledge of miRNA functions on opioids biology and briefly describe future research directions of miRNAs related to opioids. PMID:22068836

  18. Cellular microRNAs and Picornaviral Infections

    PubMed Central

    Wang, Miao; Gao, Zeqian; Pan, Li; Zhang, Yongguang

    2014-01-01

    microRNAs (miRNAs) are a subtype of short, endogenous, and non-coding RNAs, which post-transcriptionally regulate gene expression. The miRNA-mediated gene silencing mechanism is involved in a wide spectrum of biological processes, such as cellular proliferation, differentiation, and immune responses. Picornaviridae is a large family of RNA viruses, which includes a number of causative agents of many human and animal diseases viz., poliovirus, foot-and-mouth disease virus (FMDV), and coxsackievirus B3 (CVB3). Accumulated evidences have demonstrated that replication of picornaviruses can be regulated by miRNAs and picornaviral infections can alter the expression of cellular miRNAs. Herein, we outline the intricate interactions between miRNAs and picornaviral infections. PMID:24921242

  19. MicroRNAs and Cardiovascular Diseases

    PubMed Central

    Akasaka, Takashi

    2015-01-01

    Coronary artery diseases (CAD) and heart failure have high mortality rate in the world, although much progress has been made in this field in last two decades. There is still a clinical need for a novel diagnostic approach and a therapeutic strategy to decrease the incidence of CAD. MicroRNAs (miRNAs) are highly conserved noncoding small RNA molecules that regulate a large fraction of the genome by binding to complementary messenger RNA sequences, resulting in posttranscriptional gene silencing. Recent studies have shown that specific miRNAs are involved in whole stage of atherosclerosis, from endothelium dysfunction to plaque rupture. These findings suggest that miRNAs are potential biomarkers in early diagnosis and therapeutic targets in CAD. In the present review, we highlight the role of miRNAs in every stage of atherosclerosis, and discuss the prospects of miRNAs in the near future. PMID:25710020

  20. 76 FR 52006 - Information Collection Activity: Leasing of Minerals Other Than Oil, Gas and Sulphur in the Outer...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-19

    ... Minerals Other Than Oil, Gas and Sulphur in the Outer Continental Shelf, Extension of a Collection... Leasing of Minerals Other than Oil, Gas and Sulphur in the Outer Continental Shelf (OMB No. 1010- 0082... Other than Oil, Gas, and Sulphur in the Outer Continental Shelf. OMB Control Number: 1010-0082....

  1. Salivary MicroRNAs as Promising Biomarkers for Detection of Esophageal Cancer

    PubMed Central

    Zhang, Xuchao; Li, Dongfeng; Huang, Jian; Yang, Cuiqin; Zhang, Pingyong; Qin, Yuxuan; Duan, Yifan; Gong, Bo; Li, Zijun

    2013-01-01

    Background and Purpose Tissue microRNAs (miRNAs) can detect cancers and predict prognosis. Several recent studies reported that tissue, plasma, and saliva miRNAs share similar expression profiles. In this study, we investigated the discriminatory power of salivary miRNAs (including whole saliva and saliva supernatant) for detection of esophageal cancer. Materials and Methods By Agilent microarray, six deregulated miRNAs from whole saliva samples from seven patients with esophageal cancer and three healthy controls were selected. The six selected miRNAs were subjected to validation of their expression levels by RT-qPCR using both whole saliva and saliva supernatant samples from an independent set of 39 patients with esophageal cancer and 19 healthy controls. Results Six miRNAs (miR-10b*, miR-144, miR-21, miR-451, miR-486-5p, and miR-634) were identified as targets by Agilent microarray. After validation by RT-qPCR, miR-10b*, miR-144, and miR-451 in whole saliva and miR-10b*, miR-144, miR-21, and miR-451 in saliva supernatant were significantly upregulated in patients, with sensitivities of 89.7, 92.3, 84.6, 79.5, 43.6, 89.7, and 51.3% and specificities of 57.9, 47.4, 57.9%, 57.9, 89.5, 47.4, and 84.2%, respectively. Conclusions We found distinctive miRNAs for esophageal cancer in both whole saliva and saliva supernatant. These miRNAs possess discriminatory power for detection of esophageal cancer. Because saliva collection is noninvasive and convenient, salivary miRNAs show great promise as biomarkers for detection of esophageal cancer in areas at high risk. PMID:23560033

  2. Identification of sRNAs expressed by the human pathogen Neisseria gonorrhoeae under disparate growth conditions.

    PubMed

    McClure, Ryan; Tjaden, Brian; Genco, Caroline

    2014-01-01

    In the last several years, bacterial gene regulation via small RNAs (sRNAs) has been recognized as an important mechanism controlling expression of essential proteins that are critical to bacterial growth and metabolism. Technologies such as RNA-seq are rapidly expanding the field of sRNAs and are enabling a global view of the "sRNAome" of several bacterial species. While numerous sRNAs have been identified in a variety of both Gram-negative and Gram-positive bacteria, only a very small number have been fully characterized in the human pathogen Neisseria gonorrhoeae, the etiological agent of the STD gonorrhea. Here we present the first analysis of N. gonorrhoeae specifically focused on the identification of sRNAs through RNA-seq analysis of the organism cultured under different in vitro growth conditions. Using a new computational program, Rockhopper, to analyze prokaryotic RNA-seq data obtained from N. gonorrhoeae we identified several putative sRNAs and confirmed their expression and size through Northern blot analysis. In addition, RNA was collected from four different growth conditions (iron replete and deplete, as well as with and without co-culture with human endocervical cells). Many of the putative sRNAs identified shoed varying expression levels relative to the different growth conditions examine or were detected only under certain conditions but not others. Comparisons of identified sRNAs with the regulatory pattern of putative mRNA targets revealed possible functional roles for these sRNAs. These studies are the first to carry out a global analysis of N. gonorrhoeae specifically focused on sRNAs and show that RNA-mediated regulation may be an important mechanism of gene control in this human pathogen. PMID:25221548

  3. Genome-wide identification of regulatory RNAs in the human pathogen Clostridium difficile.

    PubMed

    Soutourina, Olga A; Monot, Marc; Boudry, Pierre; Saujet, Laure; Pichon, Christophe; Sismeiro, Odile; Semenova, Ekaterina; Severinov, Konstantin; Le Bouguenec, Chantal; Coppée, Jean-Yves; Dupuy, Bruno; Martin-Verstraete, Isabelle

    2013-05-01

    Clostridium difficile is an emergent pathogen, and the most common cause of nosocomial diarrhea. In an effort to understand the role of small noncoding RNAs (sRNAs) in C. difficile physiology and pathogenesis, we used an in silico approach to identify 511 sRNA candidates in both intergenic and coding regions. In parallel, RNA-seq and differential 5'-end RNA-seq were used for global identification of C. difficile sRNAs and their transcriptional start sites at three different growth conditions (exponential growth phase, stationary phase, and starvation). This global experimental approach identified 251 putative regulatory sRNAs including 94 potential trans riboregulators located in intergenic regions, 91 cis-antisense RNAs, and 66 riboswitches. Expression of 35 sRNAs was confirmed by gene-specific experimental approaches. Some sRNAs, including an antisense RNA that may be involved in control of C. difficile autolytic activity, showed growth phase-dependent expression profiles. Expression of each of 16 predicted c-di-GMP-responsive riboswitches was observed, and experimental evidence for their regulatory role in coordinated control of motility and biofilm formation was obtained. Finally, we detected abundant sRNAs encoded by multiple C. difficile CRISPR loci. These RNAs may be important for C. difficile survival in bacteriophage-rich gut communities. Altogether, this first experimental genome-wide identification of C. difficile sRNAs provides a firm basis for future RNome characterization and identification of molecular mechanisms of sRNA-based regulation of gene expression in this emergent enteropathogen. PMID:23675309

  4. Genome-Wide Identification of Regulatory RNAs in the Human Pathogen Clostridium difficile

    PubMed Central

    Soutourina, Olga A.; Monot, Marc; Boudry, Pierre; Saujet, Laure; Pichon, Christophe; Sismeiro, Odile; Semenova, Ekaterina; Severinov, Konstantin; Le Bouguenec, Chantal; Coppée, Jean-Yves; Dupuy, Bruno; Martin-Verstraete, Isabelle

    2013-01-01

    Clostridium difficile is an emergent pathogen, and the most common cause of nosocomial diarrhea. In an effort to understand the role of small noncoding RNAs (sRNAs) in C. difficile physiology and pathogenesis, we used an in silico approach to identify 511 sRNA candidates in both intergenic and coding regions. In parallel, RNA–seq and differential 5′-end RNA–seq were used for global identification of C. difficile sRNAs and their transcriptional start sites at three different growth conditions (exponential growth phase, stationary phase, and starvation). This global experimental approach identified 251 putative regulatory sRNAs including 94 potential trans riboregulators located in intergenic regions, 91 cis-antisense RNAs, and 66 riboswitches. Expression of 35 sRNAs was confirmed by gene-specific experimental approaches. Some sRNAs, including an antisense RNA that may be involved in control of C. difficile autolytic activity, showed growth phase-dependent expression profiles. Expression of each of 16 predicted c-di-GMP-responsive riboswitches was observed, and experimental evidence for their regulatory role in coordinated control of motility and biofilm formation was obtained. Finally, we detected abundant sRNAs encoded by multiple C. difficile CRISPR loci. These RNAs may be important for C. difficile survival in bacteriophage-rich gut communities. Altogether, this first experimental genome-wide identification of C. difficile sRNAs provides a firm basis for future RNome characterization and identification of molecular mechanisms of sRNA–based regulation of gene expression in this emergent enteropathogen. PMID:23675309

  5. Comprehensive evaluation of serum microRNAs as biomarkers in multiple sclerosis

    PubMed Central

    Regev, Keren; Paul, Anu; Healy, Brian; von Glenn, Felipe; Diaz-Cruz, Camilo; Gholipour, Taha; Mazzola, Maria Antonietta; Raheja, Radhika; Nejad, Parham; Glanz, Bonnie I.; Kivisakk, Pia; Chitnis, Tanuja; Weiner, Howard L.

    2016-01-01

    Objective: To identify circulating microRNAs (miRNAs) linked to disease stage and disability in multiple sclerosis (MS). Methods: Sera from 296 participants including patients with MS, other neurologic diseases (Alzheimer disease and amyotrophic lateral sclerosis), and inflammatory diseases (rheumatoid arthritis and asthma) and healthy controls (HCs) were tested. miRNA profiles were determined using LNA (locked nucleic acid)-based quantitative PCR. Patients with MS were categorized according to disease stage and disability. In the discovery phase, 652 miRNAs were measured in sera from 26 patients with MS and 20 HCs. Following this, significant miRNAs (p < 0.05) from the discovery set were validated using quantitative PCR in 58 patients with MS, 30 HCs, and in 74 samples from other disease controls (Alzheimer disease, amyotrophic lateral sclerosis, asthma, and rheumatoid arthritis). Results: We validated 7 miRNAs that differentiate patients with MS from HCs (p < 0.05 in both the discovery and validation phase); miR-320a upregulation was the most significantly changing serum miRNA in patients with MS. We also identified 2 miRNAs linked to disease progression, with miR-27a-3p being the most significant. Ten miRNAs correlated with the Expanded Disability Status Scale of which miR.199a.5p had the strongest correlation with disability. Of the 15 unique miRNAs we identified in the different group comparisons, 12 have previously been reported to be associated with MS but not in serum. Conclusions: Our findings identify circulating serum miRNAs as potential biomarkers to diagnose and monitor disease status in MS. Classification of evidence: This study provides Class III evidence that circulating serum miRNAs can be used as biomarker for MS. PMID:27606352

  6. Delivery of Therapeutic RNAs Into Target Cells IN VIVO

    NASA Astrophysics Data System (ADS)

    Ng, Mei Ying; Hagen, Thilo

    2014-02-01

    RNA-based therapy is one of the most promising approaches to treat human diseases. Specifically, the use of short interfering RNA (siRNA) siRNA and microRNA (miRNA) mimics for in vivo RNA interference has immense potential as it directly lowers the expression of the therapeutic target protein. However, there are a number of major roadblocks to the successful implementation of siRNA and other RNA based therapies in the clinic. These include the instability of RNAs in vivo and the difficulty to efficiently deliver the RNA into the target cells. Hence, various innovative approaches have been taken over the years to develop effective RNA delivery methods. These methods include liposome-, polymeric nanoparticle- and peptide-mediated cellular delivery. In a recent innovative study, bioengineered bacterial outer membrane vesicles were used as vehicles for effective delivery of siRNA into cells in vivo.

  7. Differential Expression of Exosomal microRNAs in Prefrontal Cortices of Schizophrenia and Bipolar Disorder Patients

    PubMed Central

    Kozubek, James A.; Winslow, Ashley R.; Medina, Juan; Costa, Joan; Schmitt, Andrea; Schneider, Anja; Cabral, Howard; Cagsal-Getkin, Ozge; Vanderburg, Charles R.; Delalle, Ivana

    2013-01-01

    Exosomes are cellular secretory vesicles containing microRNAs (miRNAs). Once secreted, exosomes are able to attach to recipient cells and release miRNAs potentially modulating the function of the recipient cell. We hypothesized that exosomal miRNA expression in brains of patients diagnosed with schizophrenia (SZ) and bipolar disorder (BD) might differ from controls, reflecting either disease-specific or common aberrations in SZ and BD patients. The sources of the analyzed samples included McLean 66 Cohort Collection (Harvard Brain Tissue Resource Center), BrainNet Europe II (BNE, a consortium of 18 brain banks across Europe) and Boston Medical Center (BMC). Exosomal miRNAs from frozen postmortem prefrontal cortices with well-preserved RNA were isolated and submitted to profiling by Luminex FLEXMAP 3D microfluidic device. Multiple statistical analyses of microarray data suggested that certain exosomal miRNAs were differentially expressed in SZ and BD subjects in comparison to controls. RT-PCR validation confirmed that two miRNAs, miR-497 in SZ samples and miR-29c in BD samples, have significantly increased expression when compared to control samples. These results warrant future studies to evaluate the potential of exosome-derived miRNAs to serve as biomarkers of SZ and BD. PMID:23382797

  8. Outer Appearances Can Be Deceiving

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This graph shows the chemical composition of the rock at Gusev Crater dubbed 'Mazatzal' after it was brushed and ground by the Mars Exploration Rover Spirit's rock abrasion tool. The data, taken by the rover's alpha particle X-ray spectrometer over the last few sols, show that the amount of chlorine and sulfur tri-oxide in Mazatzal first increased after brushing, then diminished after grinding. The interior of the rock appears to have the same chemical make-up as other volcanic or basalt rocks studied in the Gusev Crater area ('Adirondack' and 'Humphrey'). Its outer coating or rind, on the other hand, appears to be of a different constitution. Scientists are still puzzling out the implications of these data.

    The larger symbols on the graph represent inferred rock compositions, while the smaller symbols are actual data points. Observations were made at the target dubbed 'New York' on Mazatzal.

  9. Aft outer rim seal arrangement

    DOEpatents

    Lee, Ching-Pang; Tham, Kok-Mun; Schroeder, Eric; Meeroff, Jamie; Miller, Jr., Samuel R; Marra, John J; Campbell, Christian X

    2015-04-28

    An outer rim seal arrangement (10), including: an annular rim (70) centered about a longitudinal axis (30) of a rotor disc (31), extending fore and having a fore-end (72), an outward-facing surface (74), and an inward-facing surface (76); a lower angel wing (62) extending aft from a base of a turbine blade (22) and having an aft end (64) disposed radially inward of the rim inward-facing surface to define a lower angel wing seal gap (80); an upper angel wing (66) extending aft from the turbine blade base and having an aft end (68) disposed radially outward of the rim outward-facing surface to define a upper angel wing seal gap (80, 82); and guide vanes (100) disposed on the rim inward-facing surface in the lower angel wing seal gap. Pumping fins (102) may be disposed on the upper angel wing seal aft end in the upper angel wing seal gap.

  10. Chemistry of the outer planets

    NASA Technical Reports Server (NTRS)

    Scattergood, Thomas W.

    1992-01-01

    Various aspects were studied of past or present chemistry in the atmospheres of the outer planets and their satellites using lab simulations. Three areas were studied: (1) organic chemistry induced by kinetically hot hydrogen atoms in the region of Jupiter's atmosphere containing the ammonia cirrus clouds; (2) the conversion of NH3 into N2 by plasmas associated with entry of meteors and other objects into the atmosphere of early Titan; and (3) the synthesis of simple hydrocarbons and HCN by lightning in mixtures containing N2, CH4, and NH3 representing the atmospheres of Titan and the outer planets. The results showed that: (1) hot H2 atoms formed from the photodissociation of NH3 in Jupiter's atmosphere could account for some of the atmospheric chemistry in the ammonia cirrus cloud region; (2) the thermalization of hot H2 atoms in atmospheres predominated by molecular H is not as rapid as predicted by elastic collision theory; (3) the net quantum loss of NH3 in the presence of a 200 fold excess of H2 is 0.02, much higher than was expected from the amount of H2 present; (4) the conversion of NH3 into N2 in plasmas associated with infalling meteors is very efficient and rapid, and could account for most of the N2 present on Titan; (5) the yields of C2H2 and HCN from lightning induced chemistry in mixtures of CH4 and N2 is consistent with quenched thermodynamic models of the discharge core; and (6) photolysis induced by the UV light emitted by the gases in the hot plasmas may account for some, if not most, of the excess production of C2H6 and the more complex hydrocarbons.

  11. Viral Noncoding RNAs in Cancer Biology.

    PubMed

    Li, Zhi; Fu, Shujun; Sun, Lun-Quan

    2016-01-01

    Over 12 % of all human cancers are caused by oncoviruses, primarily including Epstein-Barr virus (EBV), high-risk human papillomaviruses (HPVs), hepatitis B and C viruses (HBV and HCV, respectively), and Kaposi's sarcoma herpesvirus (KSHV). In addition to viral oncoproteins, a variety of noncoding RNAs (ncRNAs) produced by oncoviruses have been recognized as important cofactors that contribute to the oncogenic events. In this chapter, we will focus on the recent understanding of the long and short noncoding RNAs, as well as microRNAs of the viruses, and discuss their roles in the biology of multistep oncogenesis mediated by established human oncoviruses. PMID:27376743

  12. MicroRNAs and Epithelial Immunity

    PubMed Central

    Liu, Jun; Drescher, Kristen M.; Chen, Xian-Ming

    2009-01-01

    MicroRNAs are required for development and maintenance of the epithelial barrier. It is hypothesized that microRNAs are involved in regulating epithelial anti-microbial defenses by targeting key epithelial effector molecules and/or influencing intracellular signaling pathways. Additionally, aberrant microRNA expression has been implicated in the pathogenesis of various diseases at the skin and mucosa. Increased understanding of the role of microRNAs in epithelial immunoregulation and identification of microRNAs of pathogenetic significance will enhance our understanding of epithelial immunobiology and immunopathology. PMID:19811319

  13. MicroRNAs involved in bone formation

    PubMed Central

    Papaioannou, Garyfallia; Mirzamohammadi, Fatemeh; Kobayashi, Tatsuya

    2014-01-01

    During skeletal development, mesenchymal progenitor cells undergo a multistage differentiation process in which they proliferate and become bone- and cartilage-forming cells. This process is tightly regulated by multiple levels of regulatory systems. The small non-coding RNAs, microRNAs (miRNAs), post-transcriptionally regulate gene expression. Recent studies have demonstrated that miRNAs play significant roles in all stages of bone formation, suggesting the possibility that miRNAs can be novel therapeutic targets for skeletal diseases. Here, we review the role and mechanism of action of miRNAs in bone formation. We discuss roles of specific miRNAs in major types of bone cells, osteoblasts, chondrocytes, osteoclasts, and their progenitors. Except a few, the current knowledge about miRNAs in bone formation has been obtained mainly by in vitro studies; further validation of these findings in vivo is awaited. We also discuss about several miRNAs of particular interest in the light of future therapies of bone diseases. PMID:25108446

  14. miRNAs in Bone Development

    PubMed Central

    Papaioannou, Garyfallia

    2015-01-01

    Skeletal development is a multistage process during which mesenchymal progenitor cells undergo proliferation and differentiation and subsequently give rise to bone and cartilage forming cells. Each step is regulated by various transcription factors and signaling molecules. microRNAs are small non-coding RNAs that post-transcriptionally regulate gene expression. Several in vivo and in vitro studies have shown that miRNAs play significant roles in skeletal development. Identifying their functions may give insights into the treatment of developmental disorders of the skeleton. This review summarizes miRNAs that have been shown to participate in various stages of skeletal development by targeting crucial factors. PMID:27019617

  15. Regulatory Roles of Non-Coding RNAs in Colorectal Cancer

    PubMed Central

    Wang, Jun; Song, Yong-Xi; Ma, Bin; Wang, Jia-Jun; Sun, Jing-Xu; Chen, Xiao-Wan; Zhao, Jun-Hua; Yang, Yu-Chong; Wang, Zhen-Ning

    2015-01-01

    Non-coding RNAs (ncRNAs) have recently gained attention because of their involvement in different biological processes. An increasing number of studies have demonstrated that mutations or abnormal expression of ncRNAs are closely associated with various diseases including cancer. The present review is a comprehensive examination of the aberrant regulation of ncRNAs in colorectal cancer (CRC) and a summary of the current findings on ncRNAs, including long ncRNAs, microRNAs, small interfering RNAs, small nucleolar RNAs, small nuclear RNAs, Piwi-interacting RNAs, and circular RNAs. These ncRNAs might become novel biomarkers and targets as well as potential therapeutic tools for the treatment of CRC in the near future and this review may provide important clues for further research on CRC and for the selection of effective therapeutic targets. PMID:26307974

  16. Role of Viral miRNAs and Epigenetic Modifications in Epstein-Barr Virus-Associated Gastric Carcinogenesis

    PubMed Central

    Giudice, Aldo; D'Arena, Giovanni; Crispo, Anna; Tecce, Mario Felice; Nocerino, Flavia; Grimaldi, Maria; Rotondo, Emanuela; D'Ursi, Anna Maria; Scrima, Mario; Galdiero, Massimiliano; Ciliberto, Gennaro; Capunzo, Mario; Franci, Gianluigi; Barbieri, Antonio; Bimonte, Sabrina; Montella, Maurizio

    2016-01-01

    MicroRNAs are short (21–23 nucleotides), noncoding RNAs that typically silence posttranscriptional gene expression through interaction with target messenger RNAs. Currently, miRNAs have been identified in almost all studied multicellular eukaryotes in the plant and animal kingdoms. Additionally, recent studies reported that miRNAs can also be encoded by certain single-cell eukaryotes and by viruses. The vast majority of viral miRNAs are encoded by the herpesviruses family. These DNA viruses including Epstein-Barr virus encode their own miRNAs and/or manipulate the expression of cellular miRNAs to facilitate respective infection cycles. Modulation of the control pathways of miRNAs expression is often involved in the promotion of tumorigenesis through a specific cascade of transduction signals. Notably, latent infection with Epstein-Barr virus is considered liable of causing several types of malignancies, including the majority of gastric carcinoma cases detected worldwide. In this review, we describe the role of the Epstein-Barr virus in gastric carcinogenesis, summarizing the functions of the Epstein-Barr virus-encoded viral proteins and related epigenetic alterations as well as the roles of Epstein-Barr virus-encoded and virally modulated cellular miRNAs. PMID:26977250

  17. Role of Viral miRNAs and Epigenetic Modifications in Epstein-Barr Virus-Associated Gastric Carcinogenesis.

    PubMed

    Giudice, Aldo; D'Arena, Giovanni; Crispo, Anna; Tecce, Mario Felice; Nocerino, Flavia; Grimaldi, Maria; Rotondo, Emanuela; D'Ursi, Anna Maria; Scrima, Mario; Galdiero, Massimiliano; Ciliberto, Gennaro; Capunzo, Mario; Franci, Gianluigi; Barbieri, Antonio; Bimonte, Sabrina; Montella, Maurizio

    2016-01-01

    MicroRNAs are short (21-23 nucleotides), noncoding RNAs that typically silence posttranscriptional gene expression through interaction with target messenger RNAs. Currently, miRNAs have been identified in almost all studied multicellular eukaryotes in the plant and animal kingdoms. Additionally, recent studies reported that miRNAs can also be encoded by certain single-cell eukaryotes and by viruses. The vast majority of viral miRNAs are encoded by the herpesviruses family. These DNA viruses including Epstein-Barr virus encode their own miRNAs and/or manipulate the expression of cellular miRNAs to facilitate respective infection cycles. Modulation of the control pathways of miRNAs expression is often involved in the promotion of tumorigenesis through a specific cascade of transduction signals. Notably, latent infection with Epstein-Barr virus is considered liable of causing several types of malignancies, including the majority of gastric carcinoma cases detected worldwide. In this review, we describe the role of the Epstein-Barr virus in gastric carcinogenesis, summarizing the functions of the Epstein-Barr virus-encoded viral proteins and related epigenetic alterations as well as the roles of Epstein-Barr virus-encoded and virally modulated cellular miRNAs. PMID:26977250

  18. A general approach to high-yield biosynthesis of chimeric RNAs bearing various types of functional small RNAs for broad applications.

    PubMed

    Chen, Qiu-Xia; Wang, Wei-Peng; Zeng, Su; Urayama, Shiro; Yu, Ai-Ming

    2015-04-20

    RNA research and therapy relies primarily on synthetic RNAs. We employed recombinant RNA technology toward large-scale production of pre-miRNA agents in bacteria, but found the majority of target RNAs were not or negligibly expressed. We thus developed a novel strategy to achieve consistent high-yield biosynthesis of chimeric RNAs carrying various small RNAs (e.g. miRNAs, siRNAs and RNA aptamers), which was based upon an optimal noncoding RNA scaffold (OnRS) derived from tRNA fusion pre-miR-34a (tRNA/mir-34a). Multi-milligrams of chimeric RNAs (e.g. OnRS/miR-124, OnRS/GFP-siRNA, OnRS/Neg (scrambled RNA) and OnRS/MGA (malachite green aptamer)) were readily obtained from 1 l bacterial culture. Deep sequencing analyses revealed that mature miR-124 and target GFP-siRNA were selectively released from chimeric RNAs in human cells. Consequently, OnRS/miR-124 was active in suppressing miR-124 target gene expression and controlling cellular processes, and OnRS/GFP-siRNA was effective in knocking down GFP mRNA levels and fluorescent intensity in ES-2/GFP cells and GFP-transgenic mice. Furthermore, the OnRS/MGA sensor offered a specific strong fluorescence upon binding MG, which was utilized as label-free substrate to accurately determine serum RNase activities in pancreatic cancer patients. These results demonstrate that OnRS-based bioengineering is a common, robust and versatile strategy to assemble various types of small RNAs for broad applications. PMID:25800741

  19. A general approach to high-yield biosynthesis of chimeric RNAs bearing various types of functional small RNAs for broad applications

    PubMed Central

    Chen, Qiu-Xia; Wang, Wei-Peng; Zeng, Su; Urayama, Shiro; Yu, Ai-Ming

    2015-01-01

    RNA research and therapy relies primarily on synthetic RNAs. We employed recombinant RNA technology toward large-scale production of pre-miRNA agents in bacteria, but found the majority of target RNAs were not or negligibly expressed. We thus developed a novel strategy to achieve consistent high-yield biosynthesis of chimeric RNAs carrying various small RNAs (e.g. miRNAs, siRNAs and RNA aptamers), which was based upon an optimal noncoding RNA scaffold (OnRS) derived from tRNA fusion pre-miR-34a (tRNA/mir-34a). Multi-milligrams of chimeric RNAs (e.g. OnRS/miR-124, OnRS/GFP-siRNA, OnRS/Neg (scrambled RNA) and OnRS/MGA (malachite green aptamer)) were readily obtained from 1 l bacterial culture. Deep sequencing analyses revealed that mature miR-124 and target GFP-siRNA were selectively released from chimeric RNAs in human cells. Consequently, OnRS/miR-124 was active in suppressing miR-124 target gene expression and controlling cellular processes, and OnRS/GFP-siRNA was effective in knocking down GFP mRNA levels and fluorescent intensity in ES-2/GFP cells and GFP-transgenic mice. Furthermore, the OnRS/MGA sensor offered a specific strong fluorescence upon binding MG, which was utilized as label-free substrate to accurately determine serum RNase activities in pancreatic cancer patients. These results demonstrate that OnRS-based bioengineering is a common, robust and versatile strategy to assemble various types of small RNAs for broad applications. PMID:25800741

  20. Regimes for the ocean, outer space, and weather

    NASA Technical Reports Server (NTRS)

    Brown, S.; Cornell, N. W.; Fabian, L. L.; Weiss, E. B.

    1977-01-01

    The allocation of resources among users of the oceans, outer space and the weather is discussed. Attention is given to the international management of maritime navigation, the control of fisheries, offshore oil and gas exploitation, mineral exploitation in the deep seabed (especially the mining of manganese nodules), and the regulation of oceanographic studies. The management of outer space is considered, with special reference to remote sensing by satellites, television broadcasting, the technical requirements of maritime satellites, and problems associated with satellite frequency and orbit allocation. Rainmaking and typhoon modification, as well as the distribution of weather modification capabilities in the world, are also mentioned. The United Nations, international agencies and tribunals, and multi- or bilateral agreements are some of the implements suggested for use in the regulation of the oceans, outer space and the weather.

  1. MICRO RNAs IN SEEDS: MODIFIED DETECTION TECHNIQUES AND POTENTIAL APPLICATIONS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    MicroRNAs (miRNAs) are small (21–24 nucleotides), single-stranded RNAs that regulate target gene expression at transcriptional and posttranscriptional levels. miRNAs play crucial roles in plant development, maintenance of homeostasis, and responses to environmental signals. miRNAs and their target g...

  2. microRNAs as Pharmacological Targets in Endothelial Cell Function and Dysfunction

    PubMed Central

    Chamorro-Jorganes, Aránzazu; Araldi, Elisa; Suárez, Yajaira

    2013-01-01

    Endothelial cell dysfunction is a term which implies the dysregulation of normal endothelial cell functions, including impairment of the barrier functions, control of vascular tone, disturbance of proliferative, migratory and morphogenic capacities of endothelial cells, as well as control of leukocyte trafficking. MicroRNAs (miRNAs) are short non-coding RNAs that have emerged as critical regulators of gene expression acting predominantly at the post-transcriptional level. This review summarizes the latest insights in the identification of endothelial-specific miRNAs and their targets, as well as their roles in controlling endothelial cell functions in both autocrine and paracrine manner. In addition, we discuss the therapeutic potential for the treatment of endothelial cell dysfunction and associated vascular pathophysiological conditions. PMID:23603154

  3. Characterization of defective interfering RNAs associated with RNA plant viruses

    SciTech Connect

    Morris, T.J. . School of Biological Sciences); Jackson, A.O. . Dept. of Plant Pathology)

    1993-01-01

    Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since the original observation with TBSV, we discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), and many other reports have now appeared characterizing DI and DI-like RNAs in other plant viral infections. We are seeking to improve our understanding of the mechanisms of DI generation and the precise nature of the RNA sequences necessary for DI replication and encapsidation. We also want to address the nature of the DI mediated symptom attenuation and interference effects in plants, and to determine the feasibility of using transgenic plants constitutively expressing DI RNAs for disease control. The progress made on each of these objectives is summarized along with the proposed experiments for the continuation period.

  4. Nucleocytoplasmic Transport of RNAs and RNA-Protein Complexes.

    PubMed

    Sloan, Katherine E; Gleizes, Pierre-Emmanuel; Bohnsack, Markus T

    2016-05-22

    RNAs and ribonucleoprotein complexes (RNPs) play key roles in mediating and regulating gene expression. In eukaryotes, most RNAs are transcribed, processed and assembled with proteins in the nucleus and then either function in the cytoplasm or also undergo a cytoplasmic phase in their biogenesis. This compartmentalization ensures that sequential steps in gene expression and RNP production are performed in the correct order and it allows important quality control mechanisms that prevent the involvement of aberrant RNAs/RNPs in these cellular pathways. The selective exchange of RNAs/RNPs between the nucleus and cytoplasm is enabled by nuclear pore complexes, which function as gateways between these compartments. RNA/RNP transport is facilitated by a range of nuclear transport receptors and adaptors, which are specifically recruited to their cargos and mediate interactions with nucleoporins to allow directional translocation through nuclear pore complexes. While some transport factors are only responsible for the export/import of a certain class of RNA/RNP, others are multifunctional and, in the case of large RNPs, several export factors appear to work together to bring about export. Recent structural studies have revealed aspects of the mechanisms employed by transport receptors to enable specific cargo recognition, and genome-wide approaches have provided the first insights into the diverse composition of pre-mRNPs during export. Furthermore, the regulation of RNA/RNP export is emerging as an important means to modulate gene expression under stress conditions and in disease. PMID:26434509

  5. Environmental Health and Long Non-coding RNAs.

    PubMed

    Karlsson, Oskar; Baccarelli, Andrea A

    2016-09-01

    An individual's risk of developing a common disease typically depends on an interaction of genetic and environmental factors. Epigenetic research is uncovering novel ways through which environmental factors such as diet, air pollution, and chemical exposure can affect our genes. DNA methylation and histone modifications are the most commonly studied epigenetic mechanisms. The role of long non-coding RNAs (lncRNAs) in epigenetic processes has been more recently highlighted. LncRNAs are defined as transcribed RNA molecules greater than 200 nucleotides in length with little or no protein-coding capability. While few functional lncRNAs have been well characterized to date, they have been demonstrated to control gene regulation at every level, including transcriptional gene silencing via regulation of the chromatin structure and DNA methylation. This review aims to provide a general overview of lncRNA function with a focus on their role as key regulators of health and disease and as biomarkers of environmental exposure. PMID:27234044

  6. Oscillating primary transcripts harbor miRNAs with circadian functions

    PubMed Central

    Wang, Haifang; Fan, Zenghua; Zhao, Meng; Li, Juan; Lu, Minghua; Liu, Wei; Ying, Hao; Liu, Mofang; Yan, Jun

    2016-01-01

    The roles of miRNAs as important post-transcriptional regulators in the circadian clock have been suggested in several studies. But the search for circadian miRNAs has led to disparate results. Here we demonstrated that at least 57 miRNA primary transcripts are rhythmically transcribed in mouse liver. Most of these transcripts are under the regulation of circadian transcription factors such as BMAL1/CLOCK and REV-ERBα/β. However, the mature miRNAs derived from these transcripts are either not oscillating or oscillating at low amplitudes, which could explain the inconsistency of different circadian miRNA studies. In order to show that these circadian primary transcripts can give rise to miRNAs with circadian functions, we over-expressed one of them, miR-378, in mouse by adenovirus injection. We found a significant over-representation of circadian oscillating genes under-expressed by miR-378 over-expression in liver. In particular, we observed that miR-378 modulates the oscillation amplitudes of Cdkn1a in the control of cell cycle and Por in the regulation of oxidation reduction by forming partnership with different circadian transcription factors. Our study suggests that circadian transcription of miRNA at primary transcript level can be a good indicator for circadian miRNA functions. PMID:26898952

  7. Identification and characterization of immune-related microRNAs in blunt snout bream, Megalobrama amblycephala.

    PubMed

    Yuhong, Jiang; Leilei, Tang; Fuyun, Zhang; Hongyang, Jiang; Xiaowen, Liu; Liying, Yang; Lei, Zhang; Jingrong, Mao; Jinpeng, Yan

    2016-02-01

    MicroRNAs (miRNAs) play vital roles in diverse biological processes, including in immune response. Blunt snout bream (Megalobrama amblycephala) is a prevalent and important commercial endemic freshwater fish species in China's intensive polyculture systems. To identify immune-related miRNAs of M. amblycephala, two small RNA (sRNA) libraries from immune tissues with or without lipopolysaccharide (LPS) stimulation were constructed and sequenced using the high-throughput sequencing technology. Totally, 16,425,543 and 15,076,813 raw reads, corresponding to 14,156,755 and 13,445,869 clean reads, were obtained in the normal and infected libraries, respectively. A total of 324 miRNAs, including 218 known miRNAs and 106 putative novel miRNAs were identified by bioinformatic analysis. We analyzed differentially expressed miRNAs between two libraries using pairwise comparison. 113 (34.88%) miRNAs were found to be significantly differentially expressed between two libraries, with 63 (55.75%) exhibiting elevated expression in LPS stimulation sample. Thereinto, a number of known miRNAs were identified immune-related. Real-time quantitative PCR (RT-qPCR) were implemented for 12 miRNAs of two samples, and agreement was confirmed between the sequencing and RT-qPCR data. Target genes likely regulated by these differentially expressed miRNAs were predicted using computational prediction. The functional annotation of target genes by Gene Ontology enrichment (GO) and Kyoto Encyclopedia of Genes and Genomes pathway analysis (KEGG) indicated that a majority of differential miRNAs might involved in immune response. To our knowledge, this is the first comprehensive study of miRNAs in response to LPS stimulation in M. amblycephala, even in fish. These results deepened our understanding of the role of miRNAs in the intricate host's immune system, and should be useful to develop new control strategies for host immune defense against various bacterial invasions in M. amblycephala. PMID

  8. Characterization of microRNAs in Mud Crab Scylla paramamosain under Vibrio parahaemolyticus Infection

    PubMed Central

    Li, Chuanbiao; Zhang, Zhao; Zhou, Lizhen; Wang, Shijia; Wang, Shuqi; Zhang, Yueling; Wen, Xiaobo

    2013-01-01

    Background Infection of bacterial Vibrio parahaemolyticus is common in mud crab farms. However, the mechanisms of the crab’s response to pathogenic V. parahaemolyticus infection are not fully understood. MicroRNAs (miRNAs) are a class of small noncoding RNAs that function as regulators of gene expression and play essential roles in various biological processes. To understand the underlying mechanisms of the molecular immune response of the crab to the pathogens, high-throughput Illumina/Solexa deep sequencing technology was used to investigate the expression profiles of miRNAs in S. paramamosain under V. parahaemolyticus infection. Methodology/Principal Findings Two mixed RNA pools of 7 tissues (intestine, heart, liver, gill, brain, muscle and blood) were obtained from V. parahaemolyticus infected crabs and the control groups, respectively. By aligning the sequencing data with known miRNAs, we characterized 421 miRNA families, and 133 conserved miRNA families in mud crab S. paramamosain were either identical or very similar to existing miRNAs in miRBase. Stem-loop qRT-PCRs were used to scan the expression levels of four randomly chosen differentially expressed miRNAs and tissue distribution. Eight novel potential miRNAs were confirmed by qRT-PCR analysis and the precursors of these novel miRNAs were verified by PCR amplification, cloning and sequencing in S. paramamosain. 161 miRNAs (106 of which up-regulated and 55 down-regulated) were significantly differentially expressed during the challenge and the potential targets of these differentially expressed miRNAs were predicted. Furthermore, we demonstrated evolutionary conservation of mud crab miRNAs in the animal evolution process. Conclusions/Significance In this study, a large number of miRNAs were identified in S. paramamosain when challenged with V. parahaemolyticus, some of which were differentially expressed. The results show that miRNAs might play some important roles in regulating gene expression in mud

  9. Profilings of MicroRNAs in the Liver of Common Carp (Cyprinus carpio) Infected with Flavobacterium columnare

    PubMed Central

    Zhao, Lijuan; Lu, Hong; Meng, Qinglei; Wang, Jinfu; Wang, Weimin; Yang, Ling; Lin, Li

    2016-01-01

    MicroRNAs (miRNAs) play important roles in regulation of many biological processes in eukaryotes, including pathogen infection and host interactions. Flavobacterium columnare (FC) infection can cause great economic loss of common carp (Cyprinus carpio) which is one of the most important cultured fish in the world. However, miRNAs in response to FC infection in common carp has not been characterized. To identify specific miRNAs involved in common carp infected with FC, we performed microRNA sequencing using livers of common carp infected with and without FC. A total of 698 miRNAs were identified, including 142 which were identified and deposited in the miRbase database (Available online: http://www.mirbase.org/) and 556 had only predicted miRNAs. Among the deposited miRNAs, eight miRNAs were first identified in common carp. Thirty of the 698 miRNAs were differentially expressed miRNAs (DIE-miRNAs) between the FC infected and control samples. From the DIE-miRNAs, seven were selected randomly and their expression profiles were confirmed to be consistent with the microRNA sequencing results using RT-PCR and qRT-PCR. In addition, a total of 27,363 target genes of the 30 DIE-miRNAs were predicted. The target genes were enriched in five Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, including focal adhesion, extracellular matrix (ECM)-receptor interaction, erythroblastic leukemia viral oncogene homolog (ErbB) signaling pathway, regulation of actin cytoskeleton, and adherent junction. The miRNA expression profile of the liver of common carp infected with FC will pave the way for the development of effective strategies to fight against FC infection. PMID:27092486

  10. Profilings of MicroRNAs in the Liver of Common Carp (Cyprinus carpio) Infected with Flavobacterium columnare.

    PubMed

    Zhao, Lijuan; Lu, Hong; Meng, Qinglei; Wang, Jinfu; Wang, Weimin; Yang, Ling; Lin, Li

    2016-01-01

    MicroRNAs (miRNAs) play important roles in regulation of many biological processes in eukaryotes, including pathogen infection and host interactions. Flavobacterium columnare (FC) infection can cause great economic loss of common carp (Cyprinus carpio) which is one of the most important cultured fish in the world. However, miRNAs in response to FC infection in common carp has not been characterized. To identify specific miRNAs involved in common carp infected with FC, we performed microRNA sequencing using livers of common carp infected with and without FC. A total of 698 miRNAs were identified, including 142 which were identified and deposited in the miRbase database (Available online: http://www.mirbase.org/) and 556 had only predicted miRNAs. Among the deposited miRNAs, eight miRNAs were first identified in common carp. Thirty of the 698 miRNAs were differentially expressed miRNAs (DIE-miRNAs) between the FC infected and control samples. From the DIE-miRNAs, seven were selected randomly and their expression profiles were confirmed to be consistent with the microRNA sequencing results using RT-PCR and qRT-PCR. In addition, a total of 27,363 target genes of the 30 DIE-miRNAs were predicted. The target genes were enriched in five Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, including focal adhesion, extracellular matrix (ECM)-receptor interaction, erythroblastic leukemia viral oncogene homolog (ErbB) signaling pathway, regulation of actin cytoskeleton, and adherent junction. The miRNA expression profile of the liver of common carp infected with FC will pave the way for the development of effective strategies to fight against FC infection. PMID:27092486

  11. The Host RNAs in Retroviral Particles.

    PubMed

    Telesnitsky, Alice; Wolin, Sandra L

    2016-01-01

    As they assemble, retroviruses encapsidate both their genomic RNAs and several types of host RNA. Whereas limited amounts of messenger RNA (mRNA) are detectable within virion populations, the predominant classes of encapsidated host RNAs do not encode proteins, but instead include endogenous retroelements and several classes of non-coding RNA (ncRNA), some of which are packaged in significant molar excess to the viral genome. Surprisingly, although the most abundant host RNAs in retroviruses are also abundant in cells, unusual forms of these RNAs are packaged preferentially, suggesting that these RNAs are recruited early in their biogenesis: before associating with their cognate protein partners, and/or from transient or rare RNA populations. These RNAs' packaging determinants differ from the viral genome's, and several of the abundantly packaged host ncRNAs serve cells as the scaffolds of ribonucleoprotein particles. Because virion assembly is equally efficient whether or not genomic RNA is available, yet RNA appears critical to the structural integrity of retroviral particles, it seems possible that the selectively encapsidated host ncRNAs might play roles in assembly. Indeed, some host ncRNAs appear to act during replication, as some transfer RNA (tRNA) species may contribute to nuclear import of human immunodeficiency virus 1 (HIV-1) reverse transcription complexes, and other tRNA interactions with the viral Gag protein aid correct trafficking to plasma membrane assembly sites. However, despite high conservation of packaging for certain host RNAs, replication roles for most of these selectively encapsidated RNAs-if any-have remained elusive. PMID:27548206

  12. Long noncoding RNAs: Lessons from genomic imprinting.

    PubMed

    Kanduri, Chandrasekhar

    2016-01-01

    Genomic imprinting has been a great resource for studying transcriptional and post-transcriptional-based gene regulation by long noncoding RNAs (lncRNAs). In this article, I overview the functional role of intergenic lncRNAs (H19, IPW, and MEG3), antisense lncRNAs (Kcnq1ot1, Airn, Nespas, Ube3a-ATS), and enhancer lncRNAs (IG-DMR eRNAs) to understand the diverse mechanisms being employed by them in cis and/or trans to regulate the parent-of-origin-specific expression of target genes. Recent evidence suggests that some of the lncRNAs regulate imprinting by promoting intra-chromosomal higher-order chromatin compartmentalization, affecting replication timing and subnuclear positioning. Whereas others act via transcriptional occlusion or transcriptional collision-based mechanisms. By establishing genomic imprinting of target genes, the lncRNAs play a critical role in important biological functions, such as placental and embryonic growth, pluripotency maintenance, cell differentiation, and neural-related functions such as synaptic development and plasticity. An emerging consensus from the recent evidence is that the imprinted lncRNAs fine-tune gene expression of the protein-coding genes to maintain their dosage in cell. Hence, lncRNAs from imprinted clusters offer insights into their mode of action, and these mechanisms have been the basis for uncovering the mode of action of lncRNAs in several other biological contexts. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. PMID:26004516

  13. Serum miRNAs Signature Plays an Important Role in Keloid Disease.

    PubMed

    Luan, Y; Liu, Y; Liu, C; Lin, Q; He, F; Dong, X; Xiao, Z

    2016-01-01

    The molecular mechanism underlying the pathogenesis of keloid is largely unknown. MicroRNA (miRNA) is a class of small regulatory RNA that has emerged as a group of posttranscriptional gene repressors, participating in diverse pathophysiological processes of skin diseases. We investigated the expression profiles of miRNAs in the sera of patients to decipher the complicated factors involved in the development of keloid disease. MiRNA expression profiling in the sera from 9 keloid patients and 7 normal controls were characterized using a miRNA microarray containing established human mature and precursor miRNA sequences. Quantitative real-time PCR was performed to confirm the expression of miRNAs. The putative targets of differentially expressed miRNAs were functionally annotated by bioinformatics. MiRNA microarray analysis identified 37 differentially expressed miRNAs (17 upregulated and 20 downregulated) in keloid patients, compared to the healthy controls. Functional annotations revealed that the targets of those differentially expressed miRNAs were enriched in signaling pathways essential for scar formation and wound healing. The expression profiling of miRNAs is altered in the keloid, providing a clue for the molecular mechanisms underlying its initiation and progression. MiRNAs may partly contribute to the etiology of keloids by affecting the critical signaling pathways relevant to keloid pathogenesis. PMID:27132794

  14. Differential expression of microRNAs in 2-cell and 4-cell mouse embryos.

    PubMed

    Wang, Pei; Cui, Ji; Zhao, Chun; Zhou, Lin; Guo, Xirong; Shen, Rong; Zhang, Junqiang; Ling, Xiufeng

    2014-11-01

    In vitro fertilized (IVF) human embryos have a high incidence of developmental arrest before the blastocyst stage, therefore characterization of the molecular mechanisms that regulate embryo development is urgently required. Post-transcriptional control by microRNAs (miRNAs) is one of the most investigated RNA control mechanisms, and is hypothesized to be involved actively in developmental arrest in preimplantation embryos. In this study, we extracted total RNA from mouse 2-cell and 4-cell embryos. Using a miRNA microarray, 192 miRNAs were found to be differentially expressed in 4-cell embryos and 2-cell embryos; 122 miRNAs were upregulated and 70 were downregulated in 4-cell embryos. The microarray results were confirmed by real-time quantitative RT-PCR for six miRNAs (mmu-miR-467h, mmu-miR-466d-3p, mmu-miR-292-5p, mmu-miR-154, mmu-miR-2145, and mmu-miR-706). Cdca4 and Tcf12 were identified as miR-154 target genes by target prediction analysis. This study provides a developmental map for a large number of miRNAs in 2-cell and 4-cell embryos. The function of these miRNAs and the mechanisms by which they modulate embryonic developmental arrest require further study. The results of this study have potential applications in the field of reproductive medicine. PMID:23731853

  15. Circulating microRNAs as potential biomarkers for diagnosis of congenital heart defects

    PubMed Central

    Xie, Wan-qin; Zhou, Lin; Chen, Yong; Ni, Bin

    2016-01-01

    BACKGROUND: MicroRNAs are small non-coding RNAs of approximately 22 nucleotides in length, and play important regulatory roles in normal heart development and the pathogenesis of heart diseases. Recently, a few prospective studies have implicated the diagnostic role of microRNAs in congenital heart defects (CHD). DATA RESOURCES: This review retrieved the research articles in PubMed focusing on the altered microRNAs in cardiac tissue or serum of patients with CHD versus healthy normal controls, as well as the studies exploring circulating microRNAs as potential biomarkers for (fetal) CHD. RESULTS: Most of the studies of interest were conducted in recent years, implicating that the topic in this review is a newly emerging field and is drawing much attention. Moreover, a number of differentially expressed microRNAs between CHD specimens and normal controls have been reported. CONCLUSION: Circulating microRNAs may serve as potential biomarkers for diagnosis of CHD in the future, with more efforts paving the road to the aim. PMID:27313801

  16. Stress-induced endogenous siRNAs targeting regulatory intron sequences in Brachypodium

    PubMed Central

    Wang, Hsiao-Lin V.; Dinwiddie, Brandon L.; Lee, Herman

    2015-01-01

    Exposure to abiotic stresses triggers global changes in the expression of thousands of eukaryotic genes at the transcriptional and post-transcriptional levels. Small RNA (smRNA) pathways and splicing both function as crucial mechanisms regulating stress-responsive gene expression. However, examples of smRNAs regulating gene expression remain largely limited to effects on mRNA stability, translation, and epigenetic regulation. Also, our understanding of the networks controlling plant gene expression in response to environmental changes, and examples of these regulatory pathways intersecting, remains limited. Here, to investigate the role of smRNAs in stress responses we examined smRNA transcriptomes of Brachypodium distachyon plants subjected to various abiotic stresses. We found that exposure to different abiotic stresses specifically induced a group of novel, endogenous small interfering RNAs (stress-induced, UTR-derived siRNAs, or sutr-siRNAs) that originate from the 3′ UTRs of a subset of coding genes. Our bioinformatics analyses predicted that sutr-siRNAs have potential regulatory functions and that over 90% of sutr-siRNAs target intronic regions of many mRNAs in trans. Importantly, a subgroup of these sutr-siRNAs target the important intron regulatory regions, such as branch point sequences, that could affect splicing. Our study indicates that in Brachypodium, sutr-siRNAs may affect splicing by masking or changing accessibility of specific cis-elements through base-pairing interactions to mediate gene expression in response to stresses. We hypothesize that this mode of regulation of gene expression may also serve as a general mechanism for regulation of gene expression in plants and potentially in other eukaryotes. PMID:25480817

  17. Predicting associations between microRNAs and target genes in breast cancer by bioinformatics analyses

    PubMed Central

    Zheng, Tianying; Zhang, Xing; Wang, Yonggang; Yu, Xiucui

    2016-01-01

    Breast cancer is the leading type of cancer among females. However, the association between microRNAs (miRNAs) and target genes in breast tumorigenesis is poorly studied. The original data set GSE26659 was downloaded from the Gene Expression Omnibus, and then the differentially expressed miRNAs among 77 breast cancer patients and 17 controls were identified using the Limma package in R software. Furthermore, breast cancer-related differentially expressed miRNAs were selected from a human miRNA disease database and their target genes were selected from five miRNA databases. Then, functional analysis was performed for the target genes followed by construction of a miRNA-target gene network. A total of 34 differentially expressed miRNAs were identified, including 13 breast cancer-related miRNAs. Moreover, the target genes of the 13 miRNAs were significantly enriched in regulation of transcription (P=7.43E-09) and pathways related to cancer (P=3.33E-11). Finally, eight upregulated miRNAs (including hsa-miR-425) and five downregulated miRNAs (including hsa-miR-143, hsa-miR-145 and hsa-miR-125b) were identified in the miRNA-target gene network. In conclusion, using bioinformatics approaches, we demonstrate that the changes in regulation of transcription and cancer pathways may play significant roles in the process of breast cancerogenesis. Differentially expressed miRNAs and their target genes may be new targets for breast cancer therapy. PMID:27446395

  18. Dysregulation of a family of short noncoding RNAs, tsRNAs, in human cancer.

    PubMed

    Pekarsky, Yuri; Balatti, Veronica; Palamarchuk, Alexey; Rizzotto, Lara; Veneziano, Dario; Nigita, Giovanni; Rassenti, Laura Z; Pass, Harvey I; Kipps, Thomas J; Liu, Chang-Gong; Croce, Carlo M

    2016-05-01

    Chronic lymphocytic leukemia (CLL) is the most common human leukemia, and transgenic mouse studies indicate that activation of the T-cell leukemia/lymphoma 1 (TCL1) oncogene is a contributing event in the pathogenesis of the aggressive form of this disease. While studying the regulation of TCL1 expression, we identified the microRNA cluster miR-4521/3676 and discovered that these two microRNAs are associated with tRNA sequences and that this region can produce two small RNAs, members of a recently identified class of small noncoding RNAs, tRNA-derived small RNAs (tsRNAs). We further proved that miR-3676 and miR-4521 are tsRNAs using Northern blot analysis. We found that, like ts-3676, ts-4521 is down-regulated and mutated in CLL. Analysis of lung cancer samples revealed that both ts-3676 and ts-4521 are down-regulated and mutated in patient tumor samples. Because tsRNAs are similar in nature to piRNAs [P-element-induced wimpy testis (Piwi)-interacting small RNAs], we investigated whether ts-3676 and ts-4521 can interact with Piwi proteins and found these two tsRNAs in complexes containing Piwi-like protein 2 (PIWIL2). To determine whether other tsRNAs are involved in cancer, we generated a custom microarray chip containing 120 tsRNAs 16 bp or more in size. Microarray hybridization experiments revealed tsRNA signatures in CLL and lung cancer, indicating that, like microRNAs, tsRNAs may have an oncogenic and/or tumor-suppressor function in hematopoietic malignancies and solid tumors. Thus, our results show that tsRNAs are dysregulated in human cancer. PMID:27071132

  19. Identification of miRNAs and their target genes in developing maize ears by combined small RNA and degradome sequencing

    PubMed Central

    2014-01-01

    Background In plants, microRNAs (miRNAs) are endogenous ~22 nt RNAs that play important regulatory roles in many aspects of plant biology, including metabolism, hormone response, epigenetic control of transposable elements, and stress response. Extensive studies of miRNAs have been performed in model plants such as rice and Arabidopsis thaliana. In maize, most miRNAs and their target genes were analyzed and identified by clearly different treatments, such as response to low nitrate, salt and drought stress. However, little is known about miRNAs involved in maize ear development. The objective of this study is to identify conserved and novel miRNAs and their target genes by combined small RNA and degradome sequencing at four inflorescence developmental stages. Results We used deep-sequencing, miRNA microarray assays and computational methods to identify, profile, and describe conserved and non-conserved miRNAs at four ear developmental stages, which resulted in identification of 22 conserved and 21-maize-specific miRNA families together with their corresponding miRNA*. Comparison of miRNA expression in these developmental stages revealed 18 differentially expressed miRNA families. Finally, a total of 141 genes (251 transcripts) targeted by 102 small RNAs including 98 miRNAs and 4 ta-siRNAs were identified by genomic-scale high-throughput sequencing of miRNA cleaved mRNAs. Moreover, the differentially expressed miRNAs-mediated pathways that regulate the development of ears were discussed. Conclusions This study confirmed 22 conserved miRNA families and discovered 26 novel miRNAs in maize. Moreover, we identified 141 target genes of known and new miRNAs and ta-siRNAs. Of these, 72 genes (117 transcripts) targeted by 62 differentially expressed miRNAs may attribute to the development of maize ears. Identification and characterization of these important classes of regulatory genes in maize may improve our understanding of molecular mechanisms controlling ear development

  20. Expression Profiling of Differentiating Eosinophils in Bone Marrow Cultures Predicts Functional Links between MicroRNAs and Their Target mRNAs

    PubMed Central

    Eyers, Fiona; Xiang, Yang; Guo, Man; Young, Ian G.; Rosenberg, Helene F.

    2014-01-01

    Background MicroRNAs (miRNAs) are small non-coding RNAs that regulate complex transcriptional networks underpin immune responses. However, little is known about the specific miRNA networks that control differentiation of specific leukocyte subsets. In this study, we profiled miRNA expression during differentiation of eosinophils from bone marrow (BM) progenitors (bmEos), and correlated expression with potential mRNA targets involved in crucial regulatory functions. Profiling was performed on whole BM cultures to document the dynamic changes in miRNA expression in the BM microenvironment over the differentiation period. miRNA for network analysis were identified in BM cultures enriched in differentiating eosinophils, and chosen for their potential ability to target mRNA of factors that are known to play critical roles in eosinophil differentiation pathways or cell identify. Methodology/Principal Findings We identified 68 miRNAs with expression patterns that were up- or down- regulated 5-fold or more during bmEos differentiation. By employing TargetScan and MeSH databases, we identified 348 transcripts involved in 30 canonical pathways as potentially regulated by these miRNAs. Furthermore, by applying miRanda and Ingenuity Pathways Analysis (IPA), we identified 13 specific miRNAs that are temporally associated with the expression of IL-5Rα and CCR3 and 14 miRNAs associated with the transcription factors GATA-1/2, PU.1 and C/EBPε. We have also identified 17 miRNAs that may regulate the expression of TLRs 4 and 13 during eosinophil differentiation, although we could identify no miRNAs targeting the prominent secretory effector, eosinophil major basic protein. Conclusions/Significance This is the first study to map changes in miRNA expression in whole BM cultures during the differentiation of eosinophils, and to predict functional links between miRNAs and their target mRNAs for the regulation of eosinophilopoiesis. Our findings provide an important resource that will

  1. Protection of mice against lethal rabies virus challenge using short interfering RNAs (siRNAs) delivered through lentiviral vector.

    PubMed

    Singh, Niraj K; Meshram, Chetan D; Sonwane, Arvind A; Dahiya, Shyam S; Pawar, Sachin S; Chaturvedi, V K; Saini, Mohini; Singh, R P; Gupta, Praveen K

    2014-02-01

    The antiviral potential of small interfering RNAs (siRNAs) targeting rabies virus (RV) polymerase (L) and nucleoprotein (N) genes delivered through lentiviral vector was investigated. For in vitro evaluation, siRNAs expressing BHK-21 cell lines (BHK-L and BHK-N) were developed using transduction with Lenti-L and Lenti-N lentiviruses encoding siRNAs against RV-L and N genes, respectively. When these cell lines were challenged in vitro with RV Pasteur virus-11 (PV-11) strain, there was reduction in number of RV-specific foci and target gene transcripts indicating inhibitory effect on RV multiplication. For in vivo evaluation, mice were treated intracerebrally with lentiviruses and challenged with 20 LD50 of RV challenge virus standard-11 (CVS-11) strain by intramuscular route in masseter muscle. Five out of eight mice treated with Lenti-N survived indicating 62.5 % protection. The control and Lenti-L-treated mice died within 7-10 days indicating lethal nature of challenge virus and no protection. These results demonstrated that siRNA targeting RV-N could not only inhibit RV multiplication, but also conferred protection in mice against lethal RV challenge. These findings have implication on therapeutic use of siRNA targeting RV-N against RV infection. PMID:23877894

  2. Differential Expression of microRNAs in the Ovaries from Letrozole-Induced Rat Model of Polycystic Ovary Syndrome.

    PubMed

    Li, Dandan; Li, Chunjin; Xu, Ying; Xu, Duo; Li, Hongjiao; Gao, Liwei; Chen, Shuxiong; Fu, Lulu; Xu, Xin; Liu, Yongzheng; Zhang, Xueying; Zhang, Jingshun; Ming, Hao; Zheng, Lianwen

    2016-04-01

    Polycystic ovary syndrome (PCOS) is a complex and heterogeneous endocrine disorder. To understand the pathogenesis of PCOS, we established rat models of PCOS induced by letrozole and employed deep sequencing to screen the differential expression of microRNAs (miRNAs) in PCOS rats and control rats. We observed vaginal smear and detected ovarian pathological alteration and hormone level changes in PCOS rats. Deep sequencing showed that a total of 129 miRNAs were differentially expressed in the ovaries from letrozole-induced rat model compared with the control, including 49 miRNAs upregulated and 80 miRNAs downregulated. Furthermore, the differential expression of miR-201-5p, miR-34b-5p, miR-141-3p, and miR-200a-3p were confirmed by real-time polymerase chain reaction. Bioinformatic analysis revealed that these four miRNAs were predicted to target a large set of genes with different functions. Pathway analysis supported that the miRNAs regulate oocyte meiosis, mitogen-activated protein kinase (MAPK) signaling, phosphoinositide 3-kinase/Akt (PI3K-Akt) signaling, Rap1 signaling, and Notch signaling. These data indicate that miRNAs are differentially expressed in rat PCOS model and the differentially expressed miRNA are involved in the etiology and pathophysiology of PCOS. Our findings will help identify miRNAs as novel diagnostic markers and therapeutic targets for PCOS. PMID:26745201

  3. Outer Planet Mission Studies Neptune Aerocapture

    NASA Technical Reports Server (NTRS)

    Wercinski, Paul F.; Langhoff, Steven R. (Technical Monitor)

    1997-01-01

    Current and previous studies of orbiter missions to the outer planets have clearly identified high-energy aerocapture as a critical and enabling technology. Aerocapture involves the use of aerodynamic lift to fly a trajectory through a planet's atmosphere to sufficiently decelerate an entry vehicle to capture into planetary orbit. In the past, numerous studies of different configurations of lifting entry vehicles were studied for various planetary orbiter missions which identified aerocapture as a feasible concept yet complex and technically challenging. In order to determine the feasibility of high-speed aerocapture at the outer planets, an accurate trajectory simulation of the flight vehicle is the critical first step in the proposed research. Vehicle response to aerodynamic loading must be predicted accurately in the trajectory simulations. For several Neptune orbiter missions currently under study at the Jet Propulsion Laboratory (JPL), entry velocities relative to the rotating atmosphere ranging from 25 to 30 km/sec, are to be expected. Preliminary trajectory analysis has identified the various flow regimes the entry vehicle is expected to fly in the 8 1% H2 and 19% He atmosphere of Neptune. The size and mass of the vehicle are also determined by the launch vehicle constraints and orbiter spacecraft requirements. For a given baseline arrival conditions of an inertial entry velocity of 28 km/sec and an entry mass of 400 kg, a medium lift (L/D = 1), axisymmetric biconic shaped vehicle was selected in order to satisfy entry corridor width requirements expected for Neptune aerocapture. The analysis summarized in this study indicates that a biconic entry vehicle is a feasible concept for a Neptune aerocapture orbiter mission. The preliminary entry trajectory simulations has demonstrated adequate entry corridor control authority. Furthermore, estimates of the stagnation point heating environment has enabled the preliminary selection of candidate lightweight ceramic

  4. Long noncoding RNAs in regulating adipogenesis: new RNAs shed lights on obesity.

    PubMed

    Wei, Shengjuan; Du, Min; Jiang, Zhihua; Hausman, Gary J; Zhang, Lifan; Dodson, Michael V

    2016-05-01

    Long noncoding RNAs (lncRNAs) are an emerging class of regulators involved in a myriad of biological processes. Recent studies have revealed that many lncRNAs play pivotal roles in regulating adipocyte development. Due to the prevalence of obesity and the serious effects of adiposity on human health and society development, it is necessary to summarize functions and recent advances of lncRNAs in adipogenesis. In this review, we highlight functional lncRNAs contributed to the regulation of adipogenesis, discussing their potential use as therapeutic targets to combat human obesity. PMID:26943803

  5. MicroRNAs and cardiac regeneration

    PubMed Central

    Hodgkinson, Conrad P.; Kang, Martin H.; Dal-Pra, Sophie; Mirotsou, Maria; Dzau, Victor J.

    2015-01-01

    The human heart has a very limited capacity to regenerate lost or damaged cardiomyocytes following cardiac insult. Instead, myocardial injury is characterized by extensive cardiac remodeling by fibroblasts, resulting in the eventual deterioration of cardiac structure and function. Cardiac function would be improved if these fibroblasts could be converted into cardiomyocytes. MicroRNAs (miRNAs), small non-coding RNAs that promote mRNA degradation and inhibit mRNA translation, have been shown to be important in cardiac development. Using this information various researchers have utilized miRNAs to promote the formation of cardiomyocytes through a number of approaches. Several miRNAs acting in combination promote the direct conversion of cardiac fibroblasts into cardiomyocytes. Moreover, a number of miRNAs have been identified that aid the formation of iPS cells and miRNAs also induce these cells to adopt a cardiac fate. MiRNAs have also been implicated in resident cardiac progenitor cell differentiation. In this review we will discuss the current literature as it pertains to these processes as well as discussing the therapeutic implications of these findings. PMID:25953925

  6. MicroRNAs in liver disease

    PubMed Central

    Szabo, Gyongyi; Bala, Shashi

    2014-01-01

    Small, noncoding microRNAs (miRNAs) regulate diverse biological functions in the liver and increasing evidence suggests that they have a role in liver pathology. This Review summarizes advances in the field of miRNAs in liver diseases, inflammation and cirrhosis. MicroRNA-122, the most abundant miRNA in hepatocytes, has well-defined roles in HCV replication, and data indicate that it also serves as a viable therapeutic target. The role of miR-122 is also emerging in other liver diseases. Ample evidence exists for the important regulatory potential of other miRNAs in conditions associated with liver inflammation related to alcohol use, the metabolic syndrome or autoimmune processes. In addition, a broad array of miRNAs have been associated with the development of liver fibrosis both in animal models and human studies. The significance of the function and cellular distribution of miRNAs in the liver and the potential of miRNAs as a means of communication between cells and organs is discussed as well as the emerging utility of circulating miRNAs as biomarkers of different forms of liver damage and as early markers of disease and progression in hepatocellular carcinoma. Importantly, miRNA modulation in the liver represents a new therapeutic approach in the treatment armamentarium of hepatologists in the future. PMID:23689081

  7. Exploiting tRNAs to Boost Virulence

    PubMed Central

    Albers, Suki; Czech, Andreas

    2016-01-01

    Transfer RNAs (tRNAs) are powerful small RNA entities that are used to translate nucleotide language of genes into the amino acid language of proteins. Their near-uniform length and tertiary structure as well as their high nucleotide similarity and post-transcriptional modifications have made it difficult to characterize individual species quantitatively. However, due to the central role of the tRNA pool in protein biosynthesis as well as newly emerging roles played by tRNAs, their quantitative assessment yields important information, particularly relevant for virus research. Viruses which depend on the host protein expression machinery have evolved various strategies to optimize tRNA usage—either by adapting to the host codon usage or encoding their own tRNAs. Additionally, several viruses bear tRNA-like elements (TLE) in the 5′- and 3′-UTR of their mRNAs. There are different hypotheses concerning the manner in which such structures boost viral protein expression. Furthermore, retroviruses use special tRNAs for packaging and initiating reverse transcription of their genetic material. Since there is a strong specificity of different viruses towards certain tRNAs, different strategies for recruitment are employed. Interestingly, modifications on tRNAs strongly impact their functionality in viruses. Here, we review those intersection points between virus and tRNA research and describe methods for assessing the tRNA pool in terms of concentration, aminoacylation and modification. PMID:26797637

  8. Tackling Structures of Long Noncoding RNAs

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2013-01-01

    RNAs are important catalytic machines and regulators at every level of gene expression. A new class of RNAs has emerged called long non-coding RNAs, providing new insights into evolution, development and disease. Long non-coding RNAs (lncRNAs) predominantly found in higher eukaryotes, have been implicated in the regulation of transcription factors, chromatin-remodeling, hormone receptors and many other processes. The structural versatility of RNA allows it to perform various functions, ranging from precise protein recognition to catalysis and metabolite sensing. While major housekeeping RNA molecules have long been the focus of structural studies, lncRNAs remain the least characterized class, both structurally and functionally. Here, we review common methodologies used to tackle RNA structure, emphasizing their potential application to lncRNAs. When considering the complexity of lncRNAs and lack of knowledge of their structure, chemical probing appears to be an indispensable tool, with few restrictions in terms of size, quantity and heterogeneity of the RNA molecule. Probing is not constrained to in vitro analysis and can be adapted to high-throughput sequencing platforms. Significant efforts have been applied to develop new in vivo chemical probing reagents, new library construction protocols for sequencing platforms and improved RNA prediction software based on the experimental evidence. PMID:24304541

  9. Tackling structures of long noncoding RNAs.

    PubMed

    Novikova, Irina V; Hennelly, Scott P; Sanbonmatsu, Karissa Y

    2013-01-01

    RNAs are important catalytic machines and regulators at every level of gene expression. A new class of RNAs has emerged called long non-coding RNAs, providing new insights into evolution, development and disease. Long non-coding RNAs (lncRNAs) predominantly found in higher eukaryotes, have been implicated in the regulation of transcription factors, chromatin-remodeling, hormone receptors and many other processes. The structural versatility of RNA allows it to perform various functions, ranging from precise protein recognition to catalysis and metabolite sensing. While major housekeeping RNA molecules have long been the focus of structural studies, lncRNAs remain the least characterized class, both structurally and functionally. Here, we review common methodologies used to tackle RNA structure, emphasizing their potential application to lncRNAs. When considering the complexity of lncRNAs and lack of knowledge of their structure, chemical probing appears to be an indispensable tool, with few restrictions in terms of size, quantity and heterogeneity of the RNA molecule. Probing is not constrained to in vitro analysis and can be adapted to high-throughput sequencing platforms. Significant efforts have been applied to develop new in vivo chemical probing reagents, new library construction protocols for sequencing platforms and improved RNA prediction software based on the experimental evidence. PMID:24304541

  10. Analysis of the ISS Russian Segment Outer Surface Materials Installed on the CKK Detachable Cassette

    NASA Astrophysics Data System (ADS)

    Naumov, S. F.; Borisov, V. A.; Plotnikov, A. D.; Sokolova, S. P.; Kurilenok, A. O.; Skurat, V. E.; Leipunsky, I. O.; Pshechenkov, P. A.; Beryozkina, N. G.; Volkov, I. O.

    2009-01-01

    This report presents an analysis of the effects caused by space environmental factors (SEF) and the International Space Station's (ISS) outer environment on operational parameters of the outer surface materials of the ISS Russian Segment (RS). The tests were performed using detachable container cassettes (CKK) that serve as a part of the ISS RS contamination control system.

  11. 76 FR 79705 - Information Collection Activities: Operations in the Outer Continental Shelf for Minerals Other...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-22

    ... the Outer Continental Shelf for Minerals Other than Oil, Gas, and Sulphur; Submitted for Office of..., ``Operations in the Outer Continental Shelf for Minerals Other than Oil, Gas, and Sulphur''. DATES: Submit... Continental Shelf for Minerals other than Oil, Gas, and Sulphur. OMB Control Number: 1014-NEW. Abstract:...

  12. Nuclear Noncoding RNAs and Genome Stability.

    PubMed

    Khanduja, Jasbeer S; Calvo, Isabel A; Joh, Richard I; Hill, Ian T; Motamedi, Mo

    2016-07-01

    In modern molecular biology, RNA has emerged as a versatile macromolecule capable of mediating an astonishing number of biological functions beyond its role as a transient messenger of genetic information. The recent discovery and functional analyses of new classes of noncoding RNAs (ncRNAs) have revealed their widespread use in many pathways, including several in the nucleus. This Review focuses on the mechanisms by which nuclear ncRNAs directly contribute to the maintenance of genome stability. We discuss how ncRNAs inhibit spurious recombination among repetitive DNA elements, repress mobilization of transposable elements (TEs), template or bridge DNA double-strand breaks (DSBs) during repair, and direct developmentally regulated genome rearrangements in some ciliates. These studies reveal an unexpected repertoire of mechanisms by which ncRNAs contribute to genome stability and even potentially fuel evolution by acting as templates for genome modification. PMID:27392145

  13. tRNAs as Antibiotic Targets

    PubMed Central

    Chopra, Shaileja; Reader, John

    2014-01-01

    Transfer RNAs (tRNAs) are central players in the protein translation machinery and as such are prominent targets for a large number of natural and synthetic antibiotics. This review focuses on the role of tRNAs in bacterial antibiosis. We will discuss examples of antibiotics that target multiple stages in tRNA biology from tRNA biogenesis and modification, mature tRNAs, aminoacylation of tRNA as well as prevention of proper tRNA function by small molecules binding to the ribosome. Finally, the role of deacylated tRNAs in the bacterial “stringent response” mechanism that can lead to bacteria displaying antibiotic persistence phenotypes will be discussed. PMID:25547494

  14. MicroRNAs, Genomic Instability and Cancer

    PubMed Central

    Vincent, Kimberly; Pichler, Martin; Lee, Gyeong-Won; Ling, Hui

    2014-01-01

    MicroRNAs (miRNAs) are small non-coding RNA transcripts approximately 20 nucleotides in length that regulate expression of protein-coding genes via complementary binding mechanisms. The last decade has seen an exponential increase of publications on miRNAs, ranging from every aspect of basic cancer biology to diagnostic and therapeutic explorations. In this review, we summarize findings of miRNA involvement in genomic instability, an interesting but largely neglected topic to date. We discuss the potential mechanisms by which miRNAs induce genomic instability, considered to be one of the most important driving forces of cancer initiation and progression, though its precise mechanisms remain elusive. We classify genomic instability mechanisms into defects in cell cycle regulation, DNA damage response, and mitotic separation, and review the findings demonstrating the participation of specific miRNAs in such mechanisms. PMID:25141103

  15. Linking RNA biology to lncRNAs

    PubMed Central

    Goff, Loyal A.; Rinn, John L.

    2015-01-01

    The regulatory potential of RNA has never ceased to amaze: from RNA catalysis, to RNA-mediated splicing, to RNA-based silencing of an entire chromosome during dosage compensation. More recently, thousands of long noncoding RNA (lncRNA) transcripts have been identified, the majority with unknown function. Thus, it is tempting to think that these lncRNAs represent a cadre of new factors that function through ribonucleic mechanisms. Some evidence points to several lncRNAs with tantalizing physiological contributions and thought-provoking molecular modalities. However, dissecting the RNA biology of lncRNAs has been difficult, and distinguishing the independent contributions of functional RNAs from underlying DNA elements, or the local act of transcription, is challenging. Here, we aim to survey the existing literature and highlight future approaches that will be needed to link the RNA-based biology and mechanisms of lncRNAs in vitro and in vivo. PMID:26430155

  16. microRNAs as cancer biomarkers.

    PubMed

    Flatmark, Kjersti; Høye, Eirik; Fromm, Bastian

    2016-01-01

    Since their discovery in 1993, microRNAs (miRNAs) have been identified as important gene regulators in many biological processes and as key molecular players in human disease, including cancer where they show specific pathogenic deregulation. Their remarkable chemical stability, the availability of very sensitive miRNA detection methods and the fact that miRNAs can be extracted from and detected in various kinds of clinically relevant samples, such as solid tissues, body fluids and secretions make them excellent candidate biomarkers. However, no miRNA has yet entered the level of practical clinical relevance. We present a brief background and some key aspects and challenges of miRNAs as cancer biomarkers, we discuss shortfalls and identify possible routes towards the use of miRNAs as reliable biomarkers for cancer. PMID:27542003

  17. microRNAs and Endometrial Pathophysiology.

    PubMed

    Chill, Henry H; Dior, Uri P; Kogan, Liron; Revel, Ariel

    2015-01-01

    Embryo implantation requires a reciprocal interaction between the blastocyst and endometrium and is associated with complex regulatory mechanisms. Since their discovery, microRNAs became prominent candidates providing missing links for many biological pathways. In recent years, microRNAs were implicated as one of the important players in regulation of various biological and physiological endometrial related processes. This chapter aims to present recent knowledge pertaining to the diverse aspects of microRNAs in the embryo-endometrial relationship. We will focus on the role of microRNAs in decidualization and their part in natural and stimulated cycles. Next, we will present recent studies deliberating the role of microRNAs in recurrent pregnancy loss and in the important phenomenon of recurrent implantation failure. Lastly, demonstrating an important aspect of embryo implantation and invasion, we will outline few microRNA related shared pathways of implantation and carcinogenesis. PMID:26662990

  18. MicroRNAs as biomarkers in leukemia

    PubMed Central

    Wang, Xinxin; Zhu, Baohua; Huang, Zunnan; Chen, Liyong

    2014-01-01

    Current diagnostic and prognostic markers still exhibit biological limitation and seeking novel molecular biomarkers is crucial for early clinical diagnosis and in the development of novel strategies for leukemia therapy. Emerging evidence showed that dysregulated microRNAs (miRNAs) play important roles in cancer including leukemia. In this review, we summarized recent progress on the role of miRNAs in leukemia, mainly focusing on recent findings that suggest the potential of miRNAs as biomarkers for diagnosis and prognosis. Notably, the circulating miRNAs were also discussed for the fact that they can be detected in body fluids, and thus represent a novel source of promising biomarkers that may be applied to clinical settings.

  19. Reciprocal regulation of miRNAs and piRNAs in embryonic development.

    PubMed

    Du, W W; Yang, W; Xuan, J; Gupta, S; Krylov, S N; Ma, X; Yang, Q; Yang, B B

    2016-09-01

    MicroRNAs (miRNAs) and piwi-interacting RNAs (piRNAs) are two classes of small noncoding RNAs, both of which play roles in regulating tissue development. It is unknown whether these distinct classes of noncoding RNAs can regulate one another. Here we show that ectopic expression of miR-17 inhibited mouse fertility and early embryonic development. Specifically, we found that the piRNA amplification loop was repressed by miR-17-5p, leading to increased levels of transposition mutagenesis. This occurred by suppressing the amplification loop of piRNAs with an identical 5' sequence and by targeting Mili/Miwi2, an essential component of the piRNA amplification loop, and the DNA methyltransferase, Dnmt3a. We also found that increased levels of piRNAs could compete with miRNAs for target binding, resulting in increased expression of Dnmt3a and Mili. Increased Dnmt3a levels could in turn block miR-17-5p expression, while increased Mili expression could accelerate piRNA amplification and inhibit transposon generation, favoring embryonic development. We report for the first time the reciprocal regulation between miRNAs and piRNAs in mouse embryonic development. PMID:26990662

  20. Emerging role for microRNAs in acute promyelocytic leukemia.

    PubMed

    Nervi, C; Fazi, F; Rosa, A; Fatica, A; Bozzoni, I

    2007-01-01

    Hematopoiesis is highly controlled by lineage-specific transcription factors that, by interacting with specific DNA sequences, directly activate or repress specific gene expression. These transcription factors have been found mutated or altered by chromosomal translocations associated with leukemias, indicating their role in the pathogenesis of these malignancies. The post-genomic era, however, has shown that transcription factors are not the only key regulators of gene expression. Epigenetic mechanisms such as DNA methylation, posttranslational modifications of histones, remodeling of nucleosomes, and expression of small regulatory RNAs all contribute to the regulation of gene expression and determination of cell and tissue specificity. Deregulation ofthese epigenetic mechanisms cooperates with genetic alterations to the establishment and progression of tumors. MicroRNAs (miRNAs) are negative regulators of the expression of genes involved in development, differentiation, proliferation, and apoptosis. Their expression appears to be tissue-specific and highly regulated according to the cell's developmental lineage and stage. Interestingly, miRNAs expressed in hematopoietic cells have been found mutated or altered by chromosomal translocations associated with leukemias. The expression levels of a specific miR-223 correlate with the differentiation fate of myeloid precursors. The activation of both pathways of transcriptional regulation by the myeloid lineage-specific transcription factor C/EBPalpha (CCAAT/enhancer-binding protein-alpha), and posttranscriptional regulation by miR-223 appears essential for granulocytic differentiation and clinical response of acute promyelocytic leukemia (APL) blasts to all-trans retinoic acid (ATRA). Together, this evidence underlies transcription factors, chromatin remodeling, and miRNAs as ultimate determinants for the correct organization of cell type-specific gene arrays and hematopoietic differentiation, therefore providing new

  1. Isolation of Small Noncoding RNAs from Human Serum

    PubMed Central

    Khoury, Samantha; Ajuyah, Pamela; Tran, Nham

    2014-01-01

    The analysis of RNA and its expression is a common feature in many laboratories. Of significance is the emergence of small RNAs like microRNAs, which are found in mammalian cells. These small RNAs are potent gene regulators controlling vital pathways such as growth, development and death and much interest has been directed at their expression in bodily fluids. This is due to their dysregulation in human diseases such as cancer and their potential application as serum biomarkers. However, the analysis of miRNA expression in serum may be problematic. In most cases the amount of serum is limiting and serum contains low amounts of total RNA, of which small RNAs only constitute 0.4-0.5%1. Thus the isolation of sufficient amounts of quality RNA from serum is a major challenge to researchers today. In this technical paper, we demonstrate a method which uses only 400 µl of human serum to obtain sufficient RNA for either DNA arrays or qPCR analysis. The advantages of this method are its simplicity and ability to yield high quality RNA. It requires no specialized columns for purification of small RNAs and utilizes general reagents and hardware found in common laboratories. Our method utilizes a Phase Lock Gel to eliminate phenol contamination while at the same time yielding high quality RNA. We also introduce an additional step to further remove all contaminants during the isolation step. This protocol is very effective in isolating yields of total RNA of up to 100 ng/µl from serum but can also be adapted for other biological tissues. PMID:24998448

  2. MicroRNAs and other non-coding RNAs as targets for anticancer drug development

    PubMed Central

    Ling, Hui; Fabbri, Muller; Calin, George A.

    2015-01-01

    With the first cancer-targeted microRNA drug, MRX34, a liposome-based miR-34 mimic, entering phase I clinical trial in patients with advanced hepatocellular carcinoma in April 2013, miRNA therapeutics are attracting special attention from both academia and biotechnology companies. Although to date the most studied non-coding RNAs (ncRNAs) are miRNAs, the importance of long non-coding RNAs (lncRNAs) is increasingly being recognized. Here we summarize the roles of miRNAs and lncRNAs in cancer, with a focus on the recently identified novel mechanisms of action, and discuss the current strategies in designing ncRNA-targeting therapeutics, as well as the associated challenges. PMID:24172333

  3. Alterations of miRNAs reveal a dysregulated molecular regulatory network in Parkinson's disease striatum.

    PubMed

    Nair, Venugopalan D; Ge, Yongchao

    2016-08-26

    Molecular adaptations in the striatum mediated by dopamine (DA) denervation and/or levodopa (L-dopa) treatments have been implicated in the motor deficits found in Parkinson's disease (PD). Alterations in inflammatory response mechanisms and glutamatergic neurotransmission are reported to play important roles in mediating these changes. However, the mechanisms mediating the molecular adaptations in the striatum are not well understood. Small non-coding microRNAs (miRNAs) influence numerous biological processes including the development and maintenance of striatal neurons by regulating gene expression post-transcriptionally. To investigate miRNA function in human PD striatum, we examined the global expression of miRNAs in postmortem putamen (putamen along with caudate forms the striatum) tissues obtained from PD patients and neurologically normal controls using Nanostring miRNA assays. We found that 6 miRNAs were significantly (p≤0.05) upregulated and 7 miRNAs were downregulated in PD putamen when compared with control. The differential expression (DE) of the 4 highest scoring miRNAs was further confirmed by reverse transcription polymerase chain reaction. Ingenuity pathway analysis demonstrated that these miRNAs are enriched in the processes of inflammatory responses. We found that the expression of DE miRNAs in PD putamen negatively correlates with the expression of gene transcripts implicated in inflammatory response with p53 and NF-kB as central signaling molecules. Taken together, our results suggest that in PD striatum, the DE miRNAs are associated with the oxidative stress pathway. This mechanism may contribute to the molecular adaptations and related motor complications found in PD. PMID:27369327

  4. Fitness Landscapes of Functional RNAs.

    PubMed

    Kun, Ádám; Szathmáry, Eörs

    2015-01-01

    The notion of fitness landscapes, a map between genotype and fitness, was proposed more than 80 years ago. For most of this time data was only available for a few alleles, and thus we had only a restricted view of the whole fitness landscape. Recently, advances in genetics and molecular biology allow a more detailed view of them. Here we review experimental and theoretical studies of fitness landscapes of functional RNAs, especially aptamers and ribozymes. We find that RNA structures can be divided into critical structures, connecting structures, neutral structures and forbidden structures. Such characterisation, coupled with theoretical sequence-to-structure predictions, allows us to construct the whole fitness landscape. Fitness landscapes then can be used to study evolution, and in our case the development of the RNA world. PMID:26308059

  5. Regulation of transcription by 6S RNAs

    PubMed Central

    Steuten, Benedikt; Hoch, Philipp G; Damm, Katrin; Schneider, Sabine; Köhler, Karen; Wagner, Rolf; Hartmann, Roland K

    2014-01-01

    Whereas, the majority of bacterial non-coding RNAs and functional RNA elements regulate post-transcriptional processes, either by interacting with other RNAs via base-pairing or through binding of small ligands (riboswitches), 6S RNAs affect transcription itself by binding to the housekeeping holoenzyme of RNA polymerase (RNAP). Remarkably, 6S RNAs serve as RNA templates for bacterial RNAP, giving rise to the de novo synthesis of short transcripts, termed pRNAs (product RNAs). Hence, 6S RNAs prompt the enzyme to act as an RNA-dependent RNA polymerase (RdRP). Synthesis of pRNAs exceeding a certain length limit (~13 nt) persistently rearrange the 6S RNA structure, which in turn, disrupts the 6S RNA:RNAP complex. This pRNA synthesis-mediated “reanimation” of sequestered RNAP molecules represents the conceivably fastest mechanism for resuming transcription in cells that enter a new exponential growth phase. The many different 6S RNAs found in a wide variety of bacteria do not share strong sequence homology but have in common a conserved rod-shaped structure with a large internal loop, termed the central bulge; this architecture mediates specific binding to the active site of RNAP. In this article, we summarize the overall state of knowledge as well as very recent findings on the structure, function, and physiological effects of 6S RNA examples from the two model organisms, Escherichia coli and Bacillus subtilis. Comparison of the presently known properties of 6S RNAs in the two organisms highlights common principles as well as diverse features. PMID:24786589

  6. Portraying breast cancers with long noncoding RNAs.

    PubMed

    Van Grembergen, Olivier; Bizet, Martin; de Bony, Eric J; Calonne, Emilie; Putmans, Pascale; Brohée, Sylvain; Olsen, Catharina; Guo, Mingzhou; Bontempi, Gianluca; Sotiriou, Christos; Defrance, Matthieu; Fuks, François

    2016-09-01

    Evidence is emerging that long noncoding RNAs (lncRNAs) may play a role in cancer development, but this role is not yet clear. We performed a genome-wide transcriptional survey to explore the lncRNA landscape across 995 breast tissue samples. We identified 215 lncRNAs whose genes are aberrantly expressed in breast tumors, as compared to normal samples. Unsupervised hierarchical clustering of breast tumors on the basis of their lncRNAs revealed four breast cancer subgroups that correlate tightly with PAM50-defined mRNA-based subtypes. Using multivariate analysis, we identified no less than 210 lncRNAs prognostic of clinical outcome. By analyzing the coexpression of lncRNA genes and protein-coding genes, we inferred potential functions of the 215 dysregulated lncRNAs. We then associated subtype-specific lncRNAs with key molecular processes involved in cancer. A correlation was observed, on the one hand, between luminal A-specific lncRNAs and the activation of phosphatidylinositol 3-kinase, fibroblast growth factor, and transforming growth factor-β pathways and, on the other hand, between basal-like-specific lncRNAs and the activation of epidermal growth factor receptor (EGFR)-dependent pathways and of the epithelial-to-mesenchymal transition. Finally, we showed that a specific lncRNA, which we called CYTOR, plays a role in breast cancer. We confirmed its predicted functions, showing that it regulates genes involved in the EGFR/mammalian target of rapamycin pathway and is required for cell proliferation, cell migration, and cytoskeleton organization. Overall, our work provides the most comprehensive analyses for lncRNA in breast cancers. Our findings suggest a wide range of biological functions associated with lncRNAs in breast cancer and provide a foundation for functional investigations that could lead to new therapeutic approaches. PMID:27617288

  7. Portraying breast cancers with long noncoding RNAs

    PubMed Central

    Van Grembergen, Olivier; Bizet, Martin; de Bony, Eric J.; Calonne, Emilie; Putmans, Pascale; Brohée, Sylvain; Olsen, Catharina; Guo, Mingzhou; Bontempi, Gianluca; Sotiriou, Christos; Defrance, Matthieu; Fuks, François

    2016-01-01

    Evidence is emerging that long noncoding RNAs (lncRNAs) may play a role in cancer development, but this role is not yet clear. We performed a genome-wide transcriptional survey to explore the lncRNA landscape across 995 breast tissue samples. We identified 215 lncRNAs whose genes are aberrantly expressed in breast tumors, as compared to normal samples. Unsupervised hierarchical clustering of breast tumors on the basis of their lncRNAs revealed four breast cancer subgroups that correlate tightly with PAM50-defined mRNA-based subtypes. Using multivariate analysis, we identified no less than 210 lncRNAs prognostic of clinical outcome. By analyzing the coexpression of lncRNA genes and protein-coding genes, we inferred potential functions of the 215 dysregulated lncRNAs. We then associated subtype-specific lncRNAs with key molecular processes involved in cancer. A correlation was observed, on the one hand, between luminal A–specific lncRNAs and the activation of phosphatidylinositol 3-kinase, fibroblast growth factor, and transforming growth factor–β pathways and, on the other hand, between basal-like–specific lncRNAs and the activation of epidermal growth factor receptor (EGFR)–dependent pathways and of the epithelial-to-mesenchymal transition. Finally, we showed that a specific lncRNA, which we called CYTOR, plays a role in breast cancer. We confirmed its predicted functions, showing that it regulates genes involved in the EGFR/mammalian target of rapamycin pathway and is required for cell proliferation, cell migration, and cytoskeleton organization. Overall, our work provides the most comprehensive analyses for lncRNA in breast cancers. Our findings suggest a wide range of biological functions associated with lncRNAs in breast cancer and provide a foundation for functional investigations that could lead to new therapeutic approaches. PMID:27617288

  8. A glance at subgenomic flavivirus RNAs and microRNAs in flavivirus infections.

    PubMed

    Bavia, Lorena; Mosimann, Ana Luiza Pamplona; Aoki, Mateus Nóbrega; Duarte Dos Santos, Claudia Nunes

    2016-01-01

    The family Flaviviridae comprises a wide variety of viruses that are distributed worldwide, some of which are associated with high rates of morbidity and mortality. There are neither vaccines nor antivirals for most flavivirus infections, reinforcing the importance of research on different aspects of the viral life cycle. During infection, cytoplasmic accumulation of RNA fragments mainly originating from the 3' UTRs, which have been designated subgenomic flavivirus RNAs (sfRNAs), has been detected. It has been shown that eukaryotic exoribonucleases are involved in viral sfRNA production. Additionally, viral and human small RNAs (sRNAs) have also been found in flavivirus-infected cells, especially microRNAs (miRNAs). miRNAs were first described in eukaryotic cells and in a mature and functional state present as single-stranded 18-24 nt RNA fragments. Their main function is the repression of translation through base pairing with cellular mRNAs, besides other functions, such as mRNA degradation. Canonical miRNA biogenesis involves Drosha and Dicer, however miRNA can also be generated by alternative pathways. In the case of flaviviruses, alternative pathways have been suggested. Both sfRNAs and miRNAs are involved in viral infection and host cell response modulation, representing interesting targets of antiviral strategies. In this review, we focus on the generation and function of viral sfRNAs, sRNAs and miRNAs in West Nile, dengue, Japanese encephalitis, Murray Valley encephalitis and yellow fever infections, as well as their roles in viral replication, translation and cell immune response evasion. We also give an overview regarding other flaviviruses and the generation of cellular miRNAs during infection. PMID:27233361

  9. Alcohol-induced ciliary dysfunction targets the outer dynein arm

    PubMed Central

    Yang, Fan; Pavlik, Jacqueline; Fox, Laura; Scarbrough, Chasity; Sale, Winfield S.; Sisson, Joseph H.

    2015-01-01

    Alcohol abuse results in an increased incidence of pulmonary infection, in part attributable to impaired mucociliary clearance. Analysis of motility in mammalian airway cilia has revealed that alcohol impacts the ciliary dynein motors by a mechanism involving altered axonemal protein phosphorylation. Given the highly conserved nature of cilia, it is likely that the mechanisms for alcohol-induced ciliary dysfunction (AICD) are conserved. Thus we utilized the experimental advantages offered by the model organism, Chlamydomonas, to determine the precise effects of alcohol on ciliary dynein activity and identify axonemal phosphoproteins that are altered by alcohol exposure. Analysis of live cells or reactivated cell models showed that alcohol significantly inhibits ciliary motility in Chlamydomonas via a mechanism that is part of the axonemal structure. Taking advantage of informative mutant cells, we found that alcohol impacts the activity of the outer dynein arm. Consistent with this finding, alcohol exposure results in a significant reduction in ciliary beat frequency, a parameter of ciliary movement that requires normal outer dynein arm function. Using mutants that lack specific heavy-chain motor domains, we have determined that alcohol impacts the β- and γ-heavy chains of the outer dynein arm. Furthermore, using a phospho-threonine-specific antibody, we determined that the phosphorylation state of DCC1 of the outer dynein arm-docking complex is altered in the presence of alcohol, and its phosphorylation correlates with AICD. These results demonstrate that alcohol targets specific outer dynein arm components and suggest that DCC1 is part of an alcohol-sensitive mechanism that controls outer dynein arm activity. PMID:25595647

  10. Differentially circulating miRNAs after recent osteoporotic fractures can influence osteogenic differentiation.

    PubMed

    Weilner, Sylvia; Skalicky, Susanna; Salzer, Benjamin; Keider, Verena; Wagner, Michael; Hildner, Florian; Gabriel, Christian; Dovjak, Peter; Pietschmann, Peter; Grillari-Voglauer, Regina; Grillari, Johannes; Hackl, Matthias

    2015-10-01

    Osteoporosis is the consequence of altered bone metabolism resulting in the systemic reduction of bone strength and increased risk of fragility fractures. MicroRNAs (miRNAs) regulate gene expression on a post-transcriptional level and are known to take part in the control of bone formation and bone resorption. In addition, it is known that miRNAs are secreted by many cell types and can transfer "messages" to recipient cells. Thus, circulating miRNAs might not only be useful as surrogate biomarkers for the diagnosis or prognosis of pathological conditions, but could be actively modulating tissue physiology. Therefore, the aim of this study was to test whether circulating miRNAs that exhibit changes in recent osteoporotic fracture patients could be causally related to bone metabolism. In the first step we performed an explorative analysis of 175 miRNAs in serum samples obtained from 7 female patients with recent osteoporotic fractures at the femoral neck, and 7 age-matched female controls. Unsupervised cluster analysis revealed a high discriminatory power of the top 10 circulating miRNAs for patients with recent osteoporotic fractures. In total 6 miRNAs, miR-10a-5p, miR-10b-5p, miR-133b, miR-22-3p, miR-328-3p, and let-7g-5p exhibited significantly different serum levels in response to fracture (adjusted p-value<0.05). These miRNAs were subsequently analyzed in a validation cohort of 23 patients (11 control, 12 fracture), which confirmed significant regulation for miR-22-3p, miR-328-3p, and let-7g-5p. A set of these and of other miRNAs known to change in the context of osteoporotic fractures were subsequently tested for their effects on osteogenic differentiation of human mesenchymal stem cells (MSCs) in vitro. The results show that 5 out of 7 tested miRNAs can modulate osteogenic differentiation of MSCs in vitro. Overall, these data suggest that levels of specific circulating miRNAs change in the context of recent osteoporotic fractures and that such perturbations of

  11. Experimental approaches to identify small RNAs and their diverse roles in bacteria – what we have learnt in one decade of MicA research

    PubMed Central

    Van Puyvelde, Sandra; Vanderleyden, Jozef; De Keersmaecker, Sigrid C J

    2015-01-01

    Nowadays the identification of small RNAs (sRNAs) and characterization of their role within regulatory networks takes a prominent place in deciphering complex bacterial phenotypes. Compared to the study of other components of bacterial cells, this is a relatively new but fast-growing research field. Although reports on new sRNAs appear regularly, some sRNAs are already subject of research for a longer time. One of such sRNAs is MicA, a sRNA best described for its role in outer membrane remodeling, but probably having a much broader function than anticipated. An overview of what we have learnt from MicA led to the conclusion that even for this well-described sRNA, we still do not have the overall picture. More general, the story of MicA might become an experimental lead for unraveling the many sRNAs with unknown functions. In this review, three important topics in the sRNA field are covered, exemplified from the perspective of MicA: (i) identification of new sRNAs, (ii) target identification and unraveling the biological function, (iii) structural analysis. The complex mechanisms of action of MicA deliver some original insights in the sRNA field which includes the existence of dimer formation or simultaneous cis and trans regulation, and might further inspire the understanding of the function of other sRNAs. PMID:25974745

  12. Interiors and atmospheres of the outer planets

    NASA Technical Reports Server (NTRS)

    Hubbard, W. B.

    1991-01-01

    This theoretical/observational project constrains structure of outer planet atmospheres and interiors through observational data. The primary observation tool is through observations of occultations of stars by outer solar system objects, which yield information about atmospheric temperatures and dynamics, and planetary dimensions and oblateness. The theoretical work relates the data to interior structures in a variety of ways.

  13. Design Of Robots For Outer Space

    NASA Technical Reports Server (NTRS)

    Roston, Gerald P.

    1990-01-01

    Report discusses design of robots for use in zero gravity and vacuum, with attention to differences between requirements imposed on designs by outer space and by terrestrial applications. Terrestrial robots designed for multiple purposes and for minimal cost. Outer-space robots designed specialized to one task where cost has relatively low priority. Design optimal in one environment unlikely optimal in another.

  14. Identification of Reference Genes for Quantitative Expression Analysis of MicroRNAs and mRNAs in Barley under Various Stress Conditions

    PubMed Central

    Ferdous, Jannatul; Li, Yuan; Reid, Nicolas; Langridge, Peter; Shi, Bu-Jun; Tricker, Penny J.

    2015-01-01

    For accurate and reliable gene expression analysis using quantitative real-time reverse transcription PCR (qPCR), the selection of appropriate reference genes as an internal control for normalization is crucial. We hypothesized that non-coding, small nucleolar RNAs (snoRNAs) would be stably expressed in different barley varieties and under different experimental treatments, in different tissues and at different developmental stages of plant growth and therefore might prove to be suitable reference genes for expression analysis of both microRNAs (miRNAs) and mRNAs. In this study, we examined the expression stability of ten candidate reference genes in six barley genotypes under five experimental stresses, drought, fungal infection, boron toxicity, nutrient deficiency and salinity. We compared four commonly used housekeeping genes; Actin (ACT), alpha-Tubulin (α-TUB), Glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ADP-ribosylation factor 1-like protein (ADP), four snoRNAs; (U18, U61, snoR14 and snoR23) and two microRNAs (miR168, miR159) as candidate reference genes. We found that ADP, snoR14 and snoR23 were ranked as the best of these candidates across diverse samples. For accurate and reliable gene expression analysis using quantitative real-time reverse transcription PCR (qPCR), the selection of appropriate reference genes as an internal control for normalization is crucial. We hypothesized that non-coding, small nucleolar RNAs (snoRNAs) would be stably expressed in different barley varieties and under different experimental treatments, in different tissues and at different developmental stages of plant growth and therefore might prove to be suitable reference genes for expression analysis of both microRNAs (miRNAs) and mRNAs. In this study, we examined the expression stability of ten candidate reference genes in six barley genotypes under five experimental stresses, drought, fungal infection, boron toxicity, nutrient deficiency and salinity. We

  15. 76 FR 63654 - Outer Continental Shelf Official Protraction Diagram, Lease Maps, and Supplemental Official Outer...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-13

    ... Bureau of Ocean Energy Management Outer Continental Shelf Official Protraction Diagram, Lease Maps, and Supplemental Official Outer Continental Shelf Block Diagrams AGENCY: Bureau of Ocean Energy Management (BOEM), Interior. ACTION: Availability of revised North American Datum of 1927 (NAD 27) Outer Continental...

  16. Astroparticles: Messengers from Outer Space

    NASA Astrophysics Data System (ADS)

    Desiati, Paolo

    2016-07-01

    Since Galileo pointed a spyglass toward the sky, 400 years ago, observations empowered by man-made instrumentation have provided us with an enormous leap in the knowledge of how the Universe functions. More and more powerful optical telescopes made it possible for us to reach the farthest corners of space. At the same time, the advances in microphysics and the discovery of the electromagnetic spectrum, made it possible to directly look at the Universe in a way that our eyes cannot see. The discoveries of the intimate structure of matter, of subatomic particles and of how they interact with each other, have led astronomers to use the smallest objects in Nature to observe the farthest reaches of the otherwise invisible Universe. Not unlike Galileo, today we observe Outer Space with visible light and beyond, across the entire electromagnetic spectrum, from long wavelength radio waves to short wavelength gamma rays. But also with instruments detecting cosmic rays (the atomic nuclei we know on Earth) neutrinos (neutral subatomic particles that interact very weakly with matter) and gravitational waves (perturbations of spacetime predicted by General Relativity). Each cosmic messenger provides us with a unique piece of information about their source and the history of their journey to us. Modern astrophysics has the challenging goal to collect as much information as possible from all those messengers, to reconstruct the story of the Universe and how it became what it is today. This journey started with the unsettling discovery that we are only one minuscule dot in the immensity of the Universe and yet we are able to observe objects that are far in space and time. This journey is yet to complete its course, and the more we advance our knowledge, the more we need to understand. This interdisciplinary talk provides an overview of this journey and the future perspectives.

  17. Sweating the Small Stuff: MicroRNAs and Genetic Changes Define Pancreatic Cancer

    PubMed Central

    Tang, Siuwah; Bonaroti, Jillian; Unlu, Sebnem; Liang, Xiaoyan; Tang, Daolin; Zeh, Herbert J.; Lotze, Michael T.

    2014-01-01

    MicroRNAs (miRNAs) are 18- to 22-nucleotide-long, single-stranded, noncoding RNAs that regulate important biological processes including differentiation, proliferation, and response to cellular stressors such as hypoxia, nutrient depletion, and traversion of the cell cycle by controlling protein expression within the cell. Many investigators have profiled cancer tissue and serum miRNAs to identify potential therapeutic targets, understand the pathways involved in tumorigenesis, and identify diagnostic tumor signatures. In the setting of pancreatic cancer, obtaining pancreatic tissue is invasive and impractical for early diagnosis. Several groups have profiled miRNAs that are present in the blood as a means to diagnose tumor progression and predict prognosis/survival or drug resistance. Several miRNA signatures found in pancreatic tissue and the peripheral blood, as well as the pathways that are associated with pancreatic cancer, are reviewed here in detail. Three miRNA biomarkers (miR-21, miR-155, and miR-200) have been repetitively identified in both pancreatic cancer tissue and patients’ blood. Those miRNAs regulate and are regulated by the central genetic and epigenetic changes observed in pancreatic cancer including p53, transforming growth factor [beta], p16INK4A, BRCA1/2, and Kras. These miRNAs are involved in DNA repair, cell cycle, and cell invasion and also play important roles in promoting metastases. PMID:23774697

  18. MicroRNAs in Leukemias: Emerging Diagnostic Tools and Therapeutic Targets

    PubMed Central

    Mian, Yousaf A.; Zeleznik-Le, Nancy J.

    2010-01-01

    MicroRNAs (miRNA) are small non-coding RNAs of ~22 nucleotides that regulate the translation and stability of mRNA to control different functions of the cell. Misexpression of miRNA has been linked to disruption of normal cellular functions, which results in various disorders including cancers such as leukemias. MicroRNA involvement in disease has been the subject of much attention and is increasing our current understanding of disease biology. Such linkages have been determined by high-throughput studies, which provide a framework for characterizing differential miRNA expression levels correlating to different cytogenetic abnormalities and their corresponding malignancies. In addition, functional studies of particular miRNAs have begun to define the effects of miRNA on predicted mRNA targets. It is clear that miRNAs can serve as molecular markers of leukemias and the hope is that they can also serve as new therapeutic targets. Studies are beginning to elucidate how to deliver therapeutic antagonists to attenuate overexpressed miRNAs and to replace underexpressed miRNAs. In this review, we: i) discuss the current understanding of miRNA function and expression in normal hematopoiesis, ii) provide examples of miRNAs that are misregulated in leukemias, and iii) evaluate the current status and potential future directions for the burgeoning field of antisense oligonucleotides and other therapeutic attempts to intervene in miRNA disregulation in leukemias. PMID:20370647

  19. MicroRNAs in B-cells: from normal differentiation to treatment of malignancies

    PubMed Central

    Marques, Sara Correia; Laursen, Maria Bach; Bødker, Julie Støve; Kjeldsen, Malene Krag; Falgreen, Steffen; Schmitz, Alexander; Bøgsted, Martin; Johnsen, Hans Erik; Dybkaer, Karen

    2015-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that play important post-transcriptional regulatory roles in a wide range of biological processes. They are fundamental to the normal development of cells, and evidence suggests that the deregulation of specific miRNAs is involved in malignant transformation due to their function as oncogenes or tumor suppressors. We know that miRNAs are involved in the development of normal B-cells and that different B-cell subsets express specific miRNA profiles according to their degree of differentiation. B-cell-derived malignancies contain transcription signatures reminiscent of their cell of origin. Therefore, we believe that normal and malignant B-cells share features of regulatory networks controlling differentiation and the ability to respond to treatment. The involvement of miRNAs in these processes makes them good biomarker candidates. B-cell malignancies are highly prevalent, and the poor overall survival of patients with these malignancies demands an improvement in stratification according to prognosis and therapy response, wherein we believe miRNAs may be of great importance. We have critically reviewed the literature, and here we sum up the findings of miRNA studies in hematological cancers, from the development and progression of the disease to the response to treatment, with a particular emphasis on B-cell malignancies. PMID:25622103

  20. Annotation of additional evolutionary conserved microRNAs in CHO cells from updated genomic data

    PubMed Central

    Hackl, Matthias; Klanert, Gerald; Jadhav, Vaibhav; Reithofer, Manuel; Stiefel, Fabian; Hesse, Friedemann; Grillari, Johannes; Borth, Nicole

    2015-01-01

    ABSTRACT MicroRNAs are small non‐coding RNAs that play a critical role in post‐transcriptional control of gene expression. Recent publications of genomic sequencing data from the Chinese Hamster (CGR) and Chinese hamster ovary (CHO) cells provide new tools for the discovery of novel miRNAs in this important production system. Version 20 of the miRNA registry miRBase contains 307 mature miRNAs and 200 precursor sequences for CGR/CHO. We searched for evolutionary conserved miRNAs from miRBase v20 in recently published genomic data, derived from Chinese hamster and CHO cells, to further extend the list of known miRNAs. With our approach we could identify several hundred miRNA sequences in the genome. For several of these, the expression in CHO cells could be verified from multiple next‐generation sequencing experiments. In addition, several hundred unexpressed miRNAs are awaiting further confirmation by testing for their transcription in different Chinese hamster tissues. Biotechnol. Bioeng. 2015;112: 1488–1493. © 2015 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:25689160

  1. Host gene constraints and genomic context impact the expression and evolution of human microRNAs

    PubMed Central

    França, Gustavo S.; Vibranovski, Maria D.; Galante, Pedro A. F.

    2016-01-01

    Increasing evidence has shown that recent miRNAs tend to emerge within coding genes. Here we conjecture that human miRNA evolution is tightly influenced by the genomic context, especially by host genes. Our findings show a preferential emergence of intragenic miRNAs within old genes. We found that miRNAs within old host genes are significan