These are representative sample records from related to your search topic.
For comprehensive and current results, perform a real-time search at

Radioimmunotherapy with alpha-particle-emitting immunoconjugates  

SciTech Connect

Alpha particles are energetic short-range ions whose higher linear energy transfer produces extreme cytotoxicity. An ..cap alpha..-particle-emitting radioimmunoconjugate consisting of a bismuth-212-labeled monoclonal immunoglobulin M specific for the murine T cell/neuroectodermal surface antigen Thy 1.2 was prepared. Analysis in vitro showed that the radioimmunoconjugate was selectively cytotoxic to a Thy 1.2/sup +/ EL-4 murine tumor cell line. Approximately three bismuth-212-labeled immunoconjugates per target cell reduced the uptake of (/sup 3/H)thymidine by the EL-4 target cells to background levels. Mice inoculated intraperitoneally with EL-4 cells were cured of their ascites after intraperitoneal injection of 150 microcuries of the antigen-specific radioimmunoconjugate, suggesting a possible role for such conjugates in intracavitary cancer therapy. 18 references, 3 figures.

Macklis, R.M.; Kinsey, B.M.; Kassis, A.L.; Ferrara, J.L.M.; Atcher, R.W.; Hines, J.J.; Coleman, C.N.; Adelstein, S.J.; Burakoff, S.J.



Intense alpha-particle emitting crystallites in uranium mill wastes  

USGS Publications Warehouse

Nuclear emulsion microscopy has demonstrated the presence of small, intense ??-particle emitting crystallites in laboratory-produced tailings derived from the sulfuric acid milling of uranium ores. The ??-particle activity is associated with the isotope pair 210Pb 210Po, and the host mineral appears to be PbSO4 occurring as inclusions in gypsum laths. These particles represent potential inhalation hazards at uranium mill tailings disposal areas. ?? 1994.

Landa, E.R.; Stieff, L.R.; Germani, M.S.; Tanner, A.B.; Evans, J.R.



Quality factors for alpha particles emitted in tissue  

NASA Technical Reports Server (NTRS)

A concept of a mean or dose averaged quality factor was defined in ICRP Publication 26 using relationships for quality factor as a function of LET. The concept of radiation weighting factors, wR, was introduced in ICRP Publication 60 in 1990. These are meant to be generalized factors that modify absorbed dose to reflect the risk of stochastic effects as a function of the quality of the radiation incident on the body or emitted by radioactivity within the body. The values of wr are equal to 20 for all alpha particles externally or internally emitted. This note compares the dose averaged quality factor for alpha particles originating in tissue using the old and revised recommendations for quality factor as a function of LET. The dose averaged quality factor never exceeds 20 using the old recommendations and is never less than 20 with the revised recommendations.

Borak, Thomas B.; Chatterjee, A. (Principal Investigator)



The short-lived MAT alpha 2 transcriptional regulator is ubiquitinated in vivo.  

PubMed Central

The substrates of ubiquitin-dependent proteolytic pathways include both damaged or otherwise abnormal proteins and undamaged proteins that are naturally short-lived. Few specific examples of the latter class have been identified, however. Previous work has shown that the cell type-specific MAT alpha 2 repressor of the yeast Saccharomyces cerevisiae is an extremely short-lived protein. We now demonstrate that alpha 2 is conjugated to ubiquitin in vivo. More than one lysine residue of alpha 2 can be joined to ubiquitin, and some of the ubiquitin moieties form a Lys48-linked multiubiquitin chain. Overexpression of degradation-impaired ubiquitin variants was used to show that at least a significant fraction of alpha 2 degradation is dependent on its ubiquitination. Images PMID:1647011

Hochstrasser, M; Ellison, M J; Chau, V; Varshavsky, A



Bismuth-212-labeled anti-Tac monoclonal antibody: alpha-particle-emitting radionuclides as modalities for radioimmunotherapy.  

PubMed Central

Anti-Tac, a monoclonal antibody directed to the human interleukin 2 (IL-2) receptor, has been successfully conjugated to the alpha-particle-emitting radionuclide bismuth-212 by use of a bifunctional ligand, the isobutylcarboxycarbonic anhydride of diethylenetriaminepentaacetic acid. The physical properties of 212Bi are appropriate for radioimmunotherapy in that it has a short half-life, deposits its high energy over a short distance, and can be obtained in large quantities from a radium generator. Antibody specific activities of 1-40 microCi/microgram (1 Ci = 37 GBq) were achieved. Specificity of the 212Bi-labeled anti-Tac was demonstrated for the IL-2 receptor-positive adult T-cell leukemia line HUT-102B2 by protein synthesis inhibition and clonogenic assays. Activity levels of 0.5 microCi or the equivalent of 12 rad/ml of alpha radiation targeted by anti-Tac eliminated greater than 98% the proliferative capabilities of HUT-102B2 cells with more modest effects on IL-2 receptor-negative cell lines. Specific cytotoxicity was blocked by excess unlabeled anti-Tac but not by human IgG. In addition, an irrelevant control monoclonal antibody of the same isotype labeled with 212Bi was unable to target alpha radiation to cell lines. Therefore, 212Bi-labeled anti-Tac is a potentially effective and specific immunocytotoxic reagent for the elimination of IL-2 receptor-positive cells. These experiments thus provide the scientific basis for use of alpha-particle-emitting radionuclides in immunotherapy. PMID:3079913

Kozak, R W; Atcher, R W; Gansow, O A; Friedman, A M; Hines, J J; Waldmann, T A



Angular Distribution of Alpha Particles Emitted by Oriented Np237 Nuclei  

Microsoft Academic Search

Np237 nuclei were aligned through the electric quadrupole and magnetic hyperfine couplings in NpO2Rbz(NO3)3, cooled to 0.2-4.2°K. A complete experiment, with rotatable monocrystalline sample, solid-state counter, thermometer, and goniometer, was enclosed in a copper container filled with He3 gas and thermally attached to 1\\/2 mole of paramagnetic salt which could be cooled magnetically. The measured temperature dependence of the alpha-particle

S. H. Hanauer; J. W. Dabbs; L. D. Roberts; G. W. Parker



Nucleon-Alpha Particle Disequilibrium and Short-Lived r-Process Radioactivities  

NASA Technical Reports Server (NTRS)

r-Process yields can be extremely sensitive to expansion parameters when a persistent disequilibrium between free nucleons and alpha particles is present. This may provide a natural scenario for understanding the variation of heavy and light r-process isotopes in different r-process events. Additional information is contained in the original extended abstract.

Meyer, B. S.; Clayton, D. D.; Chellapilla, S.; The, L.-S.



Production of the Alpha-Particle Emitting Radionuclide Astatine-211 at the Texas A&M Cyclotron Institute  

E-print Network

) Normalized neutron energy spectrum for Bi-209(?,xn) reaction from TALYS ........... 42 Figure 19 Target geometry utilized for MCNPX shielding simulations ................... 44 Figure 20 Gamma-ray spectrum based on first experiment measurement at 35... yields for the second experiment using an alpha-particle beam (25.3 MeV, 96.13 nA) measured at a distance of 20 cm from the detector ....................................................... 50 Table 20 MCNPX contact dose rate projections...

Bhakta, Viharkumar Satish



Treatment of HER2-Expressing Breast Cancer and Ovarian Cancer Cells With Alpha Particle-Emitting {sup 227}Th-Trastuzumab  

SciTech Connect

Purpose: To evaluate the cytotoxic effects of low-dose-rate alpha particle-emitting radioimmunoconjugate {sup 227}Th-p-isothiocyanato-benzyl-DOTA-trastuzumab ({sup 227}Th-trastuzumab [where DOTA is 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid]) internalized by breast and ovarian cancer cell lines in order to assess the potential of {sup 227}Th-trastuzumab as a therapeutic agent against metastatic cancers that overexpress the HER2 oncogene. Methods and Materials: Clonogenic survival and cell growth rates of breast cancer cells treated with {sup 227}Th-trastuzumab were compared with rates of cells treated with nonbinding {sup 227}Th-rituximab, cold trastuzumab, and X-radiation. Cell growth experiments were also performed with ovarian cancer cells. Cell-associated radioactivity was measured at several time points, and the mean radiation dose to cells was calculated. Results: SKBR-3 cells got 50% of the mean absorbed radiation dose from internalized activity and 50% from cell surface-bound activity, while BT-474 and SKOV-3 cells got 75% radiation dose from internalized activity and 25% from cell surface-bound activity. Incubation of breast cancer cells with 2.5 kBq/ml {sup 227}Th-trastuzumab for 1 h at 4{sup o}C, followed by washing, resulted in mean absorbed radiation doses of 2 to 2.5 Gy. A dose-dependent inhibition of cell growth and an increase in apoptosis were induced in all cell lines. Conclusions: Clinically relevant activity concentrations of {sup 227}Th-trastuzumab induced a specific cytotoxic effect in three HER2-expressing cell lines. The cytotoxic effect of {sup 227}Th-trastuzumab was higher than that of single-dose X-radiation (relative biological effectiveness = 1.2). These results warrant further studies of treatment of breast cancer and ovarian cancer with {sup 227}Th-trastuzumab.

Heyerdahl, Helen; Krogh, Cecilie [Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Montebello, Oslo (Norway); Borrebaek, Jorgen [Algeta ASA, Kjelsas, Oslo (Norway); Larsen, Asmund [Algeta ASA, Kjelsas, Oslo (Norway); Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Montebello, Oslo (Norway); Dahle, Jostein, E-mail: jostein.dahle@rr-research.n [Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Montebello, Oslo (Norway)



Cumulative genetic damage in hematopoietic stem cells in a patient with a 40-year exposure to alpha particles emitted by thorium dioxide.  


Thorotrast, a colloidal suspension of the long-lived radionuclide, thorium-232, was widely used as a radiographic contrast medium for several decades. Due to the poor excretion of the sol, however, Thorotrast would deposit in the liver, bone marrow and other tissue, and patients would receive alpha-particle irradiation for life. To gauge the cumulative genetic damage to hematopoietic stem cells due to chronic exposure to alpha particles, we conducted a multi-end-point evaluation in a 72-year-old man who had been administered a 32-ml bolus of Thorotrast during cerebral angiography performed over 40 years ago in 1950. Peripheral T lymphocytes were cultured to quantify the frequencies and cellular distributions of asymmetrical and symmetrical types of chromosome aberrations in first-division metaphases and micronuclei in cytokinesis-arrested interphase II cells. Aberrations were scored using classical chromosome group analysis methods and chromosome painting techniques. Assays of glycophorin-A (GPA) mutations in red blood cells were also performed to obtain a relative measurement of damage sustained by the erythroid stem cell population. Results revealed that approximately 30% of the lymphocytes in this patient contained one or more chromosome aberrations, the majority of which were of the "stable" type. About one-third of the lymphocytes with chromosome damage carried multiple aberrations, suggesting that significant numbers of stem cells survive exposures to alpha-particle radiation that induce complex genomic alterations. Increased frequencies of GPA mutations were observed, demonstrating that genomic damage is also induced in erythroid progenitors. The numbers of micronuclei in lymphocytes were only moderately increased compared to expected values for persons of comparable age, and thus this end point was not useful for quantifying exposure level. Despite the relatively severe burden of somatic cell damage induced by 40 years of internal alpha-particle irradiation, the patient remains surprisingly free of any serious illness. PMID:9254732

Littlefield, L G; Travis, L B; Sayer, A M; Voelz, G L; Jensen, R H; Boice, J D



Short-Lived Climate Pollution  

NASA Astrophysics Data System (ADS)

Although carbon dioxide emissions are by far the most important mediator of anthropogenic climate disruption, a number of shorter-lived substances with atmospheric lifetimes of under a few decades also contribute significantly to the radiative forcing that drives climate change. In recent years, the argument that early and aggressive mitigation of the emission of these substances or their precursors forms an essential part of any climate protection strategy has gained a considerable following. There is often an implication that such control can in some way make up for the current inaction on carbon dioxide emissions. The prime targets for mitigation, known collectively as short-lived climate pollution (SLCP), are methane, hydrofluo-rocarbons, black carbon, and ozone. A re-examination of the issues shows that the benefits of early SLCP mitigation have been greatly exaggerated, largely because of inadequacies in the methodologies used to compare the climate effects of short-lived substances with those of CO2, which causes nearly irreversible climate change persisting millennia after emissions cease. Eventual mitigation of SLCP can make a useful contribution to climate protection, but there is little to be gained by implementing SLCP mitigation before stringent carbon dioxide controls are in place and have caused annual emissions to approach zero. Any earlier implementation of SLCP mitigation that substitutes to any significant extent for carbon dioxide mitigation will lead to a climate irreversibly warmer than will a strategy with delayed SLCP mitigation. SLCP mitigation does not buy time for implementation of stringent controls on CO2 emissions.

Pierrehumbert, R. T.



Production of short lived radioactive beams of radium  

E-print Network

Short lived $^{212,213,214}$Ra isotopes have been produced at the TRI$\\mu$P facility in inverse kinematics via the fusion-evaporation reaction $^{206}$Pb+$^{12}$C at 8 MeV/u. Isotopes are separated from other reaction products online using the TRI$\\mu$P magnetic separator. The energetic radium (Ra) isotopes at the exit of the separator were converted into low energy ions with a thermal ionizer. Ra isotopes have been identified by observing their $\\alpha$ decay and life times.

Shidling, P D; van der Hoek, D J; Jungmann, K; Kruithof, W; Onderwater, C J G; Sohani, M; Versolato, O O; Willmann, L; Wilschut, H W



Production of short lived radioactive beams of radium  

E-print Network

Short lived $^{212,213,214}$Ra isotopes have been produced at the TRI$\\mu$P facility in inverse kinematics via the fusion-evaporation reaction $^{206}$Pb+$^{12}$C at 8 MeV/u. Isotopes are separated from other reaction products online using the TRI$\\mu$P magnetic separator. The energetic radium (Ra) isotopes at the exit of the separator were converted into low energy ions with a thermal ionizer. Ra isotopes have been identified by observing their $\\alpha$ decay and life times.

P. D. Shidling; G. S. Giri; D. J. van der Hoek; K. Jungmann; W. Kruithof; C. J. G. Onderwater; M. Sohani; O. O. Versolato; L. Willmann; H. W. Wilschut



Skylab short-lived event alert program  

NASA Technical Reports Server (NTRS)

During the three manned Skylab missions, the Center for Short-Lived Phenomena (CSLP) reported a total of 39 significant events to the Johnson Space Center (JSC) as part of the Skylab Short-Lived Event Alert Program. The telegraphed daily status reports included the names and locations of the events, the track number and revolution number during which the event could be observed, the time (GMT) to within plus or minus 2 sec when Skylab was closest to the event area, and the light condition (daylight or darkness) at that time and place. The messages sent to JSC during the Skylab 4 mission also included information pertaining to ground-truth studies and observations being conducted on the events. Photographic priorities were assigned for each event.

Citron, R. A.



Alchemy with short-lived radionuclides  

SciTech Connect

A variety of short-lived radionuclides are produced and subsequently incorporated into radiopharmaceutical compounds in the radionuclide production program currently being conducted at the Cyclotron Facility of Mount Sinai Medical Center. The recovery of high specific activity oxygen-15 labelled water prepared by means of an inexpensive system operating in conjunction with an on-line radiogas target routinely utilized for oxygen-15 labelled carbon dioxide studies is currently receiving particular attention.

Rubio, F.F.; Finn, R.D.; Gilson, A.J.



Counting Particles Emitted by Stratospheric Aircraft and Measuring Size of Particles Emitted by Stratospheric Aircraft  

NASA Technical Reports Server (NTRS)

There were two principal objectives of the cooperative agreement between NASA and the University of Denver. The first goal was to modify the design of the ER-2 condensation nuclei counter (CNC) so that the effective lower detection limit would be improved at high altitudes. This improvement was sought because, in the instrument used prior to 1993, diffusion losses prevented the smallest detectable particles from reaching the detection volume of the instrument during operation at low pressure. Therefore, in spite of the sensor's ability to detect particles as small as 0.008 microns in diameter, many of these particles were lost in transport to the sensing region and were not counted. Most of the particles emitted by aircraft are smaller than 0.1 micron in diameter. At the start date of this work, May 1990, continuous sizing techniques available on the ER-2 were only capable of detecting particles larger than 0.17 micron. Thus, the second objective of this work was to evaluate candidate sizing techniques in an effort to gain additional information concerning the size of particles emitted by aircraft.

Wilson, James Charles



Studies of images of short lived events using ERTS data  

NASA Technical Reports Server (NTRS)

The author has identified the following significant results. The program to study short-lived events with the ERTS-1 satellite has evaluated 97 events reported by the Center for Short-Lived Phenomena. Forty-eight of these events were listed as candidates for ERTS-1 coverage and 8 of these were considered significant enough to immediately alert the ERTS operation staff by telephone. Studies of the images received from six events indicate that useful data on short-lived events can be obtained from ERTS-1 that would be difficult or impossible to obtain by other methods.

Deutschman, W. A. (principal investigator)



Short-lived radionuclides in the early Solar System  

NASA Astrophysics Data System (ADS)

Short-lived radionuclides are radioactive elements with half-lives <= 100 Myr. They have all decayed away from their initial abundances, but their presence in the early Solar System could be inferred from radiogenic excesses of daughter products in meteoritic components. A detailed understanding of the initial abundance and distribution of short-lived radionuclides can shed light on the formation condition and immediate astrophysical environment of the early Solar System.

Liu, Ming-Chang



Short-lived positron emitter labeled radiotracers - present status  

SciTech Connect

The preparation of labelled compounds is important for the application of positron emission transaxial tomography (PETT) in biomedical sciences. This paper describes problems and progress in the synthesis of short-lived positron emitter (/sup 11/C, /sup 18/F, /sup 13/N) labelled tracers for PETT. Synthesis of labelled sugars, amino acids, and neurotransmitter receptors (pimozide and spiroperidol tagged with /sup 11/C) is discussed in particular. (DLC)

Fowler, J.S.; Wolf, A.P.



Bone tumor induction after incorporation of short-lived radionuclides.  


Temporally-limited internal irradiation after incorporation of short-lived bone-seeking radionuclides is a useful experimental tool for the investigation of extrinsic and intrinsic factors which modify the dose dependence of bone tumor risk. Here we describe some of the results obtained in experiments with female mice (mainly NMRI). The future aim of such experiments should be the prediction of risk of late effects using early molecular-biological changes. Molecular-biological descriptions in our model are at present very limited. PMID:1924711

Luz, A; Müller, W A; Linzner, U; Strauss, P G; Schmidt, J; Müller, K; Atkinson, M J; Murray, A B; Gössner, W; Erfle, V



Measures Urged to Cut Short-Lived Climate Pollutants  

NASA Astrophysics Data System (ADS)

To produce significant near-term climate benefits, the Obama administration should take a series of actions under existing authorities to reduce greenhouse gases that have relatively short atmospheric lifetimes of weeks to a few decades, according to a 12 March study by the nonprofit Center for Climate and Energy Solutions (C2ES). The report, "Domestic Policies to Reduce the Near-Term Risks of Climate Change," notes that recent estimates suggest that about 30-40% of warming experienced to date can be attributed to these short-lived pollutants, which include black carbon, methane, and hydrofluorocarbons (HFCs).

Showstack, Randy



Near-term climate mitigation by short-lived forcers  

PubMed Central

Emissions reductions focused on anthropogenic climate-forcing agents with relatively short atmospheric lifetimes, such as methane (CH4) and black carbon, have been suggested as a strategy to reduce the rate of climate change over the next several decades. We find that reductions of methane and black carbon would likely have only a modest impact on near-term global climate warming. Even with maximally feasible reductions phased in from 2015 to 2035, global mean temperatures in 2050 would be reduced by 0.16 °C, with a range of 0.04–0.35 °C because of uncertainties in carbonaceous aerosol emissions and aerosol forcing per unit of emissions. The high end of this range is only possible if total historical aerosol forcing is relatively small. More realistic emission reductions would likely provide an even smaller climate benefit. We find that the climate benefit from reductions in short-lived forcing agents are smaller than previously estimated. These near-term climate benefits of targeted reductions in short-lived forcers are not substantially different in magnitude from the benefits from a comprehensive climate policy. PMID:23940357

Smith, Steven J.; Mizrahi, Andrew



Short-lived Isotopes from a Close-by AGB Star Triggering the Protosolar Nebula  

NASA Astrophysics Data System (ADS)

The presence of short-lived isotopes in the early solar system, in particular 26Al, 41Ca, 60Fe, and 107Pd, point to a close-by and fresh nucleosynthesis source, possibly triggering the collapse of the protosolar nebula. We present the results of nucleosynthesis calculations based on an AGB polluting hypothesis. A general concordance of the predicted yields of the above radioactivities relative to 26Al can be obtained in the case of an intermediate mass AGB star with hot bottom burning in the envelope (thus producing 26Al), and mixing through a series of third dredge-up episodes a fraction of the C-rich and s-processed material from the He intershell with the extended envelope. Polution of the protosolar nebula with freshly synthesized material may derive from the efficient winds of the AGB star. In AGB stars, the s-process nucleosynthesis occurs both during the maximum phase of every thermal runaway, driven by the partial activation of the 22Ne(alpha,n)25Mg reaction, and in the interpulse phase, where the 13C nuclei are fully consumed in radiative conditions by the activation of the 13C(alpha,n)16O reaction. We have used different prescriptions for the amount of the 13C nuclei present in the intershell. A minimum amount of 13C is naturally expected in the ashes of H-shell burning. Possible formation of an extra "13C-pocket" derives from the injection of a small amount of protons from the envelope into the 12C-rich intershell during any third dredge-up episode, when the H-shell is inactivated. Prediction for other short-lived, 36Cl, 135Cs, and 205Pb, are given. General consequences for the pollution of the protosolar nebula with newly synthesized stable isotopes from the AGB winds are outlined. The origin of other detected short-lived nuclei, in particular 53Mn, 129I, and 182Hf, which cannot come from an AGB source, is analysed. The alternative trigger hypothesis by a close-by Supernova is discussed.

Gallino, R.; Busso, M.; Wasserburg, G. J.; Straniero, O.


Production of ?-particle emitting 211At using 45 MeV ?-beam  

NASA Astrophysics Data System (ADS)

Among the ?-particle emitting radionuclides, 211At is considered to be a promising radionuclide for targeted cancer therapy due to its decay properties. The range of alpha particles produced by the decay of 211At are less than 70 µm in water with a linear energy transfer between 100 and 130 keV µm-1, which are about the maximum relative biological effectiveness for heavy ions. It is important to note that at the present time, only a few of cyclotrons routinely produce 211At. The direct production method is based on the nuclear reactions 209Bi(?,2n)211At. Production of the radionuclide 211At was carried out using the MC-50 cyclotron at the Korea Institute of Radiological and Medical Sciences (KIRAMS). To ensure high beam current, the ?-beam was extracted with an initial energy of 45 MeV, which was degraded to obtain the appropriate ?-beam energy. The calculations of beam energy degradation were performed utilizing the MCNPX. Alumina-baked targets were prepared by heating the bismuth metal powder onto a circular cavity in a furnace. When using an E?, av of 29.17 MeV, the very small contribution of 210At confirms the right choice of the irradiation energy to obtain a pure production of 211At isotope.

Kim, Gyehong; Chun, Kwonsoo; Park, Sung Ho; Kim, Byungil



Near-Term Climate Mitigation by Short-Lived Forcers  

SciTech Connect

Emissions reductions focused on anthropogenic climate forcing agents with relatively short atmospheric lifetimes such as methane (CH4) and black carbon (BC) have been suggested as a strategy to reduce the rate of climate change over the next several decades. We find that reductions of methane and BC would likely have only a modest impact on near-term climate warming. Even with maximally feasible reductions phased in from 2015 to 2035, global mean temperatures in 2050 are reduced by 0.16 °C, with an uncertainty range of 0.04-0.36°C, with the high end of this range only possible if total historical aerosol forcing is small. More realistic mitigation scenarios would likely provide a smaller climate benefit. The climate benefits from targeted reductions in short-lived forcing agents are smaller than previously estimated and are not substantially different in magnitude from the benefits due to a comprehensive climate policy.

Smith, Steven J.; Mizrahi, Andrew H.



Nucleosynthesis of Short-lived Radioactivities in Massive Stars  

NASA Technical Reports Server (NTRS)

A leading model for the source of many of the short-lived radioactivities in the early solar nebula is direct incorporation from a massive star [1]. A recent and promising incarnation of this model includes an injection mass cut, which is a boundary between the stellar ejecta that become incorporated into the solar cloud and those ejecta that do not [2-4]. This model also includes a delay time between ejection from the star and incorporation into early solar system solid bodies. While largely successful, this model requires further validation and comparison against data. Such evaluation becomes easier if we have a better sense of the nature of the synthesis of the various radioactivities in the star. That is the goal of this brief abstract.

Meyer, B. S.



Processes regulating short-lived species in the tropical tropopause layer  

Microsoft Academic Search

A one-dimensional model of vertical transport in the tropical tropopause layer (TTL) is developed. The model uses vertical advection, a convective source, and a chemical sink to simulate the profiles of very short lived substances in the TTL. The model simulates evanescent profiles of short-lived hydrocarbon species observed by satellite and is also used to simulate short-lived bromine species. Tracers

A. Gettelman; P. H. Lauritzen; J. E. Kay



Processes regulating short-lived species in the tropical tropopause layer  

Microsoft Academic Search

(1) A one-dimensional model of vertical transport in the tropical tropopause layer (TTL) is developed. The model uses vertical advection, a convective source, and a chemical sink to simulate the profiles of very short lived substances in the TTL. The model simulates evanescent profiles of short-lived hydrocarbon species observed by satellite and is also used to simulate short-lived bromine species.

A. Gettelman; P. H. Lauritzen; J. E. Kay



Quantifying Short-Lived Events in Multistate Ionic Current Measurements  

PubMed Central

We developed a generalized technique to characterize polymer–nanopore interactions via single channel ionic current measurements. Physical interactions between analytes, such as DNA, proteins, or synthetic polymers, and a nanopore cause multiple discrete states in the current. We modeled the transitions of the current to individual states with an equivalent electrical circuit, which allowed us to describe the system response. This enabled the estimation of short-lived states that are presently not characterized by existing analysis techniques. Our approach considerably improves the range and resolution of single-molecule characterization with nanopores. For example, we characterized the residence times of synthetic polymers that are three times shorter than those estimated with existing algorithms. Because the molecule’s residence time follows an exponential distribution, we recover nearly 20-fold more events per unit time that can be used for analysis. Furthermore, the measurement range was extended from 11 monomers to as few as 8. Finally, we applied this technique to recover a known sequence of single-stranded DNA from previously published ion channel recordings, identifying discrete current states with subpicoampere resolution. PMID:24397836



Very short-lived Substances as Sources for Stratospheric Bromine  

NASA Astrophysics Data System (ADS)

Halogen-containing gases, when transported into the stratosphere, release chlorine and bromine atoms, which can lead to the destruction of ozone by catalytic cycles. Long-lived anthropogenic source gases like chlorofluorocarbons (CFCs), chlorocarbons, methyl bromide (CH3Br, also with natural sources) and halons are the most important sources for stratospheric halogen. While the budget of stratospheric chlorine is relatively well understood, greater uncertainties are present in terms of quantity and attribution of stratospheric bromine. BrO measurements in the stratosphere indicate abundances of inorganic bromine Bry that cannot be explained by the contribution from the long-lived halons and methyl bromide only. Additional input is expected to be provided by natural very-short-lived substances (VSLS), inorganic product gases and bromine tied to aerosols. We present measurements of all important brominated source gases, including the five most abundant VSLS, in the tropical tropopause layer (TTL) from balloon-borne air samples collected in June 2008 in Teresina (Brazil). The results were used to derive a local budget of organic bromine, which is revealing a considerable contribution from VSLS. We discuss variabilities in the concentrations of VSLS species both in the TTL and in the tropical marine boundary layer to assess the significance of our measurements on a global scale.

Brinckmann, Sven; Engel, Andreas; Bönisch, Harald



Convective transport of very short lived bromocarbons to the stratosphere  

NASA Astrophysics Data System (ADS)

We use the NASA Goddard Earth Observing System (GEOS) Chemistry Climate Model (GEOSCCM) to quantify the contribution of the two most important brominated very short lived substances (VSLSs), bromoform (CHBr3) and dibromomethane (CH2Br2), to stratospheric bromine and its sensitivity to convection strength. Model simulations suggest that the most active transport of VSLSs from the marine boundary layer through the tropopause occurs over the tropical Indian Ocean, the tropical western Pacific, and off the Pacific coast of Mexico. Together, convective lofting of CHBr3 and CH2Br2 and their degradation products supplies ~8 ppt total bromine to the base of the tropical tropopause layer (TTL, ~150 hPa), similar to the amount of VSLS organic bromine available in the marine boundary layer (~7.8-8.4 ppt) in the active convective lofting regions mentioned above. Of the total ~8 ppt VSLS bromine that enters the base of the TTL at ~150 hPa, half is in the form of organic source gases and half in the form of inorganic product gases. Only a small portion (<10%) of the VSLS-originated bromine is removed via wet scavenging in the TTL before reaching the lower stratosphere. On average, globally, CHBr3 and CH2Br2 together contribute ~7.7 pptv to the present-day inorganic bromine in the stratosphere. However, varying model deep-convection strength between maximum (strongest) and minimum (weakest) convection conditions can introduce a ~2.6 pptv uncertainty in the contribution of VSLSs to inorganic bromine in the stratosphere (BryVSLS). Contrary to conventional wisdom, the minimum convection condition leads to a larger BryVSLS as the reduced scavenging in soluble product gases, and thus a significant increase in product gas injection (2-3 ppt), greatly exceeds the relatively minor decrease in source gas injection (a few 10ths ppt).

Liang, Q.; Atlas, E.; Blake, D.; Dorf, M.; Pfeilsticker, K.; Schauffler, S.



Latitudinal Variation in Reproductive Timing of a Short-Lived Monocarp, Daucus Carota (Apiaceae)  

E-print Network

Latitudinal Variation in Reproductive Timing of a Short-Lived Monocarp, Daucus Carota (Apiaceaernerlca LATITUDINAL VARIATION IN REPRODUCTIVE TIMING OF A SHORT-LIVED MONOCARP, DAUCUS CAROTA (APIACEAE-history variation in Daucus carota along its latitudinal range in eastern North Amer- ica. Seeds collected from

Lacey, Elizabeth P.


Neutron-induced cross sections of short-lived nuclei via the surrogate reaction method  

E-print Network

Neutron-induced cross sections of short-lived nuclei via the surrogate reaction method G. Boutoux1 Abstract. The measurement of neutron-induced cross sections of short-lived nuclei is extremely difficult for a neutron-induced measurement. We have successfully used the surrogate reaction method to extract neutron

Boyer, Edmond


Efficiency of short-lived halogens at influencing climate through depletion of stratospheric ozone  

NASA Astrophysics Data System (ADS)

Halogens released from long-lived anthropogenic substances, such as chlorofluorocarbons, are the principal cause of recent depletion of stratospheric ozone, a greenhouse gas. Recent observations show that very short-lived substances, with lifetimes generally under six months, are also an important source of stratospheric halogens. Short-lived bromine substances are produced naturally by seaweed and phytoplankton, whereas short-lived chlorine substances are primarily anthropogenic. Here we used a chemical transport model to quantify the depletion of ozone in the lower stratosphere from short-lived halogen substances, and a radiative transfer model to quantify the radiative effects of that ozone depletion. According to our simulations, ozone loss from short-lived substances had a radiative effect nearly half that from long-lived halocarbons in 2011 and, since pre-industrial times, has contributed a total of about -0.02 W m-2 to global radiative forcing. We find natural short-lived bromine substances exert a 3.6 times larger ozone radiative effect than long-lived halocarbons, normalized by halogen content, and show atmospheric levels of dichloromethane, a short-lived chlorine substance not controlled by the Montreal Protocol, are rapidly increasing. We conclude that potential further significant increases in the atmospheric abundance of short-lived halogen substances, through changing natural processes or continued anthropogenic emissions, could be important for future climate.

Hossaini, R.; Chipperfield, M. P.; Montzka, S. A.; Rap, A.; Dhomse, S.; Feng, W.



Crantor, a short-lived horseshoe companion to Uranus  

NASA Astrophysics Data System (ADS)

Context. Stable co-orbital motion with Uranus is vulnerable to planetary migration, but temporary co-orbitals may exist today. So far, only two candidates have been suggested, both moving on horseshoe orbits: 83982 Crantor (2002 GO9) and 2000 SN331. Aims: (83982) Crantor is currently classified in the group of the Centaurs by the MPC although the value of its orbital period is close to that of Uranus. Here we revisit the topic of the possible 1:1 commensurability of (83982) Crantor with Uranus, explore its dynamical past, and look into its medium-term stability and future orbital evolution. Methods: Our analysis is based on the results of N-body calculations that use the most updated ephemerides and include perturbations by the eight major planets, the Moon, the barycenter of the Pluto-Charon system, and the three largest asteroids. Results: (83982) Crantor currently moves inside Uranus' co-orbital region on a complex horseshoe orbit. The motion of this object is primarily driven by the influence of the Sun and Uranus, although Saturn plays a significant role in destabilizing its orbit. The precession of the nodes of (83982) Crantor, which is accelerated by Saturn, controls its evolution and short-term stability. Although this object follows a temporary horseshoe orbit, more stable trajectories are possible and we present 2010 EU65 as a long-term horseshoe librator candidate in urgent need of follow-up observations. Available data indicate that the candidate 2000 SN331 is not a Uranus' co-orbital. Conclusions: Our calculations confirm that (83982) Crantor is currently trapped in the 1:1 commensurability with Uranus but it is unlikely to be a primordial 1:1 librator. Although this object follows a chaotic, short-lived horseshoe orbit, longer term horseshoe stability appears to be possible. We also confirm that high-order resonances with Saturn play a major role in destabilizing the orbits of Uranus co-orbitals. Figures 2 and 6 (animations) are available in electronic form at

de la Fuente Marcos, C.; de la Fuente Marcos, R.



Short-Lived Radionuclides and Solar System Formation  

NASA Astrophysics Data System (ADS)

The evidence for live 26Al in Allende refractory inclusions [1] implies that no more than about 1 Myr elapsed between the nucleosynthesis of the 26Al and its incorporation into cm-sized inclusions in the solar nebula [2]. A supernova was immediately suggested as the source of the 26Al, and the supernova shock front was implicated both as a means for transporting the 26Al from the supernova to the presolar cloud, and for triggering the collapse of the cloud by the impact of the shock [3]. Evidence of other exotic stellar environments comes from isotopic anomalies in presolar grains, which suggest grain formation in novae, Wolf-Rayet stars, or asymptotic giant branch (AGB) stars [4]. Nucleosynthesis in the hydrogen- and helium-burning layers of an AGB star can account for the approximate abundances of several short-lived radionuclei (26Al, 60Fe, and 107Pd) found in chondritic meteorites, assuming a mass mixing ratio of about 100:1 between the presolar cloud and the AGB star ejecta [2]. The same 100:1 mixing ratio is necessary to explain the solar system abundance of 3He if the 3He was derived from the planetary nebula phase of an AGB star [5]. 3D hydrodynamical models of the interaction of stellar shock waves with dense cloud cores suggest a mixing ratio of about 100:1 between the mass of the presolar cloud and the mass of the material from the shock wave that is injected into the collapsing protostellar cloud [6]. The agreement between these three independent estimates of mixing ratios is very remarkable, especially considering the diverse techniques employed in their derivations. AGB stars are also capable of synthesizing the 41Ca [7] that has recently been inferred to have been present in the solar nebula [8]. The presence of live 41Ca in the solar nebula would shorten the time interval between synthesis and crystallization of refractory inclusions to about 0.5 to 0.7 Myr [7]. Considering that the 'standard theory' of star formation involves a 10 Myr period of quasistatic contraction prior to the onset of the rapid collapse phase [9], the 41Ca time constraint further strengthens the need for collapse to be triggered by the arrival of the stellar shock front. A supernova has been re-proposed as the source of 26Al and other short-lived radionuclei [10]; in order to achieve the proper dilution of supernova ejecta with the presolar cloud, a distance of a few to about 10 parsecs is inferred [10]. In order to learn whether AGB stars or supernovae are better suited to triggering the collapse of the presolar cloud, we have developed a 2D gravitational hydrodynamics code and used it to study the interaction of shock waves with dense cloud cores [11]. We reproduced previous simulations of the impact of an adiabatic shock wave (appropriate for a nearby supernova), showing that in this case the cloud is destroyed by small-scale instabilities [12,13]. We find that the key factor permitting cloud collapse rather than destruction is the shock thermodynamics -- isothermal shocks (appropriate for AGB star winds or distant supernovae) can lead to sustained protostellar collapse [11]. A distant (10 or more parsecs) supernova shock has just about enough momentum to induce collapse. However, planetary nebulae appear to be somewhat deficient in momentum, and require the compressive effects of warm post-shock gas to trigger collapse. References: [1] Lee T. et al. (1976) GRL, 3, 109. [2] Wasserburg G. J. et al. (1994) Astrophys. J., 424, 412. [3] Cameron A. G. W. and Truran J. W. (1977) Icarus, 30, 447. [4] Anders E. and Zinner E. (1993) Meteoritics, 28, 490. [5] Palla F. (1995) Workshop on Galactic Star Formation and Early Stellar Evolution, Ringberg Castle, Germany. [6] Boss A. P. (1995) Astrophys. J., 439, 224. [7] Wasserburg G. J. et al. (1995) Astrophys. J. Lett., 440, L101. [8] Srinivasan G. et al. (1994) Astrophys. J. Lett., 431, L67. [9] Shu F. H. et al. (1987) Annu. Rev. Astron. Astrophys., 25, 23. [10] Cameron A. G. W. et al. (1995) Astrophys. J., in press. [11] Foster P. N. and Boss A. P. (1995) Astrophys. J., in preparation. [12] K

Foster, P. N.; Boss, A. P.



A model to predict the breathing zone concentrations of particles emitted from Jonathan Thornburg,*a  

E-print Network

A model to predict the breathing zone concentrations of particles emitted from surfaces Jonathan. Activity based sampling determines the contaminant concentration in a person's breathing zone and fluid dynamics was developed to predict the breathing zone concentration of a particulate contaminant

Ahmad, Sajjad


Global Distributions and Natural Sources of Brominated very Short-Lived Substances  

E-print Network

Brominated very short-lived substances (BrVSLS) are atmospherically important trace gases that play an important role in stratospheric ozone destruction. Major BrVSLS including bromoform (CHBr_(3)), dibromomethane (CH_(2)Br_(2...

Liu, Yina



Identification of short-lived and localized coherent structures in plasma turbulence by window biorthogonal decomposition  

Microsoft Academic Search

An alternative biorthogonal decomposition technique called the window biorthogonal decomposition (WBD) technique is introduced to analyze the coherent structures in the tokamak plasma turbulence. It can spot the short-lived and localized coherent structures in spatiotemporal turbulence signal and extract them out of the incoherence background. As an example, the localized and short-lived coherent structures existing stochastically in the CT-6B tokamak

Lifang Dong; Qingli Zhang; Long Wang




Microsoft Academic Search

Np²³⁷ nuclei were aligned through the electric quadrupole and ; magnetic hyperfine couplings in NpO²Rb(NO³)³ cooled to 0.2 to ; 4.2 deg K. A complete experiment, with rotatable monoc rystalline sample, solid- ; state counter, thermometer, and goniometer, was enclosed in a copper container ; filled with He³ gas and thermally attached to 1\\/2 mole of paramagnetic salt ; which

S. H. Hanauer; J. W. T. Dabbs; L. D. Roberts; G. W. Parker



Low-level measurement of alpha-particle emitting nuclei in ceramics and lead  

Microsoft Academic Search

Nearly all natural materials contain trace quantities of uranium (U) and thorium (Th) and their daughter nuclides, many of\\u000a which emit ?-particles in their decay. Lead, at the end of the U-decay chain, typically contains some radioactive210Pb which is chemically inseparable from the other Pb isotopes. ?-particle emission from these decays can affect sensitive\\u000a electronic components, such as memory chips

R. J. McDonald; A. R. Smith; D. L. Hurley; E. B. Norman



Counting Particles Emitted by Stratospheric Aircraft and Measuring Size of Particles Emitted by Stratospheric Aircraft. Final report, 1 May 1990-31 December 1992  

SciTech Connect

There were two principal objectives of the cooperative agreement between NASA and the University of Denver. The first goal was to modify the design of the ER-2 condensation nuclei counter (CNC) so that the effective lower detection limit would be improved at high altitudes. This improvement was sought because, in the instrument used prior to 1993, diffusion losses prevented the smallest detectable particles from reaching the detection volume of the instrument during operation at low pressure. Therefore, in spite of the sensor`s ability to detect particles as small as 0.008 microns in diameter, many of these particles were lost in transport to the sensing region and were not counted. Most of the particles emitted by aircraft are smaller than 0.1 micron in diameter. At the start date of this work, May 1990, continuous sizing techniques available on the ER-2 were only capable of detecting particles larger than 0.17 micron. Thus, the second objective of this work was to evaluate candidate sizing techniques in an effort to gain additional information concerning the size of particles emitted by aircraft.

Wilson, J.C.



Measurement of formation cross sections of short-lived nuclei by 14 MeV neutrons: Mg, Si, S, Cl, Cr, Zn, Ga, Y, In  

NASA Astrophysics Data System (ADS)

Sixteen neutron activation cross sections for (n,2n), (n,p), (n,n(prime)p), (n,t) and (n, alpha) reactions producing short-lived nuclei with half-lives between 0.5 and 20 m have been measured in the energy range of 13.4 to 14.9 MeV for Mg, Si, S, Cl, Cr, Zn, Ga, Y and In. Five half-lives of short-lived nuclei produced by 14 MeV or thermal neutron bombardments were measured with Ge detectors for Cu-66, Zr-89m, Mo-91m, Nb-97m, and Rh-104m in the spectrum multi-scaling mode.

Kawade, Kiyoshi; Yamamoto, Hiroshi; Yamada, Takashi; Katoh, Toshio; Iida, Toshiyuki; Takahashi, Akito



Multiplicity and angular distribution of particles emitted in relativistic nuclear-nuclear interactions  

E-print Network

We discuss the experimental results on the behavior of the average multiplicities and angular distributions of slow particles emitted in hadron-nuclear and nuclear-nuclear interactions at relativistic energies as a function of the centrality of collisions. It is observed that by increasing the mass of the projectiles the angular distributions of slow particles change and the structure which was demonstrated in the case of pi-mesons, protons and light nuclear projectiles, almost disappears. During the interaction of the heavier projectile with nuclear target, the number of secondary interactions as well as number of nucleon-nucleon elastic scattering and re-scattering events increases. We suggest to restore this information using the heavy ion generators taking into account the multiplicity distributions. Because our investigations show that the formation of the percolation cluster sufficiently influences the behaviour of the average multiplicity of the slow particles emitted in these interactions.

M. K. Suleymanov; E. U. Khan; A. Kravchakova; Mahnaz Q. Haseeb; S. M. Saleem; Y. H. Huseynaliyev; S. Vokal; A. S. Vodopianov; O. B. Abdinov



Extremely fast gas/liquid reactions in flow microreactors: carboxylation of short-lived organolithiums.  


Carboxylation of short-lived organolithiums bearing electrophilic functional groups such as nitro, cyano, and alkoxycarbonyl groups with CO2 to give carboxylic acids and active esters was accomplished in a flow microreactor system. The successful reactions indicate that gas/liquid mass transfer and the subsequent chemical reaction with CO2 are extremely fast. PMID:24863501

Nagaki, Aiichiro; Takahashi, Yusuke; Yoshida, Jun-ichi



Universal Slow RI-Beam Facility at RIKEN RIBF for Laser Spectroscopy of Short-Lived  

E-print Network

-Carpet Isotope Separator 30ksV Super Conducting CyclotFen - Degraderl I^High Energy Rl-beam '^^ss SpectrometeUniversal Slow RI-Beam Facility at RIKEN RIBF for Laser Spectroscopy of Short-Lived Nuclei M. Wada-0801 Japan ^^Institute for Laser Science, University of Electro-Communications, Chohugaoka, Chohu, Tokyo 182

Schuessler, Hans


Mass spectrometry of atomic ions produced by in-trap decay of short-lived nuclides  

E-print Network

Mass spectrometry of atomic ions produced by in-trap decay of short-lived nuclides A Herlert1 demonstrated the feasibility of mass spectrometry of in-trap-decay product ions. This novel technique gives is required. Experiments at radioactive-beam facilities that employ Penning traps for mass spectrometry have

Paris-Sud XI, Université de


Detailed modeling of the atmospheric degradation mechanism of very-short lived brominated species  

E-print Network

1 Detailed modeling of the atmospheric degradation mechanism of very-short lived brominated species brominated peroxy radicals RO2 (with R = CH2Br, CHBr2 and CBr3) for which the most likely reaction pathways to be important. The Henry's law constants of the brominated organics products have been estimated by using

Boyer, Edmond


Incorporation of Short-Lived Be in a Calcium-Aluminum  

E-print Network

Incorporation of Short-Lived 10 Be in a Calcium-Aluminum­ Rich Inclusion from the Allende Meteorite Kevin D. McKeegan,1 * Marc Chaussidon,2 Franc¸ois Robert3 Enrichments in boron-10/boron-11 in a calcium-aluminum canonical abundance of aluminum-26 may still require seeding of the solar system by radioactive stellar


Intergenerational transfers and the stability of public debt with short-lived governments  

E-print Network

1 Intergenerational transfers and the stability of public debt with short-lived governments Jean transfers are analyzed in an overlapping generation model. Governments have preferences, which give much will be decided by future governments with different objectives. The economy follow one of two equilibrium paths

Paris-Sud XI, Université de


Short-lived magmatic activity in an anorogenic subvolcanic complex: 40  

E-print Network

resolvable age differences (ca. 2 Ma), and at the peak of regional flood-basalt activity in the Etendeka (Erongo, Brandberg, Paresis, Messum) began simultaneously with the peak of flood-basalt effusion at about melting was caused by a short-lived thermal pulse related to the main flood-basalt event. Basic magmatism


ARTICLE IN PRESS Short-lived magmatic activity in an anorogenic subvolcanic  

E-print Network

geochronologically resolvable age differences (ca. 2 Ma), and at the peak of regional flood-basalt activity (Erongo, Brandberg, Paresis, Messum) began simultaneously with the peak of flood-basalt effusion at about melting was caused by a short-lived thermal pulse related to the main flood-basalt event. Basic magmatism


Beta camera for static and dynamic imaging of charged-particle emitting radionuclides in biologic samples  

SciTech Connect

A detection system based on microchannel plates has been constructed to image charged particles emitted by radionuclides in biomedical samples. This technique has significant advantages over conventional film autoradiography for investigating the distribution of radiolabeled compounds: shorter acquisition times due to the high sensitivity, easier sample handling, direct quantification and the ability to perform dynamic studies. The detector performance shows a spatial resolution of 0.9 mm for carbon-14 ({sup 14}C) (0.156 MeV), good linearity and homogeneity. The noise level is below 50/(cm{sup 2}.sec). Successful imaging with this system has been performed with beta-emitters {sup 14}C, sulfur-35 ({sup 35}S), iodine-131 ({sup 131}I), yttrium-90 (90Y), and positron emitters gallium-68 ({sup 68}Ga), and fluorine-18 ({sup 18}F). Dynamic studies of axonal transport of {sup 35}S-methionine in a nerve, and static images of 90Y-labeled monoclonal antibodies in slices of tumors are presented. The system shows promise for rapid quantitative imaging of charged-particle emitting radionuclides in small biologic samples.

Ljunggren, K.; Strand, S.E. (Lund Univ. (Sweden))



Experimental Measurements of Short-Lived Fission Products from Uranium, Neptunium, Plutonium and Americium  

SciTech Connect

Fission yields are especially well characterized for long-lived fission products. Modeling techniques incorporate numerous assumptions and can be used to deduce information about the distribution of short-lived fission products. This work is an attempt to gather experimental (model-independent) data on the short-lived fission products. Fissile isotopes of uranium, neptunium, plutonium and americium were irradiated under pulse conditions at the Washington State University 1 MW TRIGA reactor to achieve ~108 fissions. The samples were placed on a HPGe (high purity germanium) detector to begin counting in less than 3 minutes post irradiation. The samples were counted for various time intervals ranging from 5 minutes to 1 hour. The data was then analyzed to determine which radionuclides could be quantified and compared to the published fission yield data.

Metz, Lori A.; Payne, Rosara F.; Friese, Judah I.; Greenwood, Lawrence R.; Kephart, Jeremy D.; Pierson, Bruce D.



Time-domain magnetic resonance studies of short-lived radical pairs in liquid solution  

Microsoft Academic Search

Magnetic resonance spectra of radical-ion pairs possessing lifetimes as short as 12 ns have been obtained using a new time-resolved optically detected magnetic resonance technique. Short-lived radical pairs are produced by a laser flash. The transient optical absorbance of the radical pairs or the triplet products resulting from their collapse is monitored as a function of time in the presence

Michael R. Wasielewski; James R. Norris; Michael K. Bowman



An effective technique for the storage of short lived radioactive gaseous waste  

Microsoft Academic Search

An effective technique is described to deal with volatile, short lived radioactive waste generated as a result of the routinely produced positron emission tomography (PET) radiopharmaceutical 2-deoxy-2-[18F]fluoro-D-glucose (FDG). All radioactive gases and aerosols created during the synthesis are collected and stored safely in commercially available TEDLAR gas sampling bags. Once these collected PET by-products decay, the TEDLAR gas bags can

Lutz Schweiger



Large Differences in Aging Phenotype between Strains of the Short-Lived Annual Fish Nothobranchius furzeri  

Microsoft Academic Search

BackgroundA laboratory inbred strain of the annual fish Nothobranchius furzeri shows exceptionally short life expectancy and accelerated expression of age markers. In this study, we analyze new wild-derived lines of this short-lived species.Methodology\\/Principal FindingsWe characterized captive survival and age-related traits in F1 and F2 offspring of wild-caught N. furzeri. Wild-derived N. furzeri lines showed expression of lipofuscin and neurodegeneration at

Eva Terzibasi; Dario Riccardo Valenzano; Mauro Benedetti; Paola Roncaglia; Antonino Cattaneo; Luciano Domenici; Alessandro Cellerino; Jean-Nicolas Volff



Large Differences in Aging Phenotype between Strains of the Short-Lived Annual Fish Nothobranchius furzeri  

Microsoft Academic Search

Background: A laboratory inbred strain of the annual fish Nothobranchius furzeri shows exceptionally short life expectancy and accelerated expression of age markers. In this study, we analyze new wild-derived lines of this short-lived species. Methodology\\/Principal Findings: We characterized captive survival and age-related traits in F1 and F2 offspring of wild- caught N. furzeri. Wild-derived N. furzeri lines showed expression of

Eva Terzibasi; Dario Riccardo Valenzano; Mauro Benedetti; Paola Roncaglia; Antonino Cattaneo; Luciano Domenici; Alessandro Cellerino



Miss Piggy, a californium-252 fission fragment source as a generator of short-lived radionuclides  

Microsoft Academic Search

Carrier-free short-lived nuclides are employed in many different fields of modern nuclear chemistry. The two main production strategies are either thermal neutron-induced fission of 235U or 239Pu at nuclear reactors or spallation neutron sources or charged particle-induced nuclear reactions at accelerator facilities. An alternative method is to use a spontaneously fissioning nuclide. A facility applying this technique (“Miss Piggy”) was

Ch. E. Düllmann; B. Eichler; R. Eichler; H. W. Gäggeler; D. T. Jost; U. Kindler; D. Piguet; S. Soverna; P. Thörle; N. Trautmann; A. Türler



Are Short-Lived Jobs Stepping Stones to Long-Lasting Jobs?  

Microsoft Academic Search

This paper assesses whether short-lived jobs (lasting one quarter or less and involuntarily ending in unemployment) are stepping stones to long-lasting jobs (enduring one year or more) for Belgian long-term unemployed school-leavers. We proceed in two steps. First, we estimate labour market trajectories in a multi-spell duration model that incorporates lagged duration and lagged occurrence dependence. Second, in a simulation

Bart Cockx; Matteo Picchio



Role of the proteasome in membrane extraction of a short-lived ER-transmembrane protein.  

PubMed Central

Selective degradation of proteins at the endoplasmic reticulum (ER-associated degradation) is thought to proceed largely via the cytosolic ubiquitin-proteasome pathway. Recent data have indicated that the dislocation of short-lived integral-membrane proteins to the cytosolic proteolytic system may require components of the Sec61 translocon. Here we show that the proteasome itself can participate in the extraction of an ER-membrane protein from the lipid bilayer. In yeast mutants expressing functionally attenuated proteasomes, degradation of a short-lived doubly membrane-spanning protein proceeds rapidly through the N-terminal cytosolic domain of the substrate, but slows down considerably when continued degradation of the molecule requires membrane extraction. Thus, proteasomes engaged in ER degradation can directly process transmembrane proteins through a mechanism in which the dislocation of the substrate and its proteolysis are coupled. We therefore propose that the retrograde transport of short-lived substrates may be driven through the activity of the proteasome. PMID:9628862

Mayer, T U; Braun, T; Jentsch, S



Miss Piggy, a californium-252 fission fragment source as a generator of short-lived radionuclides  

NASA Astrophysics Data System (ADS)

Carrier-free short-lived nuclides are employed in many different fields of modern nuclear chemistry. The two main production strategies are either thermal neutron-induced fission of 235U or 239Pu at nuclear reactors or spallation neutron sources or charged particle-induced nuclear reactions at accelerator facilities. An alternative method is to use a spontaneously fissioning nuclide. A facility applying this technique ("Miss Piggy") was built at the University of Berne (Switzerland). Californium-252 ( 252Cf), which has a 3% fission branch and a half-life of 2.645 a, is used for the production of short-lived fission products that are stopped in an adjacent recoil chamber. Short-lived nuclides are transported out of the recoil chamber using the well-known gas-jet technique. Over 100 nuclides have been identified so far and used in different applications. Since such a device does not require any large facility and is easy to operate it serves well the needs of typical university laboratories.

Düllmann, Ch. E.; Eichler, B.; Eichler, R.; Gäggeler, H. W.; Jost, D. T.; Kindler, U.; Piguet, D.; Soverna, S.; Thörle, P.; Trautmann, N.; Türler, A.



Attached and unattached fractions of short-lived radon decay products in outdoor environments: effect on the human respiratory system.  


The authors developed a model for determining the alpha- and beta-activities per unit volume of air due to radon ((222)Rn), thoron ((220)Rn) and their decay products attached and unattached to the aerosol in the outdoor air at the workplace in natural conditions at different locations in Morocco by using both CR-39 and LR-115 type II solid-state nuclear track detectors. In addition, the percentage of (218)Po, (214)Pb and (214)Po radionuclides attached to the aerosols and the unattached fraction f(j) for different values of the attachment rate were evaluated. Radon and thoron concentrations in outdoor air of the studied different locations were found to vary from 9.20±0.8 to 16.30±1.50 Bq m(-3) and 0.22±0.02 to 1.80±0.20 Bq m(-3), respectively. The committed equivalent doses due to the radon short-lived progeny (218)Po and (214)Po attached and unattached to the aerosol air were evaluated in different tissues of the respiratory tract of the members of the public from the inhalation of outdoor air. PMID:24390974

Amrane, M; Oufni, L; Misdaq, M A



Absence of replicative senescence in cultured cells from the short-lived killifish Nothobranchius furzeri.  


A major challenge in age research is the absence of short-lived vertebrate model organisms. The turquoise killifish Nothobranchius furzeri has the shortest known lifespan of a vertebrate that can be bred in captivity. The short lived GRZ strain only reaches a maximum age of 3-4 months, whereas other strains (MZM) reach 6-10 months. Most importantly, the short lifespan is associated with typical signs of ageing. To find out more about possible cellular factors that might contribute to the short lifespan and to the difference in lifespan between strains, we analyzed the expression of markers for cellular senescence. Expression of Tp53, Cdkn1a and Cdkn2a/b in skin revealed no change in the short-lived GRZ but increased expression of the cell cycle inhibitors Cdkn1a and Cdkn2a/b in the long-lived MZM strain with age. This suggests that expression of distinct cell cycle inhibitors reflects rather chronological than biological age in N. furzeri. To study the relationship of organismal life span and in vitro life span of cells, we established a primary cell culture model. For both strains we demonstrate here the absence of replicative senescence as analysed by morphology, expression of Cdkn1a and Cdkn2a/b, population doubling times and ?H2AFX in long-term and short-term cultured cells. We reason this to be on account of sustained telomerase activity and maintained telomeric length. Hence, we propose that differences in maximum life span of different N. furzeri strains is not reflected by differences in proliferation speed or replicative potential of the respective cultured cells. PMID:22445733

Graf, Michael; Hartmann, Nils; Reichwald, Kathrin; Englert, Christoph



Al-26 and Be-10 in Efremovka and Acfer CAIs: Constraints on the Origin of Short-lived Radionuclides  

NASA Astrophysics Data System (ADS)

In this abstract we present aluminum-26 and beryllium-10 abundances in Efremovka and Acfer CAIs. These measurements help us to constrain the origin of short-lived radionuclides aluminum-26, beryllium-10.

Srinivasan, G.; Chaussidon, M.; Bischoff, A.



The contribution of natural and anthropogenic very short-lived species to stratospheric bromine  

Microsoft Academic Search

We have used a global three-dimensional chemical transport model to quantify the impact of the very short-lived species (VSLS) CHBr3, CH2Br2, CHBr2Cl, CHBrCl2, CH2BrCl and C2H5Br on the bromine budget of the stratosphere. Atmospheric observations of these gases allow constraints on surface mixing ratios that, when incorporated into our model, contribute ~ 4.9-5.2 parts per trillion (ppt) of inorganic bromine

R. Hossaini; M. P. Chipperfield; W. Feng; T. J. Breider; E. Atlas; S. A. Montzka; B. R. Miller; F. Moore; J. Elkins



Inducible transgenic expression in the short-lived fish Nothobranchius furzeri.  


This study demonstrates inducible transgenic expression in the exceptionally short-lived turquoise killifish Nothobranchius furzeri, which is a useful vertebrate model for ageing research. Transgenic N. furzeri bearing a green fluorescent protein (Gfp) containing construct under the control of a heat shock protein 70 promoter were generated, heat shock-induced and reversible Gfp expression was demonstrated and germline transmission of the transgene to the F1 and F2 generations was achieved. The availability of this inducible transgenic expression system will make the study of ageing-related antagonistically pleiotropic genes possible using this unique vertebrate model organism. PMID:23639168

Allard, J B; Kamei, H; Duan, C



Search for a short-lived neutral particle produced in nuclear decay  

Microsoft Academic Search

We report on a search for a short-lived neutral particle phi produced in the decay of the 9.17-MeV J-italic\\/sup ..pi..\\/ = 2\\/sup +\\/ state in ¹⁴N. The experiment is sensitive to decays into an e-italic\\/sup +\\/e⁻ pair with tau\\/sub phi\\/approx. <10⁻¹¹ s. For m-italic\\/sub phi\\/ = 1.7 MeV we place a limit on the branching ratio of GAMMA\\/sub phi\\/\\/GAMMA\\/sub ..gamma..\\/<

M. J. Savage; R. D. McKeown; B. W. Filippone; L. W. Mitchell



Mass Measurement of Short-lived Nuclei at HIRFL-CSR  

NASA Astrophysics Data System (ADS)

Four campaigns of mass measurements for short-lived nuclei have been conducted using an isochronous mass spectrometry (IMS) technique at HIRFL-CSR(Cooler Storage Ring) in Lanzhou. The radioactive nuclei were produced by projectile fragmentation and injected into the experimental storage ring CSRe. Revolution times of the ions stored in the CSRe were measured from which masses of 78Kr, 58Ni, 86Kr and 112Sn fragments have been determined with a relative uncertainty of about 10-6-10-7. The experimental results are presented and their impacts on nucleosynthesis in the rp process and nuclear structure are discussed.

Wang, M.; Xu, H. S.; Zhang, Y. H.; Tu, X. L.; Litvinov, Yu. A.



Production of exotic, short lived carbon isotopes in ISOL-type facilities  

E-print Network

The beam intensities of short-lived carbon isotopes at Isotope Separation On-Line (ISOL) facilities have been limited in the past for technical reasons. The production of radioactive ion beams of carbon isotopes is currently of high interest for fundamental nuclear physics research. To produce radioactive ions a target station consisting of a target in a container connected to an ion source via a transfer line is commonly used. The target is heated to vaporize the product for transport. Carbon in elementary form is a very reactive element and react strongly with hot metal surfaces. Due to the strong chemisorption interaction, in the target and ion source unit, the atoms undergo significant retention on their way from the target to the ion source. Due to this the short lived isotopes decays and are lost leading to low ion yields. A first approach to tackle these limitations consists of incorporating the carbon atoms into less reactive molecules and to use materials for the target housing and the transfer line ...

Franberg, Hanna; Köster, Ulli; Ammann, Markus



Short-lived pollutants in the Arctic: their climate impact and possible mitigation strategies  

SciTech Connect

Several short-lived pollutants known to impact Arctic climate may be contributing to the accelerated rates of warming observed in this region relative to the global annually averaged temperature increase. Here, we present a summary of the short-lived pollutants that impact Arctic climate including methane, tropospheric ozone, and tropospheric aerosols. For each pollutant, we provide a description of the major sources and the mechanism of forcing. We also provide the first seasonally averaged forcing and corresponding temperature response estimates focused specifically on the Arctic. The calculations indicate that the forcings due to black carbon, methane, and tropospheric ozone lead to a positive surface temperature response indicating the need to reduce emissions of these species within and outside the Arctic. Additional aerosol species may also lead to surface warming if the aerosol is coincident with thin, low lying clouds. We suggest strategies for reducing the warming based on current knowledge and discuss directions for future research to address the large remaining uncertainties.

Menon, Surabi; Quinn, P.K.; Bates, T.S.; Baum, E.; Doubleday, N.; Fiore, A.M.; Flanner, M.; Fridlind, A.; Garrett, T.J.; Koch, D.; Menon, S.; Shindell, D.; Stohl, A.; Warren, S.G.



Short-Lived Nuclei in the Early Solar System: A Low Mass Stellar Source?  

NASA Astrophysics Data System (ADS)

We discuss possible stellar origins of short-lived radioactive nuclei with meanlife ? <= 100Myr, which were shown to be alive in the Early Solar System (ESS). We first review current ideas on the production of nuclides having 10 <= ? <= 100Myr, which presumably derive from the continuous interplay of galactic astration, nucleosynthesis from massive supernovae and free decay in the interstellar medium. The abundance of the shorter lived 53Mn might be explained by this same scenario. Then we consider the nuclei 107Pd, 26Al, 41Ca and 60Fe, whose early solar system abundances are too high to have originated in this way. Present evidence favours a stellar origin, particularly for 107Pd, 26Al and 60Fe, rather than an in situ production by energetic solar particles. The idea of an encounter (rather close in time and space) between the forming Sun and a dying star is therefore discussed: this star may or may not have also triggered the solar formation. Recent nucleosynthesis calculations for the yields of the relevant short-lived isotopes and of their stable reference nuclei are discussed. Massive stars evolving to type II supernovae (either leaving a neutron star or a black hole as a remnant) seem incapable of explaining the four most critical ESS radioactivities in their observed abundance ratios. An asymptotic giant branch (AGB) star seems to be a viable source, especially if of relatively low initial mass (M <= 3Modot) and with low neutron exposure: this model can provide a solution for 26Al, 41Ca and 107Pd, with important contributions to 60Fe, which are inside the present uncertainty range of the 60Fe early solar system abundance. Such a model requires that 26Al is produced substantially on the AGB by cool bottom processing. The remaining inventory of short-lived species in the solar nebula would then be attributed to the continuous galactic processing, with the exception of 10Be, which must reflect production by later proton bombardment at a low level during early solar history.

Busso, M.; Gallino, R.; Wasserburg, G. J.


Comparative in vitro microdosimetric study of murine- and human-derived cancer cells exposed to alpha particles.  


Diffusing alpha-emitter radiation therapy (DaRT) is a proposed new form of brachytherapy using ? particles to treat solid tumors. The method relies on implantable ²²?Ra-loaded sources that continually release short-lived ?-particle-emitting atoms that spread inside the tumor over a few millimeters. This treatment was demonstrated to have a significant effect on tumor growth in murine and human-derived models, but the degree of tumor response varied across cell lines. Tumor response was found to correlate with the degree of radionuclide spread inside the tumor. In this work we examined the radiosensitivity of individual cells to determine its relationship to tumor response. Cells were irradiated in vitro by ? particles using a ²²?Th irradiator, with the mean lethal dose, D?, estimated from survival curves generated by standard methods. The results were further analyzed by microdosimetric tools to calculate z?, the specific energy resulting in a survival probability of 1/e for a single cell, which is considered to better represent the intrinsic radiosensitivity of individual cells. The results of the study demonstrate that, as a rule, tumors that respond more favorably to the DaRT treatment are also characterized by higher intrinsic cellular radiosensitivities, with D? ranging from 0.7 Gy to 1.5 Gy for the extreme cases and z? following the same trend. PMID:22077335

Lazarov, E; Arazi, L; Efrati, M; Cooks, T; Schmidt, M; Keisari, Y; Kelson, I



Counteracting the climate effects of volcanic eruptions using short-lived greenhouse gases  

NASA Astrophysics Data System (ADS)

A large volcanic eruption might constitute a climate emergency, significantly altering global temperature and precipitation for several years. Major future eruptions will occur, but their size or timing cannot be predicted. We show, for the first time, that it may be possible to counteract these climate effects through deliberate emissions of short-lived greenhouse gases, dampening the abrupt impact of an eruption. We estimate an emission pathway countering a hypothetical eruption 3 times the size of Mount Pinatubo in 1991. We use a global climate model to evaluate global and regional responses to the eruption, with and without counteremissions. We then raise practical, financial, and ethical questions related to such a strategy. Unlike the more commonly discussed geoengineering to mitigate warming from long-lived greenhouse gases, designed emissions to counter temporary cooling would not have the disadvantage of needing to be sustained over long periods. Nevertheless, implementation would still face significant challenges.

Fuglestvedt, Jan S.; Samset, Bjørn H.; Shine, Keith P.



On-line He-cryostat for Mössbauer spectroscopy with short-lived radioactive sources  

NASA Astrophysics Data System (ADS)

A special on-line He-cryostat for Mössbauer spectroscopy with accelerator-produced radioactive sources was developed. The design of this cryostat allows a computer-controlled irradiation of different targets and the fast transport of these sources to the absorber. Therefore, this setup is suitable for Mössbauer spectroscopy even with very short-lived sources. The sources are cooled down to 15 K by a cryogenerator capable of absorbing a beam power of 10 W in this temperature range. The liquid helium-cooled absorber is moved by a piezoelectric drive unit. Using this cryostat the sharp resonance of the Mössbauer effect in 63Ni was observed for the first time. In this experiment data from more than 1500 63Co sources (T {1}/{2} = 27 s) have been collected.

Trautmannsheimer, M.; Komninos, P.; Huenges, E.; Morinaga, H.



Contribution of very short-lived substances to stratospheric bromine loading: uncertainties and constraints  

NASA Astrophysics Data System (ADS)

Very short-lived substances (VSLS) still represent a major factor of uncertainty in the quantification of stratospheric bromine loading. One of the major obstacles for short-lived source gases in contributing to the stratosphere is generally thought to be loss of inorganic bromine (Bry) in the tropical tropopause layer (TTL) due to dehydration. We use sensitivity calculations with a~three-dimensional chemistry transport model comprising a consistent parametrization of convective transport and a comprehensive chemistry scheme to investigate the associated processes. The model considers the two most important bromine VSLS, bromoform (CHBr3) and dibromomethane (CH2Br2). The organic bromine source gases as well as the resulting profile of inorganic bromine in the model are consistent with available observations. In contrast to its organic precursors, Bry is assumed to have a~significant sorption capacity regarding sedimenting liquid or frozen particles thus the fraction of intact source gases during their ascent through the TTL is a critical factor. We find that source gas injection is the dominant pathway into the stratosphere, about 50% of CHBr3 and 93% of CH2Br2 is able to overcome the cold point tropopause at approximately 17 km altitude, modulated by the interannual variability of the vertical transport efficiency. In fact, our sensitivity calculations indicate that the extent of source gas injection of CHBr3 is highly sensitive to the strength of convection and large-scale ascent; in contrast, modifying the photolysis or the destruction via OH yields a significantly smaller response. In principal, the same applies as well to CH2Br2, though it is considerably less responsive due to its longer lifetime. The next important aspect we identified is that the partitioning of available Bry from short-lived sources is clearly shifted away from HBr, according to our current state of knowledge the only member of the Bry family which is efficiently adsorbed on ice particles. This effect is caused by very efficient heterogeneous reactions on ice surfaces which reduce the HBr/Bry fraction below 15% at the tropical tropopause. Under these circumstances there is no significant loss of Bry due to dehydration in the model, VSLS contribute fully to stratospheric bromine. In addition, we conduct several sensitivity calculations to test the robustness of this result. If heterogeneous chemistry is ignored, the HBr/Bry fraction exceeds 50% and about 10% of bromine from VSLS is scavenged. Dehydration plays a minor role for Bry removal under the assumption that HOBr is efficiently adsorbed on ice as well since the heterogeneous reactions alter the partitioning equilibrium of Bry in favor of HOBr. In this case, up to 12% of bromine from VSLS is removed. Even in the extreme and unrealistic case that adsorbed species on ice particles are instantaneously removed the maximum loss of bromine does not exceed 25%. In conclusion, considering the average abundance of bromine short-lived source gases in convective updrafts of 6 parts per trillion by volume (pptv) we find a most likely contribution of VSLS to stratospheric bromine in the range of 4.5-6 pptv.

Aschmann, J.; Sinnhuber, B.-M.



Contribution of very short-lived substances to stratospheric bromine loading: uncertainties and constraints  

NASA Astrophysics Data System (ADS)

Very short-lived substances (VSLS) still represent a major factor of uncertainty in the quantification of stratospheric bromine loading. One of the major obstacles for short-lived source gases in contributing to the stratosphere is generally thought to be loss of inorganic bromine (Bry) in the tropical tropopause layer (TTL) due to dehydration. We use sensitivity calculations with a three-dimensional chemistry transport model comprising a consistent parametrization of convective transport and a comprehensive chemistry scheme to investigate the associated processes. The model considers the two most important bromine VSLS, bromoform (CHBr3) and dibromomethane (CH2Br2). The organic bromine source gases as well as the resulting profile of inorganic bromine in the model are consistent with available observations. In contrast to its organic precursors, Bry is assumed to have a significant sorption capacity regarding sedimenting liquid or frozen particles thus the fraction of intact source gases during their ascent through the TTL is a critical factor. We find that source gas injection is the dominant pathway into the stratosphere, about 50% of CHBr3 and 94% of CH2Br2 is able to overcome the cold point tropopause at approximately 17 km altitude, modulated by the interannual variability of the vertical transport efficiency. In fact, our sensitivity calculations indicate that the extent of source gas injection of CHBr3 is highly sensitive to the strength of convection and large-scale ascent; in contrast, modifying the photolysis or the destruction via OH yields a significantly smaller response. In principle, the same applies as well to CH2Br2, though it is considerably less responsive due to its longer lifetime. The next important aspect we identified is that the partitioning of available Bry from short-lived sources is clearly shifted away from HBr, according to our current state of knowledge the only member of the Bry family which is efficiently adsorbed on ice particles. This effect is caused by very efficient heterogeneous reactions on ice surfaces which reduce the HBr/Bry fraction below 15% at the tropical tropopause. Under these circumstances there is no significant loss of Bry due to dehydration in the model, VSLS contribute fully to stratospheric bromine. In addition, we conduct several sensitivity calculations to test the robustness of this result. If heterogeneous chemistry is ignored, the HBr/Bry fraction exceeds 50% and about 10% of bromine from VSLS is scavenged. Dehydration plays a minor role for Bry removal under the assumption that HOBr is efficiently adsorbed on ice as well since the heterogeneous reactions alter the partitioning equilibrium of Bry in favor of HOBr. In this case, up to 12% of bromine from VSLS is removed. Even in the extreme and unrealistic case that adsorbed species on ice particles are instantaneously removed the maximum loss of bromine does not exceed 25%. Assuming 6 parts per trillion by volume (pptv) of bromine short-lived source gases in convective updrafts, a value that is supported by observational data, we find a most likely contribution of VSLS to stratospheric bromine in the range of 4.5-6 pptv.

Aschmann, J.; Sinnhuber, B.-M.



Laser spectroscopy of trapped short-lived Ra{sup +} ions  

SciTech Connect

As an important step toward an atomic parity violation experiment in one single trapped Ra{sup +} ion, laser spectroscopy on short-lived {sup 212,213,214}Ra{sup +} ions was conducted. The isotope shift of the 6 {sup 2}D{sub 3/2}-7 {sup 2}P{sub 1/2} and 6 {sup 2}D{sub 3/2}-7 {sup 2}P{sub 3/2} transitions and the hyperfine structure constants of the 7 {sup 2}P{sub 1/2} and 6 {sup 2}D{sub 3/2} states in {sup 213}Ra{sup +} were measured, which provides a benchmark for the required atomic theory. A lower limit of 232(4) ms for 6 {sup 2}D{sub 5/2} state lifetime was determined.

Versolato, O. O.; Giri, G. S.; Wansbeek, L. W.; Berg, J. E. van den; Hoek, D. J. van der; Jungmann, K.; Kruithof, W. L.; Onderwater, C. J. G.; Sahoo, B. K.; Santra, B.; Shidling, P. D.; Timmermans, R. G. E.; Willmann, L.; Wilschut, H. W. [University of Groningen, Kernfysisch Versneller Instituut, NL-9747 AA Groningen (Netherlands)



Separation efficiency of the MASHA facility for short-lived mercury isotopes  

NASA Astrophysics Data System (ADS)

The mass-separator MASHA built to identify Super Heavy Elements by their mass-to-charge ratios is described. The results of the off- and on-line measurements of its separation efficiency are presented. In the former case four calibrated leaks of noble gases were used. In the latter the efficiency was measured via 284 MeV Ar beam and with using the hot catcher. The ECR ion source was used in both cases. The -radioactive isotopes of mercury produced in the complete fusion reaction Ar+SmHg+xn were detected at the mass-separator focal plane. The half-lives and the separation efficiency for the short-lived mercury isotopes were measured. Potentialities of the MEDIPIX detector system have been demonstrated for future use at the mass-separator MASHA.

Rodin, A. M.; Belozerov, A. V.; Chernysheva, E. V.; Dmitriev, S. N.; Gulyaev, A. V.; Gulyaeva, A. V.; Itkis, M. G.; Kliman, J.; Kondratiev, N. A.; Krupa, L.; Novoselov, A. S.; Oganessian, Yu. Ts.; Podshibyakin, A. V.; Salamatin, V. S.; Sivá?ek, I.; Stepantsov, S. V.; Vanin, D. V.; Vedeneev, V. Yu.; Yukhimchuk, S. A.; Granja, C.; Pospisil, S.



Short-lived oxygen diffusion during hot, deep-seated meteoric alteration of anorthosite  


Heterogeneous oxygen isotope compositions of plagioclase from the Boehls Butte anorthosite include some of the most oxygen-18-depleted values (to -16 per mil) reported for plagioclase in meta-igneous rocks and indicate high-temperature (T > 500 degrees C) isotopic exchange between plagioclase and nearly pristine meteoric fluid. Retrograde reaction-enhanced permeability assisted influx of meteoric-hydrothermal fluids into the deep-seated anorthosite. Isotopic gradients of about 14 per mil over 600 micrometers in single crystals require short-lived (about 10(4) years) diffusional exchange of oxygen and locally large effective water:rock ratios, followed by rapid loss of water and cessation of oxygen diffusion in the anorthosite. PMID:10600738

Mora; Riciputi; Cole



Muscle senescence in short-lived wild mammals, the soricine shrews Blarina brevicauda and Sorex palustris.  


Red-toothed (soricine) shrews are consummate predators exhibiting the highest energy turnovers and shortest life spans (ca. 18 months) of any mammal, yet virtually nothing is known regarding their physiological aging. We assessed the emerging pattern of skeletal muscle senescence (contractile/connective tissue components) in sympatric species, the semi-aquatic water shrew (WS), Sorex palustris, and the terrestrial short-tailed shrew (STS), Blarina brevicauda, to determine if muscle aging occurs in wild, short-lived mammals (H(0): shrews do not survive to an age where senescence occurs), and if so, whether these alterations are species-specific. Gracilis muscles were collected from first-year (n=17) and second-year (n=17) field-caught shrews. Consistent with typical mammalian aging, collagen content (% area) increased with age in both species (S. palustris: approximately 50%; B. brevicauda: approximately 60%). Muscle was dominated by stiffer Type I collagen, and the ratio of collagen Type I:Type III more than doubled with age. The area ratio of muscle:collagen decreased with age in both species, but was considerably lower in adult STS, suggesting species-specificity of senescence. Extracellular space was age-elevated in B. brevicauda, but was preserved in S. palustris ( approximately 50 vs. 10% elevation). Though juvenile interspecific comparisons revealed no significance, adult WS myocytes had 68% larger cross-sectional area and occurred at 28% lower fibers/area than those of adult STS. We demonstrate that age-related muscle senescence does occur in wild-caught, short-lived mammals, and we therefore reject this classic aging theory tenet. Our findings moreover illustrate that differential age adjustments in contractile/connective tissue components of muscle occur in the two species of wild-caught shrews. PMID:19296507

Hindle, Allyson G; Lawler, John M; Campbell, Kevin L; Horning, Markus



Seeds of alpine plants are short lived: implications for long-term conservation  

PubMed Central

Background and Aims Alpine plants are considered one of the groups of species most sensitive to the direct and indirect threats to ecosystems caused by land use and climate change. Collecting and banking seeds of plant species is recognized as an effective tool for providing propagating material to re-establish wild plant populations and for habitat repair. However, seeds from cold wet environments have been shown to be relatively short lived in storage, and therefore successful long-term seed conservation for alpine plants may be difficult. Here, the life spans of 69 seed lots representing 63 related species from alpine and lowland locations from northern Italy are compared. Methods Seeds were placed into experimental storage at 45 °C and 60 % relative humidity (RH) and regularly sampled for germination. The time taken in storage for viability to fall to 50 % (p50) was determined using probit analysis and used as a measure of relative seed longevity between seed lots. Key Results Across species, p50 at 45 °C and 60 % RH varied from 4·7 to 95·5 d. Seed lots from alpine populations/species had significantly lower p50 values compared with those from lowland populations/species; the lowland seed lots showed a slower rate of loss of germinability, higher initial seed viability, or both. Seeds were progressively longer lived with increased temperature and decreased rainfall at the collecting site. Conclusions Seeds of alpine plants are short lived in storage compared with those from lowland populations/related taxa. The lower resistance to ageing in seeds of alpine plants may arise from low selection pressure for seed resistance to ageing and/or damage incurred during seed development due to the cool wet conditions of the alpine climate. Long-term seed conservation of several alpine species using conventional seed banking methods will be problematic. PMID:21081585

Mondoni, Andrea; Probert, Robin J.; Rossi, Graziano; Vegini, Emanuele; Hay, Fiona R.



The origin of short-lived radionuclides and the astrophysical environment of solar system formation  

E-print Network

Based on early solar system abundances of short-lived radionuclides (SRs), such as $^{26}$Al (T$_{1/2} = 0.74$ Myr) and $^{60}$Fe (T$_{1/2} = 1.5$ Myr), it is often asserted that the Sun was born in a large stellar cluster, where a massive star contaminated the protoplanetary disk with freshly nucleosynthesized isotopes from its supernova (SN) explosion. To account for the inferred initial solar system abundances of short-lived radionuclides, this supernova had to be close ($\\sim$ 0.3 pc) to the young ($\\leqslant$ 1 Myr) protoplanetary disk. Here we show that massive star evolution timescales are too long, compared to typical timescales of star formation in embedded clusters, for them to explode as supernovae within the lifetimes of nearby disks. This is especially true in an Orion Nebular Cluster (ONC)-type of setting, where the most massive star will explode as a supernova $\\sim$ 5 Myr after the onset of star formation, when nearby disks will have already suffered substantial photoevaporation and/or formed large planetesimals. We quantify the probability for {\\it any} protoplanetary disk to receive SRs from a nearby supernova at the level observed in the early solar system. Key constraints on our estimate are: (1) SRs have to be injected into a newly formed ($\\leqslant$ 1 Myr) disk, (2) the disk has to survive UV photoevaporation, and (3) the protoplanetary disk must be situated in an enrichment zone permitting SR injection at the solar system level without disk disruption. The probability of protoplanetary disk contamination by a supernova ejecta is, in the most favorable case, 3 $\\times$ 10$^{-3}$.

Gounelle Meibom



Detection and localization of particle-emitting sources with compound-eye inspired detector arrays  

NASA Astrophysics Data System (ADS)

We develop methods to detect and localize particle-emitting sources using detector arrays that are inspired by biological compound eyes. The sources of interest may be optical, nuclear, or cosmic; they emit particles such as visible photons, neutrons, protons, or charged particles. Our results may have wide applications to artificial vision, which can be important in robotics (robot vision) or medicine (e.g., artificial eyes for the blind); security, where the detection of nuclear materials is needed; or astronomy. This dissertation consists of three parts. First, we detect a far-field particle source using two directional detector arrays: cubic and spherical. We propose a mean-difference test (MDT) detector, analyze its statistical performance, and show that the MDT has a number of advantages over the generalized likelihood- ratio test (GLRT). Second, we localize the source by proposing a novel biologically inspired detector array, whose configuration generalizes the compound eye of insects. This array combines the advantages of compound eyes (e.g., large field-of-view) and human eyes (e.g., high angular resolution). Based on a statistical model of the array measurements, we analyze the array performance by computing the Cramérao bound (CRB) on the error in estimating the source direction. We also derive lower bounds on the mean-square angular error (MSAE) of the source localization and investigate the MSAE of two source- direction estimators. Numerical examples, including the optimal array design, are presented to further illustrate the array performance. Third, we derive a statistical angular resolution limit (ARL) on resolving two closely spaced point sources in a three-dimensional frame, which is applicable to various measurement models (e.g., radar, sonar, or astronomy). Using the asymptotic analysis of the GLRT, we derive the ARL with constraints on the probabilities of false alarm and detection. Our results give explicit analytical expression for the ARL that is proportional to the square root of the CRB on the angular source separation, or equivalently to the lower bound on the MSAE.

Liu, Zhi



Unobservability of short-lived unstable particles and its implications for observational claims and theories in physics  

E-print Network

The physics literature contains many claims that elementary particles have been observed: such observational claims are, of course, important for the development of existential knowledge. Regarding claimed observations of short-lived unstable particles in particular, the term `observation' is not used with reference to any particular concept of observation: physicists merely use the word `observation' based on the convention in physics that the observation of a short-lived unstable particle can be claimed when its predicted decay products have been observed with a significance of 5 sigma. However, using Fox's recent concepts of direct and indirect observation, this paper shows that unstable particles with a lifetime of less than 0.01 attosecond are fundamentally unobservable. This cognitive inaccessibility of parts of the subatomic world has far-reaching implications for physics, not the least of which is that the aforementioned convention is untenable: claims that such short-lived unstable particles have bee...

Cabbolet, Marcoen J T F



Establishing equivalence for activity standards of short-lived radionuclides using the NPL secondary standard radionuclide calibrator.  


Conventional comparison techniques used between National Metrology Institutes are not practicable for short-lived radionuclides because of geographical separations and transport difficulties. The NPL Secondary Standard Radionuclide Calibrator provides an alternative approach and a comparison was conducted with 18F to investigate its feasibility. The exercise was successful and the paper details the protocol used, the quality assurance mechanisms introduced to underpin the comparison and an analysis of the results. It was also demonstrated that this approach could be linked to the BIPM SIR system. Recommendations are presented for the extension of this work to other suitable, short-lived radionuclides. PMID:14987692

Woods, M J; Baker, M



Uncertainties and constraints regarding the contribution of very short-lived substances to stratospheric bromine loading  

NASA Astrophysics Data System (ADS)

A major factor of uncertainty in the assessment of stratospheric bromine loading is the unclear role of very short-lived substances (VSLS). One of the major obstacles for short-lived source gases in contributing to the stratosphere is generally thought to be the loss of inorganic bromine (Bry) in the tropical tropopause layer due to dehydration. Besides the dehydration process itself, transportation pathways and velocities are also of vital importance as they influence the partitioning between mostly insoluble organic source gases and partly soluble inorganic degradation products. To investigate this complex system we employ an extensive set of sensitivity calculations with a three-dimensional chemistry transport model comprising a consistent parameterization of convective transport and a comprehensive chemistry scheme. The model considers the two most important bromine VSLS, bromoform (CHBr3) and dibromomethane (CH2Br2) assuming a fixed and uniform detrainment mixing ratio of 1 pptv each. Despite our simplified approach our model agrees reasonably well with available observations of bromine source and product gases. We find that source gas injection is the dominant pathway for VSLS into the stratosphere; about 50% of CHBr3 and 93% of CH2Br2 is able to overcome the cold point tropopause at approximately 17 km altitude, modulated by the inter-annual variability of the vertical transport efficiency. In fact, our sensitivity calculations indicate that the extent of source gas injection of CHBr3 is highly sensitive to the strength of convection and large-scale ascent; in contrast, modifying the photolysis or the destruction via OH yields a significantly smaller response. The next important aspect we identified is that the partitioning of available Bry from short-lived sources is clearly shifted away from HBr, according to our current state of knowledge the only member of the Bry family which is efficiently adsorbed on ice particles. This effect is caused by very efficient heterogeneous reactions on ice surfaces which reduce the HBr/Bry fraction below 15% at the tropical tropopause. Under these circumstances there is no significant loss of Bry due to dehydration in the model; VSLS contribute fully to stratospheric bromine. In addition, we conduct several sensitivity calculations to test the robustness of this result. The loss of inorganic bromine is not very sensitive to moderate changes of the involved parameters such as the abundance of water vapor, sedimentation velocity of particles or ice uptake coefficients. However, dehydration may play a minor role for Bry removal under the assumption that HOBr is efficiently adsorbed on ice as well since the heterogeneous reactions alter the partitioning equilibrium of Bry in favor of HOBr (up to 12% loss of bromine from VSLS). Even in the extreme and unrealistic case that adsorbed species on ice particles are instantaneously removed the maximum loss of bromine does not exceed 25%.

Aschmann, Jan; Sinnhuber, Björn-Martin



Long- and short-lived nuclide constraints on the recent evolution of permafrost soils  

NASA Astrophysics Data System (ADS)

Frozen permafrost ecosystems are particularly sensitive to climate warming, which notably induces a deepening of the active layer (the maximum thawing depth during summer time). As a consequence, geochemical and hydrological fluxes within boreal areas are expected to be significantly affected in the future. Understanding the relationship between environmental changes and permafrost modifications is then a major challenge. This work aims to evaluate in a Siberian watershed the dynamics of the permafrost active layer and their recent modifications by combining a classic study of long-lived nuclides to the study of short-lived nuclides of U and Th decay series. Two soil profiles, located on opposite slopes (north- and south-facing slopes) of the Kulingdakan watershed (Putorana Plateau, Central Siberia), were sampled at several depths within the active layer and (238U), (234U), (232Th), (230Th), (226Ra), (228Ra), (228Th) and (210Pb) were measured on bulk soil samples by TIMS or gamma spectrometry. Our results show that south-facing and north-facing soil profiles are significantly different in terms of evolution of chemical concentrations and nuclide activities; north-facing soil profile is strongly affected by atmospheric inputs whereas long-lived nuclide dynamics within south-facing soil profile are dominated by weathering and exhibit more complex patterns. The amount of above-ground biomass being the single varying parameter between the two slopes of the watershed, we suggest that the structuring of permafrost active layer is very sensitive to vegetation activity and that the functioning of boreal soils will be significantly modified by its development due to more favorable climatic conditions. Moreover, the coupling of long and short-lived nuclides highlights the superimposition of a recent mobilization of chemical elements within soils (<10 years) over a much older soil structure (>8000 years), which can be observed for both soil profiles. The shallowest layer of the north-facing soil profile presents a recent increase of Th leaching that we link to the development of vegetation activity and/or organic matter degradation. In contrast, recent changes within south-facing soil profile affect the deepest part of the active layer, suggesting its deepening as a result of a global warming of Siberian soils.

Bagard, M.; Chabaux, F. J.; Rihs, S.; Pokrovsky, O. S.; Prokushkin, A. S.; Viers, J.



Evaluation of sediment dynamics in coastal systems via short-lived radioisotopes  

NASA Astrophysics Data System (ADS)

The Neuse and Pamlico River Estuaries are shallow, dynamic systems that have been plagued with symptoms of eutrophication over the past two decades. Extensive research has been conducted over the last 5-10 years to better understand the complex nutrient dynamics of these systems. However, most of these studies have concentrated on nutrient cycling in the water column. Only recently have studies focused on the benthic environment, and most sediment studies have neglected the dynamic nature of the benthos, focusing instead on diffusion as the dominant transport process delivering nutrients to the water column. Although diffusion of nutrients across the sediment-water interface may be important during quiescent periods of sediment deposition and short-term storage, wind events associated with storms throughout the year will resuspend newly deposited sediments resulting in the advective transport of sediment porewater, rich with nitrogen, phosphorus and carbon, into the water column. Sediment resuspension may increase water column nutrient concentrations, and therefore present estimates of nutrient and carbon inputs from the sediments may be too low. This study evaluated short-term sediment dynamics of natural resuspension events and deposition rates in these two estuaries with the use of short-lived radioisotopes, 7Be, 137Cs, and 234Th. Sediment cores at nine sites in the estuaries have been collected at least bimonthly since May 2001. In general, tracers indicate a depositional environment with minimal episodes of removal. The largest sediment removal occurred in August 2001 in the Neuse River where an estimated 2.2 cm of sediment were removed over the previous 6-week period. This removal mechanism essentially advects porewater nutrients into the water column. Calculated advective fluxes of ammonium and phosphate based on this resuspension event were approximately six times greater than the average diffusive flux measured in the same general area of the river. Longer-term deposition rates, using 137Cs, ranged from 1.4 to greater than 5 mm year -1, comparable to earlier studies in the area and agree well with the interpretation of the short-lived tracers. In addition, meteorological (wind speed and direction), turbidity, and bottom current data were collected and indicated that these resuspension events occur when passing fronts developed wind speeds in excess of 4 m s -1 with rapid shifts in direction. Currents exhibited estuarine flow reversals associated with wind events and apparently have some control over the sediment removal processes.

Giffin, Dan; Corbett, D. Reide



The Genetic and Environmental Control of Reproductive Timing in a Short-Lived Monocarpic Species Daucus Carota (Umbelliferae)  

E-print Network

Daucus Carota (Umbelliferae) Elizabeth P. Lacey The Journal of Ecology, Vol. 74, No. 1. (Mar., 1986), pp AND ENVIRONMENTAL CONTROL OF REPRODUCTIVE TIMING IN A SHORT-LIVED MONOCARPIC SPECIES DAUCUS CAROTA (UMBELLIFERAE.S.A. SUMMARY (1) Offspring of annual, biennial and triennial Daucus carota were grown under three nutrient

Lacey, Elizabeth P.


Nuclear Moments and Differences in Mean Square Charge Radii of Short-Lived Neon Isotopes by Collinear Laser Spectroscopy  

Microsoft Academic Search

The nuclear moments and charge radii of short-lived neon isotopes were measured by the use of collinear laser spectroscopy at the on-line mass separator ISOLDE at CERN. After a general introduction the semiclassical theory of atomic spectra is given and the relevant properties are calculated for neon. The atomic physics section is followed by a description of the experimental setup

R W Geithner; R Neugart



Measurement of Short-Lived Fission-Product Yields of URANIUM-235 Using High-Resolution Gamma Spectra.  

NASA Astrophysics Data System (ADS)

Independent yields of short-lived fission products produced by the thermal neutron induced fission of ^{235}U were determined from the measurements of high resolution gamma spectra. Comparisons were made to the recommended yield values tabulated in the ENDF/B-VI evaluated fission-product data base. Measurements of the gamma spectra were made with a high purity germanium detector (HPGe) using a NaI(Tl) annulus for Compton suppression. Use of beta-gamma coincidence reduced the random background and also allowed a precise definition of the delay time. The experiment was carried out at the 5.5 MV Van de Graaff facility at the University of Massachusetts Lowell. Rapid transfer of the fission fragments to a low background counting environment, a crucial factor in determining the yields of short-lived fission products, was enabled by a helium -jet tape transport system. The recommended yields in the evaluated data file are a combination of experimental and model-predicted values. The latter source is used since data from many short-lived fission products is still missing or poorly known. The results presented here, especially the ones for the very short-lived isotopes may be used to reduce the uncertainties associated with some of the existing values or to replace model-predicted yields. Gaussian distributions of elemental yields, based on the set of experimentally determined independent yields were examined. The feasibility of predicting unmeasured yields on the basis of charge and mass complementarity was also addressed.

Tipnis, Sameer Vijay


Unobservability of short-lived unstable particles and its implications for observational claims and theories in physics  

E-print Network

The physics literature contains many claims that elementary particles have been observed: such observational claims are, of course, important for the development of existential knowledge. Regarding claimed observations of short-lived unstable particles in particular, the term `observation' is not used with reference to any particular concept of observation: physicists merely use the word `observation' based on the convention in physics that the observation of a short-lived unstable particle can be claimed when its predicted decay products have been observed with a significance of 5 sigma. However, using Fox's recent concepts of direct and indirect observation, this paper shows that unstable particles with a lifetime of less than 0.01 attosecond are fundamentally unobservable. This cognitive inaccessibility of parts of the subatomic world has far-reaching implications for physics, not the least of which is that the aforementioned convention is untenable: claims that such short-lived unstable particles have been observed will thus have to be retracted. The main implications are two incompleteness theorems for physics, respectively stating (i) that experiments cannot prove completeness of a physical theory predicting short-lived unstable particles, and (ii) that experiments cannot prove correctness of such a theory - one can at most test its empirical adequacy. On a general note, the conclusion is that the importance of philosophical arguments for particle physics is herewith demonstrated: it is, thus, a widespread misconception that philosophical arguments can be completely avoided.

Marcoen J. T. F. Cabbolet



Multiple, short-lived ``stellar prominences'' on O stars: the supergiant ? Cephei  

NASA Astrophysics Data System (ADS)

Many OB stars show unexplained cyclical variability in their winds and in many optical lines, which are formed at the base of the wind. For these stars no dipolar magnetic fields have been detected. We propose that these cyclical variations are caused by the presence of multiple, transient, short-lived, corotating magnetic loops, which we call ``stellar prominences''. We present a simplified model representing these prominences as corotating spherical blobs and fit the rapid variability in the Heii ?4686 line of the O supergiant ? Cep for time-resolved spectra obtained in 1989. Our conclusions are: (1) From model fits we find that the life time of the prominences varies, and is between 2-7 h. (2) The adopted inclination angle is 68° with a rotation period of ~ 4.1 d (but not well constrained). (3) The contribution of non-radial pulsations is negligible (4) Similar behavior is observed in at least 4 other O stars. We propose that prominences are a common phenomenon among O stars.

Henrichs, H. F.; Sudnik, N.



Short-Lived HF Molecules in Superionic Hydrogen Fluoride at Extreme Conditions  

NASA Astrophysics Data System (ADS)

The first principles molecular dynamics study enables us to elucidate the existence of short-lived HF molecules in the superionic hydrogen fluoride at an extreme high pressure and a temperature. Three fourth of the immobile fluorines constructs the molecules with lifetime of 8 fs. The ionized fluorines form weak HF bond with the proton in the nearest HF molecule of which the lifetime is 3 fs. The covalent and the Coulomb bonds between the fluorines and the protons form indirect covalent and indirect Coulomb attractions between the di-interstitial protons on the mid-fluorines. The attractions reduce the Haven's ratio of the protons. The absence of the proton dimers indicates a failure of the caterpillar diffusion model or the Frenkel–Kontorova chain model for the superionic diffusion of the protons. The incompletely ionized cations and anions reduce their Coulomb attractions which induce the sublattice melting of smaller size and smaller mass of the protons than the fluorines. The electronic states of the fluoride are intermediate between the ionic crystals and the covalent bonded molecular crystals. The superionic conductors are classified into three groups: they are molecular type, covalent metalloid type, and metallic type conductors.

Tsumuraya, Kazuo; Ohde, Yoshiyuki; Oshimi, Tadaaki



Spatial distribution of brominated very short-lived substances in the eastern Pacific  

NASA Astrophysics Data System (ADS)

Seawater concentrations and distributions of brominated very short-lived substances (BrVSLS), including bromoform (CHBr3), dibromomethane (CH2Br2), bromodichloromethane (CHBrCl2), chlorodibromomethane (CHClBr2), were measured in the upper water column (5-750 m) in the eastern Pacific. Inorganic nutrient, pigment concentrations, and picoplankton cell counts were measured to determine biogeochemical factors that affect the production and distribution of these BrVSLS. Elevated concentrations of BrVSLS were observed in coastal and tropical seawater. Concentration maxima for CHBr3, CH2Br2, and CHClBr2 were observed below the mixed layer, near the subsurface chlorophyll a maxima, which suggest BrVSLS production may be related to photosynthetic biomass production. Our results also suggest that heterotrophic bacteria may also contribute to CH2Br2 and CHBrCl2 production in the water column. The maximum CHBrCl2 concentration was observed at a depth much deeper than the euphotic zone, which suggests sources other than photosynthetic biomass. Elevated CHBrCl2 concentrations in deeper waters were coincident with elevated CHCl3 concentrations, which may be an evidence for successive chlorine substitution of CHBr3 in deeper and older water masses.

Liu, Yina; Yvon-Lewis, Shari A.; Thornton, Daniel C. O.; Campbell, Lisa; Bianchi, Thomas S.



Development of a resonant laser ionization gas cell for high-energy, short-lived nuclei  

NASA Astrophysics Data System (ADS)

A new laser ion source configuration based on resonant photoionization in a gas cell has been developed at RIBF RIKEN. This system is intended for the future PArasitic RI-beam production by Laser Ion-Source (PALIS) project which will be installed at RIKEN's fragment separator, BigRIPS. A novel implementation of differential pumping, in combination with a sextupole ion beam guide (SPIG), has been developed. A few small scroll pumps create a pressure difference from 1000 hPa-10-3 Pa within a geometry drastically miniaturized compared to conventional systems. This system can utilize a large exit hole for fast evacuation times, minimizing the decay loss for short-lived nuclei during extraction from a buffer gas cell, while sufficient gas cell pressure is maintained for stopping high energy RI-beams. In spite of the motion in a dense pressure gradient, the photo-ionized ions inside the gas cell are ejected with an assisting force gas jet and successfully transported to a high-vacuum region via SPIG followed by a quadrupole mass separator. Observed behaviors agree with the results of gas flow and Monte Carlo simulations.

Sonoda, T.; Wada, M.; Tomita, H.; Sakamoto, C.; Takatsuka, T.; Furukawa, T.; Iimura, H.; Ito, Y.; Kubo, T.; Matsuo, Y.; Mita, H.; Naimi, S.; Nakamura, S.; Noto, T.; Schury, P.; Shinozuka, T.; Wakui, T.; Miyatake, H.; Jeong, S.; Ishiyama, H.; Watanabe, Y. X.; Hirayama, Y.; Okada, K.; Takamine, A.



Harvard-MIT research program in short-lived radiopharmaceuticals. Final report  

SciTech Connect

The Harvard-MIT Research Program in Short-lived Radiopharmaceuticals was established in 1977 to foster interaction among groups working in radiopharmaceutical chemistry at Harvard Medical School, the Massachusetts Institute of Technology, and the Massachusetts General Hospital. To this was added a group at The Childrens Hospital. From these collaborations and building upon the special strengths of the participating individuals, laboratories and institutions, it was hoped that original approaches would be found for the design of new, clinically useful, radiolabeled compounds. The original thrust of this proposal included: (a) examination of the coordination chemistry of technetium as a basis for rational radiopharmaceutical design, (b) development of an ultrashort-lived radionuclide generator for the diagnosis of congenital heart disease in newborns, (c) synthesis of receptor-site-directed halopharmaceuticals, (d) improved facile labeling of complex molecules with positron-emitting radionuclides. The authors` 1986 proposal was oriented toward organs and disease, emphasizing radiolabeled agents that delineate specific functions and the distribution of receptors in brain, heart, and tumors. In 1989, they further refined their purposes and focused on two major aims: (a) synthesis and utilization of neutral technetium and rhenium complexes of high specific activity, and (b) development of new approaches to the radiolabeling of proteins, peptides, immunoglobulins, and their fragments. In 1992, the authors amended this proposal to concentrate their efforts on biologically active peptides and proteins for targeted radiodiagnosis and therapy.

Adelstein, S.J. [Massachusetts Inst. of Tech., Cambridge, MA (United States). Office of Sponsored Programs



Observation and modeling of short-lived oxygenated hydrocarbons in the tropical free troposphere  

NASA Astrophysics Data System (ADS)

The Tropical Ocean tRoposphere Exchange experiment TORERO (Jan/Feb 2012) probed the influence of air-sea exchange of organic carbon species and very short lived halogen species on the oxidative capacity of the tropical free troposphere over the full tropospheric air column above the eastern tropical Pacific Ocean. Organic carbon is important in the atmosphere, because it influences the reactive chemistry and lifetime of climate active gases (e.g., methane, ozone, dimethyl sulfide), and because of its relevance for the formation, composition and climate impact of aerosols. This presentation summarizes unequivocal evidence for the presence of numerous oxygenated hydrocarbons (i.e., glyoxal, formaldehyde, acetaldehyde, propanal, MVK, MEK, aliphatic aldehydes, alcohols etc.) in the remote marine boundary layer, and in the tropical free troposphere. These species were detected by means of both Differential Optical Absorption Spectroscopy (Airborne MAX-DOAS), and online GC-MS (TOGA) aboard the NSF/NCAR GV aircraft. We employ atmospheric modeling constrained by observations of gas-phase hydrocarbons, aerosols, photolysis frequencies, and meterological parameters measured aboard the plane to elucidate the formation mechanism of this as of yet unaccounted source for oxidized organic carbon, and quantify the influence on the OVOCs on hydroxyl, bromine, chlorine and iodine radical abundances.

Volkamer, Rainer; Apel, Eric



Dissolved organic matter composition drives the marine production of brominated very short-lived substances.  


Brominated very short-lived substances (BrVSLS), such as bromoform, are important trace gases for stratospheric ozone chemistry. These naturally derived trace gases are formed via bromoperoxidase-mediated halogenation of dissolved organic matter (DOM) in seawater. Information on DOM type in relation to the observed BrVSLS concentrations in seawater, however, is scarce. We examined the sensitivity of BrVSLS production in relation to the presence of specific DOM moieties. A total of 28 model DOM compounds in artificial seawater were treated with vanadium bromoperoxidase (V-BrPO). Our results show a clear dependence of BrVSLS production on DOM type. In general, molecules that comprise a large fraction of the bulk DOM pool did not noticeably affect BrVSLS production. Only specific cell metabolites and humic acid appeared to significantly enhance BrVSLS production. Amino acids and lignin phenols suppressed enzyme-mediated BrVSLS production and may instead have formed halogenated nonvolatile molecules. Dibromomethane production was not observed in any experiments, suggesting it is not produced by the same pathway as the other BrVSLS. Our results suggest that regional differences in DOM composition may explain the observed BrVSLS concentration variability in the global ocean. Ultimately, BrVSLS production and concentrations are likely affected by DOM composition, reactivity, and cycling in the ocean. PMID:25723123

Liu, Yina; Thornton, Daniel C O; Bianchi, Thomas S; Arnold, William A; Shields, Michael R; Chen, Jie; Yvon-Lewis, Shari A



Chemistry of Very Short Lived Halogens in the Troposphere: Pre-Industrial to Present day  

NASA Astrophysics Data System (ADS)

Ozone in the troposphere is one of the most important short-lived gases contributing to greenhouse radiative forcing (IPCC, 2007) and is of central importance to the chemistry of this region of the atmosphere. Tropospheric ozone is produced by photochemical oxidation of carbon monoxide, methane and other non-methane volatile organic compounds in the presence of nitrogen oxide. A large fraction of the tropospheric ozone loss occurs within the tropical marine boundary layer via photolysis to excited oxygen atoms followed by reaction with water vapor, reactions with odd hydrogen radical, and surface deposition. In addition, inorganic halogens (i.e., chlorine, bromine, and iodine species) are known to destroy ozone through efficient catalytic reaction cycles. In this study, we use the NCAR 3D chemistry climate model (CAM-Chem), including a detailed representation of tropospheric and stratospheric chemistry. Its scope has been extended to include halogen sources, reactive halogen chemistry, and related atmospheric processes (Ordonez et al., ACP, 2012; Saiz-Lopez et al., ACP,. 2012). The purpose of this work is to contrast the pre-industrial importance of tropospheric halogen driven ozone loss to present day conditions, specifically the importance of iodine and bromine chemistry. The sensitivity to inorganic nitrogen abundance will be shown. The model results compared to the pre-industrial surface ozone measurements at Montsouris (Volz and Kley, 1988) will also be discussed.

Kinnison, Douglas; Saiz-Lopez, Alfonso; Fernandez, Rafael; Lamarque, Jean-Francois; Tilmes, Simone



Solar system genealogy revealed by extinct short-lived radionuclides in meteorites  

E-print Network

Little is known about the stellar environment and the genealogy of our solar system. Short-lived radionuclides (SLRs, mean lifetime shorter than 100 Myr) that were present in the solar protoplanetary disk 4.56 Gyr ago could potentially provide insight into that key aspect of our history, were their origin understood. Previous models failed to provide a reasonable explanation of the abundance of two key SLRs, 26Al (mean lifetime = 1.1 Myr) and 60Fe (mean lifetime = 3.7 Myr), at the birth of the solar system by requiring unlikely astrophysical conditions. Our aim is to propose a coherent and generic solution based on the most recent understanding of star-forming mechanisms. Iron-60 in the nascent solar system is shown to have been produced by a diversity of supernovae belonging to a first generation of stars in a giant molecular cloud. Aluminum-26 is delivered into a dense collected shell by a single massive star wind belonging to a second star generation. The Sun formed in the collected shell as part of a thir...

Gounelle, Matthieu; 10.1051/0004-6361/201219031



Mass spectrometric detection of short-lived drug metabolites generated in an electrochemical microfluidic chip.  


The costs of drug development have been rising exponentially over the last six decades, making it essential to select drug candidates in the early drug discovery phases before proceeding to expensive clinical trials. Here, we present novel screening methods using an electrochemical chip coupled online to mass spectrometry (MS) or liquid chromatography (LC) and MS, to generate phase I and phase II drug metabolites and to demonstrate protein modification by reactive metabolites. The short transit time (?4.5 s) between electrochemical oxidation and mass spectrometric detection, enabled by an integrated electrospray emitter, allows us to detect a short-lived radical metabolite of chlorpromazine which is too unstable to be detected using established test routines. In addition, a fast way to screen candidate drugs is established by recording real-time mass voltammograms, which allows one to identify the drug metabolites that are expected to be formed upon oxidation by applying a linear potential sweep and simultaneously detect oxidation products. Furthermore, detoxification of electrochemically generated reactive metabolites of paracetamol was mimicked by their adduct formation with the antioxidant glutathione. Finally, the potential toxicity of reactive metabolites can be investigated by the modification of proteins, which was demonstrated by modification of carbonic anhydrase I with electrochemically generated reactive metabolites of paracetamol. With this series of experiments, we demonstrate the potential of this electrochemical chip as a complementary tool for a variety of drug metabolism studies in the early stages of drug discovery. PMID:25531627

van den Brink, Floris T G; Büter, Lars; Odijk, Mathieu; Olthuis, Wouter; Karst, Uwe; van den Berg, Albert



Development of a resonant laser ionization gas cell for high-energy, short-lived nuclei  

E-print Network

A new laser ion source configuration based on resonant photoionization in a gas cell has been developed at RIBF RIKEN. This system is intended for the future PArasitic RI-beam production by Laser Ion-Source (PALIS) project which will be installed at RIKEN's fragment separator, BigRIPS. A novel implementation of differential pumping, in combination with a sextupole ion beam guide (SPIG), has been developed. A few small scroll pumps create a pressure difference from 1000 hPa - 10^-3 Pa within a geometry drastically miniaturized compared to conventional systems. This system can utilize a large exit hole for fast evacuation times, minimizing the decay loss for short-lived nuclei during extraction from a buffer gas cell, while sufficient gas cell pressure is maintained for stopping high energy RI-beams. In spite of the motion in a dense pressure gradient, the photo-ionized ions inside the gas cell are ejected with an assisting force gas jet and successfully transported to a high-vacuum region via SPIG followed by ...

Sonoda, T; Tomita, H; Sakamoto, C; Takatsuka, T; Furukawa, T; Iimura, H; Ito, Y; Kubo, T; Matsuo, Y; Mita, H; Naimi, S; Nakamura, S; Noto, T; Schury, P; Shinozuka, T; Wakui, T; Miyatake, H; Jeong, S; Ishiyama, H; Watanabe, Y X; Hirayama, Y; Okada, K; Takamine, A



Development of a resonant laser ionization gas cell for high-energy, short-lived nuclei  

E-print Network

A new laser ion source configuration based on resonant photoionization in a gas cell has been developed at RIBF RIKEN. This system is intended for the future PArasitic RI-beam production by Laser Ion-Source (PALIS) project which will be installed at RIKEN's fragment separator, BigRIPS. A novel implementation of differential pumping, in combination with a sextupole ion beam guide (SPIG), has been developed. A few small scroll pumps create a pressure difference from 1000 hPa - 10^-3 Pa within a geometry drastically miniaturized compared to conventional systems. This system can utilize a large exit hole for fast evacuation times, minimizing the decay loss for short-lived nuclei during extraction from a buffer gas cell, while sufficient gas cell pressure is maintained for stopping high energy RI-beams. In spite of the motion in a dense pressure gradient, the photo-ionized ions inside the gas cell are ejected with an assisting force gas jet and successfully transported to a high-vacuum region via SPIG followed by a quadrupole mass separator. Observed behaviors agree with the results of gas flow and Monte Carlo simulations.

T. Sonoda; M. Wada; H. Tomita; C. Sakamoto; T. Takatsuka; T. Furukawa; H. Iimura; Y. Ito; T. Kubo; Y. Matsuo; H. Mita; S. Naimi; S. Nakamura; T. Noto; P. Schury; T. Shinozuka; T. Wakui; H. Miyatake; S. Jeong; H. Ishiyama; Y. X. Watanabe; Y. Hirayama; K. Okada; A. Takamine



A quantitative genetic signature of senescence in a short-lived perennial plant.  


The evolution of senescence (the physiological decline of organisms with age) poses an apparent paradox because it represents a failure of natural selection to increase the survival and reproductive performance of organisms. The paradox can be resolved if natural selection becomes less effective with age, because the death of postreproductive individuals should have diminished effects on Darwinian fitness [1, 2]. A substantial body of empirical work is consistent with this prediction for animals, which transmit their genes to progeny via an immortal germline. However, such evidence is still lacking in plants, which lack a germline and whose reproduction is diffuse and modular across the soma. Here, we provide experimental evidence for a genetic basis of senescence in the short-lived perennial plant Silene latifolia. Our pedigree-based analysis revealed a marked increase with age in the additive genetic variance of traits closely associated with fitness. This result thus extends to plants the quantitative genetic support for the evolutionary theory of senescence. PMID:24631239

Pujol, Benoit; Marrot, Pascal; Pannell, John R



Trapping of relatively short-lived radioactive {}^{146}Eu in a Paul trap  

NASA Astrophysics Data System (ADS)

A new technique has been developed wherein one of the relatively short lived isotopes of europium ({}^{146}Eu, Half life =\\;4.61 days) has been generated by decay of parent {}^{146}Gd atoms and the ions are confined in a Paul trap for spectroscopic studies. Studies of the mass dependent ion oscillation frequencies show that the ions trapped have a mass number 146 amu and this was confirmed by similar measurements carried out on trapped barium and potassium ions. From calculations of thermal ionization probabilities based on the Langmuir-Saha equation and the number of trapped ions estimated from ion response signal, the approximate number of the different isobars (of mass number 146) trapped, has been evaluated. We also present simulations of the evolution of laser-induced fluorescence photons of the trapped {}^{146}Eu ions, wherein a pulsed laser is used to excite the resonance {}^{9}S_{4} - {}^{9}P_{5} transition, which rapidly decays to the metastable {}^{9}D_{4-6} states emitting fluorescence photons.

Joshi, M. K.; Sikdar, A. K.; Rao, Pushpa M.; Bhattacharjee, T.; Das, S. K.; Das, P.



Evaluation of beta partical densitometry for determination of self-absorption factors in gross alpha and gross beta radioactivity measurements on air particulate filter samples  

E-print Network

Alpha and beta particles emitted from radioactive material collected on an air filter may be significantly attenuated by the mass (thickness) of collected dust. In this study, we determined the mass or thickness of the simulated dust deposit...

Breida, Margaret A



A proposal for assessing study quality: Biomonitoring, Environmental Epidemiology, and Short-lived Chemicals (BEES-C) instrument  

PubMed Central

The quality of exposure assessment is a major determinant of the overall quality of any environmental epidemiology study. The use of biomonitoring as a tool for assessing exposure to ubiquitous chemicals with short physiologic half-lives began relatively recently. These chemicals present several challenges, including their presence in analytical laboratories and sampling equipment, difficulty in establishing temporal order in cross-sectional studies, short- and long-term variability in exposures and biomarker concentrations, and a paucity of information on the number of measurements required for proper exposure classification. To date, the scientific community has not developed a set of systematic guidelines for designing, implementing and interpreting studies of short-lived chemicals that use biomonitoring as the exposure metric or for evaluating the quality of this type of research for WOE assessments or for peer review of grants or publications. We describe key issues that affect epidemiology studies using biomonitoring data on short-lived chemicals and propose a systematic instrument – the Biomonitoring, Environmental Epidemiology, and Short-lived Chemicals (BEES-C) instrument – for evaluating the quality of research proposals and studies that incorporate biomonitoring data on short-lived chemicals. Quality criteria for three areas considered fundamental to the evaluation of epidemiology studies that include biological measurements of short-lived chemicals are described: 1) biomarker selection and measurement, 2) study design and execution, and 3) general epidemiological study design considerations. We recognize that the development of an evaluative tool such as BEES-C is neither simple nor non-controversial. We hope and anticipate that the instrument will initiate further discussion/debate on this topic. PMID:25137624

LaKind, Judy S.; Sobus, Jon R.; Goodman, Michael; Barr, Dana Boyd; Fürst, Peter; Albertini, Richard J.; Arbuckle, Tye E.; Schoeters, Greet; Tan, Yu-Mei; Teeguarden, Justin; Tornero-Velez, Rogelio; Weisel, Clifford P.



A proposal for assessing study quality: Biomonitoring, Environmental Epidemiology, and Short-lived Chemicals (BEES-C) instrument.  


The quality of exposure assessment is a major determinant of the overall quality of any environmental epidemiology study. The use of biomonitoring as a tool for assessing exposure to ubiquitous chemicals with short physiologic half-lives began relatively recently. These chemicals present several challenges, including their presence in analytical laboratories and sampling equipment, difficulty in establishing temporal order in cross-sectional studies, short- and long-term variability in exposures and biomarker concentrations, and a paucity of information on the number of measurements required for proper exposure classification. To date, the scientific community has not developed a set of systematic guidelines for designing, implementing and interpreting studies of short-lived chemicals that use biomonitoring as the exposure metric or for evaluating the quality of this type of research for WOE assessments or for peer review of grants or publications. We describe key issues that affect epidemiology studies using biomonitoring data on short-lived chemicals and propose a systematic instrument--the Biomonitoring, Environmental Epidemiology, and Short-lived Chemicals (BEES-C) instrument--for evaluating the quality of research proposals and studies that incorporate biomonitoring data on short-lived chemicals. Quality criteria for three areas considered fundamental to the evaluation of epidemiology studies that include biological measurements of short-lived chemicals are described: 1) biomarker selection and measurement, 2) study design and execution, and 3) general epidemiological study design considerations. We recognize that the development of an evaluative tool such as BEES-C is neither simple nor non-controversial. We hope and anticipate that the instrument will initiate further discussion/debate on this topic. PMID:25137624

LaKind, Judy S; Sobus, Jon R; Goodman, Michael; Barr, Dana Boyd; Fürst, Peter; Albertini, Richard J; Arbuckle, Tye E; Schoeters, Greet; Tan, Yu-Mei; Teeguarden, Justin; Tornero-Velez, Rogelio; Weisel, Clifford P



Chemical characterization of soot particles emitted by Wood-Burning Cook Stoves: A XPS and HRTEM study  

NASA Astrophysics Data System (ADS)

The morphology, microstructure, chemical composition, and electronic structure of soot particles emitted directly from biofuel cook stoves have been studied by high resolution transmission electron microscopy (HRTEM) and X-ray photoelectron spectroscopy (XPS). In order to obtain freshly emitted soot particles, copper grids for Transmission Electron Microscope (TEM) were placed on the last two of an 8-stages MOUDI cascade impactor. The analysis of HRTEM micrographs revealed the nanostructure and the particle size of soot chain. Additionally, the morphology of soot particles was analyzed calculating the border-based fractal dimension (Df). Particles sampled on the first heating stage exhibit complex shapes with high values of Df, which are present as aggregates formed by carbon ceno-spheres. The XPS survey spectrum for soot particles shows that the main particle composition is carbon. We also observed differences in the carbon/oxygen (C/O) ratio of the particles, which probably depends on the combustion process efficiency of each cook-stove analyzed. The XPS C-1s spectra show carbon with two peaks that correspond to sp2 and sp3 hybridization. Also, real-time absorption (?a) and scattering (?s) coefficients of the particles emitted by cook stoves were measured. The trend in ?a and ?s indicate that the cooking process has two important combustion stages which varied in its flaming strength, being vigorous in the first stage and soft in the second one.

Carabali, Giovanni; Peralta, Oscar; Castro, Telma; Torres, Ricardo; Ruiz, Gerardo; Molina, Luisa; Saavedra, Isabel



Coastal water source of short-lived halocarbons in New England  

NASA Astrophysics Data System (ADS)

Short-lived halocarbon tracers were used to investigate marine influences on air quality in a coastal region of New England. Atmospheric measurements made at the University of New Hampshire's Observing Station at Thompson Farm (TF) in Durham, New Hampshire, indicate that relatively large amounts of halocarbons are emitted from local estuarine and coastal oceanic regions. Bromine-containing halocarbons of interest in this work include bromoform (CHBr3) and dibromomethane (CH2Br2). The mean mixing ratios of CHBr3 and CH2Br2 from 11 January to 5 March 2002 were 2.6 pptv and 1.6 pptv, and from 1 June to 31 August 2002 mean mixing ratios were 5.9 pptv and 1.4 pptv, respectively. The mean mixing ratio of CHBr3 was not only highest during summer, but both CHBr3 and CH2Br2 exhibited large variability in their atmospheric mixing ratios during this season. We attribute the greater variability to increased production combined with faster atmospheric removal rates. Other seasonal characteristics of CHBr3 and CH2Br2 in the atmosphere, as well as the impact of local meteorology on their distributions at this coastal site, are discussed. Tetrachloroethene (C2Cl4) and trichloroethene (C2HCl3) were used to identify time periods influenced by urban emissions. Additionally, measurements of CHBr3, CH2Br2, C2Cl4, methyl iodide (CH3I), and ethyl iodide (C2H5I) were made at TF and five sites throughout the nearby Great Bay estuarine area between 18 and 19 August 2003. These measurements were used to elucidate the effect of the tidal cycle on the distributions of these gases. The mean mixing ratios of CHBr3, CH2Br2, CH3I, and C2H5I were ˜82%, 46%, 14%, and 17% higher, respectively, near the coast compared to inland sites, providing evidence for a marine source of short-lived halocarbons at TF. Correlation between the tidal cycle and atmospheric concentrations of marine tracers on the night of 18 August 2003 showed that the highest values for the brominated species occurred ˜2-3 hours after high tide. Emission fluxes of CHBr3, CH2Br2, CH3I, and C2H5I on this night were estimated to be 26 ± 57, 4.7 ± 5.4, 5.9 ± 4.6, and 0.065 ± 0.20 nmol m-2 h-1, respectively. Finally, the anthropogenic source strength of CHBr3 was calculated to determine its impact on atmospheric levels observed in this region. Although our results indicate that anthropogenic contributions could potentially range from 15 to 60% of the total dissolved CHBr3 in the Great Bay, based on the observed ratio of CH2Br2/CHBr3 and surface seawater measurements in the Gulf of Maine, it appears unlikely that anthropogenic activities are a significant source of CHBr3 in the region.

Zhou, Yong; Varner, Ruth K.; Russo, Rachel S.; Wingenter, Oliver W.; Haase, Karl B.; Talbot, Robert; Sive, Barkley C.



Polyhalogenated Very Short Live Substances in the Atlantic Ocean, and their Linkages with Ocean Primary Production  

NASA Astrophysics Data System (ADS)

The Halocarbon Air-Sea Transect - Atlantic (HalocAST-A) cruise was conducted aboard FS Polarstern during the ANT-XXVII/1 expedition. The ship departed from Bremerhaven, Germany on October 25th and arrived in Cape Town, South Africa on November 24th in 2010. The HalocAST-A cruise was devoted to studying air-sea fluxes of a suite of halocarbon compounds. Atmospheric mixing ratios and seawater concentrations of the halocarbons were continuously measured with the gas chromatograph - mass spectrometer (GC-MS). This study focuses on the polyhalogenated very short lived substances (VSLSs) such as bromoform (CHBr3), dibromomethane (CH2Br2), chlorodibromomethane (CHClBr2), and bromodichloromethane (CHBrCl2). The goal of this study is to examine the distributions of these compounds and possible relationship between their emissions and oceanic primary production. Therefore, along with the halocarbon concentrations, parameters like dissolved organic carbon concentrations, nutrient concentrations, pigment concentrations, and picoplankton and heterotrophic bacteria counts were also determined. The observed saturation anomalies indicated these VSLSs were supersaturated for almost the entire duration of the cruise. The highest seawater concentrations for these compounds were observed near the Canary Islands. Air mixing ratios were also elevated in this region. The net fluxes for CHBr3, CH2Br2, CHClBr2, and CHBrCl2 were 13.8 nmol m-2 d-1, 4.5 nmol m-2 d-1, 4.5 nmol m-2 d-1 and 1.2 nmol m-2 d-1, respectively. During the HalocAST-A cruise, these compounds exhibit similar trends with total chlorophyll a. Contributions from selected phytoplankton group will be further assessed through the use of individual pigment biomarkers.

Liu, Y.; Yvon-Lewis, S. A.; Hu, L.; Bianchi, T. S.; Campbell, L.; Smith, R. W.



Convective transport of very-short-lived bromocarbons to the stratosphere  

NASA Astrophysics Data System (ADS)

We use the NASA GEOS Chemistry Climate Model (GEOSCCM) to quantify the contribution of two most important brominated very short-lived substances (VSLS), bromoform (CHBr3) and dibromomethane (CH2Br2), to stratospheric bromine and its sensitivity to convection strength. Model simulations suggest that the most active transport of VSLS from the marine boundary layer through the tropopause occurs over the tropical Indian Ocean, the Western Pacific warm pool, and off the Pacific coast of Mexico. Together, convective lofting of CHBr3 and CH2Br2 and their degradation products supplies ∼8 ppt total bromine to the base of the Tropical Tropopause Layer (TTL, ∼150 hPa), similar to the amount of VSLS organic bromine available in the marine boundary layer (∼7.8-8.4 ppt) in the above active convective lofting regions. Of the total ∼8 ppt VSLS-originated bromine that enters the base of TTL at ∼150 hPa, half is in the form of source gas injection (SGI) and half as product gas injection (PGI). Only a small portion (< 10%) the VSLS-originated bromine is removed via wet scavenging in the TTL before reaching the lower stratosphere. On global and annual average, CHBr3 and CH2Br2, together, contribute ∼7.7 pptv to the present-day inorganic bromine in the stratosphere. However, varying model deep convection strength between maximum and minimum convection conditions can introduce a ∼2.6 pptv uncertainty in the contribution of VSLS to inorganic bromine in the stratosphere (BryVSLS). Contrary to the conventional wisdom, minimum convection condition leads to a larger BryVSLS as the reduced scavenging in soluble product gases, thus a significant increase in PGI (2-3 ppt), greatly exceeds the relative minor decrease in SGI (a few 10ths ppt).

Liang, Q.; Atlas, E.; Blake, D.; Dorf, M.; Pfeilsticker, K.; Schauffler, S.



Longitudinal analysis of Plantago: adaptive benefits of iteroparity in a short-lived, herbaceous perennial  

PubMed Central

Theory suggests that iteroparity may confer greater fitness than semelparity in situations in which temporal environmental variation is high and unpredictable. Variable age-specific mortality, density dependence, and other factors may also favor iteroparity over semelparity. Here, we empirically test the adaptive benefits of greater numbers of reproductive years in a study of reproductive schedules in an experimental population of a short-lived polycarpic perennial, Plantago lanceolata. A large experimental population was established that included four cohorts with similar genetic structure. Individuals were censused for mortality, size, and reproduction for seven years. Plants experienced variable numbers of reproductive years, but one or two years were most common (~46.7% of the population reproduced only once). The probability of flowering at least once prior to death was determined strongly by extrinsic, environmental or intrinsic but environmentally influenced variables, including early-life size, cohort, and block, but also varied with a number of interactions involving paternal lineage. Maternal effects explained small but significant components of the variance in the number of reproductive years among individuals in each cohort, while paternal effects were significant in only two cohorts. Number of reproductive years contributed significantly to fitness in this system, more so than all other variables tested, although most of the variation in relative fitness may be attributed ultimately to environmental influences. We suggest that the high proportion of each cohort composed of plants reproducing only once may be due to environmental constraints on either growth or size. Such environmental influences, particularly on early life size, may result in small but important indirect effects on fitness. PMID:20392009

Shefferson, Richard P.; Roach, Deborah A.




SciTech Connect

Analyses of primitive meteorites and cometary samples have shown that the solar nebula must have experienced a phase of large-scale outward transport of small refractory grains as well as homogenization of initially spatially heterogeneous short-lived isotopes. The stable oxygen isotopes, however, were able to remain spatially heterogeneous at the {approx}6% level. One promising mechanism for achieving these disparate goals is the mixing and transport associated with a marginally gravitationally unstable (MGU) disk, a likely cause of FU Orionis events in young low-mass stars. Several new sets of MGU models are presented that explore mixing and transport in disks with varied masses (0.016 to 0.13 M{sub Sun }) around stars with varied masses (0.1 to 1 M{sub Sun }) and varied initial Q stability minima (1.8 to 3.1). The results show that MGU disks are able to rapidly (within {approx}10{sup 4} yr) achieve large-scale transport and homogenization of initially spatially heterogeneous distributions of disk grains or gas. In addition, the models show that while single-shot injection heterogeneity is reduced to a relatively low level ({approx}1%), as required for early solar system chronometry, continuous injection of the sort associated with the generation of stable oxygen isotope fractionations by UV photolysis leads to a sustained, relatively high level ({approx}10%) of heterogeneity, in agreement with the oxygen isotope data. These models support the suggestion that the protosun may have experienced at least one FU Orionis-like outburst, which produced several of the signatures left behind in primitive chondrites and comets.

Boss, Alan P., E-mail: [Department of Terrestrial Magnetism, Carnegie Institution for Science, 5241 Broad Branch Road, NW, Washington, DC 20015-1305 (United States)



Disentangling the effects of CO2 and short-lived climate forcer mitigation.  


Anthropogenic global warming is driven by emissions of a wide variety of radiative forcers ranging from very short-lived climate forcers (SLCFs), like black carbon, to very long-lived, like CO2. These species are often released from common sources and are therefore intricately linked. However, for reasons of simplification, this CO2-SLCF linkage was often disregarded in long-term projections of earlier studies. Here we explicitly account for CO2-SLCF linkages and show that the short- and long-term climate effects of many SLCF measures consistently become smaller in scenarios that keep warming to below 2 °C relative to preindustrial levels. Although long-term mitigation of methane and hydrofluorocarbons are integral parts of 2 °C scenarios, early action on these species mainly influences near-term temperatures and brings small benefits for limiting maximum warming relative to comparable reductions taking place later. Furthermore, we find that maximum 21st-century warming in 2 °C-consistent scenarios is largely unaffected by additional black-carbon-related measures because key emission sources are already phased-out through CO2 mitigation. Our study demonstrates the importance of coherently considering CO2-SLCF coevolutions. Failing to do so leads to strongly and consistently overestimating the effect of SLCF measures in climate stabilization scenarios. Our results reinforce that SLCF measures are to be considered complementary rather than a substitute for early and stringent CO2 mitigation. Near-term SLCF measures do not allow for more time for CO2 mitigation. We disentangle and resolve the distinct benefits across different species and therewith facilitate an integrated strategy for mitigating both short and long-term climate change. PMID:25368182

Rogelj, Joeri; Schaeffer, Michiel; Meinshausen, Malte; Shindell, Drew T; Hare, William; Klimont, Zbigniew; Velders, Guus J M; Amann, Markus; Schellnhuber, Hans Joachim



Convective Transport of Very-short-lived Bromocarbons to the Stratosphere  

NASA Technical Reports Server (NTRS)

We use the NASA GEOS Chemistry Climate Model (GEOSCCM) to quantify the contribution of two most important brominated very short-lived substances (VSLS), bromoform (CHBr3) and dibromomethane (CH2Br2), to stratospheric bromine and its sensitivity to convection strength. Model simulations suggest that the most active transport of VSLS from the marine boundary layer through the tropopause occurs over the tropical Indian Ocean, the Western Pacific warm pool, and off the Pacific coast of Mexico. Together, convective lofting of CHBr3 and CH2Br2 and their degradation products supplies 8 ppt total bromine to the base of the Tropical Tropopause Layer (TTL, 150 hPa), similar to the amount of VSLS organic bromine available in the marine boundary layer (7.8-8.4 ppt) in the above active convective lofting regions. Of the total 8 ppt VSLS-originated bromine that enters the base of TTL at 150 hPa, half is in the form of source gas injection (SGI) and half as product gas injection (PGI). Only a small portion (< 10%) the VSLS-originated bromine is removed via wet scavenging in the TTL before reaching the lower stratosphere. On global and annual average, CHBr3 and CH2Br2, together, contribute 7.7 pptv to the present-day inorganic bromine in the stratosphere. However, varying model deep convection strength between maximum and minimum convection conditions can introduce a 2.6 pptv uncertainty in the contribution of VSLS to inorganic bromine in the stratosphere (BryVSLS). Contrary to the conventional wisdom, minimum convection condition leads to a larger BryVSLS as the reduced scavenging in soluble product gases, thus a significant increase in PGI (2-3 ppt), greatly exceeds the relative minor decrease in SGI (a few 10ths ppt.

Liang, Qing; Atlas, Elliot Leonard; Blake, Donald Ray; Dorf, Marcel; Pfeilsticker, Klaus August; Schauffler, Sue Myhre



Climate responses to anthropogenic emissions of short-lived climate pollutants  

NASA Astrophysics Data System (ADS)

Policies to control air quality focus on mitigating emissions of aerosols and their precursors, and other short-lived climate pollutants (SLCPs). On a local scale, these policies will have beneficial impacts on health and crop yields, by reducing particulate matter (PM) and surface ozone concentrations; however, the climate impacts of reducing emissions of SLCPs are less straightforward to predict. In this paper we consider a set of idealised, extreme mitigation strategies, in which the total anthropogenic emissions of individual SLCP emissions species are removed. This provides an upper bound on the potential climate impacts of such air quality strategies. We focus on evaluating the climate responses to changes in anthropogenic emissions of aerosol precursor species: black carbon (BC), organic carbon (OC) and sulphur dioxide (SO2). We perform climate integrations with four fully coupled atmosphere-ocean global climate models (AOGCMs), and examine the effects on global and regional climate of removing the total land-based anthropogenic emissions of each of the three aerosol precursor species. We find that the SO2 emissions reductions lead to the strongest response, with all three models showing an increase in surface temperature focussed in the northern hemisphere high latitudes, and a corresponding increase in global mean precipitation and run-off. Changes in precipitation and run-off patterns are driven mostly by a northward shift in the ITCZ, consistent with the hemispherically asymmetric warming pattern driven by the emissions changes. The BC and OC emissions reductions give a much weaker forcing signal, and there is some disagreement between models in the sign of the climate responses to these perturbations. These differences between models are due largely to natural variability in sea-ice extent, circulation patterns and cloud changes. This large natural variability component to the signal when the ocean circulation and sea-ice are free-running means that the BC and OC mitigation measures do not necessarily lead to a discernible climate response.

Baker, L. H.; Collins, W. J.; Olivié, D. J. L.; Cherian, R.; Hodnebrog, Ø.; Myhre, G.; Quaas, J.; Samset, B. H.



Longitudinal analysis of Plantago: adaptive benefits of iteroparity in a short-lived, herbaceous perennial.  


Theory suggests that iteroparity may confer greater fitness than semelparity in situations in which temporal environmental variation is high and unpredictable. Variable age-specific mortality, density dependence, and other factors may also favor iteroparity over semelparity. Here, we empirically test the adaptive benefits of greater numbers of reproductive years in a study of reproductive schedules in an experimental population of a short-lived polycarpic perennial, Plantago lanceolata. A large experimental population was established that included four cohorts with similar genetic structure. Individuals were censused for mortality, size, and reproduction for seven years. Plants experienced variable numbers of reproductive years, but one or two years were most common (approximately 46.7% of the population reproduced only once). The probability of flowering at least once prior to death was determined strongly by extrinsic, environmental or intrinsic but environmentally influenced variables, including early-life size, cohort, and block, but also varied with a number of interactions involving paternal lineage. Maternal effects explained small but significant components of the variance in the number of reproductive years among individuals in each cohort, while paternal effects were significant in only two cohorts. Number of reproductive years contributed significantly to fitness in this system, more so than all other variables tested, although most of the variation in relative fitness may be attributed ultimately to environmental influences. We suggest that the high proportion of each cohort composed of plants reproducing only once may be due to environmental constraints on either growth or size. Such environmental influences, particularly on early life size, may result in small but important indirect effects on fitness. PMID:20392009

Shefferson, Richard P; Roach, Deborah A




SciTech Connect

For nuclear waste management, an important mechanism by which radioactive waste components are isolated from returning to the human environment, the biosphere, is by the geological barrier in which the effectiveness of the barrier is characterized by in-situ retardation factor, i.e., the transport rate of a radionuclide relative to that of groundwater. As part of natural analog studies of the Yucca Mountain Project of the U. S. Department of Energy, we propose such characterization by using naturally-occurring decay-series radioisotopes as an analog. We collected large-volume (>1000 liters) groundwater samples from three wells (PB, Pozos, and PB4, respectively) near the Nopal I Uranium Ore site at Pena Blanca, Mexico, by using an in-situ Mn-cartridge filtration technique for analysis of short-lived decay-series radionuclides. Results show that the activities of short-lived radioisotopes ({sup 228}Ra, {sup 224}Ra and {sup 223}Ra) and activity ratios of {sup 224}Ra/{sup 228}Ra and {sup 224}Ra/{sup 223}Ra are higher at PB and Pozos than at PB4. In contrast, the {sup 210}Po activity is much lower at PB and Pozos than at PB4. The high Ra activities and activities ratios at PB and Pozos are attributable to the high alpha-recoil input from the aquifer rocks, while the high {sup 210}Po activity at PB4 is due to the enhanced colloidal transport. Based on a uranium-series transport model, we estimate that the in-situ retardation factor of Ra is (0.43 {+-} 0.02) x 10{sup 3} at PB, (1.68 {+-} 0.08) x 10{sup 3} at Pozos, and (1.19 {+-} 0.08) x 10{sup 3} at PB4 and that the mean fracture width in the aquifer rocks is about 0.23 {micro}m at PB, 0.37 {micro}m at Posos, and 4.0 {micro}m at PB4, respectively. The large fracture width at PB4 as derived from the model provides an additional evidence to the inference from the Po measurements that particle-reactive radionuclides are transported mainly as colloidal forms through the large fractures in rocks. Our model also suggests that in addition to alpha recoil, decay of {sup 226}Ra from the adsorbed phases also contributes a significant source of {sup 222}Rn to groundwater. It appears that the information obtained from this study provides useful testing and validation for the Yucca Mountain total system performance assessment model (TSPA).

S. Luo; T.L. Ku; V. Todd; M. Murrell; J. Alfredo Rodriguez Pineda; J. Dinsmoor; A. Mitchell



First Use of High Charge States for Mass Measurements of Short-Lived Nuclides in a Penning Trap  

SciTech Connect

Penning trap mass measurements of short-lived nuclides have been performed for the first time with highly charged ions, using the TITAN facility at TRIUMF. Compared to singly charged ions, this provides an improvement in experimental precision that scales with the charge state q. Neutron-deficient Rb isotopes have been charge bred in an electron beam ion trap to q=8-12+ prior to injection into the Penning trap. In combination with the Ramsey excitation scheme, this unique setup creating low energy, highly charged ions at a radioactive beam facility opens the door to unrivaled precision with gains of 1-2 orders of magnitude. The method is particularly suited for short-lived nuclides such as the superallowed {beta} emitter {sup 74}Rb (T{sub 1/2}=65 ms). The determination of its atomic mass and an improved Q{sub EC} value are presented.

Ettenauer, S.; Gallant, A. T.; Dilling, J. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1 (Canada); Simon, M. C.; Chaudhuri, A.; Mane, E.; Delheij, P.; Pearson, M. R. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Brunner, T. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Physik Department E12, Technische Universitaet Muenchen, D-85748 Garching (Germany); Chowdhury, U. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Department of Physics and Astronomy, University of Manitoba, Winnipeg, MB R3T 2N2 (Canada); Simon, V. V. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); Ruprecht-Karls-Universitaet, Heidelberg (Germany); Brodeur, M. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1 (Canada); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, Michigan 48824 (United States); Andreoiu, C. [Department of Chemistry, Simon Fraser University, Burnaby, BC V5A 1S6 (Canada); Audi, G. [CSNSM-IN2P3-CNRS, Universite Paris 11, 91405 Orsay (France); Lopez-Urrutia, J. R. Crespo; Ullrich, J. [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); Gwinner, G. [Dept. of Physics and Astronomy, Univ. of Manitoba, Winnipeg, MB R3T 2N2 (Canada); Lapierre, A. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); National Superconducting Cyclotron Lab., Michigan State Univ., East Lansing, Michigan 48824 (United States); Lunney, D. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); CSNSM-IN2P3-CNRS, Univ. Paris 11, 91405 Orsay (France); Ringle, R. [National Superconducting Cyclotron Lab., Michigan State Univ., East Lansing, Michigan 48824 (United States)



First Use of High Charge States for Mass Measurements of Short-lived Nuclides in a Penning Trap  

E-print Network

Penning trap mass measurements of short-lived nuclides have been performed for the first time with highly-charged ions (HCI), using the TITAN facility at TRIUMF. Compared to singly-charged ions, this provides an improvement in experimental precision that scales with the charge state q. Neutron-deficient Rb-isotopes have been charge bred in an electron beam ion trap to q = 8 - 12+ prior to injection into the Penning trap. In combination with the Ramsey excitation scheme, this unique setup creating low energy, highly-charged ions at a radioactive beam facility opens the door to unrivalled precision with gains of 1-2 orders of magnitude. The method is particularly suited for short-lived nuclides such as the superallowed {\\beta} emitter 74Rb (T1/2 = 65 ms). The determination of its atomic mass and an improved QEC-value are presented.

S. Ettenauer; M. C. Simon; A. T. Gallant; T. Brunner; U. Chowdhury; V. V. Simon; M. Brodeur; A. Chaudhuri; E. Mané; C. Andreoiu; G. Audi; J. R. Crespo López-Urrutia; P. Delheij; G. Gwinner; A. Lapierre; D. Lunney; M. R. Pearson; R. Ringle; J. Ullrich; J. Dilling



On the ecology of short-lived forbs in chalk grasslands: micro-site tolerances in relation to vegetation structure  

Microsoft Academic Search

Some aspects of vegetation structure in two chalk grasslands were studied throughout the year in relation to the occurrence of some short-lived plant species per life-cycle stage. Whereas the main growth period is in May–June, there is another relatively important growth period in less productive stands in August. When the species are arranged in the order of their tolerance for

H. J. Verkaar; A. J. Schenkeveld; J. M. Brand



Short-lived chlorine-36 in a Ca- and Al-rich inclusion from the Ningqiang carbonaceous chondrite  

PubMed Central

Excesses of sulfur-36 in sodalite, a chlorine-rich mineral, in a calcium- and aluminum-rich inclusion from the Ningqiang carbonaceous chondrite linearly correlate with chorine/sulfur ratios, providing direct evidence for the presence of short-lived chlorine-36 (with a half-life of 0.3 million years) in the early solar system. The best inferred (36Cl/35Cl)o ratios of the sodalite are ?5 × 10-6. Different from other short-lived radionuclides, chlorine-36 was introduced into the inclusion by solid-gas reaction during secondary alteration. The alteration reaction probably took place at least 1.5 million years after the first formation of the inclusion, based on the correlated study of the 26Al-26Mg systems of the relict primary minerals and the alteration assemblages, from which we inferred an initial ratio of (36Cl/35Cl)o > 1.6 × 10-4 at the time when calcium- and aluminum-rich inclusions formed. This discovery supports a supernova origin of short-lived nuclides [Cameron, A. G. W., Hoeflich, P., Myers, P. C. & Clayton, D. D. (1995) Astrophys. J. 447, L53; Wasserburg, G. J., Gallino, R. & Busso, M. (1998) Astrophys. J. 500, L189–L193], but presents a serious challenge for local irradiation models [Shu, F. H., Shang, H., Glassgold, A. E. & Lee, T. (1997) Science 277, 1475–1479; Gounelle, M., Shu, F. H., Shang, H., Glassgold, A. E., Rehm, K. E. & Lee, T. (2001) Astrophys. J. 548, 1051–1070]. Furthermore, the short-lived 36Cl may serve as a unique fine-scale chronometer for volatile-rock interaction in the early solar system because of its close association with aqueous and/or anhydrous alteration processes. PMID:15671168

Lin, Yangting; Guan, Yunbin; Leshin, Laurie A.; Ouyang, Ziyuan; Wang, Daode



Trace elements of coal, coal ashes and fly ashes by activation analysis with short-lived nuclides  

Microsoft Academic Search

On irradiation with neutrons, some of the interesting trace elements in coal, coal ash and fly ash produce short-lived nuclides\\u000a which may be determined—together with some of the matrix elements—by activation analysis. This enables the characterization\\u000a of samples. To find out the distribution of elements in the gaseous or aerosol exhaust of fossil-fired power plants, we simulated\\u000a the combustion in

H. Böck; I. Saraç; F. Grass



Transport and Chemistry of Short-Lived Bromocarbons in the Tropics  

NASA Astrophysics Data System (ADS)

We have developed a detailed chemical scheme for the degradation of the short-lived source gases bromoform (CHBr3) and dibromomethane (CH2Br2) and implemented it in the TOMCAT/SLIMCAT three-dimensional (3D) chemical transport model (CTM). The CTM has been used to predict the distribution of the two source gases (SGs) and 11 of their organic product gases (PGs). These first global calculations of the organic PGs show that their abundance is small. The longest lived organic PGs are CBr2O and CHBrO, but their peak tropospheric abundance relative to the surface volume mixing ratio (vmr) of the SGs is less than 5%. We calculate their mean local tropospheric lifetimes in the tropics to be ~7 and ~2 days (due to photolysis), respectively. Therefore, the assumption in previous modelling studies that SG degradation leads immediately to inorganic bromine seems reasonable. We have compared observed tropical SG profiles from a number of aircraft campaigns with various model experiments. In the tropical tropopause layer (TTL) we find that the CTM run using p levels (TOMCAT) and vertical winds from analysed divergence overestimates the abundance of CH2Br2, and to a lesser extent CHBr3, although the data is sparse and comparisons are not conclusive. Better agreement in the TTL is obtained in the sensitivity run using ? levels (SLIMCAT) and vertical motion from diabatic heating rates. Trajectory estimates of residence times in the two model versions show slower vertical transport in the SLIMCAT ?-level version. In the p-level model even when we switch off convection we still find significant amounts of the SGs considered may reach the cold point tropopause; the stratospheric source gas injection (SGI) is only reduced by ~16% for CHBr3 and ~2% for CH2Br2 without convection. Overall, the relative importance of the SG pathway and the PG pathway for transport of bromine to the stratospheric overworld (?>380 K) has been assessed. Assuming a 10-day washout lifetime of Bry in TOMCAT, we find the delivery of total Br from CHBr3 to be 0.72 pptv with ~53% of this coming from SGI. Similary, for CH2Br2 we find a total Br value of 1.69 pptv with ~94% coming from SGI. We infer that these species contribute ~2.4 pptv of inorganic bromine to the lower stratosphere with SGI being the dominant pathway. Slower transport to and through the TTL would decrease this estimate.

Hossaini, Ryan; Chipperfield, Martyn; Monge-Sanz, Beatriz; Richards, Nigel; Atlas, Elliot; Blake, Donald



Life-history variation in the short-lived herb Rorippa palustris: The role of carbon storage  

NASA Astrophysics Data System (ADS)

Carbon storage is commonly found among perennials, but only rarely in annuals. However, many short-lived species may behave as annuals or short-lived perennials depending on the date of germination, photoperiod or disturbance. Due to the trade-off between investments into current reproduction vs. survival, these life-history modes presumably differ in carbon allocation. In this study, we aimed to evaluate how carbon storage is affected by germination date and disturbance in an outdoor pot experiment with the short-lived Rorippa palustris. Plants from autumnal and summer cohorts were injured in different ontogenetic stages (vegetative, flowering and fruiting) and the starch content in roots was assessed. Plants from the autumnal cohort invested more carbon into growth and reproduction, whereas plants from the summer cohort invested preferentially into reserves. However, injury changed the allocation pattern: in plants from the autumnal cohort, injury prevented allocation to reproduction and thus injured plants had a larger carbon storage at the end of the season than control plants; injury at the flowering and fruiting stage caused depletion of reserves for regrowth in plants from the summer cohort, resulting in lower starch reserves compared to control plants. We suggest that life-history variation in R. palustris can be caused by changes in its carbon economy: when all resources could not be used for flowering due to weak photoinduction or loss of flowering organs due to injury, part of the resources is stored for over wintering and reproduction in the next year.

Sosnová, Monika; Klimešová, Jitka



Detailed modeling of the atmospheric degradation mechanism of very-short lived brominated species  

NASA Astrophysics Data System (ADS)

Detailed chemical reaction schemes for the atmospheric degradations of the very short-lived species (VSLS) bromoform (CHBr3) and dibromomethane (CH2Br2) have been established. These degradation schemes have been implemented in the meteorological/tracer transport model CATT-BRAMS used in the present case as pseudo one-dimensional model with chemistry of CH4, CO, HOx, NOx, NOy and Ox. They include the main possible reactions of the intermediate brominated peroxy radicals RO2 (with R = CH2Br, CHBr2 and CBr3) for which the most likely reaction pathways with HO2 have been found using ab initio computational calculations. The full degradation schemes have been run for two well-defined realistic scenarios, “clean” atmosphere and “moderately” NOy-polluted atmosphere, as representative of a tropical coastal region where these VSLS natural emissions are expected to be important. The Henry's law constants of the brominated organics products have been estimated by using the Bond Contribution Method (BCM; Meylan and Howard, 1991) or the Molecular Connectivity Index (MCI; Nirmalakhandan and Speece, 1988). Using these constants, the least soluble species formed from the VSLS degradation are found to be CBr2O, CHBrO, CBr3O2NO2, CHBr2O2NO2, BrO, BrONO2 and HOBr, which leads those to be potentially transported into the tropical tropopause layer (TTL) in case of deep convection and contribute to stratospheric bromine additionally to the original substances. For bromoform and dibromomethane degradation, the moderate NOy pollution increases the production of the least soluble species and thus approximately doubles the bromine quantity potentially able to reach the TTL (from 22.5% to 43% for CHBr3 and from 8.8% to 20.2% for CH2Br2). The influence of the reactions of the RO2 radicals with HO2, CH3O2 and NO2 on the nature and abundance of the stable intermediate and end-products has been tested for CHBr3 degradation. As a result, the reactions of the RO2 radicals with NO2 have no impact. Taking into account the reaction between RO2 and CH3O2 and modifying the branching ratios of the reaction between RO2 and HO2 lead to a small impact on the bromoform degradation by slightly decreasing (by 10%) the bromine quantity potentially able to reach the TTL. As a final point, in contrast to CHBr3, CH2Br2 degradation produces negligible quantities of organics species and the effects of pollution increase only the inorganic species production. By taking into account the results of these tests, new simplified degradation schemes for CHBr3 and CH2Br2 are proposed.

Krysztofiak, G.; Catoire, V.; Poulet, G.; Marécal, V.; Pirre, M.; Louis, F.; Canneaux, S.; Josse, B.



Global Modeling and Projection of Short-Lived Climate Pollutants in an Earth System Model  

NASA Astrophysics Data System (ADS)

In predicting and mitigating future global warming, short-lived climate pollutants (SLCPs) such as tropospheric ozone (O3), black carbon (BC), and other related components including CH4/VOCs and aerosols play crucial roles as well as long-lived species like CO2 or N2O. Several recent studies suggests that reduction of heating SLCPs (i.e., O3 and black carbon) together with CH4 can decrease and delay the expected future warming, and can be an alternative to CO2 mitigation (Shindell et al., 2012). However it should be noted that there are still large uncertainties in simulating SLCPs and their climate impacts. For instance, present global models generally have a severe tendency to underestimate BC especially in remote areas like the polar regions as shown by the recent model intercomparison project under the IPCC (ACCMIP/AeroCOM). This problem in global BC modeling, basically coming from aging and removal processes of BC, causes still a large uncertainty in the estimate of BC's atmospheric heating and climate impacts (Bond et al., 2013; Kerr et al., 2013). This study attempted to improve global simulation of BC by developing a new scheme for simulating aging process of BC and re-evaluate radiative forcing of BC in the framework of a chemistry-aerosol coupled climate model (Earth system model) MIROC-ESM-CHEM. Our improved model with the new aging scheme appears to relatively well reproduce the observed BC concentrations and seasonality in the Arctic/Antarctic region. The new model estimates radiative forcing of BC to be 0.83 W m-2 which is about two times larger than the estimate by our original model with no aging scheme (0.41 W m-2), or the model ensemble mean in the IPCC report. Using this model, future projection of SLCPs and their climate impacts is conducted following the recent IIASA emission scenarios for the year 2030 (Klimont et al., 2006; Cofala et al., 2007). Our simulation suggests that heating SLCPs components (O3, BC, and CH4) are significantly reduced in the maximal feasible reduction (MFR) scenario, contributing to global mean temperature reduction by about -0.25 oC after 2030. This heating-SLCPs-induced warming mitigation in MFR is, however, largely cancelled out by the temperature increase due to decreases in cooling aerosols (SO42-, NO3-, and organics), resulting in temperature projection which is not quite different from the other scenarios like CLE (current legislation for air quality) or 450ppm climate stabilization (intermediate reduction) scenario. References Bond et al. (2013): Bounding the role of black carbon in the climate system: A scientific assessment, J. Geophys. Res., 118, 5380-5552, doi:10.1002/jgrd.50171, 2013. Cofala et al. (2007): Scenarios of global anthropogenic emissions of air pollutants and methane until 2030, Atmos. Environ., 41, 8486-8499. Kerr et al. (2013): Soot is warming the world even more than thought, Science, 339, 382, doi: 10.1126/science.339.6118.382. Klimont, Z., Brink, C. (2006): Modelling of Emissions of Air Pollutants and Greenhouse Gases from Agricultural Sources in Europe. International Institute for Applied Systems Analysis (IIASA), Laxenburg, Austria. Shindell et al. (2012): Simultaneously Mitigating Near-Term Climate Change and Improving Human Health and Food Security, Science, 335, 183-189, doi: 10.1126/science.1210026.

Sudo, K.; Takemura, T.; Klimont, Z.; Kurokawa, J.; Akimoto, H.



Determination of sterols, estrogens and inorganic ions in waste water and size-segregated aerosol particles emitted from waste water treatment  

Microsoft Academic Search

Concentrations of steroids and inorganic ions were measured in waste water of an aerated sand trap as well as in aerosol particles emitted from this tank at the waste water treatment plant (WWTP) of Bayreuth, Germany, in January and February 2003. The investigations comprised seven sterols, two estrogens, and several inorganic ions. Since an appropriate method for the determination of

Melanie Beck; Michael Radke



Studies of images of short-lived events using ERTS data. [forest fires, oil spills, vegetation damage, volcanoes, storm ridges, earthquakes, and floods  

NASA Technical Reports Server (NTRS)

The author has identified the following significant results. Detection of short-lived events has continued. Forest fires, oil spills, vegetation damage, volcanoes, storm ridges, earthquakes, and floods have been detected and analyzed.

Deutschman, W. A. (principal investigator)



Observation of the production of short-lived particles in a high-resolution streamer-chamber experiment  

SciTech Connect

Short-lived particles produced in association with muons have been observed in the interactions of 350-GeV/c protons with neon in a high-resolution streamer chamber. The characteristics of these events are consistent with the expected properties of charmed particles if the average lifetime lies between 10/sup -13/ and 2 x 10/sup -12/ sec. With the assumption that the observed events are mainly D/sup + -/ mesons with lieftimes of approximately 10/sup -12/ sec, the production cross section is estimated to lie between 20 and 50 per nucleon.

Sandweiss, J.; Cardello, T.; Cooper, P.; Dhawan, S.; Kellogg, R.; Ljung, D.; Ludlam, T.; Majka, R.; McBride, P.; Nemethy, P.; Rosselet, L.; Slaughter, A.J.; Taft, H.D.; Teig, L.; Tzeng, L.; Ecklund, S.; Johnson, M.



Calpain-generated natural protein fragments as short-lived substrates of the N-end rule pathway  

PubMed Central

Calpains are Ca2+-dependent intracellular proteases. We show here that calpain-generated natural C-terminal fragments of proteins that include G protein–coupled receptors, transmembrane ion channels, transcriptional regulators, apoptosis controllers, kinases, and phosphatases (Phe-GluN2a, Lys-Ica512, Arg-Ankrd2, Tyr-Grm1, Arg-Atp2b2, Glu-Bak, Arg-Igfbp2, Glu-I?B?, and Arg-c-Fos), are short-lived substrates of the Arg/N-end rule pathway, which targets destabilizing N-terminal residues. We also found that the identity of a fragment’s N-terminal residue can change during evolution, but the residue’s destabilizing activity is virtually always retained, suggesting selection pressures that favor a short half-life of the calpain-generated fragment. It is also shown that a self-cleavage of a calpain can result in an N-end rule substrate. Thus, the autoprocessing of calpains can control them by making active calpains short-lived. These and related results indicate that the Arg/N-end rule pathway mediates the remodeling of oligomeric complexes by eliminating protein fragments that are produced in these complexes through cleavages by calpains or other nonprocessive proteases. We suggest that this capability of the Arg/N-end rule pathway underlies a multitude of its previously known but mechanistically unclear functions. PMID:24550490

Piatkov, Konstantin I.; Oh, Jang-Hyun; Liu, Yuan; Varshavsky, Alexander



Actinium-225 in targeted alpha-particle therapeutic applications.  


Alpha particle-emitting isotopes are being investigated in radioimmunotherapeutic applications because of their unparalleled cytotoxicity when targeted to cancer and their relative lack of toxicity towards untargeted normal tissue. Actinium- 225 has been developed into potent targeting drug constructs and is in clinical use against acute myelogenous leukemia. The key properties of the alpha particles generated by 225Ac are the following: i) limited range in tissue of a few cell diameters; ii) high linear energy transfer leading to dense radiation damage along each alpha track; iii) a 10 day halflife; and iv) four net alpha particles emitted per decay. Targeting 225Ac-drug constructs have potential in the treatment of cancer. PMID:22202153

Scheinberg, David A; McDevitt, Michael R



Direct high-resolution alpha spectrometry from nuclear fuel particles in an outdoor air sample.  


The potential use of direct high-resolution alpha spectrometry to identify the presence of transactinium elements in air samples is illustrated in the case when alpha-particle-emitting radionuclides are incorporated in nuclear fuel particles. Alpha particle energy spectra are generated through Monte Carlo simulations assuming a nuclide composition similar to RBMK (Chernobyl) nuclear fuel. The major alpha-particle-emitting radionuclides, in terms of activity, are 242Cm, 239Pu and 240Pu. The characteristics of the alpha peaks are determined by fuel particle properties as well as the type of the air filter. It is shown that direct alpha spectrometry can be readily applied to membrane filter samples containing nuclear fuel particles when rapid nuclide identification is of relevance. However, the development of a novel spectrum analysis code is a prerequisite for unfolding complex alpha spectra. PMID:17951235

Pöllänen, R; Siiskonen, T



SProtP: A Web Server to Recognize Those Short-Lived Proteins Based on Sequence-Derived Features in Human Cells  

PubMed Central

Protein turnover metabolism plays important roles in cell cycle progression, signal transduction, and differentiation. Those proteins with short half-lives are involved in various regulatory processes. To better understand the regulation of cell process, it is important to study the key sequence-derived factors affecting short-lived protein degradation. Until now, most of protein half-lives are still unknown due to the difficulties of traditional experimental methods in measuring protein half-lives in human cells. To investigate the molecular determinants that affect short-lived proteins, a computational method was proposed in this work to recognize short-lived proteins based on sequence-derived features in human cells. In this study, we have systematically analyzed many features that perhaps correlated with short-lived protein degradation. It is found that a large fraction of proteins with signal peptides and transmembrane regions in human cells are of short half-lives. We have constructed an SVM-based classifier to recognize short-lived proteins, due to the fact that short-lived proteins play pivotal roles in the control of various cellular processes. By employing the SVM model on human dataset, we achieved 80.8% average sensitivity and 79.8% average specificity, respectively, on ten testing dataset (TE1-TE10). We also obtained 89.9%, 99% and 83.9% of average accuracy on an independent validation datasets iTE1, iTE2 and iTE3 respectively. The approach proposed in this paper provides a valuable alternative for recognizing the short-lived proteins in human cells, and is more accurate than the traditional N-end rule. Furthermore, the web server SProtP ( has been developed and is freely available for users. PMID:22114707

Song, Xiaofeng; Zhou, Tao; Jia, Hao; Guo, Xuejiang; Zhang, Xiaobai; Han, Ping; Sha, Jiahao



The ``Aerogel'' Model for the Origin of the Short-Lived Radionuclides in the Early Solar System  

NASA Astrophysics Data System (ADS)

Isotopic analyses of meteorites have revealed that our Solar System contained a number of live short-lived radionuclides at its birth. These include {}41Ca (t1/2 = 0.10 Myr), {}36Cl (0.30 Myr), {}26Al (0.71 Myr), {}10Be (1.5 Myr), {}60Fe (1.5 Myr), {}53Mn (3.7 Myr), {}107Pd (6.5 Myr), {}129I (15.7 Myr), and {}182Hf (9 Myr). The radionuclide {}10Be, which must be created by spallation reactions, is known to be decoupled in meteorites from the other radionuclides, and must have a separate origin that predates the Solar System. Its origin has been attributed to trapping of {}10Be Galactic cosmic rays in the Sun's molecular cloud core (Desch et al. 2004; ApJ 602, 528). The most plausible explanation for the other radionuclides is a nearby supernova. Most models of injection of supernova radioactivities into the early Solar System hypothesize that the supernova triggered the collapse of the Sun's molecular cloud core. Chevalier (2000; ApJ 538, L151) has suggested instead that the supernova occurred after the Sun's protoplanetary disk had formed, and at a distance of < 1 pc, in analogy to the proplyds observed in the Orion Nebula only a few tenths of a parsec from ? 1 Ori C. We use meteoritical and astrophysical evidence to argue that this is by far the most plausible scenario for how the Solar System acquired its short-lived radionuclides. We hypothesize that radionuclides in the supernova ejecta condensed into grains which were then injected into our protoplanetary disk; there they were stopped like dust grains lodged in aerogel. Because of the proximity of the disk to the supernova, a key prediction of this ``aerogel'' model is the presence of very short-lived radionuclides in the early Solar System (< 104 yr). We discuss the recent, tentative evidence for live {}63Ni (t1/2 = 101 yr) in the early Solar System (Luck et al. 2003; GCA 67, 143) in this context, and discuss the effect of the injected radioactivities on the ionization state of the solar nebula.

Desch, S. J.; Ouellette, N.; Hester, J. J.; Leshin, L. A.



Development and Application of A Membrane-Based Thermodenuder for Measurement of Volatile Particles Emitted by A Jet Turbine Engine  

SciTech Connect

Measurement of volatile particles emitted by modern jet engines is a daunting task. Besides the complexity in sampling jet aircraft exhaust, the main difficulty lies at how to faithfully capture the phase-partition dynamics of volatile particles as they travel downstream from the engine exhaust nozzle. As a result, the physico-chemical properties of the exhaust are also transformed. We have developed a sampling instrument that aims at enabling study of the phase-partition dynamics. The objective of this research project was to design and evaluate a new thermodenuder for performing phase separation of the engine-emitted volatile particles. The backbone of the new thermodenuder is a thin metallic membrane. The membrane enables extraction of molecules that can be thermally desorbed from the condensed particulate phases and collected for subsequent chemical analysis. Toward realization of the technique in the future field aircraft emissions measurement we tested this new thermo-denuding device using laboratory-generated particles that were made of non-volatile or semi-volatile chemicals. The particle penetration efficiency, a measure of the device performance, of this thermodenuder was found to be better than 99%. Results obtained from the tests executed at a number of operating temperature conditions show reasonably good thermal separation. We have scheduled to apply this new device to characterize emissions from a T63 turboshaft engine in the spring of 2010 and are expecting to show the engine results at the conference. The test results based on the laboratory-generated particles were encouraging for the intended application. With excellent particle transmission efficiency and an ability to simultaneously measure the composition in the gas and particle phases of the engine particles, we believe the new technology will make a great contribution to measurement research of engine emissions.

Cheng, Mengdawn [ORNL



Nuclear Moments and Differences in Mean Square Charge Radii of Short-Lived Neon Isotopes by Collinear Laser Spectroscopy  

E-print Network

The nuclear moments and charge radii of short-lived neon isotopes were measured by the use of collinear laser spectroscopy at the on-line mass separator ISOLDE at CERN. After a general introduction the semiclassical theory of atomic spectra is given and the relevant properties are calculated for neon. The atomic physics section is followed by a description of the experimental setup of the collinear laser spectroscopy experiment at ISOLDE. From the mass separator an isotopically clean ion beam with a kinetic energy of 60 keV is delivered to the experiments. In collinear laser spectroscopy the incoming ion beam from the mass separator is superimposed to a single frequency cw laser beam. The frequency of the atomic transition $\

Geithner, R W



Clinical applications of a pressurized xenon wire chamber gamma camera utilizing the short lived agent 178Ta  

NASA Astrophysics Data System (ADS)

A pressurized xenon wire chamber camera has been developed for applications in nuclear medicine. The device employs a high speed delay-line readout and digital processing system providing a peak count rate of 850 000 cps, spatial resolution of 2.5 mm and highly uniform imaging characteristics. A short-lived generator produced radionuclide, 178Ta, having an emission energy of 55-65 keV has also been developed. It provides greatly reduced radiation dosimetry compared with any commercial isotope in current use and is imaged very effectively with the wire chamber camera. Performance of this camera and isotope for first-pass radionuclide assessment of cardiac function compares favorably with the accepted standard of this technique, the multicrystal gamma camera and 99mTc. Currently ongoing studies in exercise cardiac assessment, bedside imaging in myocardial infarction patients and pediatric cardiac imaging, point the way to unique applications of this technology in cardiology.

Lacy, J. L.; Verani, M. S.; Ball, M. E.; Roberts, R.



Transport of very short-lived substances into the tropical upper troposphere and lower stratosphere: A modeling study  

NASA Astrophysics Data System (ADS)

The transport of very short-lived substances (VSLS) into the tropical upper troposphere and lower stratosphere (UTLS) is investigated by a three-dimensional chemical transport model using archived convective updraft mass fluxes from the European Centre for Medium-Range Weather Forecast's ERA-Interim reanalysis. Large-scale vertical velocities are calculated from diabatic heating rates. With this approach we explicitly model the large scale subsidence in the tropical troposphere with convection taking place in fast and isolated updraft events. The model calculations agree generally well with observations of bromoform and methyl iodide from aircraft campaigns and with ozone and water vapor from sonde and satellite observations. We furthermore analyze the long-term transport of VSLS into the UTLS and its dependencies on regional emissions and convective activity over the whole ERA-Interim period.

Aschmann, Jan; Sinnhuber, Björn-Martin



Prompt gamma activation analysis (PGAA) and short-lived neutron activation analysis (NAA) applied to the characterization of legacy materials  

SciTech Connect

Without quality historical records that provide the composition of legacy materials, the elemental and/or chemical characterization of such materials requires a manual analytical strategy that may expose the analyst to unknown toxicological hazards. In addition, much of the existing legacy inventory also incorporates radioactivity, and, although radiological composition may be determined by various nuclear-analytical methods, most importantly, gamma-spectroscopy, current methods of chemical characterization still require direct sample manipulation, thereby presenting special problems with broad implications for both the analyst and the environment. Alternately, prompt gamma activation analysis (PGAA) provides a'single-shot' in-situ, non-destructive method that provides a complete assay of all major entrained elemental constituents.1-3. Additionally, neutron activation analysis (NAA) using short-lived activation products complements PGAA and is especially useful when NAA activation surpasses the PGAA in elemental sensitivity.

Firestone, Richard B; English, G.A.; Firestone, R.B.; Perry, D.L.; Reijonen, J.P.; Leung, Ka-Ngo; Garabedian, G.F.; Molnar, G.L.; Revay, Zs.



Identifying and quantifying short-lived fission products from thermal fission of HEU using portable HPGe detectors  

SciTech Connect

Due to the emerging potential for trafficking of special nuclear material, research programs are investigating current capabilities of commercially available portable gamma ray detection systems. Presented in this paper are the results of three different portable high-purity germanium (HPGe) detectors used to identify short-lived fission products generated from thermal neutron interrogation of small samples of highly enriched uranium. Samples were irradiated at the Washington State University (WSU) Nuclear Radiation Center’s 1MW TRIGA reactor. The three portable, HPGe detectors used were the ORTEC MicroDetective, the ORTEC Detective, and the Canberra Falcon. Canberra’s GENIE-2000 software was used to analyze the spectral data collected from each detector. Ultimately, these three portable detectors were able to identify a large range of fission products showing potential for material discrimination.

Pierson, Bruce D.; Finn, Erin C.; Friese, Judah I.; Greenwood, Lawrence R.; Kephart, Jeremy D.; Kephart, Rosara F.; Metz, Lori A.



The life span of short-lived plasma cells is partly determined by a block on activation of apoptotic caspases acting in combination with endoplasmic reticulum stress.  


Apoptosis of short-lived plasma cells after a few days of intense immunoglobulin secretion is critical for maintaining a controlled humoral immune response. The mechanisms that regulate this process are poorly understood. Here we report that the key apoptotic caspases, caspase-3 and caspase-9, become resistant to activation by apoptotic stimuli when B cells differentiate into short-lived plasma cells. As a consequence, apoptosis of most short-lived plasma cells in vitro and in vivo is effector caspase-independent. We also show that a triaspartic acid repeat that normally prevents activation of caspase-3 becomes stabilized in short-lived plasma cells and myeloma cell lines. The block on caspase activation occurs before the accumulation of intracellular immunoglobulins and a progressive rise in secretory stress in the endoplasmic reticulum (ER). Plasma cells show increased susceptibility to ER stress-induced apoptosis and activate the ER-associated caspase-12, which is required specifically for nuclear apoptotic events. In nonlymphoid cells that cannot activate effector caspases, programmed cell death is delayed in response to ER stress. These observations suggest that the block on activation of key apoptotic caspases has evolved in short-lived plasma cells to prolong survival under conditions of ER stress resulting from high-level immunoglobulin secretion. PMID:20651073

Auner, Holger W; Beham-Schmid, Christine; Dillon, Niall; Sabbattini, Pierangela



Thyroid cancer in the Marshallese: relative risk of short-lived internal emitters and external radiation exposure  

SciTech Connect

In a study of the comparative effects of internal versus external irradiation of the thyroid in young people, we determined that the dose from internal irradiation of the thyroid with short-lived internal emitters produced several times less thyroid cancer than did the same dose of radiation given externally. We determined this finding for a group of 85 Marshall Islands children, who were less than 10 years of age at the time of exposure and who were accidentially exposed to internal and external thyroid radiation at an average level of 1400 rad. The external risk coefficient ranged between 2.5 and 4.9 cancers per million person-rad-years at risk, and thus, from our computations, the internal risk coefficient for the Marshallese children was estimated to range between 1.0 and 1.4 cancers per million person-rad-years at risk. In contrast, for individual more than 10 years of age at the time of exposure, the dose from internal irradiation of the thyroid with short-lived internal emitters produced several times more thyroid cancer than did the same dose of radiation given externally. The external risk coefficients for the older age groups were reported in the literature to be in the range of 1.0 to 3.3 cancers per million person-rad-years-at risk. We computed internal risk coefficients of 3.3 to 8.1 cancers per million person-rad-years at risk for adolescent and adult groups. This higher sensitivity to cancer induction in the exposed adolescents and adults, is different from that seen in other exposed groups. 14 refs., 8 tabs.

Lessard, E.T.; Brill, A.B.; Adams, W.H.



Impact of Very Short-live Halogens on Stratospheric Ozone Abundance (and UV radiation) in a Geo-engineered Atmosphere  

NASA Astrophysics Data System (ADS)

In this study we used the Whole Atmosphere Community Climate Model (WACCM) to explore the impact of very short-lived (VSL) bromocarbons on stratospheric ozone abundance and surface UV radiation under the influence of geoengineered aerosols. VSL bromocarbons have by definition a chemical lifetime of less than 0.5 years (WMO, 2006). In contrast to long-lived bromocarbons (e.g., CH3Br plus halons), these VSL bromocarbons have natural sources (e.g., oceanic emissions) and their abundance will therefore not decrease in the future due to international protocols. They are eventually oxidized via reactions with OH and photolysis to form inorganic bromine product gases and get transported into the stratosphere. Observations suggest that VSL bromocarbons add an additional 4-10 pptv volume mixing ratios to the total stratospheric inorganic bromine abundance. Since inorganic bromine is ~60 times more efficient (relative to inorganic chlorine) at catalytic destroying ozone, this additional inorganic bromine loading could significantly affect stratospheric ozone. This is especially true in the Arctic, where the coupled BrO/ClO catalytic ozone loss cycle is as important as the ClO dimer ozone loss cycle. The chemical activation of chlorine is highly dependent on the amount of sulfate aerosol and VSL bromine provides a reaction partner for activated chlorine, resulting in a significant increase of ozone depletion in a geo-engineered aerosol environment in high latitudes. An additional impact of short-lived bromocarbons on the ozone abundance is expected and was not considered in earlier studies.

Tilmes, Simone; Kinnison, Doug; Garcia, Rolando; Salawitch, Ross; Lee-Taylor, Julia



Novel biogenic iodine-containing trihalomethanes and other short-lived halocarbons in the coastal East Atlantic  

NASA Astrophysics Data System (ADS)

Reactive halogen photochemistry and its impact on tropospheric oxidant levels have recently attracted intense research interest following the observation of the iodine oxide radical at midlatitudes. During September 1998, short-lived organoiodines including CH3I, C2H5I, CH2ICl, CH2IBr, CH2I2, and the hitherto undetected CHIBr2, as well as the organobromines CHBr3, CH2Br2, CHBr2Cl, CH3Br, and C2H5Br, were measured in air and seawater at and around Mace Head, on the west coast of Ireland. The release rates of organic bromines and iodines from seaweeds were determined from incubations of 10 species of brown, red, and green macroalgae collected in the intertidal or subtidal zones of the rocky shore. For all the brown algae studied, iodine was released mainly as CH2I2. However, for several seaweeds, the novel iodine-containing trihalomethanes CHIBr2 and CHI2Cl represented a significant fraction of the released organic iodine. The macroalgae incubation experiments as well as monitoring of the in situ concentrations in a rock pool indicated that natural halocarbon production by seaweeds was stimulated by incident light. The halocarbon fluxes derived from the seaweed incubations, coupled with published detailed biomass surveys, enabled coastal organohalogen seawater concentrations to be estimated. The CHBr3, CH2Br2, and CHBr2Cl concentrations calculated by this method compared well with coastal surface seawater measurements, implying that macroalgae were the major sources of the polybromomethanes. Measured CH3Br, CH3I, and CH2ICl levels were higher than calculated, which may be due to the existence of additional sources. CH3Br production by macroalgae accounted for less than 10% of measured levels in coastal waters. Short-lived iodocarbons such as CH2I2 and CHIBr2 were depleted in surface seawater compared to calculated levels, implying their photolytic loss within the upper water column.

Carpenter, L. J.; Malin, G.; Liss, P. S.; Küpper, F. C.



Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha-particle therapy applications  

PubMed Central

Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225Ac to potently and specifically affect cancer. PMID:18514364

Miederer, Matthias; Scheinberg, David A.; McDevitt, Michael R.



Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha particle therapy applications.  


Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225 Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209 Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225 Ac to potently and specifically affect cancer. PMID:18514364

Miederer, Matthias; Scheinberg, David A; McDevitt, Michael R



Cross Sections Needed for the Interpretation of Long-Lived and Short-Lived Cosmogenic Nuclide Production in Extraterrestrial Materials  

NASA Astrophysics Data System (ADS)

Radionuclides produced by cosmic rays in extraterrestrial materials archive information that can be used to determine cosmic-ray fluxes and to study the history of the irradiated object. Long-lived radionuclides give information about the last ~5 Myr; short-lived radionuclides give information about recent events. To calculate the solar cosmic ray (SCR) flux from measured depth profiles for cosmogenic radionuclides produced in lunar rocks, accurate and precise cross section values for the production of these radionuclides from all relevant elements are needed. About 98% of SCR and ~87% of galactic cosmic rays (GCR) falling on extraterrestrial materials are protons. Cross section measurements were made using three proton accelerators to cover the energy range ~20 - 500 MeV. Thin target techniques used in the irradiations minimized the number of protons scattered out of the stack and the neutron production within the stack. After irradiation, the short-lived radionuclides e.g. 22Na, 7Be, 24Na, 54Mn, and 56Co were determined using gamma-ray spectroscopy. 14C, 10Be, and 26Al were determined using Accelerator Mass Spectrometry. Our main objective is to measure the production cross sections of long-lived radionuclides. We have reported new cross section values for making 10Be from O and 14C from O, Mg, Al, Si, Fe, and Ni [1,2]. Using these new results, better estimates for the solar proton flux over several time periods in the past were determined [3]. However, no single value for the SCR flux could explain the measured data from different time periods. Further cross section measurements are being made to verify that the values used in these estimates were accurate. Irradiations designed to give good cross section measurements for long-lived radionuclides also give good cross section measurements for short-lived radionuclides. Results will be presented for proton production cross sections of 22Na from Mg, Al and Si, and 54Mn and 56Co from Fe and Ni; some values at low energies were reported previously [4]. These cross sections and other reported measurements [5, 6] will be used to improve the estimates of the recent SCR fluxes from the depth profiles for 22Na measured in lunar rocks [7, 8], and to better understand the SCR cosmogenic radionuclide production observed in Salem [9] and other other extraterrestrial materials. References: [1] Sisterson J. M. et al. (1992) LPS XXIII, 1305. [2] Sisterson J. M. et al. (1995) LPS XXVI, 1309. [3] Rao M. N. et al. (1994) GCA, 58, 4231. [4] Beverding A. M. et al. (1994) USGS Circular 1107, 29. [5] Michel R. and Stueck R. (1984) Proc. LPSC 14th, in JGR, 89, B673. [6] Bodemann R. et al. (1993) Nucl. Instr. Meth. Phys. Res., B82, 9. [7] Reedy R. C. (1977) Proc. LSC 8th, 825. [8] Fruchter J. S. et al. (1982) LPS XIII, 243. [9] Evans J. C. et al. (1987) LPS XVIII, 271.

Sisterson, J. M.; Beverding, A.; Kim, K. J.; Englert, P. A. J.; Jull, A. J. T.; Donahue, D. J.; Cloudt, S.; Castaneda, C.; Vincent, J.; Caffee, M. W.; Osazuwa, C. O.; Reedy, R. C.



Effects of East Asian Short-lived Anthropogenic Air Pollutants on the Northern Hemispheric Air Quality and Climate  

NASA Astrophysics Data System (ADS)

Short-lived anthropogenic pollutants (such as ozone and aerosols) not only degrade ambient air quality and influence human health, but also play an important role in scattering/absorbing atmospheric radiation and disturbing regional climate. Due to the rapid industrialization, anthropogenic emissions from East Asia (EA) have increased substantially during the past decades. At the same time, EA has experienced a changing climate in terms of surface temperature and precipitation. In order to understand to what extent that EA short-lived anthropogenic emissions could influence domestic and downwind air quality (e.g. surface O3 and PM2.5), and explore the potential linkage between hemispheric-scale climate perturbation and regional anthropogenic forcing, we simulate global climate and chemical compositions during 1981-2000 based on the coupled general circulation model CM3 for atmosphere (with interactive tropospheric and stratospheric chemistry), oceans, land and sea ice, recently developed at Geophysical Fluid Dynamics Laboratory (GFDL/NOAA). We also conduct a parallel sensitivity simulation which is identical to the base simulation but with all anthropogenic emissions over EA turned off. The difference between the base and sensitivity simulations represents the short-term response of the Northern Hemispheric climate system and atmospheric composition to the perturbation of regional anthropogenic forcing. We find that East Asian short-lived anthropogenic emissions exert significant adverse impacts on local air quality during 1981-2000, accounting for 10-30ppbV daily-averaged O3 over Eastern China in JJA. In particular, EA anthropogenic emissions elevate the summertime daily maximum 8-hour average ozone (MDA8 O3) by 30-40ppbV over the North China Plain, where the typical background MDA8 ozone ranges 30 to 45ppbV. In addition, the surface PM2.5 concentrations peak at the same season and over the same region, with a seasonal mean of 10-30ug/m3, mostly contributed from local anthropogenic sources. In terms of long-range transport, anthropogenic pollutants from EA generally account for 2-5ppbv surface ozone from east to west mid-latitude North Pacific, but with distinct seasonal variability. During spring, EA anthropogenic emissions enhance nearly 2ppbV ozone over the west coast of California, USA, which increases the number of days when MADA8 exceeds 75ppbV by 2~5days/season in JJA. We find that the high aerosol loadings over EA significantly elevate aerosol optical depth (AOD) over Eastern China (0.2-0.4 in DJF and 0.3-0.5 in JJA), which warms up the atmosphere (15~20 Watts/m2) at the expense of cooling the surface (-30~-20 Watts/m2), potentially reducing the local surface temperature by -0.5K ~ -2K. Moreover, our model results also show that EA anthropogenic pollutants significantly depress local precipitation rate (up to 1.5 mm/day) and rain frequency (4-10 days/season), particularly over South and Southwestern China. This may partly explain the change of seasonal precipitation patterns over EA during the past decades.

Liu, J.; Horowitz, L. W.; Lau, N.; Fan, S.; Tao, S.; Mauzerall, D. L.; Levy, H.



Transformations of long-living and short-living gaseous pollutants in the atmosphere of urban regions  

NASA Astrophysics Data System (ADS)

The research was devoted to the problem of estimation of chemical transformations of source species and atmospheric species in high-polluted areas. Box Air Quality Model (BAQM offline) was developed to estimate degree of influence of different species on atmospheric processes by analysis of chemical transformation and consequently lifetimes of these species, i.e. how long a representative molecule of the substance will stay in the atmosphere before it is chemically removed. Preliminary study of chemical mechanisms of Global and Regional weather forecast models with chemical branch (Enviro-HIRLAM, WRF, ALADIN, ECMWF GEMS) helped to develop a universal chemical mechanism for BAQM. The new mechanism describes chemical reaction pathways for the troposphere and lower stratosphere and can be implemented at regional and global scales. The mechanism was developed using lumping technique on the basis of RACM mechanism. Aggregation of primary species into lumped species is based on their reactivities and emission rates. The different chemical solvents were used to simulate change of production and destruction. As initial conditions BAQM considers both biogenic and anthropogenic emissions. Lifetime calculations show that "long-living" gases demand special attention since make the greatest impact on global atmospheric processes. Such species well mix in the atmosphere and can transport for long distances from the source of emissions. "Short-living" species can affect regional processes especially in the urban polluted areas where concentration of polluted species is high. So, in such regions (large cities, industrial areas, megacities) there are high concentrations of O3, NOx, but air quality depends on distribution of these concentrations in observing region. According to the simulations we define "long-living" species: SO2, N2, CH4, CO, H2, H2O (above 70hPa), H2O2, HCl and "short-living" species: O3, O(3P), O(1D), H2, HNO3, OH, HO2, CH3, CH3O2, CH3OOH, N, NO, NO2, NO3, Cl, Br2, BrO Some gases such as NOx can be short-living and long-living simultaneously. Its behavior depends on different atmospheric conditions, concentrations of other gases such as OH and O3, time of the day or model domain. It should be taken into account at chemical modeling to define which species will dominate in horizontal or vertical transport. The BAQM model confirms strong dependence of O3 on HOx. It is happened because each O3 molecule crossing the tropopause can yield at most two OH molecules in the troposphere. However, the concentrations and lifetimes depend on period of the day also. There isn't any production or loss due to photolysis reactions at night, but at daytime the photolysis plays an important role. The larger hydrocarbons have smaller global sources than CH4 and are therefore less important than CH4 for global tropospheric chemistry. They are however critical for rapid production of O3 in polluted regions, and play also an important role in the long-range transport of NOx. Hence, chemical feedbacks are very important mechanisms in the atmosphere of urban areas. Since the amount of chemically active species in the atmosphere increase due to emissions from the surface layer the conditions for chemical transformations in the upper troposphere change. Consequently, the emissions of chemically active species from polluted surface areas to the atmosphere increase (positive feedback) or the emission of chemically active species to the atmosphere decrease (negative feedback). Box Air Quality Model can be coupled with regional or global atmospheric models as a chemical module.

Filippenko, Anna; Smyshlyaev, Sergey



Measuring (n,f) cross-sections of short-lived Department of Physics and McDonnell Center for the Space Sciences  

E-print Network

, by the methods of atomic vapor laser isotope separation) so that the shorter lived states must be separated, separate and collect the short-lived states before they decay, and partly because of their comparatively an isomeric state and the ground state of the same isotope of the same element. This would test the ability

Katz, Jonathan I.


Materials Research in France: A Short-lived National Initiative (1982-1994). Emanuel Bertrand, Physico-chimie des Electrolytes, Collodes, et Sciences Analytiques  

E-print Network

1 Materials Research in France: A Short-lived National Initiative (1982-1994). Emanuel Bertrand cedex 05, France. Abstract This paper describes the French initiative in materials research against both prompted this governmental initiative, and to characterize the specific profile of materials research

Paris-Sud XI, Université de


Decay properties of short-lived neutron-rich halogen isotopes and their yields obtained in the thermal neutron fission of uranium  

Microsoft Academic Search

Thesis. The present paper reports data on the nuclear charge ; distribution of halogen isotopes in the 50- and 82-neutron shell range resulting ; from thermal neutron fission of ²³⁵U. A fully automated rapid gas-; chromatographic system has been developed which allows the isolation of short-; lived bromine and iodine isotopes by volatilization of their methyl compounds ; within a




Public health benefits of strategies to reduce greenhouse-gas emissions: health implications of short-lived greenhouse pollutants  

PubMed Central

In this report we review the health effects of three short-lived greenhouse pollutants—black carbon, ozone, and sulphates. We undertook new meta-analyses of existing time-series studies and an analysis of a cohort of 352 000 people in 66 US cities during 18 years of follow-up. This cohort study provides estimates of mortality effects from long-term exposure to elemental carbon, an indicator of black carbon mass, and evidence that ozone exerts an independent risk of mortality. Associations among these pollutants make drawing conclusions about their individual health effects difficult at present, but sulphate seems to have the most robust effects in multiple-pollutant models. Generally, the toxicology of the pure compounds and their epidemiology diverge because atmospheric black carbon, ozone, and sulphate are associated and could interact with related toxic species. Although sulphate is a cooling agent, black carbon and ozone could together exert nearly half as much global warming as carbon dioxide. The complexity of these health and climate effects needs to be recognised in mitigation policies. PMID:19942276

Smith, Kirk R.; Jerrett, Michael; Anderson, H Ross; Burnett, Richard T.; Stone, Vicki; Derwent, Richard; Atkinson, Richard W.; Cohen, Aaron; Shonkoff, Seth B.; Krewski, Daniel; Pope, C. Arden; Thun, Michael J.; Thurston, George



A five-HPGe detector system for ?-? angular correlation measurements for mass-separated short-lived nuclei  

NASA Astrophysics Data System (ADS)

A multiple-detector system for ?-? angular correlation measurements has been constructed to study low-spin states populated via the ?-decay of mass-separated short-lived nuclei using an isotope separator on-line. The system consists of five-HPGe detectors which are configured at fixed angles to provide ten correlation angles of 90°, 100°, 110°, 120°, 130°, 130°, 140°, 150°, 160° and 170° simultaneously, and with short source-to-detector distance to enlarge the detection efficiencies. The performance of the system was studied with an 152Eu source in off-line experiments. The contribution of finite solid angle of detectors, random coincidences and Compton-scattered ?-rays were appropriately corrected. Difference in the coincidence efficiency among various detector pairs was experimentally evaluated, and it was concluded that this difference was almost negligible in this system. In an on-line experiment, low-spin states in 126Ba populated via the ?+-decay of 126La were investigated with this system.

Asai, M.; Kawade, K.; Yamamoto, H.; Osa, A.; Koizumi, M.; Sekine, T.



Very Short-lived Bromomethanes in the Upper Troposphere/Lower Stratosphere during CARIBIC May 2009 to May 2011  

NASA Astrophysics Data System (ADS)

Reactive halogenated compounds including brominated very short-lived substances (VSLS) play an important role both in the stratosphere, where they impact on stratospheric ozone, and in the troposphere, where they participate in catalytic ozone destruction and aerosol formation. According to the latest WMO figures, brominated VSLS could be responsible for 1-8 ppt contribution to the stratospheric bromine burden. However, observations of brominated VSLS in the upper troposphere/lower stratosphere are relatively sparse. In this study we present measurements made during the CARIBIC project from May 2009 to May 2011 using a negative ion chemical ionisation (NICI) mass spectrometer instrument. NICI is a "soft" ionisation technique that gives enhanced detection limits for electronegative species such as halocarbons. The CARIBIC project deploys a large range of automated instruments in an airfreight container aboard a Lufthansa A340-600 passenger aircraft. The container system also houses two automated bottle samplers which are analysed for various compounds. As part of the project we measure a range of halogenated compounds in the bottle samples. We will present profiles of bromoform (CHBr3), dibromomethane (CH2Br2), dibromochloromethane (CHBr2Cl), bromodichloromethane (CHBrCl2) and bromochloromethane (CH2BrCl) and compare results with previous measurements of brominated VSLS.

Wisher, Adam; Oram, Dave; Laube, Johannes; van Velthoven, Peter; Brenninkmeijer, Carl



Ozone Destruction in the Upper Troposphere/Lower Stratosphere from Short-Lived Halogens and Climate Impacts  

NASA Astrophysics Data System (ADS)

Halogens released from very short-lived substances (VSLS) can deplete ozone in the upper-troposphere and lower stratosphere where the perturbation can exert a large climate impact. In addition to the known ozone loss from natural biogenic bromine VSLS, such as bromoform (CHBr3), using a global atmospheric model we show that anthropogenic chlorine VSLS such as dichloromethane (CH2Cl2) - not regulated by the Montreal Protocol - also contribute. Although this impact is small compared to bromine VSLS at present, CH2Cl2 has industrial sources and observations show its atmospheric loading is increasing rapidly. We estimate a significant radiative effect of the bromine and chlorine VSLS-driven lower stratospheric ozone destruction of -0.11 Wm-2. The largest impact comes from ozone loss at high latitudes, where column ozone decreases due to VSLS are up to 6%. The trend in anthropogenic chlorine VSLS could cause a significant radiative forcing, especially if augmented by any trend in natural bromine VSLS. We also used the model to study the impact of iodine-containing VSLS such as methyl iodide (CH3I). Of the three halogens iodine has the largest leverage to destroy lower stratospheric ozone, but current limits based on IO observations indicate only a minor impact at present.

Hossaini, Ryan; Chipperfield, Martyn; Montzka, Stephen; Rap, Alex; Dhomse, Sandip; Feng, Wuhu



Occurrence of adventitious sprouting in short-lived monocarpic herbs: a field study of 22 weedy species  

PubMed Central

Background and Aims Adventitious sprouting from the hypocotyle and roots in monocarpic herbs has been confirmed in previous experimental studies as a means to avoid bud limitation after severe injury in annual and biennial plants. Data regarding the role of adventitious sprouting in natural populations, however, were lacking. The aim of the present study was to assess whether adventitious sprouting occurs in natural populations and how it is affected by plant size, plant injury, plant cover and environmental characteristics. Methods Data were sampled from 14 037 individual plants from 389 populations belonging to 22 annual and biennial species. Growth parameters were measured in individual plants, species composition and plant cover in communities were evaluated, and environmental characteristics were estimated using Ellenberg indicator values. Key Results It was confirmed that adventitious sprouting occurs in natural populations of all but five species examined. Adventitious sprouting was positively affected by plant size and plant injury. Environmental factors including availability of soil nitrogen were not shown to affect adventitious sprouting. Annual and biennial plants did not differ in sprouting, but upright annuals had a lower number of and longer adventitious shoots than prostrate annuals. Conclusions Adventitious bud formation is used to overcome meristem limitation when stem parts are lost due to injury, and thus resprouting in short-lived monocarps should not be overlooked. PMID:20356953

Malíková, Lenka; Šmilauer, Petr; Klimešová, Jitka



Injection of Short-Lived Radionuclides into the Early Solar System from a Faint Supernova with Mixing-Fallback  

E-print Network

Several short-lived radionuclides (SLRs) were present in the early solar system, some of which should have formed just prior to or soon after the solar system formation. Stellar nucleosynthesis has been proposed as the mechanism for production of SLRs in the solar system, but no appropriate stellar source has been found to explain the abundances of all solar system SLRs. In this study, we propose a faint supernova with mixing and fallback as a stellar source of SLRs with mean lives of solar system. In such a supernova, the inner region of the exploding star experiences mixing, a small fraction of mixed materials is ejected, and the rest undergoes fallback onto the core. The modeled SLR abundances agree well with their solar system abundances if mixing-fallback occurs within the C/O-burning layer. In some cases, the initial solar system abundances of the SLRs can be reproduced within a factor of 2. The dilution factor of supernova ejecta to the solar system materials is ~10E-4 and the time interval between the supernova explosion and the formation of oldest solid materials in the solar system is ~1 Myr. If the dilution occurred due to spherically symmetric expansion, a faint supernova should have occurred nearby the solar system forming region in a star cluster.

A. Takigawa; J. Miki; S. Tachibana; G. R. Huss; N. Tominaga; H. Umeda; K. Nomoto



ICV-transplanted human glial precursor cells are short-lived yet exert immunomodulatory effects in mice with EAE.  


Human glial precursor cells (hGPs) have potential for remyelinating lesions and are an attractive cell source for cell therapy of multiple sclerosis (MS). To investigate whether transplanted hGPs can affect the pathogenesis of experimental autoimmune encephalomyelitis (EAE), an animal model of MS, we evaluated the therapeutic effects of transplanted hGPs together with the in vivo fate of these cells using magnetic resonance imaging (MRI) and bioluminescence imaging (BLI). At 14 days post-EAE induction, mice (n = 19) were intracerebroventricularly (ICV) injected with 5 × 10(5) hGPs that were magnetically labeled with superparamagnetic iron oxide (SPIO) particles as MR contrast agent and transduced with firefly luciferase for BLI of cell survival. Control mice (n = 18) received phosphate buffered saline (PBS) vehicle only. The severity of EAE clinical disability in the hGP-transplanted group was significantly suppressed (P < 0.05) with concomitant inhibition of ConA and MOG-specific T cell proliferation in the spleen. Astrogliosis was reduced and a lower activity of macrophages and/or microglia was observed in the spinal cord (P < 0.05). On MRI, SPIO signal was detected within the lateral ventricle from 1 day post-transplantation and remained there for up to 34 days. BLI indicated that most cells did not survive beyond 5-10 days, consistent with the lack of detectable migration into the brain parenchyma and the histological presence of an abundance of apoptotic cells. Transplanted hGPs could not be detected in the spleen. We conclude that ICV transplantation of short-lived hGPs can have a remote therapeutic effect through immunomodulation from within the ventricle, without cells directly participating in remyelination. PMID:22499166

Kim, Heechul; Walczak, Piotr; Muja, Naser; Campanelli, James T; Bulte, Jeff W M



Short-lived immunity against pertussis, age-specific routes of transmission, and the utility of a teenage booster vaccine  

PubMed Central

Background Pertussis incidence has been increasing for the past two decades in Norway, as in much of the highly vaccinated world. The greatest increase is in teenagers, although the most severe cases occur in infants. A teenage booster is recommended globally, largely with the aim of reducing infant incidence. However few countries have implemented the booster, and almost no data have been published on its utility in preventing infant cases. We aim to assess the duration of vaccine-induced immunity, and the possibility for a teenage-booster vaccine to protect infants in Norway. Methods and findings We used a unique data set that merged case reports with a national vaccine registry from Norway, 1996–2010, to assess age- and cohort-specific hazards of infection. We also developed and implemented a likelihood-based method for estimating the duration of immunity, taking into account age-contact data relevant for pertussis transmission. The risk of infection in thirteen-year olds increased nearly four-fold, however the hazard in infants did not significantly change. The seasonality of cases in pre-school-aged children differed from that of school-aged children. The introduction of a childhood booster vaccine provided indirect protection for unvaccinated members of the cohort, but little protection to neighboring cohorts. Additionally, we found evidence for increasingly rapid infection after three doses of vaccine, potentially caused by significant and heterogeneous loss of immunity. An estimated 15% of vaccinated individuals lost their immunity within five years after vaccination. Conclusions Immunity induced by the acellular pertussis vaccine prevents both disease and transmission, but is short-lived and heterogeneous. The age-mixing patterns lead to little contact between teenagers and infants. Therefore, while a teenage booster vaccine campaign would likely provide strong protection for cohorts of teenagers, it would provide little protection for infants. PMID:22119924

Lavine, Jennie; Bjørnstad, Ottar; de Blasio, Birgitte Freiesleben; Storsaeter, Jann



Adult neurogenesis in the short-lived teleost Nothobranchius furzeri: localization of neurogenic niches, molecular characterization and effects of aging  

PubMed Central

We studied adult neurogenesis in the short-lived annual fish Nothobranchius furzeri and quantified the effects of aging on the mitotic activity of the neuronal progenitors and the expression of glial fibrillary acid protein (GFAP) in the radial glia. The distribution of neurogenic niches is substantially similar to that of zebrafish and adult stem cells generate neurons, which persist in the adult brain. As opposed to zebrafish, however, the N. furzeri genome contains a doublecortin (DCX) gene. Doublecortin is transiently expressed by newly generated neurons in the telencephalon and optic tectum (OT). We also analyzed the expression of the microRNA miR-9 and miR-124 and found that they have complementary expression domains: miR-9 is expressed in the neurogenic niches of the telencephalon and the radial glia of the OT, while miR-124 is expressed in differentiated neurons. The main finding of this paper is the demonstration of an age-dependent decay in adult neurogenesis. Using unbiased stereological estimates of cell numbers, we detected an almost fivefold decrease in the number of mitotically active cells in the OT between young and old age. This reduced mitotic activity is paralleled by a reduction in DCX labeling. Finally, we detected a dramatic up-regulation of GFAP in the radial glia of the aged brain. This up-regulation is not paralleled by a similar up-regulation of S100B and Musashi-1, two other markers of the radial glia. In summary, the brain of N. furzeri replicates two typical hallmarks of mammalian aging: gliosis and reduced adult neurogenesis. PMID:22171971

Tozzini, Eva Terzibasi; Baumgart, Mario; Battistoni, Giorgia; Cellerino, Alessandro



How sensitive is the recovery of stratospheric ozone to changes in concentrations of very short lived bromocarbons?  

NASA Astrophysics Data System (ADS)

Naturally produced very short-lived substances (VSLS), like bromocarbons, account for almost a quarter of the current stratospheric inorganic bromine, Bry. Following VSLS oxidation, bromine radicals (Br and BrO) can catalytically destroy ozone. The extent to which possible increases in surface emissions or transport of these VSLS bromocarbons to the stratosphere could counteract the effect of halogen reductions under the Montreal Protocol is an important policy question. Here by using a chemistry-climate model, UM-UKCA, we investigate the impact of a hypothetical increase in VSLS on ozone and how that impact depends on the background concentrations of chlorine and bromine. Our model experiments indicate that for a ~5 ppt increase in Bry from VSLS, the local ozone loss in the lowermost stratosphere of the Southern Hemisphere (SH) may reach up to 10% in the annual mean; the ozone loss in the Northern Hemisphere (NH) is smaller (4-6%). There is more ozone loss following an increase in VSLS burden under a high stratospheric chlorine background than under a low chlorine background indicating the importance of the inter-halogen reactions. For example, the rate of decline of the stratospheric ozone concentration as a function of Bry is higher by about 30-40% when stratospheric Cly is ~3 ppb (present day) compared with Cly of ~0.8 ppb (apre-industrial or projected future situation). Although bromine plays an important role in destroying ozone, inorganic chlorine is the dominant halogen compound. Even if bromine levels from natural VSLS were to increase significantly later this century, changes in the concentration of ozone will be dominated by the recovery of anthropogenic chlorine. Our calculation suggests that for a 5 ppt increase in Bry from VSLS, the Antarctic ozone hole recover date could be delayed by approximately 7 years.

Yang, X.; Abraham, N. L.; Archibald, A. T.; Braesicke, P.; Keeble, J.; Telford, P.; Warwick, N. J.; Pyle, J. A.



How sensitive is the recovery of stratospheric ozone to changes in concentrations of very short-lived bromocarbons?  

NASA Astrophysics Data System (ADS)

Naturally produced very short-lived substances (VSLS) account for almost a quarter of the current stratospheric inorganic bromine, Bry. Following VSLS oxidation, bromine radicals (Br and BrO) can catalytically destroy ozone. The extent to which possible increases in surface emissions or transport of these VSLS bromocarbons to the stratosphere could counteract the effect of halogen reductions under the Montreal Protocol is an important policy question. Here, by using a chemistry-climate model, UM-UKCA, we investigate the impact of a hypothetical doubling (an increase of 5 ppt Bry) of VSLS bromocarbons on ozone and how the resulting ozone changes depend on the background concentrations of chlorine and bromine. Our model experiments indicate that for the 5 ppt increase in Bry from VSLS, the ozone decrease in the lowermost stratosphere of the Southern Hemisphere (SH) may reach up to 10% in the annual mean; the ozone decrease in the Northern Hemisphere (NH) is smaller (4-6%). The largest impact on the ozone column is found in the Antarctic spring. There is a significantly larger ozone decrease following the doubling of the VSLS burden under a high stratospheric chlorine background than under a low chlorine background, indicating the importance of the inter-halogen reactions. For example, the decline in the high-latitude, lower-stratospheric ozone concentration as a function of Bry is higher by about 30-40% when stratospheric Cly is ~ 3 ppb (present day), compared with Cly of ~ 0.8 ppb (a pre-industrial or projected future situation). Bromine will play an important role in the future ozone layer. However, even if bromine levels from natural VSLS were to increase significantly later this century, changes in the concentration of ozone will likely be dominated by the decrease in anthropogenic chlorine. Our calculation suggests that for a 5 ppt increase in Bry from VSLS, the Antarctic ozone hole recovery date could be delayed by approximately 6-8 years, depending on Cly levels.

Yang, X.; Abraham, N. L.; Archibald, A. T.; Braesicke, P.; Keeble, J.; Telford, P. J.; Warwick, N. J.; Pyle, J. A.



Using daily satellite observations to estimate emissions of short-lived air pollutants on a mesoscopic scale  

NASA Astrophysics Data System (ADS)

Emission inventories of air pollutants are crucial information for policy makers and form important input data for air quality models. Using satellite observations for emission estimates has important advantages over bottom-up emission inventories: they are spatially consistent, have high temporal resolution, and enable updates shortly after the satellite data become available. We present a new algorithm specifically designed to use daily satellite observations of column concentrations for fast updates of emission estimates of short-lived atmospheric constituents on a mesoscopic scale (˜25 × 25 km2). The algorithm needs only one forward model run from a chemical transport model to calculate the sensitivity of concentration to emission, using trajectory analysis to account for transport away from the source. By using a Kalman filter in the inverse step, optimal use of the a priori knowledge and the newly observed data is made. We apply the algorithm for NOx emission estimates of East China, using the CHIMERE model on a 0.25 degree resolution together with tropospheric NO2column retrievals of the OMI and GOME-2 satellite instruments. Closed loop tests show that the algorithm is capable of reproducing new emission scenarios. Applied with real satellite data, the algorithm is able to detect emerging sources (e.g., new power plants), and improves emission information for areas where proxy data are not or badly known (e.g., shipping emissions). Chemical transport model runs with the daily updated emission estimates provide better spatial and temporal agreement between observed and simulated concentrations, facilitating improved air quality forecasts.

Mijling, B.; van der A, R. J.




SciTech Connect

Many observed massive star-forming z Almost-Equal-To 2 galaxies are large disks that exhibit irregular morphologies, with Almost-Equal-To 1 kpc, Almost-Equal-To 10{sup 8}-10{sup 10}M{sub o-dot} clumps. We present the largest sample to date of high-resolution cosmological smoothed particle hydrodynamics simulations that zoom-in on the formation of individual M{sub *} Almost-Equal-To 10{sup 10.5}M{sub o-dot} galaxies in Almost-Equal-To 10{sup 12}M{sub o-dot} halos at z Almost-Equal-To 2. Our code includes strong stellar feedback parameterized as momentum-driven galactic winds. This model reproduces many characteristic features of this observed class of galaxies, such as their clumpy morphologies, smooth and monotonic velocity gradients, high gas fractions (f{sub g} Almost-Equal-To 50%), and high specific star formation rates ({approx}>1 Gyr{sup -1}). In accord with recent models, giant clumps (M{sub clump} Almost-Equal-To (5 Multiplication-Sign 10{sup 8}-10{sup 9})M{sub o-dot}) form in situ via gravitational instabilities. However, the galactic winds are critical for their subsequent evolution. The giant clumps we obtain are short-lived and are disrupted by wind-driven mass loss. They do not virialize or migrate to the galaxy centers as suggested in recent work neglecting strong winds. By phenomenologically implementing the winds that are observed from high-redshift galaxies and in particular from individual clumps, our simulations reproduce well new observational constraints on clump kinematics and clump ages. In particular, the observation that older clumps appear closer to their galaxy centers is reproduced in our simulations, as a result of inside-out formation of the disks rather than inward clump migration.

Genel, Shy; Genzel, Reinhard; Foerster Schreiber, Natascha M. [Max Planck Institut fuer extraterrestrische Physik, Giessenbachstrasse, 85748 Garching (Germany); Naab, Thorsten; Oser, Ludwig [Max Planck Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, 85741 Garching (Germany); Sternberg, Amiel [Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Johansson, Peter H. [Department of Physics, University of Helsinki, Gustaf Haellstroemin katu 2a, FI-00014 Helsinki (Finland); Dave, Romeel [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Oppenheimer, Benjamin D. [Leiden Observatory, Leiden University, P.O. Box 9513, 2300 RA Leiden (Netherlands); Burkert, Andreas, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail:, E-mail: [Universitaets-Sternwarte Muenchen, Scheinerstr. 1, D-81679 Muenchen (Germany)



SUMO-independent in vivo activity of a SUMO-targeted ubiquitin ligase toward a short-lived transcription factor.  


Many proteins are regulated by ubiquitin-dependent proteolysis. Substrate ubiquitylation can be stimulated by additional post-translational modifications, including small ubiquitin-like modifier (SUMO) conjugation. The recently discovered SUMO-targeted ubiquitin ligases (STUbLs) mediate the latter effect; however, no endogenous substrates of STUbLs that are degraded under normal conditions are known. From a targeted genomic screen, we now identify the yeast STUbL Slx5-Slx8, a heterodimeric RING protein complex, as a key ligase mediating degradation of the MATalpha2 (alpha2) repressor. The ubiquitin-conjugating enzyme Ubc4 was found in the same screen. Surprisingly, mutants with severe defects in SUMO-protein conjugation were not impaired for alpha2 turnover. Unmodified alpha2 also bound to and was ubiquitylated efficiently by Slx5-Slx8. Nevertheless, when we inactivated four SUMO-interacting motifs (SIMs) in Slx5 that together account for its noncovalent SUMO binding, both in vitro Slx5-Slx8-dependent ubiquitylation and in vivo degradation of alpha2 were inhibited. These data identify alpha2 as the first native substrate of the conserved STUbLs, and demonstrate that its STUbL-mediated ubiquitylation does not require SUMO. We suggest that alpha2, and presumably other proteins, have surface features that mimic SUMO, and therefore can directly recruit STUbLs without prior SUMO conjugation. PMID:20388728

Xie, Yang; Rubenstein, Eric M; Matt, Tanja; Hochstrasser, Mark



Light particles emitted in coincidence with evaporation residues in {sup 79}Br(930 MeV) + {sup 27}Al collisions  

SciTech Connect

Exclusive measurements of light particles, deuterons, tritons and alphas, in coincidence with Evaporation Residues (ER), were performed at the Holified Heavy Ion Research Facility of the Oak Ridge National Laboratory using the large detector array HILI (Heavy Ion Light Ion). Heavy fragments produced in the reaction (Z 35), were stopped in the Ionisation Chamber, where their energy, atomic number (Z) and position were measured. Coincident light particles, were detected in the 192 element hodoscope placed behind the chamber, where its charge (Z) and energy were measured. Also the time of flight relative to the radio frequency of the cyclotron, allowed identification of protons deuterons and tritons.

Chavez Lomeli, E.; Dacal, A.; Ortiz, M.E. [Universidad Nacional Autonoma de Mexico, Mexico City (Mexico). Inst. de Fisica; D`Onofrio, A. [Istituto Nazionale di Fisica Nucleare, Naples (Italy); Gomez del Campo, J.; Kim, H.; Korolija, M.; Shapira, D. [Oak Ridge National Lab., TN (United States)



Estimation of the contribution of short-lived radioiodines to the thyroid dose for the public in case of inhalation intake following the Fukushima accident.  


The purpose of this paper is to present (1) the method of assessing the contribution of short-lived radioiodines to the thyroid for members of the public in Fukushima and neighbouring prefectures based on available data and (2) the results of a realistic assessment of such a contribution. The estimates of that contribution for the inhalation intake that occurred on the day of the main fallout (15 March 2011) are within 15 % of the dose to the thyroid from (131)I. The contribution to the thyroid dose from intake of (132)Te is higher than that from the intake of (133)I by a factor of ?3. The contribution of short-lived radioiodines to the thyroid dose for the public in the case of inhalation intake occurring as early as March 12 might be as great as 30-40 %. PMID:25394649

Shinkarev, S M; Kotenko, K V; Granovskaya, E O; Yatsenko, V N; Imanaka, T; Hoshi, M



Do short-lived and long-lived alien plant species differ regarding the traits associated with their success in the introduced range?  

Microsoft Academic Search

In spite of the several studies trying to identify the biological traits that are generally associated with the success of\\u000a alien plant species, only a few traits are consistently shown to be important. Dividing the species into meaningful sub-categories\\u000a may improve our ability to distinguish successful alien species. We asked whether there are differences between short-lived\\u000a and long-lived herbaceous aliens

Annamária Fenesi; Zoltán Botta-Dukát



Comment on 'Electron-induced bond breaking at low energies in HCOOH and glycine: The role of very short-lived {sigma}* anion states'  

SciTech Connect

Recent model calculations by Gallup et al. [Phys. Rev. A79, 042710 (2009)] suggest that low-energy dissociative electron attachment to formic acid can be explained solely in terms of a very short-lived {sigma}* anion state and that no {sigma}*/{pi}* coupling is required. We argue that this interpretation of the experimental data, which is at odds with our earlier study, is flawed.

Rescigno, T. N. [Lawrence Berkeley National Laboratory, Chemical Sciences, Berkeley, California 94720 (United States); Trevisan, C. S. [California Maritime Academy, Vallejo, California 94590 (United States); Orel, A. E. [Department of Applied Science, University of California, Davis, California 95616 (United States)



NEW ACTIVE MEDIA AND ELEMENTS OF LASER SYSTEMS: Influence of short-lived color centers on the lifetime of a metastable level of neodymium in silicate glasses  

NASA Astrophysics Data System (ADS)

It was found that the short-lived color centers formed in neodymium-activated silicate glasses under the action of the violet part of the pump spectrum increased the lifetime of a neodymium metastable level by more than an order of magnitude in needle-shaped waveguide lasers. The highly efficient suppression of superradiance and a strong increase in the gain of the active element were due to stimulated decay of the color centers accompanying absorption of photons emitted by the neodymium.

Dzhibladze, M. I.; Lazarev, L. E.



Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes  

NASA Astrophysics Data System (ADS)

Eruptive rates in volcanic arcs increase significantly after subduction mega-thrust earthquakes. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose that increased eruption rates over longer timescales are due to the relaxation of the compressional regime that accompanies mega-thrust subduction zone earthquakes. More specifically, the reduction of the horizontal stress ?h promotes the occurrence of short-lived strike-slip kinematics rather than reverse faulting in the volcanic arc. The relaxation of the pre-earthquake compressional regime facilitates magma mobilisation by providing a short-circuit pathway to shallow depths by significantly increasing the hydraulic properties of the system. The timescale for the onset of strike-slip faulting depends on the degree of shear stress accumulated in the arc during inter-seismic periods, which in turn is connected to the degree of strain-partitioning at convergent margins. We performed Coulomb stress transfer analysis to determine the order of magnitude of the stress perturbations in present-day volcanic arcs in response to five recent mega-thrust earthquakes; the 2005 M8.6, 2007 M8.5, and 2007 M7.9 Sumatra earthquakes; the 2010 M8.8 Maule, Chile earthquake; and the 2011 M9.0 Tohoku, Japan earthquake. We find that all but one the shallow earthquakes that occurred in the arcs of Sumatra, Chile and Japan show a marked lateral component. We suggests that the long-term response of volcanic arcs to subduction zone mega-thrust earthquakes will be manifested as predominantly strike-slip seismic events, and that these future earthquakes may be followed closely by indications of rising magma to shallower depths, e.g. surface inflation and seismic swarms.

Lupi, M.; Miller, S. A.



Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes  

NASA Astrophysics Data System (ADS)

Eruptive rates in volcanic arcs increase significantly after mega-thrust earthquakes in subduction zones. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose that increased eruption rates over longer timescales are due to the relaxation of the compressional regime that accompanies mega-thrust subduction zone earthquakes. More specifically, the reduction of the horizontal stress ?h promotes the occurrence of short-lived strike-slip kinematics rather than reverse faulting in the volcanic arc. The relaxation of the pre-earthquake compressional regime facilitates magma mobilization by providing a short-circuit pathway to shallow depths by significantly increasing the hydraulic properties of the system. The timescale for the onset of strike-slip faulting depends on the degree of shear stress accumulated in the arc during inter-seismic periods, which in turn is connected to the degree of strain-partitioning at convergent margins. We performed Coulomb stress transfer analysis to determine the order of magnitude of the stress perturbations in present-day volcanic arcs in response to five actual mega-thrust earthquakes; the 2005 M8.6, 2007 M8.5, and 2007 M7.9 Sumatra earthquakes; the 2010 M8.8 Maule, Chile earthquake; and the 2011 M9.0 Tohoku, Japan earthquake. We find that all, but one, the shallow earthquakes that occurred in the arcs of Sumatra, Chile and Japan show a marked lateral component. Our hypothesis suggests that the long-term response of volcanic arcs to subduction zone mega-thrust earthquakes will be manifested as predominantly strike-slip seismic events, and that these future earthquakes will be followed closely by seismic swarms, inflation, and other indications of a rising magma source.

Lupi, M.; Miller, S. A.



Modeling the injection of short-lived radionuclides from a nearby supernova into the Solar Systems's protoplanetary disk  

NASA Astrophysics Data System (ADS)

Isotopic analyses of meteorites reveal that the early Solar System contained several short-lived radionuclides (SLRs) with half lives <= 10 Myr. These SLRs are now all decayed and their presence in the Solar System at its birth remains a longstanding mystery. In this thesis, we propose that the Solar System received its SLRs from an injection of dust, formed from ejecta produced by a nearby supernova, into its already formed protoplanetary disk. This injection model, dubbed the "aerogel" model, for the origin of the Solar System's SLRs is tested here by comparing the results of theoretical modeling and numerical simulations to astronomical and meteoritic observations. Following a review of the evidence for the presence of SLRs at the time of the formation of the solar system and a description of the competing theories attempting to explain the origins of SLRs (inheritance, irradiation, and injection), the survivability of a disk hit with fast moving ejecta is tested via computer simulations, using an explicit two-dimensional finite-difference hydrodynamic code written for this purpose. It is found that a disk as close as 0.1 pc from the supernova will survive a collision with 2000 km/s ejecta, experiencing only a 1% mass loss in the process. To test the aerogel model further, the injection efficiency of supernova dust is computed in the following manner. Dust grains are added as tracers responding to snapshots of the gas velocity fields computed in the hydrodynamic simulations; the trajectories of these grains are followed as they make their way toward the disk. It is found that the majority (> 90%) of the supernova dust mass is injected deep into the disk. Finally, it is shown that a single supernova injects sufficient mass to explain the SLR abundances measured in meteorites. Predictions based on simulated supernova yields are within 10% of measured SLR ratios in meteorites. In addition, predictions of other possible SLR ratios are calculated, suggesting non-negligible quantities of selenium-79 and tin-126 could be found in the meteoritic record. Their detection, however, could be difficult due to petrological considerations and the limitations of the instruments used to detect the remnants of extinct SLRs. Other possible evidence for the aerogel model may come from meteoritic record. Rough calculations show that ~ 10% of supernova presolar grains found in meteorites should come from the single supernova that provided the solar system with its SLRs. The high abundance of low-density graphite grains that originate from a supernova compared to other presolar graphites suggest in particular they could come from the nearby supernova. Injection of supernova ejecta into a nearby already formed disk, the aerogel model, is entirely consistent with current meteoritical observations.

Ouellette, Nicolas


On the Relation between Stratospheric Chlorine/Bromine Loading and Short-Lived Tropospheric Source Gases. Appendix D  

NASA Technical Reports Server (NTRS)

Current methods for estimating the concentrations of inorganic chlorine/bromine species Cl(y)/Br(y) in the stratosphere due to decomposition of tropospheric source gases assume that the Cl(y)/Br(y) concentration in the stratosphere is determined mainly by the balance between production from in situ oxidation of the source gases in the stratosphere and removal by transport of Cl(y)/Br(y) out of the stratosphere. The rationale being that for source gases whose lifetimes are of the order of several months or longer the concentration of Cl(y)/Br(y) in the troposphere is small because they are produced at a relatively slow rate and also removed efficiently by washout processes. As a result of the small concentration, the rate at which Cl(y)/Br(y) is transported to the stratosphere is expected to be small compared to the in situ stratospheric production. Thus the transport of Cl(y)/Br(y) from the troposphere contributes little to the stratospheric concentration. In contrast, the origin of stratospheric Cl(y)/Br(y) from reactive source gases with tropospheric lifetimes comparable to the washout lifetime of Cl(y)/Br(y) (of the order of 10-30 days) in the troposphere is distinctly different. The in situ source in the stratosphere is expected to be significantly smaller because only a small portion of the source gas is expected to survive the troposphere to be transported into this region. At the same time these short-lived source gases produce appreciable amounts of Cl(y)/Br(y) in the troposphere such that transport to the stratosphere offers a larger source for stratospheric Cl(y)/Br(y) than in situ production. Thus, for reactive source species, simple methods of estimating the concentration of stratospheric Cl(y)/Br(y) that ignore the tropospheric contribution will seriously underestimate the loading. Therefore estimation of the stratospheric Cl(y)/Br(y) loading requires not only measurements of tropospheric source gases but also measurements of Cl(y)/Br(y) at the tropopause. This paper illustrates the mechanism by using results from a two-dimensional chemistry-transport model. However, in view of the importance of tropospheric transport on stratospheric loading the detailed values should be further evaluated using a three-dimensional model with appropriate treatment of convective transport.

Ko, Malcolm K. W.; Sze, Nien-Dak; Scott, Courtney J.; Weisenstein, Debra K.



Russian policy on methane emissions in the oil and gas sector: A case study in opportunities and challenges in reducing short-lived forcers  

NASA Astrophysics Data System (ADS)

Methane is a potent greenhouse gas, 21 times as powerful as carbon dioxide in contributing to climate change on a ton-for-ton basis. Methane, along with other short-lived forcers such as black carbon and tropospheric ozone, could play an important role in addressing global climate change. This stems both from their overall effect on climate systems, and from their concentrated impact in the short term. Because reducing emissions of such short-lived pollutants may have a large near-term impact in slowing climate change, the United States and other countries have come together to cooperate under the Climate and Clean Air Coalition to Reduce Short-Lived Climate Pollutants, and other partnerships such as the Global Methane Initiative. For global impact, the success of such partnerships depends on their ability to scale up project-specific emission reductions. This paper assesses options and challenges for scaling based on a case study of Russia's oil and gas sector. We examine the challenges to achieving far-reaching emission reductions, successes of companies to date, how Russia has sought to influence methane emissions through its environmental fine system, and options for helping companies achieve large-scale emission reductions in the future through simpler and clearer incentives.

Evans, Meredydd; Roshchanka, Volha



A High-Throughput Screen for Alpha Particle Radiation Protectants  

PubMed Central

Abstract Alpha-particle-emitting elements are of increasing importance as environmental and occupational carcinogens, toxic components of radiation dispersal devices and accidents, and potent therapeutics in oncology. Alpha particle radiation differs from radiations of lower linear energy transfer in that it predominantly damages DNA via direct action. Because of this, radical scavengers effective for other radiations have had only limited effect in mitigating alpha particle toxicity. We describe here a simple assay and a pilot screen of 3,119 compounds in a high-throughput screen (HTS), using the alpha-particle-emitting isotope, 225Ac, for the discovery of compounds that might protect mammalian cells from alpha particles through novel mechanisms. The assay, which monitored the viability of a myeloid leukemic cell line upon alpha particle exposure, was robust and reproducible, yielding a Z' factor of 0.66 and a signal-to-noise ratio of nearly 10 to 1. Surprisingly, 1 compound emerged from this screen, epoxy-4,5-?-dihydroxysantonin (EDHS), that showed considerable protective activity. While the value of EDHS remains to be determined, its discovery is a proof of concept and validation of the utility of this HTS methodology. Further application of the described assay could yield compounds useful in minimizing the toxicity and carcinogenesis associated with alpha particle exposure. PMID:20658946

Seideman, Jonathan H.; Shum, David; Djaballah, Hakim



Drag on a Satellite Moving across a Spherical Galaxy: Tidal and Frictional Forces in Short-lived Encounters  

NASA Astrophysics Data System (ADS)

The drag force on a satellite of mass M moving with speed V in the gravitational field of a spherically symmetric background of stars is computed. During the encounter, the stars are subject to a time-dependent force that alters their equilibrium. The resulting distortion in the stellar density field acts back to produce a force F? that decelerates the satellite. This force is computed using a perturbative technique known as linear response theory. In this paper, we extend the formalism of linear response to derive the correct expression for the back-reaction force F? that applies when the stellar system is described by an equilibrium one-particle distribution function. F? is expressed in terms of a suitable correlation function that couples the satellite dynamics to the unperturbed dynamics of the stars. At time t, the force depends upon the whole history of the composite system. In the formalism, we account for the shift of the stellar center of mass resulting from linear momentum conservation. The self-gravity of the response is neglected since it contributes to a higher order in the perturbation. Linear response theory applies also to the case of a satellite orbiting outside the spherical galaxy. The case of a satellite moving on a straight line, at high speed relative to the stellar dispersion velocity, is explored. We find that the satellite during its passage raises (1) global tides in the stellar distribution and (2) a wake, i.e., an overdense region behind its trail. If the satellite motion is external to the galaxy, it suffers a dissipative force that is not exclusively acting along V but acquires a component along R, the position vector relative to the center of the spherical galaxy. We derive the analytical expression of the force in the impulse approximation. In penetrating short-lived encounters, the satellite moves across the stellar distribution and the transient wake excited in the density field is responsible for most of the deceleration. We find that dynamical friction arises from a memory effect involving only those stars perturbed along the path. The force can be written in terms of an effective Coulomb logarithm that now depends upon time. The value of ln ? is computed for two simple equilibrium density distributions; it is shown that the drag increases as the satellite approaches the denser regions of the stellar distribution and attains a maximum after pericentric passage. When the satellite crosses the edge of the galaxy, the force does not vanish since the galaxy keeps memory of the perturbation induced and declines on a time comparable to the dynamical time of the stellar system. In the case of a homogeneous cloud, we compute the total energy loss. In evaluating the contribution resulting from friction, we derive self-consistently the maximum impact parameter, which is found to be equal to the length traveled by the satellite within the system. Tides excited by the satellite in the galaxy reduce the value of the energy loss by friction; in close encounters, this value is decreased by a factor of ~1.5.

Colpi, Monica; Pallavicini, Andrea



Alpha particle emitters in medicine  

SciTech Connect

Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

Fisher, D.R.



182Hf–182W age dating of a 26Al-poor inclusion and implications for the origin of short-lived radioisotopes in the early Solar System  

PubMed Central

Refractory inclusions [calcium–aluminum-rich inclusions, (CAIs)] represent the oldest Solar System solids and provide information regarding the formation of the Sun and its protoplanetary disk. CAIs contain evidence of now extinct short-lived radioisotopes (e.g., 26Al, 41Ca, and 182Hf) synthesized in one or multiple stars and added to the protosolar molecular cloud before or during its collapse. Understanding how and when short-lived radioisotopes were added to the Solar System is necessary to assess their validity as chronometers and constrain the birthplace of the Sun. Whereas most CAIs formed with the canonical abundance of 26Al corresponding to 26Al/27Al of ?5 × 10?5, rare CAIs with fractionation and unidentified nuclear isotope effects (FUN CAIs) record nucleosynthetic isotopic heterogeneity and 26Al/27Al of <5 × 10?6, possibly reflecting their formation before canonical CAIs. Thus, FUN CAIs may provide a unique window into the earliest Solar System, including the origin of short-lived radioisotopes. However, their chronology is unknown. Using the 182Hf–182W chronometer, we show that a FUN CAI recording a condensation origin from a solar gas formed coevally with canonical CAIs, but with 26Al/27Al of ?3 × 10?6. The decoupling between 182Hf and 26Al requires distinct stellar origins: steady-state galactic stellar nucleosynthesis for 182Hf and late-stage contamination of the protosolar molecular cloud by a massive star(s) for 26Al. Admixing of stellar-derived 26Al to the protoplanetary disk occurred during the epoch of CAI formation and, therefore, the 26Al–26Mg systematics of CAIs cannot be used to define their formation interval. In contrast, our results support 182Hf homogeneity and chronological significance of the 182Hf–182W clock. PMID:23671077

Holst, Jesper C.; Olsen, Mia B.; Paton, Chad; Nagashima, Kazuhide; Schiller, Martin; Wielandt, Daniel; Larsen, Kirsten K.; Connelly, James N.; Jørgensen, Jes K.; Krot, Alexander N.; Nordlund, Åke; Bizzarro, Martin



Climate response to projected changes in short-lived species under an A1B scenario from 2000-2050 in the GISS climate model  

SciTech Connect

We investigate the climate forcing from and response to projected changes in short-lived species and methane under the A1B scenario from 2000-2050 in the GISS climate model. We present a meta-analysis of new simulations of the full evolution of gas and aerosol species and other existing experiments with variations of the same model. The comparison highlights the importance of several physical processes in determining radiative forcing, especially the effect of climate change on stratosphere-troposphere exchange, heterogeneous sulfate-nitrate-dust chemistry, and changes in methane oxidation and natural emissions. However, the impact of these fairly uncertain physical effects is substantially less than the difference between alternative emission scenarios for all short-lived species. The net global mean annual average direct radiative forcing from the short-lived species is .02 W/m{sup 2} or less in our projections, as substantial positive ozone forcing is largely offset by negative aerosol direct forcing. Since aerosol reductions also lead to a reduced indirect effect, the global mean surface temperature warms by {approx}0.07 C by 2030 and {approx}0.13 C by 2050, adding 19% and 17%, respectively, to the warming induced by long-lived greenhouse gases. Regional direct forcings are large, up to 3.8 W/m{sup 2}. The ensemble-mean climate response shows little regional correlation with the spatial pattern of the forcing, however, suggesting that oceanic and atmospheric mixing generally overwhelms the effect of even large localized forcings. Exceptions are the polar regions, where ozone and aerosols may induce substantial seasonal climate changes.

Menon, Surabi; Shindell, Drew T.; Faluvegi, Greg; Bauer, Susanne E.; Koch, Dorothy M.; Unger, Nadine; Menon, Surabi; Miller, Ron L.; Schmidt, Gavin A.; Streets, David G.



182Hf-182W age dating of a 26Al-poor inclusion and implications for the origin of short-lived radioisotopes in the early Solar System.  


Refractory inclusions [calcium-aluminum-rich inclusions, (CAIs)] represent the oldest Solar System solids and provide information regarding the formation of the Sun and its protoplanetary disk. CAIs contain evidence of now extinct short-lived radioisotopes (e.g., (26)Al, (41)Ca, and (182)Hf) synthesized in one or multiple stars and added to the protosolar molecular cloud before or during its collapse. Understanding how and when short-lived radioisotopes were added to the Solar System is necessary to assess their validity as chronometers and constrain the birthplace of the Sun. Whereas most CAIs formed with the canonical abundance of (26)Al corresponding to (26)Al/(27)Al of ?5 × 10(-5), rare CAIs with fractionation and unidentified nuclear isotope effects (FUN CAIs) record nucleosynthetic isotopic heterogeneity and (26)Al/(27)Al of <5 × 10(-6), possibly reflecting their formation before canonical CAIs. Thus, FUN CAIs may provide a unique window into the earliest Solar System, including the origin of short-lived radioisotopes. However, their chronology is unknown. Using the (182)Hf-(182)W chronometer, we show that a FUN CAI recording a condensation origin from a solar gas formed coevally with canonical CAIs, but with (26)Al/(27)Al of ?3 × 10(-6). The decoupling between (182)Hf and (26)Al requires distinct stellar origins: steady-state galactic stellar nucleosynthesis for (182)Hf and late-stage contamination of the protosolar molecular cloud by a massive star(s) for (26)Al. Admixing of stellar-derived (26)Al to the protoplanetary disk occurred during the epoch of CAI formation and, therefore, the (26)Al-(26)Mg systematics of CAIs cannot be used to define their formation interval. In contrast, our results support (182)Hf homogeneity and chronological significance of the (182)Hf-(182)W clock. PMID:23671077

Holst, Jesper C; Olsen, Mia B; Paton, Chad; Nagashima, Kazuhide; Schiller, Martin; Wielandt, Daniel; Larsen, Kirsten K; Connelly, James N; Jørgensen, Jes K; Krot, Alexander N; Nordlund, Ake; Bizzarro, Martin



Short-lived species detection of nitrous acid by external-cavity quantum cascade laser based quartz-enhanced photoacoustic absorption spectroscopy  

NASA Astrophysics Data System (ADS)

Spectroscopic detection of short-lived gaseous nitrous acid (HONO) at 1254.85 cm-1 was realized by off-beam coupled quartz-enhanced photoacoustic spectroscopy (QEPAS) in conjunction with an external cavity quantum cascade lasers (EC-QCL). High sensitivity monitoring of HONO was performed within a very small gas-sample volume (of ˜40 mm3) allowing a significant reduction (of about 4 orders of magnitude) of air sampling residence time which is highly desired for accurate quantification of chemically reactive short-lived species. Calibration of the developed QEPAS-based HONO sensor was carried out by means of lab-generated HONO samples whose concentrations were determined by direct absorption spectroscopy involving a ˜109.5 m multipass cell and a distributed feedback QCL. A minimum detection limit (MDL) of 66 ppbv (1 ?) HONO was achieved at 70 mbar using a laser output power of 50 mW and 1 s integration time, which corresponded to a normalized noise equivalent absorption coefficient of 3.6 × 10-8 cm-1 W/Hz1/2. This MDL was down to 7 ppbv at the optimal integration time of 150 s. The corresponding 1? minimum detected absorption coefficient is ˜1.1 × 10-7 cm-1 (MDL ˜ 3 ppbv) in 1 s and ˜1.1 × 10-8 cm-1 (MDL ˜ 330 pptv) in 150 s, respectively, with 1 W laser power.

Yi, Hongming; Maamary, Rabih; Gao, Xiaoming; Sigrist, Markus W.; Fertein, Eric; Chen, Weidong



Which radionuclide, carrier molecule and clinical indication for alpha-immunotherapy?  


Beta-emitting radionuclides are not able to kill isolated tumor cells disseminated in the body, even if a high density of radiolabeled molecules can be targeted at the surface of these cells because the vast majority of emitted electrons deliver their energy outside the targeted cells. Alpha-particle emitting radionuclides may overcome this limitation. It is thus of primary importance to test and validate the radionuclide of choice, the most appropriate carrier molecule and the most promising clinical indication. Four ?-particle emitting radionuclides have been or are clinically tested in phase I studies namely 213Bi, 225Ac, 212Pb and 211At. Clinical safety has been documented and encouraging efficacy has been shown for some of them (213Bi and 211At). 211At has been the most studied and could be the most promising radionuclide but 225Ac and 212Pb are also of potential great interest. Any carrier molecule that has been labeled with ?-emitting radionuclides could be labeled with alpha particle-emitting radionuclide using, for some of them, the same chelating agents. However, the physical half-life of the radionuclide should match the biological half-life of the radioconjugate or its catabolites. Finally everybody agrees, based on the quite short range of alpha particles, on the fact that the clinical indications for alpha-immunotherapy should be limited to the situation of disseminated minimal residual diseases made of small clusters of malignant cells or isolated tumor cells. PMID:25752501

Guerard, F; Barbet, J; Chatal, J F; Kraeber-Bodere, F; Cherel, M; Haddad, F



Time-dependent isospin composition of particles emitted in fission events following Ar40+Au197 at 35 MeV/u  

NASA Astrophysics Data System (ADS)

Fission fragments resulting from the fission of target-like nuclei produced in the Ar40+Au197 reaction at 35 MeV/u are measured in coincidence with the emitted light charged particles (LCPs). Comparison of the N /Z composition of the LCPs at middle and large angles in the laboratory frame shows that particles emitted at smaller angles, which contain a larger contribution from dynamical emission, are more neutron rich. A moving-source model is used to fit the energy spectra of the hydrogen isotopes. A hierarchy from proton to deuteron and triton is observed in the multiplicity ratio between the intermediate velocity source and the compound nucleus source. This ratio is sensitive to the dynamical emission at early stages of the reaction and to statistical emission lasting up to the scission point. Calculations with the improved quantum molecular dynamics (ImQMD) transport-model qualitatively support the picture that more free and bound neutrons are emitted during the early stage, showing a clear dependence of N /Z on the parametrization of the symmetry energy. The time-dependent isospin composition of the emitted particles thus may be used to probe the symmetry energy at subsaturation densities.

Wang, R. S.; Zhang, Y.; Xiao, Z. G.; Tian, J. L.; Zhang, Y. X.; Wu, Q. H.; Duan, L. M.; Jin, G. M.; Hu, R. J.; Wang, S. F.; Li, Z. Y.; Wang, H. W.; Zhang, Z.; Yi, H.; Li, H. J.; Cheng, W. J.; Huang, Y.; Lü, L. M.



Development of a system for real-time measurements of metabolite transport in plants using short-lived positron-emitting radiotracers  

NASA Astrophysics Data System (ADS)

Over the past 200 years, the Earth's atmospheric carbon dioxide (CO 2) concentration has increased by more than 35%, and climate experts predict that CO2 levels may double by the end of this century. Understanding the mechanisms of resource management in plants is fundamental for predicting how plants will respond to the increase in atmospheric CO 2. Plant productivity sustains life on Earth and is a principal component of the planet's system that regulates atmospheric CO2 concentration. As such, one of the central goals of plant science is to understand the regulatory mechanisms of plant growth in a changing environment. Short-lived positron-emitting radiotracer techniques provide time-dependent data that are critical for developing models of metabolite transport and resource distribution in plants and their microenvironments. To better understand the effects of environmental changes on resource transport and allocation in plants, we have developed a system for real-time measurements of rnetabolite transport in plants using short-lived positron-emitting radio-tracers. This thesis project includes the design, construction, and demonstration of the capabilities of this system for performing real-time measurements of metabolite transport in plants. The short-lived radiotracer system described in this dissertation takes advantage of the combined capabilities and close proximity of two research facilities at. Duke University: the Triangle Universities Nuclear Laboratory (TUNL) and the Duke University Phytotron, which are separated by approximately 100 meters. The short-lived positron-emitting radioisotopes are generated using the 10-MV tandem Van de Graaff accelerator located in the main TUNL building, which provides the capability of producing short-lived positron-emitting isotopes such as carbon-11 (11C: 20 minute half-life), nitrogen-13 (13N; 10 minute half-life), fluorine-18 (18F; 110 minute half-life), and oxygen-15 (15O; 2 minute half-life). The radioisotopes may be introduced to plants as biologically active molecules such as 11CO2, N13O-3, 18F--[H2O], and H152O . Plants for these studies are grown in controlled-environment chambers at the Phytotron. The chambers offer an array of control for temperature, humidity, atmospheric CO2 concentration, and light intensity. Additionally, the Phytotron houses one large reach-in growth chamber that is dedicated to this project for radioisotope labeling measurements. There are several important properties of short-lived positron-emitting radio-tracers that make them well suited for use in investigating metabolite transport in plants. First, because the molecular mass of a radioisotope-tagged compound is only minutely different from the corresponding stable compound, radiotracer substances should be metabolized and transported in plants the same as their non-radioactive counterparts. Second, because the relatively high energy gamma rays emitted from electron-positron annihilation are attenuated very little by plant tissue, the real-time distribution of a radiotracer can be measured in vivo in plants. Finally, the short radioactive half-lives of these isotopes allow for repeat measurements on the same plant in a short period of time. For example, in studies of short-term environmental changes on plant metabolite dynamics, a single plant can be labeled multiple times to measure its responses to different, environmental conditions. Also, different short-lived radiotracers can be applied to the same plant over a short period of time to investigate the transport and allocation of various metabolites. This newly developed system provides the capabilities for production of 11CO2 at TUNL, transfer of the 11CO 2 gas from the target area at TUNL to a radiation-shielded cryogenic trap at the Phytotron, labeling of photoassimilates with 11C, and in vivo gamma-ray detection for real-time measurements of the radiotracer distribution in small plants. The experimental techniques and instrumentation that enabled the quantitative biological studies reported in this thesis were developed through a

Kiser, Matthew R.


Charge and frequency resolved isochronous mass spectrometry in storage rings: First direct mass measurement of the short-lived neutron-deficient $^{51}$Co nuclide  

E-print Network

Revolution frequency measurements of individual ions in storage rings require sophisticated timing detectors. One of common approaches for such detectors is the detection of secondary electrons released from a thin foil due to penetration of the stored ions. A new method based on the analysis of intensities of secondary electrons was developed which enables determination of the charge of each ion simultaneously with the measurement of its revolution frequency. Although the mass-over-charge ratios of $^{51}$Co$^{27+}$ and $^{34}$Ar$^{18+}$ ions are almost identical, and therefore, the ions can not be resolved in a storage ring, by applying the new method the mass excess of the short-lived $^{51}$Co is determined for the first time to be ME($^{51}$Co)=-27342(48) keV. Shell-model calculations in the $fp$-shell nuclei compared to the new data indicate the need to include isospin-nonconserving forces.

P. Shuai; H. S. Xu; X. L. Tu; Y. H. Zhang; B. H. Sun; Yu. A. Litvinov; X. L. Yan; K. Blaum; M. Wang; X. H. Zhou; J. J. He; Y. Sun; K. Kaneko; Y. J. Yuan; J. W. Xia; J. C. Yang; G. Audi; X. C. Chen; G. B. Jia; Z. G. Hu; X. W. Ma; R. S. Mao; B. Mei; Z. Y. Sun; S. T. Wang; G. Q. Xiao; X. Xu; T. Yamaguchi; Y. Yamaguchi; Y. D. Zang; H. W. Zhao; T. C. Zhao; W. Zhang; W. L. Zhan



The Effect of Observers’ Mood on the Local Processing of Emotional Faces: Evidence from Short-Lived and Prolonged Mood States  

PubMed Central

We examined the effect of induced mood, varying in valence and longevity, on local processing of emotional faces. It was found that negative facial expression conveyed by the global level of the face interferes with efficient processing of the local features. The results also showed that the duration of involvement with a mood influenced the local processing. We observed that attending to the local level of faces is not different in short-lived happy and sad mood states. However, as the mood state is experienced for a longer period, local processing was impaired in happy mood compared to sad mood. Taken together, we concluded that both facial expressions and affective states influence processing of the local parts of faces. Moreover, we suggest that mediating factors like the duration of involvement with the mood play a role in the interrelation between mood, attention, and perception.

Mokhtari, Setareh; Buttle, Heather



Modifications in Dynamic Contrast-Enhanced Magnetic Resonance Imaging Parameters After ?-Particle-Emitting {sup 227}Th-trastuzumab Therapy of HER2-Expressing Ovarian Cancer Xenografts  

SciTech Connect

Purpose: The purpose of this study was to investigate the effect of ?-particle-emitting {sup 227}Th-trastuzumab radioimmunotherapy on tumor vasculature to increase the knowledge about the mechanisms of action of {sup 227}Th-trastuzumab. Methods and Materials: Human HER2-expressing SKOV-3 ovarian cancer xenografts were grown bilaterally in athymic nude mice. Mice with tumor volumes 253 ± 36 mm{sup 3} (mean ± SEM) were treated with a single injection of either {sup 227}Th-trastuzumab at a dose of 1000 kBq/kg body weight (treated group, n=14 tumors) or 0.9% NaCl (control group, n=10 tumors). Dynamic T1-weighted contrast-enhanced magnetic resonance imaging (DCEMRI) was used to study the effect of {sup 227}Th-trastuzumab on tumor vasculature. DCEMRI was performed before treatment and 1, 2, and 3 weeks after therapy. Tumor contrast-enhancement curves were extracted voxel by voxel and fitted to the Brix pharmacokinetic model. Pharmacokinetic parameters for the tumors that underwent radioimmunotherapy were compared with the corresponding parameters of control tumors. Results: Significant increases of k{sub ep}, the rate constant of diffusion from the extravascular extracellular space to the plasma (P<.05), and k{sub el,} the rate of clearance of contrast agent from the plasma (P<.01), were seen in the radioimmunotherapy group 2 and 3 weeks after injection, compared with the control group. The product of k{sub ep} and the amplitude parameter A, associated with increased vessel permeability and perfusion, was also significantly increased in the radioimmunotherapy group 2 and 3 weeks after injection (P<.01). Conclusions: Pharmacokinetic modeling of MRI contrast-enhancement curves evidenced significant alterations in parameters associated with increased tumor vessel permeability and tumor perfusion after {sup 227}Th-trastuzumab treatment of HER2-expressing ovarian cancer xenografts.

Heyerdahl, Helen, E-mail: [Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital - The Norwegian Radium Hospital, Oslo (Norway); Røe, Kathrine [Department of Oncology, Division of Medicine, Akershus University Hospital, Lørenskog (Norway); Brevik, Ellen Mengshoel [Department of Research and Development, Algeta ASA, Oslo (Norway); Dahle, Jostein [Nordic Nanovector AS, Oslo (Norway)



Experimental investigation of the concept of a 'breathing zone' using a mannequin exposed to a point source of inertial/sedimenting particles emitted with momentum.  


An inhaling mannequin, CALTOOL, was used in a specially ventilated room to compare the concentrations inhaled with those sampled by samplers mounted across the breathing zone. The CALTOOL is made from metal sheets and consists of a cylindrical torso (42 x 24 x 54 cm) with a circular cylinder as head. A circular nozzle simulates the mouth. This nozzle is part of a cassette that holds a filter. The inhalation rate is not periodic but kept constant at nominally 20 l min(-1). The CALTOOL was placed in a horizontal air stream ( approximately 10 cm s(-1)) either facing or back to the wind. In front of the lower chest of the CALTOOL, a particle source was mounted which emitted particles with a momentum directed upwards at an angle of 45 degrees towards the CALTOOL. Five monodisperse aluminium oxide powders were used as test aerosols. The mass median aerodynamic diameters of the test aerosols ranged approximately 10 to 95 mum. Six conically shaped aerosol samplers were mounted horizontally and over the breathing zone of the CALTOOL, one on each shoulder, three across the upper torso, and one at the lower torso centre. Four to six runs per test aerosol and CALTOOL orientation in the airflow were conducted. The samples were analysed gravimetrically. The concentration ratio aerosol sampler to the CALTOOL cassette was determined for the investigated mounting positions. The results showed that when the CALTOOL was exposed to particles emitted with momentum from a point source in front of the lower chest, the variation in concentration over the breathing zone was large. The ratio of the concentration sampled by an aerosol sampler mounted somewhere within the breathing zone to the CALTOOL cassette concentration, would, for specific particle sizes, easily differ by a factor of 3, but may extend up to 10-100, depending on the particular conditions. The basic concept of a breathing zone consisting of a hemisphere of radius 25-30 cm is therefore not well suited for workers handling a point source emitting large particles. For such sampling situations, it is suggested that the radius of the breathing zone is reduced to 10 cm, which may be achieved by a head-mounted sampler. PMID:19955328

Lidén, Göran; Waher, Jüri



Short Lived Climate Pollutants cause a Long Lived Effect on Sea-level Rise: Analyzing climate metrics for sea-level rise  

NASA Astrophysics Data System (ADS)

Climate change depends on the increase of several different atmospheric pollutants. While long term global warming will be determined mainly by carbon dioxide, warming in the next few decades will depend to a large extent on short lived climate pollutants (SLCP). Reducing emissions of SLCPs could contribute to lower the global mean surface temperature by 0.5 °C already by 2050 (Shindell et al. 2012). Furthermore, the warming effect of one of the most potent SLCPs, black carbon (BC), may have been underestimated in the past. Bond et al. (2013) presents a new best estimate of the total BC radiative forcing (RF) of 1.1 W/m2 (90 % uncertainty bounds of 0.17 to 2.1 W/m2) since the beginning of the industrial era. BC is however never emitted alone and cooling aerosols from the same sources offset a majority of this RF. In the wake of calls for mitigation of SLCPs it is important to study other aspects of the climate effect of SLCPs. One key impact of climate change is sea-level rise (SLR). In a recent study, the effect of SLCP mitigation scenarios on SLR is examined. Hu et al (2013) find a substantial effect on SLR from mitigating SLCPs sharply, reducing SLR by 22-42% by 2100. We choose a different approach focusing on emission pulses and analyse a metric based on sea level rise so as to further enlighten the SLR consequences of SLCPs. We want in particular to understand the time dynamics of SLR impacts caused by SLCPs compared to other greenhouse gases. The most commonly used physical based metrics are GWP and GTP. We propose and evaluate an additional metric: The global sea-level rise potential (GSP). The GSP is defined as the sea level rise after a time horizon caused by an emissions pulse of a forcer to the sea level rise after a time horizon caused by an emissions pulse of a CO2. GSP is evaluated and compared to GWP and GTP using a set of climate forcers chosen to cover the whole scale of atmospheric perturbation life times (BC, CH4, N2O, CO2 and SF6). The study utilizes an upwelling diffusion energy balance model and focuses on the thermosteric part of sea-level rise. Example GSP results are 244, 15 and 278 for BC, CH4 and N2O for a time horizon of 100 years. Compare GWP and GTP values of 405, 24 and 288 as well as 62, 4.5 and 252. The main result of the study is that no climate forcer is in any absolute sense short lived when it comes to Sea Level impacts. All of the examined climate forcers have considerable influence on the thermosteric SLR, and the closely linked ocean heat content, on the time scale of centuries. The reason for this is that heat, once it has been induced by the climate drivers and warmed the surface ocean, is transported down into the slowly mixing oceans. References: Shindell, D. et al. Simultaneously mitigating near-term climate change and improving human health and food security. Science 335, 183-189 (2012). Bond, T. C. et al. Bounding the role of black carbon in the climate system: A scientific assessment. Journal of Geophysical Research: Atmospheres 118 5380-5552 (2013). Hu, A., Xu, Y., Tebaldi, C., Washington, W. M. & Ramanathan, V. Mitigation of short-lived climate pollutants slows sea-level rise. Nature Climate Change 3, 730-734 (2013).

Sterner, E.; Johansson, D. J.



The very short-lived ozone depleting substance CHBr3 (bromoform): Revised UV absorption spectrum, atmospheric lifetime and ozone depletion potential  

NASA Astrophysics Data System (ADS)

CHBr3 (bromoform) is a short-lived atmospheric trace gas primarily of natural origin that represents a source of reactive bromine (Bry; Br + BrO) in the troposphere as well as the stratosphere. The transport of short-lived brominated species, and their brominated degradation products, to the stratosphere is known to be particularly impactful to stratospheric ozone due to the high efficiency of ozone destruction cycles involving bromine. Evaluating the impact of CHBr3 on stratospheric ozone requires not only a thorough understanding of its emissions, but also its atmospheric loss processes, which are primarily UV photolysis and reaction with the OH radical. The total global lifetime of CHBr3 is ~24 days and is mostly governed by its photolytic loss. Therefore, accurate CHBr3 UV absorption cross section data for wavelengths (?) in the actinic region, greater than 290 nm, are needed to calculate its photolysis loss rate. Currently, there is a single study (Moortgat et al., Springer-Verlag Berlin Heidelberg, 1993; Vol. 17) that reports CHBr3 UV absorption cross sections and their temperature dependence in a wavelength and temperature range applicable for atmospheric photolysis rate calculations. However, there are indications that the reported longer wavelength cross section data, in the Moortgrat et al. study, might be subject to systematic errors which possibly lead to erroneous CHBr3 atmospheric photolysis rate calculations and a misleading picture of its impact on stratospheric ozone. In this study, UV absorption cross sections, ?(?,T), for CHBr3 were measured at wavelengths between 300 and 345 nm at temperatures between 260 and 330 K using cavity ring-down spectroscopy. A thorough investigation of possible sources of systematic error in the measurements is presented. The present UV absorption cross sections at longer wavelength (>310 nm) are systematically lower compared to currently recommended values for use in atmospheric models, with the deviation being more pronounced as wavelength increases and temperature decreases. The source of this discrepancy is further discussed. A parameterization of the CHBr3 UV spectrum for use in atmospheric models is developed and illustrative photolysis rate calculations are presented to highlight the impact of the revised ?(?,T) values on its calculated local lifetimes. For instance, CHBr3 atmospheric photolysis rate in the tropical region obtained with the present spectral data was found to be 10-15% lower (longer lifetime) than that obtained using the currently recommended values. Moreover, seasonally dependent ozone depletion potentials (ODPs) for CHBr3 emitted in the Indian sub-continent were calculated using the semi-empirical relationship of Brioude et al. (Brioude et al., Geophys. Res. Lett., 37, L19804, doi: 10.1029/2010GL044856, 2010) to evaluate the impact of the present results on stratospheric ozone. In conclusion, the present study reports improved UV absorption cross section data for the short-lived ozone depleting substance CHBr3, which are a result of high quality measurements and a thorough investigation of possible sources of systematic error. The CHBr3 UV cross section data, from this study, combined with OH kinetic data enables more accurate model predictions of stratospheric bromine loading and its impact on stratospheric ozone.

Papanastasiou, Dimitrios K.; McKeen, Stuart A.; Burkholder, James B.



An alternative approach to comparing long- and short-lived emissions in light of the 2&amp;deg;C global temperature limit  

NASA Astrophysics Data System (ADS)

International climate policy has defined its goal in terms of limiting global average temperature, specifically to 2°C above pre-industrial levels. Emissions of several different greenhouse gases (GHGs) are currently aggregated and traded in terms of their carbon dioxide equivalent. The metric used for aggregating and trading is the 100-year Global Warming Potential (GWP100). Importantly though, the GWP100 does not measure temperature and so does clearly indicate the relative value of different emissions in the context of a global temperature limit. Recent developments in climate research have led to two different, potentially conflicting, perspectives on priorities in reducing emissions. First, a clear link has been demonstrated between cumulative emissions of carbon dioxide and peak temperature. This emphasises the need for carbon dioxide emissions to fall to near zero and provides a conceptually neat way to frame policy, but says little about the role of other GHGs. Second, other studies have shown that emissions of short-lived climate pollutants (SLCPs), many of which currently lie outside climate policy, have a substantial near-term effect on climate. It has been suggested that immediate SLCP reductions will therefore increase the chance of staying below 2°C and may even "buy time" for carbon dioxide reductions. This presentation summarises two recent papers which clarify the roles of SLCPs and long-lived GHGs in determining peak global temperature, and propose new emission metrics to reflect these. SLCP emissions reductions in a given decade have a significant impact on peak temperature only if carbon dioxide emissions are already falling. Immediate action on SLCPs might potentially "buy time" for adaptation by reducing near-term warming, but it does not buy time to delay reductions in carbon dioxide compared with delayed SLCP reductions. Peak temperature is ultimately constrained by cumulative emissions of several long-lived gases (including carbon dioxide) and sustained emission rates of a separate basket of shorter-lived species (including methane and other SLCPs). For these two baskets we develop an emissions-equivalence metric which allows trading within, but not between, each basket. The 2°C limit could therefore be met by setting a limit to cumulative long-lived emissions while setting a maximum future rate for short-lived emissions.

Smith, Stephen; Bowerman, Niel; Lowe, Jason; Huntingford, Chris; Frame, Dave; Allen, Myles; Gohar, Laila; Millar, Richard



Increased Concentrations of Short-Lived Decay-Series Radionuclides in Groundwaters Underneath the Nopal I Uranium Deposit at Pena Blanca, Mexico  

NASA Astrophysics Data System (ADS)

The Nopal I uranium ore deposit at Pena Blanca, Mexico, located at > 200 meters above the groundwater table, provides an ideal natural analog for quantifying the effectiveness of geological barrier for isolation of radioactive waste nuclides from reaching the human environments through ground water transport. To fulfill such natural analog studies, three wells (PB1, PB2, and PB3 respectively) were drilled at the site from the land surface down to the saturated groundwater zone and ground waters were collected from each of these wells through large- volume sampling/in-situ Mn-filter filtration for analyses of short-lived uranium/thorium-series radionuclides. Our measurements from PB1 show that the groundwater standing in the hole has much lower 222Rn activity than the freshly pumped groundwater. From this change in 222Rn activity, we estimate the residence time of groundwater in PB1 to be about 20 days. Our measurements also show that the activities of short-lived radioisotopes of Th (234Th), Ra (228Ra, 224Ra, 223Ra), Rn (222Rn), Pb (210Pb), and Po (210Po) in PB1, PB2, and PB3 are all significantly higher than those from the other wells near the Nopal I site. These high activities provide evidence for the enrichment of long-lived U and Ra isotopes in the groundwater as well as in the associated adsorbed phases on the fractured aquifer rocks underneath the ore deposit. Such enrichment suggests a rapid dissolution of U and Ra isotopes from the uranium ore deposit in the vadose zone and the subsequent migration to the groundwater underneath. A reactive transport model can be established to characterize the in-situ transport of radionuclides at the site. The observed change of 222Rn activity at PB1 also suggests that the measured high radioactivityies in ground waters from the site isare not an artifact of drilling operations. However, further studies are needed to assess if or to what extent the radionuclide migration is affected by the previous mining activities at the site.

Luo, S.; Ku, T.; Todd, V.; Murrell, M. T.; Dinsmoor, J. C.



Quantification of regional ventilation in humans using a short-lived radiotracer--theoretical evaluation of the steady-state model  

SciTech Connect

The accuracy of the steady-state measurement of ventilation by means of a short-lived insoluble inert gas tracer rests with the validity of the steady-state flow equation. This has previously been applied to the qualitative assessment of regional ventilation using krypton-81m, but may potentially be used for the calculation of regional alveolar ventilation per unit alveolar gas volume--(VA/VA)cal--from measurements of the alveolar concentration of the tracer. The steady-state alveolar tracer concentration was calculated for the course of a breathing cycle, using a lung model featuring airways dead space and tidal gas flow. The calculations were made by computer simulations of a lung, characterized by predefined values of parameters describing the lung structure and the mode of ventilation. In the normal lung of supine man at rest (specific alveolar ventilation, ranging from 1.0 to 3.5 min-1) the errors of (VA/VA)cal relative to the predefined true values range from an overestimation by some 3% in the low ventilation regions to an underestimation by 8% in the best ventilated regions. The errors mainly result from ventilation of the airways dead space, which will influence the distribution of tracer in the lung by the transfer of tracer between regions by way of the common dead space and by the decay of tracer during its transport through the bronchial tree.

Valind, S.O.; Rhodes, C.G.; Jonson, B.



Diurnal variation climatology of short-lived at atmospheric compositions (ClO, BrO, HO2 and HOCl) derived from SMILES NICT data  

NASA Astrophysics Data System (ADS)

We present a diurnal variation climatology for short-lived at atmospheric compositions, such as ClO, BrO, HO2 and HOCl, as well as for longer life time species, like O3 and HCl from observations of unprecedented sensitivity with the Superconducting SubMIllimeter wave Limb-Emission Sounder (SMILES), which is installed on the Japanese Experiment Module (JEM) at the International Space Station (ISS). With its non sun synchronous orbit, SMILES measurements comprise observations at all local times. The target altitude range is between lower stratosphere and mesopause. Differences in diurnal variation chemistry of strato-, and mesospheric BrO and ClO of the diurnal climatology are presented. The data employed is produced by the SMILES level 2 retrieval algorithm version 2.1.5 at the National Institute of Information and Communications Technology (NICT). The SMILES climatology data sets are available via the SMILES data distribution homepage in NICT at

Kreyling, Daniel; Sagawa, Hideo; Kasai, Yasuko



Preliminary Results of IS Plasma Focus as a Breeder of Short-Lived Radioisotopes 12C(d,n)13N  

NASA Astrophysics Data System (ADS)

Modified IS (Iranian Sun) plasma focus (10 kJ,15 kV, 94 ?F, 0.1 Hz) has been used to produce the short-lived radioisotope 13N (half-life of 9.97 min) through 12C(d,n)13N nuclear reaction. The filling gas was 1.5-3 torr of hydrogen (60%) deuterium (40%) mixture. The target was solid nuclear grade graphite with 5 mm thick, 9 cm width and 13 in length. The activations of the exogenous target on average of 20 shots (only one-third acceptable) through 10-13 kV produced the 511 keV gamma rays. Another peak found at the 570 keV gamma of which both was measured by a NaI portable gamma spectrometer calibrated by a 137Cs 0.25 ?Ci sealed reference source with its single line at 661.65 keV and 22Na 0.1 ?Ci at 511 keV. To measure the gamma rays, the graphite target converts to three different phases; solid graphite, powder graphite, and powder graphite in water solution. The later phase approximately has a doubled activity with respect to the solid graphite target up to 0.5 ?Ci of 511 keV and 1.1 ?Ci of 570 keV gamma lines were produced. This increment in activity was perhaps due to structural transformation of graphite powder to nano-particles characteristic in liquid water.

Sadat Kiai, S. M.; Elahi, M.; Adlparvar, S.; Shahhoseini, E.; Sheibani, S.; Ranjber akivaj, H.; Alhooie, S.; Safarien, A.; Farhangi, S.; Aghaei, N.; Amini, S.; Khalaj, M. M.; Zirak, A. R.; Dabirzadeh, A. A.; Soleimani, J.; Torkzadeh, F.; Mousazadeh, M. M.; Moradi, K.; Abdollahzadeh, M.; Talaei, A.; Zaeem, A. A.; Moslehi, A.; Kashani, A.; Babazadeh, A. R.; Bagiyan, F.; Ardestani, M.; Roozbahani, A.; Pourbeigi, H.; Tajik Ahmadi, H.; Ahmadifaghih, M. A.; Mahlooji, M. S.; Mortazavi, B. N.; Zahedi, F.



Near-infrared laser induced conformational change and UV laser photolysis of glycine in low-temperature matrices: Observation of a short-lived conformer  

NASA Astrophysics Data System (ADS)

The near-infrared spectrum (NIR) of glycine was measured in Ar and Kr matrices. Matrix-isolated glycine was irradiated with NIR laser light at the first OH or NH stretching overtone bands of the three main glycine (ttt/Ip, ccc/IIn, tct/IIIp) conformers. The main conversion paths and their efficiencies are described qualitatively, and it is shown that there are significant differences in the conversion paths in Ar and Kr. In the detailed analysis of these experiments many new, formerly unobserved low-intensity transitions of the three main conformers were identified, and in addition a short-lived (tunneling half-life is 5 ± 2 s) higher energy conformer (ttc/VIp) was observed during the irradiation at the first OH stretching overtone of ttt/Ip. The UV spectrum of glycine was also measured in Ar matrix, and the first two absorption bands of conformers ttt/Ip and ccc/IIn were identified. UV laser irradiation at longer (240 nm) wavelengths promotes rotamerization, while at shorter wavelengths (235 and 213.5 nm) it results in depletion of the different conformers with different rates. Analysis of spectra recorded after UV irradiation showed that the two main photodecomposition processes are decarboxylation and H2O loss, forming methylamine and NH2CHCO, respectively.

Bazsó, Gábor; Magyarfalvi, Gábor; Tarczay, György



Detection of the short-lived cation radical intermediate in the electrochemical oxidation of N,N-dimethylaniline by scanning electrochemical microscopy.  


The short-lived intermediate N,N-dimethylaniline (DMA) cation radical, DMA(•+), was detected during the oxidation of DMA in MeCN with 0.1 M tetra-n-butylammonium hexafluorophosphate. The detection was accomplished at steady state by scanning electrochemical microscopy (SECM) with ultramicroelectrodes using the tip generation/substrate collection mode. Cyclic voltammetry (CV) with a 2 mm Pt electrode indicates that DMA oxidation in acetonitrile is followed by a dimerization and two electrochemical reactions, which is consistent with previous results. The DMA(•+) intermediate is detected by SECM, where the DMA(•+) generated at the ca. 500 nm radius Pt tip is collected on a 5 ?m radius Pt substrate when the gap between the tip and the substrate is a few hundred nanometers. Almost all of the DMA(•+) is reduced at the substrate when the gap is 200 nm or less, yielding a dimerization rate constant of 2.5 × 10(8) M(-1)·s(-1) based on a simulation. This is roughly 3 orders of magnitude larger than the value estimated by fast-scan CV. We attribute this discrepancy to the effects of double-layer capacitance charging and adsorbed species in the high scan rate CV. PMID:25478724

Cao, Fahe; Kim, Jiyeon; Bard, Allen J



The very short-lived ozone depleting substance CHBr3 (bromoform): revised UV absorption spectrum, atmospheric lifetime and ozone depletion potential  

NASA Astrophysics Data System (ADS)

CHBr3 (bromoform) is a short-lived atmospheric trace compound that is primarily of natural origin and is a source of reactive bromine in both the troposphere and stratosphere. Estimating the overall atmospheric impact of CHBr3 and its transport to the stratosphere requires a thorough understanding of its atmospheric loss processes, which are primarily UV photolysis and reaction with the OH radical. In this study, UV absorption cross sections, ? (?,T), for CHBr3 were measured at wavelengths between 300 and 345 nm at temperatures between 260 and 330 K using cavity ring-down spectroscopy. The present results are compared with currently recommended values for use in atmospheric models and the discrepancies are discussed. A parameterization of the CHBr3 UV spectrum for use in atmospheric models is developed and illustrative photolysis rate calculations are presented to highlight the impact of the revised ? (?,T) values on its calculated local lifetimes. Seasonally dependent ozone depletion potentials (ODPs) for CHBr3 emitted in the Indian sub-continent were calculated to be 0.08, 0.26, 0.54, and 0.17 (Winter, Spring, Summer, Fall) using the semi-empirical relationship of Brioude et al. (2010).

Papanastasiou, D. K.; McKeen, S. A.; Burkholder, J. B.



The very short-lived ozone depleting substance CHBr3 (bromoform): revised UV absorption spectrum, atmospheric lifetime and ozone depletion potential  

NASA Astrophysics Data System (ADS)

CHBr3 (bromoform) is a short-lived atmospheric trace compound that is primarily of natural origin and is a source of reactive bromine in both the troposphere and stratosphere. Estimating the overall atmospheric impact of CHBr3 and its transport to the stratosphere requires a thorough understanding of its atmospheric loss processes, which are primarily UV photolysis and reaction with the OH radical. In this study, UV absorption cross sections, ? (? ,T), for CHBr3 were measured at wavelengths between 300 and 345 nm at temperatures between 260 and 330 K using cavity ring-down spectroscopy. The present results are compared with currently recommended values for use in atmospheric models, and the discrepancies are discussed. A parameterization of the CHBr3 UV spectrum for use in atmospheric models is developed, and illustrative photolysis rate calculations are presented to highlight the impact of the revised ? (?, T) values on its calculated local lifetimes. For example, the photolysis rate in the tropical region obtained with the present spectral data is 10-15% lower (longer lifetime) than obtained using currently recommended cross section values. Seasonally dependent ozone depletion potentials (ODPs) for CHBr3 emitted in the Indian sub-continent were calculated to be 0.10, 0.34, 0.72, and 0.23 (winter, spring, summer, fall) using the semi-empirical relationship of Brioude et al. (2010).

Papanastasiou, D. K.; McKeen, S. A.; Burkholder, J. B.



4-Amino-3 H-pyrimidin-2-one ("isocytosine") is a short-lived non-radical intermediate formed in the pulse radiolysis of cytosine in aqueous solution  

NASA Astrophysics Data System (ADS)

In the pulse radiolysis of 2'-deoxycytidine (dCyd) in N 2O-saturated solutions containing 0.5 M tertiary butanol to completely scavenge the water radicals, a short-lived intermediate ( ?=287 nm) is observed by UV spectroscopy which is attributed to dCydH +, generated in the reaction of dCyd with H + formed during the pulse. By reacting with OH -, which is formed in the pulse in amounts matching that of H +, this intermediate disappears in the ?s time range without a change of the spectrum. Similarly, cytosine (Cyt) gives rise to CytH + which, in contrast, in part transforms into another species ( ?=286 nm) which can be assigned to isocytosine 1, 4-amino-3 H-pyrimidin-2-one, a tautomer of Cyt which is formed by two routes, (i) deprotonation of CytH + at N(1) by OH - and (ii) deprotonation of Cyt and reprotonation of the Cyt anion by water at N(3). Compared to Cyt, 1 is richer in Gibbs' free enthalpy by 14 kJ mol -1. Its presence in low equilibrium concentrations has also been observed by conventional UV spectroscopy, making use of the increase of its equilibrium concentration with increasing temperature. From these data, an absorption coefficient of 3.3×10 4 dm 3 mol -1 cm -1 at 286 nm has been calculated. Supporting quantum chemical calculations are also reported.

Nien Schuchmann, Man; Naumov, Sergej; Schuchmann, Heinz-Peter; von Sonntag, Justus; von Sonntag, Clemens



Climate impacts of short-lived climate forcers versus CO2 from biodiesel: a case of the EU on-road sector.  


Biofuels are proposed to play an important role in several mitigation strategies to meet future CO2 emission targets for the transport sector but remain controversial due to significant uncertainties in net impacts on environment, society, and climate. A switch to biofuels can also affect short-lived climate forcers (SLCFs), which provide significant contributions to the net climate impact of transportation. We quantify the radiative forcing (RF) and global-mean temperature response over time to EU on-road fossil diesel SLCFs and the impact of 20% (B20) and 100% (B100) replacement of fossil diesel by biodiesel. SLCFs are compared to impacts of on-road CO2 using different approaches from existing literature to account for biodiesel CO2. Given the best estimates for changes in emissions when replacing fossil diesel with biodiesel, the net positive RF from EU on-road fossil diesel SLCFs of 3.4 mW/m(2) is reduced by 15% and 80% in B20 and B100, respectively. Over time the warming of SLCFs is likely small compared to biodiesel CO2 impacts. However, SLCFs may be relatively more important for the total warming than in the fossil fuel case if biodiesel from feedstock with very short rotation periods and low land-use-change impacts replaces a high fraction of fossil diesel. PMID:25405926

Lund, Marianne T; Berntsen, Terje K; Fuglestvedt, Jan S



Tropospheric ozone and its precursors from the urban to the global scale from air quality to short-lived climate forcer  

NASA Astrophysics Data System (ADS)

Ozone holds a certain fascination in atmospheric science. It is ubiquitous in the atmosphere, central to tropospheric oxidation chemistry, yet harmful to human and ecosystem health as well as being an important greenhouse gas. It is not emitted into the atmosphere but is a by-product of the very oxidation chemistry it largely initiates. Much effort is focussed on the reduction of surface levels of ozone owing to its health impacts but recent efforts to achieve reductions in exposure at a country scale have proved difficult to achieve due to increases in background ozone at the zonal hemispheric scale. There is also a growing realisation that the role of ozone as a short-lived climate pollutant could be important in integrated air quality climate-change mitigation. This review examines current understanding of the processes regulating tropospheric ozone at global to local scales from both measurements and models. It takes the view that knowledge across the scales is important for dealing with air quality and climate change in a synergistic manner.

Monks, P. S.; Archibald, A. T.; Colette, A.; Cooper, O.; Coyle, M.; Derwent, R.; Fowler, D.; Granier, C.; Law, K. S.; Stevenson, D. S.; Tarasova, O.; Thouret, V.; von Schneidemesser, E.; Sommariva, R.; Wild, O.; Williams, M. L.



Apparatus for detecting alpha radiation in difficult access areas  


An electrostatic alpha radiation detector for measuring alpha radiation emitted from inside an enclosure comprising an electrically conductive expandable electrode for insertion into the enclosure is disclosed. After insertion, the electrically conductive expandable electrode is insulated from the enclosure and defines a decay cavity between the electrically conductive expandable electrode and the enclosure so that air ions generated in the decay cavity are electrostatically captured by the electrically conductive expandable electrode and the enclosure when an electric potential is applied between the electrically conductive expandable electrode and the enclosure. Indicator means are attached to the electrically conductive expandable electrode for indicating an electrical current produced by generation of the air ions generated in the decay cavity by collisions between air molecules and the alpha particles emitted from the enclosure. A voltage source is connected between the indicator means and the electrically conductive enclosure for creating an electric field between the electrically conductive expandable electrode and the enclosure. 4 figs.

Steadman, P.; MacArthur, D.W.




SciTech Connect

The short-lived radionuclide {sup 41}Ca plays an important role in constraining the immediate astrophysical environment and the formation timescale of the nascent solar system due to its extremely short half-life (0.1 Myr). Nearly 20 years ago, the initial ratio of {sup 41}Ca/{sup 40}Ca in the solar system was determined to be (1.41 {+-} 0.14) Multiplication-Sign 10{sup -8}, primarily based on two Ca-Al-rich Inclusions (CAIs) from the CV chondrite Efremovka. With an advanced analytical technique for isotopic measurements, we reanalyzed the potassium isotopic compositions of the two Efremovka CAIs and inferred the initial ratios of {sup 41}Ca/{sup 40}Ca to be (2.6 {+-} 0.9) Multiplication-Sign 10{sup -9} and (1.4 {+-} 0.6) Multiplication-Sign 10{sup -9} (2{sigma}), a factor of 7-10 lower than the previously inferred value. Considering possible thermal processing that led to lower {sup 26}Al/{sup 27}Al ratios in the two CAIs, we propose that the true solar system initial value of {sup 41}Ca/{sup 40}Ca should have been {approx}4.2 Multiplication-Sign 10{sup -9}. Synchronicity could have existed between {sup 26}Al and {sup 41}Ca, indicating a uniform distribution of the two radionuclides at the time of CAI formation. The new initial {sup 41}Ca abundance is 4-16 times lower than the calculated value for steady-state galactic nucleosynthesis. Therefore, {sup 41}Ca could have originated as part of molecular cloud materials with a free decay time of 0.2-0.4 Myr. Alternative possibilities, such as a last-minute input from a stellar source and early solar system irradiation, could not be definitively ruled out. This underscores the need for more data from diverse CAIs to determine the true astrophysical origin of {sup 41}Ca.

Liu, Ming-Chang [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei, Taiwan (China); Chaussidon, Marc [Centre de Recherches Petrographiques et Geochimiques, CNRS, Nancy (France); Srinivasan, Gopalan [Center for Earth Science, Indian Institute of Science, Bangalore (India); McKeegan, Kevin D., E-mail: [Department of Earth and Space Sciences, UCLA, Los Angeles, CA (United States)



The serpin secreted by Brugia malayi microfilariae, Bm-SPN-2, elicits strong, but short-lived, immune responses in mice and humans.  


Understanding the basic immunology of an infectious disease requires insight into the pattern of T cell reactivity and specificity. Although lymphatic filariasis is a major tropical disease, the predominant T cell Ags of filarial species such as Brugia malayi are still undefined. We have now identified a prominent T cell Ag from B. malayi microfilariae (Mf) as Bm-SPN-2, a serpin secreted exclusively by this stage. Mf-infected mice mounted strong, but short-lived, Bm-SPN-2-specific Th1 responses, measured by in vitro production of IFN-gamma, but not IL-4 or IL-5, 14 days postinfection. By day 35, responsiveness to Bm-SPN-2 was lost despite enhanced reactivity to whole Mf extract. Single immunization with Mf extract also stimulated typical Th1 reactions to Bm-SPN-2, but IgG1 Ab responses dominated after repeated immunizations. Human patients displayed potent humoral responses to Bm-SPN-2 in both IgG1 and IgG4 subclasses. Thus, 100% (20 of 20) of the microfilaremic (MF(+)) patients bore IgG4 responses to Bm-SPN-2, while only 30% of endemic normal subjects were similarly positive. Following chemotherapy, Bm-SPN-2-specific Abs disappeared in 12 of 13 MF(+) patients, although the majority remained seropositive for whole parasite extract. PBMC from most, but not all, endemic subjects were induced to secrete IFN-gamma when stimulated with Bm-SPN-2. These findings demonstrate that Bm-SPN-2 is recognized by both murine and human T and B cells and indicate that their responses are under relatively stringent temporal control. This study also provides the first example of a stage-specific secreted molecule that acts as a major T cell Ag from filarial parasites and is a prime candidate for a serodiagnostic probe. PMID:11046048

Zang, X; Atmadja, A K; Gray, P; Allen, J E; Gray, C A; Lawrence, R A; Yazdanbakhsh, M; Maizels, R M



Stepwise Catalytic Mechanism via Short-Lived Intermediate Inferred from Combined QM/MM MERP and PES Calculations on Retaining Glycosyltransferase ppGalNAcT2  

PubMed Central

The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals. PMID:25849117

Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Ko?a, Jaroslav




SciTech Connect

A variety of stellar sources have been proposed for the origin of the short-lived radioisotopes that existed at the time of the formation of the earliest solar system solids, including Type II supernovae (SNe), asymptotic giant branch (AGB) and super-AGB stars, and Wolf-Rayet star winds. Our previous adaptive mesh hydrodynamics models with the FLASH2.5 code have shown which combinations of shock wave parameters are able to simultaneously trigger the gravitational collapse of a target dense cloud core and inject significant amounts of shock wave gas and dust, showing that thin SN shocks may be uniquely suited for the task. However, recent meteoritical studies have weakened the case for a direct SN injection to the presolar cloud, motivating us to re-examine a wider range of shock wave and cloud core parameters, including rotation, in order to better estimate the injection efficiencies for a variety of stellar sources. We find that SN shocks remain as the most promising stellar source, though planetary nebulae resulting from AGB star evolution cannot be conclusively ruled out. Wolf-Rayet (WR) star winds, however, are likely to lead to cloud core shredding, rather than to collapse. Injection efficiencies can be increased when the cloud is rotating about an axis aligned with the direction of the shock wave, by as much as a factor of {approx}10. The amount of gas and dust accreted from the post-shock wind can exceed that injected from the shock wave, with implications for the isotopic abundances expected for a SN source.

Boss, Alan P.; Keiser, Sandra A., E-mail:, E-mail: [Department of Terrestrial Magnetism, Carnegie Institution, 5241 Broad Branch Road, NW, Washington, DC 20015-1305 (United States)



A Lower Initial Abundance of Short-lived 41Ca in the Early Solar System and Its Implications for Solar System Formation  

NASA Astrophysics Data System (ADS)

The short-lived radionuclide 41Ca plays an important role in constraining the immediate astrophysical environment and the formation timescale of the nascent solar system due to its extremely short half-life (0.1 Myr). Nearly 20 years ago, the initial ratio of 41Ca/40Ca in the solar system was determined to be (1.41 ± 0.14) × 10-8, primarily based on two Ca-Al-rich Inclusions (CAIs) from the CV chondrite Efremovka. With an advanced analytical technique for isotopic measurements, we reanalyzed the potassium isotopic compositions of the two Efremovka CAIs and inferred the initial ratios of 41Ca/40Ca to be (2.6 ± 0.9) × 10-9 and (1.4 ± 0.6) × 10-9 (2?), a factor of 7-10 lower than the previously inferred value. Considering possible thermal processing that led to lower 26Al/27Al ratios in the two CAIs, we propose that the true solar system initial value of 41Ca/40Ca should have been ~4.2 × 10-9. Synchronicity could have existed between 26Al and 41Ca, indicating a uniform distribution of the two radionuclides at the time of CAI formation. The new initial 41Ca abundance is 4-16 times lower than the calculated value for steady-state galactic nucleosynthesis. Therefore, 41Ca could have originated as part of molecular cloud materials with a free decay time of 0.2-0.4 Myr. Alternative possibilities, such as a last-minute input from a stellar source and early solar system irradiation, could not be definitively ruled out. This underscores the need for more data from diverse CAIs to determine the true astrophysical origin of 41Ca.

Liu, Ming-Chang; Chaussidon, Marc; Srinivasan, Gopalan; McKeegan, Kevin D.



Concentrated fish oil (Lovaza®) extends lifespan and attenuates kidney disease in lupus-prone short-lived (NZBxNZW)F1 mice  

PubMed Central

A growing number of reports indicate that anti-inflammatory actions of fish oil (FO) are beneficial against systemic lupus erythematosus (SLE). However, the majority of pre-clinical studies were performed using 5–20% FO, which is higher than the clinically relevant dose for lupus patients. The present study was performed in order to determine the effective low dose of FDA-approved concentrated FO (Lovaza®) compared to the commonly used FO-18/12 (18-Eicosapentaenoic acid [EPA]/12-Docosahexaenoic acid [DHA]). We examined the dose-dependent response of Lovaza® (1% and 4%) on an SLE mouse strain (NZB×NZW)F1 and compared the same with 1% and 4% placebo, as well as 4% FO-18/12, maintaining standard chow as the control. Results show for the first time that 1% Lovaza® extends maximal lifespan (517 d) and 4% Lovaza® significantly extends both the median (502 d) and maximal (600 d) life span of (NZB×NZW)F1 mice. In contrast, FO-18/12 extends only median lifespan (410 d) compared to standard chow diet (301 d). Additionally, 4% Lovaza® significantly decreased anti-dsDNA antibodies, reduced glomerulonephritis and attenuated lipopolysaccharide-induced pro-inflammatory cytokines (IL-1?, IL-6, TNF-?) in splenocytes compared to placebo. 4% Lovaza® was also shown to reduce the expression of inflammatory cytokines, including IL-1?, IL-6 and TNF-?, while increasing renal anti-oxidant enzymes in comparison to placebo. Notably, NF?B activation and p65 nuclear translocation were lowered by 4% Lovaza® compared to placebo. These data indicate that 1% Lovaza® is beneficial, but 4% Lovaza® is more effective in suppressing glomerulonephritis and extending life span of SLE-prone short-lived mice, possibly via reducing inflammation signaling and modulating oxidative stress. PMID:23918873

Halade, Ganesh V; Williams, Paul J; Veigas, Jyothi M; Barnes, Jeffrey L; Fernandes, Gabriel



Stepwise Catalytic Mechanism via Short-Lived Intermediate Inferred from Combined QM/MM MERP and PES Calculations on Retaining Glycosyltransferase ppGalNAcT2.  


The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals. PMID:25849117

Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Ko?a, Jaroslav



Chronic Parasitic Infection Maintains High Frequencies of Short-Lived Ly6C+CD4+ Effector T Cells That Are Required for Protection against Re-infection  

PubMed Central

In contrast to the ability of long-lived CD8+ memory T cells to mediate protection against systemic viral infections, the relationship between CD4+ T cell memory and acquired resistance against infectious pathogens remains poorly defined. This is especially true for T helper 1 (Th1) concomitant immunity, in which protection against reinfection coincides with a persisting primary infection. In these situations, pre-existing effector CD4 T cells generated by ongoing chronic infection, not memory cells, may be essential for protection against reinfection. We present a systematic study of the tissue homing properties, functionality, and life span of subsets of memory and effector CD4 T cells activated in the setting of chronic Leishmania major infection in resistant C57Bl/6 mice. We found that pre-existing, CD44+CD62L?T-bet+Ly6C+ effector (TEFF) cells that are short-lived in the absence of infection and are not derived from memory cells reactivated by secondary challenge, mediate concomitant immunity. Upon adoptive transfer and challenge, non-dividing Ly6C+ TEFF cells preferentially homed to the skin, released IFN-?, and conferred protection as compared to CD44+CD62L?Ly6C? effector memory or CD44+CD62L+Ly6C? central memory cells. During chronic infection, Ly6C+ TEFF cells were maintained at high frequencies via reactivation of TCM and the TEFF themselves. The lack of effective vaccines for many chronic diseases may be because protection against infectious challenge requires the maintenance of pre-existing TEFF cells, and is therefore not amenable to conventional, memory inducing, vaccination strategies. PMID:25473946

Peters, Nathan C.; Pagán, Antonio J.; Lawyer, Phillip G.; Hand, Timothy W.; Henrique Roma, Eric; Stamper, Lisa W.; Romano, Audrey; Sacks, David L.




SciTech Connect

Short-lived radionuclides (SLRs) in the early solar system provide fundamental insight into protoplanetary disk evolution. We measured the {sup 36}Cl-{sup 36}S-isotope abundance in wadalite (<15 {mu}m), a secondary chlorine-bearing mineral found in calcium-aluminum-rich inclusions (CAIs) in the Allende CV chondrite, to decipher the origin of the SLR {sup 36}Cl ({tau}{sub 1/2} {approx} 3 x 10{sup 5} yr) in the early solar system. Its presence, initial abundance, and the noticeable decoupling from {sup 26}Al raise serious questions about the origin of SLRs. The inferred initial {sup 36}Cl abundance for wadalite, corresponding to a {sup 36}Cl/{sup 35}Cl ratio of (1.81 {+-} 0.13) x 10{sup -5}, is the highest {sup 36}Cl abundance ever reported in any early solar system material. The high level of {sup 36}Cl in wadalite and the absence of {sup 26}Al ({sup 26}Al/{sup 27}Al {<=} 3.9 x 10{sup -6}) in co-existing grossular (1) unequivocally support the production of {sup 36}Cl by late-stage solar energetic particle irradiation in the protoplanetary disk and (2) indicates that the production of {sup 36}Cl, recorded by wadalite, is unrelated to the origin of {sup 26}Al and other SLRs ({sup 10}Be, {sup 53}Mn) recorded by primary minerals of CAIs and chondrules. We infer that {sup 36}Cl was largely produced by irradiation of a volatile-rich reservoir in an optically thin protoplanetary disk adjacent to the region in which the CV chondrite parent asteroid accreted while the Sun was a weak T Tauri star. Subsequently, {sup 36}Cl accreted into the Allende CV chondrite together with condensed water ices.

Jacobsen, Benjamin; Yin Qingzhu [Department of Geology, University of California, Davis, CA 95616 (United States); Matzel, Jennifer; Hutcheon, Ian D.; Ramon, Erick C.; Weber, Peter K. [Glenn T. Seaborg Institute, Chemical Science Division, Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Krot, Alexander N.; Nagashima, Kazuhide [School of Ocean, Earth Science and Technology, Hawai'i Institute of Geophysics and Planetology, University of Hawai'i at Manoa, Honolulu, HI 96822 (United States); Ishii, Hope A. [Institute for Geophysics and Planetary Physics, Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Ciesla, Fred J., E-mail: [Department of the Geophysical Sciences, University of Chicago, Chicago, IL 60637 (United States)



Triggering Collapse of the Presolar Dense Cloud Core and Injecting Short-lived Radioisotopes with a Shock Wave. II. Varied Shock Wave and Cloud Core Parameters  

NASA Astrophysics Data System (ADS)

A variety of stellar sources have been proposed for the origin of the short-lived radioisotopes that existed at the time of the formation of the earliest solar system solids, including Type II supernovae (SNe), asymptotic giant branch (AGB) and super-AGB stars, and Wolf-Rayet star winds. Our previous adaptive mesh hydrodynamics models with the FLASH2.5 code have shown which combinations of shock wave parameters are able to simultaneously trigger the gravitational collapse of a target dense cloud core and inject significant amounts of shock wave gas and dust, showing that thin SN shocks may be uniquely suited for the task. However, recent meteoritical studies have weakened the case for a direct SN injection to the presolar cloud, motivating us to re-examine a wider range of shock wave and cloud core parameters, including rotation, in order to better estimate the injection efficiencies for a variety of stellar sources. We find that SN shocks remain as the most promising stellar source, though planetary nebulae resulting from AGB star evolution cannot be conclusively ruled out. Wolf-Rayet (WR) star winds, however, are likely to lead to cloud core shredding, rather than to collapse. Injection efficiencies can be increased when the cloud is rotating about an axis aligned with the direction of the shock wave, by as much as a factor of ~10. The amount of gas and dust accreted from the post-shock wind can exceed that injected from the shock wave, with implications for the isotopic abundances expected for a SN source.

Boss, Alan P.; Keiser, Sandra A.



Evaluation of shelf basin interaction in the western Arctic by use of short-lived radium isotopes: The importance of mesoscale processes  

NASA Astrophysics Data System (ADS)

Shelf-basin exchange in the western Arctic was evaluated by use of water-column analyses of 228Ra/ 226Ra ratios and the first measurements of the short-lived 224Ra ( T1/2=3.64 d) in the Arctic. During the 2002 shelf-basin interaction (SBI) program, excess 224Ra was detected over the shelf but was not found seaward of the shelf-break. Similarly, the 228Ra/ 226Ra ratio dropped rapidly from the shelf across the shelf-break. Consequently, the model age gradient (elapsed time since shelf residence) northward across the Chukchi Shelf increased from 1-5 years nearshore to approximately 14 years in surface waters sampled off shelf at the southern margin of the Beaufort Gyre. This steep gradient is consistent with very slow exchange between the Chukchi Shelf and the Beaufort Gyre, whereby Bering Strait inflow is constrained by the Earth's rotation to follow local isobaths and does not easily move into deeper water. The strong dynamic control inhibiting water that enters the system through Bering Strait from flowing north across isobaths also would lead to a long recirculation time of river water emptied into the Beaufort Gyre. Possible mechanisms that can generate cross-shelf currents that break the topographic constraint to follow isobaths, and thereby transport water (and associated properties) off the shelves include wind-induced upwelling/downwelling, meandering jets, and eddies. Evidence of such a process was found during the ICEX project in the Beaufort Sea in April 2003 when excess 224Ra was measured over 200 km from any shelf source. This required an NE offshore flow of ˜40 cm s -1 assuming that the source water derives from the mouth of Barrow Canyon. A weak northeastward flow was measured using an LADCP within the upper 300 m of the ocean, but was of lower speed than required by the 224Ra xs at the time of the ICEX occupation.

Kadko, David; Muench, Robin



Examining the mechanisms responsible for lower ROS release rates in liver mitochondria from the long-lived house sparrow ( Passer domesticus) and big brown bat ( Eptesicus fuscus) compared to the short-lived mouse ( Mus musculus)  

Microsoft Academic Search

Lower ROS release rate in long-lived species is likely caused by decreased reduction of electron transport chain (ETC) complexes, but how this is achieved remains largely unknown. We compared liver mitochondrial H2O2 release rates among endotherms of comparable size and metabolic rate: house sparrow and big brown bat (both long-lived) and house mouse (short-lived). We hypothesized that low ROS release

Jason C. L. Brown; Grant B. McClelland; Paul A. Faure; Jordan M. Klaiman; James F. Staples



Tracing historical tropical cyclones and the 1883 Krakatoa tsunami in short-lived geological archives of the Ashburton Delta (NW Australia)  

NASA Astrophysics Data System (ADS)

Records of coastal geological archives are discontinuous. They store traces of both episodic and long-term processes as particular depositional landforms, deposits or erosional features. In particular the identification and interpretation of episodic high-energy coastal flooding due to tropical cyclones (TCs) and tsunamis is associated with a number of difficulties, including the spatial and temporal variability of geological records as well as the application of different dating techniques. In addition, the differentiation between tsunami and storm deposits remains challenging, notably where modern deposits and/or historical reports on the event are absent. Analysing modern (or historic) analogues for which documentation of process-specific parameters and/or geomorphic and sedimentary effects are available contributes to a better understanding of their sedimentary signatures and related depositional processes. These studies are key components to unravel the fossil record and the history of past events. The NW coast of Western Australia (WA) is highly vulnerable to extreme wave events. On average 1-2 TCs impact the W Australian coast per year, and ten historically documented tsunami events are recorded since 1858, including the tsunami following the 1883 Krakatoa eruption. However, no sedimentary evidence on this particular event has been presented yet, and little is known about the geological imprint of both (pre)historic TCs and tsunamis in NW Australia in general. Here we present new data on the sedimentology and chronostratigraphy of historical washover events found in short-lived geological archives of the Ashburton River delta (NW part of Western Australia), where clearly distinguishable traces of both TCs and the 1883 Krakatoa tsunami are recorded. We aim at (i) establishing (at least locally valid) sedimentary criteria differentiating between TCs and tsunami deposits; (ii) presenting an OSL-based local chronostratigraphy with direct relation to historical events; and (iii) discussing the archive's overall significance for palaeoevent research. Our results show that the presented archive is discontinuous on different spatial and temporal levels, related to the episodic nature of extreme wave events and the general variability of geological archives.

May, Simon Matthias; Brill, Dominik; Engel, Max; Scheffers, Anja; Pint, Anna; Wennrich, Volker; Squire, Peter; Kelletat, Dieter; Brückner, Helmut



Evidence For Three, Short Lived, Geomagnetic Field Excursions Recorded In Postglacial (9-15,000 YBP) Carbonates Of The Tahitian Coral Reef  

NASA Astrophysics Data System (ADS)

A detailed composite record of inclinations and relative paleointensity for Late Quaternary (8-16,000 YBP) coral-reef framework rocks recovered from the island of Tahiti during IODP Expedition 310 yielded reproducible evidence for three, short-lived magnetic field excursions at 10,700±200 YBP, 12,900±200 YBP, and 14,200±200 YBP. Age estimates for these excursions, which are constrained by more than 250 radiocarbon dates from the same cores, make them younger than any other published well-documented and dated excursion from the continents or the continental margins. Samples for paleomagnetic analysis were recovered mainly from the abundant microbialites deposited in the interstices of the macro-coral framework. These carbonate rocks make up more than 60% of the Tahiti Coral Reef and 95% of all magnetic samples. Initial paleomagnetic and rock magnetic studies showed that the microbialites carry a strong and stable natural magnetic remanence with an average value of -30.6° (?95=2.9°) that is not significantly different from Tahiti's expected axial-dipole inclination. Rock magnetic studies indicate that the NRM is carried almost entirely by detrital titanomagnetite grains (<1 ?m to ~20 ?m in grain size) that were derived from the Tahiti volcanic edifice, but the grains were locked-in by biological mediation during biogenic carbonate precipitation. To assess the spatial coherence of the paleomagnetic directions, paleointensities, and the rock magnetic variability of these young excursions, detailed re-sampling of all available material with a clear up-down direction, extending from one normal polarity interval through the recorded excursion to the following normal interval (±1m), was undertaken. In total we obtained inclination and relative paleointensity estimates (based on CHI, ARM, and SIRM) from more then 750 samples. General results of this analysis show that these young magnetic excursions are real and reproducible and often associated with paleointensity lows. NRM demagnetization reveals consistent changes in both inclination and occasionally, where we have intervals with sequential samples from unbroken core segments, declination. The duration of these young excursional events is constrained by the bulk framework rock accumulation rate (5-10 m/ky; 100-200 yrs/m) to timescales of 100's of years. These intriguing new observations have profound implications and may change our ideas about the number and frequency of magnetic excursions.

Platzman, E. S.; Lund, S.; Camoin, G.; Thouveny, N.; Scientific Team IODP Expedition 310



Formation of short-lived radionuclides in the protoplanetary disk during late-stage irradiation of a volatile-rich reservoir  

SciTech Connect

The origin of short-lived (t{sub 1/2} < 5 Myr) and now extinct radionuclides ({sup 10}Be, {sup 26}Al, {sup 36}Cl, {sup 41}Ca, {sup 53}Mn, {sup 60}Fe; hereafter SLRs) is fundamental to understanding the formation of the early solar system. Two distinct classes of models have been proposed to explain the origin of SLRs: (1) injection from a nearby stellar source (e.g., supernova, asymptotic giant branch star or Wolf-Rayet star) and (2) solar energetic particle irradiation of dust and gas near the proto-Sun. Recent studies have demonstrated that {sup 36}Cl was extant in the early solar system. However, its presence, initial abundance and the noticeable decoupling from {sup 26}Al raise serious questions about the origin of SLRs. Here we report {sup 36}Cl-{sup 36}S and {sup 26}Al-{sup 26}Mg systematics for wadalite and grossular, secondary minerals in a calcium-aluminum-rich inclusion (CAI) from the CV chondrite Allende that allow us to reassess the origin of SLRs. The inferred abundance of {sup 36}Cl in wadalite, corresponding to a {sup 36}Cl/{sup 35}Cl ratio of (1.81 {+-} 0.13) x 10{sup -5}, is the highest {sup 36}Cl abundance reported in any early solar system material. The high level of {sup 36}Cl in wadalite and the absence of {sup 26}Al ({sup 26}Al/{sup 27}Al {le} 3.9 x 10{sup -6}) in co-existing grossular indicates that (1) {sup 36}Cl formed by late-stage solar energetic particle irradiation and (2) the production of {sup 36}Cl, recorded by secondary minerals, is unrelated to the origin of {sup 26}Al and other SLRs ({sup 10}Be, {sup 53}Mn) recorded by primary minerals of CAIs and chondrules. We conclude that 36Cl was produced by solar energetic particle irradiation of a volatile-rich reservoir in an optically thin protoplanetary disk adjacent to the accretion region of the CV chondrite parent asteroid.

Jacobsen, B; Matzel, J; Hutcheon, I D; Krot, A N; Yin, Q -; Nagashima, K; Ramon, E; Weber, P; Ishii, H; Ciesla, F



Alpha Thalassemia  


Alpha Thalassemia ? Physicians often mistake alpha thalassemia trait for iron deficiency anemia and incorrectly prescribe iron supplements that have no effect on the anemia. Normal alpha globin genes found on ...


Linking early Earth magma ocean crystallization and overturn with observed large low-shear-velocity provinces (LLSVPs) and short-lived radioisotopic measurements in Archean rocks  

NASA Astrophysics Data System (ADS)

Motivated by the well-characterized discrepancy between measurements of 142Nd in chondrites and those in Earth rocks (e.g.,[1][2]) in addition to recent measurements of Archean rocks with anomalous 142Nd and 182W (e.g.,[3][4][5]), we model the crystallization and overturn of a terrestrial chondritic magma ocean, and track the isotopic reservoirs that may result. Following magma ocean solidification, solid-state overturn occurs because solidification produces a gravitationally unstable configuration where the last cumulates to solidify are densest and also enriched in incompatible elements. As suggested by [1][2], these originally shallow cumulates that, following overturn, would now reside near the core-mantle boundary are tantalizing targets for the hypothesized hidden reservoir(s) of incompatible elements. These last, dense, enriched cumulates may have evolved negative 142Nd and 182W isotopic anomalies, while cumulates that form earlier and deeper in the magma ocean would likely be poor in incompatible elements and have evolved complementary positive isotopic anomalies. Because crystal - liquid partition coefficients of Sm, Nd, Hf, and W in nucleating mantle phases are poorly constrained and vary over orders of magnitude, we use a Monte Carlo approach to cover the parameter space of reported partition coefficients. Although data are limited, Archean rocks appear to show a non-linear trend between age and 142Nd and 182W, suggesting inefficient heterogeneous mixing of some of the early enriched reservoir (EER or late stage cumulates) back into the early depleted reservoir (EDR or deeper cumulates) during or after overturn, also first suggested by [1][2]. To account for this, we model various mixing scenarios using post-overturn mantle stratigraphy. Additionally, because 142Nd and 182W are decay products of short-lived radioisotopes, the timing of magma ocean crystallization is critical to producing a modern day mantle consistent with measured compositions. We therefore iterate through time to determine the statistically most likely time of the last major mantle-melting event. Consistent with [2], we argue that the EER is not hidden but is instead the seismologically observed large low-shear-velocity provinces (LLSVPs), or the D'' region, and the ultra low velocity zones (ULVZs) are dense, iron-rich silicon-poor melts of the LLSVPs. Given this, the isotopic reservoirs produced by our models must mix such that the EER remaining after mixing is the same volume as the LLSVPs, or 2% of the mantle (e.g., [6][7]). Approximately two-thirds our run results are "successful" given known partition coefficients, and so our results suggest that this model is viable: magma ocean fractional solidification can produce mantle reservoirs consistent with isotopic compositions observed in some rocks, and can produce a dense lower mantle layer consistent in longevity and volume to the LLSVPs. [1]Boyet and Carlson,2005,Science,309(5743),576-81.[2]Carlson and Boyet,2008,Phil. Trans. R. Soc. A,366(1883),4077-103. [3]Willbold et al.,2011,Nature,477(7363), 195-8. [4]Touboul et al.,2012,Science,335(6072),1065-9. [5]Rizo et al.,Nature,491(7422),96-100. [6]Burke et al.,2008,EPSL,265(1-2),49-60. [7]Hernlund and Houser,2008,EPSL,265(3-4),423-37.

Brown, S. M.; Elkins-Tanton, L. T.; Walker, R. J.



Oxygen isotopic and geochemical evidence for a short-lived, high-temperature hydrothermal event in the Chegem caldera, Caucasus Mountains, Russia  

USGS Publications Warehouse

Within the 2.8 Ma Chegem ash-flow caldera (11 ?? 15 km), a single cooling unit of rhyolitic to dacitic welded tuff more than 2 km thick is exposed in deep valleys incised during recent rapid uplift of the Caucasus Mountains. The intracaldera tuff is mineralogically fresh and unaltered, and is overlain by andesite lavas and cut by a resurgent granodiorite intrusion. Major- and trace-element compositions for a 1405-m stratigraphic section of intracaldera tuff display trends of upwardly increasing Na2O, CaO, Al2O3, total Fe, MgO, TiO2, Sr and Zr and decreasing SiO2, K2O and Rb. This mafic-upward zoning (from 76.1 to 69.9% SiO2) reflects an inverted view of the upper part of the source magma chamber. Oxygen isotope studies of 35 samples from this 1405-m section define a striking profile with "normal" igneous ??18O values (+7.0 to +8.5) in the lower 600 m of tuff, much lower ??18O values (-4.0 to +4.3) in a 700-m zone above that and a shift to high ??18O values (+4.4 to -10.9) in the upper 100 m of caldera-fill exposure. Data from two other partial stratigraphic sections indicate that these oxygen isotope systematics are probably a caldera-wide phenomenon. Quartz and feldspar phenocrysts everywhere have "normal" igneous ??18O values of about +8.5 and +7.5, respectively, whereas groundmass and glass ??18O values range from -7.7 to +12.3. Consequently, the ??18O values of coexisting feldspar, groundmass and glass form a steep array in a plot of ??feldspar vs. ??groundmass/glass. Such pronounced disequilibrium between coexisting feldspar and groundmass or glass has never before been observed on this scale. It requires a hydrothermal event involving large amounts of low-18O H2O at sufficiently high temperatures and short enough time (tens of years or less) that glass exchanges thoroughly but feldspar does not. The most likely process responsible for the O depletions at Chegem is a very high temperature (500-600??C), short-lived, vigorous meteoric-hydrothermal event that was focused within the upper 750 m of intracaldera tuff. Mass balance calculations indicate fluid fluxes of = 6 ?? 10-6 mol cm-2 s-1. We believe that the closest historical analogue to this Chegem hydrothermal event is the situation observed in the Valley of Ten Thousand Smokes (Alaska, USA), where hundreds of steam fumaroles with measured temperatures as high as 645??C persisted for 10 to 15 years in the much smaller welded ash-flow tuff sheet (??? 200 m thick) produced by the 1912 Katmai eruption.

Gazis, C.; Taylor, H.P., Jr.; Hon, K.; Tsvetkov, A.



Nuclear clusters studied with alpha resonant scatterings using RI beams at CRIB  

NASA Astrophysics Data System (ADS)

Alpha resonant scattering is a simple and promising method to study ?-cluster structure in nuclei. It has several good features which enable us to perform measurements with short-lived and relatively low-intense RI beams. Several measurements on alpha resonant scattering have been carried out at CRIB (CNS Radioactive Ion Beam separator), which is a low-energy RI beam separator at Center for Nuclear Study (CNS) of the University of Tokyo. Recent ? resonant scattering studies at CRIB, using 7Li, 7Be and 10Be beams with a helium gas target, are discussed.

Yamaguchi, H.; Kahl, D.; Nakao, T.; Wakabayashi, Y.; Hashimoto, T.; Hayakawa, S.; Kawabata, T.; Teranishi, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. N.; Kubono, S.; Suhara, T.; Kanada-En'yo, Y.; Moon, J. Y.; Kim, A.; Iwasa, N.; Lee, P. S.; Chae, K. Y.; Cha, S. M.; Gwak, M. S.; Kim, D. H.; Milman, E.



Isotope shifts of the 6d{sup 2} D{sub 3/2}-7 p{sup 2} P{sub 1/2} transition in trapped short-lived {sup 209-214}Ra{sup +}  

SciTech Connect

Laser spectroscopy of short-lived radium isotopes in a linear Paul trap has been performed. The isotope shifts of the 6d{sup 2} D{sub 3/2} -7 p{sup 2} P{sub 1/2} transition in {sup 209-214}Ra{sup +}, which are sensitive to the short-range part of the atomic wave functions, were measured. The results are essential experimental input for improving the precision of atomic structure calculations. This is indispensable for parity violation in Ra{sup +} aiming at the determination of the weak mixing angle.

Giri, G. S.; Versolato, O. O.; Berg, J. E. van den; Boell, O.; Dammalapati, U.; Hoek, D. J. van der; Jungmann, K.; Kruithof, W. L.; Mueller, S.; Nunez Portela, M.; Onderwater, C. J. G.; Santra, B.; Timmermans, R. G. E.; Wansbeek, L. W.; Willmann, L.; Wilschut, H. W. [University of Groningen, Kernfysisch Versneller Instituut, Groningen NL-9747 AA (Netherlands)



Detection of Neutrons and Charged-Particles emitted in Peripheral and Mid-Peripheral Collisions of ^124,136Xe and ^112,124Sn Nuclei at E/A = 50 MeV  

NASA Astrophysics Data System (ADS)

To investigate peripheral and mid-peripheral heavy ion collisions, neutrons and charged particles emitted in the cross-bombardment reactions ^124,136Xe + ^112,124Sn @ E/A = 50 MeV were measured. Projectile-like fragments at small angles (2.8^o<=?<=14.5^o) were identified by their atomic number and large velocity (V/Vbeam>=0.5) in the Si-Si-CsI(Tl)/PD array FIRST with high angular resolution (?? 0.1^o). Intermediate mass fragments (IMF: Z>=3) detected in FIRST were isotopically identified. At larger angles (30^o<=?<=45^o), light-charged particles and IMFs were isotopically identified in the silicon-strip array LASSA. With the DEMON array, pulse-shape discrimination and TOF were used to identify neutrons and measure their kinetic energies. Calibration of the charged particle detectors using fragmentation beams and electronic pulsers will be described. Elemental and isotopic resolution obtained with FIRST and LASSA will be shown; preliminary results will be presented.

McIntosh, A. B.; Black, J.; Hudan, S.; Metelko, C. J.; Yanez, R.; de Souza, R. T.; Chbihi, A.; Famiano, M.; Fregeau, M. O.; Gauthier, J.; Moisan, J.; Roy, R.; Bianchin, S.; Schwarz, C.; Trautmann, W.



Alpha-particle-induced cancer in humans.  


Updated information is given on alpha-particle-induced cancer in persons internally exposed to 222Rn progeny, Thorotrast, long-lived 226Ra and 228Ra, and short-lived 224Ra. The lung cancer risk to persons breathing 222Rn progeny in the indoor air of offices, schools, and homes is of increasing concern. About half of the recent deaths among the German Thorotrast patients have been from liver cancer. Animal studies indicate that the liver cancer risk from Thorotrast is mainly from its radioactivity and that the risk coefficient for the Thorotrast patients can be used provisionally for other alpha emitters in the human liver. Six skeletal cancers have occurred in persons with average skeletal doses between 0.85 and 11.8 Gy from 226Ra and 228Ra. In the low-dose German 224Ra patients, two skeletal sarcomas have occurred at about 0.7 Gy compared to about six cases predicted by results from 224Ra patients at higher doses. The minimal appearance time for radiation-induced bone sarcomas in humans is about 4 y. Following brief irradiation, the vast majority of induced bone sarcomas are expressed by about 30 y. Recent evidence against the "practical threshold" hypothesis is given. With the downward revision of neutron doses to the atomic-bomb survivors, the follow-up of persons exposed to alpha particles may be the best opportunity to evaluate directly the effects of high LET radiation on humans. PMID:2844697

Mays, C W



Processing of N-linked glycans during endoplasmic-reticulum-associated degradation of a short-lived variant of ribophorin I.  

PubMed Central

Recently, the role of N-linked glycans in the process of ERAD (endoplasmic reticulum-associated degradation) of proteins has been widely recognized. In the present study, we attempted to delineate further the sequence of events leading from a fully glycosylated soluble protein to its deglycosylated form. Degradation intermediates of a truncated form of ribophorin I, namely RI(332), which contains a single N-linked oligosaccharide and is a substrate for the ERAD/ubiquitin-proteasome pathway, were characterized in HeLa cells under conditions blocking proteasomal degradation. The action of a deoxymannojirimycin- and kifunensine-sensitive alpha1,2-mannosidase was shown here to be required for both further glycan processing and progression of RI(332) in the ERAD pathway. In a first step, the Man(8) isomer B, generated by ER mannosidase I, appears to be the major oligomannoside structure associated with RI(332) intermediates. Some other trimmed N-glycan species, in particular Glc(1)Man(7)GlcNAc(2), were also found on the protein, indicating that several mannosidases might be implicated in the initial trimming of the oligomannoside. Secondly, another intermediate of degradation of RI(332) accumulated after proteasome inhibition. We demonstrated that this completely deglycosylated form arose from the action of an N-glycanase closely linked to the ER membrane. Indeed, the deglycosylated form of the protein remained membrane-associated, while being accessible from the cytoplasm to ubiquitinating enzymes and to added protease. Our results indicate that deglycosylation of a soluble ERAD substrate glycoprotein occurs in at least two distinct steps and is coupled with the retro-translocation of the protein preceding its proteasomal degradation. PMID:12952521

Kitzmüller, Claudia; Caprini, Andrea; Moore, Stuart E H; Frénoy, Jean-Pierre; Schwaiger, Eva; Kellermann, Odile; Ivessa, N Erwin; Ermonval, Myriam



Complete cDNA sequence encoding 20S proteasome alpha 5 subunit PAE from soybean.  


The 20S proteasome is the proteolytic complex that is responsible for degrading short-lived and abnormal proteins, especially those targeted by ubiquitin conjugation. The complex exists, as a hollow cylinder shaped structure comprised of four stacked rings. The outer rings contain 7 alpha subunits and the inner rings contain 7 beta subunits. In this study, we report the amino acid sequence of the alpha 5 subunit (PAE) in soybean (Gylcine max) based on the cDNA sequence. The amino acid sequence identity is 96% with the Arabidops alpha 5 subunit and 95% with the rice alpha 5 subunit. The highly conserved sequence homology suggests there is an important biological role for this proteasome. PMID:12487028

Park, Phun Bum



On search and identification of short-lived super heavy cosmic-ray nuclei (Z >= 110) by fossil track study of the extraterrestrial crystals: Results and perspectives [II  

NASA Astrophysics Data System (ADS)

The existence of relatively stable super heavy elements (SHE) in Nature was predicted theoretically at the midst of the sixties (Nilsson, Nix, Sobichevsky, see Ref. [1]). Basing on nuclear shell model it was estimated, that double magic nuclei with atomic number 110 <= Z <= 114 and neutron number N = 184, namely, the double ``magic'' closed shells of nuclei can possess the life time at >=103 up to 109 years. Thus, these elements, similarly to Th and U, can survive in the Earth and meteorites since formation of Solar system ~ 4.6 billion years ago. The present project work was drastically stimulated by recent synthesis and discovery of very stable isotopes of SHE in Flerov Laboratory of Nuclear Reactions During 1999-2000 Oganessian and his colleagues succeed in obtaining of a number of rather neutron-rich isotopes of elements 112, 114 and 116 in the reactions of 48Ca with monoisotopic targets of 238U, 244Pu and 248Cm, respectively [2]. The most stable isotope obtained is odd-even nuclear 285112, which possess the life time in between 10-30 min. Still this isotope has only 173 neutrons which is 11 fewer as compared with the magic number N = 184. For the region of known actinide nuclei (Z = 89 - 98) such a neutron difference for the most stable isotopes provides the stabilization factor of 1010 - 1013 in the life time. The discovery of very stable isotope of the new element 112 provides firstly the final unambiguous proof on the existence of new island of very stable SHE nuclei. Now we pointed out that there is no way to get the neutron number N = 184 using present accelerators and target nuclei. The only one way to find out double magic SHE nuclei now is the search for these nuclei in natural samples. The experimental attempts to discover such long-lived SHE nuclei with the life time >=2×108 y in natural samples undertaken during the late sixties up to end of seventies provided some evidence of their existence in a number of both terrestrial samples and meteorites. These experiments were done by the investigation of alpha radioactivity and spontaneous fission activity, which exceeds significantly the effect due to the spontaneous fission of 238U nuclide. Still no decisive information on the existence of SHE in the nature was obtained.

Perelygin, V. P.; Abdullaev, I. G.; Bondar, Yu. V.; Brandt, R.; Chuburkov, Yu. T.; Kashkarov, L. L.; Knyazeva, G. P.; Kravets, L. I.; Spohr, R.; Stetsenko, S. G.; Vater, P.



Advanced alpha spectrum analysis based on the fitting and covariance analysis of dependent variables  

NASA Astrophysics Data System (ADS)

The correct handling of statistical uncertainties is crucial especially when unfolding alpha spectra that contain a low number of counts or overlapping peaks from different nuclides. For this purpose, we have developed a new spectrum analysis software package called ADAM, which performs a full covariance calculus for alpha-particle emitting radionuclides. By analyzing a large number of simulated and measured spectra, the program was proved to give unbiased peak areas and statistically correct uncertainty limits. This applies regardless of the peak areas and the number of unknown parameters during the fitting. In addition, ADAM performs reliable deconvolution for multiplets, which opens the way for the determination of isotope ratios, such as 239Pu/ 240Pu.

Ihantola, S.; Pelikan, A.; Pöllänen, R.; Toivonen, H.



In vitro cell irradiation systems based on 210Po alpha source: construction and characterisation  

NASA Technical Reports Server (NTRS)

One way of studying the risk to human health of low-level radiation exposure is to make biological experiments on living cell cultures. Two 210Po alpha-particle emitting devices, with 0.5 and 100 MBq activity, were designed and constructed to perform such experiments irradiating monolayers of cells. Estimates of dose rate at the cell surface were obtained from measurements by a PIPS alpha-particle spectrometer and from calculations by the SRIM 2000, Monte Carlo charged particle transport code. Particle fluence area distributions were measured by solid state nuclear track detectors. The design and dosimetric characterisation of the devices are discussed. c2002 Elsevier Science Ltd. All rights reserved.

Szabo, J.; Feher, I.; Palfalvi, J.; Balashazy, I.; Dam, A. M.; Polonyi, I.; Bogdandi, E. N.



Simultaneous determination of gross alpha, gross beta and ²²?Ra in natural water by liquid scintillation counting.  


The determination of gross alpha, gross beta and (226)Ra activity in natural waters is useful in a wide range of environmental studies. Furthermore, gross alpha and gross beta parameters are included in international legislation on the quality of drinking water [Council Directive 98/83/EC]. In this work, a low-background liquid scintillation counter (Wallac, Quantulus 1220) was used to simultaneously determine gross alpha, gross beta and (226)Ra activity in natural water samples. Sample preparation involved evaporation to remove (222)Rn and its short-lived decay daughters. The evaporation process concentrated the sample ten-fold. Afterwards, a sample aliquot of 8 mL was mixed with 12 mL of Ultima Gold AB scintillation cocktail in low-diffusion vials. In this study, a theoretical mathematical model based on secular equilibrium conditions between (226)Ra and its short-lived decay daughters is presented. The proposed model makes it possible to determine (226)Ra activity from two measurements. These measurements also allow determining gross alpha and gross beta simultaneously. To validate the proposed model, spiked samples with different activity levels for each parameter were analysed. Additionally, to evaluate the model's applicability in natural water, eight natural water samples from different parts of Spain were analysed. The eight natural water samples were also characterised by alpha spectrometry for the naturally occurring isotopes of uranium ((234)U, (235)U and (238)U), radium ((224)Ra and (226)Ra), (210)Po and (232)Th. The results for gross alpha and (226)Ra activity were compared with alpha spectrometry characterization, and an acceptable concordance was obtained. PMID:23415246

Fons, J; Zapata-García, D; Tent, J; Llauradó, M



Positive selection as a developmental progression initiated by alpha beta TCR signals that fix TCR specificity prior to lineage commitment.  


During positive selection, immature thymocytes commit to either the CD4+ or CD8+ T cell lineage ("commitment") and convert from short-lived thymocytes into long-lived T cells ("rescue"). By formal precursor-progeny analysis, we now identify what is likely to be the initial positive selection step signaled by alpha beta TCR, which we have termed "induction". During induction, RAG mRNA expression is downregulated, but lineage commitment does not occur. Rather, lineage commitment (which depends upon the MHC class specificity of the alpha beta TCR) only occurs after downregulation of RAG expression and the consequent fixation of alpha beta TCR specificity. We propose that positive selection can be viewed as a sequence of increasingly selective developmental steps (induction-->commitment-->rescue) that are signaled by alpha beta TCR engagements of intrathymic ligands. PMID:10204486

Bhandoola, A; Cibotti, R; Punt, J A; Granger, L; Adams, A J; Sharrow, S O; Singer, A



Cross section measurements for neutron-induced reactions off C, Al, SiO2, Si and Au producing relatively short-lived radionuclides at neutron energies between 70 and 160 MeV  

NASA Astrophysics Data System (ADS)

A systematic study was made to measure many cross sections for relevant neutron-induced reactions. This study was motivated by the need to better understand cosmic ray interactions with extraterrestrial materials. The major constituents of meteorites and lunar rocks include oxygen, silicon, and aluminum. The primary aim was to measure cross sections for neutron-induced reactions producing long-lived radionuclides (e.g. 14C) and stable isotopes (e.g. Ne isotopes) but the irradiation conditions allowed cross sections for many reactions producing relatively short-lived radionuclides (e.g. 22Na) to be well measured. Monitor foils used in the irradiations included C, Al, and Au. Quasi-monoenergetic neutron beams were produced by bombarding Be targets with 80, 120 and 160 MeV proton beams at iThemba LABS, South Africa. Two identical target stacks were irradiated in beam lines at 0° and 16° to the incident proton beam direction. The yield at an unique neutron energy was obtained by subtracting the yield measured at 16° (after suitable normalization) from that measured at 0°. The cross sections for the following reactions: 27Al(n,x)22,24Na; natC(n,x)7Be; 197Au(n,x)194,196Au; SiO2(n,x)22Na and natSi(n,x)24Na are reported.

Sisterson, Janet M.



Selective destabilization of short-lived mRNAs with the granulocyte-macrophage colony-stimulating factor AU-rich 3' noncoding region is mediated by a cotranslational mechanism.  

PubMed Central

The 3' noncoding region element (AUUUA)n specifically targets many short-lived mRNAs for degradation. Although the mechanism by which this sequence functions is not yet understood, a potential link between facilitated mRNA turnover and translation has been implied by the stabilization of cellular mRNAs in the presence of protein synthesis inhibitors. We therefore directly investigated the role of translation on mRNA stability. We demonstrate that mRNAs which are poorly translated through the introduction of stable secondary structure in the 5' noncoding region are not efficiently targeted for selective destabilization by the (AUUUA)n element. These results suggest that AUUUA-mediated degradation involves either a 5'-->3' exonuclease or is coupled to ongoing translation of the mRNA. To distinguish between these two possibilities, we inserted the poliovirus internal ribosome entry site, which promotes internal ribosome initiation, downstream of the 5' secondary structure. Translation directed by internal ribosome binding was found to fully restore targeted destabilization of AUUUA-containing mRNAs despite the presence of 5' secondary structure. This study therefore demonstrates that selective degradation mediated by the (AUUUA)n element is coupled to ribosome binding or ongoing translation of the mRNA and does not involve 5'-to-3' exonuclease activity. Images PMID:8382780

Aharon, T; Schneider, R J



Study of short-lived bromine isotopes  

NASA Astrophysics Data System (ADS)

First experiments in the systematic study of the structure of ground states and isomeric states of Br isotopes as function of neutron number at ISOLDE, CERN are reported. The isotopes74g.74m,77,78,84g,84mBr have been implanted into iron and studied with the techniques of low temperature nuclear orientation and nuclear magnetic resonance of oriented nuclei (NMR/ON). The experiments were performed with the NICOLE on-line nuclear orientation set-up using the isotope separator ISOLDE-3. NMR/ON experiments were successful for74mBr with continuous on-line implantation and for77Br. Using as value of the hyperfine field Bhf(BrFe)=+81.3S (3) T we obtain |g (74mBr)|=0.455 (3) and |g (77Br)|=0.6492 (3). Static nuclear orientation data have been measured for all above mentioned isotopes. From these data we derive |?(78Br, I=1)|=0.13 (3) and |?(84gBr, I=2)|=1.9 (7). The results are discussed within the systematics of the bromine isotopes.

Prinz, J.; Berkes, I.; Herzog, P.; Hlimi, B.; de Jesus, M.; Massaq, M.; Romanski, I.



Proton scattering by short lived sulfur isotopes  

NASA Astrophysics Data System (ADS)

Elastic and inelastic proton scattering has been measured in inverse kinematics on the unstable nucleus 40S. A phenomenological distorted wave Born approximation analysis yields a quadrupole deformation parameter ?2=0.35+/-0.05 for the 2+1 state. Consistent phenomenological and microscopic proton scattering analyses have been applied to all even-even sulfur isotopes from A=32 to A=40. The second analysis used microscopic collective model densities and a modified Jeukenne-Lejeune-Mahaux nucleon-nucleon effective interaction. This microscopic analysis suggests the presence of a neutron skin in the heavy sulfur isotopes. The analysis is consistent with normalization values for ?v and ?w of 0.95 for both the real and imaginary parts of the Jeukenne-Lejeune-Mahaux potential.

Maréchal, F.; Suomijärvi, T.; Blumenfeld, Y.; Azhari, A.; Bauge, E.; Bazin, D.; Brown, J. A.; Cottle, P. D.; Delaroche, J. P.; Fauerbach, M.; Girod, M.; Glasmacher, T.; Hirzebruch, S. E.; Jewell, J. K.; Kelley, J. H.; Kemper, K. W.; Mantica, P. F.; Morrissey, D. J.; Riley, L. A.; Scarpaci, J. A.; Scheit, H.; Steiner, M.



Rapid determination of actinides in urine by inductively coupled plasma mass spectrometry and alpha spectrometry: a hybrid approach.  


A new rapid separation method that allows separation and preconcentration of actinides in urine samples was developed for the measurement of longer lived actinides by inductively coupled plasma mass spectrometry (ICP-MS) and short-lived actinides by alpha spectrometry; a hybrid approach. This method uses stacked extraction chromatography cartridges and vacuum box technology to facilitate rapid separations. Preconcentration, if required, is performed using a streamlined calcium phosphate precipitation. Similar technology has been applied to separate actinides prior to measurement by alpha spectrometry, but this new method has been developed with elution reagents now compatible with ICP-MS as well. Purified solutions are split between ICP-MS and alpha spectrometry so that long- and short-lived actinide isotopes can be measured successfully. The method allows for simultaneous extraction of 24 samples (including QC samples) in less than 3h. Simultaneous sample preparation can offer significant time savings over sequential sample preparation. For example, sequential sample preparation of 24 samples taking just 15 min each requires 6h to complete. The simplicity and speed of this new method makes it attractive for radiological emergency response. If preconcentration is applied, the method is applicable to larger sample aliquots for occupational exposures as well. The chemical recoveries are typically greater than 90%, in contrast to other reported methods using flow injection separation techniques for urine samples where plutonium yields were 70-80%. This method allows measurement of both long-lived and short-lived actinide isotopes. (239)Pu, (242)Pu, (237)Np, (243)Am, (234)U, (235)U and (238)U were measured by ICP-MS, while (236)Pu, (238)Pu, (239)Pu, (241)Am, (243)Am and (244)Cm were measured by alpha spectrometry. The method can also be adapted so that the separation of uranium isotopes for assay is not required, if uranium assay by direct dilution of the urine sample is preferred instead. Multiple vacuum box locations may be set-up to supply several ICP-MS units with purified sample fractions such that a high sample throughput may be achieved, while still allowing for rapid measurement of short-lived actinides by alpha spectrometry. PMID:19782204

Maxwell, Sherrod L; Jones, Vernon D



Counting particles emitted by stratospheric aircraft and measuring size of particles emitted by stratospheric aircraft  

NASA Technical Reports Server (NTRS)

The ER-2 condensation nuclei counter (CNC) has been modified to reduce the diffusive losses of particles within the instrument. These changes have been successful in improving the counting efficiency of small particles at low pressures. Two techniques for measuring the size distributions of particles with diameters less than 0.17 micrometers have been evaluated. Both of these methods, the differential mobility analyzer (DMA) and the diffusion battery, have fundamental problems that limit their usefulness for stratospheric applications. We cannot recommend either for this application. Newly developed, alternative methods for measuring small particles include inertial separation with a low-loss critical orifice and thin-plate impactor device. This technique is now used to collect particles in the multisample aerosol collector housed in the ER-2 CNC-2, and shows some promise for particle size measurements when coupled with a CNC as a counting device. The modified focused-cavity aerosol spectrometer (FCAS) can determine the size distribution of particles with ambient diameters as small as about 0.07 micrometers. Data from this instrument indicates the presence of a nuclei mode when CNC-2 indicates high concentrations of particles, but cannot resolve important parameters of the distribution.

Wilson, James Charles



Study of short-lived climate forcers atmospheric variability at Kathmandu and at the WMO/GAW Global Station "Nepal Climate Observatory-Pyramid" (5079 m a.s.l.) in the Himalayas  

NASA Astrophysics Data System (ADS)

Aerosols and tropospheric ozone play a key role in the climate system, since they are short-lived climate forcers (SLCFs). South Asia represents a "hot-spot" in terms of climate change, since a vast region extending from the Indian Ocean to the Himalayas appears to be affected by large amounts of aerosols and pollutant gases (the so-called Atmospheric Brown Cloud). In the framework of the SusKat - ABC field campaign, a new measurement station has been installed in Pakanajol, Kathmandu (Nepal) on January 2013. This station is representative of the severe polluted conditions of the Kathmandu valley. Continuous measurements of equivalent black carbon (eqBC), surface ozone (O3), aerosol number concentration and size distribution, on-line PM10-PM1, as well as meteorological parameters, are carried out at this sampling site. In the high Himalayas (150 km north-east from Kathmandu), continuous atmospheric composition measurements are performed at the WMO/GAW Global Station Nepal Climate Observatory-Pyramid (NCO-P, 5079 m a.s.l.) in the Southern Himalayas. This measurement site is representative of the background conditions of the Himalayan ridge and measurements of eqBC, O3, aerosol number size distribution and meteorological parameters are continuously carried out since March 2006. The aim of this work is to compare the variability of atmospheric composition between the two sampling sites, with a particular emphasis on SLCFs, thus providing two complementary perspectives about the Atmospheric Brown Cloud phenomenon. Moreover, hints about the possible role of vertical air-mass transport of SLCFs from the foothills to the high Himalayas will be provided. The seasonal trend of eqBC at Pakanajol is characterized by a decreasing behavior from winter to monsoon, while at NCO-P it is characterized by a clear pre-monsoon maximum. On the other hand, at both sampling sites, O3 and particle number (accumulation and coarse) showed highest values during the pre-monsoon (April-May), even if at NCO-P significantly lower levels of eqBC and aerosol particle number (ratio 7% for eqBC, 29% for accumulation and 12% for coarse particles) were observed in respect to Kathmandu. Moreover, case studies concerning simultaneous events of eqBC and O3 increases in Kathmandu and in the high Himalayas will be investigated.

Putero, Davide; Cristofanelli, Paolo; Adhikary, Bhupesh; Marinoni, Angela; Duchi, Rocco; Calzolari, Francescopiero; Landi, Tony Christian; Pietro Verza, Gian; Alborghetti, Marcello; Vuillermoz, Elisa; Rupakheti, Maheswar; Lawrence, Mark; Bonasoni, Paolo



Alpha College Today.  

ERIC Educational Resources Information Center

Presents a follow-up report on Alpha, an experimental unit of the College of DuPage in Illinois. Traces the postgraduation activities of Alpha graduates and describes new Alpha programs and projects. (CAM)

Leppert, William A.



Alpha-1 Antitrypsin Deficiency  


... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...


Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells  

NASA Technical Reports Server (NTRS)

We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS).

Durante, M.; Grossi, G. F.; Gialanella, G.; Pugliese, M.; Nappo, M.; Yang, T. C.



Accelerator Production of {sup 225}Ac For Alpha-Immunotherapy  

SciTech Connect

{sup 225}Ac has tremendous potential for the treatment of metastatic cancer due to the four alpha-particles emitted during its decay to stable {sup 209}Bi. Additionally, it is one of the few alpha-emitters being considered for clinical trials. The anticipated {sup 225}Ac demand for these trials is expected to far exceed the annual worldwide supply of approximately 1,000 mCi/yr. Consequently, the DOE Office of Science has funded investigations into accelerator-based production of {sup 225}Ac. Existing {sup 232}Th(p,x){sup 225}Ac cross section data indicate that up to 480 mCi/day of {sup 225}Ac could be created by bombarding a thick target of natural thorium with 100 MeV protons at the Los Alamos Isotope Production Facility. To verify these predictions, experiments are underway at the Los Alamos Neutron Science Center to measure the {sup 232}Th(p,x){sup 225}Ac production cross sections for protons in the energy range 40-200 MeV, and at 800 MeV. For 800 MeV protons, preliminary results indicate that the {sup 225}Ac production cross section is 12.4{+-}0.6 mb and the {sup 225}Ra production cross section is 3.2{+-}0.2 mb. Moreover, preliminary results suggest that the {sup 227}Ac production cross section is 16{+-}1 mb. Experiments to measure these same cross sections at proton energies below 200 MeV are planned for the last half of calendar year 2010.

Weidner, J. W.; Nortier, F. M.; Bach, H. T.; John, K. D.; Couture, A.; Ullmann, J. L.; Fassbender, M. E.; Goff, G. S.; Taylor, W.; Valdez, F.; Wolfsberg, L. E.; Cisneros, M.; Dry, D.; Gallegos, M.; Gritzo, R.; Bitteker, L. J.; Wender, S.; Baty, R. S. [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, NM 87545 (United States)



Alpha One Foundation  


... Tested Research Donate Upcoming events Alphas of Northern Illinois Support Group Meeting (3/21/2015 11:00 ... 00 AM - 2:00 PM Alphas of Northern Illinois Support Group Meeting Saturday, March 21st from 11: ...


Alpha Hydroxy Acids  


... page Home Cosmetics Products & Ingredients Ingredients Alpha Hydroxy Acids See also: Guidance for Industry: Labeling for Cosmetics Containing Alpha Hydroxy Acids The following information is intended to answer questions ...


Alpha Thalassemia (For Parents)  


Thalassemias Thalassemias are a group of blood disorders that affect the way the body makes hemoglobin, a ... results in that type of thalassemia. About Alpha Thalassemia Alpha thalassemia occurs when the gene that controls ...


The Alpha Centauri System.  

ERIC Educational Resources Information Center

Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

Soderblom, David R.




EPA Science Inventory

The determination of concentrations of natural radioactivity in public water supplies begins with the measurement of the gross alpha particle activity. The gross alpha activity measurement is used as a screening technique. The gross alpha particle activity measurement may be su...


Targeted alpha therapy: evidence for potential efficacy of alpha-immunoconjugates in the management of micrometastatic cancer.  


There can be little doubt that one of the most important problems in the management of cancer is control of metastatic disease. This objective must be achieved ideally with a systemic therapeutic modality that targets cancer cells and gives minimal collateral damage to critical normal cells. The efficacy of targeted cancer therapy relies on the ability of a toxin to be located in the target cancer cell. The ideal toxin is one that is active only in the cancer cell, and not in critical normal cells. Failing this, the next best approach is a toxin with a short effective lifetime to target early stage micrometastatic disease. This rules out chemical toxins, given that they remain effective until excreted from the body, and localization of dose to the cancer cell rules out beta-emitting radio-isotopes (RI). Alpha-emitting RI, however, are much more appropriate toxins because they are short-lived and because their cytotoxicity is the result of their high rate of energy loss and short range of the alpha particles. These radionuclides have properties that are particularly suited for the elimination of single cells in transit or small nests of cancer cells. In vitro and in vivo experiments with alpha RI show dramatic superiority over beta RI. Only a few nuclear hits are needed to kill cells, and the formation of metastatic lung lesions and subcutaneous lesions in mice can be inhibited by systemic administration of alpha emitters. But alpha RI have not been able to control solid tumours, for which beta RI are better suited. A small number of alpha-emitting radionuclides are currently under investigation. These are terbium (Tb)-149, astatine (At)-211, bismuth (Bi)-212 and Bi-213. Terbium-149 and At-211 both require accelerators in close proximity to the place of application. The Bi isotopes are produced by long-lived parents and, as such, can be obtained from generators. The first phase-1 dose escalation trial with Bi-213 radioimmunoconjugate (RIC) commenced in New York in 1997, and other trials are planned with At-211 RIC and At-211 methylene blue for melanoma. Actinium (Ac)-225 is obtained from the decay of thorium (Th)-229, which is a waste product in the enrichment of fissile Th-233. Alternative accelerator production routes are being investigated, beginning with the European Centre for Nuclear Research (CERN) GeV proton spallation source. The ready and low-cost availability of the Ac:Bi generator is an important element in the implementation of clinical trials for patients with poor prognoses but without evidence of metastatic disease. PMID:10901964

Allen, B J



Observation of lunar radon emanation with the Apollo 15 alpha particle spectrometer.  

NASA Technical Reports Server (NTRS)

The alpha particle spectrometer, a component of the orbital Sim Bay group of 'geochemistry' experiments on Apollo 15, was designed to detect alpha particles emitted during the decay of isotopes of radon gas and her daughter products. The purpose was to measure the gross activity of radon on the lunar surface and to find possible regions of increased local activity. Results are presented from a partial analysis of Apollo 15 data. For the moon as a whole, Rn220 was not observed and the upper limit on its decay rate above the lunar surface is 0.00038 disintegrations/sq cm-sec. Rn222 was marginally observed. Possible variations of radon activity on the lunar surface are being investigated. Po210 (a daughter product of Rn222) has been detected in a broad region from west of Mare Crisium to the Van de Graaff-Orlov region. The observed count rate is (4.6 plus or minus 1.4) x 0.001 disintegrations/sq cm-sec. The observed level of Po210 activity is in excess of the amount that would be in equilibrium with Rn222 by about an order of magnitude. This implies that larger levels of radon emanation have occurred on the moon within a time scale of 10 to 100 years.

Gorenstein, P.; Bjorkholm, P.



Degradation of the Saccharomyces cerevisiae mating-type regulator alpha1: genetic dissection of cis-determinants and trans-acting pathways.  


Mating phenotype in the yeast Saccharomyces cerevisiae is a dynamic trait, and efficient transitions between alternate haploid cell types allow the organism to access the advantageous diploid form. Mating identity is determined by cell type-specific transcriptional regulators, but these factors must be rapidly removed upon mating-type switching to allow the master regulators of the alternate state to establish a new gene expression program. Targeted proteolysis by the ubiquitin-proteasome system is a commonly employed strategy to quickly disassemble regulatory networks, and yeast use this approach to evoke efficient switching from the alpha to the a phenotype by ensuring the rapid removal of the alpha2 transcriptional repressor. Transition to the a cell phenotype, however, also requires the inactivation of the alpha1 transcriptional activator, but the mechanism by which this occurs is currently unknown. Here, we report a central role for the ubiquitin-proteasome system in alpha1 inactivation. The alpha1 protein is constitutively short lived and targeted for rapid turnover by multiple ubiquitin-conjugation pathways. Intriguingly, the alpha-domain, a conserved region of unknown function, acts as a degradation signal for a pathway defined by the SUMO-targeted ligase Slx5-Slx8, which has also been implicated in the rapid destruction of alpha2. Our observations suggest coordinate regulation in the turnover of two master regulatory transcription factors ensures a rapid mating-type switch. PMID:20351217

Nixon, Christina E; Wilcox, Alexander J; Laney, Jeffrey D



Rossi Alpha Method  

SciTech Connect

The Rossi Alpha Method has proved to be valuable for the determination of prompt neutron lifetimes in fissile assemblies having known reproduction numbers at or near delayed critical. This workshop report emphasizes the pioneering applications of the method by Dr. John D. Orndoff to fast-neutron critical assemblies at Los Alamos. The value of the method appears to disappear for subcritical systems where the Rossi-..alpha.. is no longer an ..alpha..-eigenvalue.

Hansen, G.E.



A new mechanism for DNA alterations induced by alpha particles such as those emitted by radon and radon progeny.  

PubMed Central

The mechanism(s) by which alpha (alpha) particles like those emitted from inhaled radon and radon progeny cause their carcinogenic effects in the lung remains unclear. Although direct nuclear traversals by alpha-particles may be involved in mediating these outcomes, increasing evidence indicates that a particles can cause alterations in DNA in the absence of direct hits to cell nuclei. Using the occurrence of excessive sister chromatid exchanges (SCE) as an index of DNA damage in human lung fibroblasts, we investigated the hypothesis that alpha-particles may induce DNA damage through the generation of extracellular factors. We have found that a relatively low dose of alpha-particles can result in the generation of extracellular factors, which, upon transfer to unexposed normal human cells, can cause excessive SCE to an extent equivalent to that observed when the cells are directly irradiated with the same irradiation dose. A short-lived, SCE-inducing factor(s) is generated in alpha-irradiated culture medium containing serum in the absence of cells. A more persistent SCE-inducing factor(s), which can survive freeze-thaw and is heat labile is produced by fibroblasts after exposure to the alpha-particles. These results indicate that the initiating target for alpha-particle-induced genetic changes can be larger than a cell's nucleus or even a whole cell. How transmissible factors like those observed here in vitro may extend to the in vivo condition in the context of a-particle-induced carcinogenesis in the respiratory tract remains to be determined. PMID:9400706

Lehnert, B E; Goodwin, E H



Post-transcriptional regulation of bifunctional alpha-amylase/subtilisin inhibitor expression in barley embryos by abscisic acid.  


Changes in bifunctional alpha-amylase/subtilisin inhibitor (BASI) expression induced by abscisic acid (ABA) were studied using in vitro cultured barley (Hordeum vulgare cv. Bonanza) embryos. The steady-state levels of BASI mRNA and BASI protein were increased by exogenously applied ABA. Accumulation of BASI protein was preceded by an increase in message level. The results suggest that ABA does not affect BASI mRNA translation. Nuclear run-on assays demonstrated that ABA had no effect on transcriptional activity. BASI mRNA was not detectable in the embryos treated with a protein synthesis inhibitor, cycloheximide, which had no inhibitory effect on BASI transcription rate. We propose that ABA increases the stability of BASI mRNA through synthesis of a short-lived protein that protects the message. PMID:8555451

Liu, J H; Hill, R D



Imaging alpha particle detector  


A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, D.F.



Event counting alpha detector  


An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

Bolton, R.D.; MacArthur, D.W.



Imaging alpha particle detector  


A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, David F. (Los Alamos, NM)



Alpha-particle diagnostics  

SciTech Connect

This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

Young, K.M.



Genetics Home Reference: Alpha thalassemia  


... Recent literature OMIM Genetic disorder catalog Conditions > Alpha thalassemia On this page: Description Genetic changes Inheritance Diagnosis ... Glossary definitions Reviewed August 2009 What is alpha thalassemia? Alpha thalassemia is a blood disorder that reduces ...


Biosynthesis of catalytically active rat testosterone 5. alpha. -reductase in microinjected Xenopus oocytes: Evidence for tissue-specific differences in translatable mRNA  

SciTech Connect

The enzyme 4-ene-3-ketosteroid-5{alpha}-oxidoreductase plays a key role in androgen-dependent target tissues, where it catalyzes the conversion of testosterone to the biologically active dihydrotestosterone. The regulation of 5{alpha}-reductase expression has not been studied at the molecular level as the enzyme is a membrane protein that is labile in cell-free homogenates. The authors developed a sensitive bioassay of the enzyme activity expressed in Xenopus oocytes microinjected with rat liver and prostate mRNA. After microinjection, incubation of intact oocytes in the presence of ({sup 3}H)testosterone revealed the in ovo appearance of active 5{alpha}-reductase. Polyandenylylated RNA was fractionated by sucrose gradient centrifugation, and the enzymatic activity was shown to be encoded by a 1,600- to 2,000-base-pair fraction of hepatic poly(A){sup +} RNA. 5{alpha}-Reductase mRNA was most efficiently translated when up to 80 ng of RNA was injected per oocyte. In the injected oocytes, 5{alpha}-reductase mRNA was found to be a short-lived molecule whereas its in ovo translatable 5{alpha}-reductase protein exhibited stable enzymatic activity for over 40 hr. Moreover, the levels of translatable tissue-specific 5{alpha}-reductase mRNAs as monitored in the Xenopus oocytes correlated with the variable 5{alpha}-reductase activities in female rat liver, male rat liver, and prostate homogenates. Altogether, these results provide supporting evidence in favor of the transcriptional control of 5{alpha}-reductase expression in rat tissues.

Farkash, Y.; Soreq, H.; Orly, J. (Hebrew Univ. of Jerusalem (Israel))



Semiconductor polycrystalline alpha detectors  

Microsoft Academic Search

In order to check possible novel neutron detectors based on composite semiconductor detectors containing nuclides with large cross sections for neutron, we tested their response to alpha particles. In the present paper we describe results obtained with composite samples made of hexagonal Boron Nitride particles bound with Polystyrene or Nylon-6. The samples were tested under 5.5 MeV alpha particle radiation

M. Schieber; M. Roth; A. Zuck; G. Marom; O. Khakhan; Z. B. Alfassi




SciTech Connect

A new method that allows rapid preconcentration and separation of plutonium and neptunium in water samples was developed for the measurement of {sup 237}Np and Pu isotopes by inductively-coupled plasma mass spectrometry (ICP-MS) and alpha spectrometry; a hybrid approach. {sup 238}U can interfere with {sup 239}Pu measurement by ICP-MS as {sup 238}UH{sup +} mass overlap and {sup 237}Np via peak tailing. The method provide enhanced removal of uranium by separating Pu and Np initially on TEVA Resin, then moving Pu to DGA resin for additional removal of uranium. The decontamination factor for uranium from Pu is almost 100,000 and the decontamination factor for U from Np is greater than 10,000. This method uses stacked extraction chromatography cartridges and vacuum box technology to facilitate rapid separations. Preconcentration is performed using a streamlined calcium phosphate precipitation method. Purified solutions are split between ICP-MS and alpha spectrometry so that long and short-lived Pu isotopes can be measured successfully. The method allows for simultaneous extraction of 20 samples (including QC samples) in 4 to 6 hours, and can also be used for emergency response. {sup 239}Pu, {sup 242}Pu and {sup 237}Np were measured by ICP-MS, while {sup 236}Pu, {sup 238}Pu, and {sup 239}Pu were measured by alpha spectrometry.

Maxwell, S.; Jones, V.; Culligan, B.; Nichols, S.; Noyes, G.



Investigation of short-lived isotopes by laser spectroscopy  

Microsoft Academic Search

Laser-spectroscopic methods can be applied to the systematic investigation of radioactive isotopes, covering up to 30 isotopes per element (500 nuclides in total). This book shows how the high resolution and sensitivity of laser spectroscopic methods can be used in experiments on the hyperfine structure and isotope shift of the atomic spectrum or applied to the more general problem of




Short-lived radionuclides in nuclear medicine - II  

SciTech Connect

Positron emission tomography (PET) has been applied effectively in the diagnosis of Alzheimer's disease, the prognosis of stroke, and the evaluation of the efficacy of tumor therapy. In addition, PET has been applied to studies of the neuroreceptor distribution in the human brain, to studies of epilepsy and congenital disorders of the brain, and to the study of flow and metabolism of the human heart muscle. Of the many current investigations of PET, the three discussed here are now of clinical importance for patient care.

Budinger, T.F.; Peng, C.T.



Harvard-MIT research program in short-lived radiopharmaceuticals  

SciTech Connect

This report presents research on radiopharmaceuticals. The following topics are discussed: antibody labeling with positron-emitting radionuclides; antibody modification for radioimmune imaging; labeling antibodies; evaluation of technetium acetlyacetonates as potential cerebral blood flow agents; and studies in technetium chemistry. (CBS)

Adelstein, S.J.



Short-lived proton radioactivity studies at HRIBF  

SciTech Connect

An accurate determination of the experimental spectroscopic factor of proton emitting nuclei precisely defines the main component of the proton wave function for the unbound state. However, this has proven difficult for nuclei with Z{<=}71 due to the unknown beta-branching ratios involved. One way to solve this problem is to study proton-emitters with half-lives far too short for beta-emission to compete. Recent work at the Holifield Radioactive Ion Beam Facility has produced information on {sup 141m}Ho, {sup 145}Tm, {sup 150m}Lu and {sup 151m}Lu, all of which have half-lives in the {mu}s region. A comparison between calculated and experimental spectroscopic factors for these nuclei is given.

Batchelder, J. C. [Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee 37831 (United States); Bingham, C. R. [Physics Division, Oak Ridge National Laboratory, Oak Ridge, 37831 Tennessee (United States); University of Tennessee, Knoxville, Tennessee 37996 (United States); Ginter, T. N. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Gross, C. J. [Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee 37831 (United States); Physics Division, Oak Ridge National Laboratory, Oak Ridge, 37831 Tennessee (United States); Grzywacz, R. [University of Tennessee, Knoxville, Tennessee 37996 (United States); Karny, M.; Janas, Z. [Warsaw University, Warsaw, Hoza 69 Poland (Poland); Mas, F.; McConnell, J. W.; Rykaczewski, K.; Toth, K. S. [Physics Division, Oak Ridge National Laboratory, Oak Ridge, 37831 Tennessee (United States); Piechaczek, A.; Zganjar, E. F. [Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Semmes, P. [Tennessee Technological University, Cookeville, Tennessee 38505 (United States)



Simulation analysis of RED with short lived TCP connections  

Microsoft Academic Search

Several objectives have been identified in developing the random early drop (RED): decreasing queueing delay, increasing throughput, and increasing fairness between short and long lived connections. It has been believed that indeed the drop probability of a packet in RED does not depend on the size of the file to which it belongs. In this paper we study the fairness

Eitan Altman; Tania Jiménez



Short-lived isomers in {sup 94}Rb  

SciTech Connect

The medium-spin structure of the neutron-rich, odd-odd nucleus {sup 94}Rb was studied by means of {gamma}-ray spectroscopy. Excited levels were populated in the neutron-induced fission of {sup 235}U and in the spontaneous fission of {sup 252}Cf and {sup 248}Cm. Two isomeric states were found at 1485.2 and 2074.8 keV with half-lives of 18 and 107 ns, respectively. The probable structures of the two isomers involve the fully aligned, proton-neutron configurations [{pi}(g{sub 9/2}) x {nu}(g{sub 7/2})]{sub 8{sup +}} and [{pi}(g{sub 9/2}) x {nu}(h{sub 11/2})]{sub 10{sup -}}, respectively. These new data give information on the single-particle energies in the region.

Tsekhanovich, I.; Dare, J. A.; Smith, A. G.; Varley, B. J. [Schuster Laboratory, University of Manchester, Manchester M13 9PL (United Kingdom); Simpson, G. S. [Laboratoire de Physique Subatomique et de Cosmologie, F-38026 Grenoble (France); Urban, W.; Soldner, T. [Institut Laue-Langevin, 6 rue J. Horowitz, F-38042 Grenoble (France); Jolie, J.; Linnemann, A. [Institut fuer Kernphysik, Universitaet zu Koeln, Zuelpicherstr. 77, D-50937 Koeln (Germany); Orlandi, R.; Smith, J. F. [University of the West of Scotland, Paisley PA1 2BE (United Kingdom); Scherillo, A. [Rutherford Appleton Laboratory, Chilton, Didcot OX11 0QX (United Kingdom); Rzaca-Urban, T.; Zlomaniec, A. [Faculty of Physics, Warsaw University, ul. Hoza 69, 00-681 Warsaw (Poland); Dorvaux, O.; Gall, B. J. P.; Roux, B. [Institut de Recherches Subatomiques, CNRS-IN2P3, F-67037 Strasbourg (France)



Tropospheric Ozone as a Short-lived Chemical Climate Forcer  

NASA Technical Reports Server (NTRS)

Tropospheric ozone is the third most important greenhouse gas according to the most recent IPCC assessment. However, tropospheric ozone is highly variable in both space and time. Ozone that is located in the vicinity of the tropopause has the greatest effect on climate forcing. Nitrogen oxides (NOx) are the most important precursors for ozone In most of the troposphere. Therefore, pollution that is lofted upward in thunderstorm updrafts or NOx produced by lightning leads to efficient ozone production in the upper troposphere, where ozone is most important climatically. Global and regional model estimates of the impact of North American pollution and lightning on ozone radiative forcing will be presented. It will be shown that in the Northern Hemisphere summer, the lightning effect on ozone radiative forcing can dominate over that of pollution, and that the radiative forcing signal from North America extends well into Europe and North Africa. An algorithm for predicting lightning flash rates and estimating lightning NOx emissions is being incorporated into the NASA GEOS-5 Chemistry and Climate Model. Changes in flash rates and emissions over an ENSO cycle and in future climates will be assessed, along with the resulting changes in upper tropospheric ozone. Other research on the production of NOx per lightning flash and its distribution in the vertical based on cloud-resolving modeling and satellite observations will be presented. Distributions of NO2 and O3 over the Middle East from the OMI instrument on NASA's Aura satellite will also be shown.

Pickering, Kenneth E.



Cosmic crystallography using short-lived objects - Active Galactic Nuclei  

Microsoft Academic Search

Cosmic crystallography is based on the principle that peaks in the pair separation histogram (PSH) of objects in a catalogue should be induced by the high number of topologically lensed pairs that are separated by Clifford translations, in excess to ``random'' pairs of objects. Here we present modifications of this method that successively improve the signal-to-noise ratio by removing a

Andrzej Marecki; B. F. Roukema; Stanislaw Bajtlik



Short-lived Rn-222 daughters in cryogenic liquids  

SciTech Connect

In this paper a detection method of ? emitters from {sup 222}Rn decay chain, present in cryogenic liquids, using bare Si-PIN diodes immersed in the liquids is presented. Properties of ionized {sup 222}Rn daughters deduced from conducted measurements are outlined. Life-time of positive ions was found to be of the order of 10 s, and nonzero content of electronegative ions was observed.

Pelczar, Krzysztof; Frodyma, Nikodem; Wójcik, Marcin [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, PL-30-059 Kraków (Poland)] [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, PL-30-059 Kraków (Poland)



On Al-26 and other short-lived interstellar radioactivity  

NASA Technical Reports Server (NTRS)

Several authors have shown that massive stars exploding at a rate of about three per century can account for a large portion, if not all, of the observed interstellar Al-26. In a separate argument using models of Galactic chemical evolution, Clayton (1984) showed that the Al-26/Al-27 production ratio was not large enough to maintain enough Al-26 in the Galactic disk gas of about 10 exp 10 solar masses having solar composition. We present a resolution of those conflicting arguments. A past history of Galactic infall growing the Galactic disk so dilutes the stable Al-27 concentration that the two approaches can be brought into near agreement. If massive stars dominate the production of Al-26, we suggest that the apparent shortfall of their Al-26/Al-27 yield ratio is to be interpreted as evidence for significant growth of the Galactic disk. We also discuss the implications of these arguments for other extinct radioactivities in meteorites, using I-129 and Sm-146 as examples.

Clayton, Donald D.; Hartmann, Dieter H.; Leising, Mark D.




NSDL National Science Digital Library

AlphaGalileo is designed for science journalists, but anyone with an itch for breaking academic news will enjoy this research-rich site. Readers may browse by region, including Africa, Asia, Caribbean, Europe, Latin America, Middle East, North America, Oceania, and this Scout Editorâ??s favorite: Extraterrestrial. Next, try trawling the site by Science, Health, Society, Humanities, Arts, Applied Science, and Business for the latest illuminating research in each of these fields. AlphaGalileo also issues News Releases, usually five or six paragraphs long, that cover particularly interesting research findings. Best of all, since the Scout Report previously covered AlphaGalileo back in 2007, the site has dropped its membership requirements and visitors can browse more freely than ever.


Semiconductor polycrystalline alpha detectors  

NASA Astrophysics Data System (ADS)

In order to check possible novel neutron detectors based on composite semiconductor detectors containing nuclides with large cross sections for neutron, we tested their response to alpha particles. In the present paper we describe results obtained with composite samples made of hexagonal Boron Nitride particles bound with Polystyrene or Nylon-6. The samples were tested under 5.5 MeV alpha particle radiation emitted from 241Am source and 4.8MeV alpha particle of 226Ra source. Some of the responses of these composite detectors to thermal neutrons were already reported and here we shall show some newer results obtained with thermal neutrons, from a low intensity 241Am - 9Be and also from a medium intensity 252Cf source, which were thermalized using 10 cm thick paraffin. The Alpha detection experiments show that all the tested samples, regardless of the binder, show a well-defined peak around the 270 energy channel. There was very little polarization of the alpha radiation, since the amplitude of the alpha peak is reduced after ~ 2min from start of the irradiation, from 100% to 95% and it stayed stable at this level for another 10 minutes. The alpha spectrum detected from a PbI II single crystal is also shown for comparison. The neutron spectrum obtained by the composite BN samples showed an apparent peak around the 150 energy channel. The Signal to noise ratio for neutron detection from radionuclide shown here is about 2 only, whereas recent results to be published later, obtained with our composite BN detectors from a neutron beam of about 10 7 sec -1cm -2 is ~2 5. The 1.4 and 1.7 MeV alpha peaks resulting from the nuclear reaction of thermal neutrons with 10B of the boron nitride detector are not buried in the noise range. The capacitance noise requires small contact areas, therefore for large area detectors it is necessary to produce an electronic read-out device which can add up a multitude of small (less than pixilated contacts.

Schieber, M.; Roth, M.; Zuck, A.; Marom, G.; Khakhan, O.; Alfassi, Z. B.



Liver and Alpha-1  


... harm the liver are a virus, such as hepatitis B or C, or a chemical such as alcohol. There is no scientific evidence that carriers with the MS genes are at increased risk for liver disease. What Are Some Symptoms Of Alpha-1 Liver ...


[alpha]-Oxocarboxylic Acids  

ERIC Educational Resources Information Center

Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

Kerber, Robert C.; Fernando, Marian S.



ChemTeacher: Alpha Decay  

NSDL National Science Digital Library

ChemTeacher compiles background information, videos, articles, demonstrations, worksheets and activities for high school teachers to use in their classrooms. The Alpha Decay page includes resources for teaching students about the discovery and applications of alpha decay.



Contribution of uranium to gross alpha radioactivity in some environmental samples in Kuwait  

SciTech Connect

This study was done in connection with the use of uranium-tipped antitank shells during the Gulf War and possible contamination of the environment of Kuwait. It was found that uranium concentrations in the soil samples ranged from 0.3 {mu}g/g to 1.85 {mu}g/g. The average value of 0.7 {mu}g/g was lower than the world average value of 2.1 {mu}g/g for surface soils. Its contribution to the total natural alpha radioactivity (excluding Rn and its short-lived daughters) varied from 1.1% to 14%. The solid fall-out samples showed higher uranium concentration which varied from 0.35 {mu}g/g to 1.73 {mu}/g (average 1.47 {mu}g/g) but its contribution to the gross alpha radioactivity was in the same range, from 1.1 to 13.2%. The difference in the concentration of uranium in suspended air matter samples during the summer of 1993 and the winter of 1994 was found to be 2.0 {mu}g/g and 1.0 {mu}g/g, respectively. The uranium contribution to the natural alpha radioactivity in these samples was in the same range but lower for the winter period. The isotopic ratio of {sup 235}U to {sup 238}U for the measured samples was basically within an experimental error of {+-}0.001, close to the theoretical value of 0.007. The calculated total annual intake of uranium via inhalation for the Kuwait population was 0.07 Bq, e.g., 0.2% of the annual limit on intake. 13 refs., 1 fig., 3 tabs.

Bou-Rabee, F. [Kuwait Univ., Safat (Kuwait)] [Kuwait Univ., Safat (Kuwait); Bakir, Y.; Bem, H. [Ministry of Health, Qadsiya (Kuwait)] [Ministry of Health, Qadsiya (Kuwait)



Damped Lyman alpha Systems  

E-print Network

Observations of damped Lyman alpha systems offer a unique window on the neutral-gas reservoirs that gave rise to galaxies at high redshifts. This review focuses on critical properties such as the H I and metal content of the gas and on independent evidence for star formation. Together, these provide an emerging picture of gravitationally bound objects in which accretion of gas from the IGM replenishes gas consumed by star formation. Other properties such as dust content, molecular content, ionized-gas content, gas kinematics, and galaxy identifications are also reviewed. These properties point to a multiphase ISM in which radiative and hydrodynamic feedback processes are present. Numerical simulations and other types of models used to describe damped Lyman alpha systems within the context of galaxy formation are also discussed.

Arthur M. Wolfe; Eric Gawiser; Jason X. Prochaska



The alpha 21264 microprocessor  

Microsoft Academic Search

The third generation Alpha microprocessor from Compaq Computer Corporation (formerly Digital Equipment) is the 21264. This microprocessor can execute 2.0-2.4 billion instructions per second with a 500-600 MHz cycle time in a 0.35 um CMOS process, resulting in the industry-leading performance of 30+ SPECint95 and 58+ SPECfp95 in early system offerings. This paper focuses on the overall 21264 architecture, as

Richard E. Kessler



Bare alpha-alpha Potential and Implications on alpha-MATTER Properties  

Microsoft Academic Search

Double folding alpha - alpha potentials based on the density dependent n - n Gogny interactions are constrained to reproduce the l = 0 resonance in 8Be. Shallow potentials are obtained by successive supersymmetric transformations which eliminate the l = 0 Pauli forbidden states. Implication for the EOS of cold alpha-matter are discussed.

F. Carstoiu; S. Misicu; M. Rizea; M. Lassaut



High-Linear Energy Transfer Irradiation Targeted to Skeletal Metastases by the Alpha Emitter Ra-223: Adjuvant or Alternative to Conventional Modalities?  

SciTech Connect

The bone-seeking, alpha-particle emitting radiopharmaceutical Alpharadin, 223RaCl2 (t1/2 = 11.4 days) is under clinical development as a novel treatment for skeletal metastases from breast and prostate cancer. This paper summarizes the current status of preclinical and clinical research on 223RaCl2. Potential advantages of 223Ra to that of external beam irradiation or registered beta-emitting bone-seekers are discussed. Published data of 223Ra dosimetry in mice and a therapeutic study in a skeletal metastases model in nude rats have indicated significant therapeutic potential of bone-seeking alpha-emitters. This paper provides short-term and long-term results from the first clinical single dosage trial. We present data from a repeated dosage study of five consecutive injections of 50 kBq/kg bodyweight, once every third week, or two injections of 125 kBq/kg bodyweight, six weeks apart. Furthermore, preliminary results are given for a randomized phase II trial involving 64 patients with hormone-refractory prostate cancer and painful skeletal metastases who received four monthly injections of 223Ra or saline as an adjuvant to external beam radiotherapy. Also presented are preliminary dose estimates for 223Ra in humans. Results indicate that repeated dosing is feasible and that opportunities are available for combined treatment strategies.

Bruland, Oyvind S.; Nilsson, Sten; Fisher, Darrell R.; Larsen, Roy H.



Surface alpha clustering  

SciTech Connect

The problem of alpha decay is discussed on the basis of a theory which describes discrete and continuous states in a unified manner. A formula for numerical calculations is given in which configurational mixing as well as channel coupling is taken into account. The R-matrix approximation is shown to be justified if the width is spread over a small number of decay channels. Generally, renormalization of the wave function is necessary if a factorization of the width is assumed. The importance of channel coupling for the case of a small reduced width is discussed.

Rotter, I.




PubMed Central

Alpha-mannosidosis is an inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 of 500,000 live births. The children are often born apparently normal, and their condition worsens progressively. Some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial trait include large head with prominent forehead, rounded eyebrows, flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity. The disorder is caused by lysosomal alpha-mannosidase deficiency. Alpha-mannosidosis is inherited in an autosomal recessive fashion and is caused by mutations in the MAN2B1 gene located on chromosome 19 (19 p13.2-q12). Diagnosis is made by measuring acid alpha-mannosidase activity in leukocytes or other nucleated cells and can be confirmed by genetic testing. Elevated urinary secretion of mannose-rich oligosaccharides is suggestive, but not diagnostic. Differential diagnoses are mainly the other lysosomal storage diseases like the mucopolysaccharidoses. Genetic counseling should be given to explain the nature of the disease and to detect carriers. Antenatal diagnosis is possible, based on both biochemical and genetic methods. The management should be pro-active, preventing complications and treating manifestations. Infections must be treated frequently. Otolaryngological treatment of fluid in the middle ear is often required and use of hearing aids is invariably required. Early educational intervention for development of social skills is needed and physiotherapy is important to improve bodily function. Orthopedic surgery may be necessary. The long-term prognosis is poor. There is an insidiously slow progression of neuromuscular and skeletal deterioration over several decades, making most patients wheel-chair dependent. No patients manage to be completely socially independent. Many patients are over 50 years of age. PMID:18651971

Malm, Dag; Nilssen, Øivind



Background canceling surface alpha detector  


A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)



Background canceling surface alpha detector  


A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

MacArthur, D.W.; Allander, K.S.; Bounds, J.A.



Long range alpha particle detector  


An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.



Long range alpha particle detector  


An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

MacArthur, Duncan W. (Los Alamos, NM); Wolf, Michael A. (Los Alamos, NM); McAtee, James L. (Los Alamos, NM); Unruh, Wesley P. (Los Alamos, NM); Cucchiara, Alfred L. (Los Alamos, NM); Huchton, Roger L. (Los Alamos, NM)



Induction of lymphoma and osteosarcoma in mice by single and protracted low alpha doses  

SciTech Connect

Internal doses from the short-lived alpha-emitter 22Ra were given to 4-wk-old female mice. One group of about 300 animals received a single injection of 18.5 kBq 22Ra kg-1 body weight, corresponding to a mean skeletal alpha dose of 0.15 Gy. A second group of about 300 animals received the same total amount of 224Ra in the form of 72 fractions of 257 Bq kg-1 each, applied twice weekly during 36 wk. The fractionated group received the same final mean total skeletal dose of 0.15 Gy as the single injected group, but with a mean skeletal dose rate of 1 mGy d-1. A rather high incidence, 13.5% (40/296), of early malignant lymphomas was observed in the fractionated group during and shortly after the injection period, followed by a 7% incidence (21/296) of osteosarcomas during the second half of the animals' lifetime. The group with a single injection did not develop early lymphomas but did develop osteosarcomas later with an incidence of 5.8% (17/295). The occurrence of osteosarcomas was similar up to day 800 in the two experimental groups. Surprisingly, however, after this period no additional case of osteosarcoma was observed in the single-injected group, whereas one-third of all osteosarcomas occurred after day 800 in the protracted group. The additional later occurrence of osteosarcomas occurred after indicates a longer lasting induction effect on osteosarcomas, or a promoting effect in older age, for this kind of treatment.

Mueller, W.A.L.; Luz, A.; Murray, A.B.; Linzner, U. (Gesellschaft fuer Strahlen- und Umweltforschung, Neuherberg (Germany, F.R.))



Resting alpha activity predicts learning ability in alpha neurofeedback  

PubMed Central

Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho



[Microorganisms that produce alpha-galactosidase, alpha-mannosidase, alpha-fucosidase and beta-acetylglucosaminidase].  


The capacity to synthesize alpha-D-galactosidase (EC, alpha-D-mannosidase (EC, alpha-L-fucosidase (EC and beta-D-acetylglucose aminidase (EC was tested among 100 different cultures of soil microscopic fungi and actinomycetes. Two genera of micromycetes, viz. Scopulariopsis and Aposphaeria, which had not been known as producing alpha-D-galactosidase, were found, as well as several new species of the genus Penicillium: Pen. canescens, Pen. claviforme, Pen. cyclopium, Pen. daleae, Pen. frequentans, Pen. piscarum, Pen. simplicissimu, Pen. thomii. PMID:6248742

Ulezlo, I V; Zaprometova, O M; Ozerskaia, S M; Bezborodov, A M



[Alpha-glucosidase inhibitor].  


Alpha-glucosidase inhibitors (?-GI) have abdominal signs which are generally regarded as side-reaction. The abdominal signs are caused by generation of intestinal gas which contains hydrogen gas. The hydrogen gas absorbed in the body eliminates oxidant stress and consequently the abdominal signs may have beneficial effects preventing onset and progression of arteriosclerosis. Recently, it has been reported that the combination therapy of dipeptidyl peptidase-4 inhibitors with a-GI enhances glucagon like peptide-1 (GLP- 1) secretion and increases active GLP-1 concentration. Therefore, ?-GI is not only a matured and reliable oral anti-diabtic agent (OAD) but also a promising OAD which collaborates effectively with DPP-4 inhibitors or sodium-glucose cotransporter-2 inhibitors. PMID:25812363

Osonoi, Takeshi



Live! From 2-Alpha  

NSDL National Science Digital Library

This activity is one of several in which students are required to access and analyze actual data from NASA missions, including video "interviews" with real NASA scientists, to solve a mystery. In this mystery, students learn about the force of gravity and how scientists analyze data by studying the properties of different objects in space. Live! From 2-Alpha can be used to support instruction about forces and motion, origin and evolution of the universe, and the interaction of energy and matter. This activity is one of several in "Space Mysteries," a series of inquiry-driven, interactive Web explorations. Each Mystery in "Space Mysteries" is designed to teach at least one physical science concept (e.g. interactions of energy and matter, structures and properties of matter, energy, motion, or forces), and is accompanied by materials to be used by classroom teachers.


ORNL ALPHA MIS programmer's manual  

SciTech Connect

This manual is a reference tool for programmers who are responsible for the software maintenance of the ALPHA system user interface program, also called simply ALPHA. This ALPHA user program is a part of the overall ALPHA Management Information System (MIS), which is a general-purpose MIS. The ALPHA user interface program provides the ALPHA MIS with a user-friendly, interactive interface between the general user and the System 1022 (trademark of Software House) data base. Through this facility the general user is able to choose a data base, select records from the data base, sort those records, and display in a variety of ways useful information contained in those records. User friendliness is supported by an extensive HELP facility. This manual documents all source code necessary for the successful compilation of the ALPHA user program (version 3-A). Also included is documentation covering the external files and common blocks necessary for the successful compilation of this program as well as the system reference file, which drives the program after it is compiled. Data base external files and tables that may be accessed by the ALPHA user program are documented elsewhere.

Haese, R.L.; Smith, S.E.; Lovin, J.K.; Grubb, J.W.



EEG Alpha Power and Intelligence.  

ERIC Educational Resources Information Center

Tested whether alpha power in different sub-bands is selectively related to intelligence. For 74 Austrian subjects, the EEG was recorded during a resting session and 2 different intelligence tests were performed. Findings show a strong positive correlation between intelligence and alpha power. (SLD)

Doppelmayr, M.; Klimesch, W.; Stadler, W.; Pollhuber, D.; Heine, C.




Technology Transfer Automated Retrieval System (TEKTRAN)

Plant cells are unique in that they contain four species of alpha-ketoacid dehydrogenase complex: plastidial pyruvate dehydrogenase, mitochondrial pyruvate dehydrogenase, alpha-ketoglutarate (2-oxoglutarate) dehydrogenase, and branched-chain alpha-ketoacid dehydrogenase. All complexes include multi...


I. Excluded volume effects in Ising cluster distributions and nuclear multifragmentation. II. Multiple-chance effects in alpha-particle evaporation  

NASA Astrophysics Data System (ADS)

In Part I, geometric clusters of the Ising model are studied as possible model clusters for nuclear multifragmentation. These clusters may not be considered as non-interacting (ideal gas) due to excluded volume effect which predominantly is the artifact of the cluster's finite size. Interaction significantly complicates the use of clusters in the analysis of thermodynamic systems. Stillinger's theory is used as a basis for the analysis, which within the RFL (Reiss, Frisch, Lebowitz) fluid-of-spheres approximation produces a prediction for cluster concentrations well obeyed by geometric clusters of the Ising model. If thermodynamic condition of phase coexistence is met, these concentrations can be incorporated into a differential equation procedure of moderate complexity to elucidate the liquid-vapor phase diagram of the system with cluster interaction included. The drawback of increased complexity is outweighted by the reward of greater accuracy of the phase diagram, as it is demonstrated by the Ising model. A novel nuclear-cluster analysis procedure is developed by modifying Fisher's model to contain cluster interaction and employing the differential equation procedure to obtain thermodynamic variables. With this procedure applied to geometric clusters, the guidelines are developed to look for excluded volume effect in nuclear multifragmentation. In Part II, an explanation is offered for the recently observed oscillations in the energy spectra of alpha-particles emitted from hot compound nuclei. Contrary to what was previously expected, the oscillations are assumed to be caused by the multiple-chance nature of alpha-evaporation. In a semi-empirical fashion this assumption is successfully confirmed by a technique of two-spectra decomposition which treats experimental alpha-spectra as having contributions from at least two independent emitters. Building upon the success of the multiple-chance explanation of the oscillations, Moretto's single-chance evaporation theory is augmented to include multiple-chance emission and tested on experimental data to yield positive results.

Breus, Dimitry Eugene


I. Excluded Volume Effects in Ising Cluster Distributions and Nuclear Multifragmentation II. Multiple-Chance Effects in Alpha-Particle Evaporation  

SciTech Connect

In Part 1, geometric clusters of the Ising model are studied as possible model clusters for nuclear multifragmentation. These clusters may not be considered as non-interacting (ideal gas) due to excluded volume effect which predominantly is the artifact of the cluster's finite size. Interaction significantly complicates the use of clusters in the analysis of thermodynamic systems. Stillinger's theory is used as a basis for the analysis, which within the RFL (Reiss, Frisch, Lebowitz) fluid-of-spheres approximation produces a prediction for cluster concentrations well obeyed by geometric clusters of the Ising model. If thermodynamic condition of phase coexistence is met, these concentrations can be incorporated into a differential equation procedure of moderate complexity to elucidate the liquid-vapor phase diagram of the system with cluster interaction included. The drawback of increased complexity is outweighted by the reward of greater accuracy of the phase diagram, as it is demonstrated by the Ising model. A novel nuclear-cluster analysis procedure is developed by modifying Fisher's model to contain cluster interaction and employing the differential equation procedure to obtain thermodynamic variables. With this procedure applied to geometric clusters, the guidelines are developed to look for excluded volume effect in nuclear multifragmentation. In part 2, an explanation is offered for the recently observed oscillations in the energy spectra of {alpha}-particles emitted from hot compound nuclei. Contrary to what was previously expected, the oscillations are assumed to be caused by the multiple-chance nature of {alpha}-evaporation. In a semi-empirical fashion this assumption is successfully confirmed by a technique of two-spectra decomposition which treats experimental {alpha}-spectra has having contributions from at least two independent emitters. Building upon the success of the multiple-chance explanation of the oscillations, Moretto's single-chance evaporation theory is augmented to include multiple-chance emission and tested on experimental data to yield positive results.

Breus, Dimitry E.



Alpha--College for Exploring  

ERIC Educational Resources Information Center

Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

Leppert, William; Koenig, Joan



Alpha decay in electron surrounding  

SciTech Connect

The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

Igashov, S. Yu. [All-Russia Research Institute of Automatics (FSUE VNIIA) (Russian Federation); Tchuvil’sky, Yu. M. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation)



Long-range alpha detection  

SciTech Connect

The detection and measurement of alpha contamination is not an easy task. An alpha particle`s characteristic high charge and large mass make it highly interactive with surrounding matter. The particle is often absorbed before its presence can be sensed with a detector. Los Alamos National Laboratory has studied this problem and has developed an improved process to detect alpha-emitting contaminants. The process is called long-range alpha detection (LRAD). The LRAD process focuses on the collection and measurement of ions created as a result of an alpha particle`s interaction with air. With only about 35 eV necessary to create an ion pair, a typical 5-MeV alpha particle, upon emission from its maternal nucleus, creates about 150,000 pairs of charged particles. In air these charged particles take several seconds to locate a mate and become electrically neutral. During this time, ions can be pulled away from the source, collected, and measured. Ions can be motivated to a collection device by using an electric field or by moving the air mass in which the ions are located. The collected charges create a small but discrete current that can give some useful information about the alpha-emitting source. In this article, two commercially available applications of the LRADS technology will be discussed. One of these, a device used primarily for pipe monitoring, is from BNFL Instruments, Inc. The other is a monitoring box of sorts from Eberline that will produce an alpha measurement on anything that is placed in the box.

Kasper, K.



Linkage of alpha G-Philadelphia to alpha-thalassemia in African-Americans .  

PubMed Central

We have studied the inheritance of the alpha-chain hemoglobin variant Hb G-Philadelphia (alpha 2(68 Asn leads to Lys)Beta 2) in two African-American families. Expression of the alpha-globin loci was monitored by the percentage of Hb G in these individuals. The variant represented approximately 33% of the total adult hemoglobin in some and 50% in others. alpha-Globin gene fragments were analyzed by using restricton endonucleases that cleave outside (EcoRI), within (HindIII), and between (Bgl II) the normal duplicated alpha-globin loci (alpha alpha/alpha alpha). Individuals having 33% variant lack one functioning alpha gene (alpha G/alpha alpha); those with 50% variant lack two genes, one missing on each chromosome (alpha G/alpha). Inheritance of alpha G was therefore linked to that of a chromosome with only one functional alpha-globin gene locus. This locus is probably the result of a nonhomologous crossover. Our results also suggest equal expression of the alpha-globin loci in humans because the percentages of the variant could be explained solely on the basis of the total number of alpha genes present. The percentages of Hb G as well as other hematologic data all were consistent with the number of alpha-globin genes identified by restriction endonuclease mapping. Gene mapping yields a more precise determination of the number of alpha-globin genes than does study of globin synthesis. Images PMID:6933536

Surrey, S; Ohene-Frempong, K; Rappaport, E; Atwater, J; Schwartz, E



DPL ALPHA System and Codd's Cellular Space  

Microsoft Academic Search

DPL ALPHA differs from Codd's original DSL ALPHA only in one essential aspect, namely, that in Data Processing Language ALPHA primitive notions are mostly from predicate calculus (i.e., relation calculus without quantifiers). Boolean algebra and edge-notched card system rather than from relation calculus and relational algebra. ALPHA concepts then can be synthetized from these. [6

G. Fay



Circulating integrins: alpha 5 beta 1, alpha 6 beta 4 and Mac-1, but not alpha 3 beta 1, alpha 4 beta 1 or LFA-1.  

PubMed Central

The alpha 5 beta 1, alpha 6 beta 4 and Mac-1 integrins all participate in the endocytotic cycle. By contrast, alpha 3 beta 1, alpha 4 beta 1 and LFA-1 do so much more slowly, or not at all, in the cell lines examined. This indicates that the alpha-chains appear to determine whether an integrin cycles or not, and that alpha 5 beta 1, alpha 6 beta 4 and Mac-1 can be brought to the leading edge of a moving cell by endocytosis and recycling. Images PMID:1531629

Bretscher, M S



Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane  

Technology Transfer Automated Retrieval System (TEKTRAN)

We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...


Scale Setting for $\\alpha_{s}$ Beyond Leading Order  

E-print Network

We present a general procedure for applying the scale-setting prescription of Brodsky, Lepage and Mackenzie to higher orders in the strong coupling constant $\\alphas$. In particular, we show how to apply this prescription when the leading coefficient or coefficients in a series in $\\alphas$ are anomalously small. We give a general method for computing an optimum scale numerically, within dimensional regularization, and in cases when the coefficients of a series are known. We find significant corrections to the scales for $R_{e^+ e^-}$, $\\Gamma(B \\to X_u e \\bar{\

Hornbostel, K; Morningstar, C J



Workshop on Precision Measurements of $\\alpha_s$  

SciTech Connect

These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

Bethke, Siegfried; /Munich, Max Planck Inst.; Hoang, Andre H.; /Vienna U.; Kluth, Stefan; /Munich, Max Planck Inst.; Schieck, Jochen; /Munich U.; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS



Targeted therapy using alpha emitters  

NASA Astrophysics Data System (ADS)

Radionuclides such as and which decay by the emission of -particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of and -particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the -particles emitted by radionuclides such as and , -particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with - and -labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of -emitting radiopharmaceuticals is meta-[]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by []thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[]iodobenzylguanidine. For meta-[]astatobenzylguanidine, the value was equivalent to only atoms bound per cell. These results suggest that meta-[]astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

Vaidyanathan, Ganesan; Zalutsky, Michael R.



Counting particles emitted by stratospheric aircraft and measuring size of particles emitted by stratospheric aircraft. Final technical report, 1 May 1990-31 December 1992  

SciTech Connect

The ER-2 condensation nuclei counter (CNC) has been modified to reduce the diffusive losses of particles within the instrument. These changes have been successful in improving the counting efficiency of small particles at low pressures. Two techniques for measuring the size distributions of particles with diameters less than 0.17 micrometers have been evaluated. Both of these methods, the differential mobility analyzer (DMA) and the diffusion battery, have fundamental problems that limit their usefulness for stratospheric applications. The authors cannot recommend either for this application. Newly developed, alternative methods for measuring small particles include inertial separation with a low-loss critical orifice and thin-plate impactor device. This technique is now used to collect particles in the multisample aerosol collector housed in the ER-2 CNC-2, and shows some promise for particle size measurements when coupled with a CNC as a counting device. The modified focused-cavity aerosol spectrometer (FCAS) can determine the size distribution of particles with ambient diameters as small as about 0.07 micrometers. Data from this instrument indicates the presence of a nuclei mode when CNC-2 indicates high concentrations of particles, but cannot resolve important parameters of the distribution.

Wilson, J.C.



Evaluation of internal alpha radiation exposure and subsequent infertility among a cohort of women formerly employed in the radium dial industry.  

SciTech Connect

This study examined the effect of internal exposure to {alpha}-particle radiation on subsequent fertility among women employed in the radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n=603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of {alpha} particles emitted, fraction of energy absorbed with in the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of {gamma}-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility.

Schieve, L. A.; Davis, F.; Roeske, J.; Handler, A.; Freels, S.; Stinchcomb, T.; Keane, A.; Environmental Research; Univ. of Illinois at Chicago; Univ. of Chicago; DePaul Univ.



Evaluation of internal alpha-particle radiation exposure and subsequent fertility among a cohort of women formerly employed in the radium dial industry  

SciTech Connect

This study examined the effect of internal exposure to {alpha}-particle radiation on subsequent fertility among women employed in radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n = 603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of {alpha} particles emitted, fraction of energy absorbed within the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of {gamma}-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility. 42 refs., 5 tabs.

Schieve, L.A.; Davis, F.; Freels, S. [Univ. of Illinois, Chicago, IL (United States)] [and others



EEG alpha power and alpha power asymmetry in sleep and wakefulness  

E-print Network

--Madison, USA Abstract Asymmetry of waking electroencephalography ~EEG! alpha power in frontal regions has been and sleeping are considered. Descriptors: Electroencephalography, Alpha, Sleep, REM sleep, Human Individual

Wisconsin at Madison, University of


Alcoholism, Alpha Production, and Biofeedback  

ERIC Educational Resources Information Center

Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

Jones, Frances W.; Holmes, David S.



Alpha Testing Escape from Diab  

Technology Transfer Automated Retrieval System (TEKTRAN)

Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...


Alpha proton x ray spectrometer  

NASA Technical Reports Server (NTRS)

Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

Rieder, Rudi; Waeke, H.; Economou, T.



Alpha 1-adrenergic receptor structure  

SciTech Connect

The structure of the alpha 1-adrenergic receptor was investigated by comparing polypeptides identified by sodium dodecyl sulfate (NaDodSO4)-polyacrylamide gel electrophoresis with the size of the intact receptor in cell membranes as determined by target size analysis. The alpha 1-adrenergic receptor from rat liver membranes affinity-labeled with (/sup 3/H)phenoxybenzamine, a covalent affinity reagent, appeared as a single polypeptide with a molecular mass of 85,000 daltons (Da) on NaDodSO4-polyacrylamide gels. In the absence of protease inhibitors, smaller peptides of 58-62 kDa and 40-45 kDa, specifically labeled with (/sup 3/H)phenoxybenzamine, were also apparent on NaDodSO4 gels. In order to determine whether the 85-kDa protein represented all or only a portion of the alpha 1-receptor, radiation inactivation (target size analysis) was undertaken. Radiation-induced receptor inactivation was measured by the loss of specific (/sup 3/H)phenoxybenzamine and (/sup 3/H)prazosin binding and by the loss of affinity-labeled alpha 1-adrenergic receptors on NaDodSO4 gels. Target size analysis of rat liver alpha 1-receptors indicated that the intact membrane-bound receptor has an average molecular mass of 160,000 Da. These data suggest that the intact alpha-receptor may exist in the membrane as a dimer of two 85,000-Da subunits. The structure of the alpha 1-receptor was further studied by limited proteolysis of the 85-kDa protein isolated from NaDodSO4 gels. Trypsin, chymotrypsin, and papain produce smaller peptides similar to those produced during membrane isolation in the absence of protease inhibition. Limited proteolysis of the membrane-bound receptor produces water-soluble peptides, the largest of which is 45,000 Da. This peptide contains the ligand-binding domain and protrudes from the membrane into the extracellular space.

Venter, J.C.; Horne, P.; Eddy, B.; Greguski, R.; Fraser, C.M.



Orthopositronium Lifetime: Analytic Results in O({alpha}) and O({alpha}{sup 3}ln{alpha})  

SciTech Connect

We present the O({alpha}) and O({alpha}{sup 3}ln{alpha}) corrections to the total decay width of orthopositronium in closed analytic form, in terms of basic irrational numbers, which can be evaluated numerically to arbitrary precision.

Kniehl, Bernd A.; Kotikov, Anatoly V.; Veretin, Oleg L. [II. Institut fuer Theoretische Physik, Universitaet Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany)



Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be  

SciTech Connect

The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

Itagaki, N. [Department of Physics, University of Tokyo, Hongo, 113-0033 Tokyo (Japan); Ito, M. [RIKEN Nishina Center, Wako, 351-0198 Saitama (Japan); Milin, M. [Department of Physics, University of Zagreb, HR-10000 Zagreb (Croatia); Hashimoto, T.; Ishiyama, H.; Miyatake, H. [Tokai Radioactive Ion Accelerator Complex, High Energy Accelerator Research Organization (KEK), Tokai, 319-1105 Ibaraki (Japan)



How Is Alpha-1 Antitrypsin Deficiency Treated?  


... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...


What Causes Alpha-1 Antitrypsin Deficiency?  


... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...


Slow alpha variant during REM sleep.  


REM sleep resembles wakefulness or drowsiness. The pattern can be low-voltage, or else alpha-like. Alpha frequencies are present only during the tonic phases of REM sleep and, compared to wakefulness tracings, alpha activities are slightly slower by 1-2 Hz and are more monomorphic. The slow alpha-variant rhythm or subharmonic alpha pattern consists of rhythmic notched theta waves. It shares the same topography and reactivity with the alpha rhythm. We report its presence during the tonic phases of REM sleep without any modification in its morphology in the first case. In the second case, its morphology was similar to awakening but with slower amplitude. No alpha frequencies were found in REM sleep but only its slow alpha variant. This study provides evidence that REM sleep is a stage of sleep that contains rhythms similar to those seen during wakefulness and drowsiness. PMID:18329545

Gelisse, P; Crespel, A



Selectin-like kinetics and biomechanics promote rapid platelet adhesion in flow: the GPIb(alpha)-vWF tether bond.  


The ability of platelets to tether to and translocate on injured vascular endothelium relies on the interaction between the platelet glycoprotein receptor Ib alpha (GPIb(alpha)) and the A1 domain of von Willebrand factor (vWF-A1). To date, limited information exists on the kinetics that govern platelet interactions with vWF in hemodynamic flow. We now report that the GPIb(alpha)-vWF-A1 tether bond displays similar kinetic attributes as the selectins including: 1) the requirement for a critical level of hydrodynamic flow to initiate adhesion, 2) short-lived tethering events at sites of vascular injury in vivo, and 3) a fast intrinsic dissociation rate constant, k(0)(off) (3.45 +/- 0.37 s(-1)). Values for k(off), as determined by pause time analysis of transient capture/release events, were also found to vary exponentially (4.2 +/- 0.8 s(-1) to 7.3 +/- 0.4 s(-1)) as a function of the force applied to the bond (from 36 to 217 pN). The biological importance of rapid bond dissociation in platelet adhesion is demonstrated by kinetic characterization of the A1 domain mutation, I546V that is associated with type 2B von Willebrand disease (vWD), a bleeding disorder that is due to the spontaneous binding of plasma vWF to circulating platelets. This mutation resulted in a loss of the shear threshold phenomenon, a approximately sixfold reduction in k(off), but no significant alteration in the ability of the tether bond to resist shear-induced forces. Thus, flow dependent adhesion and rapid and force-dependent kinetic properties are the predominant features of the GPIb(alpha)-vWF-A1 tether bond that in part may explain the preferential binding of platelets to vWF at sites of vascular injury, the lack of spontaneous platelet aggregation in circulating blood, and a mechanism to limit thrombus formation. PMID:12080112

Doggett, Teresa A; Girdhar, Gaurav; Lawshé, Avril; Schmidtke, David W; Laurenzi, Ian J; Diamond, Scott L; Diacovo, Thomas G




SciTech Connect

By combining data from the NASA Wide-field Infrared Survey Explorer (WISE) mission with optical spectroscopy from the W. M. Keck telescope, we discover a mid-IR color criterion that yields a 78% success rate in identifying rare, typically radio-quiet, 1.6 {approx}< z {approx}< 4.6 dusty Ly{alpha} emitters (LAEs). Of these, at least 37% have emission extended on scales of 30-100 kpc and are considered Ly{alpha} ''blobs'' (LABs). The objects have a surface density of only {approx}0.1 deg{sup -2}, making them rare enough that they have been largely missed in deep, small area surveys. We measured spectroscopic redshifts for 92 of these galaxies, and find that the LAEs (LABs) have a median redshift of 2.3 (2.5). The WISE photometry coupled with data from Herschel (Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA) reveals that these galaxies are in the Hyper Luminous IR galaxy regime (L{sub IR} {approx}> 10{sup 13}-10{sup 14} L{sub Sun }) and have warm colors. They are typically more luminous and warmer than other dusty, z {approx} 2 populations such as submillimeter-selected galaxies and dust-obscured galaxies. These traits are commonly associated with the dust being illuminated by intense active galactic nucleus activity. We hypothesize that the combination of spatially extended Ly{alpha}, large amounts of warm IR-luminous dust, and rarity (implying a short-lived phase) can be explained if the galaxies are undergoing brief, intense ''feedback'' transforming them from an extreme dusty starburst/QSO into a mature galaxy.

Bridge, Carrie R. [California Institute of Technology, MS249-17, Pasadena, CA 91125 (United States); Blain, Andrew [Department of Physics and Astronomy, University of Leicester, LE1 7RH Leicester (United Kingdom); Borys, Colin J. K.; Griffith, Roger L.; Tsai, Chao-Wei [Infrared Processing and Analysis Center, California Institute of Technology, MS 100-22, Pasadena, CA 91125 (United States); Petty, Sara; Farrah, Duncan [Department of Physics, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061 (United States); Benford, Dominic [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Eisenhardt, Peter; Stern, Daniel; Wu Jingwen [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Dr., Pasadena, CA 91109 (United States); Jarrett, Tom [Astronomy Department, University of Cape Town, Rondebosch 7701 (South Africa); Lonsdale, Carol [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States); Stanford, Spencer A. [Department of Physics, University of California Davis, One Shields Ave., Davis, CA 95616 (United States); Wright, Edward L., E-mail: [Astronomy Department, University of California Los Angeles, Los Angeles, CA 90095 (United States)



A New Population of High-z, Dusty Lyman-alpha Emitters and Blobs Discovered by WISE: Feedback Caught in the Act?  

NASA Technical Reports Server (NTRS)

By combining data from the NASA Wide-field Infrared Survey Explorer (WISE) mission with optical spectroscopy from the W. M. Keck telescope, we discover a mid-IR color criterion that yields a 78% success rate in identifying rare, typically radio-quiet, 1.6 approx. < z approx. < 4.6 dusty Ly-alpha emitters (LAEs). Of these, at least 37% have emission extended on scales of 30-100 kpc and are considered Ly-alpha "blobs" (LABs). The objects have a surface density of only approx.. 0.1 deg(exp -2), making them rare enough that they have been largely missed in deep, small area surveys. We measured spectroscopic redshifts for 92 of these galaxies, and find that the LAEs (LABs) have a median redshift of 2.3 (2.5). The WISE photometry coupled with data from Herschel (Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA) reveals that these galaxies are in the Hyper Luminous IR galaxy regime (L(sub IR) approx. > 10(exp 13)-10(exp 14) Solar L) and have warm colors. They are typically more luminous and warmer than other dusty, z approx.. 2 populations such as submillimeter-selected galaxies and dust-obscured galaxies. These traits are commonly associated with the dust being illuminated by intense active galactic nucleus activity. We hypothesize that the combination of spatially extended Ly-alpha, large amounts of warm IR-luminous dust, and rarity (implying a short-lived phase) can be explained if the galaxies are undergoing brief, intense "feedback" transforming them from an extreme dusty starburst/QSO into a mature galaxy.

Bridge, Carrie R.; Blain, Andrew; Borys, Colin J. K.; Petty, Sara; Benford, Dominic; Eisenhardt, Peter; Farrah, Duncan; Griffith, Roger, L.; Jarrett, Tom; Lonsdale, Carol; Stanford. Spencer A.; Stern, Daniel; Tsai, Chao-Wei; Wright, Edward L.; Wu, Jingwen



Evolution and seismology of alpha Centauri  

E-print Network

Solar-like oscillations detected in both components of the binary system alpha Centauri provide strong constraints on the fundamental parameters of the stellar system. We model alpha Centauri by means of a Levenberg-Marquardt minimization algorithm including seismic and classical constraints. Computations, that were perfomed decreasing significanly the weight of alpha Cen B seismic data in the calibration procedure, predict small separations in good agreement with new observations of solar-like oscillations in alpha Cen B by Bedding (these proceedings).

Josefina Montalban; Andrea Miglio



AlphaSort: a RISC machine sort  

Microsoft Academic Search

A new sort algorithm, called AlphaSort, demonstrates that commodity processors and disks can handle commercial batch workloads. Using Alpha AXP processors, commodity memory, and arrays of SCSI disks, AlphaSort runs the industry-standard sort benchmark in seven seconds. This beats the best published record on a 32-cpu 32-disk Hypercube by 8:1. On another benchmark, AlphaSort sorted more than a gigabyte in

Chris Nyberg; Tom Barclay; Zarka Cvetanovic; Jim Gray; Dave Lomet



Effectiveness of Alpha Biofeedback Therapy: Negative Results.  

ERIC Educational Resources Information Center

Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

Watson, Charles G.; Herder, Joseph



Recent Results on the CKM Angle Alpha  

SciTech Connect

The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

Mihalyi, A.; /Wisconsin U., Madison



Alpha 1 antitrypsin phenotypes and alcoholic pancreatitis  

Microsoft Academic Search

Altered frequencies of alpha 1 antitrypsin phenotypes have been reported in patients with chronic pancreatitis, suggesting a possible genetic basis for individual susceptibility to this disease. Alpha 1 antitrypsin phenotypes, with particular regard to alcoholic pancreatitis, were studied. Patients with alcoholic pancreatitis were compared with alcoholic control subjects with no history of pancreatic disease. Serum alpha 1 antitrypsin concentrations were

P S Haber; J S Wilson; B H McGarity; W Hall; M C Thomas; R C Pirola



Alpha 1-antitrypsin in acute myocardial infarction  

Microsoft Academic Search

Alpha 1-antitrypsin serum levels were measured in 48 patients with acute myocardial infarction and in 19 control patients either with coronary heart disease without necrosis, or with neither coronary disease nor inflammation. Alpha 1-antitrypsin was significantly raised in the group of patients with acute myocardial infarction. As some patients individually showed no change in alpha 1-antitrypsin levels, however, they were

H Gilutz; Y Siegel; E Paran; N Cristal; M R Quastel



Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume  

ERIC Educational Resources Information Center

Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.



17Alpha Centauri Bb -a nearby extrasolar planet? Alpha Centauri is a binary  

E-print Network

17Alpha Centauri Bb - a nearby extrasolar planet? Alpha Centauri is a binary star system located 4 at La Silla in Chile to detect the tell-tail motion of Alpha Centauri B caused by an earth-sized planet in close orbit around this star. The planet, called Alpha Centauri Bb, orbits at a distance of only six


[Anti alpha-herpesvirus drugs].  


Therapy for infectious diseases resulting from alpha-herpesvirus infections has been dramatically improved by the development of acyclovir (ACV). ACV is highly specific against herpes simplex virus type 1(HSV-1), herpes simplex virus type 2 (HSV-2) and varicella-zoster virus (VZV) as ACV is specifically phosphorylated by the thymidine kinases (TKs) of these viruses. These viral TKs are important enzymes for viral replication in vivo; therefore, the growth of TK-deficient mutants is impaired. ACV-resistant viruses are rarely isolated from immunocompetent patients but are frequently obtained from immunocompromised patients. Recently, other anti alpha-herpesvirus drugs, such as valacyclovir and famciclovir, have become available for use in Japan, but the need to develop new antiherpetic compounds with different mechanisms of action remains. PMID:22568134

Koshizuka, Tetsuo; Suzutani, Tatsuo



Spectroscopic analysis of alpha Andromedae  

NASA Astrophysics Data System (ADS)

Coude-spectrographic data for the visible and UV are employed to determine the atmospheric chemical composition of alpha And. Nothing that five previous observations of the star by other researchers failed to produce a consensus for the spectra, the present study considered only lines which were present in all the spectra obtained. The detected energy distribution indicated an effective temperature within 350 of 13850 K, a surface gravity around 3.85, and a microturbulence velocity of 2.5-3.5 km/sec. Normal C and Si abundances were present, along with overabundances of Mg, S, and Fe. Significant overabundances of P, Mn, Ga, Sr, Y, Zr, Eu, and Hg were detected. It is suggested that alpha And has a circumstellar envelope, indicating an unstable atmosphere and mass loss.

Derman, I. E.



Alpha-plutonium's Grüneisen parameter  

NASA Astrophysics Data System (ADS)

Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals.

Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert



Alpha-plutonium's Grüneisen parameter.  


Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals. PMID:21386421

Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert



Voglibose: An Alpha Glucosidase Inhibitor  

PubMed Central

Diabetes Mellitus (DM) is a morbid disease worldwide, with increasing incidence as time passes. It has macro-vascular and micro-vascular complications. The main cause of these complications is poorly controlled postprandial hyperglycaemia. Alpha glucosidase inhibitors, namely acarbose, voglibose and miglitol, are available for therapy. Voglibose is well tolerated and effective in comparable doses among these drugs. This article highlights the important features of voglibose. PMID:24551718

Dabhi, Ajay S.; Bhatt, Nikita R.; Shah, Mohit J.



The Alpha 21264 microprocessor architecture  

Microsoft Academic Search

The 21264 is the third generation Alpha microprocessor from Compaq Computer (formerly Digital Equipment) Corporation. This microprocessor achieves the industry-leading performance levels of 30+ Specint95 and 50+ Specfp95. In addition to the aggressive 600 MHz cycle time in a 0.35 ?m CMOS process, there are also many architectural features that enable the outstanding performance level of the 21264. This paper

R. E. Kessler; E. J. McLellan; D. A. Webb




SciTech Connect

We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

Hayes, Matthew [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France); Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, SE-106 91 Stockholm (Sweden); Schaerer, Daniel [CNRS, IRAP, 14, avenue Edouard Belin, F-31400 Toulouse (France); Verhamme, Anne; Orlitova, Ivana [Geneva Observatory, University of Geneva, 51 Chemin des Maillettes, CH-1290 Versoix (Switzerland); Mas-Hesse, J. Miguel; Oti-Floranes, Hector [Centro de Astrobiologia (CSIC-INTA), Departamento de Astrofisica, POB 78, 28691 Villanueva de la Canada (Spain); Adamo, Angela [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Atek, Hakim [Laboratoire d'Astrophysique, Ecole Polytechnique Federale de Lausanne (EPFL), Observatoire, CH-1290 Sauverny (Switzerland); Cannon, John M. [Department of Physics and Astronomy, Macalester College, 1600 Grand Avenue, Saint Paul, MN 55105 (United States); Herenz, E. Christian [Leibniz-Institut fuer Astrophysik (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Kunth, Daniel [Institut d'Astrophysique de Paris, UMR 7095 CNRS and UPMC, 98 bis Bd Arago, F-75014 Paris (France); Laursen, Peter, E-mail: [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark)



Alpha voltaic batteries and methods thereof  

NASA Technical Reports Server (NTRS)

An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)



In Vitro Cytotoxicity of Low-Dose-Rate Radioimmunotherapy by the Alpha-Emitting Radioimmunoconjugate Thorium-227-DOTA-Rituximab  

SciTech Connect

Purpose: To determine whether the low-dose-rate alpha-particle-emitting radioimmunoconjugate {sup 227}Th-1,4,7,10-p-isothiocyanato-benzyl-tetraazacyclododecane-1,4,7, 10-tetraacetic acid (DOTA)-rituximab can be used to inactivate lymphoma cells growing as single cells and small colonies. Methods and Materials: CD20-positive lymphoma cell lines were treated with {sup 227}Th-DOTA-rituximab for 1-5 weeks. To simulate the in vivo situation with continuous but decreasing supply of radioimmunoconjugates from the blood pool, the cells were not washed after incubation with {sup 227}Th-DOTA-rituximab, but half of the medium was replaced with fresh medium, and cell concentration and cell-bound activity were determined every other day after start of incubation. A microdosimetric model was established to estimate the average number of hits in the nucleus for different localizations of activity. Results: There was a specific targeted effect on cell growth of the {sup 227}Th-DOTA-rituximab treatment. Although the cells were not washed after incubation with {sup 227}Th-DOTA-rituximab, the average contribution of activity in the medium to the mean dose was only 6%, whereas the average contribution from activity on the cells' own surface was 78%. The mean dose rates after incubation with 800 Bq/mL {sup 227}Th-DOTA-rituximab varied from 0.01 to 0.03 cGy/min. The average delay in growing from 10{sup 5} to 10{sup 7} cells/mL was 15 days when the cells were treated with a mean absorbed radiation dose of 2 Gy alpha-particle radiation from {sup 227}Th-DOTA-rituximab, whereas it was 11 days when the cells were irradiated with 6 Gy of X-radiation. The relative biologic effect of the treatment was estimated to be 2.9-3.4. Conclusions: The low-dose-rate radioimmunoconjugate {sup 227}Th-DOTA-rituximab is suitable for inactivation of single lymphoma cells and small colonies of lymphoma cells.

Dahle, Jostein, E-mail: jostein.dahle@rr-research.n [Department of Radiation Biology, Norwegian Radium Hospital, Montebello, Oslo (Norway); Krogh, Cecilie; Melhus, Katrine B. [Department of Radiation Biology, Norwegian Radium Hospital, Montebello, Oslo (Norway); Borrebaek, Jorgen [Algeta ASA, Oslo (Norway); Larsen, Roy H. [Department of Radiation Biology, Norwegian Radium Hospital, Montebello, Oslo (Norway); Kvinnsland, Yngve [Nordic Neurolabs, Bergen (Norway)



Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.  


Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha abnormalities in ASD. PMID:25231288

Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L



Further Precise Determinations of $\\alpha_s$ from Lattice QCD  

E-print Network

We present a new determination of the strong coupling constant from lattice QCD simulations. We use four different short-distance quantities to obtain the coupling, three different (infrared) meson splittings to tune the simulation parameters, and a wide range of lattice spacings, quark masses, and lattice volumes to test for systematic errors. Our final result consists of ten different determinations of $\\alpha^{(3)}_{P}(8.2 GeV)$, which agree well with each other and with our previous results. The most accurate of these, when evolved perturbatively to the $Z^0$ mass, gives obtained from other recent lattice simulations.

Davies, C T H; Lepage, G P; McCallum, P; Shigemitsu, J; Sloan, J



Interferon Alpha-Induced Depression in Chronic Hepatitis C Patients: Comparison between Different Types of Interferon Alpha  

Microsoft Academic Search

IFN alpha treatment is able to produce dose-related side effects, such as depression, in the central nervous system. We assessed the effects on depression of four different types of IFN alpha (recombinant IFN alpha 2a, recombinant IFN alpha 2b, lymphoblastoid IFN alpha, leukocyte IFN alpha), administered at the same doses in four homogeneous groups of chronic hepatitis C patients (96

M. Malaguarnera; I. Di Fazio; S. Restuccia; G. Pistone; L. Ferlito; L. Rampello



Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-print Network

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N



Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-print Network

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Düllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schädel; A. Yakushev; S. Åberg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jäger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thörle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Türler; A. Ward; D. E. Ward; N. Wiehl



Atypical alpha asymmetry in adults with ADHD*  

PubMed Central

Introduction A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8– 12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha asymmetry has been associated with ADHD-like traits such as reduced reward responsiveness, a lack of inhibition toward aversive experience, and increased approach behaviors, and previous work has indicated increased rightward alpha asymmetry in children with ADHD. The current study explores whether increased rightward alpha asymmetry is also evident in adults with ADHD. Method We assessed low (8– 10 Hz) and high (10– 12 Hz) alpha asymmetry in adults with ADHD (n = 29) versus controls (n = 62) during baseline and cognitive activation conditions for nine homologous electrode pairs along the anterior–posterior axis. Result Seven results emerged (p < .05) showing increased rightward alpha asymmetry in adults with ADHD. This occurred in three specific electrode pairs across two testing conditions, and five of six results occurred in the lower alpha band. Finally, post hoc analysis indicated that increased rightward alpha asymmetry was generally associated with greater numbers of ADHD symptoms—with a possible parietal association for inattentive and a fronto-temporal association for hyperactivity symptoms. Conclusions Increased rightward alpha asymmetry previously observed in children with ADHD appears to be a developmentally persistent feature of ADHD. PMID:19467358

Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.



Scale setting for alpha_s beyond leading order  

E-print Network

We present a general procedure for incorporating higher-order information into the scale-setting prescription of Brodsky, Lepage and Mackenzie. In particular, we show how to apply this prescription when the leading coefficient or coefficients in a series in the strong coupling alpha_s are anomalously small and the original prescription can give an unphysical scale. We give a general method for computing an optimum scale numerically, within dimensional regularization, and in cases when the coefficients of a series are known. We apply it to the heavy quark mass and energy renormalization in lattice NRQCD, and to a variety of known series. Among the latter, we find significant corrections to the scales for the ratio of e+e- to hadrons over muons, the ratio of the quark pole to MSbar mass, the semi-leptonic B-meson decay width, and the top decay width. Scales for the latter two decay widths, expressed in terms of MSbar masses, increase by factors of five and thirteen, respectively, substantially reducing the size...

Hornbostel, K; Morningstar, C J



High gas flow alpha detector  


An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.



Targeted alpha therapy for cancer  

NASA Astrophysics Data System (ADS)

Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John



The Cycles of Alpha Centauri  

NASA Astrophysics Data System (ADS)

The main AB pair of the nearby Alpha Centauri triple system has one of the most extensive X-ray records of any cosmic object, stretching over three decades. The primary, ? Cen A (G2V), is a near twin of the Sun, with a similarly soft (1-2 MK) corona. The secondary, ? Cen B (K1V), is more active than the Sun, with a generally harder coronal spectrum. Here, spatially resolved measurements of the pair by Chandra's High Resolution Camera are compared, on a common basis, with previous pointings from ROSAT and XMM-Newton.

Ayres, Thomas R.



alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.  

PubMed Central

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L



Beta/alpha continuous air monitor  


A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

Becker, G.K.; Martz, D.E.



Cluster Expansion of Cold Alpha Matter Energy  

Microsoft Academic Search

In the cluster expansion framework of Bose liquids we calculate analytical expressions of the two-body, three-body and four-body diagrams contributing to the g.s. energy of an infinite system of neutral alpha-particles at zero-temperature, interacting via the strong nuclear forces exclusively. This is analytically tractable by assuming a density dependent two-body correlation function of Gaussian type. For the alpha-alpha potential we

F. Carstoiu; S Misicu; V. Balanica; M. Lassaut



On alpha heating in toroidal devices  

Microsoft Academic Search

Studies of the alpha particle losses and heating profiles for an alpha-heated TFTR-sized tokamak and a small field-reversed mirror reactor (FRM) are presented. The slowing-down and drift of high-energy alpha particles, including detailed orbital effects, is approximated for tokamak geometry using the SYMALF multi-energy-angle code. Results of the calculation for a beam-driven TFTR-type plasma indicate that, except for the center

G. H. Miley



Beta/alpha continuous air monitor  


A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

Becker, Gregory K. (Idaho Falls, ID); Martz, Dowell E. (Grand Junction, CO)



Alpha-Fetoprotein-Producing Renal Cell Carcinoma  

Microsoft Academic Search

Renal cell carcinoma with increased serum alpha-fetoprotein is rare; only 13 such cases have been reported. Our patient, a 51-year-old man, had an increased serum alpha-fetoprotein level and a tumor in the lower pole of the right kidney; which was discovered incidentally with sonography. Two weeks after a partial nephrectomy, his serum alpha-fetoprotein level declined to within the normal range.

Chang-Min Lin; En Meng; Shang-Sen Lee; Sheng-Tang Wu; Ching-Jiunn Wu; Ann Chen; Dah-Shyong Yu; Sun-Yran Chang; Guang-Huan Sun


[Alpha-linolenic acid and cardiovascular diseases].  


IMPORTANCE AND METABOLISM OF ALPHA-LINOLENIC ACID: Alpha-linolenic acid is an essential fatty acid which cannot be produced in the body and must be taken by food. Both in animals and humans, alpha-linolenic acid is desaturated and elongated into eicosapentaenoic and docosahexaenoic acid. It is also incorporated into plasma and tissue lipids and its conversion is affected by levels of linoleic acid. POTENTIAL ROLE IN PATHOGENESIS OF CARDIOVASCULAR DISEASES: Diet enriched in n-3 fatty acids, especially alpha-linolenic acid, reduces the incidence of cardiac death. Studies have shown that alpha linolenic acid prevents ventricular fibrillation which is the main cause of cardiac death. Studies in rats suggest that alpha-linolenic acid may be more effective in preventing ventricular fibrillations than eicosapentaenoic and docosahexaenoic acid. Furthermore, alpha-linolenic acid is the main fatty acid decreasing platalet aggregation which is an important step in thrombosis i.e. non-fatal myocardial infarction and stroke. DIETARY SOURCES AND NUTRITION RECOMMENDATIONS: Dietary sources include flaxseed and flaxseed oil, canola oil, soybean and soybean oil, pumpkin seed and pumpkin oil, walnuts and walnut oil. Strong evidence supports beneficial effects of alpha-linolenic acid and its dietary sources should be incorporated into balanced diet for prevention of cardiovascular diseases. The recommended daily intake is 2 g with a ratio of 5/1 for linoleic/alpha-linolenic acid. PMID:15510909

Risti?-Medi?, Danijela; Risti?, Gordana; Tepsi?, Vesna



Prospects for alpha particle studies on TFTR  

SciTech Connect

TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

Zweben, S.J.



EEG alpha power and alpha power asymmetry in sleep and wakefulness.  


Asymmetry of waking electroencephalography (EEG) alpha power in frontal regions has been correlated with waking emotional reactivity and the emotional content of dream reports. Little is known regarding alpha asymmetry during sleep. The present study was performed to compare alpha power and alpha power asymmetry in various brain regions across states of sleep and wakefulness. Waking and sleep EEG were recorded in a group of patients undergoing polysomnographic evaluation for possible sleep disorders. Alpha EEG asymmetry in frontal and temporal regions was significantly correlated in waking versus sleep, particularly during rapid eye movement (REM) sleep. These results suggest that patterns of frontal alpha asymmetry are stable across sleep and waking and may be related to emotional reactivity during dreaming. During sleep, alpha power was highest during slow-wave sleep and lowest during REM sleep. Implications of these data for understanding the functional significance of alpha power during waking and sleeping are considered. PMID:10432792

Benca, R M; Obermeyer, W H; Larson, C L; Yun, B; Dolski, I; Kleist, K D; Weber, S M; Davidson, R J



Molecular basis of alpha-thalassemia in Portugal.  


We have estimated the incidence and molecular basis of alpha-thalassemia in a Portuguese population, mostly from the Greater Lisbon area. In a group of 100 consecutive cord blood samples, the gene frequency of the rightward deletion (-alpha 3.7) was 0.035, and the leftward deletion (-alpha 4.2) was 0.015. In this group, we have also found four heterozygotes for the triple alpha-globin gene rearrangement (alpha alpha alpha anti 3.7. gene frequency 0.020). We have characterized the subtypes of -alpha 3.7 and alpha alpha alpha anti 3.7 rearrangements. On the whole, these results give an incidence of 10% for deletional alpha-thalassemia carriers in the studied Portuguese population. In a group of 342 subjects presenting beta-thalassemia, or Hb S trait, beta-thalassemia major sickle cell disease or low red blood cell indices, the -alpha 3.7, -alpha 4.2, -SEA, -MED, (alpha alpha)MM, and alpha alpha alpha anti 3.7 haplotypes were found in different combinations. Only one nondeletional alpha-thalassemia determinant (a 5 nucleotide deletion in the alpha 2-globin gene in the second intervening sequence donor site) was detected, which might suggest a low incidence of these defects in the Portuguese population. PMID:8718693

Peres, M J; Romão, L; Carreiro, H; Picanço, I; Batalha, L; Magalhães, H A; Martins, M C; Lavinha, J



Particles emitted from indoor combustion sources: size distribution measurement and chemical analysis.  


This study is primarily focused toward measuring the particle size distribution and chemical analysis of particulate matter that originates from combustion sources typically found in Indian urban homes. Four such sources were selected: cigarette, incense stick, mosquito coil, and dhoop, the latter being actually a thick form of incense stick. Altogether, seven of the most popular brands available in the Indian market were tested. Particle size distribution in the smoke was measured using a scanning mobility particle sizer, using both long and nano forms of differential mobility analyzer (DMA), with readings averaged from four to six runs. The measurable particle size range of the nano DMA was 4.6 nm to 157.8 nm, whereas that of the long DMA was 15.7 nm to 637.8 nm. Therefore, readings obtained from the long and the nano DMA were compared for different brands as well as for different sources. An overlap was seen in the readings in the common range of measurement. The lowest value of peak concentration was seen for one brand of incense stick (0.9 x 10(6) cm(-3)), whereas the highest (7.1 x 10(6) cm(-3)) was seen for the dhoop. Generally, these sources showed a peak between 140 and 170 nm; however, 2 incense stick brands showed peaks at 79 nm and 89 nm. The dhoop showed results much different from the rest of the sources, with a mode at around 240 nm. Chemical analysis in terms of three heavy metals (cadmium, zinc, and lead) was performed using graphite tube atomizer and flame-atomic absorption spectrophotometer. Calculations were made to assess the expected cancer and noncancer risks, using published toxicity potentials for these three heavy metals. Our calculations revealed that all the sources showed lead concentrations much below the American Conference of Governmental Industrial Hygienists (ACGIH) threshold limit value (TLV) level. One of the two mosquito coil brands (M(2)) showed cadmium concentrations two times higher than the California Environmental Protection Agency (Cal EPA) reference exposure level (REL). The latter also showed the highest carcinogenic risks of 350 people per million population. The amount of zinc obtained from the sources, however, was found to be quite below the standard limits, implying no risk in terms of zinc. PMID:19591538

Roy, A A; Baxla, S P; Gupta, Tarun; Bandyopadhyaya, R; Tripathi, S N



Evolution of trace gases and particles emitted by a chaparral fire in California  

NASA Astrophysics Data System (ADS)

Biomass burning (BB) is a major global source of trace gases and particles. Accurately representing the production and evolution of these emissions is an important goal for atmospheric chemical transport models. We measured a suite of gases and aerosols emitted from an 81 hectare prescribed fire in chaparral fuels on the central coast of California, US on 17 November 2009. We also measured physical and chemical changes that occurred in the isolated downwind plume in the first ~4 h after emission. The measurements were carried out onboard a Twin Otter aircraft outfitted with an airborne Fourier transform infrared spectrometer (AFTIR), aerosol mass spectrometer (AMS), single particle soot photometer (SP2), nephelometer, LiCor CO2 analyzer, a chemiluminescence ozone instrument, and a wing-mounted meteorological probe. Our measurements included: CO2; CO; NOx; NH3; non-methane organic compounds; organic aerosol (OA); inorganic aerosol (nitrate, ammonium, sulfate, and chloride); aerosol light scattering; refractory black carbon (rBC); and ambient temperature, relative humidity, barometric pressure, and three-dimensional wind velocity. The molar ratio of excess O3 to excess CO in the plume (?O3/?CO) increased from -5.13 (±1.13) × 10-3 to 10.2 (±2.16) × 10-2 in ~4.5 h following smoke emission. Excess acetic and formic acid (normalized to excess CO) increased by factors of 1.73 ± 0.43 and 7.34 ± 3.03 (respectively) over the same time since emission. Based on the rapid decay of C2H4 we infer an in-plume average OH concentration of 5.27 (±0.97) × 106 molec cm-3, consistent with previous studies showing elevated OH concentrations in biomass burning plumes. Ammonium, nitrate, and sulfate all increased over the course of 4 h. The observed ammonium increase was a factor of 3.90 ± 2.93 in about 4 h, but accounted for just ~36% of the gaseous ammonia lost on a molar basis. Some of the gas phase NH3 loss may have been due to condensation on, or formation of, particles below the AMS detection range. NOx was converted to PAN and particle nitrate with PAN production being about two times greater than production of observable nitrate in the first ~4 h following emission. The excess aerosol light scattering in the plume (normalized to excess CO2) increased by a factor of 2.50 ± 0.74 over 4 h. The increase in light scattering was similar to that observed in an earlier study of a biomass burning plume in Mexico where significant secondary formation of OA closely tracked the increase in scattering. In the California plume, however, ?OA/?CO2 decreased sharply for the first hour and then increased slowly with a net decrease of ~20% over 4 h. The fraction of thickly coated rBC particles increased up to ~85% over the 4 h aging period. Decreasing OA accompanied by increased scattering/particle coating in initial aging may be due to a combination of particle coagulation and evaporation processes. Recondensation of species initially evaporated from the particles may have contributed to the subsequent slow rise in OA. We compare our results to observations from other plume aging studies and suggest that differences in environmental factors such as smoke concentration, oxidant concentration, actinic flux, and RH contribute significantly to the variation in plume evolution observations.

Akagi, S. K.; Craven, J. S.; Taylor, J. W.; McMeeking, G. R.; Yokelson, R. J.; Burling, I. R.; Urbanski, S. P.; Wold, C. E.; Seinfeld, J. H.; Coe, H.; Alvarado, M. J.; Weise, D. R.



Evolution of trace gases and particles emitted by a chaparral fire in California  

NASA Astrophysics Data System (ADS)

Biomass burning (BB) is a major global source of trace gases and particles. Accurately representing the production and evolution of these emissions is an important goal for atmospheric chemical transport models. We measured a suite of gases and aerosols emitted from an 81 ha prescribed fire in chaparral fuels on the central coast of California, US on 17 November 2009. We also measured post-emission chemical changes in the isolated downwind plume for ~4 h of smoke aging. The measurements were carried out on board a Twin Otter aircraft outfitted with an airborne Fourier transform infrared spectrometer (AFTIR), aerosol mass spectrometer (AMS), single particle soot photometer (SP2), nephelometer, LiCor CO2 analyzer, a chemiluminescence ozone instrument, and a wing-mounted meteorological probe. Our measurements included: CO2; CO; NOx; NH3; non-methane organic compounds; organic aerosol (OA); inorganic aerosol (nitrate, ammonium, sulfate, and chloride); aerosol light scattering; refractory black carbon (rBC); and ambient temperature, relative humidity, barometric pressure, and three-dimensional wind velocity. The molar ratio of excess O3 to excess CO in the plume (?O3/?CO) increased from -0.005 to 0.102 in 4.5 h. Excess acetic and formic acid (normalized to excess CO) increased by factors of 1.7 ± 0.4 and 7.3 ± 3.0 (respectively) over the same aging period. Based on the rapid decay of C2H4 we infer an in-plume average OH concentration of 5.3 (±1.0) × 106 molecules cm-3, consistent with previous studies showing elevated OH concentrations in biomass burning plumes. Ammonium, nitrate, and sulfate all increased with plume aging. The observed ammonium increase was a factor of 3.9 ± 2.6 in about 4 h, but accounted for just ~36 % of the gaseous ammonia lost on a molar basis. Some of the gas phase NH3 loss may have been due to condensation on, or formation of, particles below the AMS detection range. NOx was converted to PAN and particle nitrate with PAN production being about two times greater than production of observable nitrate over a 4 h aging period. The excess aerosol light scattering in the plume (normalized to excess CO2) increased by a factor of 2.3 ± 0.7 over 4 h. The increase in light scattering was similar to that observed in an earlier study of a biomass burning plume in Mexico where significant secondary formation of OA closely tracked the increase in scattering. In the California plume, however, ?OA/?CO2 decreased sharply for the first hour and then increased slowly with a net decrease of ~24 % over 4 h. The fraction of thickly coated rBC particles increased almost twofold over the 4 h aging period. Decreasing OA accompanied by increased scattering/coating in the initial aging may be due to a combination of particle coagulation and evaporation processes. Recondensation of species initially evaporated from the particles may have contributed to the subsequent slow rise in OA. We compare our results to observations from other plume aging studies and suggest that differences in environmental factors such as smoke concentration, oxidant concentration, actinic flux, and RH contribute significantly to the variation in plume evolution observations.

Akagi, S. K.; Craven, J. S.; Taylor, J. W.; McMeeking, G. R.; Yokelson, R. J.; Burling, I. R.; Urbanski, S. P.; Wold, C. E.; Seinfeld, J. H.; Coe, H.; Alvarado, M. J.; Weise, D. R.




EPA Science Inventory

The research described was initiated with the objective of developing methods to identify and measure inorganic compounds in particulate emissions which emanate from sources using or processing fossil fuels. An extensive literature review was carried out to ascertain prior knowle...


Pseudorapidity spectra of relativistic particles emitted in the Au and Pb induced reactions at high energies  

E-print Network

The structure of the pseudorapidity spectra of charged relativistic particles with beta > 0.7 measured in Au+Em and Pb+Em collisions at AGS and SPS energies are analyzed using Fourier transformation method and maximum entropy one. The dependences of these spectra on the number of fast target protons (g-particles) are studied. They show visually some plateau and "shoulder" which are at least three selected points on the distributions. The plateau seems wider in Pb+Em reactions. The existing of plateau is expected for the parton models. The maximum entropy method confirms the existence of the plateau and the shoulder of the distributions.

Belashev, B Z; Vokál, S; Vrláková, J; Ajaz, M; Khan, K H; Zaman, Ali; Wazir, Z



Pseudorapidity spectra of relativistic particles emitted in the Au and Pb induced reactions at high energies  

E-print Network

The structure of the pseudorapidity spectra of charged relativistic particles with beta > 0.7 measured in Au+Em and Pb+Em collisions at AGS and SPS energies are analyzed using Fourier transformation method and maximum entropy one. The dependences of these spectra on the number of fast target protons (g-particles) are studied. They show visually some plateau and "shoulder" which are at least three selected points on the distributions. The plateau seems wider in Pb+Em reactions. The existing of plateau is expected for the parton models. The maximum entropy method confirms the existence of the plateau and the shoulder of the distributions.

B. Z. Belashev; M. K. Suleymanov; S. Vokál; J. Vrláková; M. Ajaz; K. H. Khan; Ali Zaman; Z. Wazir




EPA Science Inventory

Individual particles from coal- and oil-fired power plants were analyzed by a scanning electron microscope equipped with an energy dispersive X-ray spectrometer to investigate the morphology and composition as a function of size. Samples were collected on filters by a dichotomous...


Characterization of individual fly-ash particles emitted from coal- and oil-fired power plants  

Microsoft Academic Search

Individual particles from coal- and oil-fired power plants were analyzed by a scanning electron microscope equipped with an energy dispersive x-ray spectrometer to investigate the morphology and composition as a function of size. Samples were collected on filters by a dichotomous sampler in the fine (<2.5 micrometer aerodynamic diameter) and the coarse fractions (2.5 to 5-10 micrometers). In both fractions,

Y. Mamane; J. L. Miller; T. G. Dzubay



A Model to Predict the Breathing Zone Concentrations of Particles Emitted from Surfaces  

EPA Science Inventory

Activity based sampling (ABS) is typically performed to assess inhalation exposure to particulate contaminants known to have low, heterogeneous concentrations on a surface. Activity based sampling determines the contaminant concentration in a person's breathing zone as they perfo...


Combustion particles emitted during church services: implications for human respiratory health.  


Burning candles and incense generate particulate matter (PM) that produces poor indoor air quality and may cause human pulmonary problems. This study physically characterised combustion particles collected in a church during services. In addition, the emissions from five types of candles and two types of incense were investigated using a combustion chamber. The plasmid scission assay was used to determine the oxidative capacities of these church particles. The corresponding risk factor (CRf) was derived from the emission factor (Ef) and the oxidative DNA damage, and used to evaluate the relative respiratory exposure risks. Real-time PM measurements in the church during candle-incense burning services showed that the levels (91.6 ?g/m(3) for PM(10); 38.9 ?g/m(3) for PM(2.5)) exceeded the European Union (EU) air quality guidelines. The combustion chamber testing, using the same environmental conditions, showed that the incense Ef for both PM(10) (490.6-587.9 mg/g) and PM(2.5) (290.1-417.2 mg/g) exceeded that of candles; particularly the PM(2.5) emissions. These CRf results suggested that the exposure to significant amounts of incense PM could result in a higher risk of oxidative DNA adducts (27.4-32.8 times) than tobacco PM. The generation and subsequent inhalation of PM during church activities may therefore pose significant risks in terms of respiratory health effects. PMID:21831441

Chuang, Hsiao-Chi; Jones, Tim; BéruBé, Kelly



The isotropic condition of energetic particles emitted from a large solar flare. Ph.D. Thesis  

NASA Technical Reports Server (NTRS)

Isotope abundance ratios for 5 to 50 MeV/nuc nuclei from a large solar flare were measured. The measurements were made by the heavy isotope spectrometer telescope (HIST) on the ISEE-3 satellite orbiting the Sun near an Earth-Sun liberation point approximately one million miles sunward of the Earth. Finite values for the isotope abundance ratios C-13/C-12, N-15/N-14, O-18/O-16, Ne-22/Ne-20, Mg-25/Mg-24, and Mg-26/Mg-24, and upper limits for the isotope abundance ratios He-3/He-4, C-14/C-12, O-17/O-16 and Ne-21/Ne-20 were reported. Element abundances and spectra were measured to compare the flare with other reported flares. The flare is a typical large flare with low Fe/O abundance or = to 0.1). For C-13/C-12, N-15/N-14, O-18/O-16, Mg-25/Mg-24 and Mg-26/Mg-24 isotope abundance ratios agree with the solar system abundance ratios. Measurement for Ne-22/Ne-20 agree with the isotopic composition of the meteoritic component neon-A.

Spalding, J.



Identification of platinum and palladium particles emitted from vehicles and dispersed into the surface environment.  


Platinum, palladium, and rhodium are emitted from vehicle catalytic converters. Until now, the form of precious metal particles in road dust and urban waste has not been identified. This study has located, imaged, and analyzed these particles in road dust and gully waste. Two fragments of catalytic converter have been observed in road dust. They are 40-80 ?m in size and covered in many minute particles (<0.3 ?m) of either platinum with minor rhodium or palladium. One fragment identified in gully sediment is smaller, 25 ?m in diameter, hosting only one attached particle of palladium with minor rhodium. As fragments are washed off roads they begin to disintegrate and the precious metals become detached. Also precious metal-bearing particles have been located in incinerated sewage ash including a 20 ?m diameter cluster of <3 ?m sized platinum particles that may be the remains of a catalytic converter fragment that has survived incineration. The form of these precious metal-bearing particles described here reveals that as they are dispersed from roads they are likely to be present predominantly as two particle sizes. Either they are attached to larger fragments of catalytic converter or they are released as individual detached tiny <0.3 ?m to nanoparticle sizes. PMID:22313190

Prichard, Hazel M; Fisher, Peter C



Matching coefficients for alpha_s and m_b to O(alpha_s^2) in the MSSM  

E-print Network

We compute the exact two-loop matching coefficients for the strong coupling constant alpha_s and the bottom-quark mass m_b within the Minimal Supersymmetric Standard Model (MSSM), taking into account O(alpha_s^2) contributions from Supersymmetric Quantum Chromodynamics (SQCD). We find that the explicit mass pattern of the supersymmetric particles has a significant impact on the predictions of alpha_s and m_b at high energies. Further on, the three-loop corrections exceed the uncertainty due to the current experimental accuracy. In case of the the running bottom-quark mass, they can reach in the large tan(beta) regime up to 30% of the tree-level value.

A. Bauer; L. Mihaila; J. Salomon



Synthesis of regioisomeric methyl alpha-L-arabinofuranobiosides.  


The three regioisomers of methyl alpha-L-arabinofuranobioside, namely methyl O-alpha-L-arabinofuranosyl-(1-->2)-alpha-L-arabinofuranoside, methyl O-alpha-L-arabinofuranosyl-(1-->3)-alpha-L-arabinofuranoside, and methyl O-alpha-L-arabinofuranosyl-(1-->5)-alpha-L-arabinofuranoside, were synthesized for use as substrates in studies of the specificity of alpha-L-arabinofuranosidase. The regiospecifically protected precursors, namely methyl 3,5-di-O-benzoyl-alpha-L-arabinofuranoside, methyl 2,5-di-O-benzyl-alpha-L-arabinofuranoside, and methyl 2,3-di-O-benzoyl-alpha-L-arabinofuranoside, were prepared from 2,3,5-tri-O-benzoyl-alpha-L-arabinofuranosyl chloride (4) and methyl 5-O-trityl-alpha-L-arabinofuranoside, respectively, and glycosylated with 4 in the presence of silver trifluoromethanesulfonate and s-collidine. 1H and 13C NMR data for all compounds are presented. PMID:7697668

Kawabata, Y; Kaneko, S; Kusakabe, I; Gama, Y



Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells  

SciTech Connect

The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

Abair, Tristin D. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Sundaramoorthy, Munirathinam; Chen, Dong [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Heino, Jyrki [Department of Biochemistry and Food Chemistry, University of Turku, Turku (Finland); Ivaska, Johanna [VTT Technical Research Centre of Finland, Medical Biotechnology, Turku (Finland); Hudson, Billy G. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Sanders, Charles R. [Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Pozzi, Ambra [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Zent, Roy [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37232 (United States)], E-mail:



Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes  

SciTech Connect

{alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

Chi, Seung-Wook [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of)]. E-mail:



The trypsin-inhibitory efficiency of human alpha 2-macroglobulin in the presence of alpha 1-proteinase inhibitor: evidence for the formation of an alpha 2-macroglobulin--alpha 1-proteinase inhibitor complex.  


The inhibition of bovine pancreatic trypsin was studied at pH 7, 25 degrees C, using mixtures of purified human alpha 2-macroglobulin (alpha 2M) and alpha 1-proteinase inhibitor (alpha 1 PI). The partitioning of the enzyme between the two inhibitors was determined by comparing control esterase activity, assayed with N-benzoyl-L-arginine ethyl ester as substrate, with that remaining after incubation with inhibitory mixtures. (At [I]0 > [E]0, remaining esteratic activity reflects the concentration of alpha 2M-associated enzyme (alpha 2M-E*) and the concentration of alpha 1PI-associated, inactive enzyme (alpha 1PI-E*) is given by the difference, [E]0-[alpha 2M-E*].) The pattern of product distribution was found to be incompatible with an inhibitory model involving parallel, second-order reactions of E with alpha 2M and alpha 1PI. The data pointed to complex formation between the two inhibitors, limiting the level of alpha 2M readily available for reaction with E. Analysis based on the binding equilibrium, alpha 2M (dimeric unit) + alpha 1PI reversible alpha 2M-alpha 1PI, yielded Kd = 2.1 +/- 0.3 microM. Complex formation between alpha 2M and alpha 1PI was verified by gel permeation experiments. alpha 2M was found to restrict the volume of distribution of alpha 1PI in Sephadex G200 beds. Kd, deduced from gel permeation behaviour, was 0.8 +/- 0.32 microM. Preliminary kinetic experiments with dialyzed plasma suggested that the alpha 2M-alpha 1PI interaction is effective also in vivo. Given Kd and the mean plasma levels of the two inhibitors ([alpha 2M] = 2 microM; [alpha 1PI] = 36 microM), it was estimated that > 90% of alpha 2M in human circulation must be complexed to alpha 1PI and lack immediate antiproteinase activity. PMID:10488249

Dejgaard, S; Ortapamuk, O; Ozer, I



Differential cardiovascular regulatory activities of the alpha 1B- and alpha 1D-adrenoceptor subtypes.  


The regulation of cardiac and vascular function by the alpha 1B- and alpha 1D-adrenoceptors (ARs) has been assessed in two lines of transgenic mice, one over-expressing a constitutively active alpha 1B-AR mutation (alpha 1B-ARC128F) and the other an alpha 1D-AR knockout line. The advantage of using mice expressing a constitutively active alpha 1B-AR is that the receptor is tonically active, thus avoiding the use of nonselective agonists that can activate all subtypes. In hearts from animals expressing alpha 1B-ARC128F, the activities of the mitogen-activated protein kinases, extracellular signal-regulated kinase, and c-Jun N-terminal kinase were significantly elevated compared with nontransgenic control animals. Mice over-expressing the alpha 1B-ARC128F had echocardiographic evidence of contractile dysfunction and increases in chamber dimensions. In isolated-perfused hearts or left ventricular slices from alpha 1B-ARC128F-expressing animals, the ability of isoproterenol to increase contractile force or increase cAMP levels was significantly decreased. In contrast to the prominent effects on the heart, constitutive activation of the alpha 1B-AR had little effect on the ability of phenylephrine to induce vascular smooth muscle contraction in the isolated aorta. The ability of phenylephrine to stimulate coronary vasoconstriction was diminished in alpha 1D-AR knockout mice. In alpha 1D-AR knockout animals, no negative effects on cardiac contractile function were noted. These results show that the alpha1-ARs regulate distinctly different physiologic processes. The alpha 1B-AR appears to be involved in the regulation of cardiac growth and contractile function, whereas the alpha 1D-AR is coupled to smooth muscle contraction and the regulation of systemic arterial blood pressure. PMID:12649302

Chalothorn, Dan; McCune, Dan F; Edelmann, Stephanie E; Tobita, Kimimasa; Keller, Bradley B; Lasley, Robert D; Perez, Dianne M; Tanoue, Akito; Tsujimoto, Gozoh; Post, Ginell R; Piascik, Michael T



Alpha labelings of straight simple polyominal caterpillars  

E-print Network

Alpha labelings of straight simple polyominal caterpillars Dalibor Froncek, O'Neill Kingston, Kyle. We introduce a related family of graphs called straight simple polyominal caterpillars and prove that they also admit an alpha labeling. This implies that every straight simple polyominal caterpillar with n

Froncek, Dalibor


Personal alpha contamination simulator and detector  

Microsoft Academic Search

A simulated radiation source and a compatible detector system are disclosed. The combination is useful in training for detecting alpha radiation contamination. A flexible, soft iron plate or first permanent magnet in the detector system responds to a second magnet that is employed to represent an alpha radiation source. Where the first permanent magnet is used, an iron member may

R. H. Insinger; A. H. Rodemann



Personal alpha contamination simulator and detector  

Microsoft Academic Search

A simulated radiation source and a compatible detector system are disclosed. The combination is useful in training for detecting alpha radiation contamination. A flexible, soft iron plate or first permanent magnet in the detector system responds to a second magnet that is employed to represent an alpha radiation source. Where the first permanent magnet is used, an iron member may

R. H. Insinger; A. H. Rodemann



Psychiatric Symptoms in Alpha-Mannosidosis  

ERIC Educational Resources Information Center

Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

Malm, D.; Pantel, J.; Linaker, O. M.



A nuclear diagnostic for fast alpha particles  

Microsoft Academic Search

The authors investigate the possibility of seeding a fusion plasma with nuclei that can undergo nuclear reactions with energetic alpha particles to produce product nuclei that are radioactive. If a fraction of these product nuclei can be collected and measured, one can obtain information about the presence of fast alpha particles. It appears that a feasible diagnostic could be based

L. R. Grisham; J. M. Dawson; D. E. Post



Teaching Calculus with Wolfram|Alpha  

ERIC Educational Resources Information Center

This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne



Elementary Processes Underlying Alpha Channeling in Tokamaks  

SciTech Connect

Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

NM.J. Fisch



A Liquid Sodium alpha omega Dynamo Experiment  

Microsoft Academic Search

A Liquid Sodium alpha omega Dynamo Experiment; Stirling Colgate, Howard Beckley, Hui Li, Richard Sonnenfeld, Dave Westpfahl, Ian Bentley, Rocky Ginanni, Travis Mckinnly, and Valadimir Pariev, LANL, NMIMT, & Univ. of Rochester. A liquid sodium alpha omega dynamo experiment has been constructed at NMIMT to simulate MRI, dynamo gain, and feed back in liquid sodium (r1 = 15 cm,; r2

Stirling Colgate; Howard Beckley; Hui Li; Richard Sonnenfield; Dave Westpfahl; Ian Bentley; Rocky Ginanni; Travis McKinnly; Valadimir Pariev



Measurement of alpha particles on PLT  

SciTech Connect

The radial emission profile of the d(/sup 3/He,p)..cap alpha.. fusion reaction was measured on PLT by pitch angle resolution of the escaping 3.7-MeV alphas. The d-/sup 3/He reactions were produced by /sup 3/He minority ICRF and the emission was strongly peaked at the ICRF resonance layer.

Murphy, T.J.; Strachan, J.D.



ORNL ALPHA MIS data base manual  

SciTech Connect

ALPHA is a general-purpose Management Information System (MIS) sponsored and developed by the Finance and Materials Division of the Oak Ridge National Laboratory (ORNL). It allows users to access any System 1022 data base on ORNL's DECsystem-10 computer to obtain information for use in the process of management. As its name implies, ALPHA is the foundation of most of the business information systems sponsored by the Finance and Materials Division. The purpose of this manual is to aid the experienced ALPHA user in setting up a data base and the associated tables and files to use fully the capabilities of the ALPHA System in solving the routine and the more complex MIS problems. This manual is one of a series of reports documenting the ALPHA System. When completed, these manuals will provide complete systems documentation on ORNL's most versatile and useful MIS.

Grubb, J.W.; Lovin, J.K.; Haese, R.L.



Long-range alpha detector (LRAD)  

SciTech Connect

Historically, alpha detectors have been limited by the very short range of alpha particles in air and by relatively poor sensitivity, even if the particles are intercepted. Of necessity, these detectors are operated in a vacuum or in close proximity to the source if reasonable efficiency is desired. In our new long-range alpha detector (LRAD), alpha particles interact with the ambient air, producing ionization in the air at the rate of about 30,000 ion pairs per MeV of alpha energy. These charges can be transported over significant distances (several meters) in a moving current of air generated by a small fan. An ion chamber located in front of the fan measures the current carried by the moving ions. The LRAD-based monitor is more sensitive and more thorough than conventional monitors. We present current LRAD sensitivity limits and results, practical monitor designs, and proposed uses for LRAD monitors. 4 refs., 7 figs.

MacArthur, D.W.; McAtee, J.L.



Catalytic Mechanism of Human Alpha-galactosidase  

SciTech Connect

The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S



Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression  

SciTech Connect

Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J



Organization of the alpha-globin genes in the Chinese alpha-thalassemia syndromes.  

PubMed Central

The alpha-thalassemia syndromes are a group of inherited anemias, the clinical severity of which has been shown to increase with the number of alpha-globin structural genes deleted. Employing restriction endonuclease gene mapping, we defined the organization of the alpha-globin genes in cellular DNA from Chinese subjects with various alpha-thalassemia syndromes. The four alpha-globin genes of normals are at two loci located on a 23.0-kilobase pair (kb) Eco RI fragment. In deletion type hemoglobin-H disease the 5' alpha-globin locus is deleted and the single 3' alpha-globin locus is found on a 19.0-kb Eco RI fragment. In alpha-thalassemia-2 there are two alpha-globin genes on a 23.0-kb Eco RI fragment and one on a 19.0-kb fragment. In alpha-thalassemia-1 and the nondeletion type of hemoglobin-H disease the two alpha-globin genes are at two loci on one chromosome and none reside on the other chromosome. Images PMID:447845

Embury, S H; Lebo, R V; Dozy, A M; Kan, Y W



The fratricide of alpha-Omega dynamos by their alpha-squared siblings  

E-print Network

Context. Helically forced magneto-hydrodynamic shearing-sheet turbulence can support different large-scale dynamo modes, although the {\\alpha} - {\\Omega} mode is generally expected to dominate because it is the fastest growing. In an {\\alpha} - {\\Omega} dynamo, most of the field amplification is produced by the shear. As differential rotation is an ubiquitous source of shear in astrophysics, such dynamos are believed to be the source of most astrophysical large-scale magnetic fields. Aims. We study the stability of oscillatory migratory {\\alpha} - {\\Omega} type dynamos in turbulence simulations. Methods. We use shearing-sheet simulations of hydromagnetic turbulence that is helically forced at a wavenumber that is about three times larger than the lowest wavenumber in the domain so that both {\\alpha} - {\\Omega} and {\\alpha}2 dynamo action is possible. Results. After initial dominance and saturation, the {\\alpha} - {\\Omega} mode is found to be destroyed by an orthogonal {\\alpha}2 mode sustained by the helical t...

Hubbard, Alexander; Brandenburg, Axel



{alpha} ratio 2n ratio {alpha} Molecular Band in {sup 10}Be  

SciTech Connect

The 10.15 MeV resonance in {sup 10}Be has been probed via resonant {sup 6}He+{sup 4}He elastic scattering. It is demonstrated that it is the J{sup {pi}}=4{sup +} member of a rotational band built on the 6.18 MeV 0{sup +} state. A {gamma}{sub {alpha}} of 0.10-0.13 MeV and {gamma}{sub {alpha}}/{gamma}=0.35-0.46 were deduced. The corresponding reduced {alpha} width, {gamma}{sub {alpha}}{sup 2}, indicates one of the largest {alpha}-cluster spectroscopic factors known. The deformation of the band, including the 7.54 MeV, 2{sup +} member, is large (({Dirac_h}/2{pi}){sup 2}/2I=200 keV). Such a deformation and the significant degree of clusterization signals a well-developed {alpha} ratio 2n ratio {alpha} molecular structure.

Freer, M.; Ashwood, N.I.; Curtis, N.; Price, D.; Ziman, V.A. [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham, B15 2TT (United Kingdom); Casarejos, E.; Angulo, C.; Demaret, P. [CRC/LLN Centre de Recherches du Cyclotron, Universite catholique de Louvain, B-1348 Louvain-la-Neuve (Belgium); Achouri, L.; Laurent, B.; Orr, N.A. [Laboratoire de Physique Corpusculaire, ISMRA and Universite de Caen, IN2P3-CNRS, 14050 Caen Cedex (France); Harlin, C. [School of Electronics and Physical Sciences, University of Surrey, Guildford, Surrey, GU2 7XH (United Kingdom); Milin, M.; Soic, N. [Department of Experimental Physics, Rudjer Boskovic Institute, Bijenicka 54, HR-10000 Zagreb (Croatia); Raabe, R. [Instituut voor Kern- en Stralingsfysica, University of Leuven, B-3001 Leuven (Belgium)



Nonlinear interface dynamos with alpha -quenching  

NASA Astrophysics Data System (ADS)

There exist various mechanisms capable of limiting the magnitude of the (presumably) dynamo-generated, large-scale solar magnetic field. One such mechanism is the so-called ``alpha -quenching''. The underlying idea is that the Lorentz force associated with the dynamo-generated magnetic fields impedes the small scale, turbulent fluid motions giving rise to the so-called ``alpha -effect'' (the production of poloidal from toroidal fields in the framework of mean-field dynamo theory). In mean-field models, a popular ---yet essentially ad hoc--- prescription for alpha -quenching consists in replacing the coefficient (alpha ) of the alpha -effect source term in the dynamo equations by an expression of the form alpha -> alpha (B) =alpha_0 /(1+(|B|/B_eq)(2)) , where alpha_0 is a measure of the strength of the alpha -effect in the linear regime, and B_eq is the equipartition field strength, based on the kinetic energy of the turbulent, convective fluid motions (B_eq ~ 10(4) G at the base of the solar convection zone). In principle, such ``Weak Quenching'' allows the production of magnetic fields of roughly equipartition strength, as demonstrated by the numerous conventional mean-field dynamo models making use of eq. (1), or some close variant, published to date. Vainshtein & Cattaneo (1992, ApJ 393, 165) and Gruzinov & Diamond (1995, Phys. Plasmas 2, 1941) have argued, however, that alpha -quenching should be described by alpha -> alpha (B) =alpha_0 /(R_m(|B|/B_eq)(2)) where R_m is a magnetic Reynolds number based on the microscopic properties of the flow (R_m>> 1 for solar interior conditions). This now describes a much stronger form of alpha -quenching, and, with R_m>> 1, could be fatal to large-scale dynamo action, in the sense that the dynamo could only produce magnetic fields of strength << B_eq. This is in marked contradiction with the demands set by recent models of bipolar magnetic region emergence, which require field strengths of order 10x B_eq ~ 10(5) G for the observed latitudes and tilt of emergence to be adequately reproduced. In this contribution, we investigate the circumstances under which interface dynamos can avoid alpha -quenching, either in the ``Weak'' or ``Strong'' forms defined above. In interface dynamos the alpha -effect is assumed to operate within the solar convective envelope, while the strongest magnetic fields are generated by shearing below the core-envelope interface (Parker 1993, ApJ 408, 707; Charbonneau & MacGregor, submitted to ApJ). This spatial segregation of the alpha -effect source region is the key to avoiding alpha -quenching. This is illustrated using a few nonlinear, kinematic interface dynamo solutions applicable to the Sun.

Charbonneau, P.; MacGregor, K. B.



[Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].  


Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo



alpha-Crystallin can Function as a Molecular Chaperone  

Microsoft Academic Search

The alpha-crystallins (alphaA and alphaB) are major lens structural proteins of the vertebrate eye that are related to the small heat shock protein family. In addition, crystallins (especially alphaB) are found in many cells and organs outside the lens, and alphaB is overexpressed in several neurological disorders and in cell lines under stress conditions. Here I show that alpha-crystallin can

Joseph Horwitz



Alpha 1-blocker combination therapy for hypertension.  


Combination therapy is a cost-effective and rational approach to treatment of severe hypertension and of mild to moderate hypertension that is refractory to monotherapy. The method has several advantages, most notably improved tolerability and enhanced antihypertensive efficacy. Long-term prospective studies are needed to confirm that such agents as calcium channel blockers, ACE inhibitors, and alpha 1 blockers reduce end-organ damage more effectively than do older antihypertensive drugs. However, scientific evidence strongly suggests that reducing risk factors for end-organ damage reduces heart, brain, kidney, and large-artery injury. Alpha 1 blockers appear to be a particularly suitable choice for use in combination regimens. The only class of agents that should be avoided in combination with alpha 1 blockers is central alpha agonists; all other agents act in an additive or synergistic fashion. Unlike diuretics and beta blockers, alpha 1 blockers do not adversely affect serum lipid, glucose, or insulin levels. In fact, alpha 1 blockers may improve these measurements and also counteract the adverse effects of other antihypertensive agents on them. Alpha1-blocker therapy may bring about regression of LVH, and it does not have deleterious effects on disorders that often coexist with hypertension (e.g., gout, chronic obstructive lung disease, peripheral ischemia). PMID:9742910

Houston, M C



Lyman Alpha Spicule Observatory (LASO)  

NASA Technical Reports Server (NTRS)

The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Ang