Sample records for short-lived alpha particle-emitting

  1. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  2. Intense alpha-particle emitting crystallites in uranium mill wastes

    USGS Publications Warehouse

    Landa, E.R.; Stieff, L.R.; Germani, M.S.; Tanner, A.B.; Evans, J.R.

    1994-01-01

    Nuclear emulsion microscopy has demonstrated the presence of small, intense ??-particle emitting crystallites in laboratory-produced tailings derived from the sulfuric acid milling of uranium ores. The ??-particle activity is associated with the isotope pair 210Pb 210Po, and the host mineral appears to be PbSO4 occurring as inclusions in gypsum laths. These particles represent potential inhalation hazards at uranium mill tailings disposal areas. ?? 1994.

  3. Quality factors for alpha particles emitted in tissue

    NASA Technical Reports Server (NTRS)

    Borak, Thomas B.; Chatterjee, A. (Principal Investigator)

    2002-01-01

    A concept of a mean or dose averaged quality factor was defined in ICRP Publication 26 using relationships for quality factor as a function of LET. The concept of radiation weighting factors, wR, was introduced in ICRP Publication 60 in 1990. These are meant to be generalized factors that modify absorbed dose to reflect the risk of stochastic effects as a function of the quality of the radiation incident on the body or emitted by radioactivity within the body. The values of wr are equal to 20 for all alpha particles externally or internally emitted. This note compares the dose averaged quality factor for alpha particles originating in tissue using the old and revised recommendations for quality factor as a function of LET. The dose averaged quality factor never exceeds 20 using the old recommendations and is never less than 20 with the revised recommendations.

  4. Enhanced retention of the alpha-particle-emitting daughters of Actinium-225 by liposome carriers.

    PubMed

    Sofou, Stavroula; Kappel, Barry J; Jaggi, Jaspreet S; McDevitt, Michael R; Scheinberg, David A; Sgouros, George

    2007-01-01

    Targeted alpha-particle emitters hold great promise as therapeutics for micrometastatic disease. Because of their high energy deposition and short range, tumor targeted alpha-particles can result in high cancer-cell killing with minimal normal-tissue irradiation. Actinium-225 is a potential generator for alpha-particle therapy: it decays with a 10-day half-life and generates three alpha-particle-emitting daughters. Retention of (225)Ac daughters at the target increases efficacy; escape and distribution throughout the body increases toxicity. During circulation, molecular carriers conjugated to (225)Ac cannot retain any of the daughters. We previously proposed liposomal encapsulation of (225)Ac to retain the daughters, whose retention was shown to be liposome-size dependent. However, daughter retention was lower than expected: 22% of theoretical maximum decreasing to 14%, partially due to the binding of (225)Ac to the phospholipid membrane. In this study, Multivesicular liposomes (MUVELs) composed of different phospholipids were developed to increase daughter retention. MUVELs are large liposomes with entrapped smaller lipid-vesicles containing (225)Ac. PEGylated MUVELs stably retained over time 98% of encapsulated (225)Ac. Retention of (213)Bi, the last daughter, was 31% of the theoretical maximum retention of (213)Bi for the liposome sizes studied. MUVELs were conjugated to an anti-HER2/neu antibody (immunolabeled MUVELs) and were evaluated in vitro with SKOV3-NMP2 ovarian cancer cells, exhibiting significant cellular internalization (83%). This work demonstrates that immunolabeled MUVELs might be able to deliver higher fractions of generated alpha-particles per targeted (225)Ac compared to the relative fractions of alpha-particles delivered by (225)Ac-labeled molecular carriers. PMID:17935286

  5. Determining the impact of alpha-particle-emitting contamination from the Fukushima Daiichi disaster on Japanese manufacturing sites

    Microsoft Academic Search

    Robert C. Baumann

    2011-01-01

    We briefly review nuclear reactor operation from the point of view of the major radioactive contaminants formed and consider how these were released and dispersed into the air, water, and soil around Fukushima. The risk of contamination from alpha-particle-emitting uranium and plutonium isotopes at semiconductor manufacturing sites in Japan is considered from theoretical aspects. We report the results of low

  6. Thorium and actinium polyphosphonate compounds as bone-seeking alpha particle-emitting agents.

    PubMed

    Henriksen, Gjermund; Bruland, Oyvind S; Larsen, Roy H

    2004-01-01

    The present study explores the use of alpha-particle-emitting, bone-seeking agents as candidates for targeted radiotherapy. Actinium and thorium 1,4,7,10 tetraazacyclododecane N,N',N'',N''' 1,4,7,10-tetra(methylene) phosphonic acid (DOTMP) and thorium-diethylene triamine N,N',N'' penta(methylene) phosphonic acid (DTMP) were prepared and their biodistribution evaluated in conventional Balb/C mice at four hours after injection. All three bone-seeking agents showed a high uptake in bone and a low uptake in soft tissues. Among the soft tissue organs, only kidney had a relatively high uptake. The femur/kidney ratios for 227Th-DTMP, 228-Ac-DOTMP and 227Th-DOTMP were 14.2, 7.6 and 6.0, respectively. A higher liver uptake of 228Ac-DOTMP was seen than for 227Th-DTMP and 227Th-DOTMP. This suggests that some demetallation of the 228Ac-DOTMP complex had occurred. The results indicate that 225Ac-DOTMP, 227Th-DOTMP and 227Th-DTMP have promising properties as potential therapeutic bone-seeking agents. PMID:15015582

  7. Renal tubulointerstitial changes after internal irradiation with alpha-particle-emitting actinium daughters.

    PubMed

    Jaggi, Jaspreet Singh; Seshan, Surya V; McDevitt, Michael R; LaPerle, Krista; Sgouros, George; Scheinberg, David A

    2005-09-01

    The effect of external gamma irradiation on the kidneys is well described. However, the mechanisms of radiation nephropathy as a consequence of targeted radionuclide therapies are poorly understood. The functional and morphologic changes were studied chronologically (from 10 to 40 wk) in mouse kidneys after injection with an actinium-225 (225Ac) nanogenerator, a molecular-sized, antibody-targeted, in vivo generator of alpha-particle-emitting elements. Renal irradiation from free, radioactive daughters of 225Ac led to time-dependent reduction in renal function manifesting as increase in blood urea nitrogen. The histopathologic changes corresponded with the decline in renal function. Glomerular, tubular, and endothelial cell nuclear pleomorphism and focal tubular cell injury, lysis, and karyorrhexis were observed as early as 10 wk. Progressive thinning of the cortex as a result of widespread tubulolysis, collapsed tubules, glomerular crowding, decrease in glomerular cellularity, interstitial inflammation, and an elevated juxtaglomerular cell count were noted at 20 to 30 wk after treatment. By 35 to 40 wk, regeneration of simplified tubules with tubular atrophy and loss with focal, mild interstitial fibrosis had occurred. A lower juxtaglomerular cell count with focal cytoplasmic vacuolization, suggesting increased degranulation, was also observed in this period. A focal increase in tubular and interstitial cell TGF-beta1 expression starting at 20 wk, peaking at 25 wk, and later declining in intensity with mild increase in the extracellular matrix deposition was noticed. These findings suggest that internally delivered alpha-particle irradiation-induced loss of tubular epithelial cells triggers a chain of adaptive changes that result in progressive renal parenchymal damage accompanied by a loss of renal function. These findings are dissimilar to those seen after gamma or beta irradiation of kidneys. PMID:15987754

  8. Calculations of Alpha-Particle Trajectories for Long-Range Alpha Particles Emitted in Spontaneous Fission

    Microsoft Academic Search

    Y. Boneh; Z. Fraenkel; I. Nebenzahl

    1967-01-01

    Calculated angular and energy distributions of the alpha particles in long-range alpha-particle fission are presented. The distributions were obtained from calculated alpha-particle trajectories based on a three-point-charge model for the scissioning nucleus. The calculation is two dimensional, and spontaneous fission (no preferred direction) is assumed. This reduces the number of free variables of the system to seven (except for the

  9. Alpha-Particle Emitting 213Bi-Anti-EGFR Immunoconjugates Eradicate Tumor Cells Independent of Oxygenation

    PubMed Central

    Gaertner, Florian C.; Bruchertseifer, Frank; Morgenstern, Alfred; Essler, Markus; Senekowitsch-Schmidtke, Reingard

    2013-01-01

    Hypoxia is a central problem in tumor treatment because hypoxic cells are less sensitive to chemo- and radiotherapy than normoxic cells. Radioresistance of hypoxic tumor cells is due to reduced sensitivity towards low Linear Energy Transfer (LET) radiation. High LET ?-emitters are thought to eradicate tumor cells independent of cellular oxygenation. Therefore, the aim of this study was to demonstrate that cell-bound ?-particle emitting 213Bi immunoconjugates kill hypoxic and normoxic CAL33 tumor cells with identical efficiency. For that purpose CAL33 cells were incubated with 213Bi-anti-EGFR-MAb or irradiated with photons with a nominal energy of 6 MeV both under hypoxic and normoxic conditions. Oxygenation of cells was checked via the hypoxia-associated marker HIF-1?. Survival of cells was analysed using the clonogenic assay. Cell viability was monitored with the WST colorimetric assay. Results were evaluated statistically using a t-test and a Generalized Linear Mixed Model (GLMM). Survival and viability of CAL33 cells decreased both after incubation with increasing 213Bi-anti-EGFR-MAb activity concentrations (9.25 kBq/ml–1.48 MBq/ml) and irradiation with increasing doses of photons (0.5–12 Gy). Following photon irradiation survival and viability of normoxic cells were significantly lower than those of hypoxic cells at all doses analysed. In contrast, cell death induced by 213Bi-anti-EGFR-MAb turned out to be independent of cellular oxygenation. These results demonstrate that ?-particle emitting 213Bi-immunoconjugates eradicate hypoxic tumor cells as effective as normoxic cells. Therefore, 213Bi-radioimmunotherapy seems to be an appropriate strategy for treatment of hypoxic tumors. PMID:23724085

  10. Cytotoxicity of alpha-particle-emitting astatine-211-labelled antibody in tumour spheroids: no effect of hyperthermia.

    PubMed Central

    Hauck, M. L.; Larsen, R. H.; Welsh, P. C.; Zalutsky, M. R.

    1998-01-01

    The high linear energy transfer, alpha-particle-emitting radionuclide astatine-211 (211At) is of interest for certain therapeutic applications; however, because of the 55- to 70-microm path length of its alpha-particles, achieving homogeneous tracer distribution is critical. Hyperthermia may enhance the therapeutic efficacy of alpha-particle endoradiotherapy if it can improve tracer distribution. In this study, we have investigated whether hyperthermia increased the cytotoxicity of an 211At-labelled monoclonal antibody (MAb) in tumour spheroids with a radius (approximately 100 microm) greater than the range of 211At alpha-particles. Hyperthermia for 1 h at 42 degrees C was used because this treatment itself resulted in no regrowth delay. Radiolabelled chimeric MAb 81C6 reactive with the extracellular matrix antigen tenascin was added to spheroids grown from the D-247 MG human glioma cell line at activity concentrations ranging from 0.125 to 250 kBq ml(-1). A significant regrowth delay was observed at 125 and 250 kBq ml(-1) in both hyperthermia-treated and untreated spheroids. For groups receiving hyperthermia, no increase in cytotoxicity was seen compared with normothermic controls at any activity concentration. These results and those from autoradiographs indicate that hyperthermia at 42 degrees C for 1 h had no significant effect on the uptake or distribution of this antitenascin MAb in D-247 MG spheroids. Images Figure 4 Figure 5 PMID:9514054

  11. Streptavidin in antibody pretargeting. 5. chemical modification of recombinant streptavidin for labeling with the alpha-particle-emitting radionuclides 213Bi and 211At.

    PubMed

    Wilbur, D Scott; Hamlin, Donald K; Chyan, Ming-Kuan; Brechbiel, Martin W

    2008-01-01

    We are investigating the use of recombinant streptavidin (rSAv) as a carrier molecule for the short-lived alpha-particle-emitting radionuclides 213Bi ( t 1/2 = 45.6 min) and 211At ( t 1/2 = 7.21 h) in cancer therapy. To utilize rSAv as a carrier, it must be modified in a manner that permits rapid chelation or bonding with these short-lived radionuclides and also modified in a manner that diminishes its natural propensity for localization in the kidney. Modification for labeling with (213)Bi was accomplished by conjugation of rSAv with the DTPA derivative p-isothiocyanato-benzyl-CHX-A'' (CHX-A''), 3a. Modification for direct labeling with 211At was accomplished by conjugation of rSAv with an isothiocyanatophenyl derivative of a nido-carborane (nCB), 3b, or an isothiocyanatophenyl-dPEG/decaborate(2-) derivative, 3c. After conjugation of the chelating or bonding moiety, rSAv was further modified by reaction with an excess (50-100 equivalents) of succinic anhydride. Succinylation of the lysine amines has previously been shown to greatly diminish kidney localization. rSAv modified by conjugation with 3a and succinylated rapidly radiolabeled with 213Bi (<5 min), providing a 72% isolated yield. 211At labeling of modified rSAv was accomplished in aqueous solution using chloramine-T as the oxidant. Astatination of rSAv conjugated with 3b and succinylated occurred very rapidly (<1 min), providing a 50% isolated radiochemical yield. Astatination of rSAv conjugated with 3c and succinylated was also very rapid (<1 min) providing 66-71% isolated radiochemical yields. Astatination of succinylated rSAv, 2a, which did not have conjugated borane cage moieties, resulted in a much lower radiolabeling yield (18%). The 213Bi or 211At-labeled modified rSAv preparations were mixed with the corresponding 125 I-labeled rSAv, and dual-label in vivo distributions were obtained in athymic mice. The in vivo data show that 213Bi-labeled succinylated rSAv [ 213Bi] 6a has tissue concentrations similar to those of 125 I-labeled modified rSAv [ 125 I] 6b, suggesting that (213)Bi is quite stable toward release from the chelate in vivo. In vivo data also indicate that the (211)At-labeled rSAv conjugated with 3b or 3c and succinylated are stable to in vivo deastatination, whereas succinylated rSAv lacking a boron cage moiety is subject to some deastatination. The modified rSAv conjugated with nido-carborane derivative 3b has a higher retention in many tissues than rSAv without the carborane conjugated. Interestingly, the rSAv conjugated with 3c, which also contains an m-dPEG 12 moiety, has significantly decreased concentrations in blood and other tissues when compared with those of direct-labeled rSAv, suggesting that it may be a good candidate for further study. In conclusion, rSAv that has been modified with CHX-A'' and succinylated (i.e., 5a) may be useful as a carrier of 213Bi. The encouraging results obtained with the PEGylated decaborate(2-) derivative 3c and succinylated (i.e., 5c) suggests that its further study as a carrier of 211At in pretargeting protocols is warranted. PMID:18072725

  12. Investigation of short-lived PT and PB {alpha} emitters near the proton drip line

    SciTech Connect

    Bingham, C.R.; Wauters, J.; Zimmerman, B.E. [University of Tennessee, Knoxville, Tennessee 37996 (United States); Toth, K.S. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Batchelder, J.C.; Zganjar, E.F. [Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Blumenthal, D.J.; Davids, C.N.; Henderson, D.J.; Seweryniak, D. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Brown, L.T. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Busse, B.C. [Oregon State University, Corvallis, Oregon 97331 (United States); Conticchio, L.F.; Walters, W.B. [University of Maryland, College Park, Maryland 20742 (United States); Davinson, T.; Irvine, R.J.; Woods, P.J. [Edinburgh University, Edinburgh, EH93JZ (United Kingdom)

    1997-02-01

    In a series of experiments at the Argonne ATLAS Accelerator Facility, several {alpha} emitters near the proton drip line were produced with fusion evaporation reactions, separated from the beam and dispersed in M/Q with a recoil mass spectrometer, and implanted and studied in a double-sided silicon strip detector. In {sup 78}Kr bombardments of {sup 92}Mo and {sup 96}Ru, the new isotopes {sup 166}Pt and {sup 167}Pt were identified {ital via} their {alpha}-decay properties and more accurate half-lives were measured for {sup 168}Pt and {sup 170}Pt. The light isotopes of lead, {sup 180}Pb, {sup 182}Pb, and {sup 184}Pb were produced in Mo bombardments of Zr target nuclei. The {alpha}-decay energies and half-lives of the new isotopes are as follows: (1) {sup 166}Pt, E{sub {alpha}}=7110(15)keV, T{sub 1/2}=0.3(1)ms; and (2) {sup 167}Pt, E{sub {alpha}}=6988(10)keV, T{sub 1/2}=0.7(2)ms. Also, the half-life of {sup 168}Pt, which was previously unknown, was determined to be 2.0(4) ms and that of {sup 170}Pt was observed to be 14.7(5) ms. The tentative {alpha}-decay energies and half-lives of the even Pb isotopes are: (1) {sup 184}Pb, E{sub {alpha}}=6625(10)keV, T{sub 1/2}=500(25)ms; (2) {sup 182}Pb, E{sub {alpha}}=6895(10)keV, T{sub 1/2}=62(5)ms; and (3) {sup 180}Pb, E{sub {alpha}}=7250(15)keV, T{sub 1/2}=5.8{sup +2.8}{sub {minus}1.4} ms. The {alpha}-decay rates for these Pt and Pb nuclides are compared with earlier measurements and systematic trends of the reduced widths with neutron number are discussed. {copyright} {ital 1997 American Institute of Physics.}

  13. Investigation of short-lived PT and PB {alpha} emitters near the proton drip line

    SciTech Connect

    Bingham, C.R.; Wauters, J.; Zimmerman, B.E. [Tennessee Univ., Knoxville, TN (United States)] [and others

    1996-11-01

    In a series of experiments at the Argonne ATLAS Accelerator Facility, several {alpha} emitters near the proton drip line were produced with fusion evaporation reactions, separated from the beam and dispersed in M/Q with a recoil mass spectrometer, and implanted and studied in a double-sided silicon strip detector. In {sup 78}Kr bombardments of {sup 92}Mo and {sup 96}Ru, the new isotopes {sup 166}Pt and {sup 167}Pt were identified via their {alpha}-decay properties and more accurate half-lives were measured for {sup 169}Pt and {sup 170}Pt. The light isotopes of lead, {sup 180}Pb, {sup 182}Pb, and {sup 184}Pb were produced in Mo bombardments of Zr target nuclei. The {alpha}-decay energies and half-lives of the new isotopes are as follows: (1) {sup 166}Pt, E{sub {alpha}} = 7110(15) keV, T{sub 1/2} = 0.3(1) ms; and (2) {sup 167}Pt, E{sub {alpha}} = 6988(10) keV, T{sub 1/2} = 0. 7(2) ms. Also, the half-life of {sup 168}Pt, which was previously unknown, was determined to be 2.0(4) ms and that of {sup 170}Pt was observed to be 14.7(5) ms. The tentative {alpha}-decay energies and half-lives of the even Pb isotopes are: (1) {sup 184}Pb, E{sub {alpha}} = 6625(10) keV, T{sub 1/2} =500(25) ms; (2) {sup 182}Pb, E{sub {alpha}} = 6895(10) keV, T{sub 1/2} = 62(5) ms; and (3) {sup 180}Pb, E{sub {alpha}} = 7250(15) keV, T{sub 1/2} = 5.8 {sup +2.8}{sub -1.4} ms. The a-decay rates for these Pt and Pb nuclides are compared with earlier measurements and systematic trends of the reduced widths with neutron number are discussed.

  14. First In Vivo Evaluation of Liposome-encapsulated 223Ra as a Potential Alpha-particle-emitting Cancer Therapeutic Agent

    SciTech Connect

    Jonasdottir, Thora J.; Fisher, Darrell R.; Borrebaek, Jorgen; Bruland, Oyvind S.; Larsen, Roy H.

    2006-09-13

    Liposomes carrying chemotherapeutics have had some success in cancer treatment and may be suitable carriers for therapeutic radionuclides. This study was designed to evaluate the biodistribution of and to estimate the radiation doses from the alpha emitter 223Ra loaded into pegylated liposomes in selected tissues. 223Ra was encapsulated in pegylated liposomal doxorubicin by ionophore-mediated loading. The biodistribution of liposomal 223Ra was compared to free cationic 223Ra in Balb/C mice. We showed that liposomal 223 Ra circulated in the blood with an initial half-time in excess of 24 hours, which agreed well with that reported for liposomal doxorubicin in rodents, while the blood half-time of cationic 223Ra was considerably less than one hour. When liposomal 223 Ra was catabolized, the released 223Ra was either excreted or taken up in the skeleton. This skeletal uptake increased up to 14 days after treatment, but did not reach the level seen with free 223Ra. Pre-treatment with non-radioactive liposomal doxorubicin 4 days in advance lessened the liver uptake of liposomal 223 Ra. Dose estimates showed that the spleen, followed by bone surfaces, received the highest absorbed doses. Liposomal 223 Ra was relatively stable in vivo and may have potential for radionuclide therapy and combination therapy with chemotherapeutic agents.

  15. Treatment of HER2-Expressing Breast Cancer and Ovarian Cancer Cells With Alpha Particle-Emitting {sup 227}Th-Trastuzumab

    SciTech Connect

    Heyerdahl, Helen; Krogh, Cecilie [Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Montebello, Oslo (Norway); Borrebaek, Jorgen [Algeta ASA, Kjelsas, Oslo (Norway); Larsen, Asmund [Algeta ASA, Kjelsas, Oslo (Norway); Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Montebello, Oslo (Norway); Dahle, Jostein, E-mail: jostein.dahle@rr-research.n [Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital, Montebello, Oslo (Norway)

    2011-02-01

    Purpose: To evaluate the cytotoxic effects of low-dose-rate alpha particle-emitting radioimmunoconjugate {sup 227}Th-p-isothiocyanato-benzyl-DOTA-trastuzumab ({sup 227}Th-trastuzumab [where DOTA is 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid]) internalized by breast and ovarian cancer cell lines in order to assess the potential of {sup 227}Th-trastuzumab as a therapeutic agent against metastatic cancers that overexpress the HER2 oncogene. Methods and Materials: Clonogenic survival and cell growth rates of breast cancer cells treated with {sup 227}Th-trastuzumab were compared with rates of cells treated with nonbinding {sup 227}Th-rituximab, cold trastuzumab, and X-radiation. Cell growth experiments were also performed with ovarian cancer cells. Cell-associated radioactivity was measured at several time points, and the mean radiation dose to cells was calculated. Results: SKBR-3 cells got 50% of the mean absorbed radiation dose from internalized activity and 50% from cell surface-bound activity, while BT-474 and SKOV-3 cells got 75% radiation dose from internalized activity and 25% from cell surface-bound activity. Incubation of breast cancer cells with 2.5 kBq/ml {sup 227}Th-trastuzumab for 1 h at 4{sup o}C, followed by washing, resulted in mean absorbed radiation doses of 2 to 2.5 Gy. A dose-dependent inhibition of cell growth and an increase in apoptosis were induced in all cell lines. Conclusions: Clinically relevant activity concentrations of {sup 227}Th-trastuzumab induced a specific cytotoxic effect in three HER2-expressing cell lines. The cytotoxic effect of {sup 227}Th-trastuzumab was higher than that of single-dose X-radiation (relative biological effectiveness = 1.2). These results warrant further studies of treatment of breast cancer and ovarian cancer with {sup 227}Th-trastuzumab.

  16. Counting Particles Emitted by Stratospheric Aircraft and Measuring Size of Particles Emitted by Stratospheric Aircraft

    NASA Technical Reports Server (NTRS)

    Wilson, James Charles

    1994-01-01

    There were two principal objectives of the cooperative agreement between NASA and the University of Denver. The first goal was to modify the design of the ER-2 condensation nuclei counter (CNC) so that the effective lower detection limit would be improved at high altitudes. This improvement was sought because, in the instrument used prior to 1993, diffusion losses prevented the smallest detectable particles from reaching the detection volume of the instrument during operation at low pressure. Therefore, in spite of the sensor's ability to detect particles as small as 0.008 microns in diameter, many of these particles were lost in transport to the sensing region and were not counted. Most of the particles emitted by aircraft are smaller than 0.1 micron in diameter. At the start date of this work, May 1990, continuous sizing techniques available on the ER-2 were only capable of detecting particles larger than 0.17 micron. Thus, the second objective of this work was to evaluate candidate sizing techniques in an effort to gain additional information concerning the size of particles emitted by aircraft.

  17. Search for short-lived isomer of 204Tl

    Microsoft Academic Search

    Donald L. Horrocks

    1968-01-01

    After 9.4 y observation, the best half-life for 204Tl is 3.825+\\/-0.003 y. No evidence of a short-lived (about 2.5 y) isomer of 204Tl has been found. Based on work performed under the auspices of the U.S. Atomic Energy Commission.

  18. Conversion-electron spectroscopy of short-lived nuclides

    Microsoft Academic Search

    D. R. Zolnowski; T. T. Sugihara

    1974-01-01

    A simple technique for obtaining conversion-electron spectra of short-; lived activities with a Si(Li) detector is described. The method employs the ; helium-jet technique to produce sources repetitively for subsequent counting ; through a 0.90 mg\\/cm² aluminized Mylar window. The effects of the Mylar ; window on resolution and line shape were investigated and shown to give ; acceptable results

  19. Ozone depletion potentials for very short lived species

    NASA Astrophysics Data System (ADS)

    Pisso, I.; Haynes, P.; Esler, G.; Fueglistaler, F.; Law, K.; Berthet, G.; Hoor, P.

    2009-04-01

    How many molecules of ozone would a single molecule of depleting species released at the surface destroy? Ozone depletion potentials (ODPs) give an approximate answer to this question for most (long lived) species considered in the Montreal protocol. However, the actual figure for a Very Short Lived Species (VSLS) is likely to depend on the location and time of release. VSLSs include precursors to odd bromine (Bry), an active depleting trace gas family with sources in the boundary layer. Hence, ODPs for VSLSs should take into account location and time of release. The work reported here sets out a scheme for using ensemble trajectory calculations as a basis for calculating ODPs for VSLSs. The trajectory calculations are divided into two parts to reflect the different timescales and physico-chemical processes in the troposphere and stratosphere.

  20. Near-Term Climate Mitigation by Short-Lived Forcers

    SciTech Connect

    Smith, Steven J.; Mizrahi, Andrew H.

    2013-08-12

    Emissions reductions focused on anthropogenic climate forcing agents with relatively short atmospheric lifetimes such as methane (CH4) and black carbon (BC) have been suggested as a strategy to reduce the rate of climate change over the next several decades. We find that reductions of methane and BC would likely have only a modest impact on near-term climate warming. Even with maximally feasible reductions phased in from 2015 to 2035, global mean temperatures in 2050 are reduced by 0.16 °C, with an uncertainty range of 0.04-0.36°C, with the high end of this range only possible if total historical aerosol forcing is small. More realistic mitigation scenarios would likely provide a smaller climate benefit. The climate benefits from targeted reductions in short-lived forcing agents are smaller than previously estimated and are not substantially different in magnitude from the benefits due to a comprehensive climate policy.

  1. Short-Lived Radioactivities and the Birth of the sun

    NASA Astrophysics Data System (ADS)

    Meyer, Bradley S.; Clayton, Donald D.

    2000-04-01

    Now extinct short-lived radioactive isotopes were apparently extant in the early solar system. Their abundances can be inferred from isotopic effects in their daughter nuclei in primitive meteorites, and the deviation of these abundances from expectations from continuous galactic nucleosynthesis yields important information on the last nucleosynthetic events that contributed new nuclei to the solar system and on the general circumstances of the Sun's birth. In this paper we present a rudimentary model that attempts to reconcile the abundances of ten short-lived radioactivities in the early solar system. In broad outlines, the picture requires 1) that Type Ia supernovae maintained a steady ISM supply of 53Mn and 146Sm, 2) that the r-process events that slowly admixed new 107Pd, 129I, 182Hf, and 244Pu nuclei to the solar system occurred over an interval of several hundred million years prior to solar system formation, and 3) that a massive star, by injecting only material outside its helium-exhausted core into the proto-solar nebula, contributed 26Al, 36Cl, 41Ca, 60Fe, and 182Hf no more than one million years prior to the Sun's birth. In this picture, the live 182Hf present in the early solar system was not due to r-process production but rather to a fast s-process in helium or carbon burning shell in the massive star. We conclude with a possible chemical-memory explanation for the putative 53Cr/52Cr gradient in the solar system.

  2. Very short-lived Substances as Sources for Stratospheric Bromine

    NASA Astrophysics Data System (ADS)

    Brinckmann, Sven; Engel, Andreas; Bönisch, Harald

    2010-05-01

    Halogen-containing gases, when transported into the stratosphere, release chlorine and bromine atoms, which can lead to the destruction of ozone by catalytic cycles. Long-lived anthropogenic source gases like chlorofluorocarbons (CFCs), chlorocarbons, methyl bromide (CH3Br, also with natural sources) and halons are the most important sources for stratospheric halogen. While the budget of stratospheric chlorine is relatively well understood, greater uncertainties are present in terms of quantity and attribution of stratospheric bromine. BrO measurements in the stratosphere indicate abundances of inorganic bromine Bry that cannot be explained by the contribution from the long-lived halons and methyl bromide only. Additional input is expected to be provided by natural very-short-lived substances (VSLS), inorganic product gases and bromine tied to aerosols. We present measurements of all important brominated source gases, including the five most abundant VSLS, in the tropical tropopause layer (TTL) from balloon-borne air samples collected in June 2008 in Teresina (Brazil). The results were used to derive a local budget of organic bromine, which is revealing a considerable contribution from VSLS. We discuss variabilities in the concentrations of VSLS species both in the TTL and in the tropical marine boundary layer to assess the significance of our measurements on a global scale.

  3. Studies of images of short-lived events using ERTS data

    NASA Technical Reports Server (NTRS)

    Deutschman, W. A. (principal investigator)

    1973-01-01

    The author has identified the following significant results. Significant results are the continued detection of short-lived events. The following have been detected and analyzed: forest fires, oil spills, vegetation damage, volcanoes, storm ridges, and earthquakes. It is hoped that the Mississippi River flood scenes will arrive shortly and then floods be added to the list of identified short-lived events.

  4. Neutron-induced cross sections of short-lived nuclei via the surrogate reaction method

    E-print Network

    Boyer, Edmond

    Neutron-induced cross sections of short-lived nuclei via the surrogate reaction method G. Boutoux1 Abstract. The measurement of neutron-induced cross sections of short-lived nuclei is extremely difficult for a neutron-induced measurement. We have successfully used the surrogate reaction method to extract neutron

  5. nature geoscience | ADVANCE ONLINE PUBLICATION | www.nature.com/naturegeoscience 1 Short-lived uncertainty?

    E-print Network

    climate warming. Curbing their emissions and quantifying the forcing by all short-lived components could-first century. But rolling back anthropogenic emissions of several short-lived atmospheric pollutants that lead's climate can only be stabilized by bringing carbon dioxide emissions under control in the twenty

  6. Detection of 210Po on filter papers 16 years after use for the collection of short-lived radon progeny in a room

    Microsoft Academic Search

    F Abu-Jarad

    2003-01-01

    Radon gas was allowed to accumulate in its radium source and then injected into a 36 m3 test room, resulting in an initial radon concentration of 15 kBq m–3. Filter papers were used to collect the short-lived radon progeny and thus to measure the Potential Alpha Energy Concentration (PAEC) in-situ in the year 1984 at different times and conditions according

  7. Short-lived isotopes and 23Na production in low mass AGB Stars

    E-print Network

    S. Cristallo; R. Gallino; O. Straniero; L. Piersanti; I. Dominguez

    2006-06-15

    We discuss the synthesis of some short-lived isotopes and of 23Na in thermally pulsing AGB stars with initial mass of 2 Msun and two different metallicities (Z=1.5e-2, corresponding to the metal amount in the Sun, and Z=1e-4), representative of disk and halo stars, respectively. The different nucleosynthesis channels are illustrated in some details. As previously found, the 13C formed after each third dredge up episode is usually completely consumed by alpha captures before the onset of the subsequent thermal pulse, releasing neutrons. This is the most efficient neutron source in low mass AGB stars and the resulting s-process nucleosynthesis is at the origin of the solar main component. However, in the solar metallicity model, we find that the temperature of the first formed 13C pocket remains too low during the interpulse and the 13C is not completely burnt, being partially engulfed in the convective zone generated by the following thermal pulse. Due to the rapid convective mixing in this zone, the 13C is exposed to a larger temperature and a nucleosynthesis characterized by a relatively high neutron density develops. The main effect is the strong enhancement of isotopes located beyond some critical branching in the neutron-capture path, like 60Fe, otherwise only marginally produced during a standard s-process nucleosynthesis.

  8. Studies of images of short-lived events using ERTS data

    NASA Technical Reports Server (NTRS)

    Deutschman, W. A. (principal investigator)

    1973-01-01

    The author has identified the following significant results. Of significance are the continued detection and analysis of such short-lived events as forest fires, oil spills, vegetation damage, volcanoes, storm ridges, and earthquakes.

  9. Impact of Reducing Short-Lived Air Pollutants on Atmospheric Composition and Climate

    Microsoft Academic Search

    V. Naik; L. W. Horowitz; A. M. Fiore; H. Levy

    2010-01-01

    Most studies to date have quantified the impact of short-lived air pollutants on climate in terms of radiative forcing, where radiative forcing is calculated based on changes in forcing agent distributions induced by emission perturbations simulated in a chemistry-transport model (CTM). Here, we employ the GFDL AM3 model to investigate the impact of a change in the emissions of short-lived

  10. Counting Particles Emitted by Stratospheric Aircraft and Measuring Size of Particles Emitted by Stratospheric Aircraft. Final report, 1 May 1990-31 December 1992

    SciTech Connect

    Wilson, J.C.

    1994-04-01

    There were two principal objectives of the cooperative agreement between NASA and the University of Denver. The first goal was to modify the design of the ER-2 condensation nuclei counter (CNC) so that the effective lower detection limit would be improved at high altitudes. This improvement was sought because, in the instrument used prior to 1993, diffusion losses prevented the smallest detectable particles from reaching the detection volume of the instrument during operation at low pressure. Therefore, in spite of the sensor`s ability to detect particles as small as 0.008 microns in diameter, many of these particles were lost in transport to the sensing region and were not counted. Most of the particles emitted by aircraft are smaller than 0.1 micron in diameter. At the start date of this work, May 1990, continuous sizing techniques available on the ER-2 were only capable of detecting particles larger than 0.17 micron. Thus, the second objective of this work was to evaluate candidate sizing techniques in an effort to gain additional information concerning the size of particles emitted by aircraft.

  11. A technique for the measurement of electron attachment to short-lived excited species

    SciTech Connect

    Christophorou, L.G.; Pinnaduwage, L.A. (Oak Ridge National Lab., TN (USA)); Bitouni, A.P. (Tennessee Univ., Knoxville, TN (USA). Dept. of Physics)

    1990-01-01

    A technique is described for the measurement of electron attachment to short-lived ({approx lt}10{sup {minus}9} s) excited species. Preliminary results are presented for photoenhanced electron attachment to short-lived electronically-excited states of triethylamine molecules produced by laser two-photon excitation. The attachment cross sections for these excited states are estimated to be >10{sup {minus}11} cm{sup 2} and are {approximately}10{sup 7} larger compared to those for the unexcited (ground-state) molecules. 8 refs., 4 figs.

  12. Compensation of seed production after severe injury in the short-lived herb Barbarea vulgaris

    Microsoft Academic Search

    Jana Martínková; Stanislav Mihulka

    2008-01-01

    A pot experiment with the common ruderal herb Barbarea vulgaris (Brassicaceae) was set up to elucidate to what extent short-lived species sprouting from roots regenerate and compensate for seed production after damage. We tested if sprouting from roots ensures survival after severe aboveground biomass damage, but the number of seeds produced declines with increasing severity of injury, decreasing nutrient availability

  13. Short-Lived Ontology Approach for Agent\\/HLA Federated Enterprise Interoperability

    Microsoft Academic Search

    Gregory Zacharewicz; David Chen; Bruno Vallespir

    2009-01-01

    This paper aims at proposing an implementation of the federation oriented enterprise interoperability concept, using the rising notion of short-lived ontology. We give first, a review of ongoing researches on enterprise interoperability. Then, we recall on artificial agent concept and HLA standard that appear to be adequate to support execution of the studied concept. Indeed, on the one hand agent

  14. Isotope Shift Measurements of Stable and Short-Lived Lithium Isotopes for Nuclear Charge Radii Determination

    E-print Network

    Pachucki, Krzysztof

    Isotope Shift Measurements of Stable and Short-Lived Lithium Isotopes for Nuclear Charge Radii along the lithium isotopic chain were determined using a combination of precise isotope shift of lithium isotopes which combines high sensitivity, speed, and accuracy to measure the extremely small field

  15. Involvement of short-lived proteins in the regulation of expression of the LH recep-

    E-print Network

    Paris-Sud XI, Université de

    , cells exhibited a transient over-expression of the LH receptor upon treatment with cycloheximideInvolvement of short-lived proteins in the regulation of expression of the LH recep- tor. B Goxe, R Jouy en-Josas Cedex, France) The expression of the LH receptor can be in- duced in porcine granulosa

  16. Long-lived digital integrity using short-lived hash functions Stuart Haber

    E-print Network

    Long-lived digital integrity using short-lived hash functions Stuart Haber Hewlett-Packard Laboratories stuart.haber@hp.com August 2006 Abstract New collision-finding attacks on widely used crypto integrity certifi- cates 2.1 Time-stamp certificates Here we describe the process of "renewing" digital time

  17. Managing short-lived and long-lived values in Coarse-Grained Reconfigurable Arrays

    E-print Network

    Hauck, Scott

    Managing short-lived and long-lived values in Coarse-Grained Reconfigurable Arrays Brian Van Essen as area. Examination of applications for coarse-grained recon- figurable arrays (CGRAs) shows that most architects to guide future design choices. Keywords-CGRA; energy-efficiency; storage; architec- ture; I

  18. Precision mass measurements of short-lived nuclides for nuclear structure studies at TITAN

    NASA Astrophysics Data System (ADS)

    Chaudhuri, A.; Andreoiu, C.; Brunner, T.; Chowdhury, U.; Ettenauer, S.; Frekers, D.; Gallant, A. T.; Grossheim, A.; Gwinner, G.; Klawitter, R.; Kwiatkowski, A. A.; Leach, K. G.; Lennarz, A.; Lunney, D.; Macdonald, T. D.; Schultz, B. E.; Seeraji, S.; Simon, M. C.; Simon, V. V.; Dilling, J.

    2014-03-01

    TITAN (TRIUMF's Ion Trap for Atomic and Nuclear science) at TRIUMF's rare isotope beam facility ISAC is an advanced Penning trap based mass spectrometer dedicated to precise and accurate mass determinations. An overview of TITAN, the measurement technique and a highlight of recent mass measurements of the short-lived nuclides important to the nuclear structure program at TITAN are presented.

  19. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  20. Short-lived Extinct Radioactivities and the Birth of the Sun

    NASA Astrophysics Data System (ADS)

    Meyer, Bradley

    2002-10-01

    Extinct radioactivities are isotopes that were extant at the time of formation of the solar system but that have since decayed. Their abundances may be inferred from isotopic anomalies in the daughter isotopes, and these data provide valuable constraints on the circumstance of the birth of our Sun. Remarkably, among ten or so isotopes we are convinced were alive in the early solar nebula, only two or three agree with expectations from Galactic nucleosynthesis. The r-process isotopes tend to be lower in the meteorites than a naive Galactic nucleosynthesis would imply, and the short-lived species seem to have had extra production from either a nearby star or from energetic particles from the early Sun. This talk will review the data available and then will attempt to reconcile the abundances of the short-lived radioactivities with appropriate models for Galactic chemical evolution and the astrophysical setting of the Sun's birth.

  1. Advanced short-lived nuclide NAA with application in the life sciences

    Microsoft Academic Search

    N. N. Papadopoulos; N. F. Tsagas

    1994-01-01

    A new technique for short-lived nuclide activation analysis has been developed that compensates the rapid radioactive decay\\u000a during the counting period by simultaneous approach of the sample holder to the detector with a mechanical device, permitting\\u000a prolongation of the counting time and reduction of the required complementary cyclic activation to avoid sample container\\u000a damage. The operation of the analytical system

  2. Application of short-lived radionuclides in neutron activation analysis of biological and environmental samples

    Microsoft Academic Search

    F. Grass; M. Bichler; J. Dorner; H. Holzner; A. Ritschel; A. Ramadan; G. P. Westphal; R. Gwozdz

    1994-01-01

    The application of short-lived nuclides, especially in connection with the6LiD-converter, in biological and environmental samples is demonstrated on I and Br determination in human urine, on I in pet\\u000a food, and on the analysis of all the halogens in volcanic gases in a single activation. Trace element determination in lichens\\u000a indicates polluted and unpolluted areas. The use of the 74-s38mCl

  3. Short-lived Radiative Species at the Intersection of Climate and Air Quality

    NASA Astrophysics Data System (ADS)

    Levy, H.

    2006-12-01

    Synthesis and Assessment Product 3.2 of the US Climate Change Science Program (CCSP) is attempting to assess the sign, magnitude and duration of future climate impacts due to changing levels of short-lived radiative species which may be subject to future mitigation actions to address air quality issues. We will first discuss the policy relevance of this study in the hierarchy of CCSP Synthesis and Assessment Products. We will then present and discuss results from the GFDL climate model integrations of 3 member ensembles employing both the A1B emission scenario and a modified A1B scenario where short-lived radiative species are fixed at present values throughout the integration. In all cases the integrations run from 2000 to 2100. This idealized study is seen as a first step in examining the climate impact of potential actions taken to mitigate air pollution which would also reduce radiatively active short-lived species. We will conclude with some thoughts about the potential for policy cross-fertilization.

  4. Attached and unattached fractions of short-lived radon decay products in outdoor environments: effect on the human respiratory system.

    PubMed

    Amrane, M; Oufni, L; Misdaq, M A

    2014-12-01

    The authors developed a model for determining the alpha- and beta-activities per unit volume of air due to radon ((222)Rn), thoron ((220)Rn) and their decay products attached and unattached to the aerosol in the outdoor air at the workplace in natural conditions at different locations in Morocco by using both CR-39 and LR-115 type II solid-state nuclear track detectors. In addition, the percentage of (218)Po, (214)Pb and (214)Po radionuclides attached to the aerosols and the unattached fraction f(j) for different values of the attachment rate were evaluated. Radon and thoron concentrations in outdoor air of the studied different locations were found to vary from 9.20±0.8 to 16.30±1.50 Bq m(-3) and 0.22±0.02 to 1.80±0.20 Bq m(-3), respectively. The committed equivalent doses due to the radon short-lived progeny (218)Po and (214)Po attached and unattached to the aerosol air were evaluated in different tissues of the respiratory tract of the members of the public from the inhalation of outdoor air. PMID:24390974

  5. Have we underestimated the role of short-lived chlorine compounds in ozone depletion?

    NASA Astrophysics Data System (ADS)

    Oram, David; Laube, Johannes; Sturges, Bill; Gooch, Lauren; Leedham, Emma; Ashfold, Matthew; Pyle, John; Abu Samah, Azizan; Moi Phang, Siew; Ou-Yang, Chang-Feng; Lin, Neng-Huei; Wang, Jia-Lin; Brenninkmeijer, Carl

    2015-04-01

    In recent years much attention has been focussed on the potential of bromine-containing VSLS (very short lived substances) to contribute to stratospheric ozone depletion. This is primarily due to the large observed discrepancy between the measured inorganic bromine in the stratosphere and the amount of bromine available from known, longer lived sources gases (halons and CH3Br). In contrast, the role of very short-lived chlorine compounds (VSLS-CL) has been considered trivial because they contribute only a few percent to the total organic chlorine in the troposphere, the majority of which is supplied by long-lived compounds such as the CFCs, HCFCs, methyl chloroform and carbon tetrachloride. However recent evidence shows that one VSLS-Cl, dichloromethane (CH2Cl2) has increased by 60% over the past decade (WMO, 2014) and has already begun to offset the long-term decline in stratospheric chlorine loading caused by the reduction in emissions of substances controlled by the Montreal Protocol. We will present new VSLS-Cl measurements from recent ground-based and aircraft campaigns in SE Asia where we have observed dramatic enhancements in a number of VSLS-Cl, including CH2Cl2. Furthermore we will demonstrate how pollution from China and the surrounding region can rapidly, and regularly, be transported across the South China Sea and subsequently uplifted to altitudes of 11-12 km, the region close to the lower TTL. This process occurs frequently during the winter monsoon season and could represent a fast and efficient mechanism for transporting short-lived compounds, and other pollutants, to the lower stratosphere.

  6. Health co-benefits of mitigating short-lived climate forcers

    NASA Astrophysics Data System (ADS)

    Anenberg, S.

    2011-12-01

    Tropospheric ozone and black carbon (BC), a component of fine particulate matter (PM2.5), are associated with premature mortality and disrupt global and regional climate. While attention to their impacts on climate is relatively new, these pollutants have been regulated under health-based standards in the US and elsewhere in the world for decades. Understanding the health benefits of reducing short-lived climate forcers may help inform mitigation strategies, since health will likely continue to drive concern over air quality in the future. Several recent studies have examined the health and climate co-benefits of control measures targeting BC and methane, an ozone precursor. This talk will highlight the health benefits of 14 presently available BC and methane mitigation measures examined in the United Nations Environment Programme/World Meteorological Organization Integrated Assessment of Black Carbon and Ozone. Fully implementing these specific measures is estimated to avoid 1-5 million annual ozone and PM2.5-related premature deaths globally in 2030, >80% of which occur in Asia. BC mitigation measures are estimated to achieve ~98% of the avoided deaths from all measures, due to associated reductions of non-methane ozone precursor and organic carbon emissions and stronger mortality relationships for PM2.5 relative to ozone. These substantial public health co-benefits of mitigating short-lived climate forcers are independent of whether CO2 measures are enacted. Further analyses are needed to improve economic valuation of the varied impacts of short-lived climate forcers and quantify the benefits and costs of these measures in individual countries or regions to support policy decisions made at the national level.

  7. Mass Measurement of Short-lived Nuclei at HIRFL-CSR

    NASA Astrophysics Data System (ADS)

    Wang, M.; Xu, H. S.; Zhang, Y. H.; Tu, X. L.; Litvinov, Yu. A.

    2014-03-01

    Four campaigns of mass measurements for short-lived nuclei have been conducted using an isochronous mass spectrometry (IMS) technique at HIRFL-CSR(Cooler Storage Ring) in Lanzhou. The radioactive nuclei were produced by projectile fragmentation and injected into the experimental storage ring CSRe. Revolution times of the ions stored in the CSRe were measured from which masses of 78Kr, 58Ni, 86Kr and 112Sn fragments have been determined with a relative uncertainty of about 10-6-10-7. The experimental results are presented and their impacts on nucleosynthesis in the rp process and nuclear structure are discussed.

  8. Phase-Imaging Ion-Cyclotron-Resonance Measurements for Short-Lived Nuclides

    NASA Astrophysics Data System (ADS)

    Eliseev, S.; Blaum, K.; Block, M.; Droese, C.; Goncharov, M.; Minaya Ramirez, E.; Nesterenko, D. A.; Novikov, Yu. N.; Schweikhard, L.

    2013-02-01

    A novel approach based on the projection of the Penning-trap ion motion onto a position-sensitive detector opens the door to very accurate mass measurements on the ppb level even for short-lived nuclides with half-lives well below a second. In addition to the accuracy boost, the new method provides a superior resolving power by which low-lying isomeric states with excitation energy on the 10-keV level can be easily separated from the ground state. A measurement of the mass difference of Xe130 and Xe129 has demonstrated the great potential of the new approach.

  9. Short-lived pollutants in the Arctic: their climate impact and possible mitigation strategies

    SciTech Connect

    Menon, Surabi; Quinn, P.K.; Bates, T.S.; Baum, E.; Doubleday, N.; Fiore, A.M.; Flanner, M.; Fridlind, A.; Garrett, T.J.; Koch, D.; Menon, S.; Shindell, D.; Stohl, A.; Warren, S.G.

    2007-09-24

    Several short-lived pollutants known to impact Arctic climate may be contributing to the accelerated rates of warming observed in this region relative to the global annually averaged temperature increase. Here, we present a summary of the short-lived pollutants that impact Arctic climate including methane, tropospheric ozone, and tropospheric aerosols. For each pollutant, we provide a description of the major sources and the mechanism of forcing. We also provide the first seasonally averaged forcing and corresponding temperature response estimates focused specifically on the Arctic. The calculations indicate that the forcings due to black carbon, methane, and tropospheric ozone lead to a positive surface temperature response indicating the need to reduce emissions of these species within and outside the Arctic. Additional aerosol species may also lead to surface warming if the aerosol is coincident with thin, low lying clouds. We suggest strategies for reducing the warming based on current knowledge and discuss directions for future research to address the large remaining uncertainties.

  10. Short-Lived K2S Molecules in Superionic Potassium Sulfide

    NASA Astrophysics Data System (ADS)

    Tsumuraya, Kazuo; Okeya, Yusuke

    2015-06-01

    First principles molecular dynamics study enables us to elucidate the formation of short-lived K2S molecules in superionic potassium sulfide. Covalent electron densities exist between the ionized immobile sulfurs and their coordinated ionized mobile potassiums forming the respective covalent and the Coulomb bonds between them. Both the bonds induce indirect covalent and indirect Coulomb attractions between the di-interstitial potassiums on the mid-sulfurs forming the molecules. The lifetime of the molecules is 120 fs at 1050 K. The covalent density also exists in short-lived potassium pairs with the lifetime of 110 fs. The three attractions constrain the self-diffusion of the potassiums in the sulfide which reduces Haven's ratios of the potassiums. The absence of the rigid potassium dimers indicates a failure of the chain models for the superionic diffusion. The attractions reduce the Coulomb attractions between them comparing with their completely ionized states which induces the melting of the sublattice of smaller size of the potassiums than the sulfurs: the electronic state of the conductor is intermediate between the ionic crystals and the covalent crystals. The present study classifies the conductors into four types from their electronic states; ionomolecular, ionocovalent, ionometalloid, and ionometallic type superionic conductors.

  11. A multi-proxy approach to identifying short-lived marine incursions in the Early Carboniferous

    NASA Astrophysics Data System (ADS)

    Bennett, Carys; Davies, Sarah; Leng, Melanie; Snelling, Andrea; Millward, David; Kearsey, Timothy; Marshall, John; Reves, Emma

    2015-04-01

    This study is a contribution to the TW:eed Project (Tetrapod World: early evolution and diversification), which examines the rebuilding of Carboniferous ecosystems following a mass extinction at the end of the Devonian. The project focuses on the Tournaisian Ballagan Formation of Scotland and the Borders, which contains rare fish and tetrapod material. The Ballagan Formation is characterised by sandstones, dolomitic cementstones, paleosols, siltstones and gypsum deposits. The depositional environment ranges from fluvial, alluvial-plain to marginal-marine environments, with fluvial, floodplain and lacustrine deposition dominant. A multi-proxy approach combining sedimentology, palaeontology, micropalaeontology, palynology and geochemistry is used to identify short-lived marine transgressions onto the floodplain environment. Rare marginal marine fossils are: Chondrites-Phycosiphon, Spirorbis, Serpula, certain ostracod species, rare orthocones, brachiopods and putative marine sharks. More common non-marine fauna include Leiocopida and Podocopida ostracods, Mytilida and Myalinida bivalves, plants, eurypterids, gastropods and fish. Thin carbonate-bearing dolomitic cementstones and siltstone contain are the sedimentary deposits of marine incursions and occur throughout the formation. Over 600 bulk carbon isotope samples were taken from the 500 metre thick Norham Core (located near Berwick-Upon-Tweed), encompassing a time interval of around 13 million years. The results range from -26o to -19 ?13Corg, with an average of -19o much lighter than the average value for Early Carboniferous marine bulk organic matter (?13C of -28 to -30). The isotope results correspond to broad-scale changes in the depositional setting, with more positive ?13C in pedogenic sediments and more negative ?13C in un-altered grey siltstones. They may also relate to cryptic (short-lived) marine incursions. A comparison of ?13C values from specific plant/wood fragments, palynology and bulk sedimentary organic matter from the core is used to identify further changes in environment and vegetation. From the base to the top of the formation, there is a gradual increase in relatively drier conditions, with more developed palaeosols and deep desiccation cracks. However, the main character of the formation is that of rapidly changing deposition between silts, sands and carbonates with many periods of pedogenesis and/or desiccation suggesting frequent switching from alluvial-plain to coastal environments. Marine incursions were short-lived, but important and caused a significant increase in the macro and microfaunal diversity. This temporal variability in the environments may have been an important factor in the evolution of tetrapods in the Early Carboniferous.

  12. Prolonged Marital Stress is Associated with Short-Lived Responses to Positive Stimuli

    PubMed Central

    Lapate, Regina C.; van Reekum, Carien M.; Schaefer, Stacey M.; Greischar, Lawrence L.; Norris, Catherine J.; Bachhuber, David R.W.; Ryff, Carol D.; Davidson, Richard J.

    2014-01-01

    Marital stress is associated with a higher incidence of psychiatric disorders, in particular major depression. One pathway through which marital stress may impact emotional health is by compromising emotion responding processes. We examined a longitudinal sample of adults (N=116; 59 males; 39-84 years) to verify how marital stress predicts reactivity to, and recovery from, emotional provocation. Individuals watched positive, neutral and negative pictures while an objective measure of affective state, corrugator supercilii muscle activity, was recorded continuously. Our results indicate that marital stress is associated with short-lived responses to positive pictures, indexed by a less persistent decrease in corrugator activity after picture offset. Extending beyond the prior focus on negative emotional processes, these results suggest that social stress may impact health by influencing the time course of responding to positive events. PMID:24660957

  13. Short-living supermassive magnetar model for the early X-ray flares following short GRBs

    E-print Network

    W. H. Gao; Y. Z. Fan

    2006-09-14

    We suggest a short-living supermassive magnetar model to account for the X-ray flares following short $\\gamma-$ray bursts. In this model, the central engine of the short $\\gamma-$ray bursts is a supermassive millisecond magnetar. The X-ray flares are powered by the dipole radiation of the magnetar. When the magnetar has lost a significant part of its angular momentum, it collapses to a black hole and the X-ray flares disappear abruptly. Two important predictions of this model are (i) X-ray flares much more energetic than that detected in GRB 050724 may be detectable in the coming months and years by the XRT onboard {\\it Swift}. (ii) The short GRBs with X-ray flares may occur outside of their host galaxy.

  14. Short-lived oxygen diffusion during hot, deep-seated meteoric alteration of anorthosite

    PubMed

    Mora; Riciputi; Cole

    1999-12-17

    Heterogeneous oxygen isotope compositions of plagioclase from the Boehls Butte anorthosite include some of the most oxygen-18-depleted values (to -16 per mil) reported for plagioclase in meta-igneous rocks and indicate high-temperature (T > 500 degrees C) isotopic exchange between plagioclase and nearly pristine meteoric fluid. Retrograde reaction-enhanced permeability assisted influx of meteoric-hydrothermal fluids into the deep-seated anorthosite. Isotopic gradients of about 14 per mil over 600 micrometers in single crystals require short-lived (about 10(4) years) diffusional exchange of oxygen and locally large effective water:rock ratios, followed by rapid loss of water and cessation of oxygen diffusion in the anorthosite. PMID:10600738

  15. Contribution of very short-lived substances to stratospheric bromine loading: uncertainties and constraints

    NASA Astrophysics Data System (ADS)

    Aschmann, J.; Sinnhuber, B.-M.

    2012-11-01

    Very short-lived substances (VSLS) still represent a major factor of uncertainty in the quantification of stratospheric bromine loading. One of the major obstacles for short-lived source gases in contributing to the stratosphere is generally thought to be loss of inorganic bromine (Bry) in the tropical tropopause layer (TTL) due to dehydration. We use sensitivity calculations with a~three-dimensional chemistry transport model comprising a consistent parametrization of convective transport and a comprehensive chemistry scheme to investigate the associated processes. The model considers the two most important bromine VSLS, bromoform (CHBr3) and dibromomethane (CH2Br2). The organic bromine source gases as well as the resulting profile of inorganic bromine in the model are consistent with available observations. In contrast to its organic precursors, Bry is assumed to have a~significant sorption capacity regarding sedimenting liquid or frozen particles thus the fraction of intact source gases during their ascent through the TTL is a critical factor. We find that source gas injection is the dominant pathway into the stratosphere, about 50% of CHBr3 and 93% of CH2Br2 is able to overcome the cold point tropopause at approximately 17 km altitude, modulated by the interannual variability of the vertical transport efficiency. In fact, our sensitivity calculations indicate that the extent of source gas injection of CHBr3 is highly sensitive to the strength of convection and large-scale ascent; in contrast, modifying the photolysis or the destruction via OH yields a significantly smaller response. In principal, the same applies as well to CH2Br2, though it is considerably less responsive due to its longer lifetime. The next important aspect we identified is that the partitioning of available Bry from short-lived sources is clearly shifted away from HBr, according to our current state of knowledge the only member of the Bry family which is efficiently adsorbed on ice particles. This effect is caused by very efficient heterogeneous reactions on ice surfaces which reduce the HBr/Bry fraction below 15% at the tropical tropopause. Under these circumstances there is no significant loss of Bry due to dehydration in the model, VSLS contribute fully to stratospheric bromine. In addition, we conduct several sensitivity calculations to test the robustness of this result. If heterogeneous chemistry is ignored, the HBr/Bry fraction exceeds 50% and about 10% of bromine from VSLS is scavenged. Dehydration plays a minor role for Bry removal under the assumption that HOBr is efficiently adsorbed on ice as well since the heterogeneous reactions alter the partitioning equilibrium of Bry in favor of HOBr. In this case, up to 12% of bromine from VSLS is removed. Even in the extreme and unrealistic case that adsorbed species on ice particles are instantaneously removed the maximum loss of bromine does not exceed 25%. In conclusion, considering the average abundance of bromine short-lived source gases in convective updrafts of 6 parts per trillion by volume (pptv) we find a most likely contribution of VSLS to stratospheric bromine in the range of 4.5-6 pptv.

  16. Contribution of very short-lived substances to stratospheric bromine loading: uncertainties and constraints

    NASA Astrophysics Data System (ADS)

    Aschmann, J.; Sinnhuber, B.-M.

    2013-02-01

    Very short-lived substances (VSLS) still represent a major factor of uncertainty in the quantification of stratospheric bromine loading. One of the major obstacles for short-lived source gases in contributing to the stratosphere is generally thought to be loss of inorganic bromine (Bry) in the tropical tropopause layer (TTL) due to dehydration. We use sensitivity calculations with a three-dimensional chemistry transport model comprising a consistent parametrization of convective transport and a comprehensive chemistry scheme to investigate the associated processes. The model considers the two most important bromine VSLS, bromoform (CHBr3) and dibromomethane (CH2Br2). The organic bromine source gases as well as the resulting profile of inorganic bromine in the model are consistent with available observations. In contrast to its organic precursors, Bry is assumed to have a significant sorption capacity regarding sedimenting liquid or frozen particles thus the fraction of intact source gases during their ascent through the TTL is a critical factor. We find that source gas injection is the dominant pathway into the stratosphere, about 50% of CHBr3 and 94% of CH2Br2 is able to overcome the cold point tropopause at approximately 17 km altitude, modulated by the interannual variability of the vertical transport efficiency. In fact, our sensitivity calculations indicate that the extent of source gas injection of CHBr3 is highly sensitive to the strength of convection and large-scale ascent; in contrast, modifying the photolysis or the destruction via OH yields a significantly smaller response. In principle, the same applies as well to CH2Br2, though it is considerably less responsive due to its longer lifetime. The next important aspect we identified is that the partitioning of available Bry from short-lived sources is clearly shifted away from HBr, according to our current state of knowledge the only member of the Bry family which is efficiently adsorbed on ice particles. This effect is caused by very efficient heterogeneous reactions on ice surfaces which reduce the HBr/Bry fraction below 15% at the tropical tropopause. Under these circumstances there is no significant loss of Bry due to dehydration in the model, VSLS contribute fully to stratospheric bromine. In addition, we conduct several sensitivity calculations to test the robustness of this result. If heterogeneous chemistry is ignored, the HBr/Bry fraction exceeds 50% and about 10% of bromine from VSLS is scavenged. Dehydration plays a minor role for Bry removal under the assumption that HOBr is efficiently adsorbed on ice as well since the heterogeneous reactions alter the partitioning equilibrium of Bry in favor of HOBr. In this case, up to 12% of bromine from VSLS is removed. Even in the extreme and unrealistic case that adsorbed species on ice particles are instantaneously removed the maximum loss of bromine does not exceed 25%. Assuming 6 parts per trillion by volume (pptv) of bromine short-lived source gases in convective updrafts, a value that is supported by observational data, we find a most likely contribution of VSLS to stratospheric bromine in the range of 4.5-6 pptv.

  17. Seeds of alpine plants are short lived: implications for long-term conservation

    PubMed Central

    Mondoni, Andrea; Probert, Robin J.; Rossi, Graziano; Vegini, Emanuele; Hay, Fiona R.

    2011-01-01

    Background and Aims Alpine plants are considered one of the groups of species most sensitive to the direct and indirect threats to ecosystems caused by land use and climate change. Collecting and banking seeds of plant species is recognized as an effective tool for providing propagating material to re-establish wild plant populations and for habitat repair. However, seeds from cold wet environments have been shown to be relatively short lived in storage, and therefore successful long-term seed conservation for alpine plants may be difficult. Here, the life spans of 69 seed lots representing 63 related species from alpine and lowland locations from northern Italy are compared. Methods Seeds were placed into experimental storage at 45 °C and 60 % relative humidity (RH) and regularly sampled for germination. The time taken in storage for viability to fall to 50 % (p50) was determined using probit analysis and used as a measure of relative seed longevity between seed lots. Key Results Across species, p50 at 45 °C and 60 % RH varied from 4·7 to 95·5 d. Seed lots from alpine populations/species had significantly lower p50 values compared with those from lowland populations/species; the lowland seed lots showed a slower rate of loss of germinability, higher initial seed viability, or both. Seeds were progressively longer lived with increased temperature and decreased rainfall at the collecting site. Conclusions Seeds of alpine plants are short lived in storage compared with those from lowland populations/related taxa. The lower resistance to ageing in seeds of alpine plants may arise from low selection pressure for seed resistance to ageing and/or damage incurred during seed development due to the cool wet conditions of the alpine climate. Long-term seed conservation of several alpine species using conventional seed banking methods will be problematic. PMID:21081585

  18. Muscle Senescence in Short-Lived Wild Mammals, the Soricine Shrews Blarina brevicauda and Sorex palustris

    PubMed Central

    HINDLE, ALLYSON G.; LAWLER, JOHN M.; CAMPBELL, KEVIN L.; HORNING, MARKUS

    2015-01-01

    Red-toothed (soricine) shrews are consummate predators exhibiting the highest energy turnovers and shortest life spans (ca. 18 months) of any mammal, yet virtually nothing is known regarding their physiological aging. We assessed the emerging pattern of skeletal muscle senescence (contractile/connective tissue components) in sympatric species, the semi-aquatic water shrew (WS), Sorex palustris, and the terrestrial short-tailed shrew (STS), Blarina brevicauda, to determine if muscle aging occurs in wild, short-lived mammals (H0: shrews do not survive to an age where senescence occurs), and if so, whether these alterations are species-specific. Gracilis muscles were collected from first-year (n = 17) and second-year (n = 17) field-caught shrews. Consistent with typical mammalian aging, collagen content (% area) increased with age in both species (S. palustris: ~50%; B. brevicauda: ~60%). Muscle was dominated by stiffer Type I collagen, and the ratio of collagen Type I:Type III more than doubled with age. The area ratio of muscle:collagen decreased with age in both species, but was considerably lower in adult STS, suggesting species-specificity of senescence. Extracellular space was age-elevated in B. brevicauda, but was preserved in S. palustris (~50 vs. 10% elevation). Though juvenile interspecific comparisons revealed no significance, adult WS myocytes had 68% larger cross-sectional area and occurred at 28% lower fibers/area than those of adult STS. We demonstrate that age-related muscle senescence does occur in wild-caught, short-lived mammals, and we therefore reject this classic aging theory tenet. Our findings moreover illustrate that differential age adjustments in contractile/connective tissue components of muscle occur in the two species of wild-caught shrews. PMID:19296507

  19. The origin of short-lived radionuclides and the astrophysical environment of solar system formation

    E-print Network

    Gounelle Meibom

    2008-05-05

    Based on early solar system abundances of short-lived radionuclides (SRs), such as $^{26}$Al (T$_{1/2} = 0.74$ Myr) and $^{60}$Fe (T$_{1/2} = 1.5$ Myr), it is often asserted that the Sun was born in a large stellar cluster, where a massive star contaminated the protoplanetary disk with freshly nucleosynthesized isotopes from its supernova (SN) explosion. To account for the inferred initial solar system abundances of short-lived radionuclides, this supernova had to be close ($\\sim$ 0.3 pc) to the young ($\\leqslant$ 1 Myr) protoplanetary disk. Here we show that massive star evolution timescales are too long, compared to typical timescales of star formation in embedded clusters, for them to explode as supernovae within the lifetimes of nearby disks. This is especially true in an Orion Nebular Cluster (ONC)-type of setting, where the most massive star will explode as a supernova $\\sim$ 5 Myr after the onset of star formation, when nearby disks will have already suffered substantial photoevaporation and/or formed large planetesimals. We quantify the probability for {\\it any} protoplanetary disk to receive SRs from a nearby supernova at the level observed in the early solar system. Key constraints on our estimate are: (1) SRs have to be injected into a newly formed ($\\leqslant$ 1 Myr) disk, (2) the disk has to survive UV photoevaporation, and (3) the protoplanetary disk must be situated in an enrichment zone permitting SR injection at the solar system level without disk disruption. The probability of protoplanetary disk contamination by a supernova ejecta is, in the most favorable case, 3 $\\times$ 10$^{-3}$.

  20. Global Air Quality and Climate Impacts of Mitigating Short-lived Climate Pollution in China

    NASA Astrophysics Data System (ADS)

    Harper, K.; Unger, N.; Heyes, C.; Kiesewetter, G.; Klimont, Z.; Schoepp, W.; Wagner, F.

    2014-12-01

    China is a major emitter of harmful air pollutants, including the short-lived climate pollutants (SLCPs) and their precursors. Implementation of pollution control technologies provides a mechanism for simultaneously protecting human and ecosystem health and achieving near-term climate co-benefits; however, predicting the outcomes of technical and policy interventions is challenging because the SLCPs participate in both climate warming and cooling and share many common emission sources. Here, we present the results of a combined regional integrated assessment and global climate modeling study aimed at quantifying the near-term climate and air quality co-benefits of selective control of Chinese air pollution emissions. Results from IIASA's Greenhouse Gas - Air Pollution Interactions and Synergies (GAINS) integrated assessment model indicate that methane emission reductions make up > 75% of possible CO2-equivalent emission reductions of the SLCPs and their precursors in China in 2030. A multi-pollutant emission reduction scenario incorporating the 2030 Chinese pollution control measures with the highest potential for future climate impact is applied to the NASA ModelE2 - Yale Interactive Terrestrial Biosphere (NASA ModelE2-YIBs) global carbon - chemistry - climate model to assess the regional and long-range impacts of Chinese SLCP mitigation measures. Using model simulations that incorporate dynamic methane emissions and photosynthesis-dependent isoprene emissions, we quantify the impacts of Chinese reductions of the short-lived air pollutants on radiative forcing and on surface ozone and particulate air pollution. Present-day modeled methane mole fractions are evaluated against SCIAMACHY methane columns and NOAA ESRL/GMD surface flask measurements.

  1. Muscle senescence in short-lived wild mammals, the soricine shrews Blarina brevicauda and Sorex palustris.

    PubMed

    Hindle, Allyson G; Lawler, John M; Campbell, Kevin L; Horning, Markus

    2009-06-01

    Red-toothed (soricine) shrews are consummate predators exhibiting the highest energy turnovers and shortest life spans (ca. 18 months) of any mammal, yet virtually nothing is known regarding their physiological aging. We assessed the emerging pattern of skeletal muscle senescence (contractile/connective tissue components) in sympatric species, the semi-aquatic water shrew (WS), Sorex palustris, and the terrestrial short-tailed shrew (STS), Blarina brevicauda, to determine if muscle aging occurs in wild, short-lived mammals (H(0): shrews do not survive to an age where senescence occurs), and if so, whether these alterations are species-specific. Gracilis muscles were collected from first-year (n=17) and second-year (n=17) field-caught shrews. Consistent with typical mammalian aging, collagen content (% area) increased with age in both species (S. palustris: approximately 50%; B. brevicauda: approximately 60%). Muscle was dominated by stiffer Type I collagen, and the ratio of collagen Type I:Type III more than doubled with age. The area ratio of muscle:collagen decreased with age in both species, but was considerably lower in adult STS, suggesting species-specificity of senescence. Extracellular space was age-elevated in B. brevicauda, but was preserved in S. palustris ( approximately 50 vs. 10% elevation). Though juvenile interspecific comparisons revealed no significance, adult WS myocytes had 68% larger cross-sectional area and occurred at 28% lower fibers/area than those of adult STS. We demonstrate that age-related muscle senescence does occur in wild-caught, short-lived mammals, and we therefore reject this classic aging theory tenet. Our findings moreover illustrate that differential age adjustments in contractile/connective tissue components of muscle occur in the two species of wild-caught shrews. PMID:19296507

  2. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  3. Unobservability of short-lived unstable particles and its implications for observational claims and theories in physics

    E-print Network

    Cabbolet, Marcoen J T F

    2015-01-01

    The physics literature contains many claims that elementary particles have been observed: such observational claims are, of course, important for the development of existential knowledge. Regarding claimed observations of short-lived unstable particles in particular, the term `observation' is not used with reference to any particular concept of observation: physicists merely use the word `observation' based on the convention in physics that the observation of a short-lived unstable particle can be claimed when its predicted decay products have been observed with a significance of 5 sigma. However, using Fox's recent concepts of direct and indirect observation, this paper shows that unstable particles with a lifetime of less than 0.01 attosecond are fundamentally unobservable. This cognitive inaccessibility of parts of the subatomic world has far-reaching implications for physics, not the least of which is that the aforementioned convention is untenable: claims that such short-lived unstable particles have bee...

  4. Production of the Alpha-Particle Emitting Radionuclide Astatine-211 at the Texas A&M Cyclotron Institute 

    E-print Network

    Bhakta, Viharkumar Satish

    2011-10-21

    connections. 6) Vacuum system. ................................................................................... 27 Figure 10 Background spectrum obtained using HPGe detector in the counting room. The only major gamma contribution observed... was that of potassium-40 (K-40) at 1.460 MeV ........................................ 30 Figure 11 Uncalibrated Co-60 spectrum at 10 cm (Counts v. Channel Number) ..... 32 Figure 12 HPGe efficiency curves utilized for gamma-ray spectroscopy at different source...

  5. Production of the Alpha-Particle Emitting Radionuclide Astatine-211 at the Texas A&M Cyclotron Institute

    E-print Network

    Bhakta, Viharkumar Satish

    2011-10-21

    in damage to the liver, bone surfaces and bone marrow posing a serious health risk for the exposed individual. Based on this hazard, great emphasis is placed in minimizing the production of this contaminant. Along with cross-section data, TALYS also... my time at Texas A&M University. vi NOMENCLATURE A Ampere Bq Becquerel Ci Curie EOB End of Bombardment FWHM Full Width Half Max LET Linear Energy Transfer mAb monoclonal Antibody NCI National Cancer Institute NHL Non-Hodgkin?s Lymphoma...

  6. Modeling of carbonaceous particles emitted by boreal and temperature wildfires at northern latitudes

    NASA Astrophysics Data System (ADS)

    Lavoué, David; Liousse, Catherine; Cachier, HéLèNe; Stocks, Brian J.; Goldammer, Johann G.

    2000-11-01

    For the first time, a spatial and monthly inventory has been constructed for carbonaceous particles emitted by boreal and temperate wildfires in forests, shrublands, and grasslands, with burned area data statistics, fuel load maps, fire characteristics, and particle emission factors. The time period considered is 1960-1997, and an important year-to-year variability was observed. On average, boreal and temperate vegetation fires represent 4% of global biomass burning, but during extreme years, their contribution may reach 12%, producing 9% and 20% of black carbon (BC) and particulate organic matter (POM), respectively, emitted by worldwide fires. The North American component of the boreal forest fires (Canada and Alaska) represents 4 to 122 Gg C yr-1 of BC and 0.07 to 2.4 Tg yr-1 of POM emitted, whereas the Eurasiatic component (Russia and northern Mongolia) may vary in the 16 to 474 Gg C yr-1 range for BC and between 0.3 and 9.4 Tg yr-1 for POM, with however great uncertainty. Temperate forests in conterminous United States and Europe have a much lower contribution with an average of 11 Gg C yr-1 of BC and 0.2 Tg yr-1 of POM. Grassland fires in Mongolia represent significant BC and POM sources which may reach 62 Gg C and 0.4 Tg, respectively. Finally, an annual average of BC emissions for shrubland fires in both the Mediterranean region and California is 20 Gg C yr-1, with average POM emissions of 0.1 Tg yr-1. These source maps obtained with a high spatial resolution (lox lo) can now be added to previous ones developed for other global carbonaceous aerosol sources (fossil fuel combustion, tropical biomass burning, agricultural and domestic fires) in order to provide global maps of particulate carbon emissions. Taking into account particle injection height in relation with each type of fire, our source map is a useful tool for studying the atmospheric transport and the impact of carbonaceous aerosols in three-dimensional transport and climate models.

  7. Uncertainties and constraints regarding the contribution of very short-lived substances to stratospheric bromine loading

    NASA Astrophysics Data System (ADS)

    Aschmann, Jan; Sinnhuber, Björn-Martin

    2013-04-01

    A major factor of uncertainty in the assessment of stratospheric bromine loading is the unclear role of very short-lived substances (VSLS). One of the major obstacles for short-lived source gases in contributing to the stratosphere is generally thought to be the loss of inorganic bromine (Bry) in the tropical tropopause layer due to dehydration. Besides the dehydration process itself, transportation pathways and velocities are also of vital importance as they influence the partitioning between mostly insoluble organic source gases and partly soluble inorganic degradation products. To investigate this complex system we employ an extensive set of sensitivity calculations with a three-dimensional chemistry transport model comprising a consistent parameterization of convective transport and a comprehensive chemistry scheme. The model considers the two most important bromine VSLS, bromoform (CHBr3) and dibromomethane (CH2Br2) assuming a fixed and uniform detrainment mixing ratio of 1 pptv each. Despite our simplified approach our model agrees reasonably well with available observations of bromine source and product gases. We find that source gas injection is the dominant pathway for VSLS into the stratosphere; about 50% of CHBr3 and 93% of CH2Br2 is able to overcome the cold point tropopause at approximately 17 km altitude, modulated by the inter-annual variability of the vertical transport efficiency. In fact, our sensitivity calculations indicate that the extent of source gas injection of CHBr3 is highly sensitive to the strength of convection and large-scale ascent; in contrast, modifying the photolysis or the destruction via OH yields a significantly smaller response. The next important aspect we identified is that the partitioning of available Bry from short-lived sources is clearly shifted away from HBr, according to our current state of knowledge the only member of the Bry family which is efficiently adsorbed on ice particles. This effect is caused by very efficient heterogeneous reactions on ice surfaces which reduce the HBr/Bry fraction below 15% at the tropical tropopause. Under these circumstances there is no significant loss of Bry due to dehydration in the model; VSLS contribute fully to stratospheric bromine. In addition, we conduct several sensitivity calculations to test the robustness of this result. The loss of inorganic bromine is not very sensitive to moderate changes of the involved parameters such as the abundance of water vapor, sedimentation velocity of particles or ice uptake coefficients. However, dehydration may play a minor role for Bry removal under the assumption that HOBr is efficiently adsorbed on ice as well since the heterogeneous reactions alter the partitioning equilibrium of Bry in favor of HOBr (up to 12% loss of bromine from VSLS). Even in the extreme and unrealistic case that adsorbed species on ice particles are instantaneously removed the maximum loss of bromine does not exceed 25%.

  8. Evaluation of beta partical densitometry for determination of self-absorption factors in gross alpha and gross beta radioactivity measurements on air particulate filter samples 

    E-print Network

    Breida, Margaret A

    1994-01-01

    Alpha and beta particles emitted from radioactive material collected on an air filter may be significantly attenuated by the mass (thickness) of collected dust. In this study, we determined the mass or thickness of the ...

  9. Strong sensitivity of late 21st century climate to projected changes in short-lived air pollutants

    E-print Network

    not follow the regional patterns of changes in short-lived species emissions, tropospheric loadings] This study examines the impact of projected changes (A1B ``marker'' scenario) in emissions of four short decrease in sulfate aerosol (driven by a 65% reduction in global sulfur dioxide emissions

  10. Sizes and shapes of short-lived nuclei via laser spectroscopy. Progress report, 1 August 1979-1 May 1980

    SciTech Connect

    Lewis, D.A.

    1980-05-01

    The first stage of the program to study the sizes and shapes of short-lived nuclei through their atomic hyperfine structure is the development of a movable laser spectroscopy system. Progress in this area is described in this report along with plans for experiments at Argonne National Laboratory and Brookhaven National Laboratory. 2 figures.

  11. Sizes and shapes of short-lived nuclei via laser spectroscopy. Progress report, May 1, 1980-January 31, 1981

    SciTech Connect

    Lewis, D.A.

    1981-02-01

    The first stage of the program to study the sizes and shapes of short-lived nuclei through their atomic hyperfine structure is to develop a movable laser spectroscopy system. This system is now almost complete and is described in this report along with plans for measurements at Argonne National Laboratory and Brookhaven National Laboratory.

  12. Unobservability of short-lived unstable particles and its implications for observational claims and theories in physics

    E-print Network

    Marcoen J. T. F. Cabbolet

    2015-02-03

    The physics literature contains many claims that elementary particles have been observed: such observational claims are, of course, important for the development of existential knowledge. Regarding claimed observations of short-lived unstable particles in particular, the term `observation' is not used with reference to any particular concept of observation: physicists merely use the word `observation' based on the convention in physics that the observation of a short-lived unstable particle can be claimed when its predicted decay products have been observed with a significance of 5 sigma. However, using Fox's recent concepts of direct and indirect observation, this paper shows that unstable particles with a lifetime of less than 0.01 attosecond are fundamentally unobservable. This cognitive inaccessibility of parts of the subatomic world has far-reaching implications for physics, not the least of which is that the aforementioned convention is untenable: claims that such short-lived unstable particles have been observed will thus have to be retracted. The main implications are two incompleteness theorems for physics, respectively stating (i) that experiments cannot prove completeness of a physical theory predicting short-lived unstable particles, and (ii) that experiments cannot prove correctness of such a theory - one can at most test its empirical adequacy. On a general note, the conclusion is that the importance of philosophical arguments for particle physics is herewith demonstrated: it is, thus, a widespread misconception that philosophical arguments can be completely avoided.

  13. Short-Lived Effector CD8 T Cells Induced by Genetically Attenuated Malaria Parasite Vaccination Express CD11c

    PubMed Central

    Cooney, Laura A.; Gupta, Megha; Thomas, Sunil; Mikolajczak, Sebastian; Choi, Kimberly Y.; Gibson, Claire; Jang, Ihn K.; Danziger, Sam; Aitchison, John; Gardner, Malcolm J.; Kappe, Stefan H. I.

    2013-01-01

    Vaccination with a single dose of genetically attenuated malaria parasites can induce sterile protection against sporozoite challenge in the rodent Plasmodium yoelii model. Protection is dependent on CD8+ T cells, involves perforin and gamma interferon (IFN-?), and is correlated with the expansion of effector memory CD8+ T cells in the liver. Here, we have further characterized vaccine-induced changes in the CD8+ T cell phenotype and demonstrated significant upregulation of CD11c on CD3+ CD8b+ T cells in the liver, spleen, and peripheral blood. CD11c+ CD8+ T cells are predominantly CD11ahi CD44hi CD62L?, indicative of antigen-experienced effector cells. Following in vitro restimulation with malaria-infected hepatocytes, CD11c+ CD8+ T cells expressed inflammatory cytokines and cytotoxicity markers, including IFN-?, tumor necrosis factor alpha (TNF-?), interleukin-2 (IL-2), perforin, and CD107a. CD11c? CD8+ T cells, on the other hand, expressed negligible amounts of all inflammatory cytokines and cytotoxicity markers tested, indicating that CD11c marks multifunctional effector CD8+ T cells. Coculture of CD11c+, but not CD11c?, CD8+ T cells with sporozoite-infected primary hepatocytes significantly inhibited liver-stage parasite development. Tetramer staining for the immunodominant circumsporozoite protein (CSP)-specific CD8+ T cell epitope demonstrated that approximately two-thirds of CSP-specific cells expressed CD11c at the peak of the CD11c+ CD8+ T cell response, but CD11c expression was lost as the CD8+ T cells entered the memory phase. Further analyses showed that CD11c+ CD8+ T cells are primarily KLRG1+ CD127? terminal effectors, whereas all KLRG1? CD127+ memory precursor effector cells are CD11c? CD8+ T cells. Together, these results suggest that CD11c marks a subset of highly inflammatory, short-lived, antigen-specific effector cells, which may play an important role in eliminating infected hepatocytes. PMID:23980113

  14. Mixing and Transport of Short-Lived and Stable Isotopes and Refractory Grains in Protoplanetary Disks

    E-print Network

    Boss, Alan P

    2013-01-01

    Analyses of primitive meteorites and cometary samples have shown that the solar nebula must have experienced a phase of large-scale outward transport of small refractory grains as well as homogenization of initially spatially heterogeneous short-lived isotopes. The stable oxygen isotopes, however, were able to remain spatially heterogenous at the $\\sim$ 6% level. One promising mechanism for achieving these disparate goals is the mixing and transport associated with a marginally gravitationally unstable (MGU) disk, a likely cause of FU Orionis events in young low-mass stars. Several new sets of MGU models are presented that explore mixing and transport in disks with varied masses (0.016 to 0.13 $M_\\odot$) around stars with varied masses (0.1 to 1 $M_\\odot$) and varied initial $Q$ stability minima (1.8 to 3.1). The results show that MGU disks are able to rapidly (within $\\sim 10^4$ yr) achieve large-scale transport and homogenization of initially spatially heterogeneous distributions of disk grains or gas. In a...

  15. Multiple, short-lived ``stellar prominences'' on O stars: the supergiant ? Cephei

    NASA Astrophysics Data System (ADS)

    Henrichs, H. F.; Sudnik, N.

    2015-01-01

    Many OB stars show unexplained cyclical variability in their winds and in many optical lines, which are formed at the base of the wind. For these stars no dipolar magnetic fields have been detected. We propose that these cyclical variations are caused by the presence of multiple, transient, short-lived, corotating magnetic loops, which we call ``stellar prominences''. We present a simplified model representing these prominences as corotating spherical blobs and fit the rapid variability in the Heii ?4686 line of the O supergiant ? Cep for time-resolved spectra obtained in 1989. Our conclusions are: (1) From model fits we find that the life time of the prominences varies, and is between 2-7 h. (2) The adopted inclination angle is 68° with a rotation period of ~ 4.1 d (but not well constrained). (3) The contribution of non-radial pulsations is negligible (4) Similar behavior is observed in at least 4 other O stars. We propose that prominences are a common phenomenon among O stars.

  16. Direct detection and reactivity of the short-lived phenyloxenium ion.

    PubMed

    Hanway, Patrick J; Xue, Jiadan; Bhattacharjee, Ujjal; Milot, Maeia J; Ruixue, Zhu; Phillips, David Lee; Winter, Arthur H

    2013-06-19

    Photolysis of protonated phenylhydroxylamine was studied using product analysis, trapping experiments, and laser flash photolysis experiments (UV-vis and TR(3) detection) ranging from the femtosecond to the microsecond time scale. We find that the excited state of the photoprecursor is followed by two species: a longer-lived transient (150 ns) that we assign to the phenoxy radical and a shorter-lived (3-20 ns) transient that we assign to the singlet phenyloxenium ion. Product studies from photolysis of this precursor show rearranged protonated o-/p-aminophenols and solvent water adducts (catechol, hydroquinone) and ammonium ion. The former products can be largely ascribed to radical recombination or ion recombination, while the latter are ascribed to solvent water addition to the phenyloxenium ion. The phenyloxenium ion is apparently too short-lived under these conditions to be trapped by external nucleophiles other than solvent, giving only trace amounts of o-/p-chloro adducts upon addition of chloride trap. Product studies upon thermolysis of this precursor give the same products as those generated from photolysis, with the difference being that the ortho adducts (o-aminophenol, hydroquinone) are formed in a higher ratio in comparison to the photolysis products. PMID:23713909

  17. Mass spectrometric detection of short-lived drug metabolites generated in an electrochemical microfluidic chip.

    PubMed

    van den Brink, Floris T G; Büter, Lars; Odijk, Mathieu; Olthuis, Wouter; Karst, Uwe; van den Berg, Albert

    2015-02-01

    The costs of drug development have been rising exponentially over the last six decades, making it essential to select drug candidates in the early drug discovery phases before proceeding to expensive clinical trials. Here, we present novel screening methods using an electrochemical chip coupled online to mass spectrometry (MS) or liquid chromatography (LC) and MS, to generate phase I and phase II drug metabolites and to demonstrate protein modification by reactive metabolites. The short transit time (?4.5 s) between electrochemical oxidation and mass spectrometric detection, enabled by an integrated electrospray emitter, allows us to detect a short-lived radical metabolite of chlorpromazine which is too unstable to be detected using established test routines. In addition, a fast way to screen candidate drugs is established by recording real-time mass voltammograms, which allows one to identify the drug metabolites that are expected to be formed upon oxidation by applying a linear potential sweep and simultaneously detect oxidation products. Furthermore, detoxification of electrochemically generated reactive metabolites of paracetamol was mimicked by their adduct formation with the antioxidant glutathione. Finally, the potential toxicity of reactive metabolites can be investigated by the modification of proteins, which was demonstrated by modification of carbonic anhydrase I with electrochemically generated reactive metabolites of paracetamol. With this series of experiments, we demonstrate the potential of this electrochemical chip as a complementary tool for a variety of drug metabolism studies in the early stages of drug discovery. PMID:25531627

  18. Spin relaxation of a short-lived radical in zero magnetic field.

    PubMed

    McKenzie, Iain

    2011-01-21

    A short-lived radical containing only one I = 1/2 nucleus, the muoniated 1,2-dicarboxyvinyl radical dianion, was produced in an aqueous solution by the reaction of muonium with the dicarboxyacetylene dianion. The identity of the radical was confirmed by measuring the muon hyperfine coupling constant (hfcc) by transverse field muon spin rotation spectroscopy and comparing this value with the hfcc obtained from DFT calculations. The muon spin relaxation rate of this radical was measured as a function of temperature in zero magnetic field by the zero field muon spin relaxation technique. The results have been interpreted using the theoretical model of Fedin et al. (J. Chem. Phys., 2003, 118, 192). The muon spin polarization decreases exponentially with time after muon implantation and the temperature dependence of the spin relaxation rate indicates that the dominant relaxation mechanism is the modulation of the anisotropic hyperfine interaction due to molecular rotation. The effective radius of the radical in solution was determined to be 1.12 ± 0.04 nm from the dependence of the muon spin relaxation rate on the temperature and viscosity of the solution, and is approximately 3.6 times larger than the value obtained from DFT calculations. PMID:21079834

  19. Simulating Supernova Injection of Short Lived Radionuclides with Consideration of the Solar Birth Environment

    NASA Astrophysics Data System (ADS)

    Davis, Keith W.; Leising, M. D.

    2006-12-01

    The existence of short-lived radionuclides (SLRNs) in the early solar system above their background galactic abundances is well accepted. Studies into the relative abundances and possible sources for radioisotopes indicate a model with three separate sources for the total abundance of SLRNs: the background galactic value, material from some nearby stellar source, and in-situ creation by the early active Sun. A type II SN may be the most likely source for the stellar component, specifically 60Fe. The geometric details of the stellar birth are largely unknown despite evidence that the presolar cloud was not isolated. From a hydrodynamic perspective, the injection of SLRNs may be difficult because of intervening material between the core and the explosion necessary to slow the shock speed enough that the core is compressed rather than shredded. For the SN component it is vital to understand how SN ejecta can reach a core and whether certain SN/cloud environments are precluded by the hydrodynamics. We present Zeus-2D simulations studying the possibility of SLRN injection into a presolar core that is part of a larger cloud complex.

  20. Solar system genealogy revealed by extinct short-lived radionuclides in meteorites

    E-print Network

    Gounelle, Matthieu; 10.1051/0004-6361/201219031

    2012-01-01

    Little is known about the stellar environment and the genealogy of our solar system. Short-lived radionuclides (SLRs, mean lifetime shorter than 100 Myr) that were present in the solar protoplanetary disk 4.56 Gyr ago could potentially provide insight into that key aspect of our history, were their origin understood. Previous models failed to provide a reasonable explanation of the abundance of two key SLRs, 26Al (mean lifetime = 1.1 Myr) and 60Fe (mean lifetime = 3.7 Myr), at the birth of the solar system by requiring unlikely astrophysical conditions. Our aim is to propose a coherent and generic solution based on the most recent understanding of star-forming mechanisms. Iron-60 in the nascent solar system is shown to have been produced by a diversity of supernovae belonging to a first generation of stars in a giant molecular cloud. Aluminum-26 is delivered into a dense collected shell by a single massive star wind belonging to a second star generation. The Sun formed in the collected shell as part of a thir...

  1. A quantitative genetic signature of senescence in a short-lived perennial plant.

    PubMed

    Pujol, Benoit; Marrot, Pascal; Pannell, John R

    2014-03-31

    The evolution of senescence (the physiological decline of organisms with age) poses an apparent paradox because it represents a failure of natural selection to increase the survival and reproductive performance of organisms. The paradox can be resolved if natural selection becomes less effective with age, because the death of postreproductive individuals should have diminished effects on Darwinian fitness [1, 2]. A substantial body of empirical work is consistent with this prediction for animals, which transmit their genes to progeny via an immortal germline. However, such evidence is still lacking in plants, which lack a germline and whose reproduction is diffuse and modular across the soma. Here, we provide experimental evidence for a genetic basis of senescence in the short-lived perennial plant Silene latifolia. Our pedigree-based analysis revealed a marked increase with age in the additive genetic variance of traits closely associated with fitness. This result thus extends to plants the quantitative genetic support for the evolutionary theory of senescence. PMID:24631239

  2. 3D Modelling of Halogenated Very Short-Lived Source Gas Degradation in the Tropical Troposphere

    NASA Astrophysics Data System (ADS)

    Hossaini, R.

    2009-04-01

    Halogenated very short-lived species (VSLS) are known to provide an additional supply of inorganic bromine (Bry) to the stratosphere (e.g. WMO, 2003). The magnitude of this supply is uncertain with current estimates ranging from ~3-8 ppt. Furthermore, uncertainties exist as to the relative importance of the so-called, source gas injection (SGI) and product gas injection (PGI) pathways. This is enhanced by a lack of observational data, particularly of the degradation products (aka. product gases, e.g.CBr2O) formed following the breakdown of source gases (e.g. CHBr3) via reaction with OH or photolysis. Previous model work has not directly considered the fate of these species and thus this is omission is addressed. A detailed chemical scheme describing the tropospheric degradation of CHBr3, dibromomethane (CH2Br2) and other bromo/chloro-carbon source gases has been developed for use in the TOMCAT/SLIMCAT 3D chemical transport model (CTM). We present results from multi-annual simulations quantifying the contribution of these species to the stratospheric halogen budget. We also present novel estimates of the degradation products of these species in the tropical near-tropopause region. In addition, results are verified with comparison of modelled source gas profiles with observations taken during the 2007 NASA TC4 campaign. Sensitivity runs investigating the importance of convection and also the lifetime of Bry due to washout have also been performed

  3. Yields of short-lived fission products produced following 235U(nth,f)

    NASA Astrophysics Data System (ADS)

    Tipnis, S. V.; Campbell, J. M.; Couchell, G. P.; Li, S.; Nguyen, H. V.; Pullen, D. J.; Schier, W. A.; Seabury, E. H.; England, T. R.

    1998-08-01

    Measurements of gamma-ray spectra, following the thermal neutron fission of 235U have been made using a high purity germanium detector at the University of Massachusetts Lowell (UML) Van de Graaff facility. The gamma spectra were measured at delay times ranging from 0.2 s to nearly 10 000 s following the rapid transfer of the fission fragments with a helium-jet system. On the basis of the known gamma transitions, forty isotopes have been identified and studied. By measuring the relative intensities of these transitions, the relative yields of the various precursor nuclides have been calculated. The results are compared with the recommended values listed in the ENDF/B-VI fission product data base (for the lifetimes and the relative yields) and those published in the Nuclear Data Sheets (for the beta branching ratios). This information is particularly useful for the cases of short-lived fission products with lifetimes of the order of fractions of a second or a few seconds. Independent yields of many of these isotopes have rather large uncertainties, some of which have been reduced by the present study.

  4. Recovery of short-lived chemical species in a couette flow reactor

    SciTech Connect

    Ouyang, Q.; Swinney, H.L. (Center for Nonlinear Dynamics, Dept. of Physics, Univ. of Texas, Austin, TX (US)); Roux, J.C.; Kepper, P.; Boissonade, J. (Centre de Recherche Paul Pascal, Univ. de Bordeau I, Chateau Brivazac, F-33600 (FR))

    1992-04-01

    This paper reports on a new technique for studying and recovering short-lived chemical intermediate species that has been developed using a Couette reactor, which is an open one-dimensional reaction-diffusion system. Reaction occurs in the annulus between concentric cylinders with the inner one rotating and the outer one at rest. Fresh reagents are in contact with the ends of the annulus, but there is no net axial flow. The axial transport arising from the hydrodynamic motion is effectively diffusive, but has a diffusion coefficient 3 to 5 order of magnitude larger than that of molecular diffusion. The oxidant (ClO{sub 2}{sup {minus}}) and reductant (I{sup {minus}}) of an autocatalytic reaction are fed at opposite ends of the reactor. The reactants diffuse toward each other and react, forming a steady, sharp chemical front and a stable spatial concentration band of unstable intermediate species (HOCl) in the front region. Unstable intermediate species are thus stabilized at a well-defined spatial position where they can be recovered and studied. The experiments and numerical simulations demonstrate that the faster the reaction rate, the stabler the chemical front and the more effective the recovery of unstable intermediate species.

  5. Simulating the impact of emissions of brominated very short lived substances on past stratospheric ozone trends

    NASA Astrophysics Data System (ADS)

    Sinnhuber, Björn-Martin; Meul, Stefanie

    2015-04-01

    Bromine from very short lived substances (VSLS), primarily from natural oceanic sources, contributes substantially to the stratospheric bromine loading. This source of stratospheric bromine has so far been ignored in most chemistry climate model calculations of stratospheric ozone trends. Here we present a transient simulation with the chemistry climate model EMAC for the period 1960-2005 including emissions of the five brominated VSLS CHBr3, CH2Br2, CH2BrCl, CHBrCl2, and CHBr2Cl. The emissions lead to a realistic stratospheric bromine loading of about 20 pptv for present-day conditions. Comparison with a standard model simulation without VSLS shows large differences in modeled ozone in the extratropical lowermost stratosphere and in the troposphere. Differences in ozone maximize in the Antarctic Ozone Hole, resulting in more than 20% less ozone when VSLS are included. Even though the emissions of VSLS are assumed to be constant in time, the model simulation with VSLS included shows a much larger ozone decrease in the lowermost stratosphere during the 1979-1995 period and a faster ozone increase during 1996-2005, in better agreement with observed ozone trends than the standard simulation without VSLS emissions.

  6. Short-lived nuclei in the early Solar System: Possible AGB sources

    NASA Astrophysics Data System (ADS)

    Wasserburg, G. J.; Busso, M.; Gallino, R.; Nollett, K. M.

    2006-10-01

    The abundances of short-lived radionuclides in the early Solar System (ESS) are reviewed, as well as the methodology used in determining them. These results are compared with the inventory estimated for a uniform galactic production model. It is shown that, to within a factor of two, the observed abundances of 238U, 235U, 232Th, 244Pu, 182Hf, 146Sm, and 53Mn are roughly compatible with long-term galactic nucleosynthesis. 129I is an exception, with an ESS inventory much lower than expected from uniform production. The isotopes 107Pd, 60Fe, 41Ca, 36Cl, 26Al, and 10Be require late addition to the protosolar nebula. 10Be is the product of energetic particle irradiation of the Solar System as most probably is 36Cl. Both of these nuclei appear to be present when 26Al is absent. A late injection by a supernova (SN) cannot be responsible for most of the short-lived nuclei without excessively producing 53Mn; it can however be the source of 53Mn itself and possibly of 60Fe. If a late SN injection is responsible for these two nuclei, then there remains the problem of the origin of 107Pd and several other isotopes. Emphasis is given to an AGB star as a source of many of the nuclei, including 60Fe; this possibility is explored with a new generation of stellar models. It is shown that if the dilution factor (i.e. the ratio of the contaminating mass to the solar parental cloud mass) is f˜4×10, a reasonable representation for many nuclei is obtained; this requires that (60Fe/56Fe)ESS ˜ 10-7 to 2×10. The nuclei produced by an AGB source do not include 53Mn, 10Be or 36Cl if it is very abundant. The role of irradiation is discussed with regard to 26Al, 36Cl and 41Ca, and the estimates of bulk solar abundances of these isotopes are commented on. The conflict between various scenarios is emphasized as well as the current absence of an astrophysically plausible global interpretation for all the existing data. Examination of abundances for the actinides indicates that a quiescent interval of ˜10 yr is required for actinide group production. This is needed in order to explain the data on 244Pu and the new bounds on 247Cm. Because this quiescent interval is not compatible with the 182Hf data, a separate type of r-process event is needed for at least the actinides, distinct from the two types that have previously been identified. The apparent coincidence of the 129I and trans-actinide time scales suggests that the last heavy r contribution was from an r-process that produced very heavy nuclei but without fission recycling so that the yields at Ba and below (including I) were governed by fission.

  7. Distributions of short-lived radioactive nuclei produced by young embedded star clusters

    SciTech Connect

    Adams, Fred C. [Physics Department, University of Michigan, Ann Arbor, MI 48109 (United States); Fatuzzo, Marco [Physics Department, Xavier University, Cincinatti, OH 45255 (United States); Holden, Lisa [Department of Mathematics, Northern Kentucky University, Highland Heights, KY 41099 (United States)

    2014-07-01

    Most star formation in the Galaxy takes place in clusters, where the most massive members can affect the properties of other constituent solar systems. This paper considers how clusters influence star formation and forming planetary systems through nuclear enrichment from supernova explosions, where massive stars deliver short-lived radioactive nuclei (SLRs) to their local environment. The decay of these nuclei leads to both heating and ionization, and thereby affects disk evolution, disk chemistry, and the accompanying process of planet formation. Nuclear enrichment can take place on two spatial scales: (1) within the cluster itself (? ? 1 pc), the SLRs are delivered to the circumstellar disks associated with other cluster members. (2) On the next larger scale (? ? 2-10 pc), SLRs are injected into the background molecular cloud; these nuclei provide heating and ionization to nearby star-forming regions and to the next generation of disks. For the first scenario, we construct the expected distributions of radioactive enrichment levels provided by embedded clusters. Clusters can account for the SLR mass fractions inferred for the early Solar Nebula, but typical SLR abundances are lower by a factor of ?10. For the second scenario, we find that distributed enrichment of SLRs in molecular clouds leads to comparable abundances. For both the direct and distributed enrichment processes, the masses of {sup 26}Al and {sup 60}Fe delivered to individual circumstellar disks typically fall in the range 10-100 pM {sub ?} (where 1 pM {sub ?} = 10{sup –12} M {sub ?}). The corresponding ionization rate due to SLRs typically falls in the range ?{sub SLR} ? 1-5 × 10{sup –19} s{sup –1}. This ionization rate is smaller than that due to cosmic rays, ?{sub CR} ? 10{sup –17} s{sup –1}, but will be important in regions where cosmic rays are attenuated (e.g., disk mid-planes).

  8. The contribution of natural and anthropogenic very short-lived species to stratospheric bromine

    NASA Astrophysics Data System (ADS)

    Hossaini, R.; Chipperfield, M. P.; Feng, W.; Breider, T. J.; Atlas, E.; Montzka, S. A.; Miller, B. R.; Moore, F.; Elkins, J.

    2011-08-01

    We have used a global three-dimensional chemical transport model to quantify the impact of the very short-lived species (VSLS) CHBr3, CH2Br2, CHBr2Cl, CHBrCl2, CH2BrCl and C2H5Br on the bromine budget of the stratosphere. Atmospheric observations of these gases allow constraints on surface mixing ratios that, when incorporated into our model, contribute ~ 4.9-5.2 parts per trillion (ppt) of inorganic bromine (Bry) to the stratosphere. Of this total, ~ 76 % comes from naturally-emitted CHBr3 and CH2Br2. The remaining species individually contribute modest amounts. However, their accumulated total accounts for up to ~ 1.2 ppt of the supply and thus should not be ignored. We have compared modelled tropical profiles of a range of VSLS with observations from the recent 2009 NSF HIPPO-1 aircraft campaign. Modelled profiles agree reasonably well with observations from the surface to the lower tropical tropopause layer. We have also considered the poorly studied anthropogenic VSLS, C2H5Br, CH2BrCH2Br, n-C3H7Br and i-C3H7Br. We find the local atmospheric lifetime of these species in the tropical tropopause layer are ~ 183, 603, 39 and 49 days, respectively. These species, particularly C2H5Br and CH2BrCH2Br, would thus be important carriers of bromine to the stratosphere if emissions were to increase substantially. Our model shows ~ 70-73 % and ~ 80-85 % of bromine from these species in the tropical boundary layer can reach the lower stratosphere.

  9. Name Modelling Activities for the CAST/Contrast/Attrex Very Short Lived Species Measurements

    NASA Astrophysics Data System (ADS)

    Harris, N. R. P.; Filus, M. T.; Ashfold, M.; Pyle, J. A.; Atlas, E. L.; Manning, A.; Meneguz, E.

    2014-12-01

    The UK Met Office Numerical Atmospheric dispersion Modeling Environment (NAME) is used to assess the spatial and temporal variability of transport of very short-lived halogenated organic species (VSLS), in particular bromoform, dibromomethane and methyl iodide, within the West Pacific tropical region. The NAME modelling results are compared with airborne measurements of VSLS taken during NASA ATTREX, NCAR CONTRAST and NERC CAST campaigns in January-March, 2014. In this work, the NAME model is used to link the aircraft measurements to examine the vertical distribution of VSLS in the West Pacific troposphere. The major focus will be on assessing vertical transport in deep convection which is one of the crucial factors in redistributing chemicals within the tropical troposphere. The work presented shows the analysis of NAME runs made from the ATTREX flights over the East Pacific in January-February, 2013 and the ATTREX and CONTRAST flight tracks over the West Pacific in January-March, 2014. Each ATTREX 2013 and 2014 flight track is divided into segments, from which particles are released and followed backward to identify the low-level sources of air. Particles (10,000 per single point along the flight track) are released from the flight tracks and followed 12-days backwards. Fractions of trajectories are calculated according to particles which crossed below 5 and 1 km (corresponding to low troposphere and oceanic boundary layer, respectively). Then, initial concentrations for VSLS are assigned to particles which originated from below 5/1 km and final concentrations at flight altitudes are determined based on e-folding equations. Results, obtained by running NAME, are compared with ATTREX VSLS flight measurements.

  10. Mixing and Transport of Short-lived and Stable Isotopes and Refractory Grains in Protoplanetary Disks

    NASA Astrophysics Data System (ADS)

    Boss, Alan P.

    2013-08-01

    Analyses of primitive meteorites and cometary samples have shown that the solar nebula must have experienced a phase of large-scale outward transport of small refractory grains as well as homogenization of initially spatially heterogeneous short-lived isotopes. The stable oxygen isotopes, however, were able to remain spatially heterogeneous at the ~6% level. One promising mechanism for achieving these disparate goals is the mixing and transport associated with a marginally gravitationally unstable (MGU) disk, a likely cause of FU Orionis events in young low-mass stars. Several new sets of MGU models are presented that explore mixing and transport in disks with varied masses (0.016 to 0.13 M ?) around stars with varied masses (0.1 to 1 M ?) and varied initial Q stability minima (1.8 to 3.1). The results show that MGU disks are able to rapidly (within ~104 yr) achieve large-scale transport and homogenization of initially spatially heterogeneous distributions of disk grains or gas. In addition, the models show that while single-shot injection heterogeneity is reduced to a relatively low level (~1%), as required for early solar system chronometry, continuous injection of the sort associated with the generation of stable oxygen isotope fractionations by UV photolysis leads to a sustained, relatively high level (~10%) of heterogeneity, in agreement with the oxygen isotope data. These models support the suggestion that the protosun may have experienced at least one FU Orionis-like outburst, which produced several of the signatures left behind in primitive chondrites and comets.

  11. Convective Transport of Very-short-lived Bromocarbons to the Stratosphere

    NASA Technical Reports Server (NTRS)

    Liang, Qing; Atlas, Elliot Leonard; Blake, Donald Ray; Dorf, Marcel; Pfeilsticker, Klaus August; Schauffler, Sue Myhre

    2014-01-01

    We use the NASA GEOS Chemistry Climate Model (GEOSCCM) to quantify the contribution of two most important brominated very short-lived substances (VSLS), bromoform (CHBr3) and dibromomethane (CH2Br2), to stratospheric bromine and its sensitivity to convection strength. Model simulations suggest that the most active transport of VSLS from the marine boundary layer through the tropopause occurs over the tropical Indian Ocean, the Western Pacific warm pool, and off the Pacific coast of Mexico. Together, convective lofting of CHBr3 and CH2Br2 and their degradation products supplies 8 ppt total bromine to the base of the Tropical Tropopause Layer (TTL, 150 hPa), similar to the amount of VSLS organic bromine available in the marine boundary layer (7.8-8.4 ppt) in the above active convective lofting regions. Of the total 8 ppt VSLS-originated bromine that enters the base of TTL at 150 hPa, half is in the form of source gas injection (SGI) and half as product gas injection (PGI). Only a small portion (< 10%) the VSLS-originated bromine is removed via wet scavenging in the TTL before reaching the lower stratosphere. On global and annual average, CHBr3 and CH2Br2, together, contribute 7.7 pptv to the present-day inorganic bromine in the stratosphere. However, varying model deep convection strength between maximum and minimum convection conditions can introduce a 2.6 pptv uncertainty in the contribution of VSLS to inorganic bromine in the stratosphere (BryVSLS). Contrary to the conventional wisdom, minimum convection condition leads to a larger BryVSLS as the reduced scavenging in soluble product gases, thus a significant increase in PGI (2-3 ppt), greatly exceeds the relative minor decrease in SGI (a few 10ths ppt.

  12. First Use of High Charge States for Mass Measurements of Short-Lived Nuclides in a Penning Trap

    SciTech Connect

    Ettenauer, S.; Gallant, A. T.; Dilling, J. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1 (Canada); Simon, M. C.; Chaudhuri, A.; Mane, E.; Delheij, P.; Pearson, M. R. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Brunner, T. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Physik Department E12, Technische Universitaet Muenchen, D-85748 Garching (Germany); Chowdhury, U. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Department of Physics and Astronomy, University of Manitoba, Winnipeg, MB R3T 2N2 (Canada); Simon, V. V. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); Ruprecht-Karls-Universitaet, Heidelberg (Germany); Brodeur, M. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); Department of Physics and Astronomy, University of British Columbia, Vancouver, BC V6T 1Z1 (Canada); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, Michigan 48824 (United States); Andreoiu, C. [Department of Chemistry, Simon Fraser University, Burnaby, BC V5A 1S6 (Canada); Audi, G. [CSNSM-IN2P3-CNRS, Universite Paris 11, 91405 Orsay (France); Lopez-Urrutia, J. R. Crespo; Ullrich, J. [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, 69117 Heidelberg (Germany); Gwinner, G. [Dept. of Physics and Astronomy, Univ. of Manitoba, Winnipeg, MB R3T 2N2 (Canada); Lapierre, A. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); National Superconducting Cyclotron Lab., Michigan State Univ., East Lansing, Michigan 48824 (United States); Lunney, D. [TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3 (Canada); CSNSM-IN2P3-CNRS, Univ. Paris 11, 91405 Orsay (France); Ringle, R. [National Superconducting Cyclotron Lab., Michigan State Univ., East Lansing, Michigan 48824 (United States)

    2011-12-30

    Penning trap mass measurements of short-lived nuclides have been performed for the first time with highly charged ions, using the TITAN facility at TRIUMF. Compared to singly charged ions, this provides an improvement in experimental precision that scales with the charge state q. Neutron-deficient Rb isotopes have been charge bred in an electron beam ion trap to q=8-12+ prior to injection into the Penning trap. In combination with the Ramsey excitation scheme, this unique setup creating low energy, highly charged ions at a radioactive beam facility opens the door to unrivaled precision with gains of 1-2 orders of magnitude. The method is particularly suited for short-lived nuclides such as the superallowed {beta} emitter {sup 74}Rb (T{sub 1/2}=65 ms). The determination of its atomic mass and an improved Q{sub EC} value are presented.

  13. The proposed TITAN facility at ISAC for very precise mass measurements on highly charged short-lived isotopes

    Microsoft Academic Search

    J. Dilling; P. Bricault; M. Smith; H.-J. Kluge

    2003-01-01

    One of the necessary experimental quantities required for the test of unitarity of the fundamental Cabbibo–Kobayashi–Maskawa (CKM) quark mixing matrix can be gained from nuclear beta decay. However, the short-lived beta-decaying nuclei have to be produced on-line in order to provide a large enough sample to carry out the experiments. At the new ISAC (Isotope Separator and Accelerator) facility at

  14. On the ecology of short-lived forbs in chalk grasslands: micro-site tolerances in relation to vegetation structure

    Microsoft Academic Search

    H. J. Verkaar; A. J. Schenkeveld; J. M. Brand

    1983-01-01

    Some aspects of vegetation structure in two chalk grasslands were studied throughout the year in relation to the occurrence of some short-lived plant species per life-cycle stage. Whereas the main growth period is in May–June, there is another relatively important growth period in less productive stands in August. When the species are arranged in the order of their tolerance for

  15. Short-lived chlorine-36 in a Ca- and Al-rich inclusion from the Ningqiang carbonaceous chondrite

    PubMed Central

    Lin, Yangting; Guan, Yunbin; Leshin, Laurie A.; Ouyang, Ziyuan; Wang, Daode

    2005-01-01

    Excesses of sulfur-36 in sodalite, a chlorine-rich mineral, in a calcium- and aluminum-rich inclusion from the Ningqiang carbonaceous chondrite linearly correlate with chorine/sulfur ratios, providing direct evidence for the presence of short-lived chlorine-36 (with a half-life of 0.3 million years) in the early solar system. The best inferred (36Cl/35Cl)o ratios of the sodalite are ?5 × 10-6. Different from other short-lived radionuclides, chlorine-36 was introduced into the inclusion by solid-gas reaction during secondary alteration. The alteration reaction probably took place at least 1.5 million years after the first formation of the inclusion, based on the correlated study of the 26Al-26Mg systems of the relict primary minerals and the alteration assemblages, from which we inferred an initial ratio of (36Cl/35Cl)o > 1.6 × 10-4 at the time when calcium- and aluminum-rich inclusions formed. This discovery supports a supernova origin of short-lived nuclides [Cameron, A. G. W., Hoeflich, P., Myers, P. C. & Clayton, D. D. (1995) Astrophys. J. 447, L53; Wasserburg, G. J., Gallino, R. & Busso, M. (1998) Astrophys. J. 500, L189–L193], but presents a serious challenge for local irradiation models [Shu, F. H., Shang, H., Glassgold, A. E. & Lee, T. (1997) Science 277, 1475–1479; Gounelle, M., Shu, F. H., Shang, H., Glassgold, A. E., Rehm, K. E. & Lee, T. (2001) Astrophys. J. 548, 1051–1070]. Furthermore, the short-lived 36Cl may serve as a unique fine-scale chronometer for volatile-rock interaction in the early solar system because of its close association with aqueous and/or anhydrous alteration processes. PMID:15671168

  16. Age-specific, density-dependent and environment-based mortality of a short-lived perennial herb

    Microsoft Academic Search

    F. X. Pico ´; J. Retana

    2008-01-01

    Density-independent and density-dependent processes affect plant mortality. Although less well understood, age-specific mortality can also play an important role in plant mortality. The goal of this study was to analyse sev- eral factors accounting for mortality in the Mediterranean short-lived peren- nial herb Lobularia maritima. We followed three cohorts of plants (from emergence to death) during 4 years in field

  17. Impact of Very Short-live Halogens on Stratospheric Ozone Abundance (and UV radiation) in a Geo-engineered Atmosphere

    Microsoft Academic Search

    Simone Tilmes; Doug Kinnison; Rolando Garcia; Ross Salawitch; Julia Lee-Taylor

    2010-01-01

    In this study we used the Whole Atmosphere Community Climate Model (WACCM) to explore the impact of very short-lived (VSL) bromocarbons on stratospheric ozone abundance and surface UV radiation under the influence of geoengineered aerosols. VSL bromocarbons have by definition a chemical lifetime of less than 0.5 years (WMO, 2006). In contrast to long-lived bromocarbons (e.g., CH3Br plus halons), these

  18. On the relation between stratospheric chlorine/bromine loading and short-lived tropospheric source gases

    NASA Astrophysics Data System (ADS)

    Ko, Malcolm K. W.; Sze, Nien-Dak; Scott, Courtney J.; Weisenstein, Debra K.

    1997-11-01

    Current methods for estimating the concentrations of inorganic chlorine/bromine species (Cly/Bry) in the stratosphere due to decomposition of tropospheric source gases assume that the Cly/Bry concentration in the stratosphere is determined mainly by the balance between production from in situ oxidation of the source gases in the stratosphere and removal by transport of Cly/Bry out of the stratosphere. The rationale being that for source gases whose lifetimes are of the order of several months or longer the concentration of Cly/Bry in the troposphere is small because they are produced at a relatively slow rate and also removed efficiently by washout processes. As a result of the small concentration, the rate at which Cly/Bry is transported to the stratosphere is expected to be small compared to the in situ stratospheric production. Thus the transport of Cly/Bry from the troposphere contributes little to the stratospheric concentration. In contrast, the origin of stratospheric Cly/Bry from reactive source gases with tropospheric lifetimes comparable to the washout lifetime of Cly/Bry (of the order of 10-30 days) in the troposphere is distinctly different. The in situ source in the stratosphere is expected to be significantly smaller because only a small portion of the source gas is expected to survive the troposphere to be transported into this region. At the same time these short-lived source gases produce appreciable amounts of Cly/Bry in the troposphere such that transport to the stratosphere offers a larger source for stratospheric Cly/Bry than in situ production. Thus, for reactive source species, simple methods of estimating the concentration of stratospheric Cly/Bry that ignore the tropospheric contribution will seriously underestimate the loading. Therefore estimation of the stratospheric Cly/Bry loading requires not only measurements of tropospheric source gases but also measurements of Cly/Bry at the tropopause. This paper illustrates the mechanism by using results from a two-dimensional chemistry-transport model. However, in view of the importance of tropospheric transport on stratospheric loading the detailed values should be further evaluated using a three-dimensional model with appropriate treatment of convective transport.

  19. Transport and Chemistry of Short-Lived Bromocarbons in the Tropics

    NASA Astrophysics Data System (ADS)

    Hossaini, Ryan; Chipperfield, Martyn; Monge-Sanz, Beatriz; Richards, Nigel; Atlas, Elliot; Blake, Donald

    2010-05-01

    We have developed a detailed chemical scheme for the degradation of the short-lived source gases bromoform (CHBr3) and dibromomethane (CH2Br2) and implemented it in the TOMCAT/SLIMCAT three-dimensional (3D) chemical transport model (CTM). The CTM has been used to predict the distribution of the two source gases (SGs) and 11 of their organic product gases (PGs). These first global calculations of the organic PGs show that their abundance is small. The longest lived organic PGs are CBr2O and CHBrO, but their peak tropospheric abundance relative to the surface volume mixing ratio (vmr) of the SGs is less than 5%. We calculate their mean local tropospheric lifetimes in the tropics to be ~7 and ~2 days (due to photolysis), respectively. Therefore, the assumption in previous modelling studies that SG degradation leads immediately to inorganic bromine seems reasonable. We have compared observed tropical SG profiles from a number of aircraft campaigns with various model experiments. In the tropical tropopause layer (TTL) we find that the CTM run using p levels (TOMCAT) and vertical winds from analysed divergence overestimates the abundance of CH2Br2, and to a lesser extent CHBr3, although the data is sparse and comparisons are not conclusive. Better agreement in the TTL is obtained in the sensitivity run using ? levels (SLIMCAT) and vertical motion from diabatic heating rates. Trajectory estimates of residence times in the two model versions show slower vertical transport in the SLIMCAT ?-level version. In the p-level model even when we switch off convection we still find significant amounts of the SGs considered may reach the cold point tropopause; the stratospheric source gas injection (SGI) is only reduced by ~16% for CHBr3 and ~2% for CH2Br2 without convection. Overall, the relative importance of the SG pathway and the PG pathway for transport of bromine to the stratospheric overworld (?>380 K) has been assessed. Assuming a 10-day washout lifetime of Bry in TOMCAT, we find the delivery of total Br from CHBr3 to be 0.72 pptv with ~53% of this coming from SGI. Similary, for CH2Br2 we find a total Br value of 1.69 pptv with ~94% coming from SGI. We infer that these species contribute ~2.4 pptv of inorganic bromine to the lower stratosphere with SGI being the dominant pathway. Slower transport to and through the TTL would decrease this estimate.

  20. Evaluating the climate and air quality impacts of short-lived pollutants

    NASA Astrophysics Data System (ADS)

    Stohl, A.; Aamaas, B.; Amann, M.; Baker, L. H.; Bellouin, N.; Berntsen, T. K.; Boucher, O.; Cherian, R.; Collins, W.; Daskalakis, N.; Dusinska, M.; Eckhardt, S.; Fuglestvedt, J. S.; Harju, M.; Heyes, C.; Hodnebrog, Ø.; Hao, J.; Im, U.; Kanakidou, M.; Klimont, Z.; Kupiainen, K.; Law, K. S.; Lund, M. T.; Maas, R.; MacIntosh, C. R.; Myhre, G.; Myriokefalitakis, S.; Olivié, D.; Quaas, J.; Quennehen, B.; Raut, J.-C.; Rumbold, S. T.; Samset, B. H.; Schulz, M.; Seland, Ø.; Shine, K. P.; Skeie, R. B.; Wang, S.; Yttri, K. E.; Zhu, T.

    2015-06-01

    This paper presents a summary of the work done within the European Union's Seventh Framework Programme project ECLIPSE (Evaluating the Climate and Air Quality Impacts of Short-Lived Pollutants). ECLIPSE had a unique systematic concept for designing a realistic and effective mitigation scenario for short-lived climate pollutants (SLCPs: methane, aerosols and ozone, and their precursor species) and quantifying its climate and air quality impacts, and this paper presents the results in the context of this overarching strategy. The first step in ECLIPSE was to create a new emission inventory based on current legislation (CLE) for the recent past and until 2050. Substantial progress compared to previous work was made by including previously unaccounted types of sources such as flaring of gas associated with oil production, and wick lamps. These emission data were used for present-day reference simulations with four advanced Earth system models (ESMs) and six chemistry transport models (CTMs). The model simulations were compared with a variety of ground-based and satellite observational data sets from Asia, Europe and the Arctic. It was found that the models still underestimate the measured seasonality of aerosols in the Arctic but to a lesser extent than in previous studies. Problems likely related to the emissions were identified for Northern Russia and India, in particular. To estimate the climate impacts of SLCPs, ECLIPSE followed two paths of research: the first path calculated radiative forcing (RF) values for a large matrix of SLCP species emissions, for different seasons and regions independently. Based on these RF calculations, the Global Temperature change Potential metric for a time horizon of 20 years (GTP20) was calculated for each SLCP emission type. This climate metric was then used in an integrated assessment model to identify all emission mitigation measures with a beneficial air quality and short-term (20 year) climate impact. These measures together defined a SLCP mitigation (MIT) scenario. Compared to CLE, the MIT scenario would reduce global methane (CH4) and black carbon emissions by about 50 and 80%, respectively. For CH4, measures on shale gas production, waste management and coal mines were most important. For non-CH4 SLCPs, elimination of high emitting vehicles and wick lamps, as well as reducing emissions from gas flaring, coal and biomass stoves, agricultural waste, solvents and diesel engines were most important. These measures lead to large reductions in calculated surface concentrations of ozone and particulate matter. We estimate that in the EU the loss of statistical life expectancy due to air pollution was 7.5 months in 2010, which will be reduced to 5.2 months by 2030 in the CLE scenario. The MIT scenario would reduce this value by another 0.9 to 4.3 months. Substantially larger reductions due to the mitigation are found for China (1.8 months) and India (11-12 months). The climate metrics cannot fully quantify the climate response. Therefore, a second research path was taken. Transient climate ensemble simulations with these ESMs were run for the CLE and MIT scenarios, to determine the climate impacts of the mitigation. In these simulations, the CLE scenario resulted in a surface temperature increase of 0.70±0.14 K between the years 2006 and 2050. For the decade 2041-2050, the warming was reduced by 0.22±0.07 K in the MIT scenario, and this result was in almost exact agreement with the response calculated based on the emission metrics (reduced warming of 0.22±0.09 K). The metrics calculations suggest that non-CH4 SLCPs contribute ∼22% to this response and CH4 78%. This could not be fully confirmed by the transient simulations, which attributed about 90% of the temperature response to CH4 reductions. Attribution of the observed temperature response to non-CH4 SLCP emission reductions and black carbon (BC) specifically is hampered in the transient simulations by small forcing and co-emitted species of the emission basket chosen. Nevertheless, an important conclusion is that our mitig

  1. In vitro immunotoxic and genotoxic activities of particles emitted from two different small-scale wood combustion appliances

    NASA Astrophysics Data System (ADS)

    Tapanainen, Maija; Jalava, Pasi I.; Mäki-Paakkanen, Jorma; Hakulinen, Pasi; Happo, Mikko S.; Lamberg, Heikki; Ruusunen, Jarno; Tissari, Jarkko; Nuutinen, Kati; Yli-Pirilä, Pasi; Hillamo, Risto; Salonen, Raimo O.; Jokiniemi, Jorma; Hirvonen, Maija-Riitta

    2011-12-01

    Residential wood combustion appliances emit large quantities of fine particles which are suspected to cause a substantial health burden worldwide. Wood combustion particles contain several potential health-damaging metals and carbon compounds such as polycyclic aromatic hydrocarbons (PAH), which may determine the toxic properties of the emitted particles. The aim of the present study was to characterize in vitro immunotoxicological and chemical properties of PM 1 ( Dp ? 1 ?m) emitted from a pellet boiler and a conventional masonry heater. Mouse RAW264.7 macrophages were exposed for 24 h to different doses of the emission particles. Cytotoxicity, production of the proinflammatory cytokine TNF-? and the chemokine MIP-2, apoptosis and phases of the cell cycle as well as genotoxic activity were measured after the exposure. The type of wood combustion appliance had a significant effect on emissions and chemical composition of the particles. All the studied PM 1 samples induced cytotoxic, genotoxic and inflammatory responses in a dose-dependent manner. The particles emitted from the conventional masonry heater were 3-fold more potent inducers of programmed cell death and DNA damage than those emitted from the pellet boiler. Furthermore, the particulate samples that induced extensive DNA damage contained also large amounts of PAH compounds. Instead, significant differences between the studied appliances were not detected in measurements of inflammatory mediators, although the chemical composition of the combustion particles differed considerably from each other. In conclusion, the present results show that appliances representing different combustion technology have remarkable effects on physicochemical and associated toxicological and properties of wood combustion particles. The present data indicate that the particles emitted from incomplete combustion are toxicologically more potent than those emitted from more complete combustion processes.

  2. Global Modeling and Projection of Short-Lived Climate Pollutants in an Earth System Model

    NASA Astrophysics Data System (ADS)

    Sudo, K.; Takemura, T.; Klimont, Z.; Kurokawa, J.; Akimoto, H.

    2013-12-01

    In predicting and mitigating future global warming, short-lived climate pollutants (SLCPs) such as tropospheric ozone (O3), black carbon (BC), and other related components including CH4/VOCs and aerosols play crucial roles as well as long-lived species like CO2 or N2O. Several recent studies suggests that reduction of heating SLCPs (i.e., O3 and black carbon) together with CH4 can decrease and delay the expected future warming, and can be an alternative to CO2 mitigation (Shindell et al., 2012). However it should be noted that there are still large uncertainties in simulating SLCPs and their climate impacts. For instance, present global models generally have a severe tendency to underestimate BC especially in remote areas like the polar regions as shown by the recent model intercomparison project under the IPCC (ACCMIP/AeroCOM). This problem in global BC modeling, basically coming from aging and removal processes of BC, causes still a large uncertainty in the estimate of BC's atmospheric heating and climate impacts (Bond et al., 2013; Kerr et al., 2013). This study attempted to improve global simulation of BC by developing a new scheme for simulating aging process of BC and re-evaluate radiative forcing of BC in the framework of a chemistry-aerosol coupled climate model (Earth system model) MIROC-ESM-CHEM. Our improved model with the new aging scheme appears to relatively well reproduce the observed BC concentrations and seasonality in the Arctic/Antarctic region. The new model estimates radiative forcing of BC to be 0.83 W m-2 which is about two times larger than the estimate by our original model with no aging scheme (0.41 W m-2), or the model ensemble mean in the IPCC report. Using this model, future projection of SLCPs and their climate impacts is conducted following the recent IIASA emission scenarios for the year 2030 (Klimont et al., 2006; Cofala et al., 2007). Our simulation suggests that heating SLCPs components (O3, BC, and CH4) are significantly reduced in the maximal feasible reduction (MFR) scenario, contributing to global mean temperature reduction by about -0.25 oC after 2030. This heating-SLCPs-induced warming mitigation in MFR is, however, largely cancelled out by the temperature increase due to decreases in cooling aerosols (SO42-, NO3-, and organics), resulting in temperature projection which is not quite different from the other scenarios like CLE (current legislation for air quality) or 450ppm climate stabilization (intermediate reduction) scenario. References Bond et al. (2013): Bounding the role of black carbon in the climate system: A scientific assessment, J. Geophys. Res., 118, 5380-5552, doi:10.1002/jgrd.50171, 2013. Cofala et al. (2007): Scenarios of global anthropogenic emissions of air pollutants and methane until 2030, Atmos. Environ., 41, 8486-8499. Kerr et al. (2013): Soot is warming the world even more than thought, Science, 339, 382, doi: 10.1126/science.339.6118.382. Klimont, Z., Brink, C. (2006): Modelling of Emissions of Air Pollutants and Greenhouse Gases from Agricultural Sources in Europe. International Institute for Applied Systems Analysis (IIASA), Laxenburg, Austria. Shindell et al. (2012): Simultaneously Mitigating Near-Term Climate Change and Improving Human Health and Food Security, Science, 335, 183-189, doi: 10.1126/science.1210026.

  3. Spatial and Time Coincidence Detection of the Decay Chain of Short-Lived Radioactive Nuclei

    SciTech Connect

    Granja, Carlos; Jakubek, Jan; Platkevic, Michal; Pospisil, Stanislav [Institute of Experimental and Applied Physics, Czech Technical University in Prague, Horska 3a/22, 128 00 Prague 2 (Czech Republic); Koester, Ulli [Institute Laue Langevin, 6 rue Jules Horowitz, F-38042 Grenoble Cedex 9 (France)

    2010-08-04

    The quantum counting position sensitive pixel detector Timepix with per-pixel energy and time resolution enables to detect radioactive ions and register the consecutive decay chain by simultaneous position-and time-correlation. This spatial and timing coincidence technique in the same sensor is demonstrated by the registration of the decay chain {sup 8}He{yields}{sup {beta} 8}Li and {sup 8}Li{yields}{sup {beta}-} {sup 8}Be{yields}{alpha}+{alpha} and by the measurement of the {beta} decay half-lives. Radioactive ions, selectively obtained from the Lohengrin fission fragment spectrometer installed at the High Flux Reactor of the ILL Grenoble, are delivered to the Timepix silicon sensor where decays of the implanted ions and daughter nuclei are registered and visualized. We measure decay lifetimes in the range {>=}{mu}s with precision limited just by counting statistics.

  4. Studies of images of short-lived events using ERTS data. [forest fires, oil spills, vegetation damage, volcanoes, storm ridges, earthquakes, and floods

    NASA Technical Reports Server (NTRS)

    Deutschman, W. A. (principal investigator)

    1973-01-01

    The author has identified the following significant results. Detection of short-lived events has continued. Forest fires, oil spills, vegetation damage, volcanoes, storm ridges, earthquakes, and floods have been detected and analyzed.

  5. Production of Short-lived Radionuclides by Protons and Neutrons in Fe and Ni Targets: Cross Sections Needed for Cosmic Ray Studies

    NASA Technical Reports Server (NTRS)

    Sisterson, J. M.; Vincent, J.; Jones, D. T. L.; Binns, P. J.; Langen, K.; Schroeder, I.; Buthelezi, Z.; Brooks, F. D.; Buffler, A.; Allie, M. S.

    2000-01-01

    New neutron and proton cross sections for short-lived radionuclides produced in Fe and Ni are presented. These cross sections are essential to understand cosmic ray interactions with meteorites and the lunar surface.

  6. Genome-wide determination of RNA stability reveals hundreds of short-lived noncoding transcripts in mammals

    PubMed Central

    Tani, Hidenori; Mizutani, Rena; Salam, Kazi Abdus; Tano, Keiko; Ijiri, Kenichi; Wakamatsu, Ai; Isogai, Takao; Suzuki, Yutaka; Akimitsu, Nobuyoshi

    2012-01-01

    Mammalian genomes produce huge numbers of noncoding RNAs (ncRNAs). However, the functions of most ncRNAs are unclear, and novel techniques that can distinguish functional ncRNAs are needed. Studies of mRNAs have revealed that the half-life of each mRNA is closely related to its physiological function, raising the possibility that the RNA stability of an ncRNA reflects its function. In this study, we first determined the half-lives of 11,052 mRNAs and 1418 ncRNAs in HeLa Tet-off (TO) cells by developing a novel genome-wide method, which we named 5?-bromo-uridine immunoprecipitation chase–deep sequencing analysis (BRIC-seq). This method involved pulse-labeling endogenous RNAs with 5?-bromo-uridine and measuring the ongoing decrease in RNA levels over time using multifaceted deep sequencing. By analyzing the relationship between RNA half-lives and functional categories, we found that RNAs with a long half-life (t1/2 ? 4 h) contained a significant proportion of ncRNAs, as well as mRNAs involved in housekeeping functions, whereas RNAs with a short half-life (t1/2 < 4 h) included known regulatory ncRNAs and regulatory mRNAs. The stabilities of a significant set of short-lived ncRNAs are regulated by external stimuli, such as retinoic acid treatment. In particular, we identified and characterized several novel long ncRNAs involved in cell proliferation from the group of short-lived ncRNAs. We designated this novel class of ncRNAs with a short half-life as Short-Lived noncoding Transcripts (SLiTs). We propose that the strategy of monitoring RNA half-life will provide a powerful tool for investigating hitherto functionally uncharacterized regulatory RNAs. PMID:22369889

  7. Determination of sterols, estrogens and inorganic ions in waste water and size-segregated aerosol particles emitted from waste water treatment

    Microsoft Academic Search

    Melanie Beck; Michael Radke

    2006-01-01

    Concentrations of steroids and inorganic ions were measured in waste water of an aerated sand trap as well as in aerosol particles emitted from this tank at the waste water treatment plant (WWTP) of Bayreuth, Germany, in January and February 2003. The investigations comprised seven sterols, two estrogens, and several inorganic ions. Since an appropriate method for the determination of

  8. The TITAN EBIT charge breeder for mass measurements on highly charged short-lived isotopes—First online operation

    NASA Astrophysics Data System (ADS)

    Lapierre, A.; Brodeur, M.; Brunner, T.; Ettenauer, S.; Gallant, A. T.; Simon, V.; Good, M.; Froese, M. W.; Crespo López-Urrutia, J. R.; Delheij, P.; Epp, S.; Ringle, R.; Schwarz, S.; Ullrich, J.; Dilling, J.

    2010-12-01

    TITAN (TRIUMF's Ion Traps for Atomic and Nuclear science) is a novel online facility for high-precision mass measurements on short-lived isotopes. TITAN is the only such facility that employs an Electron-Beam Ion Trap (EBIT) charge-state breeder to produce highly charged ions for their use to increase the precision of mass measurements. We describe the recently commissioned TITAN EBIT and present the results of first injection, charge breeding, and extraction tests performed with stable and radioactive ions.

  9. VLA Observations Confirm Origin of Gamma Ray Bursts in Short-Lived Stars

    NASA Astrophysics Data System (ADS)

    1998-06-01

    Radio telescope studies of the fiery afterglow of a Gamma Ray Burst have provided astronomers with the best clues yet about the origins of these tremendous cosmic cataclysms since their discovery more than 30 years ago. Observations with the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope confirm that a blast seen to occur on March 29 had its origin in a star-forming region in a distant galaxy. "There are two leading theories for the causes of Gamma Ray Bursts," said Dale Frail of the NSF National Radio Astronomy Observatory (NRAO) in Socorro, NM. "According to one theory, the blasts occur in the death throes of pairs of old stars. The other requires them to arise from exploding, massive, short-lived stars that still reside within the star-forming gas and dust from which they formed. The VLA studies of the burst show that at least this one almost certainly occurred within a star-forming region. This result also explains why half of the Gamma Ray Burst afterglows are not detected by optical telescopes." Frail heads a VLA observing team including Greg Taylor, also of NRAO, and Shri Kulkarni of Caltech, that reported its findings to the American Astronomical Society meeting in San Diego, CA. The March 29 burst was seen clearly by radio telescopes (the accompanying image is GRB 980329 as seen by the VLA) but only very faintly with optical instruments. "That is extremely important," said Taylor. "This burst was very faint at visible wavelengths, brighter at infrared wavelengths and brighter still at radio wavelengths. This is a clear indication that the exploding object was surrounded by dust. Dust is most commonly found in star-forming regions." This strongly favors one of the two leading theories about Gamma Ray Bursts over the other. One explanation for these tremendously energetic fireballs is that a pair of superdense neutron stars collides. The other is that a single, very massive star explodes in a "hypernova," more powerful than a supernova, at the end of its normal life. The hypernova explosion, scientists believe, would come only a few million years after the giant star was formed, while it is still within the cloud of gas and dust from which it formed. Neutron stars, on the other hand, are formed by supernova explosions that give a "kick" to the resulting neutron star, propelling it at high speeds. An orbiting pair of neutron stars, astronomers think, would collide only after hundreds of millions of years of orbital decay, by which time they would be far away from the gas and dust of their birthplace. "The observations already have provided crucial insight; we intend to continue observing the relic of the March 29 burst with the VLA, and in the coming months, we will gain new information that will help further refine our ideas about these fireballs," Frail said. "We're going to learn about the size and expansion rate of the fireball and test predictions made by the models." "These observations indicate the extraordinary importance of radio astronomy for providing information that can be gained in no other way about one of the major frontier areas of astrophysics," said Hugh Van Horn, Director of the NSF's Division of Astronomical Sciences. The March 29 burst (GRB 980329) was the second such blast to have its afterglow detected at radio wavelengths. Last year, the VLA made the first radio detection of a GRB afterglow, finding radio emission coming from the location of a Gamma Ray Burst on May 8, 1997 (GRB 970508). "Of the world's radio telescopes, only the VLA has the sensitivity and resolving power to quickly detect these radio afterglows of Gamma Ray Bursts and study them in detail over extended periods of time," Taylor said. "Even so, we only see the brightest one-third of them. With upgraded capabilities at the VLA, as planned by NRAO, we will see them all." The National Radio Astronomy Observatory is a facility of the National Science Foundation, operated under cooperative agr

  10. Actinium-225 in targeted alpha-particle therapeutic applications.

    PubMed

    Scheinberg, David A; McDevitt, Michael R

    2011-10-01

    Alpha particle-emitting isotopes are being investigated in radioimmunotherapeutic applications because of their unparalleled cytotoxicity when targeted to cancer and their relative lack of toxicity towards untargeted normal tissue. Actinium- 225 has been developed into potent targeting drug constructs and is in clinical use against acute myelogenous leukemia. The key properties of the alpha particles generated by 225Ac are the following: i) limited range in tissue of a few cell diameters; ii) high linear energy transfer leading to dense radiation damage along each alpha track; iii) a 10 day halflife; and iv) four net alpha particles emitted per decay. Targeting 225Ac-drug constructs have potential in the treatment of cancer. PMID:22202153

  11. The production of short-lived radionuclides by new non-rotating and rotating Wolf-Rayet model stars

    E-print Network

    M. Arnould; S. Goriely; G. Meynet

    2006-03-21

    It has been speculated that WR winds may have contaminated the forming solar system, in particular with short-lived radionuclides (half-lives in the approximate 10^5 - 10^8 y range) that are responsible for a class of isotopic anomalies found in some meteoritic materials. We revisit the capability of the WR winds to eject these radionuclides using new models of single non-exploding WR stars with metallicity Z = 0.02. The earlier predictions for non-rotating WR stars are updated, and models for rotating such stars are used for the first time in this context. We find that (1) rotation has no significant influence on the short-lived radionuclide production by neutron capture during the core He-burning phase, and (2) 26Al, 36Cl, 41Ca, and 107Pd can be wind-ejected by a variety of WR stars at relative levels that are compatible with the meteoritic analyses for a period of free decay of around 10^5 y between production and incorporation into the forming solar system solid bodies. We confirm the previously published conclusions that the winds of WR stars have a radionuclide composition that can meet the necessary condition for them to be a possible contaminating agent of the forming solar system. Still, it remains to be demonstrated from detailed models that this is a sufficient condition for these winds to have provided a level of pollution that is compatible with the observations.

  12. Contribution of very short-lived organic substances to stratospheric chlorine and bromine in the tropics - a case study

    NASA Astrophysics Data System (ADS)

    Laube, J. C.; Engel, A.; Bönisch, H.; Möbius, T.; Worton, D. R.; Sturges, W. T.; Grunow, K.; Schmidt, U.

    2008-12-01

    The total stratospheric organic chlorine and bromine burden was derived from balloon-borne measurements in the tropics (Teresina, Brazil, 5°04´ S, 42°52´ W) in 2005. Whole air samples were collected cryogenically at altitudes between 15 and 34 km. For the first time, we report measurements of a set of 28 chlorinated and brominated substances in the tropical upper troposphere and stratosphere including ten substances with an atmospheric lifetime of less than half a year. The substances were quantified using pre-concentration techniques followed by Gas Chromatography with Mass Spectrometric detection. In the tropical tropopause layer at altitudes between 15 and 17 km we found 1.1-1.4% of the chlorine and 6-8% of the bromine to be present in the form of very short-lived organic compounds. By combining the data with tropospheric reference data and age of air observations the abundances of inorganic chlorine and bromine (Cly and Bry) were derived. At an altitude of 34 km we calculated 3062 ppt of Cly and 17.5 ppt of Bry from the decomposition of both long- and short-lived organic source gases. Furthermore we present indications for the presence of additional organic brominated substances in the tropical upper troposphere and stratosphere.

  13. Chemical and size characterization of particles emitted from the burning of coal and wood in rural households in Guizhou, China

    NASA Astrophysics Data System (ADS)

    Zhang, Hefeng; Wang, Shuxiao; Hao, Jiming; Wan, Lin; Jiang, Jingkun; Zhang, Min; Mestl, Heidi E. S.; Alnes, Line W. H.; Aunan, Kristin; Mellouki, Abdel Wahid

    2012-05-01

    Field measurements were conducted to determine indoor air particulate pollutant emissions from the burning of coal and wood, two major household fuels, in rural households in Guizhou, China. Chemical composition, particle mass and particle size distribution as well as number concentration were measured in this study. Chemical composition analysis indicates that the carbonaceous particle is dominant in the PM2.5 mass, accounting for about 41% for wood and 55% for coal. The OC/EC ratio was 10.8 for wood and 7.6 for coal. Most of the water-soluble ions were found in the 0.4-2.1 ?m size fractions and dominated by ammonium and sulfate. Particle mass concentrations inversely correlate with particle total number concentrations during the sampling period. Obvious differences were observed in the evolution of particle number concentrations and size distributions between coal combustion and wood burning. Particles emitted from coal combustion were characterized by unimodal size distribution, with average peak values ranging from 70.3 to 75.7 nm during the flaming stage of the burning cycle. Particles from wood burning were characterized by a transition from a bimodal size distribution to a unimodal distribution during the same period. Average peak values in the bimodal mode were 10-20 nm (nucleation mode) and 40-50 nm (Aitken mode), whereas the average peak value in the unimodal mode was about 63 nm.

  14. Size distribution, chemical composition, and hygroscopicity of fine particles emitted from an oil-fired heating plant.

    PubMed

    Happonen, Matti; Mylläri, Fanni; Karjalainen, Panu; Frey, Anna; Saarikoski, Sanna; Carbone, Samara; Hillamo, Risto; Pirjola, Liisa; Häyrinen, Anna; Kytömäki, Jorma; Niemi, Jarkko V; Keskinen, Jorma; Rönkkö, Topi

    2013-12-17

    Heavy fuel oil (HFO) is a commonly used fuel in industrial heating and power generation and for large marine vessels. In this study, the fine particle emissions of a 47 MW oil-fired boiler were studied at 30 MW power and with three different fuels. The studied fuels were HFO, water emulsion of HFO, and water emulsion of HFO mixed with light fuel oil (LFO). With all the fuels, the boiler emitted considerable amounts of particles smaller than 200 nm in diameter. Further, these small particles were quite hygroscopic even as fresh and, in the case of HFO+LFO emulsion, the hygroscopic growth of the particles was dependent on particle size. The use of emulsions and the addition of LFO to the fuel had a reducing effect on the hygroscopic growth of particles. The use of emulsions lowered the sulfate content of the smallest particles but did not affect significantly the sulfate content of particles larger than 42 nm and, further, the addition of LFO considerably increased the black carbon content of particulate matter. The results indicate that even the fine particles emitted from HFO based combustion can have a significant effect on cloud formation, visibility, and air quality. PMID:24245691

  15. New methodology for Ozone Depletion Potentials of short-lived compounds: n-Propyl bromide as an example

    NASA Astrophysics Data System (ADS)

    Wuebbles, Donald J.; Patten, Kenneth O.; Johnson, Matthew T.; Kotamarthi, Rao

    2001-07-01

    A number of the compounds proposed as replacements for substances controlled under the Montreal Protocol have extremely short atmospheric lifetimes, on the order of days to a few months. An important example is n-propyl bromide (also referred to as 1-bromopropane, CH2BrCH2CH3 or simplified as 1-C3H7Br or nPB). This compound, useful as a solvent, has an atmospheric lifetime of less than 20 days due to its reaction with hydroxyl. Because nPB contains bromine, any amount reaching the stratosphere has the potential to affect concentrations of stratospheric ozone. The definition of Ozone Depletion Potentials (ODP) needs to be modified for such short-lived compounds to account for the location and timing of emissions. It is not adequate to treat these chemicals as if they were uniformly emitted at all latitudes and longitudes as normally done for longer-lived gases. Thus, for short-lived compounds, policymakers will need a table of ODP values instead of the single value generally provided in past studies. This study uses the MOZART2 three-dimensional chemical-transport model in combination with studies with our less computationally expensive two-dimensional model to examine potential effects of nPB on stratospheric ozone. Multiple facets of this study examine key questions regarding the amount of bromine reaching the stratosphere following emission of nPB. Our most significant findings from this study for the purposes of short-lived replacement compound ozone effects are summarized as follows. The degradation of nPB produces a significant quantity of bromoacetone which increases the amount of bromine transported to the stratosphere due to nPB. However, much of that effect is not due to bromoacetone itself, but instead to inorganic bromine which is produced from tropospheric oxidation of nPB, bromoacetone, and other degradation products and is transported above the dry and wet deposition processes of the model. The MOZART2 nPB results indicate a minimal correction of the two-dimensional results in order to derive our final results: an nPB chemical lifetime of 19 days and an Ozone Depletion Potential range of 0.033 to 0.040 for assumed global emissions over landmasses, 19 days and 0.021 to 0.028, respectively, for assumed emissions in the industrialized regions of the Northern Hemisphere, and 9 days and 0.087 to 0.105, respectively, for assumed emission in tropical Southeast Asia.

  16. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha particle therapy applications.

    PubMed

    Miederer, Matthias; Scheinberg, David A; McDevitt, Michael R

    2008-09-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225 Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209 Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225 Ac to potently and specifically affect cancer. PMID:18514364

  17. Treatment of HER2 Positive Breast Carcinomatous Meningitis with Intrathecal Administration of ?-Particle Emitting 211At-labeled Trastuzumab?

    PubMed Central

    Boskovitz, Abraham; McLendon, Roger E.; Okamura, Tatsunori; Sampson, John H.; Bigner, Darell D.; Zalutsky, Michael R.

    2009-01-01

    Introduction Carcinomatous meningitis (CM) is a devastating disease characterized by the dissemination of malignant tumor cells into the subarachnoid space along the brain and spine. Systemic treatment with monoclonal antibody (mAb) trastuzumab can be effective against HER2-positive systemic breast carcinoma but like other therapies, is ineffective against CM. The goal of this study was to evaluate the therapeutic effect of ?-particle emitting 211At-labeled trastuzumab following intrathecal administration in a rat model of breast carcinoma CM. Methods Athymic rats were injected intrathecally with MCF-7/HER2-18 breast carcinoma cells through a surgically-implanted indwelling intrathecal catheter. In Experiment 1, animals received 33 or 66 µCi 211At-labeled trastuzumab, cold trastuzumab, or saline. In Experiment 2, animals were inoculated with a lower tumor burden and received 46 or 92 µCi 211At-labeled trastuzumab, or saline. In Experiment 3, animals received 28 µCi 211At-labeled trastuzumab, 30 µCi 211At-labeled TPS3.2 control mAb or saline. Histopathological analysis of the neuroaxis was performed at the end of the study. Results In Experiment 1, median survival increased from 21 days for the saline and cold trastuzumab groups to 45 and 48 days for 33 and 66 µCi 211At-labeled trastuzumab, respectively. In Experiment 2, median survival increased from 23 days for saline controls to 68 and 92 days for 46 and 92 µCi 211At-labeled trastuzumab, respectively. In Experiment 3, median survival increased from 20 days to 29 and 36 days for animals treated with 211At-labeled TPS3.2 and 211At-labeled trastuzumab, respectively. Long-term survivors were observed exclusively in the 211At-trastuzumab-treated groups. Conclusion Intrathecal 211At-labeled trastuzumab shows promise as a treatment for patients with HER2-positive breast CM. PMID:19647172

  18. Time-separated oscillatory fields for high-precision mass measurements on short-lived Al and Ca nuclides

    E-print Network

    S. George; G. Audi; B. Blank; K. Blaum; M. Breitenfeldt; U. Hager; F. Herfurth; A. Herlert; A. Kellerbauer; H. -J. Kluge; M. Kretzschmar; D. Lunney; R. Savreux; S. Schwarz; L. Schweikhard; C. Yazidjian

    2008-01-17

    High-precision Penning trap mass measurements on the stable nuclide 27Al as well as on the short-lived radionuclides 26Al and 38,39Ca have been performed by use of radiofrequency excitation with time-separated oscillatory fields, i.e. Ramsey's method, as recently introduced for the excitation of the ion motion in a Penning trap, was applied. A comparison with the conventional method of a single continuous excitation demonstrates its advantage of up to ten times shorter measurements. The new mass values of 26,27Al clarify conflicting data in this specific mass region. In addition, the resulting mass values of the superallowed beta-emitter 38Ca as well as of the groundstate of the beta-emitter 26Al m confirm previous measurements and corresponding theoretical corrections of the ft-values.

  19. Upper mantle lower crust dikes of the Zambales Ophiolite Complex (Philippines): distinct short-lived, subduction-related magmatism

    NASA Astrophysics Data System (ADS)

    Yumul, G. P.; Dimalanta, C. B.; Faustino, D. V.; de Jesus, J. V.

    1998-09-01

    The residual harzburgite-lherzolite suites in the Coto and Acoje blocks of the Zambales Ophiolite Complex are cut by numerous dikes that range from clinopyroxenites to diabases, gabbros and diorites. Diabase dikes extensively cut the Coto block harzburgites while some clinopyroxenite to gabbro dikes are noted in the Acoje block lherzolite-harzburgite-dunite suite. The upper mantle-lower crust dikes in both blocks do not extend to their respective overlying sheeted dike-sill complexes. The whole-rock geochemistry of the mafic dikes intruded into the Coto and Acoje block peridotites show subduction-related signatures. These island-arc dikes are not unextracted frozen melts from their respective abyssal peridotite-like country rocks. They represent post-ophiolite, short-lived magmatic events that tapped geochemically different mantle source regions in a subduction-related marginal basin setting.

  20. The Notch Signaling Pathway Controls Short-Lived Effector CD8+ T Cell Differentiation but Is Dispensable for Memory Generation.

    PubMed

    Mathieu, Mélissa; Duval, Frédéric; Daudelin, Jean-François; Labrecque, Nathalie

    2015-06-15

    Following an infection, naive CD8(+) T cells expand and differentiate into two main populations of effectors: short-lived effector cells (SLECs) and memory precursor effector cells (MPECs). There is limited understanding of the molecular mechanism and cellular processes governing this cell fate. Notch is a key regulator of cell fate decision relevant in many immunological pathways. In this study, we add to the role of Notch in cell fate decision and demonstrate that the Notch signaling pathway controls the MPEC/SLEC differentiation choice following both Listeria infection and dendritic cell immunization of mice. Although fewer SLECs were generated, Notch deficiency did not alter the rate of memory CD8(+) T cell generation. Moreover, we reveal that the Notch signaling pathway plays a context-dependent role for optimal cytokine production by effector CD8(+) T cells. Together, our results unravel critical functions for the Notch signaling pathway during effector CD8(+) T cell differentiation. PMID:25972473

  1. Effects of fragment size and isolation on the occurrence of four short-lived plants in semi-natural grasslands

    NASA Astrophysics Data System (ADS)

    Kiviniemi, Katariina

    2008-01-01

    Habitat fragmentation is predicted to lead to an area-related reduction in population size and a decreasing colonisation rate due to isolation. A reduction in grassland size may promote a "run-away-decline process" leading to reduced individual fitness and viability of the populations originally inhabiting the grassland. To circumvent the problems of time-lags associated with the slow response of long-lived plants to semi-natural grassland fragmentation, four short-lived grassland species were studied. During three years, data on population sizes were gathered for Carum carvi, Rhinanthus minor, Trifolium arvense and Viola tricolor in Swedish semi-natural grasslands varying in size and degree of isolation. A seed-sowing experiment was conducted to assess dispersal and seed limitation at a local and regional scale, respectively. Overall, the presence/absence of species was not related to fragment size and isolation (connectivity). However, for the fragments where the species were present, positive relationships between grassland size and population size were detected for three species. No significant relationships between isolation and population size were detected for any species. This study thus demonstrates that short-lived plant species, confined to semi-natural grasslands, respond to decreases in fragment size by forming smaller populations. Seed sowing indicated that the species are both dispersal and seed limited in the study area, and that disturbances are important for establishment. In order to maintain characteristic grassland species in fragmented (isolated) semi-natural grasslands, it may therefore be of interest to preserve large intact fragments instead of several small ones.

  2. Evolution of the Galaxy and the Birth of the Solar System: The Short-Lived Nuclides Connection

    NASA Astrophysics Data System (ADS)

    Sahijpal, S.

    2014-06-01

    An attempt is made, probably for the first time, to understand the origin of the solar system in context with the evolution of the galaxy as a natural consequence of the birth of several generations of stellar clusters. The galaxy is numerically simulated to deduce the inventories of the short-lived nuclides, 26Al, 36Cl, 41Ca, 53Mn and 60Fe, from the stellar nucleosynthetic contributions of the various stellar clusters using an N-body simulation with updated prescriptions of the astrophysical processes. The galaxy is evolved by considering the discreteness associated with the stellar clusters and individual stars. We estimate the steady state abundance of the radionuclides around 4.56 billion years ago at the time of formation of the solar system. Further, we also estimate the present 26Al/27Al and 60Fe/56Fe of the interstellar medium that match within a factor of two with the observed estimates. In contrary to the conventional Galactic Chemical Evolution (GCE) model, the present adopted numerical approach provides a natural framework to understand the astrophysical environment related with the origin of the solar system. We deduce the nature of the two stellar clusters; the one that formed and evolved prior to the solar system formation, and the other within which the solar system that was probably formed. The former could have contributed to the short-lived nuclides 129I and 53Mn, whereas, the supernova associated with the most massive star in the latter contributed 26Al and 60Fe to the solar system. The analysis was performed with the revised solar metallicity of 0.014.

  3. Li and B isotopic variations in an Allende CAI: Evidence for the in situ decay of short-lived 10Be and for the possible presence of the short-lived nuclide 7Be in the early solar system

    NASA Astrophysics Data System (ADS)

    Chaussidon, Marc; Robert, François; McKeegan, Kevin D.

    2006-01-01

    The concentrations and isotopic compositions of lithium, beryllium, and boron, analyzed in situ by ion microprobe in 66 spots of a type B1 Ca-Al-rich inclusion (CAI 3529-41) from the Allende meteorite, are reported. Large variations are observed for both the Li and the B isotopic ratios with 7Li/ 6Li ranging from 9.2 ± 0.22 to 12.22 ± 0.43 (a ?250‰ range in ?7Li values) and 10B/ 11B ranging from 0.2468 ± 0.0057 to 0.4189 ± 0.0493 (a 410‰ range in ?11B values). The very low Li concentrations (<1 ppb) observed in several anorthite and fassaite grains require that a correction for the contribution of spallogenic Li produced during irradiation of the Allende meteoroid by galactic cosmic rays (GCR) be made (after this correction 7Li/ 6Li ranges from 9.2 ± 0.22 to 13.44 ± 0.56, i.e., a ?350‰ range in ?7Li values). In 3529-41, the 10B/ 11B ratios are positively correlated with 9Be/ 11B in a manner indicating the in situ decay of short-lived 10Be (half-life = 1.5 Ma) with a 10Be/ 9Be ratio at the time of formation of the CAI of 8.8 ± 0.6 × 10 -4, which is in agreement with previous findings [McKeegan, K.D., Chaussidon, M., Robert, F., 2000. Incorporation of short-lived 10Be in a calcium-aluminum-rich inclusion from the Allende meteorite. Science289, 1334-1337]. The present detailed investigation demonstrates that only minor perturbations of the 10Be- 10B system are present in 3529-41, contrary to the 26Al/ 26Mg system for which numerous examples of isotopic redistribution following crystallization were observed [Podosek, F.A., Zinner, E.K., MacPherson, G.J., Lundberg, L.L., Brannon, J.C., Fahey, A.J., 1991. Correlated study of initial 87Sr/ 86Sr and Al-Mg systematics and petrologic properties in a suite of refractory inclusions from the Allende meteorite. Geochim. Cosmochim. Acta55, 1083-1110]. Petrographically based criteria were developed to identify within the 66 analyzed spots in 3529-41, those where post-magmatic perturbation of the Li and Be distributions occurred. Li and Be concentrations measured in different analytical spots are compared with those predicted by using experimentally determined partition coefficients according to a model of closed-system crystallization of the CAI melt. These criteria show that 56% of the spots in melilite, 38% in anorthite, and 8% in fassaite suffered post-crystallization perturbations of Li and/or Be distributions. In the remaining spots, which do not show obvious indication of redistribution of Li or Be, the 7Li/ 6Li isotopic variations (corrected for GCR exposure) are positively correlated with 9Be/ 6Li suggesting the in situ decay of now-extinct 7Be. The derived isochron implies that at the time of its formation, the CAI melt had a 7Be/ 9Be ratio of 0.0061 ± 0.0013 and a 7Li/ 6Li ratio of 11.49 ± 0.13. In contrast, all the spots in 3529-41, which do show evidence for post-magmatic redistribution of Li and Be, have relatively constant 7Li/ 6Li, averaging 11.72 ± 0.56, which is consistent with mass balance calculations for Li isotopic homogenization in the CAI after the decay of 7Be. The incorporation of live 7Be in 3529-41 requires, because of the very short half-life of this nuclide (53 days), that it be produced essentially contemporaneously with the formation of the CAI. Therefore, the irradiation processes responsible for production of 7Be must have occurred within the solar accretion disk. Calculations developed in the framework of the x-wind model [Gounelle, M., Shu, F.H., Shang, H., Glassgold, A.E., Rehm, E.K., Lee, T., 2004. The origin of short-lived radionuclides and early Solar System irradiation (abstract). Lunar Planet. Sci.35, 1829] reproduce the 7Be and 10Be abundances observed in 3529-41. The correlated presence of 7Be and 10Be in 3529-41 is thus a strong argument that 10Be, which is observed rather ubiquitously in CAIs, is also a product of irradiation in the early solar system, as might be a significant fraction of other short-lived radionuclides observed in early solar system materials.

  4. The formation and breach of a short-lived landslide dam at Hsiaolin village, Taiwan — part I: Post-event reconstruction of dam geometry

    Microsoft Academic Search

    Jia-Jyun Dong; Yun-Shan Li; Chyh-Yu Kuo; Rui-Tang Sung; Ming-Hsu Li; Chyi-Tyi Lee; Chien-Chih Chen; Wang-Ru Lee

    2011-01-01

    In this paper, technologies from multiple disciplines are used to reconstruct the shape of the Hsiaolin landslide dam, a short-lived landslide dam (SLD), that was triggered by Typhoon Morakot. Here, the formation, failure mode and breaching process of this SLD are investigated. The results indicate that the overtopping time and the debris budget constrained the dam geometry. The inferred volume

  5. Measuring (n,f) cross-sections of short-lived Department of Physics and McDonnell Center for the Space Sciences

    E-print Network

    Katz, Jonathan I.

    small fission cross-sections at these energies. I present quantitative calculations of the efficiencyMeasuring (n,f) cross-sections of short-lived states J. I. Katz Department of Physics and McDonnell Center for the Space Sciences Washington University, St. Louis, Mo. 63130 and Lawrence Livermore National

  6. Mood regulation in youth: research findings and clinical approaches to irritability and short-lived episodes of mania like symptoms

    PubMed Central

    Leigh, Eleanor; Smith, Patrick; Milavic, Gordana; Stringaris, Argyris

    2013-01-01

    Purpose of review Mood regulation problems, such as severe chronic irritability or short episodes of mania like symptoms are common, impairing and a topic of intense recent interest to clinicians, researchers and the DSM-5 process. Here we review the most recent findings about these two presentations and discuss approaches to their treatment. Recent findings Longitudinal and genetic findings suggest that chronic irritability should be regarded as a mood problem that is distinct from bipolar disorder. A proportion of children with short (less than 4 days) episodes of mania like symptoms seem to progress to classical (Type I or II) bipolar disorder over time in US clinic samples. In a UK sample, such episodes were independently associated with psychosocial impairment. The evidence base for the treatment of either irritability or short-lived episodes to mania-like symptoms is still small. Clinicians should be cautious with extrapolating treatments from classical bipolar disorder to these mood regulation problems. CBT-based approaches targeting general mood regulation processes may be effective for cases with severe irritability or short episodes of mania like symptoms. Summary There is increasing research evidence for the importance of mood regulation problems in the form of either irritability or short episodes of mania like symptoms in youth. The evidence base for their drug treatment has yet to be developed. CBT-based interventions to modify processes of mood regulation may be a useful and safe intervention for patients with these presentations. PMID:22569307

  7. Injection of Short-Lived Radionuclides into the Early Solar System from a Faint Supernova with Mixing-Fallback

    E-print Network

    A. Takigawa; J. Miki; S. Tachibana; G. R. Huss; N. Tominaga; H. Umeda; K. Nomoto

    2008-08-11

    Several short-lived radionuclides (SLRs) were present in the early solar system, some of which should have formed just prior to or soon after the solar system formation. Stellar nucleosynthesis has been proposed as the mechanism for production of SLRs in the solar system, but no appropriate stellar source has been found to explain the abundances of all solar system SLRs. In this study, we propose a faint supernova with mixing and fallback as a stellar source of SLRs with mean lives of solar system. In such a supernova, the inner region of the exploding star experiences mixing, a small fraction of mixed materials is ejected, and the rest undergoes fallback onto the core. The modeled SLR abundances agree well with their solar system abundances if mixing-fallback occurs within the C/O-burning layer. In some cases, the initial solar system abundances of the SLRs can be reproduced within a factor of 2. The dilution factor of supernova ejecta to the solar system materials is ~10E-4 and the time interval between the supernova explosion and the formation of oldest solid materials in the solar system is ~1 Myr. If the dilution occurred due to spherically symmetric expansion, a faint supernova should have occurred nearby the solar system forming region in a star cluster.

  8. Contribution of very short-lived organic substances to stratospheric chlorine and bromine in the tropics - a case study

    NASA Astrophysics Data System (ADS)

    Laube, J. C.; Engel, A.; Bönisch, H.; Möbius, T.; Worton, D. R.; Sturges, W. T.; Grunow, K.; Schmidt, U.

    2008-05-01

    The total stratospheric organic chlorine and bromine burden was derived from balloon-borne measurements in the tropics (Teresina, Brazil, 5°04´S, 42°52´W) in 2005. Whole air samples were collected cryogenically at altitudes between 15 and 34 km. For the first time, we report measurements of a set of 28 chlorinated and brominated substances in the tropical upper troposphere and stratosphere including ten substances with an atmospheric lifetime of less than half a year. The substances were quantified using pre-concentration techniques followed by Gas Chromatography with Mass Spectrometric detection. In the tropical tropopause layer at an altitude of 15.2 km we found 1.4% of the chlorine and 8% of the bromine to be present in the form of very short-lived compounds. By combining the data with tropospheric reference data and age of air observations the abundances of inorganic chlorine and bromine (Cly and Bry) were derived. At an altitude of 34 km we calculated 3062 ppt of Cly and 17.5 ppt of Bry from organic source gases. Furthermore we present indications for the presence of additional organic brominated substances in the tropical upper troposphere and stratosphere.

  9. Age-specific, density-dependent and environment-based mortality of a short-lived perennial herb.

    PubMed

    Picó, F X; Retana, J

    2008-05-01

    Density-independent and density-dependent processes affect plant mortality. Although less well understood, age-specific mortality can also play an important role in plant mortality. The goal of this study was to analyse several factors accounting for mortality in the Mediterranean short-lived perennial herb Lobularia maritima. We followed three cohorts of plants (from emergence to death) during 4 years in field conditions. We collected data on plant mortality of the effect of biotic agents (moth larvae and mycoplasma-like organisms, MLOs) and environmental variables. We also estimated density-dependent relationships affecting the fate of seedlings and adults. Results show that cohorts differed in their survival curves and ageing significantly increased mortality risk. Seedling mortality was density-dependent whereas adult mortality was not affected by density. MLO infection led to higher plant mortality whereas moth larvae attack did not affect plant mortality. In general, seedlings and adult plants experienced the highest mortality events in summer. We found, however, weak relationships between weather records and plant mortality. Age and size structures were not correlated. Overall, this study provides a comprehensive review of age-specific, density-dependent and density-independent factors that account for mortality of L. maritima plants throughout their life cycle in field conditions, highlighting the fact that age is an important factor in determining plant population dynamics. PMID:18426484

  10. Yields of short-lived fission products produced following {sup 235}U(n{sub th},f)

    SciTech Connect

    Tipnis, S.V.; Campbell, J.M.; Couchell, G.P.; Li, S.; Nguyen, H.V.; Pullen, D.J.; Schier, W.A.; Seabury, E.H. [University of Massachusetts Lowell, Lowell, Massachusetts 01854 (United States)] [University of Massachusetts Lowell, Lowell, Massachusetts 01854 (United States); England, T.R. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)] [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    1998-08-01

    Measurements of gamma-ray spectra, following the thermal neutron fission of {sup 235}U have been made using a high purity germanium detector at the University of Massachusetts Lowell (UML) Van de Graaff facility. The gamma spectra were measured at delay times ranging from 0.2 s to nearly 10thinsp000 s following the rapid transfer of the fission fragments with a helium-jet system. On the basis of the known gamma transitions, forty isotopes have been identified and studied. By measuring the relative intensities of these transitions, the relative yields of the various precursor nuclides have been calculated. The results are compared with the recommended values listed in the ENDF/B-VI fission product data base (for the lifetimes and the relative yields) and those published in the Nuclear Data Sheets (for the beta branching ratios). This information is particularly useful for the cases of short-lived fission products with lifetimes of the order of fractions of a second or a few seconds. Independent yields of many of these isotopes have rather large uncertainties, some of which have been reduced by the present study. {copyright} {ital 1998} {ital The American Physical Society}

  11. Gamma-ray study of short-lived aggregate fission products from {sup 235}U(n,f)

    SciTech Connect

    Schier, W.A.; Campbell, J.M.; Couchell, G.P.; Li, S. [and others

    1993-10-01

    A high purity germanium detector was used to measure gamma-ray spectra following thermal neutron-induced fission of {sup 235}U for eighteen delay time intervals in the range 0.1-100,000 a following fission. A helium-jet system was used to rapidly transport fission products to a low-background counting area. The gamma-ray spectrometer employed beta-gamma coincidence as well as a Nal(Tl) annulus for background suppression. Nearly 300 gamma-ray peaks have been analyzed for delay-time intervals < 10 s after fission in the energy range 0-6 MeV. The time evolution of a peak provides information about the lifetime of the precursor nuclide as well as the ratio of its direct production in fission to its production through radioactive decay. Where decay schemes are known the measured gamma-ray intensities can be used to deduce relative yields and in some cases metastable-to-ground-state production probabilities. Results of lifetimes, yields, etc. of short-lived products will be compared with CINDER 10 calculations based on ENDF/B-IV fission-product data.

  12. Light scattering from an assembly of tracks in a PADC film

    Microsoft Academic Search

    D. Nikezic; K. N. Yu

    2009-01-01

    A computer program was developed to calculate the light scattered from an assembly of alpha particle tracks in a PADC film. The tracks were randomly seeded on the film to simulate the irradiation by alpha particles emitted by the naturally occurring radon gas and its short-lived progeny. The ray-tracing method was applied to simulate light propagation through the tracks. The

  13. Automated system for neutron activation analysis determination of short lived isotopes at The DOW Chemical Company's TRIGA research reactor

    NASA Astrophysics Data System (ADS)

    Zieman, J. J.; Rigot, W. L.; Romick, J. D.; Quinn, T. J.; Kocher, C. W.

    1994-12-01

    An automated neutron activation analysis (NAA) system for the determination of short lived isotopes was constructed at The DOW Chemical Company's TRIGA Research Reactor in 1993. The NAA group of the Analytical Sciences Laboratory uses the reactor for thousands of analyses each year and therefore automation is important to achieve and maintain high throughput and precision (productivity). This project is complementary to automation of the long-lived counting facilities (see Romick et al., these Proceedings). Canberra/Nuclear Data Systems DEC-based software and electronics modules and an I/O mounting board are the basic commercial components. A Fortran program on a VAX computer controls I/O via ethernet to an Acquisition Interface Module (AIM). The AIM controls the ? spectrometer modules and is interfaced to a Remote Parallel Interface (RPI) module which controls the pneumatic transfer apparatus with TTL signals to the I/O mounting board. Near-infrared sensors are used to monitor key points in the transfer system. Spectra are acquired by a single HPGe detector mounted on a sliding rail to allow flexible and more reproducible counting geometries than with manual sample handling. The maximum sample size is 8 ml in a heat-sealed two dram vial. The sample vial is nested into a "rabbit" vial for irradiation which can be automatically removed prior to spectrum collection. The system was designed to be used by the reactor operator at the control console without the aid of an additional experimenter. Applications include the determination of selenium and silver in coal and water, fluorine in tetra-fluoro ethylene (TFE) coated membranes, aluminum and titanium in composite materials and trace fluorine in non-chlorinated cleaning solvents. Variable dead time software allows analysis for 77mSe despite high dead times from 16N encountered in samples.

  14. How sensitive is the recovery of stratospheric ozone to changes in concentrations of very short lived bromocarbons?

    NASA Astrophysics Data System (ADS)

    Yang, X.; Abraham, N. L.; Archibald, A. T.; Braesicke, P.; Keeble, J.; Telford, P.; Warwick, N. J.; Pyle, J. A.

    2014-04-01

    Naturally produced very short-lived substances (VSLS), like bromocarbons, account for almost a quarter of the current stratospheric inorganic bromine, Bry. Following VSLS oxidation, bromine radicals (Br and BrO) can catalytically destroy ozone. The extent to which possible increases in surface emissions or transport of these VSLS bromocarbons to the stratosphere could counteract the effect of halogen reductions under the Montreal Protocol is an important policy question. Here by using a chemistry-climate model, UM-UKCA, we investigate the impact of a hypothetical increase in VSLS on ozone and how that impact depends on the background concentrations of chlorine and bromine. Our model experiments indicate that for a ~5 ppt increase in Bry from VSLS, the local ozone loss in the lowermost stratosphere of the Southern Hemisphere (SH) may reach up to 10% in the annual mean; the ozone loss in the Northern Hemisphere (NH) is smaller (4-6%). There is more ozone loss following an increase in VSLS burden under a high stratospheric chlorine background than under a low chlorine background indicating the importance of the inter-halogen reactions. For example, the rate of decline of the stratospheric ozone concentration as a function of Bry is higher by about 30-40% when stratospheric Cly is ~3 ppb (present day) compared with Cly of ~0.8 ppb (apre-industrial or projected future situation). Although bromine plays an important role in destroying ozone, inorganic chlorine is the dominant halogen compound. Even if bromine levels from natural VSLS were to increase significantly later this century, changes in the concentration of ozone will be dominated by the recovery of anthropogenic chlorine. Our calculation suggests that for a 5 ppt increase in Bry from VSLS, the Antarctic ozone hole recover date could be delayed by approximately 7 years.

  15. How sensitive is the recovery of stratospheric ozone to changes in concentrations of very short-lived bromocarbons?

    NASA Astrophysics Data System (ADS)

    Yang, X.; Abraham, N. L.; Archibald, A. T.; Braesicke, P.; Keeble, J.; Telford, P. J.; Warwick, N. J.; Pyle, J. A.

    2014-10-01

    Naturally produced very short-lived substances (VSLS) account for almost a quarter of the current stratospheric inorganic bromine, Bry. Following VSLS oxidation, bromine radicals (Br and BrO) can catalytically destroy ozone. The extent to which possible increases in surface emissions or transport of these VSLS bromocarbons to the stratosphere could counteract the effect of halogen reductions under the Montreal Protocol is an important policy question. Here, by using a chemistry-climate model, UM-UKCA, we investigate the impact of a hypothetical doubling (an increase of 5 ppt Bry) of VSLS bromocarbons on ozone and how the resulting ozone changes depend on the background concentrations of chlorine and bromine. Our model experiments indicate that for the 5 ppt increase in Bry from VSLS, the ozone decrease in the lowermost stratosphere of the Southern Hemisphere (SH) may reach up to 10% in the annual mean; the ozone decrease in the Northern Hemisphere (NH) is smaller (4-6%). The largest impact on the ozone column is found in the Antarctic spring. There is a significantly larger ozone decrease following the doubling of the VSLS burden under a high stratospheric chlorine background than under a low chlorine background, indicating the importance of the inter-halogen reactions. For example, the decline in the high-latitude, lower-stratospheric ozone concentration as a function of Bry is higher by about 30-40% when stratospheric Cly is ~ 3 ppb (present day), compared with Cly of ~ 0.8 ppb (a pre-industrial or projected future situation). Bromine will play an important role in the future ozone layer. However, even if bromine levels from natural VSLS were to increase significantly later this century, changes in the concentration of ozone will likely be dominated by the decrease in anthropogenic chlorine. Our calculation suggests that for a 5 ppt increase in Bry from VSLS, the Antarctic ozone hole recovery date could be delayed by approximately 6-8 years, depending on Cly levels.

  16. Evolution of the Solar Nebula. VIII. Spatial and Temporal Heterogeneity of Short-Lived Radioisotopes and Stable Oxygen Isotopes

    E-print Network

    Alan P. Boss

    2007-02-02

    Isotopic abundances of short-lived radionuclides such as 26Al provide the most precise chronometers of events in the early solar system, provided that they were initially homogeneously distributed. On the other hand, the abundances of the three stable isotopes of oxygen in primitive meteorites show a mass-independent fractionation that survived homogenization in the solar nebula. As as result of this and other cosmochemical evidence, the degree of spatial heterogeneity of isotopes in the solar nebula has long been a puzzle. We show here that based on hydrodynamical models of the mixing and transport of isotopic anomalies formed at, or injected onto, the surface of the solar nebula, initially high levels of isotopic spatial heterogeneity are expected to fall to steady state levels (~10%) low enough to validate the use of 26Al for chronometry, but high enough to preserve the evidence for mass-independent fractionation of oxygen isotopes. The solution to this puzzle relies on the mixing being accomplished by the chaotic fluid motions in a marginally gravitationally unstable disk, as seems to be required for the formation of gas giant planets and by the inability of alternative physical processes to drive large-scale mixing and transport in the planet-forming midplane of the solar nebula. Such a disk is also capable of large-scale outward transport of the thermally annealed dust grains found in comets, and of driving the shock fronts that appear to be responsible for much of the thermal processing of the components of primitive meteorites, creating a self-consistent picture of the basic physical processes shaping the early solar nebula.

  17. Short-lived halocarbons efficient at influencing climate through ozone loss in the upper troposphere-lower stratosphere

    NASA Astrophysics Data System (ADS)

    Hossaini, Ryan; Chipperfield, Martyn; Montzka, Steven; Rap, Alex; Dhomse, Sandip; Feng, Wuhu

    2015-04-01

    Halogenated very short-lived substances (VSLS) of both natural and anthropogenic origin are a significant source of atmospheric bromine, chlorine and iodine. Due to relatively short atmospheric lifetimes (typically <6 months), VSLS breakdown in the upper troposphere-lower stratosphere (UTLS), where ozone perturbations drive a disproportionately large climate impact compared to other altitudes. Here we present chemical transport model simulations that quantify VSLS-driven ozone loss in the UTLS and infer the climate relevance of these ozone perturbations using a radiative transfer model. Our results indicate that through their impact on UTLS ozone, VSLS are efficient at influencing climate. We calculate a whole atmosphere global mean radiative effect (RE) of -0.20 (-0.16 to -0.23) Wm-2 from natural and anthropogenic VSLS-driven ozone loss, including a tropospheric contribution of -0.12 Wm-2. In the stratosphere, the RE due to ozone loss from natural bromine-containing VSLS (e.g. CHBr3, CH2Br2) is almost half of that from long-lived anthropogenic compounds (e.g. CFCs) and normalized by equivalent chlorine is ~4 times larger. We show that the anthropogenic chlorine-containing VSLS, not regulated by the Montreal Protocol, also contribute to ozone loss in the UTLS and that the atmospheric concentration of dichloromethane (CH2Cl2), the most abundant of these, is increasing rapidly. Finally, we present evidence that VSLS have made a small yet previously unrecognized contribution to the ozone-driven radiative forcing of climate since pre-industrial times of -0.02 (-0.01 to -0.03) Wm-2. Given the climate leverage that VSLS possess, future increases to their emissions, either through continued industrial or altered natural processes, may be important for future climate forcing.

  18. Cooling of highly-charged, short-lived ions for precision mass spectrometry at TRIUMF's Ion Trap for Atomic and Nuclear Science

    NASA Astrophysics Data System (ADS)

    Schultz, B. E.; Chowdhury, U.; Simon, V. V.; Andreoiu, C.; Chaudhuri, A.; Gallant, A. T.; Kwiatkowski, A. A.; Macdonald, T. D.; Simon, M. C.; Dilling, J.; Gwinner, G.

    2013-09-01

    At TRIUMF's Ion Trap for Atomic and Nuclear Science (TITAN), masses of short-lived nuclides are measured accurately and precisely using Penning trap mass spectrometry. The achievable precision is primarily limited by the radioactive lifetime of the nuclides. To boost the precision TITAN has demonstrated that short-lived isotopes can be charge-bred to higher charge states within 10-100 s of ms using an electron beam ion trap. The charge breeding process increases the energy spread of the ions, which in turn affects the precision and the efficiency. A novel cooler Penning trap (CPET) has been developed to trap and cool highly-charged ions using electrons prior to the precision measurement. A discussion of electron cooling and the current status of CPET will be given.

  19. Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes

    NASA Astrophysics Data System (ADS)

    Lupi, M.; Miller, S. A.

    2014-01-01

    Eruptive rates in volcanic arcs increase significantly after subduction mega-thrust earthquakes. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose that increased eruption rates over longer timescales are due to the relaxation of the compressional regime that accompanies mega-thrust subduction zone earthquakes. More specifically, the reduction of the horizontal stress ?h promotes the occurrence of short-lived strike-slip kinematics rather than reverse faulting in the volcanic arc. The relaxation of the pre-earthquake compressional regime facilitates magma mobilisation by providing a short-circuit pathway to shallow depths by significantly increasing the hydraulic properties of the system. The timescale for the onset of strike-slip faulting depends on the degree of shear stress accumulated in the arc during inter-seismic periods, which in turn is connected to the degree of strain-partitioning at convergent margins. We performed Coulomb stress transfer analysis to determine the order of magnitude of the stress perturbations in present-day volcanic arcs in response to five recent mega-thrust earthquakes; the 2005 M8.6, 2007 M8.5, and 2007 M7.9 Sumatra earthquakes; the 2010 M8.8 Maule, Chile earthquake; and the 2011 M9.0 Tohoku, Japan earthquake. We find that all but one the shallow earthquakes that occurred in the arcs of Sumatra, Chile and Japan show a marked lateral component. We suggests that the long-term response of volcanic arcs to subduction zone mega-thrust earthquakes will be manifested as predominantly strike-slip seismic events, and that these future earthquakes may be followed closely by indications of rising magma to shallower depths, e.g. surface inflation and seismic swarms.

  20. Precision Test of Many-Body QED in the Be$^+$ $2p$ Fine Structure Doublet Using Short-Lived Isotopes

    E-print Network

    Nörtershäuser, Wilfried; Krieger, Andreas; Pachucki, Krzysztof; Puchalski, Mariusz; Blaum, Klaus; Bissell, Mark L; Frömmgen, Nadja; Hammen, Michael; Kowalska, Magdalena; Krämer, Jörg; Kreim, Kim; Neugart, Rainer; Neyens, Gerda; Sánchez, Rodolfo; Yordanov, Deyan T

    2015-01-01

    Absolute transition frequencies of the $2s\\; ^2{\\rm S}_{1/2} \\rightarrow 2p\\;^2\\mathrm{P}_{1/2,3/2}$ transitions in Be$^+$ were measured for the isotopes $^{7,9-12}$Be. The fine structure splitting of the $2p$ state and its isotope dependence are extracted and compared to results of \\textit{ab initio} calculations using explicitly correlated basis functions, including relativistic and quantum electrodynamics effects at the order of $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$. Accuracy has been improved in both the theory and experiment by 2 orders of magnitude, and good agreement is observed. This represents one of the most accurate tests of quantum electrodynamics for many-electron systems, being insensitive to nuclear uncertainties.

  1. The Fall of the St. Robert Meteorite: Interpretation of Eyewitness Accounts, Satellite Data, Short-Lived Isotope Activity, and Infrasound

    NASA Astrophysics Data System (ADS)

    Brown, P.; Hildebrand, A.; Green, D.; Page, D.; Jacobs, C.; Revelle, D.; Tagliaferri, E.; Wacker, J.

    1995-09-01

    The St. Robert meteoroid (a monomict H5 breccia) entered the Earth's atmosphere at 00:02 UT on June 15, 1994 approximately one hour before local sunset. The resulting daylight fireball was widely observed from the provinces of Ontario and Quebec and the states of New York, Vermont and New Hampshire. The fireball was first observed over New York state at an altitude of ~60 km traveling in a N-NE direction to its point of terminal burst ~60 km northeast of Montreal. At least one observer noted electrophonic sounds heard simultaneously with the passage of the fireball. Several episodes of fragmentation occurred at the end point near an altitude of ~33 km with observers reporting several clumps of dust along the trajectory. Eyewitnesses to the explosion described multi-directional debris dispersal. A prominent dust trail persisted for ~10 minutes after the passage of the fireball. The terminal burst produced loud detonations audible for more than 200 km and of sufficient strength to shake buildings throughout metropolitan Montreal. Twenty fragments of this meteorite have been recovered in a fall ellipse of 7.5 X 4 km located near the farming community of St. Robert. Total recovered mass to date is ~25.4 kg, but the shower of meteorites was sufficiently dense, in at least the uprange part of the ellipse, so that one fragment partially penetrated the roof of a farmer's shed, and two fragments were found on roads. The most productive UTM grid square of 1 km sides yielded 6 meteorites. From the searched fraction of this square km, and a search efficiency of ~0.5 due to ground conditions and subsequent ground disturbance by farming, we estimate that ~25 meteorites fell in this grid square. This concentration implies that as many as 100 fragments greater than 55 g (the smallest recovered) may have fallen. Eighteen of the recovered fragments were completely covered by dark fusion crusts with surfaces showing varying degrees of ablation in accord with the multiple fragmentation episodes observed. Most fragments were found in shallow pits up to ~50 cm deep in the soft clay and sand soils of the region. Dedicated searches by interested local residents and members of the Meteorites and Impacts Advisory Committee to the Canadian Space Agency (and friends) recovered half of the known fragments. Interpretation of the eyewitness data suggest that the fireball traveled from SSW to NNE with a moderate slope from the horizontal of 15-35 degrees. An evaluation of the probable orbits for the meteoroid suggests an entry velocity in the range 12 -15 km/s. The object moved in a low- inclination orbit with perihelion very near the Earth's orbit. The total mass estimated to have reached the ground is 50-100 kg while the pre-atmospheric mass derived from visual observations is found to be of order 1,000 kg. The fireball of the St. Robert meteorite shower was also observed from above by sensors located on satellites of the Department of Defense. In the visual the fireball reached a peak magnitude of -18 during its terminal flare and the observations suggest a lengthy period of fragmentation lasting perhaps as long as one second near the endpoint. Data reduction is proceeding on infrared observations of the fireball, and initial mass estimates will be derived for the pre-atmospheric meteoroid from infrasound considerations, short lived isotope measurements for 8 of the 20 fragments, and dynamical information from eyewitness data in addition to satellite measurements. The St. Robert meteorite shower affords the first opportunity to combine satellite and eyewitness observations of the hypervelocity entry of a natural object into the Earth's atmosphere together with "ground truth" from the surviving remnants of the object's atmospheric passage.

  2. Measurement of the Internal Magnetic Field of Plasmas using an Alpha Particle Source

    SciTech Connect

    S.J. Zweben; D.S. Darrow; P.W. Ross; J.L. Lowrance; G. Renda

    2004-05-13

    The internal magnetic fields of plasmas can be measured under certain conditions from the integrated v x B deflection of MeV alpha particles emitted by a small radioactive source. This alpha source and large-area alpha particle detector would be located inside the vacuum vessel but outside the plasma. Alphas with a typical energy of 5.5 MeV (241Am) can reach the center of almost all laboratory plasmas and magnetic fusion devices, so this method can potentially determine the q(r) profile of tokamaks or STs. Orbit calculations, background evaluations, and conceptual designs for such a vxB (or ''AVB'') detector are described.

  3. Climate response to projected changes in short-lived species under an A1B scenario from 2000-2050 in the GISS climate model

    SciTech Connect

    Menon, Surabi; Shindell, Drew T.; Faluvegi, Greg; Bauer, Susanne E.; Koch, Dorothy M.; Unger, Nadine; Menon, Surabi; Miller, Ron L.; Schmidt, Gavin A.; Streets, David G.

    2007-03-26

    We investigate the climate forcing from and response to projected changes in short-lived species and methane under the A1B scenario from 2000-2050 in the GISS climate model. We present a meta-analysis of new simulations of the full evolution of gas and aerosol species and other existing experiments with variations of the same model. The comparison highlights the importance of several physical processes in determining radiative forcing, especially the effect of climate change on stratosphere-troposphere exchange, heterogeneous sulfate-nitrate-dust chemistry, and changes in methane oxidation and natural emissions. However, the impact of these fairly uncertain physical effects is substantially less than the difference between alternative emission scenarios for all short-lived species. The net global mean annual average direct radiative forcing from the short-lived species is .02 W/m{sup 2} or less in our projections, as substantial positive ozone forcing is largely offset by negative aerosol direct forcing. Since aerosol reductions also lead to a reduced indirect effect, the global mean surface temperature warms by {approx}0.07 C by 2030 and {approx}0.13 C by 2050, adding 19% and 17%, respectively, to the warming induced by long-lived greenhouse gases. Regional direct forcings are large, up to 3.8 W/m{sup 2}. The ensemble-mean climate response shows little regional correlation with the spatial pattern of the forcing, however, suggesting that oceanic and atmospheric mixing generally overwhelms the effect of even large localized forcings. Exceptions are the polar regions, where ozone and aerosols may induce substantial seasonal climate changes.

  4. 182Hf–182W age dating of a 26Al-poor inclusion and implications for the origin of short-lived radioisotopes in the early Solar System

    PubMed Central

    Holst, Jesper C.; Olsen, Mia B.; Paton, Chad; Nagashima, Kazuhide; Schiller, Martin; Wielandt, Daniel; Larsen, Kirsten K.; Connelly, James N.; Jørgensen, Jes K.; Krot, Alexander N.; Nordlund, Åke; Bizzarro, Martin

    2013-01-01

    Refractory inclusions [calcium–aluminum-rich inclusions, (CAIs)] represent the oldest Solar System solids and provide information regarding the formation of the Sun and its protoplanetary disk. CAIs contain evidence of now extinct short-lived radioisotopes (e.g., 26Al, 41Ca, and 182Hf) synthesized in one or multiple stars and added to the protosolar molecular cloud before or during its collapse. Understanding how and when short-lived radioisotopes were added to the Solar System is necessary to assess their validity as chronometers and constrain the birthplace of the Sun. Whereas most CAIs formed with the canonical abundance of 26Al corresponding to 26Al/27Al of ?5 × 10?5, rare CAIs with fractionation and unidentified nuclear isotope effects (FUN CAIs) record nucleosynthetic isotopic heterogeneity and 26Al/27Al of <5 × 10?6, possibly reflecting their formation before canonical CAIs. Thus, FUN CAIs may provide a unique window into the earliest Solar System, including the origin of short-lived radioisotopes. However, their chronology is unknown. Using the 182Hf–182W chronometer, we show that a FUN CAI recording a condensation origin from a solar gas formed coevally with canonical CAIs, but with 26Al/27Al of ?3 × 10?6. The decoupling between 182Hf and 26Al requires distinct stellar origins: steady-state galactic stellar nucleosynthesis for 182Hf and late-stage contamination of the protosolar molecular cloud by a massive star(s) for 26Al. Admixing of stellar-derived 26Al to the protoplanetary disk occurred during the epoch of CAI formation and, therefore, the 26Al–26Mg systematics of CAIs cannot be used to define their formation interval. In contrast, our results support 182Hf homogeneity and chronological significance of the 182Hf–182W clock. PMID:23671077

  5. Sister chromatid exchange induced by short-lived monoadducts produced by the bifunctional agents mitomycin C and 8-methoxypsoralen. [CHO cells

    SciTech Connect

    Linnainmaa, K.; Wolff, S.

    1982-01-01

    To see if DNA crosslinks are involved in the induction of sister chromated exchange (SCE), Chinese hamster ovary cells were exposed to two bifunctional alkylating agents,mitomycin C and 8-methoxypsoralen, and their monofunctional derivatives, decarbamoyl mitomycin C and angelicin. The data indicates that monoadducts, rather than crosslinks, are responsible for SCE formation. Furthermore, all agents but angelicin produced short-lived lesions that led to SCEs in the first period of DNA replication after treatment (twin SCEs). In contrast, angelicin, like methyl methanesulfonate and N-acetoxyacetylaminofluorene, produced lesions that lasted more than one cycle, indicating that several different types of DNA lesions are capable of SCE induction.

  6. Development of resonance ionization in a supersonic gas-jet for studies of short-lived and long-lived radioactive nuclei

    NASA Astrophysics Data System (ADS)

    Takatsuka, Takaaki; Tomita, Hideki; Sonnenschein, Volker; Sonoda, Tetsu; Adachi, Yoshitaka; Sakamoto, Chika; Mita, Hiroki; Noto, Takuma; Ito, Chikara; Maeda, Shigetaka; Iguchi, Tetsuo; Wada, Michiharu; Wendt, Klaus; Moore, Iain

    2013-12-01

    High-resolution resonance ionization spectroscopy (RIS) is required for laser spectroscopy and trace analysis of short-lived and long-lived radioactive nuclei. We have proposed high-resolution resonance ionization spectroscopy in a gas jet combined with a narrow band-width injection-locked Ti:Sapphire laser. Resonance ionization of stable 93Nb in a gas jet was demonstrated using a broad bandwidth Ti:Sapphire laser. In addition, a setup for high-resolution RIS in a gas-jet was designed using numerical simulations of the gas-jet conditions based on computational fluid dynamics.

  7. Galactic Plane H$\\alpha$ Surveys: IPHAS & VPHAS+

    E-print Network

    Wright, Nicholas J

    2015-01-01

    The optical Galactic Plane H$\\alpha$ surveys IPHAS and VPHAS+ are dramatically improving our understanding of Galactic stellar populations and stellar evolution by providing large samples of stars in short lived, but important, evolutionary phases, and high quality homogeneous photometry and images over the entire Galactic Plane. Here I summarise some of the contributions these surveys have already made to our understanding of a number of key areas of stellar and Galactic astronomy.

  8. Triggering collapse of the presolar dense cloud core and injecting short-lived radioisotopes with a shock wave. III. Rotating three-dimensional cloud cores

    SciTech Connect

    Boss, Alan P.; Keiser, Sandra A., E-mail: boss@dtm.ciw.edu [Department of Terrestrial Magnetism, Carnegie Institution for Science, 5241 Broad Branch Road, NW, Washington, DC 20015-1305 (United States)

    2014-06-10

    A key test of the supernova triggering and injection hypothesis for the origin of the solar system's short-lived radioisotopes is to reproduce the inferred initial abundances of these isotopes. We present here the most detailed models to date of the shock wave triggering and injection process, where shock waves with varied properties strike fully three-dimensional, rotating, dense cloud cores. The models are calculated with the FLASH adaptive mesh hydrodynamics code. Three different outcomes can result: triggered collapse leading to fragmentation into a multiple protostar system; triggered collapse leading to a single protostar embedded in a protostellar disk; or failure to undergo dynamic collapse. Shock wave material is injected into the collapsing clouds through Rayleigh-Taylor fingers, resulting in initially inhomogeneous distributions in the protostars and protostellar disks. Cloud rotation about an axis aligned with the shock propagation direction does not increase the injection efficiency appreciably, as the shock parameters were chosen to be optimal for injection even in the absence of rotation. For a shock wave from a core-collapse supernova, the dilution factors for supernova material are in the range of ?10{sup –4} to ?3 × 10{sup –4}, in agreement with recent laboratory estimates of the required amount of dilution for {sup 60}Fe and {sup 26}Al. We conclude that a type II supernova remains as a promising candidate for synthesizing the solar system's short-lived radioisotopes shortly before their injection into the presolar cloud core by the supernova's remnant shock wave.

  9. Short-lived species detection of nitrous acid by external-cavity quantum cascade laser based quartz-enhanced photoacoustic absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Yi, Hongming; Maamary, Rabih; Gao, Xiaoming; Sigrist, Markus W.; Fertein, Eric; Chen, Weidong

    2015-03-01

    Spectroscopic detection of short-lived gaseous nitrous acid (HONO) at 1254.85 cm-1 was realized by off-beam coupled quartz-enhanced photoacoustic spectroscopy (QEPAS) in conjunction with an external cavity quantum cascade lasers (EC-QCL). High sensitivity monitoring of HONO was performed within a very small gas-sample volume (of ˜40 mm3) allowing a significant reduction (of about 4 orders of magnitude) of air sampling residence time which is highly desired for accurate quantification of chemically reactive short-lived species. Calibration of the developed QEPAS-based HONO sensor was carried out by means of lab-generated HONO samples whose concentrations were determined by direct absorption spectroscopy involving a ˜109.5 m multipass cell and a distributed feedback QCL. A minimum detection limit (MDL) of 66 ppbv (1 ?) HONO was achieved at 70 mbar using a laser output power of 50 mW and 1 s integration time, which corresponded to a normalized noise equivalent absorption coefficient of 3.6 × 10-8 cm-1 W/Hz1/2. This MDL was down to 7 ppbv at the optimal integration time of 150 s. The corresponding 1? minimum detected absorption coefficient is ˜1.1 × 10-7 cm-1 (MDL ˜ 3 ppbv) in 1 s and ˜1.1 × 10-8 cm-1 (MDL ˜ 330 pptv) in 150 s, respectively, with 1 W laser power.

  10. Time-dependent isospin composition of particles emitted in fission events following Ar40+Au197 at 35 MeV/u

    NASA Astrophysics Data System (ADS)

    Wang, R. S.; Zhang, Y.; Xiao, Z. G.; Tian, J. L.; Zhang, Y. X.; Wu, Q. H.; Duan, L. M.; Jin, G. M.; Hu, R. J.; Wang, S. F.; Li, Z. Y.; Wang, H. W.; Zhang, Z.; Yi, H.; Li, H. J.; Cheng, W. J.; Huang, Y.; Lü, L. M.

    2014-06-01

    Fission fragments resulting from the fission of target-like nuclei produced in the Ar40+Au197 reaction at 35 MeV/u are measured in coincidence with the emitted light charged particles (LCPs). Comparison of the N /Z composition of the LCPs at middle and large angles in the laboratory frame shows that particles emitted at smaller angles, which contain a larger contribution from dynamical emission, are more neutron rich. A moving-source model is used to fit the energy spectra of the hydrogen isotopes. A hierarchy from proton to deuteron and triton is observed in the multiplicity ratio between the intermediate velocity source and the compound nucleus source. This ratio is sensitive to the dynamical emission at early stages of the reaction and to statistical emission lasting up to the scission point. Calculations with the improved quantum molecular dynamics (ImQMD) transport-model qualitatively support the picture that more free and bound neutrons are emitted during the early stage, showing a clear dependence of N /Z on the parametrization of the symmetry energy. The time-dependent isospin composition of the emitted particles thus may be used to probe the symmetry energy at subsaturation densities.

  11. The Birth of the Solar System in a Molecular Cloud: Evidence from the Isotopic Pattern of Short-lived Nuclides in the Early Solar System

    NASA Astrophysics Data System (ADS)

    Jacobsen, S. B.

    2005-12-01

    A good positive correlation between the initial solar abundances of short-lived (now extinct) nuclides (when normalized to their nucleosynthetic production ratios) and their mean lifetimes on a logarithmic plot has been well known for some time. Here I show that: (i) the slope for short-lived nuclides in the average interstellar medium in such a diagram is always 1. (ii) for molecular clouds, the slope is expected to be 2 or slightly less than 2 for a model where the molecular clouds are at a steady state and slowly exchange matter with the remaining interstellar medium. The existing data suggest a residence time of ˜ 6 x107 yrs for the matter present in molecular clouds. (iii) the intercept depends on (1) the residence time of matter in molecular clouds, (2) the mass fraction of the interstellar medium that is in molecular clouds, (3) the age of the galaxy and (4) the ratio of the time-average nucleosynthtic production rate and the production rate at the time of solar system formation. (iv) the abundances of 53Mn, 182Hf, 244Pu and 146Sm in the early solar system are likely formed by the same type of supernova sources (SNII?) over the history of our galaxy, while 129I (and possibly 107Pd) were produced in a different type of supernova sources (SNIa?) with the production rate skewed toward the early history of our galaxy. The abundances of these nuclides most likely characterize the average ISM values modified during their residence in the molecular cloud complex where the solar system formed. The abundances of 26Al, 41 Ca and 60Fe are too high to be of galactic production; these must be a contamination from young stellar sources that formed within the proto-Solar molecular cloud. These young sources could not have contributed significant quantities of 53Mn, 182Hf, 244Pu and 146Sm or 129I and thus were dissimilar to typical supernova sources.

  12. Modifications in Dynamic Contrast-Enhanced Magnetic Resonance Imaging Parameters After ?-Particle-Emitting {sup 227}Th-trastuzumab Therapy of HER2-Expressing Ovarian Cancer Xenografts

    SciTech Connect

    Heyerdahl, Helen, E-mail: Helen.Heyerdahl@rr-research.no [Department of Radiation Biology, Institute for Cancer Research, Oslo University Hospital - The Norwegian Radium Hospital, Oslo (Norway); Røe, Kathrine [Department of Oncology, Division of Medicine, Akershus University Hospital, Lørenskog (Norway); Brevik, Ellen Mengshoel [Department of Research and Development, Algeta ASA, Oslo (Norway); Dahle, Jostein [Nordic Nanovector AS, Oslo (Norway)

    2013-09-01

    Purpose: The purpose of this study was to investigate the effect of ?-particle-emitting {sup 227}Th-trastuzumab radioimmunotherapy on tumor vasculature to increase the knowledge about the mechanisms of action of {sup 227}Th-trastuzumab. Methods and Materials: Human HER2-expressing SKOV-3 ovarian cancer xenografts were grown bilaterally in athymic nude mice. Mice with tumor volumes 253 ± 36 mm{sup 3} (mean ± SEM) were treated with a single injection of either {sup 227}Th-trastuzumab at a dose of 1000 kBq/kg body weight (treated group, n=14 tumors) or 0.9% NaCl (control group, n=10 tumors). Dynamic T1-weighted contrast-enhanced magnetic resonance imaging (DCEMRI) was used to study the effect of {sup 227}Th-trastuzumab on tumor vasculature. DCEMRI was performed before treatment and 1, 2, and 3 weeks after therapy. Tumor contrast-enhancement curves were extracted voxel by voxel and fitted to the Brix pharmacokinetic model. Pharmacokinetic parameters for the tumors that underwent radioimmunotherapy were compared with the corresponding parameters of control tumors. Results: Significant increases of k{sub ep}, the rate constant of diffusion from the extravascular extracellular space to the plasma (P<.05), and k{sub el,} the rate of clearance of contrast agent from the plasma (P<.01), were seen in the radioimmunotherapy group 2 and 3 weeks after injection, compared with the control group. The product of k{sub ep} and the amplitude parameter A, associated with increased vessel permeability and perfusion, was also significantly increased in the radioimmunotherapy group 2 and 3 weeks after injection (P<.01). Conclusions: Pharmacokinetic modeling of MRI contrast-enhancement curves evidenced significant alterations in parameters associated with increased tumor vessel permeability and tumor perfusion after {sup 227}Th-trastuzumab treatment of HER2-expressing ovarian cancer xenografts.

  13. The very short-lived ozone depleting substance CHBr3 (bromoform): Revised UV absorption spectrum, atmospheric lifetime and ozone depletion potential

    NASA Astrophysics Data System (ADS)

    Papanastasiou, Dimitrios K.; McKeen, Stuart A.; Burkholder, James B.

    2014-05-01

    CHBr3 (bromoform) is a short-lived atmospheric trace gas primarily of natural origin that represents a source of reactive bromine (Bry; Br + BrO) in the troposphere as well as the stratosphere. The transport of short-lived brominated species, and their brominated degradation products, to the stratosphere is known to be particularly impactful to stratospheric ozone due to the high efficiency of ozone destruction cycles involving bromine. Evaluating the impact of CHBr3 on stratospheric ozone requires not only a thorough understanding of its emissions, but also its atmospheric loss processes, which are primarily UV photolysis and reaction with the OH radical. The total global lifetime of CHBr3 is ~24 days and is mostly governed by its photolytic loss. Therefore, accurate CHBr3 UV absorption cross section data for wavelengths (?) in the actinic region, greater than 290 nm, are needed to calculate its photolysis loss rate. Currently, there is a single study (Moortgat et al., Springer-Verlag Berlin Heidelberg, 1993; Vol. 17) that reports CHBr3 UV absorption cross sections and their temperature dependence in a wavelength and temperature range applicable for atmospheric photolysis rate calculations. However, there are indications that the reported longer wavelength cross section data, in the Moortgrat et al. study, might be subject to systematic errors which possibly lead to erroneous CHBr3 atmospheric photolysis rate calculations and a misleading picture of its impact on stratospheric ozone. In this study, UV absorption cross sections, ?(?,T), for CHBr3 were measured at wavelengths between 300 and 345 nm at temperatures between 260 and 330 K using cavity ring-down spectroscopy. A thorough investigation of possible sources of systematic error in the measurements is presented. The present UV absorption cross sections at longer wavelength (>310 nm) are systematically lower compared to currently recommended values for use in atmospheric models, with the deviation being more pronounced as wavelength increases and temperature decreases. The source of this discrepancy is further discussed. A parameterization of the CHBr3 UV spectrum for use in atmospheric models is developed and illustrative photolysis rate calculations are presented to highlight the impact of the revised ?(?,T) values on its calculated local lifetimes. For instance, CHBr3 atmospheric photolysis rate in the tropical region obtained with the present spectral data was found to be 10-15% lower (longer lifetime) than that obtained using the currently recommended values. Moreover, seasonally dependent ozone depletion potentials (ODPs) for CHBr3 emitted in the Indian sub-continent were calculated using the semi-empirical relationship of Brioude et al. (Brioude et al., Geophys. Res. Lett., 37, L19804, doi: 10.1029/2010GL044856, 2010) to evaluate the impact of the present results on stratospheric ozone. In conclusion, the present study reports improved UV absorption cross section data for the short-lived ozone depleting substance CHBr3, which are a result of high quality measurements and a thorough investigation of possible sources of systematic error. The CHBr3 UV cross section data, from this study, combined with OH kinetic data enables more accurate model predictions of stratospheric bromine loading and its impact on stratospheric ozone.

  14. Short Lived Climate Pollutants cause a Long Lived Effect on Sea-level Rise: Analyzing climate metrics for sea-level rise

    NASA Astrophysics Data System (ADS)

    Sterner, E.; Johansson, D. J.

    2013-12-01

    Climate change depends on the increase of several different atmospheric pollutants. While long term global warming will be determined mainly by carbon dioxide, warming in the next few decades will depend to a large extent on short lived climate pollutants (SLCP). Reducing emissions of SLCPs could contribute to lower the global mean surface temperature by 0.5 °C already by 2050 (Shindell et al. 2012). Furthermore, the warming effect of one of the most potent SLCPs, black carbon (BC), may have been underestimated in the past. Bond et al. (2013) presents a new best estimate of the total BC radiative forcing (RF) of 1.1 W/m2 (90 % uncertainty bounds of 0.17 to 2.1 W/m2) since the beginning of the industrial era. BC is however never emitted alone and cooling aerosols from the same sources offset a majority of this RF. In the wake of calls for mitigation of SLCPs it is important to study other aspects of the climate effect of SLCPs. One key impact of climate change is sea-level rise (SLR). In a recent study, the effect of SLCP mitigation scenarios on SLR is examined. Hu et al (2013) find a substantial effect on SLR from mitigating SLCPs sharply, reducing SLR by 22-42% by 2100. We choose a different approach focusing on emission pulses and analyse a metric based on sea level rise so as to further enlighten the SLR consequences of SLCPs. We want in particular to understand the time dynamics of SLR impacts caused by SLCPs compared to other greenhouse gases. The most commonly used physical based metrics are GWP and GTP. We propose and evaluate an additional metric: The global sea-level rise potential (GSP). The GSP is defined as the sea level rise after a time horizon caused by an emissions pulse of a forcer to the sea level rise after a time horizon caused by an emissions pulse of a CO2. GSP is evaluated and compared to GWP and GTP using a set of climate forcers chosen to cover the whole scale of atmospheric perturbation life times (BC, CH4, N2O, CO2 and SF6). The study utilizes an upwelling diffusion energy balance model and focuses on the thermosteric part of sea-level rise. Example GSP results are 244, 15 and 278 for BC, CH4 and N2O for a time horizon of 100 years. Compare GWP and GTP values of 405, 24 and 288 as well as 62, 4.5 and 252. The main result of the study is that no climate forcer is in any absolute sense short lived when it comes to Sea Level impacts. All of the examined climate forcers have considerable influence on the thermosteric SLR, and the closely linked ocean heat content, on the time scale of centuries. The reason for this is that heat, once it has been induced by the climate drivers and warmed the surface ocean, is transported down into the slowly mixing oceans. References: Shindell, D. et al. Simultaneously mitigating near-term climate change and improving human health and food security. Science 335, 183-189 (2012). Bond, T. C. et al. Bounding the role of black carbon in the climate system: A scientific assessment. Journal of Geophysical Research: Atmospheres 118 5380-5552 (2013). Hu, A., Xu, Y., Tebaldi, C., Washington, W. M. & Ramanathan, V. Mitigation of short-lived climate pollutants slows sea-level rise. Nature Climate Change 3, 730-734 (2013).

  15. Clinical Experience with ?-Particle–Emitting 211At: Treatment of Recurrent Brain Tumor Patients with 211At-Labeled Chimeric Antitenascin Monoclonal Antibody 81C6

    PubMed Central

    Zalutsky, Michael R.; Reardon, David A.; Akabani, Gamal; Coleman, R. Edward; Friedman, Allan H.; Friedman, Henry S.; McLendon, Roger E.; Wong, Terence Z.; Bigner, Darell D.

    2010-01-01

    ?-Particle–emitting radionuclides, such as 211At, with a 7.2-h half-life, may be optimally suited for the molecularly targeted radiotherapy of strategically sensitive tumor sites, such as those in the central nervous system. Because of the much shorter range and more potent cytotoxicity of ?-particles than of ?-particles, 211At-labeled agents may be ideal for the eradication of tumor cells remaining after surgical debulking of malignant brain tumors. The main goal of this study was to investigate the feasibility and safety of this approach in patients with recurrent malignant brain tumors. Methods Chimeric antitenascin monoclonal antibody 81C6 (ch81C6) (10 mg) was labeled with 71–347 MBq of 211At by use of N-succinimidyl 3-[211At]astatobenzoate. Eighteen patients were treated with 211At-labeled ch81C6 (211At-ch81C6) administered into a surgically created resection cavity (SCRC) and then with salvage chemotherapy. Serial ?-camera imaging and blood sampling over 24 h were performed. Results A total of 96.7% ± 3.6% (mean ± SD) of 211At decays occurred in the SCRC, and the mean blood-pool percentage injected dose was ?0.3. No patient experienced dose-limiting toxicity, and the maximum tolerated dose was not identified. Six patients experienced grade 2 neurotoxicity within 6 wk of 211At-ch81C6 administration; this neurotoxicity resolved fully in all but 1 patient. No toxicities of grade 3 or higher were attributable to the treatment. No patient required repeat surgery for radionecrosis. The median survival times for all patients, those with glioblastoma multiforme, and those with anaplastic astrocytoma or oligodendroglioma were 54, 52, and 116 wk, respectively. Conclusion This study provides proof of concept for regional targeted radiotherapy with 211At-labeled molecules in oncology. Specifically, the regional administration of 211At-ch81C6 is feasible, safe, and associated with a promising antitumor benefit in patients with malignant central nervous system tumors. PMID:18077533

  16. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  17. Very short-lived bromomethanes measured by the CARIBIC observatory over the North Atlantic, Africa and South-East Asia during 2009-2013

    NASA Astrophysics Data System (ADS)

    Wisher, A.; Oram, D. E.; Laube, J. C.; Mills, G. P.; van Velthoven, P.; Zahn, A.; Brenninkmeijer, C. A. M.

    2013-11-01

    Short-lived organic brominated compounds make up a significant part (~20%) of the organic bromine budget in the atmosphere. Emissions of these compounds are highly variable and there are limited measurements, particularly in the extra-tropical upper troposphere/lower stratosphere and tropical troposphere. Measurements of five short-lived bromomethanes (VSLB) were made in air samples collected on the CARIBIC project aircraft over three flight routes; Germany to Venezuela/Columbia during 2009-2011, Germany to South Africa during 2010 and 2011 and Germany to Thailand/Kuala Lumpur, Malaysia during 2012 and 2013. In the tropical troposphere, as the most important entrance region to the stratosphere, we observe a total mean organic bromine derived from these compounds across all flights at 10-12 km altitude of 3.4 ± 1.5 ppt. Individual mean tropical tropospheric mixing ratios across all flights were 0.43, 0.74, 0.14, 0.23 and 0.11 ppt for CHBr3, CH2Br2, CHBr2Cl, CHBrCl2 and CH2BrCl respectively. The highest levels of VSLS-derived bromine (4.20 ± 0.56 ppt) were observed in flights between Bangkok and Kuala Lumpur indicating that the South China Sea is an important source region for these compounds. Across all routes, CHBr3 and CH2Br2 accounted for 34% (4.7-71) and 48% (14-73) respectively of total bromine derived from the analysed VSLB in the tropical mid-upper troposphere totalling 82% (54-89). In samples collected between Germany and Venezuela/Columbia, we find decreasing mean mixing ratios with increasing potential temperature in the extra-tropics. Tropical mean mixing ratios are higher than extra-tropical values between 340-350 K indicating that rapid uplift is important in determining mixing ratios in the lower tropical tropopause layer in the West Atlantic tropics. O3 was used as a tracer for stratospherically influenced air and we detect rapidly decreasing mixing ratios for all VSLB above ~100 ppb O3 corresponding to the extra-tropical tropopause layer.

  18. Very short-lived bromomethanes measured by the CARIBIC observatory over the North Atlantic, Africa and Southeast Asia during 2009-2013

    NASA Astrophysics Data System (ADS)

    Wisher, A.; Oram, D. E.; Laube, J. C.; Mills, G. P.; van Velthoven, P.; Zahn, A.; Brenninkmeijer, C. A. M.

    2014-04-01

    Short-lived organic brominated compounds make up a significant part of the organic bromine budget in the atmosphere. Emissions of these compounds are highly variable and there are limited measurements, particularly in the extra-tropical upper troposphere/lower stratosphere and tropical troposphere. Measurements of five very short-lived bromomethanes (VSLB) were made in air samples collected on the CARIBIC project aircraft over three flight routes; Germany to Venezuela/Columbia during 2009-2011, Germany to South Africa during 2010 and 2011 and Germany to Thailand/Kuala Lumpur, Malaysia during 2012 and 2013. In the tropical troposphere, as the most important entrance region to the stratosphere, we observe a total mean organic bromine derived from these compounds across all flights at 10-12 km altitude of 3.4 ± 1.5 ppt. Individual mean tropical tropospheric mixing ratios across all flights were 0.43, 0.74, 0.14, 0.23 and 0.11 ppt for CHBr3, CH2Br2, CHBr2Cl, CHBrCl2 and CH2BrCl respectively. The highest levels of VSLB-derived bromine (4.20 ± 0.56 ppt) were observed in flights between Bangkok and Kuala Lumpur indicating that the South China Sea is an important source region for these compounds. Across all routes, CHBr3 and CH2Br2 accounted for 34% (4.7-71) and 48% (14-73) respectively of total bromine derived from the analysed VSLB in the tropical mid-upper troposphere totalling 82% (54-89). In samples collected between Germany and Venezuela/Columbia, we find decreasing mean mixing ratios with increasing potential temperature in the extra-tropics. Tropical mean mixing ratios are higher than extra-tropical values between 340-350 K indicating that rapid uplift is important in determining mixing ratios in the lower tropical tropopause layer in the West Atlantic tropics. O3 was used as a tracer for stratospherically influenced air and we detect rapidly decreasing mixing ratios for all VSLB above ∼100 ppb O3 corresponding to the extra-tropical tropopause layer.

  19. Apparatus for detecting alpha radiation in difficult access areas

    DOEpatents

    Steadman, Peter (Santa Fe, NM); MacArthur, Duncan W. (Los Alamos, NM)

    1997-09-02

    An electrostatic alpha radiation detector for measuring alpha radiation emitted from inside an enclosure comprising an electrically conductive expandable electrode for insertion into the enclosure. After insertion, the electrically conductive expandable electrode is insulated from the enclosure and defines a decay cavity between the electrically conductive expandable electrode and the enclosure so that air ions generated in the decay cavity are electrostatically captured by the electrically conductive expandable electrode and the enclosure when an electric potential is applied between the electrically conductive expandable electrode and the enclosure. Indicator means are attached to the electrically conductive expandable electrode for indicating an electrical current produced by generation of the air ions generated in the decay cavity by collisions between air molecules and the alpha particles emitted from the enclosure. A voltage source is connected between the indicator means and the electrically conductive enclosure for creating an electric field between the electrically conductive expandable electrode and the enclosure.

  20. Combining radon, short-lived radium isotopes and hydrodynamic modeling to assess submarine groundwater discharge from an anthropized semiarid watershed to a Mediterranean lagoon (Mar Menor, SE Spain)

    NASA Astrophysics Data System (ADS)

    Baudron, Paul; Cockenpot, Sabine; Lopez-Castejon, Francisco; Radakovitch, Olivier; Gilabert, Javier; Mayer, Adriano; Garcia-Arostegui, José Luis; Martinez-Vicente, David; Leduc, Christian; Claude, Christelle

    2015-06-01

    In highly anthropized watersheds, surface water tributaries may carry unexpected high quantities of radon and radium to coastal lagoons. Investigating submarine groundwater discharge (SGD) with radionuclide tracers is therefore a complex task. In order to quantify SGD and decipher the influence of the different water sources, we combined a radon (222Rn) and short-lived radium (223Ra, 224Ra) survey with the hydrodynamic modeling of a lagoon. We applied it to the Mar Menor lagoon (SE Spain) where surface water tributaries and undocumented emissaries carry water from groundwater drainage and brines from groundwater desalinization. We identified the areas of influence of the plume of radionuclides from the river, located major areas of SGD and proposed a location for two submarine emissaries. Porewater, i.e. interstitial water from underlying sediments, was found to be the most representative SGD end member, compared to continental groundwater collected from piezometers. Mass balances in winter and summer seasons provided yearly SGD fluxes of water of 0.4-2.2 ? 108 m3/y (222Rn), 4.4-19.0 ? 108 m3/y (224Ra) and 1.3 ? 108 m3/y (223Ra, measured in winter only). Tidal pumping was identified as a main driver for recirculated saline groundwater, while fresh submarine groundwater discharge from the aquifer ranged between 2% and 23% of total SGD.

  1. Quantification of regional ventilation in humans using a short-lived radiotracer--theoretical evaluation of the steady-state model

    SciTech Connect

    Valind, S.O.; Rhodes, C.G.; Jonson, B.

    1987-07-01

    The accuracy of the steady-state measurement of ventilation by means of a short-lived insoluble inert gas tracer rests with the validity of the steady-state flow equation. This has previously been applied to the qualitative assessment of regional ventilation using krypton-81m, but may potentially be used for the calculation of regional alveolar ventilation per unit alveolar gas volume--(VA/VA)cal--from measurements of the alveolar concentration of the tracer. The steady-state alveolar tracer concentration was calculated for the course of a breathing cycle, using a lung model featuring airways dead space and tidal gas flow. The calculations were made by computer simulations of a lung, characterized by predefined values of parameters describing the lung structure and the mode of ventilation. In the normal lung of supine man at rest (specific alveolar ventilation, ranging from 1.0 to 3.5 min-1) the errors of (VA/VA)cal relative to the predefined true values range from an overestimation by some 3% in the low ventilation regions to an underestimation by 8% in the best ventilated regions. The errors mainly result from ventilation of the airways dead space, which will influence the distribution of tracer in the lung by the transfer of tracer between regions by way of the common dead space and by the decay of tracer during its transport through the bronchial tree.

  2. The impact of dietary restriction, intermittent feeding and compensatory growth on reproductive investment and lifespan in a short-lived fish

    PubMed Central

    Inness, Claire L.W; Metcalfe, Neil B

    2008-01-01

    While dietary restriction usually increases lifespan, an intermittent feeding regime, where periods of deprivation alternate with times when food is available, has been found to reduce lifespan in some studies but prolong it in others. We suggest that these disparities arise because in some situations lifespan is reduced by the costs of catch-up growth (following the deprivation) and reproductive investment, a factor that has rarely been measured in studies of lifespan. Using three-spined sticklebacks, we show for the first time that while animals subjected to an intermittent feeding regime can grow as large as continuously fed controls that receive the same total amount of food, and can maintain reproductive investment, they have a shorter lifespan. Furthermore, we show that this reduction in lifespan is linked to rapid skeletal growth rate and is due to an increase in the instantaneous risk of mortality rather than in the rate of senescence. By contrast, dietary restriction caused a reduction in reproductive investment in females but no corresponding increase in longevity. This suggests that in short-lived species where reproduction is size dependent, selection pressures may lead to an increase in intrinsic mortality risk when resources are diverted from somatic maintenance to both growth and reproductive investment. PMID:18445563

  3. The origin and disappearance of the late Pleistocene-early Holocene short-lived coastal wetlands along the Carmel coast, Israel

    NASA Astrophysics Data System (ADS)

    Sivan, Dorit; Greenbaum, Noam; Cohen-Seffer, Ronit; Sisma-Ventura, Guy; Almogi-Labin, Ahuva

    The formation of short-lived backswamps along the Carmel coast of Israel coincides with the rapid global sea-level rise during the late Pleistocene-early Holocene transition. The current study shows that the wetland phenomena originated around 10,000 yr ago and dried up shortly before the local Pre-Pottery Neolithic humans settled on the wetland dark clay sediments 9430 cal yr BP. Palaeontological and stable-isotope data were used in this study to elucidate previously published sedimentological reconstruction obtained from a core drilled into the western trough of the Carmel coastal plain. The water body contained typical brackish calcareous fauna, with variable numerical abundance and low species richness of ostracods and foraminifera. The ? 18O and ? 13C of the ostracod Cyprideis torosa show close similarity to the present Pleistocene coastal aquifer isotopic values. This study therefore concludes that the wetlands were shallow-water bodies fed by groundwater, with no evidence of sea-water mixing. It seems that they developed as the result of high groundwater levels, transportation of sediments landward, and deposition of sand bars at the paleo-river mouths. It is still not fully understood why these wetlands deteriorated abruptly and disappeared within less than 1000 yr.

  4. Preliminary Results of IS Plasma Focus as a Breeder of Short-Lived Radioisotopes 12C(d,n)13N

    NASA Astrophysics Data System (ADS)

    Sadat Kiai, S. M.; Elahi, M.; Adlparvar, S.; Shahhoseini, E.; Sheibani, S.; Ranjber akivaj, H.; Alhooie, S.; Safarien, A.; Farhangi, S.; Aghaei, N.; Amini, S.; Khalaj, M. M.; Zirak, A. R.; Dabirzadeh, A. A.; Soleimani, J.; Torkzadeh, F.; Mousazadeh, M. M.; Moradi, K.; Abdollahzadeh, M.; Talaei, A.; Zaeem, A. A.; Moslehi, A.; Kashani, A.; Babazadeh, A. R.; Bagiyan, F.; Ardestani, M.; Roozbahani, A.; Pourbeigi, H.; Tajik Ahmadi, H.; Ahmadifaghih, M. A.; Mahlooji, M. S.; Mortazavi, B. N.; Zahedi, F.

    2011-04-01

    Modified IS (Iranian Sun) plasma focus (10 kJ,15 kV, 94 ?F, 0.1 Hz) has been used to produce the short-lived radioisotope 13N (half-life of 9.97 min) through 12C(d,n)13N nuclear reaction. The filling gas was 1.5-3 torr of hydrogen (60%) deuterium (40%) mixture. The target was solid nuclear grade graphite with 5 mm thick, 9 cm width and 13 in length. The activations of the exogenous target on average of 20 shots (only one-third acceptable) through 10-13 kV produced the 511 keV gamma rays. Another peak found at the 570 keV gamma of which both was measured by a NaI portable gamma spectrometer calibrated by a 137Cs 0.25 ?Ci sealed reference source with its single line at 661.65 keV and 22Na 0.1 ?Ci at 511 keV. To measure the gamma rays, the graphite target converts to three different phases; solid graphite, powder graphite, and powder graphite in water solution. The later phase approximately has a doubled activity with respect to the solid graphite target up to 0.5 ?Ci of 511 keV and 1.1 ?Ci of 570 keV gamma lines were produced. This increment in activity was perhaps due to structural transformation of graphite powder to nano-particles characteristic in liquid water.

  5. Detection of the short-lived cation radical intermediate in the electrochemical oxidation of N,N-dimethylaniline by scanning electrochemical microscopy.

    PubMed

    Cao, Fahe; Kim, Jiyeon; Bard, Allen J

    2014-12-31

    The short-lived intermediate N,N-dimethylaniline (DMA) cation radical, DMA(•+), was detected during the oxidation of DMA in MeCN with 0.1 M tetra-n-butylammonium hexafluorophosphate. The detection was accomplished at steady state by scanning electrochemical microscopy (SECM) with ultramicroelectrodes using the tip generation/substrate collection mode. Cyclic voltammetry (CV) with a 2 mm Pt electrode indicates that DMA oxidation in acetonitrile is followed by a dimerization and two electrochemical reactions, which is consistent with previous results. The DMA(•+) intermediate is detected by SECM, where the DMA(•+) generated at the ca. 500 nm radius Pt tip is collected on a 5 ?m radius Pt substrate when the gap between the tip and the substrate is a few hundred nanometers. Almost all of the DMA(•+) is reduced at the substrate when the gap is 200 nm or less, yielding a dimerization rate constant of 2.5 × 10(8) M(-1)·s(-1) based on a simulation. This is roughly 3 orders of magnitude larger than the value estimated by fast-scan CV. We attribute this discrepancy to the effects of double-layer capacitance charging and adsorbed species in the high scan rate CV. PMID:25478724

  6. Early Effector CD8 T Cells Display Plasticity in Populating the Short-Lived Effector and Memory-Precursor Pools Following Bacterial or Viral Infection

    PubMed Central

    Plumlee, Courtney R.; Obar, Joshua J.; Colpitts, Sara L.; Jellison, Evan R.; Haining, W. Nicholas; Lefrancois, Leo; Khanna, Kamal M.

    2015-01-01

    Naïve antigen-specific CD8 T cells expand in response to infection and can be phenotypically separated into distinct effector populations, which include memory precursor effector cells (MPECs) and short-lived effector cells (SLECs). In the days before the peak of the T cell response, a third population called early effector cells (EECs) predominate the antigen-specific response. However, the contribution of the EEC population to the CD8 T cell differentiation program during an antimicrobial immune response is not well understood. To test if EEC populations were pre-committed to either an MPEC or SLEC fate, we purified EECs from mice infected with Listeria monocytogenes (LM) or vesicular stomatitis virus (VSV), where the relative frequency of each population is known to be different at the peak of the response. Sorted EECs transferred into uninfected hosts revealed that EECs were pre-programmed to differentiate based on early signals received from the distinct infectious environments. Surprisingly, when these same EECs were transferred early into mismatched infected hosts, the transferred EECs could be diverted from their original fate. These results delineate a model of differentiation where EECs are programmed to form MPECs or SLECs, but remain susceptible to additional inflammatory stimuli that can alter their fate. PMID:26191658

  7. Diurnal variation climatology of short-lived at atmospheric compositions (ClO, BrO, HO2 and HOCl) derived from SMILES NICT data

    NASA Astrophysics Data System (ADS)

    Kreyling, Daniel; Sagawa, Hideo; Kasai, Yasuko

    2013-04-01

    We present a diurnal variation climatology for short-lived at atmospheric compositions, such as ClO, BrO, HO2 and HOCl, as well as for longer life time species, like O3 and HCl from observations of unprecedented sensitivity with the Superconducting SubMIllimeter wave Limb-Emission Sounder (SMILES), which is installed on the Japanese Experiment Module (JEM) at the International Space Station (ISS). With its non sun synchronous orbit, SMILES measurements comprise observations at all local times. The target altitude range is between lower stratosphere and mesopause. Differences in diurnal variation chemistry of strato-, and mesospheric BrO and ClO of the diurnal climatology are presented. The data employed is produced by the SMILES level 2 retrieval algorithm version 2.1.5 at the National Institute of Information and Communications Technology (NICT). The SMILES climatology data sets are available via the SMILES data distribution homepage in NICT at https://smiles-p6.nict.go.jp/products/research_latitude-longitude.jsf

  8. Patient-specific alpha-particle dosimetry.

    PubMed

    Palm, Stig; Elgqvist, Jörgen; Jacobsson, Lars

    2011-10-01

    Alpha-particle therapy has received increased attention during the last few years because of the development of new targeting constructs and new labeling techniques and the availability of suitable ?-particle - emitting radionuclides. This work provides an overview of methods that have been used in clinical trials in estimating the absorbed dose to tumors and healthy tissue in patients following such ?-particle therapy. Similarities and differences compared to conventional therapies using ?¯-particle emitters are presented. The specific challenges of establishing accurate dosimetry for ?- particles in the individual patient are also discussed, as is the effect that improved patient-specific dosimetry might have on the overall efficacy of this type of therapy. PMID:22202155

  9. IPHAS: The INT\\/WFC Photometric H-alpha Survey of the Northern Galactic Plane

    Microsoft Academic Search

    N. A. Walton; J. Drew; M. J. Barlow; R. Corradi; J. Drake; B. Gaensicke; R. Greimel; P. Groot; M. J. Irwin; C. Knigge; P. Leisy; D. J. Lennon; A. Mampaso; M. Masheder; R. Morris; Q. A. Parker; S. Phillipps; M. Pretorius; P. Rodriguez-Gil; I. Skillen; J. Sokoloski; D. Steegs; Y. Unruh; A. Witham; A. Zijlstra; A. Zurita

    2004-01-01

    H-alpha emission both traces diffuse ionised nebulae and is commonly prominent in the spectra of pre- and post-main-sequence stars and interacting binaries. Since these are mostly relatively short-lived phases of evolution, they represent a minority of objects in a mature galaxy like our own at any one time. In the case of interacting binaries, they are simply hard to find.

  10. Stepwise catalytic mechanism via short-lived intermediate inferred from combined QM/MM MERP and PES calculations on retaining glycosyltransferase ppGalNAcT2.

    PubMed

    Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Ko?a, Jaroslav

    2015-04-01

    The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals. PMID:25849117

  11. A short lived protein involved in the heat shock sensing mechanism responsible for stress-activated protein kinase 2 (SAPK2/p38) activation.

    PubMed

    Dorion, S; Bérubé, J; Huot, J; Landry, J

    1999-12-31

    The stress-activated protein kinase 2 (SAPK2/p38) is activated by various environmental stresses and also by a vast array of agonists including growth factors and cytokines. This implies the existence of multiple proximal signaling pathways converging to the SAPK2/p38 activation cascade. Here, we show that there is a sensing mechanism highly specific to heat shock for activation of SAPK2/p38. After mild heat shock, cells became refractory to reinduction of the SAPK2/p38 pathway by a second heat shock. This was not the result of a toxic effect because the cells remained fully responsive to reinduction by other stresses, cytokines, or growth factors. Neither the activity of SAPK2/p38 itself nor the accumulation of the heat shock proteins was essential in the desensitization process. The cells were not desensitized to heat shock by other treatments that activated SAPK2/p38. Moreover, inhibiting SAPK2/p38 activity during heat shock did not block desensitization. Also, overexpression of HSP70, HSP27, or HSP90 by gene transfection did not cause desensitization, and inhibiting their synthesis after heat shock did not prevent desensitization. Desensitization rather appeared to be linked closely to the turnover of a putative upstream activator of SAPK2/p38. Cycloheximide induced a progressive and eventually complete desensitization. The effect was specific to heat shock and minimally affected activation by other stress inducers. Inhibiting protein degradation with MG132 caused the constitutive activation of SAPK2/p38, which was blocked by a pretreatment with either cycloheximide or heat shock. The results thus indicate that there is a sensing pathway highly specific to heat shock upstream of SAPK2/p38 activation. The pathway appears to involve a short lived protein that is the target of rapid successive up- and down-regulation by heat shock. PMID:10608813

  12. TRIGGERING COLLAPSE OF THE PRESOLAR DENSE CLOUD CORE AND INJECTING SHORT-LIVED RADIOISOTOPES WITH A SHOCK WAVE. II. VARIED SHOCK WAVE AND CLOUD CORE PARAMETERS

    SciTech Connect

    Boss, Alan P.; Keiser, Sandra A., E-mail: boss@dtm.ciw.edu, E-mail: keiser@dtm.ciw.edu [Department of Terrestrial Magnetism, Carnegie Institution, 5241 Broad Branch Road, NW, Washington, DC 20015-1305 (United States)

    2013-06-10

    A variety of stellar sources have been proposed for the origin of the short-lived radioisotopes that existed at the time of the formation of the earliest solar system solids, including Type II supernovae (SNe), asymptotic giant branch (AGB) and super-AGB stars, and Wolf-Rayet star winds. Our previous adaptive mesh hydrodynamics models with the FLASH2.5 code have shown which combinations of shock wave parameters are able to simultaneously trigger the gravitational collapse of a target dense cloud core and inject significant amounts of shock wave gas and dust, showing that thin SN shocks may be uniquely suited for the task. However, recent meteoritical studies have weakened the case for a direct SN injection to the presolar cloud, motivating us to re-examine a wider range of shock wave and cloud core parameters, including rotation, in order to better estimate the injection efficiencies for a variety of stellar sources. We find that SN shocks remain as the most promising stellar source, though planetary nebulae resulting from AGB star evolution cannot be conclusively ruled out. Wolf-Rayet (WR) star winds, however, are likely to lead to cloud core shredding, rather than to collapse. Injection efficiencies can be increased when the cloud is rotating about an axis aligned with the direction of the shock wave, by as much as a factor of {approx}10. The amount of gas and dust accreted from the post-shock wind can exceed that injected from the shock wave, with implications for the isotopic abundances expected for a SN source.

  13. Stepwise Catalytic Mechanism via Short-Lived Intermediate Inferred from Combined QM/MM MERP and PES Calculations on Retaining Glycosyltransferase ppGalNAcT2

    PubMed Central

    Trnka, Tomáš; Kozmon, Stanislav; Tvaroška, Igor; Ko?a, Jaroslav

    2015-01-01

    The glycosylation of cell surface proteins plays a crucial role in a multitude of biological processes, such as cell adhesion and recognition. To understand the process of protein glycosylation, the reaction mechanisms of the participating enzymes need to be known. However, the reaction mechanism of retaining glycosyltransferases has not yet been sufficiently explained. Here we investigated the catalytic mechanism of human isoform 2 of the retaining glycosyltransferase polypeptide UDP-GalNAc transferase by coupling two different QM/MM-based approaches, namely a potential energy surface scan in two distance difference dimensions and a minimum energy reaction path optimisation using the Nudged Elastic Band method. Potential energy scan studies often suffer from inadequate sampling of reactive processes due to a predefined scan coordinate system. At the same time, path optimisation methods enable the sampling of a virtually unlimited number of dimensions, but their results cannot be unambiguously interpreted without knowledge of the potential energy surface. By combining these methods, we have been able to eliminate the most significant sources of potential errors inherent to each of these approaches. The structural model is based on the crystal structure of human isoform 2. In the QM/MM method, the QM region consists of 275 atoms, the remaining 5776 atoms were in the MM region. We found that ppGalNAcT2 catalyzes a same-face nucleophilic substitution with internal return (SNi). The optimized transition state for the reaction is 13.8 kcal/mol higher in energy than the reactant while the energy of the product complex is 6.7 kcal/mol lower. During the process of nucleophilic attack, a proton is synchronously transferred to the leaving phosphate. The presence of a short-lived metastable oxocarbenium intermediate is likely, as indicated by the reaction energy profiles obtained using high-level density functionals. PMID:25849117

  14. A LOWER INITIAL ABUNDANCE OF SHORT-LIVED {sup 41}Ca IN THE EARLY SOLAR SYSTEM AND ITS IMPLICATIONS FOR SOLAR SYSTEM FORMATION

    SciTech Connect

    Liu, Ming-Chang [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei, Taiwan (China); Chaussidon, Marc [Centre de Recherches Petrographiques et Geochimiques, CNRS, Nancy (France); Srinivasan, Gopalan [Center for Earth Science, Indian Institute of Science, Bangalore (India); McKeegan, Kevin D., E-mail: mcliu@asiaa.sinica.edu.tw [Department of Earth and Space Sciences, UCLA, Los Angeles, CA (United States)

    2012-12-20

    The short-lived radionuclide {sup 41}Ca plays an important role in constraining the immediate astrophysical environment and the formation timescale of the nascent solar system due to its extremely short half-life (0.1 Myr). Nearly 20 years ago, the initial ratio of {sup 41}Ca/{sup 40}Ca in the solar system was determined to be (1.41 {+-} 0.14) Multiplication-Sign 10{sup -8}, primarily based on two Ca-Al-rich Inclusions (CAIs) from the CV chondrite Efremovka. With an advanced analytical technique for isotopic measurements, we reanalyzed the potassium isotopic compositions of the two Efremovka CAIs and inferred the initial ratios of {sup 41}Ca/{sup 40}Ca to be (2.6 {+-} 0.9) Multiplication-Sign 10{sup -9} and (1.4 {+-} 0.6) Multiplication-Sign 10{sup -9} (2{sigma}), a factor of 7-10 lower than the previously inferred value. Considering possible thermal processing that led to lower {sup 26}Al/{sup 27}Al ratios in the two CAIs, we propose that the true solar system initial value of {sup 41}Ca/{sup 40}Ca should have been {approx}4.2 Multiplication-Sign 10{sup -9}. Synchronicity could have existed between {sup 26}Al and {sup 41}Ca, indicating a uniform distribution of the two radionuclides at the time of CAI formation. The new initial {sup 41}Ca abundance is 4-16 times lower than the calculated value for steady-state galactic nucleosynthesis. Therefore, {sup 41}Ca could have originated as part of molecular cloud materials with a free decay time of 0.2-0.4 Myr. Alternative possibilities, such as a last-minute input from a stellar source and early solar system irradiation, could not be definitively ruled out. This underscores the need for more data from diverse CAIs to determine the true astrophysical origin of {sup 41}Ca.

  15. IL-2 induction of Blimp-1 is a key in vivo signal for CD8+ short-lived effector T cell differentiation.

    PubMed

    Boulet, Salix; Daudelin, Jean-François; Labrecque, Nathalie

    2014-08-15

    During infection or vaccination, only a small proportion of CD8(+) T cells differentiate into memory cells. The mechanisms underlying the differentiation of CD8(+) T cells into short-lived effector cells (SLECs) or memory precursor effector cells are poorly defined. It was recently shown in infectious models that the transcriptional repressor B lymphocyte-induced maturation protein 1 (Blimp-1) enhances the formation of SLECs. The factors controlling Blimp-1 expression leading to the in vivo formation of SLECs are still not known. However, it has been shown that cytokines such as IL-2 induce Blimp-1 expression in vitro. In this study, we took advantage of the low-inflammation model of dendritic cell immunization to study the role of the IL-2/Blimp-1 axis in SLEC differentiation as well as the importance of Blimp-1 expression in memory precursor effector cells for proper CD8(+) memory generation. Our results show that Blimp-1 deficiency affects effector differentiation and function in the absence of inflammation. Unexpectedly, memory generation was not affected in Blimp-1-deficient OT-I cells responding to vaccination. In addition, modulation of the bioavailability of IL-2 by injection either of a blocking Ab or of the cytokine, demonstrates a link between IL-2, Blimp-1 induction, and SLEC formation in wild-type cells. Conversely, injection of IL-2 had less effect on Blimp-1-deficient CD8(+) T cells, indicating that the effect of IL-2 on in vivo SLEC differentiation is mediated by Blimp-1. In conclusion, IL-2 induction of Blimp-1 expression is a key regulator of SLEC differentiation in vivo. PMID:25015830

  16. 2014 ICHLNRRA intercomparison of radon/thoron gas and radon short-lived decay products measuring instruments in the NRPI Prague.

    PubMed

    Jílek, K; Timková, J

    2015-06-01

    During the Eighth International Conference on High Levels of Natural Radiation and Radon Areas held in autumn 2014 at Prague, the third intercomparison of radon/thoron gas and radon short-lived decay products measurement instruments was organised by and held at the Natural Radiation Division of the National Radiation Protection Institute (NRPI; SÚRO v.v.i.) in Prague. The intercomparison was newly focussed also on continuous monitors with active sampling adapters capable to distinguish radon/thoron gas in their mix field.The results of radon gas measurements carried out in the big NRPI radon chamber indicated very well an average deviation of up to 5 % from the reference NRPI value for 80 % of all the exposed instruments. The results of equilibrium equivalent concentration continuous monitors indicated an average deviation of up to 5 % from the reference NRPI value for 40 % of all the exposed instruments and their ?8-10 % shift compared with the NRPI. The results of investigated ambient conditions upon response of exposed continuous monitors indicated influence of aerosol changes upon response of radon monitors with an active air sampling adapters through the filter, only. The exposures of both radon/thoron gas discriminative continuous monitors and passive detectors have been indicated inconsistent results: on one hand, their excellent agreement up to several per cent for both the gases, and on the other hand, systematic unsatisfactory differences up to 40 %. Additional radon/thoron exercises are recommended to improve both the instruments themselves and quality of their operators. PMID:25990114

  17. Hypoxia-induced and A2A adenosine receptor-independent T-cell suppression is short lived and easily reversible

    PubMed Central

    2014-01-01

    Tissue hypoxia plays a key role in establishing an immunosuppressive environment in vivo by, among other effects, increasing the level of extracellular adenosine, which then signals through A2A adenosine receptor (A2AR) to elicit its immunosuppressive effect. Although the important role of the adenosine–A2AR interaction in limiting inflammation has been established, the current study revisited this issue by asking whether hypoxia can also exert its T-cell inhibitory effects even without A2AR. A similar degree of hypoxia-triggered inhibition was observed in wild-type and A2AR-deficient T cells both in vitro and, after exposure of mice to a hypoxic atmosphere, in vivo. This A2AR-independent hypoxic T-cell suppression was qualitatively and mechanistically different from immunosuppression by A2AR stimulation. The A2AR-independent hypoxic immunosuppression strongly reduced T-cell proliferation, while IFN-?-producing activity was more susceptible to the A2AR-dependent inhibition. In contrast to the sustained functional impairment after A2AR-mediated T-cell inhibition, the A2AR-independent inhibition under hypoxia was short lived, as evidenced by the quick recovery of IFN-?-producing activity upon re-stimulation. These data support the view that T-cell inhibition by hypoxia can be mediated by multiple mechanisms and that both A2AR and key molecules in the A2AR-independent T-cell inhibition should be targeted to overcome the hypoxia-related immunosuppression in infected tissues and tumors. PMID:24150242

  18. Hypoxia-induced and A2A adenosine receptor-independent T-cell suppression is short lived and easily reversible.

    PubMed

    Ohta, Akio; Madasu, Manasa; Subramanian, Meenakshi; Kini, Radhika; Jones, Graham; Choukèr, Alexander; Ohta, Akiko; Sitkovsky, Michail

    2014-02-01

    Tissue hypoxia plays a key role in establishing an immunosuppressive environment in vivo by, among other effects, increasing the level of extracellular adenosine, which then signals through A2A adenosine receptor (A2AR) to elicit its immunosuppressive effect. Although the important role of the adenosine--A2AR interaction in limiting inflammation has been established, the current study revisited this issue by asking whether hypoxia can also exert its T-cell inhibitory effects even without A2AR. A similar degree of hypoxia-triggered inhibition was observed in wild-type and A2AR-deficient T cells both in vitro and, after exposure of mice to a hypoxic atmosphere, in vivo. This A2AR-independent hypoxic T-cell suppression was qualitatively and mechanistically different from immunosuppression by A2AR stimulation. The A2AR-independent hypoxic immunosuppression strongly reduced T-cell proliferation, while IFN-?-producing activity was more susceptible to the A2AR-dependent inhibition. In contrast to the sustained functional impairment after A2AR-mediated T-cell inhibition, the A2AR-independent inhibition under hypoxia was short lived, as evidenced by the quick recovery of IFN-?-producing activity upon re-stimulation. These data support the view that T-cell inhibition by hypoxia can be mediated by multiple mechanisms and that both A2AR and key molecules in the A2AR-independent T-cell inhibition should be targeted to overcome the hypoxia-related immunosuppression in infected tissues and tumors. PMID:24150242

  19. FORMATION OF THE SHORT-LIVED RADIONUCLIDE {sup 36}Cl IN THE PROTOPLANETARY DISK DURING LATE-STAGE IRRADIATION OF A VOLATILE-RICH RESERVOIR

    SciTech Connect

    Jacobsen, Benjamin; Yin Qingzhu [Department of Geology, University of California, Davis, CA 95616 (United States); Matzel, Jennifer; Hutcheon, Ian D.; Ramon, Erick C.; Weber, Peter K. [Glenn T. Seaborg Institute, Chemical Science Division, Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Krot, Alexander N.; Nagashima, Kazuhide [School of Ocean, Earth Science and Technology, Hawai'i Institute of Geophysics and Planetology, University of Hawai'i at Manoa, Honolulu, HI 96822 (United States); Ishii, Hope A. [Institute for Geophysics and Planetary Physics, Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Ciesla, Fred J., E-mail: jacobsen5@llnl.gov [Department of the Geophysical Sciences, University of Chicago, Chicago, IL 60637 (United States)

    2011-04-20

    Short-lived radionuclides (SLRs) in the early solar system provide fundamental insight into protoplanetary disk evolution. We measured the {sup 36}Cl-{sup 36}S-isotope abundance in wadalite (<15 {mu}m), a secondary chlorine-bearing mineral found in calcium-aluminum-rich inclusions (CAIs) in the Allende CV chondrite, to decipher the origin of the SLR {sup 36}Cl ({tau}{sub 1/2} {approx} 3 x 10{sup 5} yr) in the early solar system. Its presence, initial abundance, and the noticeable decoupling from {sup 26}Al raise serious questions about the origin of SLRs. The inferred initial {sup 36}Cl abundance for wadalite, corresponding to a {sup 36}Cl/{sup 35}Cl ratio of (1.81 {+-} 0.13) x 10{sup -5}, is the highest {sup 36}Cl abundance ever reported in any early solar system material. The high level of {sup 36}Cl in wadalite and the absence of {sup 26}Al ({sup 26}Al/{sup 27}Al {<=} 3.9 x 10{sup -6}) in co-existing grossular (1) unequivocally support the production of {sup 36}Cl by late-stage solar energetic particle irradiation in the protoplanetary disk and (2) indicates that the production of {sup 36}Cl, recorded by wadalite, is unrelated to the origin of {sup 26}Al and other SLRs ({sup 10}Be, {sup 53}Mn) recorded by primary minerals of CAIs and chondrules. We infer that {sup 36}Cl was largely produced by irradiation of a volatile-rich reservoir in an optically thin protoplanetary disk adjacent to the region in which the CV chondrite parent asteroid accreted while the Sun was a weak T Tauri star. Subsequently, {sup 36}Cl accreted into the Allende CV chondrite together with condensed water ices.

  20. Time-series variations of the short-lived Ra in coastal waters: implying input of SGD to the coastal zone of Da-Chia River, Taichung, Taiwan

    NASA Astrophysics Data System (ADS)

    Hsu, Feng-Hsin; Su, Chih-Chieh; Lin, In-Tain; Huh, Chih-An

    2015-04-01

    Submarine groundwater discharge (SGD) has been recognized as an important pathway for materials exchanging between land and sea. Input of SGD carries the associated nutrients, trace metals, and inorganic carbon that may makes great impacts on ecosystem in the coastal zone. Due to the variability of SGD magnitude, it is difficult to estimate the flux of those associated materials around the world. Even in the same area, SGD magnitude also varies in response to tide fluctuation and seasonal change on hydraulic gradient. Thus, long-term investigation is in need. In Taiwan, the SGD study is rare and the intrusion of seawater in the coastal aquifer is emphasized in previous studies. According to the information from Hydrogeological Data Bank (Central Geological Survey, MOEA), some areas still show potentiality of SGD. Here, we report the preliminary investigation result of SGD at Gaomei Wildlife Conservation Area which located at the south of the Da-Chia River mouth. This study area is characterized by a great tidal rang and a shallow aquifer with high groundwater recharge rate. Time-series measurement of the short-lived Ra in surface water was done in both dry and wet seasons at a tidal flat site and shows different trends of excess Ra-224 between dry and wet seasons. High excess Ra-224 activities (>20 dpm/100L) occurred at high tide in dry season but at low tide in wet season. The plot of salinity versus excess Ra-224, showing non-conservative curve, suggests that high excess Ra-224 activities derive from desorption in dry season but from SGD input in wet season.

  1. Constraining the Time-Scale of Interaction of Sea Ice Sediments and Surface Sea Water in the Arctic Ocean Using Short-Lived Radionuclide Tracers

    NASA Astrophysics Data System (ADS)

    Baskaran, M.; Andersson, P. S.; Jweda, J.; Dahlqvist, R.; Ketterer, M. E.

    2007-12-01

    We measured the activities of short-lived radionuclides (Th-234, Be-7, Po-210, Pb-210, Cs-137, Th-234, Ra-226 and Ra-228) and concentrations of several elements (Be, Pb, Fe, Al, Co, Ni, Cu and Zn) on a suite of ice-rafted sediments (IRS) collected during BERINGIA-2005 in the Western Arctic Ocean. A suite of water samples were also collected and analyzed for particulate and dissolved Be-7, Po-210, Pb-210, Th-234, Ra-226 and Ra-228. The activities of Be-7 and Pb-210 in the IRS are 1-2 orders of magnitude higher than those reported in the source sediments. Presence of excess Th-234 in the IRS indicates that the removal of Th-234 from surface seawater took place on time scales comparable to the mean-life of Th-234. While the Po-210/Pb-210 activity ratios in the source sediments (1.0) and the atmospheric depositional input (~0.1) are known, varying ratios of 0.78 to 1.0 were found in the IRS. This ratio can be utilized to obtain the residence time of the IRS in sea ice. The activity of Ra-226 and Ra-228 in all the IRS is nearly constant (within a factor of 1.6) and are comparable to the benthic sediments in the source region. The activities of atmospherically-delivered radionuclides, Be-7 and Pb-210, in IRS varied by factors of ~4.5 and 9, respectively, and this variation is attributed to differences in the extent of interaction of surface water with IRS and differences in the mean-lives of these nuclides. While significant enrichment of Be-7 and Pb-210 has been found, there is no enrichment of stable Pb or Be. The Al-normalized enrichment factor for elements measured (Co, Ni, Cu, Zn, Pb and Be) indicate that there is no significant enrichment of these elements, with Al-normalized enrichment factors less than 1.3.

  2. Formation of short-lived radionuclides in the protoplanetary disk during late-stage irradiation of a volatile-rich reservoir

    SciTech Connect

    Jacobsen, B; Matzel, J; Hutcheon, I D; Krot, A N; Yin, Q -; Nagashima, K; Ramon, E; Weber, P; Ishii, H; Ciesla, F

    2010-11-30

    The origin of short-lived (t{sub 1/2} < 5 Myr) and now extinct radionuclides ({sup 10}Be, {sup 26}Al, {sup 36}Cl, {sup 41}Ca, {sup 53}Mn, {sup 60}Fe; hereafter SLRs) is fundamental to understanding the formation of the early solar system. Two distinct classes of models have been proposed to explain the origin of SLRs: (1) injection from a nearby stellar source (e.g., supernova, asymptotic giant branch star or Wolf-Rayet star) and (2) solar energetic particle irradiation of dust and gas near the proto-Sun. Recent studies have demonstrated that {sup 36}Cl was extant in the early solar system. However, its presence, initial abundance and the noticeable decoupling from {sup 26}Al raise serious questions about the origin of SLRs. Here we report {sup 36}Cl-{sup 36}S and {sup 26}Al-{sup 26}Mg systematics for wadalite and grossular, secondary minerals in a calcium-aluminum-rich inclusion (CAI) from the CV chondrite Allende that allow us to reassess the origin of SLRs. The inferred abundance of {sup 36}Cl in wadalite, corresponding to a {sup 36}Cl/{sup 35}Cl ratio of (1.81 {+-} 0.13) x 10{sup -5}, is the highest {sup 36}Cl abundance reported in any early solar system material. The high level of {sup 36}Cl in wadalite and the absence of {sup 26}Al ({sup 26}Al/{sup 27}Al {le} 3.9 x 10{sup -6}) in co-existing grossular indicates that (1) {sup 36}Cl formed by late-stage solar energetic particle irradiation and (2) the production of {sup 36}Cl, recorded by secondary minerals, is unrelated to the origin of {sup 26}Al and other SLRs ({sup 10}Be, {sup 53}Mn) recorded by primary minerals of CAIs and chondrules. We conclude that 36Cl was produced by solar energetic particle irradiation of a volatile-rich reservoir in an optically thin protoplanetary disk adjacent to the accretion region of the CV chondrite parent asteroid.

  3. Transfer time and source tracing in the soil - water- -plant system deciphered by the U-and Th-series short-lived nuclides

    NASA Astrophysics Data System (ADS)

    Rihs, S.; Pierret, M.; Chabaux, F.

    2011-12-01

    Because soils form at the critical interface between the lithosphere and the atmosphere, characterization of the dynamics occurring through this compartment represents an important goal for several scientific fields and/or human activities. However, this issue remains a challenge because soils are complex systems, where a continuous evolution of minerals and organic soil constituents occurs in response to interactions with waters and vegetation. This study aims to investigate the relevance of short-lived nuclides of U- and Th-series to quantify the transfer times and scheme of radionuclides through a soil - water - plant ecosystem. Activities of (226Ra), (228Ra) and (228Th), as well as the long-lived (232Th), were measured by TIMS and gamma-spectrometry in the major compartments of a forested soil section, i.e.: solid soil fractions (exchangeable fraction, secondary phases and inherited primary minerals), waters (seepage soil waters and a spring further down the watershed) and vegetation (fine and coarse roots of beech trees, young and mature leaves). The matching of these nuclides half-live to bio-geochemical processes time-scale and the relatively good chemical analogy of radium with calcium make these isotopes especially suitable to investigate either time or mechanism of transfers within a soil-water-plant system. Indeed, the (228Ra/226Ra) isotopic ratios strongly differ in the range of samples, allowing quantifying the source and duration transfers. Analyses of the various solid soil fractions demonstrate a full redistribution of Ra isotopes between the inherited minerals and secondary soil phases. However, the transfer of these isotopes to the seepage water or to the tree roots does not follow a simple and obvious scheme. Both primary and secondary phases show to contribute to the dissolved radium. However, depending on the season, the tree leaves degradation also produces up to 70% of dissolved radium. Immobilization of a large part of this radium occurs within the first 70cm of the soil layer, either by plant uptake, or adsorption/ precipitation in particular soil layers. Consistently, the Ra isotope ratio in the spring water is similar to the inherited primary soil fraction, suggesting a "deep" (i.e. below the shallow 70cm of soil layer) origin of the exported dissolved radium and the short-scale effect of vegetation cycling onto radium transfer. The radium isotopic ratio in the trees roots does not match the soil exchangeable fraction, nor the seepage waters, but rather the bulk soil, suggesting a large and mixed pool of radium for roots uptake. Decay of 228Ra within the various parts of the trees allows calculating a vegetation cycling duration of about 10 years for this nuclide. Finally an unexpected large amount of unsupported 228Th in the tree leaves can only be explained by a preferential migration of the 228Ac (228Th precursor). The very short life of this nuclide allows therefore assessing that such transport from roots and deposition within stem and leaves take place within 30 hours at the most.

  4. Alpha Thalassemia

    MedlinePLUS

    ... the anemia. Normal alpha globin genes found on chromosome 16 People who do not produce enough alpha ... by four genes, two on each strand of chromosome 16. Individuals who have one or two abnormal ...

  5. Alpha Particle

    Microsoft Academic Search

    P. Murdin

    2000-01-01

    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...

  6. Rn alpha-ray detector on board lunar mission SELENE

    NASA Astrophysics Data System (ADS)

    Nishimura, J.; Kashiwagi, T.; Takashima, T.; Okuno, S.; Yoshida, K.; Mori, K.; Itoh, M.; Saeki, K.

    Alpha Ray Detector (ARD) will be on-board SELENE, a Japanese lunar orbiter to be launched in 2005. The Primary target is alpha particles emitted by 222Rn and 210Po. 222Rn is emitted from the lunar surface and trapped by the gravity, which decays with the half-life of 3.8days emitting 5.490MeV alpha particle. Half of the daughter nuclei are deposited on the lunar surface. Among them, 210Po nuclei emit alpha particles with the energy of 5.305 MeV about 20 yrs after the decay of Rn. Thus 210Po provides us with the information on the crust movement and change of Rn emission rate during the time scale of 20 yr. Results from Apollo 15, 16, and recent Lunar Prospector mission indicate that the amount of Rn on the lunar surface is much smaller than expected, and the Rn-alpha distribution suggests that Rn comes out through gas emission from the crack of the lunar surface. We developed large area detector of about 300cm^2 for ARD, being 20-30 times of that of Apollo, and low background achieved with the anti-coincidence by rejecting cosmic-ray tracks. It will enable (1) the precise global mapping of the radio-active material, (2) identification of gas emission location to be useful future human exploration on the moon, (3) obtaining information on the crust movement during about 20yrs.

  7. A short-lived chromospheric flare-point with a lifetime of 20 seconds and rise and fall times of 5 seconds

    NASA Technical Reports Server (NTRS)

    Hyder, C. L.; Epstein, G. L.; Hobbs, R. W.

    1973-01-01

    We have observed a chromospheric brightening in the H alpha and Ca II K lines with a diameter of about 1 arc second. The time structure of this event, obtained with a relative resolution of 1 second, shows the rise time to be 4 seconds, the lifetime (FWHM) to be 20 seconds, and the decay time to be 5 seconds. This imposes new constraints on flare-point models. These restrictions can be accommodated easily by either an infall-impact flare model or a model invoking the precipitation of high-energy particles from the corona.

  8. Modelling and Dosimetry for Alpha-Particle Therapy

    PubMed Central

    Sgouros, George; Hobbs, Robert F.; Song, Hong

    2015-01-01

    As a consequence of the high potency and short range of alpha-particles, radiopharmaceutical therapy with alpha-particle emitting radionuclides is a promising treatment approach that is under active pre-clinical and clinical investigation. To understand and predict the biological effects of alpha-particle radiopharmaceuticals, dosimetry is required at the micro or multi-cellular scale level. At such a scale, highly non-uniform irradiation of the target volume may be expected and the utility of a single absorbed dose value to predict biological effects comes into question. It is not currently possible to measure the pharmacokinetic input required for micro scale dosimetry in humans. Accordingly, pre-clinical studies are required to provide the pharmacokinetic data for dosimetry calculations. The translation of animal data to the human requires a pharmacokinetic model that links macro- and micro-scale pharmacokinetics thereby enabling the extrapolation of micro-scale kinetics from macroscopic measurements. These considerations along with a discussion of the appropriate physical quantity and related units for alpha-particle radiopharmaceutical therapy are examined in this review. PMID:22201712

  9. Targeted alpha particle immunotherapy for myeloid leukemia.

    PubMed

    Jurcic, Joseph G; Larson, Steven M; Sgouros, George; McDevitt, Michael R; Finn, Ronald D; Divgi, Chaitanya R; Ballangrud, Ase M; Hamacher, Klaus A; Ma, Dangshe; Humm, John L; Brechbiel, Martin W; Molinet, Roger; Scheinberg, David A

    2002-08-15

    Unlike beta particle-emitting isotopes, alpha emitters can selectively kill individual cancer cells with a single atomic decay. HuM195, a humanized anti-CD33 monoclonal antibody, specifically targets myeloid leukemia cells and has activity against minimal disease. When labeled with the beta-emitters (131)I and (90)Y, HuM195 can eliminate large leukemic burdens in patients, but it produces prolonged myelosuppression requiring hematopoietic stem cell transplantation at high doses. To enhance the potency of native HuM195 yet avoid the nonspecific cytotoxicity of beta-emitting constructs, the alpha-emitting isotope (213)Bi was conjugated to HuM195. Eighteen patients with relapsed and refractory acute myelogenous leukemia or chronic myelomonocytic leukemia were treated with 10.36 to 37.0 MBq/kg (213)Bi-HuM195. No significant extramedullary toxicity was seen. All 17 evaluable patients developed myelosuppression, with a median time to recovery of 22 days. Nearly all the (213)Bi-HuM195 rapidly localized to and was retained in areas of leukemic involvement, including the bone marrow, liver, and spleen. Absorbed dose ratios between these sites and the whole body were 1000-fold greater than those seen with beta-emitting constructs in this antigen system and patient population. Fourteen (93%) of 15 evaluable patients had reductions in circulating blasts, and 14 (78%) of 18 patients had reductions in the percentage of bone marrow blasts. This study demonstrates the safety, feasibility, and antileukemic effects of (213)Bi-HuM195, and it is the first proof-of-concept for systemic targeted alpha particle immunotherapy in humans. PMID:12149203

  10. Direct mass measurements of short-lived A=2Z-1 nuclides (63)Ge, (65)As, (67)Se, and (71)Kr and their impact on nucleosynthesis in the rp process.

    PubMed

    Tu, X L; Xu, H S; Wang, M; Zhang, Y H; Litvinov, Yu A; Sun, Y; Schatz, H; Zhou, X H; Yuan, Y J; Xia, J W; Audi, G; Blaum, K; Du, C M; Geng, P; Hu, Z G; Huang, W X; Jin, S L; Liu, L X; Liu, Y; Ma, X; Mao, R S; Mei, B; Shuai, P; Sun, Z Y; Suzuki, H; Tang, S W; Wang, J S; Wang, S T; Xiao, G Q; Xu, X; Yamaguchi, T; Yamaguchi, Y; Yan, X L; Yang, J C; Ye, R P; Zang, Y D; Zhao, H W; Zhao, T C; Zhang, X Y; Zhan, W L

    2011-03-18

    Mass excesses of short-lived A=2Z-1 nuclei (63)Ge, (65)As, (67)Se, and (71)Kr have been directly measured to be -46,921(37), -46,937(85), -46,580(67), and -46,320(141)??keV, respectively. The deduced proton separation energy of -90(85)??keV for (65)As shows that this nucleus is only slightly proton unbound. X-ray burst model calculations with the new mass excess of (65)As suggest that the majority of the reaction flow passes through (64)Ge via proton capture, indicating that (64)Ge is not a significant rp-process waiting point. PMID:21469858

  11. Simultaneous determination of gross alpha, gross beta and ²²?Ra in natural water by liquid scintillation counting.

    PubMed

    Fons, J; Zapata-García, D; Tent, J; Llauradó, M

    2013-11-01

    The determination of gross alpha, gross beta and (226)Ra activity in natural waters is useful in a wide range of environmental studies. Furthermore, gross alpha and gross beta parameters are included in international legislation on the quality of drinking water [Council Directive 98/83/EC]. In this work, a low-background liquid scintillation counter (Wallac, Quantulus 1220) was used to simultaneously determine gross alpha, gross beta and (226)Ra activity in natural water samples. Sample preparation involved evaporation to remove (222)Rn and its short-lived decay daughters. The evaporation process concentrated the sample ten-fold. Afterwards, a sample aliquot of 8 mL was mixed with 12 mL of Ultima Gold AB scintillation cocktail in low-diffusion vials. In this study, a theoretical mathematical model based on secular equilibrium conditions between (226)Ra and its short-lived decay daughters is presented. The proposed model makes it possible to determine (226)Ra activity from two measurements. These measurements also allow determining gross alpha and gross beta simultaneously. To validate the proposed model, spiked samples with different activity levels for each parameter were analysed. Additionally, to evaluate the model's applicability in natural water, eight natural water samples from different parts of Spain were analysed. The eight natural water samples were also characterised by alpha spectrometry for the naturally occurring isotopes of uranium ((234)U, (235)U and (238)U), radium ((224)Ra and (226)Ra), (210)Po and (232)Th. The results for gross alpha and (226)Ra activity were compared with alpha spectrometry characterization, and an acceptable concordance was obtained. PMID:23415246

  12. ALPHA OMEGA ALPHA National Honor Medical Society

    E-print Network

    12/7/2011 1 ALPHA OMEGA ALPHA National Honor Medical Society www.alphaomegaalpha.org AA and Leadership William Root The Alpha Omega Alpha honor medical society was initially organized in 1902/community service. AA and Medical Professionalism "Be Worthy to Serve the Suffering" #12;Alpha Omega Alpha Honor

  13. In vitro cell irradiation systems based on 210Po alpha source: construction and characterisation

    NASA Technical Reports Server (NTRS)

    Szabo, J.; Feher, I.; Palfalvi, J.; Balashazy, I.; Dam, A. M.; Polonyi, I.; Bogdandi, E. N.

    2002-01-01

    One way of studying the risk to human health of low-level radiation exposure is to make biological experiments on living cell cultures. Two 210Po alpha-particle emitting devices, with 0.5 and 100 MBq activity, were designed and constructed to perform such experiments irradiating monolayers of cells. Estimates of dose rate at the cell surface were obtained from measurements by a PIPS alpha-particle spectrometer and from calculations by the SRIM 2000, Monte Carlo charged particle transport code. Particle fluence area distributions were measured by solid state nuclear track detectors. The design and dosimetric characterisation of the devices are discussed. c2002 Elsevier Science Ltd. All rights reserved.

  14. Targeted alpha-particle radiotherapy with 211At-labeled monoclonal antibodies.

    PubMed

    Zalutsky, Michael R; Reardon, David A; Pozzi, Oscar R; Vaidyanathan, Ganesan; Bigner, Darell D

    2007-10-01

    An attractive feature of targeted radionuclide therapy is the ability to select radionuclides and targeting vehicles with characteristics that are best suited for a particular clinical application. One combination that has been receiving increasing attention is the use of monoclonal antibodies (mAbs) specifically reactive to receptors and antigens that are expressed in tumor cells to selectively deliver the alpha-particle-emitting radiohalogen astatine-211 (211At) to malignant cell populations. Promising results have been obtained in preclinical models with multiple 211At-labeled mAbs; however, translation of the concept to the clinic has been slow. Impediments to this process include limited radionuclide availability, the need for suitable radiochemistry methods operant at high activity levels and lack of data concerning the toxicity of alpha-particle emitters in humans. Nonetheless, two clinical trials have been initiated to date with 211At-labeled mAbs, and others are planned for the near future. PMID:17921029

  15. Calculation procedure of potential alpha energy concentration with continuous air sampling.

    PubMed

    Tokonami, S; Ichiji, T; Iimoto, T; Kurosawa, R

    1996-12-01

    A continuous potential alpha energy concentration monitor was developed to estimate the lung dose for inhalation of radon progeny. A silicon semiconductor detector was used as a detector. The build-up method was used and alpha particles emitted from 218Po, 214Po, 212Bi, and 212Po were detected. As 218Po and 212Bi have alpha particles of nearly the same energy, three detecting channels were set up. Counts corresponding to each nuclide were sent to a printer every 30 min. For the purpose of determining the potential alpha energy concentration of radon progeny continuously, a proper calculation procedure was investigated in detail. With this method, 218Po concentration and potential alpha energy concentration of radon progeny could be continuously obtained. The potential alpha energy concentration based on this procedure agreed well with that calculated from individual radon progeny concentration. When the measurement was done at 30-min intervals, the minimum detectable concentrations of 218Po concentration and equilibrium equivalent radon concentration were 0.3 Bq m(-3) and 0.15 Bq m(-3), respectively. The monitor can be used not only to estimate the lung dose but also to analyze environmental behavior of radon progeny. PMID:8919077

  16. ALPHA OMEGA ALPHA National Honor Medical Society

    E-print Network

    12/6/2012 1 ALPHA OMEGA ALPHA National Honor Medical Society www.alphaomegaalpha.org AA and Leadership The Alpha Omega Alpha honor medical society was organized in 1902 to "recognize and perpetuate Omega Alpha Honor Medical Society Wisconsin beta Chapter All upcoming MCW seniors who are interested

  17. Radon and Thoron Measured in Petrol and Gas-oil Exhaust Fumes by Using CR-39 and LR-115 II Nuclear Track Detectors: Radiation Doses to the Respiratory Tract of Mechanic Workers.

    PubMed

    Misdaq, M A; Chaouqi, A; Ouguidi, J; Touti, R; Mortassim, A

    2015-06-01

    Mechanic workers are exposed to exhaust fumes when controlling vehicle engines in motion inside repair shops. To assess radiation doses due to radon short-lived progeny from the inhalation of exhaust fumes by mechanic workers, concentrations of these radionuclides were measured in petrol (gasoline) and gas-oil exhaust fumes by evaluating mean critical angles of etching of the CR-39 and LR-115 type II SSNTDs for alpha particles emitted by the radon and thoron decay series. Committed effective doses due to Po and Po short-lived radon decay products from the inhalation of petrol and gas-oil exhaust fumes by workers were evaluated. A maximum value of 1.35 mSv y due to radon short-lived decay products from the inhalation of gas-oil exhaust fumes by mechanic workers was found, which is lower than the (3-10 mSv y) dose limit interval for workers. PMID:25905520

  18. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  19. The $\\alpha-\\alpha$ fishbone potential revisited

    E-print Network

    Day, J P; Elhanafy, M; Smith, E; Woodhouse, R; Papp, Z

    2011-01-01

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the $\\alpha-\\alpha$ fishbone potential by simultaneously fitting to two-$\\alpha$ resonance energies, experimental phase shifts and three-$\\alpha$ binding energies. We found that essentially a simple gaussian can provide a good description of two-$\\alpha$ and three-$\\alpha$ experimental data without invoking three-body potentials.

  20. Alpha One Foundation

    MedlinePLUS

    ... Support Find Doctor 20th Anniversary What Is Alpha-1? Alpha-1 Antitrypsin Deficiency (Alpha-1) is a ... daily treatment for COPD More News Our Number One Goal: Find a cure for Alpha-1. Website ...

  1. Examining the mechanisms responsible for lower ROS release rates in liver mitochondria from the long-lived house sparrow (Passer domesticus) and big brown bat (Eptesicus fuscus) compared to the short-lived mouse (Mus musculus).

    PubMed

    Brown, Jason C L; McClelland, Grant B; Faure, Paul A; Klaiman, Jordan M; Staples, James F

    2009-08-01

    Lower ROS release rate in long-lived species is likely caused by decreased reduction of electron transport chain (ETC) complexes, but how this is achieved remains largely unknown. We compared liver mitochondrial H(2)O(2) release rates among endotherms of comparable size and metabolic rate: house sparrow and big brown bat (both long-lived) and house mouse (short-lived). We hypothesized that low ROS release rates in long-lived species result from (i) lower mitochondrial respiration rate, (ii) increased mitochondrial proton conductance ('uncoupling to survive'), and/or (iii) increased ETC oxidative capacity ('spare oxidative capacity'). H(2)O(2) release rate was 70% lower in bats than mice despite similar respiration rates. Consistent with 'uncoupling to survive', proton leakiness was 3-fold higher in bats at membrane potentials above 130mV. Basal H(2)O(2) release rate and respiration rates were 2-fold higher in sparrows than mice. Consistent with 'spare oxidative capacity', subsaturating succinate decreased H(2)O(2) release rate in sparrows but not mice. Moreover, succinate:Cytochrome c oxidoreductase activity was 3-fold higher in sparrows, and ETC inhibitors increased ROS release rate 20-27-fold in sparrows (with glutamate or subsaturating succinate) but only 4-5-fold in mice. Taken together these data suggest that complexes I and III are less reduced under physiological conditions in sparrows. We conclude that different long-lived species may use distinct mechanisms to lower mitochondrial ROS release rate. PMID:19464314

  2. Absorbed fractions for alpha-particles in tissues of cortical bone

    NASA Astrophysics Data System (ADS)

    Watchman, Christopher J.; Bolch, Wesley E.

    2009-10-01

    Bone-seeking alpha-particle emitting radionuclides are common health physics hazards. Additionally, they are under consideration as an option for therapeutic molecular radiotherapy applications. Current dose models do not account for energy or bone-site dependence as shown by alpha-particle absorbed fractions given in ICRP Publication 30. Energy-dependent, yet bone-site independent, alpha-particle absorbed fractions have been presented by the models of Stabin and Siegel (2003 Health Phys. 85 294-310). In this work, a chord-based computational model of alpha-particle transport in cortical bone has been developed that explicitly accounts for both the bone-site and particle-energy dependence of alpha-particle absorbed fractions in this region of the skeleton. The model accounts for energy deposition to three targets: cortical endosteum, haversian space tissues and cortical bone. Path length distributions for cortical bone given in Beddoe (1977 Phys. Med. Biol. 22 298-308) provided additional transport regions in the absorbed fraction calculation. Significant variations in absorbed fractions between different skeletal sites were observed. Differences were observed between this model and the absorbed fractions given in ICRP Publication 30, which varied by as much as a factor of 2.1 for a cortical bone surface source irradiating cortical endosteum.

  3. Sterically stabilized liposomes as a carrier for alpha-emitting radium and actinium radionuclides.

    PubMed

    Henriksen, Gjermund; Schoultz, B W; Michaelsen, T E; Bruland, Ø S; Larsen, R H

    2004-05-01

    The alpha-particle emitting radionuclides (223)Ra (t(1/2) = 11.4 d), (224)Ra (t(1/2) = 3.6 d), and (225)Ac(t(1/2) = 10.0 d) may have a broad application in targeted radiotherapy provided that they could be linked to vehicles with tumor affinity. The potential usefulness of liposomes as carriers was studied in the present work. Radium and actinium radionuclides could be loaded in good yields into sterically stabilized liposomes. Subsequent coating of the liposomes with a folate-F(ab')(2) construct yielded a product with affinity towards tumor cells expressing folate receptors. Radionuclide loaded liposomes showed excellent stability in serum in vitro. PMID:15093814

  4. Counting particles emitted by stratospheric aircraft and measuring size of particles emitted by stratospheric aircraft

    NASA Technical Reports Server (NTRS)

    Wilson, James Charles

    1994-01-01

    The ER-2 condensation nuclei counter (CNC) has been modified to reduce the diffusive losses of particles within the instrument. These changes have been successful in improving the counting efficiency of small particles at low pressures. Two techniques for measuring the size distributions of particles with diameters less than 0.17 micrometers have been evaluated. Both of these methods, the differential mobility analyzer (DMA) and the diffusion battery, have fundamental problems that limit their usefulness for stratospheric applications. We cannot recommend either for this application. Newly developed, alternative methods for measuring small particles include inertial separation with a low-loss critical orifice and thin-plate impactor device. This technique is now used to collect particles in the multisample aerosol collector housed in the ER-2 CNC-2, and shows some promise for particle size measurements when coupled with a CNC as a counting device. The modified focused-cavity aerosol spectrometer (FCAS) can determine the size distribution of particles with ambient diameters as small as about 0.07 micrometers. Data from this instrument indicates the presence of a nuclei mode when CNC-2 indicates high concentrations of particles, but cannot resolve important parameters of the distribution.

  5. Local Control of Lung Derived Tumors by Diffusing Alpha-Emitting Atoms Released From Intratumoral Wires Loaded With Radium-224

    SciTech Connect

    Cooks, Tomer [Department of Clinical Microbiology and Immunology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv (Israel); Schmidt, Michael [School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Sciences, Tel Aviv University, Tel Aviv (Israel); Bittan, Hadas; Lazarov, Elinor [Department of Clinical Microbiology and Immunology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv (Israel); School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Sciences, Tel Aviv University, Tel Aviv (Israel); Arazi, Lior; Kelson, Itzhak [School of Physics and Astronomy, Raymond and Beverly Sackler Faculty of Exact Sciences, Tel Aviv University, Tel Aviv (Israel); Althera Medical Ltd., Tel Aviv (Israel); Keisari, Yona [Department of Clinical Microbiology and Immunology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv (Israel)], E-mail: ykeisari@post.tau.ac.il

    2009-07-01

    Purpose: Diffusing alpha-emitters radiation therapy (DART) is a new form of brachytherapy enabling the treatment of solid tumors with alpha radiation. The present study examines the antitumoral effects resulting from the release of alpha emitting radioisotopes into solid lung carcinoma (LL2, A427, and NCI-H520). Methods and Materials: An in vitro setup tested the dose-dependent killing of tumor cells exposed to alpha particles. In in vivo studies, radioactive wires (0.3 mm diameter, 5 mm long) with {sup 224}Ra activities in the range of 21-38 kBq were inserted into LL/2 tumors in C57BL/6 mice and into human-derived A427 or NCI-H520 tumors in athymic mice. The efficacy of the short-lived daughters of {sup 224}Ra to produce tumor growth retardation and prolong life was assessed, and the spread of radioisotopes inside tumors was measured using autoradiography. Results: The insertion of a single DART wire into the center of 6- to 7-mm tumors had a pronounced retardation effect on tumor growth, leading to a significant inhibition of 49% (LL2) and 93% (A427) in tumor development and prolongations of 48% (LL2) in life expectancy. In the human model, more than 80% of the treated tumors disappeared or shrunk. Autoradiographic analysis of the treated sectioned tissue revealed the intratumoral distribution of the radioisotopes, and histological analysis showed corresponding areas of necrosis. In vitro experiments demonstrated a dose-dependent killing of tumors cells exposed to alpha particles. Conclusions: Short-lived diffusing alpha-emitters produced tumor growth retardation and increased survival in mice bearing lung tumor implants. These results justify further investigations with improved dose distributions.

  6. Alpha Backgrounds for HPGe Detectors in Neutrinoless Double-Beta Decay Experiments

    E-print Network

    R. A. Johnson; T. H. Burritt; S. R. Elliott; V. M. Gehman; V. E. Guiseppe; J. F. Wilkerson

    2011-12-30

    The Majorana Experiment will use arrays of enriched HPGe detectors to search for the neutrinoless double-beta decay of 76Ge. Such a decay, if found, would show lepton-number violation and confirm the Majorana nature of the neutrino. Searches for such rare events are hindered by obscuring backgrounds which must be understood and mitigated as much as possible. A potentially important background contribution to this and other double-beta decay experiments could come from decays of alpha-emitting isotopes in the 232Th and 238U decay chains on or near the surfaces of the detectors. An alpha particle emitted external to an HPGe crystal can lose energy before entering the active region of the detector, either in some external-bulk material or within the dead region of the crystal. The measured energy of the event will only correspond to a partial amount of the total kinetic energy of the alpha and might obscure the signal from neutrinoless double-beta decay. A test stand was built and measurements were performed to quantitatively assess this background. We present results from these measurements and compare them to simulations using Geant4. These results are then used to measure the alpha backgrounds in an underground detector in situ. We also make estimates of surface contamination tolerances for double-beta decay experiments using solid-state detectors.

  7. Alpha Backgrounds for HPGe Detectors in Neutrinoless Double-Beta Decay Experiments

    SciTech Connect

    Johnson, R. A. [University of Washington, Seattle; Burritt, T. H. [University of Washington, Seattle; Elliott, S. R. [Los Alamos National Laboratory (LANL); Gehman, V. M. [Los Alamos National Laboratory (LANL); Guiseppe, V.E. [University of South Dakota; Wilkerson, J. F. [UNC/Triangle Univ. Nucl. Lab, Durham, NC/ORNL

    2012-01-01

    The Majorana Experiment will use arrays of enriched HPGe detectors to search for the neutrinoless double-beta decay of 76Ge. Such a decay, if found, would show lepton-number violation and confirm the Majorana nature of the neutrino. Searches for such rare events are hindered by obscuring backgrounds which must be understood and mitigated as much as possible. A potentially important background contribution to this and other double-beta decay experiments could come from decays of alpha-emitting isotopes in the 232Th and 238U decay chains on or near the surfaces of the detectors. An alpha particle emitted external to an HPGe crystal can lose energy before entering the active region of the detector, either in some external-bulk material or within the dead region of the crystal. The measured energy of the event will only correspond to a partial amount of the total kinetic energy of the alpha and might obscure the signal from neutrinoless double-beta decay. A test stand was built and measurements were performed to quantitatively assess this background. We present results from these measurements and compare them to simulations using Geant4. These results are then used to measure the alpha backgrounds in an underground detector in situ. We also make estimates of surface contamination tolerances for double-beta decay experiments using solid-state detectors.

  8. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  9. Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Durante, M.; Grossi, G. F.; Gialanella, G.; Pugliese, M.; Nappo, M.; Yang, T. C.

    1995-01-01

    We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS).

  10. Cancer Stem Cell Targeting Using the Alpha-Particle Emitter, 213Bi: Mathematical Modeling and Feasibility Analysis

    PubMed Central

    Sgouros, George; Song, Hong

    2010-01-01

    There is increasing recognition that treatment failure in cancer may be associated with the failure to sterilize a small subpopulation of tumor cells that have been characterized as tumor stem cells. Defined as cells that are able to self-renew and also to replenish a phenotypically diverse tumor-cell population, such cells are also considered resistant to chemotherapy. These characteristics are optimal for targeting by using alpha-particle-emitting radionuclides. Because of their high-energy deposition density per track, alpha-particles are capable of targeting single cells or small clusters of cells with minimal normal organ toxicity. The DNA damage induced by alpha-particles is largely irreparable and, therefore, alpha-particle-induced damage is minimally susceptible to resistance mechanisms. In this work, theoretical modeling was performed to examine the potential of alpha-emitter targeting of such small clusters of cancer stem cells. Critical parameters influencing efficacy and toxicity were identified and their relationship elucidated. The results identify specific activity, antigen site density, and number of target cells as critical parameters for effective cell killing and demonstrate substantial efficacy gains by targeting a smaller number of stem cells, as opposed to the entire tumor-cell population. PMID:18298331

  11. Implementation of a microdosimetric model for radioimmunotherapeutic alpha emitters.

    PubMed

    Chouin, Nicolas; Bitar, Abdalkader; Lisbona, Albert; Chérel, Michel; Davodeau, François; Barbet, Jacques; Bardiès, Manuel

    2007-06-01

    A microdosimetric model for alpha-particle-emitting radiolabeled antibodies, based on an analytic method, was developed to be used for in vitro studies. The model took into consideration cell radii distributions or distributions of activity bound to cells, and calculated the single- and multihit distributions of specific energy within the target. The mean absorbed dose could then be derived from the specific energy spectra. The mean number of hits, the probability that no particle crossed the target, and the average lineal energy transfer at which the energy is deposited were also calculated. Many in vitro geometric configurations of cells (single cell, cellular monolayer, and cellular clusters) and many different distributions of radioactive sources observed in experiments (distribution on the cell surface or within the extracellular volume) could be modeled. To verify the implementation of our algorithm, a comparison was carried out for different sources and target configurations between our model and a general Monte Carlo code (MCNPX). A positive agreement was observed between the two approaches. By using the proposed model, computation speed was greatly improved, as compared with the Monte-Carlo approach. An example of the impact of some parameters (cell radii and activity distributions) on the dosimetric results is also given in this paper. PMID:17651044

  12. Measurement of the {sup 40}Ca({alpha},{gamma}){sup 44}Ti reaction relevant for supernova nucleosynthesis

    SciTech Connect

    Vockenhuber, C.; Buchmann, L.; Caggiano, J.; Crawford, H.; Davids, B.; Fogarty, L.; Hutcheon, D. A.; O'Connor, E.; Ottewell, D.; Pavan, M. M.; Ruiz, C.; Ruprecht, G.; Trinczek, M. [TRIUMF, 4004 Wesbrook Mall, Vancouver, British Columbia, V6T 2A3 (Canada); Ouellet, C. O.; Chen, A. A.; Pearson, J.; Wales, B. [McMaster University, Hamilton, Ontario (Canada); The, L.-S. [Department of Physics and Astronomy, Clemson University, Clemson, South Carolina (United States); D'Auria, J. M. [Simon Fraser University, Burnaby, British Columbia (Canada); Frekers, D. [Institut fuer Kernphysik, Universitaet Muenster, Muenster (Germany)] (and others)

    2007-09-15

    The short-lived nuclide {sup 44}Ti is an important nuclide for the understanding of explosive nucleosynthesis. The main production reaction, {sup 40}Ca({alpha},{gamma}){sup 44}Ti, has been studied in inverse kinematics with the recoil mass spectrometer DRAGON located at the TRIUMF-ISAC facility in Vancouver, Canada. The temperature range relevant for {alpha}-rich freeze-out during a core-collapse supernova has been covered entirely with a {sup 40}Ca beam of 0.60 to 1.15 MeV/nucleon. All relevant quantities for the calculation of the astrophysical reaction rate have been measured directly. Because of many previously undiscovered resonances, the reaction rate derived from the energy dependent {sup 44}Ti yield is higher than the one based on previous prompt {gamma}-ray studies commonly used in supernova models. The presented new rate results in an increased {sup 44}Ti production in supernovae.

  13. Ab initio alpha-alpha scattering

    E-print Network

    Serdar Elhatisari; Dean Lee; Gautam Rupak; Evgeny Epelbaum; Hermann Krebs; Timo A. Lähde; Thomas Luu; Ulf-G. Meißner

    2015-06-11

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  14. Ab initio alpha-alpha scattering

    E-print Network

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-01-01

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  15. Targeted cancer therapy with a novel low-dose rate alpha-emitting radioimmunoconjugate.

    PubMed

    Dahle, Jostein; Borrebaek, Jørgen; Jonasdottir, Thora J; Hjelmerud, Anne Kristine; Melhus, Katrine B; Bruland, Øyvind S; Press, Oliver W; Larsen, Roy H

    2007-09-15

    Alpha-emitting radionuclides are highly cytotoxic and are of considerable interest in the treatment of cancer. A particularly interesting approach is in radioimmunotherapy. However, alpha-emitting antibody conjugates have been difficult to exploit clinically due to the short half-life of the radionuclides, low production capability, or limited source materials. We have developed a novel technology based on the low-dose rate alpha-particle-emitting nuclide (227)Th, exemplified here using the monoclonal antibody rituximab. In vitro, this radioimmunoconjugate killed lymphoma cells at Becquerel per milliliter (Bq/mL) levels. A single injection of (227)Th-rituximab induced complete tumor regression in up to 60% of nude mice bearing macroscopic (32-256 mm(3)) human B-lymphoma xenografts at Becquerel per gram (Bq/g) levels without apparent toxicity. Therapy with (227)Th-rituximab was significantly more effective than the control radioimmunoconjugate (227)Th-trastuzumab and the standard beta-emitting radioimmunoconjugate for CD20(+) lymphoma(90)Y-tiuxetan-ibritumomab. Thorium-227 based constructs may provide a novel approach for targeted therapy against a wide variety of cancers. PMID:17536011

  16. Radon alpha-ray detector on-board lunar mission SELENE

    NASA Astrophysics Data System (ADS)

    Nishimura, J.; Kashiwagi, T.; Takashima, T.; Okuno, S.; Yoshida, K.; Mori, K.; Itoh, M.; Saeki, K.; Furuichi, K.

    Alpha-ray detector (ARD) will be on-board SELENE, a Japanese lunar orbiter to be launched around 2006. Primary target is the alpha particles emitted by 222Rn and 210Po. 222Rn is produced by the decay of 238U and emanates from the lunar surface. It is trapped by the lunar gravity and decays with the half-life of 3.8 days emitting 5.490 MeV alpha particle. In the decay sequence of 222Rn, 210Po emits alpha particle with the energy of 5.305 MeV. Time scale of the activity is dominated by the 21-year half-life of 210Pb. Thus, alpha particle intensity from 210Po is an indicator of the change of radon emanation rate and change of crust condition due to seismic activity or impact events for the time scale of ˜50 years, while that of 222Rn reflects the current emanation rate. Results from Apollo 15, 16, and recent Lunar Prospector mission indicate that the average amount of radon on the lunar surface is much smaller than expected, and the radon-alpha distribution suggests that radon comes out through gas emanation from fissures of the lunar surface. We developed a large-area detector of 326 cm2 for the ARD, which is 15 20 times larger than the detectors of Apollo and Lunar Prospector. Reduction of the background was achieved with the anti-coincidence by rejecting cosmic-ray tracks. It will enable: (1) precise global mapping of the radioactive material on the lunar surface; (2) identification of gas emanation location; (3) study of the radon gas emanation mechanism on the lunar surface and the origin of the lunar atmosphere; (4) obtaining information on the crustal movement during the last ˜50 years.

  17. Phenyl-/alpha/,/alpha/,/omega/-trihydropolyfluoroalkyliodonium fluoroborates

    SciTech Connect

    Mironova, A.A.; Soloshonok, I.V.; Maletina, I.I.; Orda, V.V.; Yagupol'skii, L.M.

    1988-08-20

    The reaction of difluoroiodo-/alpha/,/alpha/,/omega/-trihydrofluoroalkanes (I) with boron trifluoride and benzene gave phenyl-/alpha/,/alpha/,/omega/-trihydropolyfluoroalkyliodonium fluoroborates (II). It was established that the polyfluoroalkyl radical adds at the sulfur atom in reaction with p-chlorothiophenol, the N-polyfluoroalkylation product is formed with aniline, pyridine is polyfluoroalkylated at the nitrogen atom with the formation of a quaternary salt, and a mixture of products from polyfluoroalkylation at the nitrogen atom of the dimethylamino group and at the para position of the benzene ring is formed with dimethylaniline.

  18. Observation of lunar radon emanation with the Apollo 15 alpha particle spectrometer.

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    The alpha particle spectrometer, a component of the orbital Sim Bay group of 'geochemistry' experiments on Apollo 15, was designed to detect alpha particles emitted during the decay of isotopes of radon gas and her daughter products. The purpose was to measure the gross activity of radon on the lunar surface and to find possible regions of increased local activity. Results are presented from a partial analysis of Apollo 15 data. For the moon as a whole, Rn220 was not observed and the upper limit on its decay rate above the lunar surface is 0.00038 disintegrations/sq cm-sec. Rn222 was marginally observed. Possible variations of radon activity on the lunar surface are being investigated. Po210 (a daughter product of Rn222) has been detected in a broad region from west of Mare Crisium to the Van de Graaff-Orlov region. The observed count rate is (4.6 plus or minus 1.4) x 0.001 disintegrations/sq cm-sec. The observed level of Po210 activity is in excess of the amount that would be in equilibrium with Rn222 by about an order of magnitude. This implies that larger levels of radon emanation have occurred on the moon within a time scale of 10 to 100 years.

  19. Preferential leaching and natural annealing of alpha-recoil tracks in metamict betafite and samarskite

    SciTech Connect

    Lumpkin, G.R.; Ewing, R.C.; Eyal, Y.

    1988-03-01

    Leaching experiments on naturally occurring, metamict betafite and samarskite minerals in a bicarbonate--carbonate solution show strongly enhanced release to the solution of short-lived /sup 228/Th relative to its parent isotope /sup 232/Th (by a factor of 3 to 6), but only slightly enhanced dissolution (by a factor of 1.2 to 2) of long-lived /sup 234/U and /sup 230/Th relative to /sup 238/U and /sup 232/Th, respectively. The betafite (a complex Ca--U--Ti--Nb oxide of the pyrochlore group, A/sub 2-//sub m/B/sub 2/X/sub 6/Y/sub 0-1/xH/sub 2/O) and samarskite (a complex Y--Fe--U--Nb oxide with varying stoichiometry between ABO/sub 4/ and AB/sub 2/O/sub 6/) are x-ray and electron diffraction amorphous having experienced doses of 2.2--2.8 x 10/sup 17/ alpha-decay events/mg (24--31 dpa) and 3.8--4.4 x 10/sup 17/ alpha-decay events/mg (39--45 dpa), respectively. The isotopic fractionation is attributed to the radiation damage created by the alpha-decay events. Individual alpha-recoil tracks are preserved for some time as disordered regions of higher chemical reactivity in already fully damaged, aperiodic areas that result from the alpha-decay events. The annealing time of the alpha-recoil track within the aperiodic atomic array of the metamict state is calculated to be 29,300 +- 8100 years for samarskite and 42,700 +- 13,700 years for the betafite. These data plus data on an earlier studied betafite sample (annealing time = 2000 +- 1300 years) give an average annealing time of 25,000 +- 21,000 years.

  20. Event counting alpha detector

    DOEpatents

    Bolton, Richard D. (Los Alamos, NM); MacArthur, Duncan W. (Los Alamos, NM)

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  1. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  2. Reexamination of the {alpha}-{alpha}''fishbone'' potential

    SciTech Connect

    Day, J. P.; McEwen, J. E.; Elhanafy, M.; Smith, E.; Woodhouse, R.; Papp, Z. [Department of Physics and Astronomy, California State University Long Beach, Long Beach, California (United States)

    2011-09-15

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the {alpha}-{alpha} fishbone potential by simultaneously fitting to two-{alpha} resonance energies, experimental phase shifts, and three-{alpha} binding energies. We found that, essentially, a simple Gaussian can provide a good description of two-{alpha} and three-{alpha} experimental data without invoking three-body potentials.

  3. Skeletal dosimetry models for alpha-particles for use in molecular radiotherapy

    NASA Astrophysics Data System (ADS)

    Watchman, Christopher J.

    Molecular radiotherapy is a cancer treatment methodology whereby a radionuclide is combined with a biologically active molecule to preferentially target cancer cells. Alpha-particle emitting radionuclides show significant potential for use in molecular radiotherapy due to the short range of the alpha-particles in tissue and their high rates of energy deposition. Current radiation dosimetry models used to assess alpha emitter dose in the skeleton were developed originally for occupational applications. In medical dosimetry, individual variability in uptake, translocation and other biological factors can result in poor correlation of clinical outcome with marrow dose estimates determined using existing skeletal models. Methods presented in this work were developed in response to the need for dosimetry models which account for these biological and patient-specific factors. Dosimetry models are presented for trabecular bone alpha particle dosimetry as well as a model for cortical bone dosimetry. These radiation transport models are the 3D chord-based infinite spongiosa transport model (3D-CBIST) and the chord-based infinite cortical transport model (CBICT), respectively. Absorbed fraction data for several skeletal tissues for several subjects are presented. Each modeling strategy accounts for biological parameters, such as bone marrow cellularity, not previously incorporated into alpha-particle skeletal dosimetry models used in radiation protection. Using these data a study investigating the variability in alpha-particle absorbed fractions in the human skeleton is also presented. Data is also offered relating skeletal tissue masses in individual bone sites for a range of ages. These data are necessary for dose calculations and have previously only been available as whole body tissue masses. A revised 3D-CBIST model is also presented which allows for changes in endosteum thickness to account for revised target cell location of tissues involved in the radiological induction of bone cancer. In addition, new data are presented on the location of bone-marrow stem cells within the marrow cavities of trabecular bone of the pelvis. All results presented in this work may be applied to occupational exposures, but their greatest utility lies in dose assessments for alpha-emitters in molecular radiotherapy.

  4. Learning about Alpha-1 Antitrypsin Deficiency (AATD)

    MedlinePLUS

    ... terms used on this page Learning About Alpha-1 Antitrypsin Deficiency (AATD) What is alpha-1 antitrypsin ... for Alpha-1 Anttrypsin Deficiency What is alpha-1 antitrypsin defciency? Alpha-1 antitrypsin deficiency (AATD) is ...

  5. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  6. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  7. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  8. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  9. Varying-{alpha} monopoles

    SciTech Connect

    Menezes, J.; Avelino, P.P.; Santos, C. [Centro de Fisica do Porto e Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007, Porto (Portugal)

    2005-11-15

    We study static magnetic monopoles in the context of varying-{alpha} theories and show that there is a group of models for which the 't Hooft-Polyakov solution is still valid. Nevertheless, in general static magnetic monopole solutions in varying-{alpha} theories depart from the classical 't Hooft-Polyakov solution with the electromagnetic energy concentrated inside the core seeding spatial variations of the fine-structure constant. We show that Equivalence Principle constraints impose tight limits on the allowed variations of {alpha} induced by magnetic monopoles which confirms the difficulty to generate significant spatial variation of the fine-structure constant found in previous works. This is true even in the most favorable case where magnetic monopoles are the source for these variations.

  10. Doubled \\alpha'-Geometry

    E-print Network

    Hohm, Olaf; Zwiebach, Barton

    2014-01-01

    We develop doubled-coordinate field theory to determine the \\alpha' corrections to the massless sector of oriented bosonic closed string theory. Our key tool is a string current algebra of free left-handed bosons that makes O(D,D) T-duality manifest. While T-dualities are unchanged, diffeomorphisms and b-field gauge transformations receive corrections, with a gauge algebra given by an \\alpha'-deformation of the duality-covariantized Courant bracket. The action is cubic in a double metric field, an unconstrained extension of the generalized metric that encodes the gravitational fields. Our approach provides a consistent truncation of string theory to massless fields with corrections that close at finite order in \\alpha'.

  11. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  12. Alpha Antihydrogen Experiment

    NASA Astrophysics Data System (ADS)

    Fujiwara, M. C.; Andresen, G. B.; Ashkezari, M. D.; Baquero-Ruiz, M.; Bertsche, W.; Bray, C. C.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Cesar, C. L.; Fajans, J.; Friesen, T.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jonsell, S.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Menary, S.; Nolan, P.; Olchanski, K.; Olin, A.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; Silveira, D. M.; So, C.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wilding, D.; Wurtele, J. S.; Yamazaki, Y.

    2011-12-01

    ALPHA is an experiment at CERN, whose ultimate goal is to perform a precise test of CPT symmetry with trapped antihydrogen atoms. After reviewing the motivations, we discuss our recent progress toward the initial goal of stable trapping of antihydrogen, with some emphasis on particle detection techniques.

  13. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  14. [alpha-Neurotoxins and alpha-conotoxins--nicotinic cholinoreceptor blockers].

    PubMed

    Utkin, Iu N; Kasheverov, I E; Tsetlin, V I

    1999-11-01

    The review is devoted to the competitive blockers of different nicotinic acetylcholine receptors, alpha-neurotoxins from snake venoms, and alpha-conotoxins from marine snails of the Conidae family. The relationship between the structure and function of these toxins is discussed. Recent data on the mechanism of alpha-neurotoxin and alpha-conotoxin interaction with the nicotinic acetylcholine receptor are presented. PMID:10645484

  15. Mitigation of radiation nephropathy after internal {alpha}-particle irradiation of kidneys

    SciTech Connect

    Jaggi, Jaspreet Singh [Molecular Pharmacology and Chemistry Program, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Seshan, Surya V. [Department of Pathology, Cornell University Weill Medical College, New York, NY (United States); McDevitt, Michael R. [Molecular Pharmacology and Chemistry Program, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Sgouros, George [Department of Radiology, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Hyjek, Elizabeth [Department of Pathology, Cornell University Weill Medical College, New York, NY (United States); Scheinberg, David A. [Molecular Pharmacology and Chemistry Program, Memorial Sloan-Kettering Cancer Center, New York, NY (United States) and Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)]. E-mail: d-scheinberg@ski.mskcc.org

    2006-04-01

    Purpose: Internal irradiation of kidneys as a consequence of radioimmunotherapy, radiation accidents, or nuclear terrorism can result in radiation nephropathy. We attempted to modify pharmacologically, the functional and morphologic changes in mouse kidneys after injection with the actinium ({sup 225}Ac) nanogenerator, an in vivo generator of {alpha}- and {beta}-particle emitting elements. Methods and Materials: The animals were injected with 0.35 {mu}Ci of the {sup 225}Ac nanogenerator, which delivers a dose of 27.6 Gy to the kidneys. Then, they were randomized to receive captopril (angiotensin-converting enzyme inhibitor), L-158,809 (angiotensin II receptor-1 blocker), spironolactone (aldosterone receptor antagonist), or a placebo. Results: Forty weeks after the {sup 225}Ac injection, the placebo-control mice showed a significant increase in blood urea nitrogen (BUN) (87.6 {+-} 6.9 mg/dL), dilated Bowman spaces, and tubulolysis with basement membrane thickening. Captopril treatment accentuated the functional (BUN 119.0 {+-} 4.0 mg/dL; p <0.01 vs. placebo controls) and histopathologic damage. In contrast, L-158,809 offered moderate protection (BUN 66.6 {+-} 3.9 mg/dL; p = 0.02 vs. placebo controls). Spironolactone treatment, however, significantly prevented the development of histopathologic and functional changes (BUN 31.2 {+-} 2.5 mg/dL; p <0.001 vs. placebo controls). Conclusions: Low-dose spironolactone and, to a lesser extent, angiotensin receptor-1 blockade can offer renal protection in a mouse model of internal {alpha}-particle irradiation.

  16. Stellar (n, ?)-cross sections of short-lived nuclei.

    NASA Astrophysics Data System (ADS)

    Käppeler, F.

    Stellar neutron capture cross sections are the essential input for investigating the element production via the slow neutron capture process (s-process). With the availability of accurate cross sections for the stable s-process isotopes, analyses of the abundance patterns in the various branchings of the s-process flow require also reliable cross sections for unstable nuclei with stellar half-lives down to a few days. This contribution deals with the question to which extent existing techniques can be applied for these cases, and whether a future radioactive ion beam could be used for the preparation of suited samples. As an example, recent measurements of the stellar (n, ?) cross section of 147Pm (t1/2 = 2.6 yr) are discussed.

  17. Harvard--MIT research program in short-lived radiopharmaceuticals

    SciTech Connect

    Not Available

    1991-03-01

    This report describes progress on five projects. The first project showed a 1000 fold concentration of the cationic complex {sup 99m}Tc (MIBI) in heart cell mitochondria vs heart cell cytoplasm, as determined by high resolution electron probe microanalysis. Additional technetium-99m based complexes are being developed and tested. The second project involves evaluating technetium acetylacteonates as potential indicators of cerebral blood flow. An intermediate in the synthesis of a technetium porphyrin complex has been synthesized; an oxotechnetium(V)-2,4-pentanedione complex has been prepared and is currently being characterized. The third project involves using radio labelled antibodies for diagnosis and treatment of cancer. An early discovery was that chloramine-T based iodination protocols resulted in a reversal of the charge on mouse lgGs. Immunoperoxidase-labelled monoclonal antibody MOv 18 was shown to bind specifically to the most frequent ovarian aderon carcinomas, and not to healthy tissue, making this antibody a good candidate for immunotherapy or immunodetection. Work on a specific immunotherapy protocol suffered a setback when one reagent, a {sup 125}I-biotin complex, proved to be unstable in vivo. The fourth project involves labelling antibodies with positron emitting radionuclides. Radiofluorination was accomplished through reductive alkylation of {sup 18}F-aldehyde, or pentafluorophenyl esters. Radioiodination was accomplished using alkyl-tin derivation exchange. The fifth project examined antibody modification for use in radioimmune imaging. Technetium-99m-labelled lgG was shown to be biologically equivalent to Indium-III-labelled lgG for imaging focal sites of inflamation. Also, Indium III labelling of small bioactive peptides was examined as a means of imaging important physiological processes. 44 refs., 2 figs.

  18. Probing short-lived fluctuations in hadrons and nuclei

    NASA Astrophysics Data System (ADS)

    Munier, Stéphane

    2015-04-01

    We develop a picture of dipole-nucleus (namely dilute-dense) and dipole-dipole (dilute-dilute) scattering in the high-energy regime based on the analysis of the fluctuations in the quantum evolution. We emphasize the difference in the nature of the fluctuations probed in these two processes respectively, which, interestingly enough, leads to observable differences in the scattering amplitude profiles.

  19. Short-lived radionuclides in nuclear medicine - II

    SciTech Connect

    Budinger, T.F.; Peng, C.T.

    1985-11-01

    Positron emission tomography (PET) has been applied effectively in the diagnosis of Alzheimer's disease, the prognosis of stroke, and the evaluation of the efficacy of tumor therapy. In addition, PET has been applied to studies of the neuroreceptor distribution in the human brain, to studies of epilepsy and congenital disorders of the brain, and to the study of flow and metabolism of the human heart muscle. Of the many current investigations of PET, the three discussed here are now of clinical importance for patient care.

  20. Short-lived ants take greater risks during food collection.

    PubMed

    Moro?, Dawid; Lenda, Magdalena; Skórka, Piotr; Woyciechowski, Micha?

    2012-12-01

    Life-history theory predicts that organisms should alter their behavior if life expectancy declines. Recent theoretical work has focused on worker life expectancy as an ultimate factor in allocating risk-related tasks among the workforce in social insects. A key prediction of this evolutionary model is that workers with shorter life expectancy should perform riskier tasks. We tested this hypothesis, using laboratory colonies of the ant Myrmica scabrinodis. We modified foraging so that it differed in level of risk by manipulating distances, temperatures, and the presence of competitors on foraging patches. The life expectancies of foragers were shortened by poisoning with carbon dioxide or by injury through removal of their propodeal spines. Both treatments significantly shortened worker life expectancy in comparison with untreated ants. We show, for the first time, that foragers with a shorter life expectancy foraged under risk more often than foragers in the control group. Thus, a worker's strategy of foraging under risky circumstances appears to be fine-tuned to its life expectancy. PMID:23149399

  1. Short-Lived Proton Entanglement in Yttrium Hydrides

    NASA Astrophysics Data System (ADS)

    Karlsson, E. B.; Abdul-Redah, T.; Udovic, T. J.; Hjörvarsson, B.; Chatzidimitriou-Dreismann, C. A.

    2002-10-01

    Previous experiments on NbH0.8 and PdH0.6 have shown large anomalies in the cross sections for protons, when studied by neutron Compton scattering. Here, these investigations are extended to the metallic hydrides YH2, YH3, YD2, YD3, and Y(HxD1-x)3. Considerably reduced cross sections for hydrogen are observed both in YH2 and YH3, but only minor ones for YD2 and YD3. The scattering time depends on the neutron scattering angle, which allows a time-differential analysis where the time window lies around one femtosecond. The anomalies persist longer in YH2 and YH3 than in NbH0.8 and PdHo.6 The reduced cross sections are interpreted as a result of quantum entanglement between protons, surviving for a few fs in the solids.

  2. Short-lived proton entanglement in yttrium hydrides

    NASA Astrophysics Data System (ADS)

    Karlsson, E. B.; Abdul-Redah, T.; Udovic, T. J.; Hjörvarsson, B.; Chatzidimitriou-Dreismann, C. A.

    Earlier experiments on NbH0.8 and PdH0.6 have shown large anomalies in the cross sections for protons, when studied by neutron Compton scattering. Here, these investigations are extended to the metallic hydrides YH2, YH3, YD2, YD3, and Y(HxD1-x)3. Strongly reduced cross sections for hydrogen are observed both in YH2 and YH3, but only minor ones for YD2 and YD3. The scattering time depends on the neutron-scattering angle, which allows a time-differential analysis where the time window lies at around one femtosecond. The anomalies persist longer in YH2 and YH3 than in NbH0.8 and PdH0.6. The reduced cross sections are interpreted as a result of quantum entanglement between protons, surviving for a few femtoseconds in the solids.

  3. Cosmic crystallography using short-lived objects - Active Galactic Nuclei

    Microsoft Academic Search

    Andrzej Marecki; B. F. Roukema; Stanislaw Bajtlik

    2005-01-01

    Cosmic crystallography is based on the principle that peaks in the pair separation histogram (PSH) of objects in a catalogue should be induced by the high number of topologically lensed pairs that are separated by Clifford translations, in excess to ``random'' pairs of objects. Here we present modifications of this method that successively improve the signal-to-noise ratio by removing a

  4. Production of short-lived radiopharmaceuticals for pet

    NASA Astrophysics Data System (ADS)

    Schlyer, David J.

    1987-04-01

    Research projects currently being undertaken in the area of postron emission tomography (PET), require the use of very high specific activity radiopharmaceuticals. The cyclotron targetry necessary to produce near carrier free radiopharmaceuticals has posed some interesting and challenging problems in target design and construction. Radionuclides are produced at Brookhaven from gas, liquid and solid targets. Each of these phases of matter has its own special problems associated with it. Besides the normal design considerations such as heat transfer, density reduction and beam scattering, other factors such as radiation damage to metal surfaces, surface wetting angles, transport line materials and solder fluxes must also be taken in account in the design of the target. The most difficult target in which to maintain the isotopic purity has proven to be the 11C from nitrogen gas target. The most difficult target in which to maintain the chemical form and reactivity over long periods of time is the 18F from 18O water target. These targets and the design consideration which went into them are discussed in detail.

  5. Tropospheric Ozone as a Short-lived Chemical Climate Forcer

    NASA Technical Reports Server (NTRS)

    Pickering, Kenneth E.

    2012-01-01

    Tropospheric ozone is the third most important greenhouse gas according to the most recent IPCC assessment. However, tropospheric ozone is highly variable in both space and time. Ozone that is located in the vicinity of the tropopause has the greatest effect on climate forcing. Nitrogen oxides (NOx) are the most important precursors for ozone In most of the troposphere. Therefore, pollution that is lofted upward in thunderstorm updrafts or NOx produced by lightning leads to efficient ozone production in the upper troposphere, where ozone is most important climatically. Global and regional model estimates of the impact of North American pollution and lightning on ozone radiative forcing will be presented. It will be shown that in the Northern Hemisphere summer, the lightning effect on ozone radiative forcing can dominate over that of pollution, and that the radiative forcing signal from North America extends well into Europe and North Africa. An algorithm for predicting lightning flash rates and estimating lightning NOx emissions is being incorporated into the NASA GEOS-5 Chemistry and Climate Model. Changes in flash rates and emissions over an ENSO cycle and in future climates will be assessed, along with the resulting changes in upper tropospheric ozone. Other research on the production of NOx per lightning flash and its distribution in the vertical based on cloud-resolving modeling and satellite observations will be presented. Distributions of NO2 and O3 over the Middle East from the OMI instrument on NASA's Aura satellite will also be shown.

  6. Life Extension in the Short-Lived Fish Nothobranchius furzeri

    Microsoft Academic Search

    Alessandro Cellerino

    \\u000a Genetic and pharmacological research on aging is hampered by the life span of available vertebrate models. We recently initiated\\u000a studies on Nothobranchius furzeri, a species with a maximum life expectancy in captivity of just 3 months, the shortest documented captive life span for a vertebrate.\\u000a Further research on N. furzeri has demonstrated the following:\\u000a \\u000a \\u000a \\u000a 1. \\u000a \\u000a Short life span correlates with

  7. ChemTeacher: Alpha Decay

    NSDL National Science Digital Library

    2011-01-01

    ChemTeacher compiles background information, videos, articles, demonstrations, worksheets and activities for high school teachers to use in their classrooms. The Alpha Decay page includes resources for teaching students about the discovery and applications of alpha decay.

  8. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  9. PGC-1alpha: turbocharging mitochondria.

    PubMed

    Houten, Sander M; Auwerx, Johan

    2004-10-01

    PGC-1alpha plays essential and diverse functions in the control of metabolism ranging from mitochondrial biogenesis and respiration to hepatic gluconeogenesis and muscle fiber-type switching. In a paper in this issue of Cell, the characterization of PGC-1alpha(-/-) mice illustrates these pleiotropic functions and reveals an unexpected role for PGC-1alpha in the brain. PMID:15454076

  10. High-Linear Energy Transfer Irradiation Targeted to Skeletal Metastases by the Alpha Emitter Ra-223: Adjuvant or Alternative to Conventional Modalities?

    SciTech Connect

    Bruland, Oyvind S.; Nilsson, Sten; Fisher, Darrell R.; Larsen, Roy H.

    2006-10-15

    The bone-seeking, alpha-particle emitting radiopharmaceutical Alpharadin, 223RaCl2 (t1/2 = 11.4 days) is under clinical development as a novel treatment for skeletal metastases from breast and prostate cancer. This paper summarizes the current status of preclinical and clinical research on 223RaCl2. Potential advantages of 223Ra to that of external beam irradiation or registered beta-emitting bone-seekers are discussed. Published data of 223Ra dosimetry in mice and a therapeutic study in a skeletal metastases model in nude rats have indicated significant therapeutic potential of bone-seeking alpha-emitters. This paper provides short-term and long-term results from the first clinical single dosage trial. We present data from a repeated dosage study of five consecutive injections of 50 kBq/kg bodyweight, once every third week, or two injections of 125 kBq/kg bodyweight, six weeks apart. Furthermore, preliminary results are given for a randomized phase II trial involving 64 patients with hormone-refractory prostate cancer and painful skeletal metastases who received four monthly injections of 223Ra or saline as an adjuvant to external beam radiotherapy. Also presented are preliminary dose estimates for 223Ra in humans. Results indicate that repeated dosing is feasible and that opportunities are available for combined treatment strategies.

  11. Effects of abscisic Acid and ethylene on the gibberellic Acid-induced synthesis of alpha-amylase by isolated wheat aleurone layers.

    PubMed

    Varty, K; Arreguín, B L; Gómez, M T; López, P J; Gómez, M A

    1983-11-01

    Gibberellic acid-induced alpha-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of alpha-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. alpha-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of alpha-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of alpha-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene.The rate of incorporation of [methyl-(14)C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of alpha-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  12. An alpha scintillation spectrometer

    E-print Network

    Yates, Ralph Aaron

    1952-01-01

    . Uranium 1'hick Uranium sources were tested to determine if any differences would exist between the oulse height distribution oi' thick Uranium and Thorium sources. Sources were prepared by placing small pieces of Uranium nitrate, UO2 (NO3)2 6H20, on a... phosphor covered light-piper. The ten different energy alpha particles that were emitted from the Uranium were blended into a continuous distribution, there being no apparent difference between this and the thick Thorium distribution. The same was true...

  13. An alpha scintillation spectrometer 

    E-print Network

    Yates, Ralph Aaron

    1952-01-01

    . Uranium 1'hick Uranium sources were tested to determine if any differences would exist between the oulse height distribution oi' thick Uranium and Thorium sources. Sources were prepared by placing small pieces of Uranium nitrate, UO2 (NO3)2 6H20, on a... phosphor covered light-piper. The ten different energy alpha particles that were emitted from the Uranium were blended into a continuous distribution, there being no apparent difference between this and the thick Thorium distribution. The same was true...

  14. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  15. Induction of lymphoma and osteosarcoma in mice by single and protracted low alpha doses

    SciTech Connect

    Mueller, W.A.L.; Luz, A.; Murray, A.B.; Linzner, U. (Gesellschaft fuer Strahlen- und Umweltforschung, Neuherberg (Germany, F.R.))

    1990-09-01

    Internal doses from the short-lived alpha-emitter 22Ra were given to 4-wk-old female mice. One group of about 300 animals received a single injection of 18.5 kBq 22Ra kg-1 body weight, corresponding to a mean skeletal alpha dose of 0.15 Gy. A second group of about 300 animals received the same total amount of 224Ra in the form of 72 fractions of 257 Bq kg-1 each, applied twice weekly during 36 wk. The fractionated group received the same final mean total skeletal dose of 0.15 Gy as the single injected group, but with a mean skeletal dose rate of 1 mGy d-1. A rather high incidence, 13.5% (40/296), of early malignant lymphomas was observed in the fractionated group during and shortly after the injection period, followed by a 7% incidence (21/296) of osteosarcomas during the second half of the animals' lifetime. The group with a single injection did not develop early lymphomas but did develop osteosarcomas later with an incidence of 5.8% (17/295). The occurrence of osteosarcomas was similar up to day 800 in the two experimental groups. Surprisingly, however, after this period no additional case of osteosarcoma was observed in the single-injected group, whereas one-third of all osteosarcomas occurred after day 800 in the protracted group. The additional later occurrence of osteosarcomas occurred after indicates a longer lasting induction effect on osteosarcomas, or a promoting effect in older age, for this kind of treatment.

  16. Alpha:2n:alpha molecular band in 10Be.

    PubMed

    Freer, M; Casarejos, E; Achouri, L; Angulo, C; Ashwood, N I; Curtis, N; Demaret, P; Harlin, C; Laurent, B; Milin, M; Orr, N A; Price, D; Raabe, R; Soi?, N; Ziman, V A

    2006-02-01

    The 10.15 MeV resonance in 10Be has been probed via resonant 6He+4He elastic scattering. It is demonstrated that it is the Jpi=4+ member of a rotational band built on the 6.18 MeV 0+ state. A Gammaalpha of 0.10-0.13 MeV and Gammaalpha/Gamma=0.35-0.46 were deduced. The corresponding reduced alpha width, gamma2alpha, indicates one of the largest alpha-cluster spectroscopic factors known. The deformation of the band, including the 7.54 MeV, 2+ member, is large (h2/2I=200 keV). Such a deformation and the significant degree of clusterization signals a well-developed alpha:2n:alpha molecular structure. PMID:16486811

  17. alpha_S and Power Corrections from JADE

    E-print Network

    Fernández, P A M

    2002-01-01

    Re-analysed JADE data were used to determine alpha_S at sqrt{s} = 14-44 GeV on the basis of resummed calculations for event shapes and hadronisation models tuned to LEP data. The combined result is alpha_S(M_Z) = 0.1194 +/- 0.0082/0.0068 which is consistent with the world average. Event shapes have also been used to test power corrections based on an analytical model and to verify the gauge structure of QCD. The only non-perturbative parameter alpha_0 of the model was measured to alpha_0(2GeV) = 0.503 +/- 0.066/0.045 and is found to be universal within the total errors.

  18. alpha_S and Power Corrections from JADE

    E-print Network

    P. A. Movilla Fernandez

    2002-09-13

    Re-analysed JADE data were used to determine alpha_S at sqrt{s} = 14-44 GeV on the basis of resummed calculations for event shapes and hadronisation models tuned to LEP data. The combined result is alpha_S(M_Z) = 0.1194 +/- 0.0082/0.0068 which is consistent with the world average. Event shapes have also been used to test power corrections based on an analytical model and to verify the gauge structure of QCD. The only non-perturbative parameter alpha_0 of the model was measured to alpha_0(2GeV) = 0.503 +/- 0.066/0.045 and is found to be universal within the total errors.

  19. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  20. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  1. Live! From 2-Alpha

    NSDL National Science Digital Library

    This activity is one of several in which students are required to access and analyze actual data from NASA missions, including video "interviews" with real NASA scientists, to solve a mystery. In this mystery, students learn about the force of gravity and how scientists analyze data by studying the properties of different objects in space. Live! From 2-Alpha can be used to support instruction about forces and motion, origin and evolution of the universe, and the interaction of energy and matter. This activity is one of several in "Space Mysteries," a series of inquiry-driven, interactive Web explorations. Each Mystery in "Space Mysteries" is designed to teach at least one physical science concept (e.g. interactions of energy and matter, structures and properties of matter, energy, motion, or forces), and is accompanied by materials to be used by classroom teachers.

  2. Quantum electrodynamics $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$ corrections to the fine splitting in Li and Be$^+$

    E-print Network

    Puchalski, Mariusz

    2015-01-01

    We derive quantum electrodynamics corrections to the fine structure in three-electron atomic systems at $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$ orders and present their numerical evaluations for the Li atom and Be$^+$ ion.

  3. THE COMPLEX FATE OF ALPHA-KETOACIDS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant cells are unique in that they contain four species of alpha-ketoacid dehydrogenase complex: plastidial pyruvate dehydrogenase, mitochondrial pyruvate dehydrogenase, alpha-ketoglutarate (2-oxoglutarate) dehydrogenase, and branched-chain alpha-ketoacid dehydrogenase. All complexes include multi...

  4. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610...Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes...

  5. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610...Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes...

  6. How Is Alpha-1 Antitrypsin Deficiency Diagnosed?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Diagnosed? Alpha-1 antitrypsin (AAT) deficiency usually is diagnosed after you ... Rate This Content: NEXT >> October 11, 2011 Alpha-1 Antitrypsin Deficiency Clinical Trials Clinical trials are research ...

  7. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePLUS

    Alpha-1 Antitrypsin Deficiency Chronic obstructive pulmonary disease or COPD for short is a lung disease that affects millions ... The inherited form of emphysema is called Alpha-1 Antitrypsin Deficiency or " Alpha-1 " for short. People ...

  8. Efficacy of astatine-211-labeled monoclonal antibody in treatment of murine T-cell lymphoma

    SciTech Connect

    Harrison, A.; Royle, L.

    1987-01-01

    The short-lived isotope /sup 211/At (half-life, 7.2 hr), an alpha particle-emitting halogen, has been attached to a monoclonal antibody (anti-thy 1.1, IgG1, OX7) and used in mice in the treatment of a thy 1.1 T-cell lymphoma (A120). Forty-eight hours after receiving an iv injection of 10(3) or 10(5) A120 cells, mice were treated with phosphate-buffered saline, /sup 211/At-, antibody alone, or /sup 211/At conjugated to OX7. Treatment with the /sup 211/At-labeled OX7 conjugate increased the median survival time of mice and probably cured (survival at 200 days) 6 of the 15 mice given 10(5) cells and 21 of the 27 mice given 10(3) cells.

  9. Alpha detection on moving surfaces

    SciTech Connect

    MacArthur, D. [Los Alamos National Lab., NM (United States); Orr, C.; Luff, C. [BNFL Instruments Ltd., Sellafield (United Kingdom)

    1998-12-01

    Both environmental restoration (ER) and decontamination and decommissioning (D and D) require characterization of large surface areas (walls, floors, in situ soil, soil and rubble on a conveyor belt, etc.) for radioactive contamination. Many facilities which have processed alpha active material such as plutonium or uranium require effective and efficient characterization for alpha contamination. Traditional methods for alpha surface characterization are limited by the short range and poor penetration of alpha particles. These probes are only sensitive to contamination located directly under the probe. Furthermore, the probe must be held close to the surface to be monitored in order to avoid excessive losses in the ambient air. The combination of proximity and thin detector windows can easily cause instrument damage unless extreme care is taken. The long-range alpha detection (LRAD) system addresses these problems by detecting the ions generated by alpha particles interacting with ambient air rather than the alpha particle directly. Thus, detectors based on LRAD overcome the limitations due to alpha particle range (the ions can travel many meters as opposed to the several-centimeter alpha particle range) and penetrating ability (an LRAD-based detector has no window). Unfortunately, all LRAD-based detectors described previously are static devices, i.e., these detectors cannot be used over surfaces which are continuously moving. In this paper, the authors report on the first tests of two techniques (the electrostatic ion seal and the gridded electrostatic LRAD detector) which extend the capabilities of LRAD surface monitors to use over moving surfaces. This dynamic surface monitoring system was developed jointly by Los Alamos National Laboratory and at BNFL Instruments. All testing was performed at the BNFL Instruments facility in the UK.

  10. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  11. Rapid identification and analysis of airborne plutonium using a combination of alpha spectroscopy and inductively coupled plasma mass spectrometry.

    PubMed

    Farmer, Dennis E; Steed, Amber C; Sobus, Jon; Stetzenbach, Klaus; Lindley, Kaz; Hodge, Vernon F

    2003-10-01

    Recent wildland fires near two U.S. nuclear facilities point to a need to rapidly identify the presence of airborne plutonium during incidents involving the potential release of radioactive materials. Laboratory turn-around times also need to be shortened for critical samples collected in the earliest stages of radiological emergencies. This note discusses preliminary investigations designed to address both these problems. The methods under review are same day high-resolution alpha spectroscopy to screen air filter samples for the presence of plutonium and inductively coupled plasma mass spectrometry to perform sensitive plutonium analyses. Thus far, using modified alpha spectroscopy techniques, it has been possible to reliably identify the approximately 5.2 MeV emission of 239Pu on surrogate samples (air filters artificially spiked with plutonium after collection) even though the primary alpha-particle emissions of plutonium are, as expected, superimposed against a natural alpha radiation background dominated by short-lived radon and thoron progeny (approximately 6-9 MeV). Several processing methods were tested to prepare samples for analysis and shorten laboratory turn-around time. The most promising technique was acid-leaching of air filter samples using a commercial open-vessel microwave digestion system. Samples prepared in this way were analyzed by both alpha spectroscopy (as a thin-layer iron hydroxide co-precipitate) and inductively coupled plasma mass spectrometry. The detection levels achieved for 239Pu--approximately 1 mBq m(-3) for alpha spectroscopy screening, and, < 0.1 mBq m(-3) for inductively coupled plasma mass spectrometry analysis--are consistent with derived emergency response levels based on EPA's Protective Action Guides, and samples can be evaluated in 36 to 72 h. Further, if samples can be returned to a fixed-laboratory and processed immediately, results from mass spectrometry could be available in as little as 24 h. When fully implemented, these techniques have the potential to provide useful information and improved operational flexibility to emergency planners and first-responders during radiological emergencies. PMID:13678286

  12. Measurement of alpha_S in e+e- collisions at LEP and JADE

    E-print Network

    J. Schieck

    2006-10-06

    Data from e+e- annihilation into hadrons collected by the JADE, the L3 and the OPAL experiment at centre-of-mass energies between 14 GeV and 209 GeV are used to determine the strong coupling alpha_S. Observables in leading order sensitive to alpha_S as well as alpha_S**2 are used. The evolution of alpha_S with respect to the centre-of-mass energy as predicted by QCD is studied and confirmed with high precision. All measurements of alpha_S are consistent with the current world average.

  13. Measurement of alpha_S in e+e- collisions at LEP and JADE

    E-print Network

    Schieck, J

    2007-01-01

    Data from e+e- annihilation into hadrons collected by the JADE, the L3 and the OPAL experiment at centre-of-mass energies between 14 GeV and 209 GeV are used to determine the strong coupling alpha_S. Observables in leading order sensitive to alpha_S as well as alpha_S**2 are used. The evolution of alpha_S with respect to the centre-of-mass energy as predicted by QCD is studied and confirmed with high precision. All measurements of alpha_S are consistent with the current world average.

  14. I. Excluded Volume Effects in Ising Cluster Distributions and Nuclear Multifragmentation II. Multiple-Chance Effects in Alpha-Particle Evaporation

    SciTech Connect

    Breus, Dimitry E.

    2005-05-16

    In Part 1, geometric clusters of the Ising model are studied as possible model clusters for nuclear multifragmentation. These clusters may not be considered as non-interacting (ideal gas) due to excluded volume effect which predominantly is the artifact of the cluster's finite size. Interaction significantly complicates the use of clusters in the analysis of thermodynamic systems. Stillinger's theory is used as a basis for the analysis, which within the RFL (Reiss, Frisch, Lebowitz) fluid-of-spheres approximation produces a prediction for cluster concentrations well obeyed by geometric clusters of the Ising model. If thermodynamic condition of phase coexistence is met, these concentrations can be incorporated into a differential equation procedure of moderate complexity to elucidate the liquid-vapor phase diagram of the system with cluster interaction included. The drawback of increased complexity is outweighted by the reward of greater accuracy of the phase diagram, as it is demonstrated by the Ising model. A novel nuclear-cluster analysis procedure is developed by modifying Fisher's model to contain cluster interaction and employing the differential equation procedure to obtain thermodynamic variables. With this procedure applied to geometric clusters, the guidelines are developed to look for excluded volume effect in nuclear multifragmentation. In part 2, an explanation is offered for the recently observed oscillations in the energy spectra of {alpha}-particles emitted from hot compound nuclei. Contrary to what was previously expected, the oscillations are assumed to be caused by the multiple-chance nature of {alpha}-evaporation. In a semi-empirical fashion this assumption is successfully confirmed by a technique of two-spectra decomposition which treats experimental {alpha}-spectra has having contributions from at least two independent emitters. Building upon the success of the multiple-chance explanation of the oscillations, Moretto's single-chance evaporation theory is augmented to include multiple-chance emission and tested on experimental data to yield positive results.

  15. Inflaton decay in an alpha vacuum

    Microsoft Academic Search

    Siddartha Naidu; Richard Holman

    2005-01-01

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show

  16. alphaCertified Jonathan D. Hauenstein

    E-print Network

    Sottile, Frank

    Certified The program alphaCertified by Jonathan D. Hauenstein and Frank Sottile implements algorithms based on Smale's -theory to certify solutions to polynomial systems. This manual provides de- tailed instructions on how alphaCertified. 2 Compiling alphaCertified The program alphaCertified is written in C and uses the GMP[3

  17. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  18. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent in reducing cell proliferation and the expression of the CD36 scavenger receptor than the un-phosphorylated alpha-tocopherol (alpha T). We have now assessed the effects of alpha T an...

  19. Alpha Chain Structures of ^{12}C

    E-print Network

    Suk-Ho Hong; Suk-Joon Lee

    1999-03-01

    N-\\alpha structures of light nuclei with axial symmetry are studied using relativistic Hartree approximation. Metastable excited states are searched in a configuration space which allows linear alpha chain structures. As a result, it is shown that ^{12}C has ^8Be + \\alpha resonance state at about 1 MeV above ^8Be-\\alpha threshold as an asymmetric 3-\\alpha linear-chain structure, which plays an important role in stellar nucleosynthesis.

  20. Alpha-factor structural gene mutations in Saccharomyces cerevisiae: effects on alpha-factor production and mating.

    PubMed Central

    Kurjan, J

    1985-01-01

    The role of alpha-factor structural genes MF alpha 1 and MF alpha 2 in alpha-factor production and mating has been investigated by the construction of mf alpha 1 and mf alpha 2 mutations that totally eliminate gene function. An mf alpha 1 mutant in which the entire coding region is deleted shows a considerable decrease in alpha-factor production and a 75% decrease in mating. Mutations in mf alpha 2 have little or no effect on alpha-factor production or mating. The mf alpha 1 mf alpha 2 double mutants are completely defective in mating and alpha-factor production. These results indicate that at least one alpha-factor structural gene product is required for mating in MAT alpha cells, that MF alpha 1 is responsible for the majority of alpha-factor production, and that MF alpha 1 and MF alpha 2 are the only active alpha-factor genes. Images PMID:3887136

  1. Alpha effects on TAE modes and alpha transport

    Microsoft Academic Search

    C. Z. Cheng; G. Y. Fu; H. E. Mynick; R. Budny; R. B. White; S. J. Zweben; C. T. Hsu; D. J. Sigmar; D. A. Spong; B. A. Carreras; C. L. Hedrick

    1992-01-01

    In a fusion reactor, any unanticipated loss of alpha power could result in serious wall damage, impurity influx, major operational control problems, and even a failure to sustain ignition. Neutral beam injection (NBI) experiments in large tokamaks have indicated that toroidicity-induced Alfven eigenmode (TAE) can be strongly unstable and cause the loss of about half of the fast beam ions.

  2. Assignments of Jpi in 58Ni via (alpha, alpha') and (6Li, d) reactions

    Microsoft Academic Search

    G. Guillaume; F. C. Jundt; H. W. Fulbright; J. C. D. Milton; C. L. Bennett

    1977-01-01

    Measurements of 58Ni(alpha, alpha')58Ni angular distributions have been extended to small angles and disagreements between Jpi assignments based on earlier (alpha, alpha'), and (6Li, d) measurements have been explained and resolved. NUCLEAR REACTIONS 58Ni(alpha, alpha'), Ealpha=30 MeV; measured dsigmadOmega, deduced Jpi for 5.59 and 6.02 MeV levels.

  3. Inflaton decay in an alpha vacuum

    SciTech Connect

    Naidu, S.; Holman, R. [Department of Physics, Carnegie Mellon University, Pittsburgh Pennsylvania 15213 (United States)

    2005-03-15

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show that it leads to an alpha independent result. This result suggests that it may be possible to calculate in any alpha vacuum if we employ the appropriate causality preserving prescription.

  4. Inflaton decay in an alpha vacuum

    NASA Astrophysics Data System (ADS)

    Naidu, S.; Holman, R.

    2005-03-01

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show that it leads to an alpha independent result. This result suggests that it may be possible to calculate in any alpha vacuum if we employ the appropriate causality preserving prescription.

  5. Experience with alpha track detectors

    Microsoft Academic Search

    R. A. Oswald; R. V. Wheeler; C. Yoder

    1988-01-01

    The heightened awareness of radon hazards have resulted in an increase in the use of alpha track detectors. Field and laboratory tests have been conducted over sufficiently long periods of time by enough different laboratories so that characteristics of these detectors are better understood. The paper compares common experiences of Terradex Radtrak and Type SF detectors. Both detectors employ the

  6. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  7. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  8. LAMBDA ALPHA GRADUATE RESEARCH GRANTS

    E-print Network

    Tennessee, University of

    ) for the National Executive Council of the following materials printed front-to-back and stapled, with NO covers to the National Office before the postmarked March 1st deadline 4 copies (one original and 3 copies). Please mail materials to: Lambda Alpha National Office c/o Mrs. Barbara Di Fabio Department

  9. Alpha Testing Escape from Diab

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...

  10. Evaluation of internal alpha-particle radiation exposure and subsequent fertility among a cohort of women formerly employed in the radium dial industry.

    PubMed

    Schieve, L A; Davis, F; Roeske, J; Handler, A; Freels, S; Stinchcomb, T; Keane, A

    1997-02-01

    This study examined the effect of internal exposure to alpha-particle radiation on subsequent fertility among women employed in the radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n = 603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of alpha particles emitted, fraction of energy absorbed within the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of gamma-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility. PMID:9008216

  11. Evaluation of internal alpha-particle radiation exposure and subsequent fertility among a cohort of women formerly employed in the radium dial industry

    SciTech Connect

    Schieve, L.A.; Davis, F.; Freels, S. [Univ. of Illinois, Chicago, IL (United States)] [and others

    1997-02-01

    This study examined the effect of internal exposure to {alpha}-particle radiation on subsequent fertility among women employed in radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n = 603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of {alpha} particles emitted, fraction of energy absorbed within the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of {gamma}-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility. 42 refs., 5 tabs.

  12. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate in thp-1 monocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent than the un-phosphorylated alpha alpha-tocopherol (alphaT). We have now measured plasma levels of alphaTP and compared the cellular effects of alphaTP and gamma-tocopheryl phosphate ...

  13. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  14. 10 CFR 72.54 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  15. 10 CFR 40.42 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  16. 10 CFR 40.42 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  17. 10 CFR 30.36 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  18. 10 CFR 72.54 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  19. 10 CFR 70.38 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  20. 10 CFR 40.42 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  1. 10 CFR 30.36 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  2. 10 CFR 72.54 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  3. 10 CFR 72.54 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  4. 10 CFR 30.36 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  5. 10 CFR 40.42 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  6. 10 CFR 40.42 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  7. 10 CFR 70.38 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  8. 10 CFR 70.38 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  9. 10 CFR 30.36 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  10. 10 CFR 30.36 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  11. 10 CFR 70.38 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  12. 10 CFR 72.54 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  13. 10 CFR 70.38 - Expiration and termination of licenses and decommissioning of sites and separate buildings or...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...allowing short-lived radionuclides to decay; (4) Whether a significant reduction...allowing short-lived radionuclides to decay; and (5) Other site-specific factors...of radioactivity, including alpha and beta, in units of megabecquerels...

  14. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  15. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  16. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  17. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  18. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePLUS

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  19. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  20. Genetics Home Reference: Alpha-1 antitrypsin deficiency

    MedlinePLUS

    ... Where can I find information about diagnosis or management of alpha-1 antitrypsin deficiency? These resources address the diagnosis or management of alpha-1 antitrypsin deficiency and may include ...

  1. Activation of local and systemic anti-tumor immune responses by ablation of solid tumors with intratumoral electrochemical or alpha radiation treatments.

    PubMed

    Keisari, Yona; Hochman, Ilan; Confino, Hila; Korenstein, Rafi; Kelson, Itzhak

    2014-01-01

    Cancer, the most devastating chronic disease affecting humankind, is treated primarily by surgery, chemotherapy, and radiation therapy. Surgery and radiotherapy are mainly used for debulking the primary tumor, while chemotherapy is the most efficient anti-metastatic treatment. To control better metastatic cancer, the host immune system should be stimulated. Yet, successful specific stimulation of the immune system against tumors was seldom achieved even in antigenic tumors. Our working hypothesis is that aggressive in situ tumor ablation can release tumor antigens and danger signals, which will enhance anti-tumor T cell responses resulting in the destruction of residual malignant cells in primary tumors and distant metastases. We developed two efficient in situ ablation treatments for solid cancer, which can be used to destroy the primary tumors and stimulate anti-tumor immune responses. The first treatment, electrochemical ablation, is applied through intratumoral electrodes, which deliver unipolar-pulsed electric currents. The second treatment, diffusing alpha-emitters radiation therapy (DaRT), is based on intratumoral (224)Ra-loaded wire(s) that release by recoil its daughter atoms. These short-lived alpha-emitting atoms spread in the tumor and spray it with lethal alpha particles. It was confirmed that these treatments effectively destroy various malignant animal and human primary solid tumors. As a consequence of such tumor ablation, tumor-derived antigenic material was released and provoked systemic T cell-dependent anti-tumor immunological reactions. These reactions conferred protection against a secondary tumor challenge and destroyed remaining malignant cells in the primary tumor as well as in distant metastases. Such anti-tumor immune responses could be further amplified by the immune adjuvant, CpG. Electrochemical ablation or DaRT together with chemotherapy and immunostimulatory agents can serve as treatment protocols for solid metastatic tumors and can be applied instead of or in combination with surgery. PMID:23955682

  2. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  3. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  4. cap alpha. Particle confinement in compact tori

    Microsoft Academic Search

    Bozhokin

    1986-01-01

    The motion of high-energy ..cap alpha.. particles in compact tori is studied. The classically accessible regions of motion of charged particles are found. The conditions are formulated under which the ..cap alpha.. particles produced in fusion reactions are absolutely confined. An ..cap alpha.. particle starting in a region enclosed by a ''critical'' surface will never, in the course of its

  5. Phi Alpha Theta Beta Iota Chapter

    E-print Network

    Martinez, Tony R.

    Phi Alpha Theta Beta Iota Chapter Membership Application If everyone can help in some capacity, Phi Alpha Theta will be a success! Check if you would like to help with the following: _____Activities:_________________ Attach a check for $45 made payable to Phi Alpha Theta and give to the History Department receptionist

  6. Nonsingular $\\alpha$-rigid maps: Short proof

    E-print Network

    Ageev, Oleg N

    2009-01-01

    It is shown that for every $\\alpha$, where $\\alpha\\in [0, 1/2]$, there exists an $\\alpha$-rigid transformation whose spectrum has Lebesgue component. This answers the question posed by Klemes and Reinhold in [7]. We apply a certain correspondence between weak limits of powers of a transformation and its skew products.

  7. Refinement of the $n-\\alpha$ and $p-\\alpha$ fish-bone potential

    E-print Network

    Smith, E; Papp, Z

    2012-01-01

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the $n-\\alpha$ and $p-\\alpha$ fish-bone potential by simultaneously fitting to the experimental phase shifts. We found that with a double Gaussian parametrization of the local potential can describe the $n-\\alpha$ and $p-\\alpha$ phase shifts for all partial waves.

  8. 17Alpha Centauri Bb -a nearby extrasolar planet? Alpha Centauri is a binary

    E-print Network

    17Alpha Centauri Bb - a nearby extrasolar planet? Alpha Centauri is a binary star system located 4 at La Silla in Chile to detect the tell-tail motion of Alpha Centauri B caused by an earth-sized planet in close orbit around this star. The planet, called Alpha Centauri Bb, orbits at a distance of only six

  9. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  10. Counting particles emitted by stratospheric aircraft and measuring size of particles emitted by stratospheric aircraft. Final technical report, 1 May 1990-31 December 1992

    SciTech Connect

    Wilson, J.C.

    1994-04-01

    The ER-2 condensation nuclei counter (CNC) has been modified to reduce the diffusive losses of particles within the instrument. These changes have been successful in improving the counting efficiency of small particles at low pressures. Two techniques for measuring the size distributions of particles with diameters less than 0.17 micrometers have been evaluated. Both of these methods, the differential mobility analyzer (DMA) and the diffusion battery, have fundamental problems that limit their usefulness for stratospheric applications. The authors cannot recommend either for this application. Newly developed, alternative methods for measuring small particles include inertial separation with a low-loss critical orifice and thin-plate impactor device. This technique is now used to collect particles in the multisample aerosol collector housed in the ER-2 CNC-2, and shows some promise for particle size measurements when coupled with a CNC as a counting device. The modified focused-cavity aerosol spectrometer (FCAS) can determine the size distribution of particles with ambient diameters as small as about 0.07 micrometers. Data from this instrument indicates the presence of a nuclei mode when CNC-2 indicates high concentrations of particles, but cannot resolve important parameters of the distribution.

  11. Effects of pre-equilibrium nucleon emission on excitation functions of various reactions in vanadium induced by alpha particles

    Microsoft Academic Search

    N L Singh; S Mukherjee; A V Mohan Rao; L Chaturvedi; P P Singh

    1995-01-01

    Excitation functions for the 51V(( alpha ,n), ( alpha ,3n), ( alpha ,p3n), ( alpha ,p6n), ( alpha , alpha 3n), ( alpha , alpha 2pn), ( alpha ,2 alpha ), ( alpha ,2 alpha n) and ( alpha ,2 alpha 3n)) reactions have been measured up to 120 MeV using the stacked foil technique with a view to improving

  12. {alpha}-particle spectrum in the reaction p + {sup 11}B {yields} {alpha} + {sup 8}Be* {yields} 3{alpha}

    SciTech Connect

    Dmitriev, V. F., E-mail: dmitriev@inp.nsk.s [Budker Institute of Nuclear Physics (Russian Federation)

    2009-07-15

    Using a simple phenomenological parametrization of the reaction amplitude we calculated {alpha}-particle spectrumin the reaction p + {sup 11}B {yields} {alpha} + {sup 8}Be* {yields} 3{alpha} at the resonance proton energy of 675 keV. The parametrization includes Breit-Wigner factor with an energy-dependent width for intermediate {sup 8}Be* state and the Coulomb and the centrifugal factors in {alpha}-particle-emission vertices. The shape of the spectrum consists of a well-defined peak corresponding to emission of the primary {alpha} and a flat shoulder going down to very low energy. We found that below 1.5MeV there are 17.5% of {alpha}'s and below 1MeV there are 11% of them.

  13. Alpha-plutonium's Grüneisen parameter.

    PubMed

    Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert

    2010-04-28

    Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals. PMID:21386421

  14. Adult chicken alpha-globin genes alpha A and alpha D: no anemic shock alpha-globin exists in domestic chickens.

    PubMed

    Dodgson, J B; McCune, K C; Rusling, D J; Krust, A; Engel, J D

    1981-10-01

    Three alpha-type globin genes have been identified in the alpha-globin linkage group of chickens. No other alpha-type genes hae been directly shown to be within 10 kilobase pairs of any of these three closely linked genes. These three genes have been conclusively identified by DNA sequence analysis. The gene at the 5' end of the linkage group is an embryonic alpha-type globin gene, pi or pi', and the central gene corresponds to the minor adult alpha- globin, alpha D. The 3'-terminal gene sequence corresponds to the sequence of cDNA clones previously described as "alpha S", presumed anemic shock-induced alpha-globin gene [Salser, W. A., Cummings, I., Liu, A., Strommer, J., Padayatty, J. & Clarke, P. (1979) in Cellular and Molecular Regulation of Hemoglobin Switching, eds. Stamatoyannopoulos, G. & Nienheis, A. (Grune and Stratton, New York), pp. 621-643; Richards, R. I. & Wells, J. R. E. (1980) J. Biol. Chem. 255, 9306-9311]. Several groups of workers have isolated alpha S-type cDNA clones but no one has identified a cDNA clone corresponding to the published amino acid sequence of the major chicken alpha-globin, alpha A. We have identified the alpha S-type sequence as the only abundant alpha-like globin sequence in cDNA clones made from reticulocyte mRNA isolated from nonanemic chickens. Therefore, we suggest that the alpha S-type sequence corresponds to the true alpha A-globin species. PMID:6273837

  15. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France); Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, SE-106 91 Stockholm (Sweden); Schaerer, Daniel [CNRS, IRAP, 14, avenue Edouard Belin, F-31400 Toulouse (France); Verhamme, Anne; Orlitova, Ivana [Geneva Observatory, University of Geneva, 51 Chemin des Maillettes, CH-1290 Versoix (Switzerland); Mas-Hesse, J. Miguel; Oti-Floranes, Hector [Centro de Astrobiologia (CSIC-INTA), Departamento de Astrofisica, POB 78, 28691 Villanueva de la Canada (Spain); Adamo, Angela [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Atek, Hakim [Laboratoire d'Astrophysique, Ecole Polytechnique Federale de Lausanne (EPFL), Observatoire, CH-1290 Sauverny (Switzerland); Cannon, John M. [Department of Physics and Astronomy, Macalester College, 1600 Grand Avenue, Saint Paul, MN 55105 (United States); Herenz, E. Christian [Leibniz-Institut fuer Astrophysik (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Kunth, Daniel [Institut d'Astrophysique de Paris, UMR 7095 CNRS and UPMC, 98 bis Bd Arago, F-75014 Paris (France); Laursen, Peter, E-mail: matthew@astro.su.se [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark)

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  16. alpha-Tocopheryl phosphate – an active lipid mediator?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The vitamin E (alpha-tocopherol, alphaT) derivative, alpha-tocopheryl phosphate (alphaTP), is detectable in small amounts in plasma, tissues, and cultured cells. Studies done in vitro and in vivo suggest that alphaT can become phosphorylated and alphaTP dephosphorylated, suggesting the existence of ...

  17. Variation in RBE for Survival of V79-4 Cells as a Function of Alpha-Particle (Helium Ion) Energy.

    PubMed

    Tracy, Bliss L; Stevens, David L; Goodhead, Dudley T; Hill, Mark A

    2015-07-01

    High linear energy transfer (LET) ? particles are important with respect to the carcinogenic risk associated with human exposure to ionizing radiation, most notably to radon and its progeny. Additionally, the potential use of alpha-particle-emitting radionuclides in radiotherapy is increasingly being explored. Within the body the emitted alpha particles slow down, traversing a number of cells with a range of energies and therefore with varying efficiencies at inducing biological response. The LET of the particle typically rises from between ~70-90 keV ?m(-1) at the start of the track (depending on initial energy) to a peak of ~237 keV ?m(-1) towards the end of the track, before falling again at the very end of its range. To investigate the variation in biological response with incident energy, a plutonium-238 alpha-particle irradiator was calibrated to enable studies with incident energies ranging from 4.0 MeV down to 1.1 MeV. The variation in clonogenic survival of V79-4 cells was determined as a function of incident energy, along with the relative variation in the initial yields of DNA double-strand breaks (DSB) measured using the FAR assay. The clonogenic survival data also extends previously published data obtained at the Medical Research Council (MRC), Harwell using the same cells irradiated with helium ions, with energies ranging from 34.9 MeV to 5.85 MeV. These studies were performed in conjunction with cell morphology measurements on live cells enabling the determination of absorbed dose and calculation of the average LET in the cell. The results show an increase in relative biological effectiveness (RBE) for cell inactivation with decreasing helium ion energy (increasing LET), reaching a maximum for incident energies of ~3.2 MeV and corresponding average LET of 131 keV ?m(-1), above which the RBE is observed to fall at lower energies (higher LETs). The effectiveness of single alpha-particle traversals (relevant to low-dose exposure) at inducing cell inactivation was observed to increase with decreasing energy to a peak of ~68% survival probability for incident energies of ~1.8 MeV (average LET of 190 keV ?m(-1)) producing ~0.39 lethal lesions per track. However, the efficiency of a single traversal will also vary significantly with cell morphology and angle of incidence, as well as cell type. PMID:26121227

  18. Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.

    PubMed

    Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L

    2015-03-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha abnormalities in ASD. PMID:25231288

  19. Measurement of the 33S(\\alpha,p)36Cl cross section: Implications for production of 36Cl in the early Solar System

    E-print Network

    Bowers, Matthew; Bauder, William; Beard, Mary; Collon, Philippe; Lu, Wenting; Ostdiek, Karen; Robertson, Daniel

    2013-01-01

    Short-lived radionuclides (SLRs) with lifetimes \\tau < 100 Ma are known to have been extant when the Solar System formed over 4.5 billion years ago. Identifying the sources of SLRs is important for understanding the timescales of Solar System formation and processes that occurred early in its history. Extinct 36Cl (t_1/2 = 0.301 Ma) is thought to have been produced by interaction of solar energetic particles (SEPs), emitted by the young Sun, with gas and dust in the nascent Solar System. However, models that calculate SLR production in the early Solar System (ESS) lack experimental data for the 36Cl production reactions. We present here the first measurement of the cross section of one of the main 36Cl production reactions, 33S(\\alpha,p)36Cl, in the energy range 0.70 - 2.42 MeV/A. The cross section measurement was performed by bombarding a target and collecting the recoiled 36Cl atoms produced in the reaction, chemically processing the samples, and measuring the 36Cl/Cl ratio of the activated samples with ...

  20. The Ly-alpha/H-alpha ratio in high-redshift radio galaxies

    NASA Technical Reports Server (NTRS)

    Mccarthy, Patrick J.; Elston, Richard; Eisenhardt, Peter

    1992-01-01

    The first spectroscopic detection of H-alpha emission from radio galaxies at z greater than 2 are presented. Strong H-alpha emission is detected at z = 2.429 in B3 0731 + 438, and H-alpha is directed at z = 2.428 in 0406 - 244 at a significant level of greater than 6 sigma. The resulting Ly-alpha/H-alpha ratios for 0731 + 438 and 0406 - 244 are 3.9 and 3.2 with 3 sigma uncertainties of 1.5 for each. A range of possible extinctions is derived depending on the reddening-free Ly-alpha/H-alpha ratio assumed and the extinction curve employed. The most important result of this study is the demonstration that the Ly-alpha/H-alpha ratio in distant galaxies can now be measured with relative ease.

  1. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Düllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schädel; A. Yakushev; S. Åberg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jäger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thörle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Türler; A. Ward; D. E. Ward; N. Wiehl

    2015-02-10

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  2. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

    2015-01-01

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  3. alpha,alpha-Difluoro-beta-aminodeoxystatine-containing renin inhibitory peptides.

    PubMed

    Thaisrivongs, S; Schostarez, H J; Pals, D T; Turner, S R

    1987-10-01

    The preparations of sodium 4(S)-[(tert-butyloxycarbonyl)amino]-2,2-difluoro-3(S)- and -3(R)-[(4-methoxyphenyl)amino]-6-methylheptanoates (7a and 7b) from sodium 4(S)-[(tert-butyloxycarbonyl)amino]-2,2-difluoro-3(R)- and -3(S)-hydroxy-6-methylheptanoates (1a and 1b) are described. The key step involves the stereospecific intramolecular displacement via a Mitsunobu reaction for the conversion of a beta-hydroxy hydroxamate to a beta-lactam ring. Compounds 7a and 7b are useful as synthetic intermediates for the preparation of enzyme inhibitors that contain 3(S),4(S)- and 3(R),4(S)-diamino-2,2-difluoro-6-methylheptanoic acid inserts. Angiotensinogen analogues VII and VIII that contain these novel amino analogues of difluorostatine were shown to be inhibitors of the enzyme renin. The alpha,alpha-difluoro-beta-aminodeoxystatine-containing compounds were shown to be weaker inhibitors than the corresponding difluorostatine-containing congeners. PMID:3309315

  4. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  5. Targeted alpha therapy for cancer

    NASA Astrophysics Data System (ADS)

    Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John

    2004-08-01

    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

  6. [Cardiovascular complications of alpha interferon].

    PubMed

    Le Corguillé, Monika; Pochmalicki, Gilbert; Eugène, Claude

    2007-12-01

    Interferon-alpha is a biological response modifier with antiviral and tumoral effect that is used in the treatment of chronic viral hepatitis. Cardiovascular complications occurred in clinical trials of interferon. The most common presentations of cardio toxicity were cardiac arrhythmia, dilated cardiomyopathy, atrial extrasystole and symptoms of ischemic heart disease, including myocardial infarction and other effects less common and dangerous: low-level conduction impairment or reversible hypertension. The physiopathology of this cardiotoxicity remains unknown, but rigorous cardiological monitoring of all patients receiving this treatment seems necessary. PMID:18176361

  7. Preferred conformation of peptides from C alpha,alpha- symmetrically disubstituted glycines: aromatic residues.

    PubMed

    Crisma, M; Valle, G; Bonora, G M; Toniolo, C; Lelj, F; Barone, V; Fraternali, F; Hardy, P M; Maia, H L

    1991-05-01

    The conformational preference of C(alpha,alpha-diphenylglycine (D-phi-g) and C(alpha,alpha)-dibenzylglycine (Dbz) residues was assessed in selected derivatives and small peptides by conformational energy computations, ir absorption, 1H-nmr, and x-ray diffraction. Conformational energy computations on the two monopeptides strongly support the view that these C(alpha,alpha)-symmetrically disubstituted glycines are conformationally restricted and that their minimum energy conformation falls in the fully extended (C5) region. The results of the theoretical analyses appear to be in agreement with the solution and crystal-state structural propensities of three derivatives and seven di- and tripeptides. PMID:1932563

  8. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  9. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network. PMID:9030876

  10. Local varying-alpha theories

    NASA Astrophysics Data System (ADS)

    2015-06-01

    In a recent paper, we demonstrated how the simplest model for varying-alpha may be interpreted as the effect of a dielectric material, generalized to be consistent with Lorentz invariance. Unlike normal dielectrics, such a medium cannot change the speed of light, and its dynamics obey a Klein-Gordon equation. This work immediately suggests an extension of the standard theory, even if we require compliance with Lorentz invariance. Instead of a wave equation, the dynamics may satisfy a local algebraic relation involving the permittivity and the properties of the electromagnetic (EM) field, in analogy with more conventional dielectric (but still preserving Lorentz invariance). We develop the formalism for such theories and investigate some phenomenological implications. The problem of the divergence of the classical self-energy can be solved, or at least softened, in this framework. Some interesting new cosmological solutions for the very early universe are found, including the possibility of a bounce, inflation and expansion with a loitering phase, all of which are induced by early variations in alpha.

  11. Alpha decay properties of light einsteinium isotopes

    Microsoft Academic Search

    Hatsukawa Yuichi; Ohtsuki Tsutomu; Sueki Keisuke; Nakahara Hiromichi; Kohno Isao; Magara Masaaki; Shinohara Nobuo; Howard L. Hall; Roger A. Henderson; Carolyn M. Gannet; John A. Leyba; Robert B. Chadwick; Kenneth E. Gregorich; Diana Lee; Matti J. Nurmia; Darleane C. Hoffman

    1989-01-01

    The light einsteinium isotopes, with mass numbers 249, 248, 247, 246, 245 and 243, were produced by irradiating 249Cf with protons, 238U with 14N, 237Np with 12C and 233U with 14N, and have been studied by means of alpha-ray spectroscopy. An analysis of the complex alpha-peaks of the einsteinium isotopes gave new alpha-branchings. The tentative assignments of 7\\/2+ --> 7\\/2+,

  12. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  13. On alpha heating in toroidal devices

    Microsoft Academic Search

    G. H. Miley

    1979-01-01

    Studies of the alpha particle losses and heating profiles for an alpha-heated TFTR-sized tokamak and a small field-reversed mirror reactor (FRM) are presented. The slowing-down and drift of high-energy alpha particles, including detailed orbital effects, is approximated for tokamak geometry using the SYMALF multi-energy-angle code. Results of the calculation for a beam-driven TFTR-type plasma indicate that, except for the center

  14. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K. (Idaho Falls, ID); Martz, Dowell E. (Grand Junction, CO)

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  15. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  16. cap alpha. -Particle confinement in compact tori

    SciTech Connect

    Bozhokin, S.V.

    1986-11-01

    The motion of high-energy ..cap alpha.. particles in compact tori is studied. The classically accessible regions of motion of charged particles are found. The conditions are formulated under which the ..cap alpha.. particles produced in fusion reactions are absolutely confined. An ..cap alpha.. particle starting in a region enclosed by a ''critical'' surface will never, in the course of its motion, intersect the separatrix of a compact torus. These critical surfaces are constructed. The ratio of the volume of absolute ..cap alpha.. confinement to the total volume of a compact torus is calculated as a function of the magnetic field strength and the dimensions of the compact torus.

  17. EEG alpha power and alpha power asymmetry in sleep and wakefulness.

    PubMed

    Benca, R M; Obermeyer, W H; Larson, C L; Yun, B; Dolski, I; Kleist, K D; Weber, S M; Davidson, R J

    1999-07-01

    Asymmetry of waking electroencephalography (EEG) alpha power in frontal regions has been correlated with waking emotional reactivity and the emotional content of dream reports. Little is known regarding alpha asymmetry during sleep. The present study was performed to compare alpha power and alpha power asymmetry in various brain regions across states of sleep and wakefulness. Waking and sleep EEG were recorded in a group of patients undergoing polysomnographic evaluation for possible sleep disorders. Alpha EEG asymmetry in frontal and temporal regions was significantly correlated in waking versus sleep, particularly during rapid eye movement (REM) sleep. These results suggest that patterns of frontal alpha asymmetry are stable across sleep and waking and may be related to emotional reactivity during dreaming. During sleep, alpha power was highest during slow-wave sleep and lowest during REM sleep. Implications of these data for understanding the functional significance of alpha power during waking and sleeping are considered. PMID:10432792

  18. /sup 20/Ne(. cap alpha. ,2. cap alpha. )/sup 16/O reaction

    SciTech Connect

    Sharma, N.R.; Jain, B.K.; Shyam, R.

    1988-02-01

    The /sup 20/Ne(..cap alpha..,2..cap alpha..)/sup 16/O reaction at 140 MeV incident energy is analyzed in the framework of the distorted-wave impulse approximation. The bound state ..cap alpha.. wave functions in /sup 20/Ne are generated using the orthogonal condition model. The predicted results agree with the experimental data. They are also in rough accord with the results obtained with the Woods-Saxon ..cap alpha.. wave function.

  19. Preparation of 9-alpha,11-xi-tritiated 17-alpha-ethynylestradiol, mestranol, estradiol-alpha-17-beta, and norethindrone.

    PubMed

    Rao, P N

    1971-08-01

    The preparation of 9alpha, 11xi-tritiated 17alpha-ethinyl estradiol, mestranol, estradiol-17beta, and norethindrone are described. Estrone-3-methyl ether was employed as starting material, and ethinylation with lithium acetylide-ethylene diamine resulted in 95% mestranol. Demethylation of mestranol with boron tribromide at 0 degrees resulted in 92% 17alpha-ethinyl estradiol. Dimethylsulfoxide was the choice of reagent for the condensation reaction which was complete at room temperature in about 4 hours. The usually less than 3% of unreacted 17-oxo product was removed by Girard separation. Demethylation of methyl ether with boran tribromide in methylene chloride resulted in an excellent yield of 17alpha-ethinyl estradiol-9alpha, 11xi-tritium. 3-methoxyestra-1,3,5-trien-17-one-9alpha, 11xi-tritium was reduced with sodium bis(2-methoxyethoxy) aluminum hydride to the 17beta-hydroxy compound and subsequent demethylation resulted in estradiol-9alpha, 11xi-tritium. The general method of Ringold et al was employed for the preparation of 17beta-hydroxy-17alpha-ethinylestr-4-en-3-one. Improvements for small scale radiosynthesis are also presented. PMID:5126820

  20. Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells

    SciTech Connect

    Abair, Tristin D. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Sundaramoorthy, Munirathinam; Chen, Dong [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Heino, Jyrki [Department of Biochemistry and Food Chemistry, University of Turku, Turku (Finland); Ivaska, Johanna [VTT Technical Research Centre of Finland, Medical Biotechnology, Turku (Finland); Hudson, Billy G. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Sanders, Charles R. [Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Pozzi, Ambra [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Zent, Roy [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37232 (United States)], E-mail: roy.zent@vanderbilt.edu

    2008-11-15

    The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

  1. Alpha-1 Antitrypsin Deficiency: It's All in the Family

    MedlinePLUS

    Alpha-1 Antitrypsin Deficiency: It’s All in the Family 1 ALPHA-1 FOUNDATION The Alpha-1 Foundation is committed to finding a cure for Alpha-1 Antitrypsin ... health choices. Be tested for Alpha-1: It’s all in the family. For more information, call the ...

  2. Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes

    SciTech Connect

    Chi, Seung-Wook [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2006-06-23

    {alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

  3. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  4. Plasma alpha natriuretic peptide in cardiac impairment

    Microsoft Academic Search

    A M Richards; J G Cleland; G Tonolo; G D McIntyre; B J Leckie; H J Dargie; S G Ball; J I Robertson

    1986-01-01

    Regional plasma alpha human atrial natriuretic peptide concentrations were measured, and their relation to intracardiac pressures assessed, in an unselected series of 45 patients undergoing diagnostic cardiac catheterisation. Arteriovenous gradients in plasma concentrations of alpha human atrial natriuretic peptide were consistent with its cardiac secretion and its clearance by the liver and kidneys. Plasma concentrations of the peptide in the

  5. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco...ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at 752mm...

  6. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco...ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at 752mm...

  7. Alpha high-power chemical laser program

    Microsoft Academic Search

    Richard Ackerman; David Callahan; Anthony J. Cordi; Henry Lurie; Matthew Thomson

    1995-01-01

    Alpha is a megawatt-class hydrogen fluoride, continuous wave, space based chemical laser brassboard which demonstrates and validates technology for space-based applications. It consists of a cylindrical gain generator that exhausts radially outward through circumferential nozzles forming an annular lasing media and an annular ring resonator, which extracts the laser energy. Technical innovations first demonstrated on Alpha include: (1) use of

  8. Search for Trapped Antihydrogen ALPHA Collaboration

    E-print Network

    Fajans, Joel

    Search for Trapped Antihydrogen ALPHA Collaboration G.B. Andresena , M.D. Ashkezarib , M. BaqueroDepartment of Physics, Swansea University, Swansea SA2 8PP, United Kingdom eInstituto de F´isica, Universidade Federal to search for trapped antihydrogen atoms with the ALPHA antihydrogen trap at the CERN Antiproton Decelerator

  9. Orbiting mechanism in alpha-40Ca scattering

    Microsoft Academic Search

    I. Parija; R. K. Satpathy; C. S. Shastry

    1984-01-01

    The large angle oscillations in several cases of alpha-40Ca scattering are examined in terms of orbital amplitude and the background amplitude interference using the approach developed recently to analyze 16O-28Si scattering. [NUCLEAR REACTIONS alpha-40Ca scattering, anomalous large angle scattering, orbiting phenomena.

  10. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  11. Meta-Analysis of Coefficient Alpha

    ERIC Educational Resources Information Center

    Rodriguez, Michael C.; Maeda, Yukiko

    2006-01-01

    The meta-analysis of coefficient alpha across many studies is becoming more common in psychology by a methodology labeled reliability generalization. Existing reliability generalization studies have not used the sampling distribution of coefficient alpha for precision weighting and other common meta-analytic procedures. A framework is provided for…

  12. TF ripple loss of fast alphas

    SciTech Connect

    Hively, L.M.

    1987-02-06

    Viewgraphs from this presentation are given. The topics covered included: (1) previous work on background plasma, fast ion transport - MeV alphas, neutral beam ions, and rf heated tail ion; (2) important results; (3) alpha loss calculations; and (4) unresolved issues. (MOW)

  13. Microbial transformations of alpha-santonin.

    PubMed

    Ata, Athar; Nachtigall, Jason A

    2004-01-01

    Fungal biotransformations of alpha-santonin (1) were conducted with Mucor plumbeus (ATCC 4740), Cunninghamella bainieri (ATCC 9244), Cunninghamella echinulata (ATCC 9245), Curvularia lunata (ATCC 12017) and Rhizopus stolonifer (ATCC 10404). Rhizopus stolonifer (ATCC 10404) metabolized compound 1 to afford 3,4-epoxy-alpha-santonin (2) and 4,5-dihydro-alpha-santonin (3) while Cunninghamella bainieri (ATCC 9244), Cunninghamella echinulata (ATCC 9245) and Mucor plumbeus (ATCC 4740) were capable of metabolizing compound 1 to give a reported metabolite, 1,2-dihydro-alpha-santonin (4). The structures of these transformed metabolites were established with the aid of extensive spectroscopic studies. These fungi regiospecifically reduced the carbon-carbon double bond in ring A of alpha-santonin. PMID:15241928

  14. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States)] [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States); Stevens, Victoria L. [Epidemiology and Surveillance Research, American Cancer Society, Atlanta, Georgia (United States)] [Epidemiology and Surveillance Research, American Cancer Society, Atlanta, Georgia (United States); Owens, Timothy R. [Emory University, School of Medicine, Atlanta, Georgia (United States)] [Emory University, School of Medicine, Atlanta, Georgia (United States); Oyesiku, Nelson M., E-mail: noyesik@emory.edu [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States)

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  15. Molecular modeling of the alpha9alpha10 nicotinic acetylcholine receptor subtype.

    PubMed

    Pérez, Edwin G; Cassels, Bruce K; Zapata-Torres, Gerald

    2009-01-01

    This study reports the comparative molecular modeling, docking and dynamic simulations of human alpha9alpha10 nicotinic acetylcholine receptors complexed with acetylcholine, nicotine and alpha-conotoxin RgIA, using as templates the crystal structures of Aplysia californica and Lymnaea stagnalis acetylcholine binding proteins. The molecular dynamics simulations showed that Arg112 in the complementary alpha10(-) subunit, is a determinant for recognition in the site that binds small ligands. However, Glu195 in the principal alpha9(+), and Asp114 in the complementary alpha10(-) subunit, might confer the potency and selectivity to alpha-conotoxin RgIA when interacting with Arg7 and Arg9 of this ligand. PMID:19013796

  16. What Does It Mean to Be an Alpha-1 Carrier?

    MedlinePLUS

    ... Alpha-1 link. RESOURCES Alpha-1 Foundation Toll Free: (877) 228-7321 • www.alpha1.org The not-for-profit Foundation provides resources, education, and information on testing and diagnosis for healthcare ...

  17. Local structure and vibrational properties of alpha-Pu, alpha-Uand the alpha-U charge density wave

    SciTech Connect

    Nelson, E.J.; Allen, P.G.; Blobaum, K.J.M.; Wall, W.A.; Booth, C.H.

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure a-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}{prime}-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}{prime}-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  18. Process of converting polluting particles, emitted in chemical or physical processes, into harmless substances

    SciTech Connect

    Hooykaas, C.W.

    1982-03-02

    Harmful metals containing particles being emitted in chemical or physical processes, such as in iron production or in combustion processes, are caught and intimately divided in a molten metallurgic slag in order to avoid pollution problems.

  19. A Model to Predict the Breathing Zone Concentrations of Particles Emitted from Surfaces

    EPA Science Inventory

    Activity based sampling (ABS) is typically performed to assess inhalation exposure to particulate contaminants known to have low, heterogeneous concentrations on a surface. Activity based sampling determines the contaminant concentration in a person's breathing zone as they perfo...

  20. Detection of charged particles emitted by electrolytically induced cold nuclear fusion

    Microsoft Academic Search

    Ryoichi Taniguchi; Takao Yamamoto; Setsuko Irie

    1989-01-01

    An attempt was made to obtain evidence for electrolytically induced cold nuclear fusion by detecting charged particles associated with the nuclear reaction. Charged particles were detected by a conventional silicon surface barrier detector attached close to the thin foil cathode which formed the bottom of an electrolysis cell. The efficiency and signal-to-noise ratio of this system are higher than those

  1. Physico-chemical characteristics of particles emitted from vehicles using gasoline with methylcyclopentadienyl manganese tricarbonyl

    SciTech Connect

    Ardeleanu, A.; Loranger, S.; Gareau, L.; Zayed, J. [Univ. of Montreal, Quebec (Canada); L`Esperance, G.; Kennedy, G. [Ecole Polytechnique de Montreal, Quebec (Canada)

    1995-12-31

    Methylcyclopentadienyl manganese tricarbonyl (MMT), an organic derivative of manganese, has been used exclusively in Canada since 1990 as an antiknock agent in unleaded gasoline. Its combustion leads to the formation and the release to the atmosphere of oxides of Mn, especially manganese tetraoxide or hausmanite. The aim of this research is to estimate the quantity of Mn oxides emitted at the tailpipe and to determine the physico-chemical characteristics of the particles. A total of nine different vehicles were used, with engine sizes varying from 2 to 5 liters and previously driven from 3,500 to 124,000 km. The tests were carried out with urban (UDDS -- Urban Dynamometer Driving Schedule) and highway (HWFET -- Highway Fuel Economy Test) cycles based on the Federal Test Procedure. Particles to be analyzed by scanning electron microscopy for size distribution and chemical composition were collected at the end of the tailpipe using a pump and 0.4 {micro}m Teflon filters. Other solid particles were collected by bubbling the exhaust gases through water and the Mn concentrations were measured by neutron activation analysis. The Mn emissions from the vehicles varied from 4 to 52% which is of the same order of magnitude as previous studies on the subject. A positive correlation between % emission and vehicle mileage was obtained for the urban cycle only with a coefficient of 0.57 (p < 0.05) Scanning electron microscopy enabled the identification of Mn oxide particles bound to different elements such as S, Fe, Cr, Si and Al. The size of the agglomerates varied from 0.2 to 30 {micro}m. Almost 50% of the Mn particles were found to be in the respirable fraction (<0.5 {micro}m).

  2. Identification of platinum and palladium particles emitted from vehicles and dispersed into the surface environment.

    PubMed

    Prichard, Hazel M; Fisher, Peter C

    2012-03-20

    Platinum, palladium, and rhodium are emitted from vehicle catalytic converters. Until now, the form of precious metal particles in road dust and urban waste has not been identified. This study has located, imaged, and analyzed these particles in road dust and gully waste. Two fragments of catalytic converter have been observed in road dust. They are 40-80 ?m in size and covered in many minute particles (<0.3 ?m) of either platinum with minor rhodium or palladium. One fragment identified in gully sediment is smaller, 25 ?m in diameter, hosting only one attached particle of palladium with minor rhodium. As fragments are washed off roads they begin to disintegrate and the precious metals become detached. Also precious metal-bearing particles have been located in incinerated sewage ash including a 20 ?m diameter cluster of <3 ?m sized platinum particles that may be the remains of a catalytic converter fragment that has survived incineration. The form of these precious metal-bearing particles described here reveals that as they are dispersed from roads they are likely to be present predominantly as two particle sizes. Either they are attached to larger fragments of catalytic converter or they are released as individual detached tiny <0.3 ?m to nanoparticle sizes. PMID:22313190

  3. Particles emitted from indoor combustion sources: size distribution measurement and chemical analysis.

    PubMed

    Roy, A A; Baxla, S P; Gupta, Tarun; Bandyopadhyaya, R; Tripathi, S N

    2009-08-01

    This study is primarily focused toward measuring the particle size distribution and chemical analysis of particulate matter that originates from combustion sources typically found in Indian urban homes. Four such sources were selected: cigarette, incense stick, mosquito coil, and dhoop, the latter being actually a thick form of incense stick. Altogether, seven of the most popular brands available in the Indian market were tested. Particle size distribution in the smoke was measured using a scanning mobility particle sizer, using both long and nano forms of differential mobility analyzer (DMA), with readings averaged from four to six runs. The measurable particle size range of the nano DMA was 4.6 nm to 157.8 nm, whereas that of the long DMA was 15.7 nm to 637.8 nm. Therefore, readings obtained from the long and the nano DMA were compared for different brands as well as for different sources. An overlap was seen in the readings in the common range of measurement. The lowest value of peak concentration was seen for one brand of incense stick (0.9 x 10(6) cm(-3)), whereas the highest (7.1 x 10(6) cm(-3)) was seen for the dhoop. Generally, these sources showed a peak between 140 and 170 nm; however, 2 incense stick brands showed peaks at 79 nm and 89 nm. The dhoop showed results much different from the rest of the sources, with a mode at around 240 nm. Chemical analysis in terms of three heavy metals (cadmium, zinc, and lead) was performed using graphite tube atomizer and flame-atomic absorption spectrophotometer. Calculations were made to assess the expected cancer and noncancer risks, using published toxicity potentials for these three heavy metals. Our calculations revealed that all the sources showed lead concentrations much below the American Conference of Governmental Industrial Hygienists (ACGIH) threshold limit value (TLV) level. One of the two mosquito coil brands (M(2)) showed cadmium concentrations two times higher than the California Environmental Protection Agency (Cal EPA) reference exposure level (REL). The latter also showed the highest carcinogenic risks of 350 people per million population. The amount of zinc obtained from the sources, however, was found to be quite below the standard limits, implying no risk in terms of zinc. PMID:19591538

  4. Combustion particles emitted during church services: implications for human respiratory health.

    PubMed

    Chuang, Hsiao-Chi; Jones, Tim; BéruBé, Kelly

    2012-04-01

    Burning candles and incense generate particulate matter (PM) that produces poor indoor air quality and may cause human pulmonary problems. This study physically characterised combustion particles collected in a church during services. In addition, the emissions from five types of candles and two types of incense were investigated using a combustion chamber. The plasmid scission assay was used to determine the oxidative capacities of these church particles. The corresponding risk factor (CRf) was derived from the emission factor (Ef) and the oxidative DNA damage, and used to evaluate the relative respiratory exposure risks. Real-time PM measurements in the church during candle-incense burning services showed that the levels (91.6 ?g/m(3) for PM(10); 38.9 ?g/m(3) for PM(2.5)) exceeded the European Union (EU) air quality guidelines. The combustion chamber testing, using the same environmental conditions, showed that the incense Ef for both PM(10) (490.6-587.9 mg/g) and PM(2.5) (290.1-417.2 mg/g) exceeded that of candles; particularly the PM(2.5) emissions. These CRf results suggested that the exposure to significant amounts of incense PM could result in a higher risk of oxidative DNA adducts (27.4-32.8 times) than tobacco PM. The generation and subsequent inhalation of PM during church activities may therefore pose significant risks in terms of respiratory health effects. PMID:21831441

  5. [Characteristics of water soluble inorganic ions in fine particles emitted from coal-fired power plants].

    PubMed

    Duan, Lei; Ma, Zi-Zhen; Li, Zhen; Jiang, Jing-Kun; Ye, Zhi-Xiang

    2015-03-01

    Currently, China suffers from serious pollution of fine particulate matter (PM2.5). Coal-fired power plant is one of the most important sources of PM2.5 in the atmosphere. To achieve the national goals of total emission reductions of sulfur dioxide (SO2) and nitrogen oxides (NO(x)) during the 11th and 12th Five-Year Plan, most of coal-fired power plants in China have installed or will install flue gas desulfurization (FGD) and flue gas denitrification (DNO(x)) systems. As a result, the secondary PM2.5, generated from gaseous pollutants in the atmosphere, would be decreased. However, the physical and chemical characteristics of PM2.5 in flue gas would be affected, and the emission of primary PM2.5 might be increased. This paper summarized the size distributions of PM2.5 and its water soluble ions emitted from coal-fired power plants, and highlighted the effects of FGD and DNO(x) on PM2.5 emission, especially on water soluble ions (such as SO4(2-), Ca2+ and NH4+) in PM2.5. Under the current condition of serious PM2.5 pollution and wide application of FGD and DNO(x), quantitative study on the effects of FGD and DNO(x) installation on emission characteristics of PM2.5 from coal-fired power plants is of great necessity. PMID:25929084

  6. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  7. Serum TNF alpha inhibitor in mouse typhoid.

    PubMed

    Mastroeni, P; Villarreal, B; Demarco de Hormaeche, R; Hormaeche, C E

    1992-05-01

    Administration of anti-TNF alpha antiserum enhanced a sublethal infection with salmonellae of moderate virulence (Salmonella typhimurium M525) in innately susceptible (Ity(s)) BALB/c mice, indicating that TNF alpha is important in the early response which suppresses bacterial growth in the reticuloendothelial system (RES). However, only transient low levels of TNF alpha were detectable on day 3 in sera from some, but not all, sublethally infected mice. Conversely, on day 4 of the same infection, clear TNF alpha inhibitory activity was detected in some sera. Neither TNF alpha or any inhibitory activity were detected in sera of lethally infected BALB/c mice undergoing an acute, overwhelming Salmonella infection. In contrast, TNF alpha inhibitory activity, but not TNF alpha, was detected in sera of mice showing a cachectic syndrome induced by persistent high bacterial numbers following intravenous inoculation of a very high dose (2 x 10(7)) of the attenuated aro- S. typhimurium SL3261 strain. PMID:1501573

  8. Glucosylation of alpha-butyl- and alpha-octyl-D-glucopyranosides by dextransucrase and alternansucrase from Leuconostoc mesenteroides.

    PubMed

    Richard, Gaëtan; Morel, Sandrine; Willemot, René-Marc; Monsan, Pierre; Remaud-Simeon, Magali

    2003-04-22

    For the first time, glucosylation of alpha-butyl- and alpha-octylglucopyranoside was achieved using dextransucrase (DS) of various specificities, and alternansucrase (AS) from Leuconostoc mesenteroides. All the glucansucrases (GS) tested used alpha-butylglucopyranoside as acceptor; in particular, DS produced alpha-D-glucopyranosyl-(1-->6)-O-butyl-alpha-D-glucopyranoside and alpha-D-glucopyranosyl-(1-->6)-alpha-D-glucopyranosyl-(1-->6)-O-butyl-alpha-D-glucopyranoside. In contrast, alpha-octylglucopyranoside was glucosylated only by AS which was shown to be the most efficient catalyst. The conversion rates, obtained with this enzyme at sucrose to acceptor molar ratio of 2:1 reached 81 and 61% for alpha-butylglucopyranoside and alpha-octylglucopyranoside, respectively. Analyses obtained from liquid chromatography coupled with mass spectrometry revealed that different series of alpha-alkylpolyglucopyranosides regioisomers of increasing polymerization degree can be formed depending on the specificity of the catalyst. PMID:12681910

  9. High precision {sup 89}Y({alpha},{alpha}){sup 89}Y scattering at low energies

    SciTech Connect

    Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.; Elekes, Z.; Somorjai, E. [Institute of Nuclear Research (ATOMKI), H-4001 Debrecen (Hungary); Mohr, P. [Diakonie-Klinikum, D-74523 Schwaebisch Hall (Germany); Galaviz, D. [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Kretschmer, A.; Sonnabend, K. [Institut fuer Kernphysik, Technische Universitaet Darmstadt, D-64289 Darmstadt (Germany); Zilges, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937 Koeln (Germany); Avrigeanu, M. [Horia Hulubei National Institute for Physics and Nuclear Engineering, RO-76900 Bucharest (Romania)

    2009-10-15

    Elastic scattering cross sections of the {sup 89}Y({alpha},{alpha}){sup 89}Y reaction have been measured at energies E{sub c.m.}=15.51 and 18.63 MeV. The high-precision data for the semimagic N=50 nucleus {sup 89}Y are used to derive a local potential and to evaluate the predictions of global and regional {alpha}-nucleus potentials. The variation of the elastic {alpha}-scattering cross sections along the N=50 isotonic chain is investigated by a study of the ratios of angular distributions for {sup 89}Y({alpha},{alpha}){sup 89}Y and {sup 92}Mo({alpha},{alpha}){sup 92}Mo at E{sub c.m.}{approx_equal}15.51 and 18.63 MeV. This ratio is a very sensitive probe at energies close to the Coulomb barrier, where scattering data alone is usually not enough to characterize the different potentials. Furthermore, {alpha}-cluster states in {sup 93}Nb={sup 89}Y x {alpha} are investigated.

  10. The alpha decay of deformed superheavy elements

    E-print Network

    M. Kowal; Z. Lojewski

    2003-04-09

    The interaction potential between the alpha particle and the deformed parent nucleus was used for description of the decay of superheavy nuclei. It consists of centrifugal, nuclear and Coulomb parts suitably modified for deformed nuclei. The significant effect of various shapes of barriers obtained for deformed parent nuclei on calculated alpha half-life times were shown. The finally calculated half-life times due to the spontaneous alpha decay for superheavy elements were compared with the results obtained from other models and the experimental data.

  11. Hb Constant Spring [alpha 142, Term-->Gln (TAA>CAA in alpha2)] in the alpha-thalassemia of anemic patients in Myanmar.

    PubMed

    Ne-Win; Harano, Keiko; Harano, Teruo; Kyaw-Shwe; Aye-Aye-Myint; Khin-Thander-Aye; Okada, Shigeru

    2008-01-01

    Hb Constant Spring (Hb CS), the gene (alpha(CS)) of which arises from a point mutation in the termination codon of the alpha2-globin gene, is the most prevalent variety of nondeletional alpha-thalassemia (alpha-thal) in Asian populations. It is a major cause of Hb H disease in compound heterozygotes who have Hb CS combined with a duplicated alpha gene deletion (--/alpha(CS)alpha), and it tends to be more severe than Hb H disease which is caused by a triple alpha gene deletion (--/-alpha). Hb CS is often missed by routine electrophoresis but not by polymerase chain reaction (PCR) methods. During alpha-thal screening and genotyping of 235 patients diagnosed by laboratory tests hemoglobin (Hb), MCV, MCH and Hb H inclusion bodies] using the gap-PCR method, 175 patients were diagnosed to be carriers of an alpha-thal gene, genotypes of which were 133 alpha-thal-2, 34 alpha-thal-1 (including one only by laboratory test) and eight with Hb H disease. Detection of the alpha(CS) gene for the carriers of alpha-thal-1 and Hb H disease was done by the mismatched PCR-RFLP (restriction fragment length polymorphism) method and the alpha(CS) gene was found in the homozygous state in an alpha-thal-1 patient and a single gene form in two Hb H disease patients. These genotypes were characterized by the PCR-sequencing method. These patients clinically presented the aspects of Hb H disease and of a homozygote form of alpha-thal-1. The description of the alpha(CS) gene in Myanmar is of great value in the development of an effective procedure for prenatal diagnosis of Hb Bart's hydrops fetalis syndrome. PMID:18932070

  12. Alpha high-power chemical laser program

    NASA Astrophysics Data System (ADS)

    Ackerman, Richard A.; Callahan, David; Cordi, Anthony J.; Lurie, Henry; Thomson, Matthew

    1995-03-01

    Alpha is a megawatt-class hydrogen fluoride, continuous wave, space based chemical laser brassboard which demonstrates and validates technology for space-based applications. It consists of a cylindrical gain generator that exhausts radially outward through circumferential nozzles forming an annular lasing media and an annular ring resonator, which extracts the laser energy. Technical innovations first demonstrated on Alpha include: (1) use of extruded aluminum components, (2) diamond turned, annular optics made of molybdenum, (3) uncooled silicon mirrors, (4) light weight optical benches, and (5) active alignment. Alpha first lased in 1989, and has repeatably demonstrated megawatt-class power and excellent beam quality. Using Alpha, TRW has demonstrated the use of low weight uncooled mirrors in very high power lasers to reduce system jitter. They have performed flawlessly and beam jitter levels were significantly reduced.

  13. Genetics Home Reference: Alpha-mannosidosis

    MedlinePLUS

    ... enzyme helps break down complexes of sugar molecules (oligosaccharides) attached to certain proteins (glycoproteins). In particular, alpha-mannosidase helps break down oligosaccharides containing a sugar molecule called mannose. Mutations in ...

  14. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  15. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  16. Three-alpha structures in 12C

    Microsoft Academic Search

    R. Pichler; H. Oberhummer; Attila Csótó; S. A. Moszkowski

    1997-01-01

    We search for three-alpha resonances in 12C by using the complex scaling method in a microscopic cluster model. All experimentally known low-lying natural-parity states of 12C are localized. For the first time we unambiguously show in a microscopic model that the 0+2 state in 12C, which plays an important role in stellar nucleosynthesis, is a genuine three-alpha resonance.

  17. Three-alpha structures in 12C

    Microsoft Academic Search

    P. Pichler; H. Oberhummer; Attila Csótó; S. A. Moszkowski

    1997-01-01

    We search for three-alpha resonances in 12C by using the complex scaling method in a microscopic cluster model. All experimentally known low-lying natural-parity states of 12 are localized. For the first time we unambiguously show in a microscopic model that the 02+ state in 12C, which plays an important role in stellar nucleosynthesis, is a genuine three-alpha resonance.

  18. Energy dependence of event shapes and of $\\\\alpha_s$ at LEP 2

    Microsoft Academic Search

    P. Abreu; W Adam; T Adye; P Adzic; Z Albrecht; T Alderweireld; G D Alekseev; R Alemany; T Allmendinger; P P Allport; S Almehed; Ugo Amaldi; N Amapane; S Amato; E G Anassontzis; P Andersson; A Andreazza; S Andringa; P Antilogus; W D Apel; Y Arnoud; B Åsman; J E Augustin; A Augustinus; Paul Baillon; P Bambade; F Barão; Guido Barbiellini; R Barbier; Dimitri Yuri Bardin; G Barker; A Baroncelli; Marco Battaglia; M Baubillier; K H Becks; M Begalli; A Behrmann; P Beillière; Yu A Belokopytov; K S Belous; N C Benekos; Alberto C Benvenuti; C Bérat; M Berggren; D Bertini; D Bertrand; M Besançon; F Bianchi; M Bigi; S M Bilenky; M A Bizouard; D Bloch; H M Blom; M Bonesini; W Bonivento; M Boonekamp; P S L Booth; A W Borgland; G Borisov; C Bosio; O Botner; E Boudinov; B Bouquet; C Bourdarios; T J V Bowcock; I Boyko; I Bozovic; M Bozzo; P Branchini; T Brenke; R A Brenner; P Brückman; J M Brunet; L Bugge; T Buran; T Burgsmüller; Brigitte Buschbeck; P Buschmann; S Cabrera; M Caccia; M Calvi; T Camporesi; V Canale; F Carena; L Carroll; Carlo Caso; M V Castillo-Gimenez; A Cattai; F R Cavallo; V Chabaud; M M Chapkin; P Charpentier; L Chaussard; P Checchia; G A Chelkov; R Chierici; P V Chliapnikov; P Chochula; V Chorowicz; J Chudoba; K Cieslik; P Collins; R Contri; E Cortina; G Cosme; F Cossutti; J H Cowell; H B Crawley; D J Crennell; S Crépé; G Crosetti; J Cuevas-Maestro; S Czellar; Martyn Davenport; W Da Silva; A Deghorain; G Della Ricca; P A Delpierre; N Demaria; A De Angelis; Wim de Boer; C De Clercq; B De Lotto; A De Min; L S De Paula; H Dijkstra; Lucia Di Ciaccio; J Dolbeau; K Doroba; M Dracos; J Drees; M Dris; A Duperrin; J D Durand; G Eigen; T J C Ekelöf; Gösta Ekspong; M Ellert; M Elsing; J P Engel; B Erzen; M C Espirito-Santo; E Falk; G K Fanourakis; D Fassouliotis; J Fayot; Michael Feindt; A Fenyuk; P Ferrari; A Ferrer; E Ferrer-Ribas; F Ferro; S Fichet; A Firestone; U Flagmeyer; H Föth; E Fokitis; F Fontanelli; B J Franek; A G Frodesen; R Frühwirth; F Fulda-Quenzer; J A Fuster; A Galloni; D Gamba; S Gamblin; M Gandelman; C García; C Gaspar; M Gaspar; U Gasparini; P Gavillet; E N Gazis; D Gelé; N Ghodbane; I Gil; F Glege; R Gokieli; B Golob; G Gómez-Ceballos; P Gonçalves; I González-Caballero; Gian P Gopal; L Gorn; M Górski; Yu Guz; Valerio Gracco; J Grahl; E Graziani; C Green; H J Grimm; P Gris; G Grosdidier; K Grzelak; M Günther; J Guy; F Hahn; S Hahn; S Haider; A Hallgren; K Hamacher; J Hansen; F J Harris; V Hedberg; S Heising; J J Hernández; P Herquet; H Herr; T L Hessing; J M Heuser; E Higón; S O Holmgren; P J Holt; S Hoorelbeke; M A Houlden; Josef Hrubec; K Huet; G J Hughes; K Hultqvist; J N Jackson; R Jacobsson; P Jalocha; R Janik; C Jarlskog; G Jarlskog; P Jarry; B Jean-Marie; E K Johansson; P E Jönsson; C Joram; P Juillot; F Kapusta; K Karafasoulis; S Katsanevas; E C Katsoufis; R Keränen; Borut P Kersevan; B A Khomenko; N N Khovanskii; A P Kiiskinen; B J King; A Kinvig; N J Kjaer; O Klapp; H Klein; P M Kluit; P Kokkinias; M Koratzinos; V Kostyukhin; C Kourkoumelis; O Kuznetsov; Manfred Krammer; E Kriznic; J Krstic; Z Krumshtein; P Kubinec; J Kurowska; K L Kurvinen; J Lamsa; P Langefeld; V Lapin; J P Laugier; R Lauhakangas; Gerhard Leder; F Ledroit; V Lefébure; L Leinonen; A Leisos; R Leitner; J Lemonne; Georg Lenzen; V Lepeltier; T Lesiak; M Lethuillier; J Libby; D Liko; A Lipniacka; I Lippi; B Lörstad; J G Loken; J H Lopes; J M López; R López-Fernandez; D Loukas; P Lutz; L Lyons; J N MacNaughton; J R Mahon; A Maio; A Malek; T G M Malmgren; S Maltezos; V Malychev; F Mandl; J Marco; R P Marco; B Maréchal; M Margoni; J C Marin; C Mariotti; A Markou; C Martínez-Rivero; F Martínez-Vidal; S Martí i García; N Mastroyiannopoulos; F Matorras; C Matteuzzi; Giorgio Matthiae; J Masik; F Mazzucato; M Mazzucato; M L McCubbin; R McKay; R McNulty; G McPherson; C Meroni; W T Meyer; E Migliore; L Mirabito; Winfried A Mitaroff; U Mjörnmark; T Moa; M Moch; R Møller; K Mönig; M R Monge; X Moreau; P Morettini; G A Morton; U Müller; K Münich; M Mulders; C Mulet-Marquis; R Muresan; W J Murray; B Muryn; Gerald Myatt; T Myklebust; F Naraghi; M Nassiakou; Francesco Luigi Navarria; S Navas; K Nawrocki; P Negri; S Némécek; N Neufeld; N Neumeister; R Nicolaidou; B S Nielsen; M Nikolenko; V P Nomokonov; Ainsley Normand; A Nygren; V F Obraztsov; A G Olshevskii; A Onofre; Risto Orava; G Orazi; K Österberg; A Ouraou; M Paganoni; S Paiano; R Pain; R Paiva; J Palacios; H Palka; T D Papadopoulou; K Papageorgiou; L Pape; C Parkes; F Parodi; U Parzefall; A Passeri; O Passon; M Pegoraro; L Peralta; Manfred Pernicka; A Perrotta; C Petridou; A Petrolini; H T Phillips; F Pierre; M Pimenta; E Piotto; T Podobnik; M E Pol; G Polok; P Poropat; V Pozdnyakov; P Privitera; N Pukhaeva; Antonio Pullia; D Radojicic; S Ragazzi; H Rahmani; P N Ratoff; A L Read; P Rebecchi; N G Redaelli; Meinhard Regler; D Reid

    1999-01-01

    Infrared and collinear safe event shape distributions and their mean values are determined using the data taken at ve di erent centre of mass energies above $M_Z$ with the DELPHI detector at LEP. From the event shapes, the strong coupling $\\\\alpha_s$ is extracted in $O(\\\\alpha^2_s)$, NLLA and a combined scheme using hadronisation corrections evaluated with fragmentation model generators as well

  19. Preparation and properties of (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl- (R)-(+)-alpha-hydroxy-alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy-alpha- (4-[125I]iodophenyl)-alpha-phenyl acetate as potential radiopharmaceuticals.

    PubMed

    Cohen, V I; Rzeszotarski, W J; Gibson, R E; Fan, L H; Reba, R C

    1989-10-01

    rac-4-Nitrobenzilic acid was synthesized and resolved with quinidine and quinine to give the corresponding (R)- and (S)-salts. The resolved diastereomeric salts were converted to (R)- and (S)-4-nitrobenzilic acids and subsequent esterification gave their corresponding ethyl esters. Transesterification with (R)-(-)-3-quinuclidinol afforded (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)-alpha-hydroxy-alpha- (4-nitrophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-nitrophenyl)-alpha-phenyl acetate. After hydrogenation, the (R,R)- and (R,S)-amines were converted to the respective triazene derivatives. The triazene derivatives reacted with sodium [125I]iodide to give (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)- alpha-hydroxy-alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate. The evaluation of their affinities to muscarinic acetylcholine receptors (MAcChR) shows that (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy-alpha-(4- [125I]iodophenyl)-alpha-phenyl acetate exhibits an affinity for the MAcChR from corpus striatum that is approximately threefold lower than that of (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)-alpha-hydroxy-alpha-(4- [125I]iodophenyl)-alpha-phenyl acetate. PMID:2600789

  20. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  1. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  2. Jet Physics at LEP and World Summary of $\\alpha_{s}$

    E-print Network

    Bethke, Siegfried

    1999-01-01

    Recent results on jet physics and tests of QCD from hadronic final states in $e^+e^-$ annihilation at PETRA and at LEP are reviewed, with special emphasis on hadronic event shapes, charged particle production rates, properties of quark and gluon jets and determinations of $\\alpha_s$. The data in the entire energy range from PETRA to LEP-2 are in broad agreement with the QCD predictions. The world summary of measurements of $\\alpha_s$ is updated and a detailed discussion of various methods to determine the overall error of uncertainties.

  3. Overview of Suborbital Human Transportation Concept ALPHA

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steelant, J.; Mack, A.

    2011-08-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched Phoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to their high cost, limited safety and toxicity, a low-cost, "green" and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was selected as baseline ALPHA propulsion. The general feasibility of hybrid propulsion for suborbital vehicle application with this propellant combination was already successfully demonstrated in the first reusable and privately-funded manned launch vehicle SpaceShipOne and consequently represents the solution with the lowest development risk for the investigated application. Due to the huge success of SpaceShipOne, the same type of hybrid propulsion is foreseen for Virgin Galactic's SpaceShipTwo. ALPHA vehicle guidance will preferably be fully autonomous during the entire mission flight profile. The required technology for autonomous vehicle guidance can be from the European RLV demonstrator Phoenix, which successfully demonstrated automated landing when it was dropped three times by a helicopter and landed precisely after a GPS-guided glide. This paper outlines the current status of the technology development work for ALPHA and has a special focus on aerodynamic and aerothermodynamic aspects of the concept.

  4. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  5. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high n? can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  6. Atypical antipsychotics as noncompetitive inhibitors of alpha4beta2 and alpha7 neuronal nicotinic receptors.

    PubMed

    Grinevich, Vladimir P; Papke, Roger L; Lippiello, Patrick M; Bencherif, Merouane

    2009-08-01

    It has been suggested that the interaction of antipsychotic medications with neuronal nicotinic receptors may increase the cognitive dysfunction associated with schizophrenia and may explain why current therapies only partially address this core feature of the illness. In the present studies we compared the effects of the atypical antipsychotics quetiapine, clozapine and N-desmethylclozapine to those of the typical antipsychotics haloperidol and chlorpromazine on the alpha4beta2 and alpha7 nicotinic receptor subtypes. The binding of [(3)H]-nicotine to rat cortical alpha4beta2 receptors and [(3)H]-methyllycaconitine to rat hippocampal alpha7 receptors was not affected by any of the compounds tested. However, Rb(+) efflux evoked either by nicotine or the selective alpha4beta2 agonist TC-1827 from alpha4beta2 receptors expressed in SH-EP1 cells and nicotine-evoked [(3)H]-dopamine release from rat striatal synaptosomes were non-competitively inhibited by all of the antipsychotics. Similarly, alpha-bungarotoxin-sensitive epibatidine-evoked [(3)H]-norepinephrine release from rat hippocampal slices and acetylcholine-activated currents of alpha7 nicotinic receptors expressed in oocytes were inhibited by haloperidol, chlorpromazine, clozapine and N-desmethylclozapine. The inhibitory effects on nicotinic receptor function produced by the antipsychotics tested occurred at concentrations similar to plasma levels achieved in schizophrenia patients, suggesting that they may lead to clinically relevant effects on cognition. PMID:19481556

  7. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  8. {alpha}-nucleus potentials, {alpha}-decay half-lives, and shell closures for superheavy nuclei

    SciTech Connect

    Mohr, Peter [Diakoniekrankenhaus Schwaebisch Hall, D-74523 Schwaebisch Hall (Germany)

    2006-03-15

    Systematic {alpha}-nucleus folding potentials are used to analyze {alpha}-decay half-lives of superheavy nuclei. Preformation factors of about several percent are found for all nuclei under study. The systematic behavior of the preformation factors and the volume integrals of the potentials allows predictions of {alpha}-decay energies and half-lives for unknown nuclei. Shell closures can be determined from measured {alpha}-decay energies using the discontinuity of the volume integral at shell closures. For the first time a double shell closure is predicted for Z{sub magic}=132,N{sub magic}=194, and A{sub magic}=326 from the systematics of folding potentials. The calculated {alpha}-decay half-lives remain far below 1 ns for superheavy nuclei with double shell closure and masses A>300 independent of the precise knowledge of the magic proton and neutron numbers.

  9. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  10. Benchmarking the External Surrogate Ratio Method using the ({alpha},{alpha}{sup '}f) reaction at STARS

    SciTech Connect

    Lesher, S. R. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Bernstein, L. A.; Bleuel, D.; Burke, J. T.; Lyles, B. F.; Moody, K. J.; Norman, E. B. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Ai, H. [Yale University, New Haven, Connecticut 06520 (United States); Beausang, C. W. [Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Clark, R. M.; Fallon, P.; Gibelin, J.; Lee, I. Y.; Macchiavelli, A. O.; McMahan, M. A.; Phair, L.; Rodriguez-Vieitez, E.; Wiedeking, M. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2008-04-17

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{sup '}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n,f) and {sup 235}U(n,f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha},{alpha}{sup '}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  11. Selective Inhibition of Alpha/Beta-Hydrolase Domain 6 Attenuates Neurodegeneration, Alleviates Blood Brain Barrier Breakdown, and Improves Functional Recovery in a Mouse Model of Traumatic Brain Injury

    PubMed Central

    Tchantchou, Flaubert

    2013-01-01

    Abstract 2-arachidonylglycerol (2-AG) is the most abundant endocannabinoid in the central nervous system and is elevated after brain injury. Because of its rapid hydrolysis, however, the compensatory and neuroprotective effect of 2-AG is short-lived. Although inhibition of monoacylglycerol lipase, a principal enzyme for 2-AG degradation, causes a robust increase of brain levels of 2-AG, it also leads to cannabinoid receptor desensitization and behavioral tolerance. Alpha/beta hydrolase domain 6 (ABHD6) is a novel 2-AG hydrolytic enzyme that accounts for a small portion of 2-AG hydrolysis, but its inhibition is believed to elevate the levels of 2-AG within the therapeutic window without causing side effect. Using a mouse model of traumatic brain injury (TBI), we found that post-insult chronic treatment with a selective ABHD6 inhibitor WWL70 improved motor coordination and working memory performance. WWL70 treatment reduced lesion volume in the cortex and neurodegeneration in the dendate gyrus. It also suppressed the expression of inducible nitric oxide synthase and cyclooxygenase-2 and enhanced the expression of arginase-1 in the ipsilateral cortex at 3 and 7 days post-TBI, suggesting microglia/macrophages shifted from M1 to M2 phenotypes after treatment. The blood-brain barrier dysfunction at 3 and 7 days post-TBI was dramatically reduced. Furthermore, the beneficial effects of WWL70 involved up-regulation and activation of cannabinoid type 1 and type 2 receptors and were attributable to the phosphorylation of the extracellular signal regulated kinase and the serine/threonine protein kinase AKT. This study indicates that the fine-tuning of 2-AG signaling by modulating ABHD6 activity can exert anti-inflammatory and neuroprotective effects in TBI. PMID:23151067

  12. An on-line target transport system for short-lived radioisotopes

    Microsoft Academic Search

    D. W. Holdsworth; D. A. L. Paul

    1985-01-01

    Equipment has been developed to transport self supporting target films in vacuo at high speeds. The targets may be transferred over 3 m in less than 2 s and are gently accelerated and decelerated. In addition, the targets are accurately positioned at each end to within 25 mum. Non-magnetic materials are used throughout and wear is reduced so that 500

  13. Search for short lived axions emitted from neutron capture on protons

    SciTech Connect

    Freedman, S.J.; Arnold, M.; Doehner, J.; Last, J.; Dubbers, D.

    1986-01-01

    A search has been conducted for light neutral particles like the axions which decay rapidly to electron positron pairs produced in the reaction n + p ..-->.. D + a. Instead the e/sup +/e/sup -/ signal expected from direct internal pair conversion has been detected. A preliminary analysis gives (GAMMA/sub p//GAMMA/sub ..gamma../)/sub expt//(GAMMA/sub p//GAMMA/sub ..gamma../)/sub theo/ = 1.06 +- 0.12. The results exclude existing axion models over the mass range 2 m/sub e/ < m/sub a/ < 2.22 MeV/c/sup 2/. The axion mass would fall in this range if they were responsible for the narrow positron lines observed in recent heavy-ion experiments at the GSI.

  14. Global Distributions and Natural Sources of Brominated very Short-Lived Substances 

    E-print Network

    Liu, Yina

    2013-07-09

    ), is required. However, BrVSLS production rates are largely controlled by other biogeochemical factors in seawater, such as DOM composition. Results from this study also suggest that V-BrPO activity not only plays an essential role in BrVSLS production...

  15. Orbit of the short-lived Sun-grazing comet C/1999 X3

    NASA Astrophysics Data System (ADS)

    Dermawan, B.; Wulandari, H. R. T.; Mahasena, P.; Wibowo, R. W.; Sulistiyowati, Guritno, C. S.

    2014-03-01

    Sun-grazing comet C/1999 X3 was discovered by SOHO and does not belong to any known Sun-grazer group. The comet resides in near-Earth space and no cometary outgassing component constants are available. Using recent orbital data on May 2012, we numerically followed a nominal orbit of the comet and put all planets as perturbing bodies. We find that C/1999 X3 will plunge into the sun in only about 2100 yrs. This lifetime is roughly a quarter that of the known sun-grazer comet 96P/Machholz 1. Involving an adopted 96P model of cometary outgassing and relativity correction into the equations of motion of the comet will insignificantly shorten its lifetime, before impact. We generated about 3500 orbital clones of C/1999 X3 to analyze orbital variations of the comet. Results show that 95% clones will impact the Sun over the lifetime. This high solar impact probability offers a study of cometary dynamics in near-Earth space for which it may indicate a new group of Sun-grazer.

  16. SOURCE ATTRIBUTION OF RADIATIVE FORCING FROM SHORT LIVED CLIMATE FORCING AGENTS

    EPA Science Inventory

    The immediate project result is quantification of the pre-industrial to present forcing for anthropogenic emissions, the radiative effects of natural emissions, and spatial distribution of the radiative forcing efficiency for key aerosol and O3 precursors (i.e., mW/m2...

  17. Atomic mass measurements of short-lived nuclides around the doubly-magic 208Pb

    E-print Network

    C. Weber; G. Audi; D. Beck; K. Blaum; G. Bollen; F. Herfurth; A. Kellerbauer; H. -J. Kluge; D. Lunney; S. Schwarz

    2008-01-14

    Accurate atomic mass measurements of neutron-deficient and neutron-rich nuclides around the doubly-magic 208Pb and of neutron-rich cesium isotopes were performed with the Penning trap mass spectrometer ISOLTRAP at ISOLDE/CERN. The masses of 145,147Cs, 181,183Tl, 186Tlm, 187Tl, 196Tlm, 205Tl, 197Pbm, 208Pb, 190 to 197Bi, 209,215,216Bi, 203,205,229Fr, and 214,229,230Ra were determined. The obtained relative mass uncertainty in the range of $2 \\cdot 10^{-7}$ to $2 \\cdot 10^{-8}$ is not only required for safe identification of isomeric states but also allows mapping the detailed structure of the mass surface. A mass adjustment procedure was carried out and the results included into the Atomic Mass Evaluation. The resulting separation energies are discussed and the mass spectrometric and laser spectroscopic data are examined for possible correlations.

  18. GANIL LPC, 9 July 2010 Short-lived binary splits of an excited

    E-print Network

    de Souza, Romualdo T.

    -up #12;S. Hudan, GANIL-LPC, July 9 2010 Nuclear Symmetry Energy · Impacts: · Properties of neutron stars to free nucleons · Importance of measuring free nucleons 64Zn + 64Zn at E/A = 45MeV: Mass Identification E-E technique "E" "E" CsI carbon neon silicon carbon neon silicon #12;S. Hudan, GANIL-LPC, July 9

  19. Neutron-induced cross sections of short-lived nuclei via the surrogate reaction method

    E-print Network

    Paris-Sud XI, Université de

    this technique can be used to determine neutron-induced capture cross sections in the rare-earth region. 1 for a neutron- induced measurement. We have successfully used the surrogate reaction method to extract neutron allows one to extract the dec

  20. Isotope Shift Measurements of Stable and Short-Lived Lithium Isotopes for Nuclear Charge Radii Determination

    E-print Network

    W. Nörtershäuser; R. Sánchez; G. Ewald; A. Dax; J. Behr; P. Bricault; B. A. Bushaw; J. Dilling; M. Dombsky; G. W. F. Drake; S. Götte; H. -J. Kluge; Th. Kühl; J. Lassen; C. D. P. Levy; K. Pachucki; M. Pearson; M. Puchalski; A. Wojtaszek; Z. -C. Yan; C. Zimmermann

    2010-12-17

    Changes in the mean-square nuclear charge radii along the lithium isotopic chain were determined using a combination of precise isotope shift measurements and theoretical atomic structure calculations. Nuclear charge radii of light elements are of high interest due to the appearance of the nuclear halo phenomenon in this region of the nuclear chart. During the past years we have developed a new laser spectroscopic approach to determine the charge radii of lithium isotopes which combines high sensitivity, speed, and accuracy to measure the extremely small field shift of an 8 ms lifetime isotope with production rates on the order of only 10,000 atoms/s. The method was applied to all bound isotopes of lithium including the two-neutron halo isotope Li-11 at the on-line isotope separators at GSI, Darmstadt, Germany and at TRIUMF, Vancouver, Canada. We describe the laser spectroscopic method in detail, present updated and improved values from theory and experiment, and discuss the results.

  1. Isotope Shift Measurements of Stable and Short-Lived Lithium Isotopes for Nuclear Charge Radii Determination

    E-print Network

    Nörtershäuser, W; Ewald, G; Dax, A; Behr, J; Bricault, P; Bushaw, B A; Dilling, J; Dombsky, M; Drake, G W F; Götte, S; Kluge, H -J; Kühl, Th; Lassen, J; Levy, C D P; Pachucki, K; Pearson, M; Puchalski, M; Wojtaszek, A; Yan, Z -C; Zimmermann, C

    2010-01-01

    Changes in the mean-square nuclear charge radii along the lithium isotopic chain were determined using a combination of precise isotope shift measurements and theoretical atomic structure calculations. Nuclear charge radii of light elements are of high interest due to the appearance of the nuclear halo phenomenon in this region of the nuclear chart. During the past years we have developed a new laser spectroscopic approach to determine the charge radii of lithium isotopes which combines high sensitivity, speed, and accuracy to measure the extremely small field shift of an 8 ms lifetime isotope with production rates on the order of only 10,000 atoms/s. The method was applied to all bound isotopes of lithium including the two-neutron halo isotope Li-11 at the on-line isotope separators at GSI, Darmstadt, Germany and at TRIUMF, Vancouver, Canada. We describe the laser spectroscopic method in detail, present updated and improved values from theory and experiment, and discuss the results.

  2. Isotope Shift Measurements of Stable and Short-Lived Lithium Isotopes for Nuclear Charge Radii Determination

    Microsoft Academic Search

    W. Nörtershäuser; R. Sánchez; G. Ewald; A. Dax; J. Behr; P. Bricault; B. A. Bushaw; J. Dilling; M. Dombsky; G. W. F. Drake; S. Götte; H.-J. Kluge; Th. Kühl; J. Lassen; C. D. P. Levy; K. Pachucki; M. Puchalski; A. Wojtaszek; Z.-C. Yan; C. Zimmermann

    2010-01-01

    Changes in the mean-square nuclear charge radii along the lithium isotopic\\u000achain were determined using a combination of precise isotope shift measurements\\u000aand theoretical atomic structure calculations. Nuclear charge radii of light\\u000aelements are of high interest due to the appearance of the nuclear halo\\u000aphenomenon in this region of the nuclear chart. During the past years we have\\u000adeveloped

  3. Long- and short-lived electrons with anomalously high collision rates in laser-ionized gases

    SciTech Connect

    Kampfrath, Tobias; Perfetti, Luca; Tegeder, Petra; Wolf, Martin; Frischkorn, Christian [Fachbereich Physik, Freie Universitaet Berlin, Arnimallee 14, 14195 Berlin (Germany); Gericke, Dirk O. [Centre for Fusion, Space and Astrophysics, Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)

    2007-12-15

    Ultrashort broadband terahertz pulses are applied to probe the electron dynamics of gaseous Ar and O{sub 2} following ionization by an intense femtosecond laser pulse. The conductivity in the plasma center is extracted by a modified Wentzel-Kramers-Brillouin approach. It exhibits a nearly perfect Drude-like spectral shape and yields the temporal evolution of the free-electron density and collision rate. While the electron density in the Ar plasma remains nearly constant during the first 200 ps after generation, it decays much faster in O{sub 2} due to dissociative recombination which is only possible in molecular plasmas. Adding a small amount of the electron scavenger SF{sub 6} to Ar reduces the electron lifetime in the plasma dramatically and allows us to determine the electron temperature to about 20 000 K. Furthermore, anomalously high, metal-like electron collision rates of up to 25 THz are found. Kinetic plasma theory substantially underestimates these rates pointing towards additional and more complex processes randomizing the total electronic momentum. Our results are relevant to both lightning control and generation of terahertz radiation by intense laser pulses in gases.

  4. Evaluation of Uncertainties in Decay Constants of ``Short-Lived'' Radionuclides: A Meta-Analysis Approach

    NASA Astrophysics Data System (ADS)

    Boehnke, P.; Steele, R. C. J.

    2014-09-01

    We have performed a meta-analysis of half-lives for cosmochemically relevant radionuclides. We show that there is a range of behavior from well (e.g., 10Be) to poorly constrained (e.g., 53Mn or 129I).

  5. Incorporation of Short-Lived Be in a Calcium-Aluminum

    E-print Network

    in meteorites are controversial: These isotopes can be pro- duced by nucleosynthesis in different stellar canonical abundance of aluminum-26 may still require seeding of the solar system by radioactive stellar with the destruction of these elements in stellar interiors by nuclear burning, accounts for the depleted cosmic

  6. Dynamical evidence for a short-lived CTTS state of indoles in glycerol

    Microsoft Academic Search

    H. Lami

    1981-01-01

    Summary  Subnanosecond time-resolved fluorescence spectroscopy has been used to investigate the excited-state interaction between indole\\u000a and 2, 3-dimenthyl indole and glycerol, at different temperatures (25°C to ?57°C). Impulse response functions obtained at\\u000a the red tail of the emission spectra are typical of an excited molecular system, undergoing Bakhshiev’s universal excited-state\\u000a solvent relaxation. At the blue edge, however, an anomalous effect is

  7. Management strategies for short lived species: The case of Australia's Northern Prawn Fishery

    Microsoft Academic Search

    Catherine M. Dichmont; André E. Punt; William Venables; Malcolm Haddon

    2006-01-01

    Management strategies for tiger prawns, Penaeus semisulcatus and P. esculentus, in Australia's Northern Prawn Fishery (NPF), are evaluated in terms of conservation- and economic-related performance measures. A two-stage process is used to determine the factors to which these performance measures are most sensitive. The first stage involves identifying the possible factors and their interactions, constructing a partial factorial design to

  8. Population maintenance of the short-lived shrub Sambucus in a deciduous forest.

    PubMed

    Abe, Shin; Motai, Hideyo; Tanaka, Hiroshi; Shibata, Mitsue; Kominami, Yohsuke; Nakashizuka, Tohru

    2008-04-01

    This study quantitatively clarifies the life history of a shrub, Sambucus racemosa ssp. sieboldiana, in an old-growth forest, the Ogawa Forest Reserve, Japan, by a demographic approach using a projection matrix model that incorporates interactions between demographic parameters and canopy height dynamics. S. racemosa is a common deciduous shrub in central Japan and is known to grow predominantly at forest edges or roadsides. This indicates that it is a highly light-demanding species, and occurrence in gaps in old-growth stands suggests its "fugitive," gap-dependent life history in old-growth forests. We found that one distinctive feature of this species was that its seedlings can survive well in shaded conditions by alternating stems every year like perennial herb species. Matrix model analyses demonstrated that S. racemosa can continuously regenerate under the present disturbance regime of this forest and is highly adaptable to the structural dynamics of the old-growth forest. The maturity of S. racemosa shrubs depends on their size, and nearly all (>90%) of the mature (reproducing) individuals were found in gaps or near gaps. But wide seed dispersal by birds and the ability to form both seed banks and seedling banks, the latter of which has been regarded as a common characteristic of shade-tolerant climax species, probably increase the species' chances to encounter canopy gaps. Dynamic-canopied matrix models showed that the greatest elasticity is with shaded seedling survival. The frequent stem alternation of shaded seedlings often makes the growth rate negative, but the survival rate of seedlings in low light awaiting new gap creation is remarkably high (0.93 yr(-1)). The lower survival rate of the larger individuals and smaller minimum size to start reproduction than other canopy or subcanopy shade-tolerant species indicate that S. racemosa has the potential to reproduce before the closure of the encountered gaps and to complete its life history rapidly. PMID:18481539

  9. Stock Price Reactions to Short-Lived Public Information: The Case of Betting Odds

    Microsoft Academic Search

    F. A. Palomino; L. D. R. Renneboog; C. Zhang

    2005-01-01

    Stock markets and betting markets co-exist for professional soccer clubs listed on the London Stock Exchange.For each firm, two pieces of information are released to the stock market on a weekly basis from August to June: experts expectations about game outcomes through the betting odds, and the game outcomes.Stock markets process the news about games results fast.By contrast, there is

  10. Detection of short lived radioisotopes as a fast diagnostic for intense laser-solid interactions

    SciTech Connect

    Clarke, R. J.; Ledingham, K. W. D.; McKenna, P.; Robson, L.; McCanny, T.; Neely, D.; Lundh, O.; Lindau, F.; Wahlstroem, C.-G.; Simpson, P. T.; Zepf, M. [SUPA, Department of Physics, University of Strathclyde, Glasgow G4 0NG, Scotland (United Kingdom); CCLRC Rutherford Appleton Laboratory, Chilton, Didcot, Oxfordshire OX11 OQX (United Kingdom); Department of Physics, Lund Institute of Technology, P.O. Box 118, S-221 00 Lund (Sweden); Department of Physics and Astronomy, Queens University Belfast, Belfast BT7 1NN, Northern Ireland (United Kingdom)

    2006-10-02

    As a diagnostic of high-intensity laser interactions (>10{sup 19} W cm{sup -2}), the detection of radioactive isotopes is regularly used for the characterization of proton, neutron, ion, and photon beams. This involves sample removal from the interaction chamber and time consuming post shot analysis using NaI coincidence counting or Ge detectors. This letter describes the use of in situ detectors to measure laser-driven (p,n) reactions in {sup 27}Al as an almost real-time diagnostic for proton acceleration. The produced {sup 27}Si isotope decays with a 4.16 s half-life by the predominantly {beta}+ emission, producing a strong 511 keV annihilation peak.

  11. Sensitivity of stratospheric Bry to uncertainties in very short lived substance emissions and atmospheric transport

    NASA Astrophysics Data System (ADS)

    Schofield, R.; Fueglistaler, S.; Wohltmann, I.; Rex, M.

    2010-10-01

    We evaluate the sensitivity of Bry entering the stratosphere with a simplified model that allows calculations over a wide parameter range for parameters that are currently poorly quantified. The model examines the transport process uncertainties in the source concentrations and lifetimes, in the convective parameterization and in the inorganic bromine washout process due to dehydration. Source concentrations at the surface and lifetimes were found to have a slight effect on the resultant Bry (~2 ppt), however this was highly dependent upon, with increasing significance, the degree of efficiency of convective delivery. Efficiency of convective delivery of boundary layer (BL) air to the tropical tropopause layer (TTL) along with washout at the CPT were found to significantly affect Bry at 400 K - altering the delivered Bry by 3.3 ppt and 2.9 ppt, respectively. We find that the results critically depend on free tropospheric Bry concentrations due to dilution of convective updrafts, and the processes that control free tropospheric Bry require further attention.

  12. Sensitivity of stratospheric Bry to uncertainties in very short lived substance emissions and atmospheric transport

    NASA Astrophysics Data System (ADS)

    Schofield, R.; Fueglistaler, S.; Wohltmann, I.; Rex, M.

    2011-02-01

    We evaluate the sensitivity of Bry entering the stratosphere with a simplified model that allows calculations over a wide parameter range for parameters that are currently poorly quantified. The model examines the transport process uncertainties in the source concentrations and lifetimes, in the convective parameterization and in the inorganic bromine washout process due to dehydration. Source concentrations at the surface and lifetimes were found to have a slight effect on the resultant Bry (1 ppt), however this was highly dependent upon, with increasing significance, the BL component of convectively delivered air. Efficiency of convective delivery of boundary layer (BL) air to the tropical tropopause layer (TTL) along with washout at the CPT were found to substantially affect Bry at 400 K - altering the delivered Bry by 3.3 ppt and 2.9 ppt, respectively. We find that the results critically depend on free tropospheric bromine source gas concentrations due to dilution of convective updrafts, and the processes that control free tropospheric bromine source gas concentrations require further attention.

  13. Short-lived excited triplet states studied by time-resolved EPR spectroscopy

    Microsoft Academic Search

    Noboru Hirota; Seigo Yamauchi

    2003-01-01

    In this review, we present an overview of the application of time-resolved electron paramagnetic resonance (TREPR) to the study of excited triplet states. After a brief discussion of background and experimental methods, triplet properties clarified by TREPR are reviewed to show how TREPR provides rich information about electronic and molecular structures and dynamic properties of the lowest excited triplet states.

  14. Short-lived variations in the background gamma-radiation dose.

    PubMed

    Burnett, J L; Croudace, I W; Warwick, P E

    2010-09-01

    Sudden increases in the background gamma-radiation dose may occur due to the removal of (222)Rn and (220)Rn progeny from the atmosphere by wet deposition mechanisms. This contribution has been measured using a Geiger-Muller detector at the Atomic Weapons Establishment (Aldermaston, UK) during July 2005-April 2006. The results are approximated by a log-normal distribution and there were nine separate occurrences of the gamma-radiation dose exceeding 125% of the geometric mean value. The increases were associated with periods of heavy rainfall, although no correlation was evident between the dose rate and the amount of rainfall, as increased rainfall dilutes the activity further rather than increasing its atmospheric removal. The events were preceded by periods of fine weather and atmospheric stability that allow for the build-up of (222)Rn and (220)Rn progeny. Similar increases in gamma-radiation dose have been measured at a nearby monitoring station situated approximately 11 miles from Aldermaston. Increases in gamma-radiation dose during heavy rainfall have also been observed throughout the UK, that followed the trajectory of an air mass. All events decreased to typical values within 1-2 h as the water permeated into the ground below and the radioactivity decayed away. PMID:20826890

  15. Biogeographic insights from a short-lived Palaeocene island in the Ninetyeast Ridge

    E-print Network

    Renner, Susanne

    flowering plants, and 20 species of ferns and club mosses, all identified from pollen and spores. Carpenter and spores of distinctly Australian and New Zealand affinities, with weaker similarity to fossil assemblages of spores and pollen, dinoflagellate cysts, acritarchs, foraminifera, nannofossils and molluscs provides

  16. Investigation of short-lived PT and PB ? emitters near the proton drip line

    Microsoft Academic Search

    C. R. Bingham; J. Wauters; B. E. Zimmerman; K. S. Toth; J. C. Batchelder; E. F. Zganjar; D. J. Blumenthal; C. N. Davids; D. J. Henderson; D. Seweryniak; L. T. Brown; B. C. Busse; L. F. Conticchio; W. B. Walters; T. Davinson; R. J. Irvine; P. J. Woods

    1997-01-01

    In a series of experiments at the Argonne ATLAS Accelerator Facility, several ? emitters near the proton drip line were produced with fusion evaporation reactions, separated from the beam and dispersed in M\\/Q with a recoil mass spectrometer, and implanted and studied in a double-sided silicon strip detector. In 78Kr bombardments of 92Mo and 96Ru, the new isotopes 166Pt and

  17. Investigation of short-lived PT and PB α emitters near the proton drip line

    NASA Astrophysics Data System (ADS)

    Bingham, C. R.; Wauters, J.; Zimmerman, B. E.; Toth, K. S.; Batchelder, J. C.; Zganjar, E. F.; Blumenthal, D. J.; Davids, C. N.; Henderson, D. J.; Seweryniak, D.; Brown, L. T.; Busse, B. C.; Conticchio, L. F.; Walters, W. B.; Davinson, T.; Irvine, R. J.; Woods, P. J.

    1997-02-01

    In a series of experiments at the Argonne ATLAS Accelerator Facility, several ? emitters near the proton drip line were produced with fusion evaporation reactions, separated from the beam and dispersed in M/Q with a recoil mass spectrometer, and implanted and studied in a double-sided silicon strip detector. In 78Kr bombardments of 92Mo and 96Ru, the new isotopes 166Pt and 167Pt were identified via their ?-decay properties and more accurate half-lives were measured for 168Pt and 170Pt. The light isotopes of lead, 180Pb, 182Pb, and 184Pb were produced in Mo bombardments of Zr target nuclei. The ?-decay energies and half-lives of the new isotopes are as follows: 1) 166Pt, E?=7110(15) keV, T1/2=0.3(1) ms; and 2) 167Pt, E?=6988(10) keV, T1/2=0.7(2) ms. Also, the half-life of 168Pt, which was previously unknown, was determined to be 2.0(4) ms and that of 170Pt was observed to be 14.7(5) ms. The tentative ?-decay energies and half-lives of the even Pb isotopes are: 1) 184Pb, E?=6625(10) keV, T1/2=500(25) ms; 2) 182Pb, E?=6895(10) keV, T1/2=62(5) ms; and 3) 180Pb, E?=7250(15) keV, T1/2=5.8-1.4+2.8 ms. The ?-decay rates for these Pt and Pb nuclides are compared with earlier measurements and systematic trends of the reduced widths with neutron number are discussed.

  18. Investigation of short-lived PT and PB α emitters near the proton drip line

    Microsoft Academic Search

    C. R. Bingham; J. Wauters; B. E. Zimmerman

    1996-01-01

    In a series of experiments at the Argonne ATLAS Accelerator Facility, several α emitters near the proton drip line were produced with fusion evaporation reactions, separated from the beam and dispersed in M\\/Q with a recoil mass spectrometer, and implanted and studied in a double-sided silicon strip detector. In ⁷⁸Kr bombardments of ⁹²Mo and ⁹⁶Ru, the new isotopes ¹⁶⁶Pt and

  19. Opposing hormonal mechanisms of aggression revealed through short-lived testosterone manipulations and multiple winning experiences

    E-print Network

    Trainor, Brian

    aggression tests (before application of T or saline injections), and aromatase activity in the bed nucleus. The effect of T injections on aggression was androgen-based, as the inhibition of aromatase did not block the T injections from increasing aggression. Aromatase inhibition did, however, increase aggression in the initial

  20. Persistence of Dactylogyrus eucalius (Monogenea: Dactylogyridae) on the short-lived host Culaea inconstans (Pisces: Gasterosteiformes).

    PubMed

    King, Stanley D; Cone, David K

    2008-08-01

    The monogene Dactylogyrus eucalius Mizelle and Regensberger, 1945 and its ability to maintain a population from year to year on the annual fish Culaea inconstans Kirkland was examined in a small lake in central Ontario. Fish were sampled toward the end of their annual breeding season, at a time when the host population consisted of 2 cohorts, i.e., young-of-the-year (0+) and mature adults (1+). Prevalence of infection was 94%, with a mean intensity of 8.8 +/- 9.6; neither measure varied significantly with host length or between cohorts (P > 0.05). At necropsy, parasites were characterized as juveniles that included postoncomiracidia (immature, with a ventrally directed haptor) as well as developing protandrous males (body with a near-complete haptor and with little or no pigmented vitellaria), or as adults (with testis, ovarium, darkened vitellaria, and occasionally bearing a tanned egg). The proportion of juvenile to adult parasites differed significantly between cohorts (P < 0.05), with 0+ fish infected with a mixture of juveniles and adults, whereas 1+ fish had almost exclusively adult parasites. Since adult (1+) brook stickleback typically die after spawning, the increased frequency of juvenile parasites exploiting juvenile hosts may represent an evolutionary adaptation, maximizing the chances of parasites infecting hosts that will enter winter. It is suspected that 0+ fish can be infected in the nest within 2 wk of hatching and persist by effectively infecting new host recruits when they are sympatric with their parents. PMID:18576820

  1. On the atmospheric degradation of very short lived brominated compounds and their reservoir species

    NASA Astrophysics Data System (ADS)

    Martinez-Aviles, Monica

    Under the international agreements for the protection of the ozone layer, the production of chlorofluorocarbons (CFCs), halons and several other halocarbons has been prohibited. Consequently, there is an interest in replacing these compounds. As part of the development of such replacing compounds, their potential effects on stratospheric ozone need to be evaluated. In the present work, the atmospheric oxidation mechanisms of bromoethane and bromopropane are thoroughly discussed with the use of ab initio molecular orbital methods aiming to identify other brominated species not yet accounted for. From these calculations, reaction enthalpies and activation energies are determined to characterize the potential energy surface of the proposed mechanisms for the complete atmospheric degradation of bromoethane and bromopropane. Moreover, modeling studies on the atmospheric degradation of bromopropane and its ODP are performed. Uncertainty in the ozone effects of bromoethane and bromopropane is associated to the lack of information regarding their respective brominated by-products for the atmospheric degradation chemistry. Ab initio molecular orbital methods have been used to determine the fundamental IR vibrational modes of HC(O)H, CH3C(O)H, BrC(O)H, BrCH2C(O)H, BrCH2CH 2C(O)H, CH3C(O)CH3, BrC(O)CH3, BrC(O)CH 2CH3, and BrCH2C(O)CH3. A complete assignment for all the fundamental modes has been made for all the species under study. The vibrational infrared spectra of the brominated reservoir species is theoretically modeled and compared to experimental values where available. Rotational constants are calculated and compared with the literature.

  2. On the Vega Debris Disc's Dust Grains: Short-Lived or Long-Lived ?

    E-print Network

    Jiang, Ing-Guey

    2009-01-01

    Through Spitzer Space Telescope's observations, Su et al. (2005) show that the Vega debris disc is dominated by grains which are small enough to be blown out by radiation pressure. This implies the lifetime of Vega debris disc's grains is relatively short, about 1000 years, and a continuous dust production is necessary to maintain the observed debris disc. However, Krivov et al. (2006)'s theoretical calculations show that the Vega debris disc is dominated by 10 micro-meter grains, which would be in bound orbits and thus long-lived, provided that the disc is in a steady state. In order to solve the above contradiction, through dynamical simulations, we determine the grains' orbital evolutions and density profiles and seek a model of size distribution which can reproduce the observed surface brightness. Our results show that a self-consistent dynamical model with a 1/R disc density profile can be constructed when the grains have a power-law size distribution. Moreover, both types of models, dominated by short-l...

  3. Managing Short-Lived and Long-Lived Values in Coarse-Grained Reconfigurable Arrays

    Microsoft Academic Search

    Brian Van Essen; Robin Panda; Aaron Wood; Carl Ebeling; Scott Hauck

    2010-01-01

    Efficient storage in spatial processors is increasingly important as such devices get larger and support more concurrent operations. Unlike sequential processors that rely heavily on centralized storage, e.g. register files and embedded memories, spatial processors require many small storage structures to efficiently manage values that are distributed throughout the processor's fabric. The goal of this work is to determine the

  4. New Developments for Isochronous Mass Measurements of Short-Lived Nuclei

    SciTech Connect

    Knoebel, R.; Litvinov, S. A.; Boutin, D.; Chen, L.; Geissel, H.; Litvinov, Yu. A.; Scheidenberger, C.; Winckler, N. [Gesellschaft fuer Schwerionenforschung GSI, 64291 Darmstadt (Germany); Justus-Liebig-Universitaet Giessen, 35392 Giessen (Germany); Sun, B. [Gesellschaft fuer Schwerionenforschung GSI, 64291 Darmstadt (Germany); School of Physics, Peking University, Beijing 100871 (China); Beckert, K.; Beller, P.; Bosch, F.; Brandau, C.; Dimopoulou, C.; Dolinskii, A.; Kozhuharov, C.; Mazzocco, M.; Montes, F.; Muenzenberg, G.; Nociforo, C. [Gesellschaft fuer Schwerionenforschung GSI, 64291 Darmstadt (Germany)] (and others)

    2007-02-26

    The combination of the in-flight separator FRS and the storage-ring ESR at GSI offers unique possibilities for high accuracy mass and lifetime measurements of bare and few-electron fragments. Operating the ESR in the isochronous mode allows for measurements of revolution frequencies of stored ions without cooling. Isochronous Mass Spectrometry (IMS) can be applied to fragments with half-lives as short as several tens of microseconds. Newly developed magnetic rigidity tagging increases the resolving power of IMS to about 500000. IMS can be used to measure masses of nuclei with rates even lower than one ion per day, a property also needed for the purpose of the ILIMA project at the future facility FAIR.

  5. Infection resistance of surface modified catheters with either short-lived or prolonged activity

    Microsoft Academic Search

    L. A. Sampath; N. Chowdhury; L. Caraos; S. M. Modak

    1995-01-01

    It has been suggested that the invasion of microbes into the catheter tract occurs mainly at the time of catheter insertion. To investigate whether the presence of an antimicrobial environment during the initial period after insertion is sufficient to reduce the risk of subsequent catheter colonization and infection, we evaluated the use of benzalkonium chloride-heparin bonded (BZK-hep) central venous catheters,

  6. Yields of Short-lived Fission-Products of ^235U

    NASA Astrophysics Data System (ADS)

    Tipnis, S. V.; Campbell, J. M.; Couchell, G. P.; Li, S.; Nguyen, H. V.; Pullen, D. J.; Seabury, E. H.; Schier, W. A.

    1996-10-01

    Delayed gamma spectra from ^235U(n_th, f) fission-products were measured over delay times ranging from 0.4 to 7500 s using an HPGe detector enclosed in a NaI(Tl) Compton suppression annulus. Use of beta-gamma coincidence for background reduction, and a helium-jet/moving tape arrangement to rapidly transport the fission products to the detector allowed for a precise measurement of the delay time after fission. Yields of the individual gamma lines were compared with the intensity values listed in the Nuclear Data Sheets. From the relative intensities of the gamma lines, the relative independent and cumulative yields of the precursor isotopes were calculated using the Bateman equations and compared with the values listed in the ENDF/B-VI fission-product data base. Charge-mass complementarity was used to estimate the elemental yields of the unmeasured fission-products.

  7. Muscle senescence in short-lived wild mammals, the soricine shrews Blarina brevicauda and Sorex palustris

    Microsoft Academic Search

    Allyson G. Hindle; John M. Lawler; Kevin L. Campbell; Markus Horning

    2009-01-01

    Red-toothed (soricine) shrews are consummate predators exhibiting the highest energy turnovers and shortest life spans (ca. 18 months) of any mammal, yet virtually nothing is known regarding their physiological aging. We assessed the emerging pattern of skeletal muscle senescence (contractile\\/connective tissue components) in sympatric species, the semi-aquatic water shrew (WS), Sorex palustris, and the terrestrial short-tailed shrew (STS), Blarina brevicauda

  8. The spatial extent of source influences on modeled column concentrations of short-lived species

    E-print Network

    Martin, Randall

    by the oxidation of volatile organic compounds (VOCs) and can provide information about VOC emissions, which affect have been used as a proxy for estimating VOC emissions [Palmer et al., 2003; Millet et al., 2008]. SO2

  9. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Lee, Si-Hyung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Jae-Sung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  10. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R. (Lawrence Township, Mercer County, NJ); Post, Jr., Douglass E. (Belle Mead, NJ); Dawson, John M. (Pacific Palisades, CA)

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  11. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  12. Performance of an Alpha-IPEM.

    SciTech Connect

    Doyle, Barney Lee (University of Padova and INFN, Padova, Italy); McDaniel, Floyd Del (University of North Texas, Denton, TX); Rossi, Paolo; Auzelyte, Vaida (Lund Technical University, Lund, Sweden); Mellon, Michael (Quantar Technology Incorporation, Santa Cruz, CA)

    2005-07-01

    The ion photon emission microscope, or IPEM, is the first device that allows scientists to microscopically study the effects of single ions in air on semiconductors, microchips and even biological cells without having to focus the beam. Reported here is a prototype, the size of a conventional optical microscope, developed at Sandia. The alpha-IPEM, that employs alpha particles from a radioactive source, represents the first example of IBA imaging without an accelerator. The IPEM resolution is currently limited to 10 {micro}m, but we also report a gridded-phosphor approach that could improve this resolution to that of the optical microscope, or {approx} 1 {micro}m. Finally, we propose that a simple adaptation of the alpha-IPEM could be the only way to maintain the high utility of radiation effects microscopy into the future.

  13. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.

    1992-08-01

    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  14. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.

    1992-01-01

    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  15. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  16. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  17. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); McAtee, James L. (Los Alamos, NM)

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  18. Cosmological Attractors from $\\alpha$-Scale Supergravity

    E-print Network

    Roest, Diederik

    2015-01-01

    The Planck value of the spectral index can be interpreted as $n_s = 1 - 2/N$ in terms of the number of e-foldings $N$. An appealing explanation for this phenomenological observation is provided by $\\alpha$-attractors: the inflationary predictions of these supergravity models are fully determined by the curvature of the Kahler manifold. We provide a novel formulation of $\\alpha$-attractors which only involves a single chiral superfield. Our construction involves a natural deformation of no-scale models, and employs these to construct a De Sitter plateau with an exponential fall-off. Finally, we show how analogous structures with a flat Kahler geometry arise as a singular limit of such $\\alpha$-scale models.

  19. Deep H alpha images of interacting galaxies

    NASA Technical Reports Server (NTRS)

    Beck, S. C.; Kovo, O.

    1993-01-01

    Gravitational interactions between galaxies are believed to increase star formation activity dramatically, and most of the brightest starburst galaxies show clear signs of recent interactions. However, it is still not known how interaction triggers star formation, nor are there models to relate the type or strength of interaction to the location or amount of star formation. We report on a series of deep H alpha images of interacting and post-interaction galaxies which we took with the purpose of finding the young stars and ionized gas in these objects. We were motivated in part by the hope that by studying the very recently formed stars we could see how the interaction process had affected the star formation. We observed the galaxies through 50 A-wide filters, one on the redshifted H alpha line and one off, and a standard R filter. Depending on the galaxy and conditions, images in the B, V, and I filters were also obtained. The images were recorded with a 4x7 ft. or 17 ft. diameter CCD at the 1-meter telescope of the Wise Observatory in Mitzpe Ramon. The H alpha and continuum images are used, together with observations at other wavelengths, to put together as complete a picture as possible of star formation and interactions in each galaxy. The complete observation set is not yet available for all the galaxies but certain results are already clear. There do not seem to be any correlations between H 1 and H alpha structures. In some H 1 plume galaxies H alpha extensions were seen on the other side of the galaxy from the H 1; in others extensive H alpha filaments have been found but not H 1. The preliminary results agree with the simplest model that interaction-induced star formation will be concentrated in the system center, since that is where the mass ends up.

  20. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein-protein interactions. Deletion of the PLZF POZ domain partially abrogated the inhibitory effect of PLZF-RAR alpha on RA-induced differentiation and on RA-mediated type II TGase up-regulation, suggesting that POZ-mediated protein interactions might be responsible for the inhibitory transcriptional activities of PLZF-RAR alpha. PMID:9234742

  1. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  2. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Bounds, John A. (Los Alamos, NM)

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  3. Monitoring airborne alpha-emitter contamination

    SciTech Connect

    Kerr, P.L.; Koster, J.E.; Conaway, J.G.; Bounds, J.A.; Whitley, C.W. [Los Alamos National Lab., NM (United States); Steadman, P.A. [National Center for Genome Resources, Santa Fe, NM (United States)

    1998-02-01

    Facilities that may produce airborne alpha emitter contamination require a continuous air monitoring (CAM) system. However, these traditional CAMs have difficulty in environments with large quantities of non-radioactive particulates such as dust and salt. Los Alamos has developed an airborne plutonium sensor (APS) for the REBOUND experiment at the Nevada Test Site which detects alpha contamination directly in the air, and so is less vulnerable to the problems associated with counting activity on a filter. In addition, radon compensation is built into the detector by the use of two measurement chambers.

  4. Radiological hazards of alpha-contaminated waste

    SciTech Connect

    Rodgers, J.C.

    1982-01-01

    The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

  5. Lyman Alpha Searches at Redshift Z>7

    NASA Astrophysics Data System (ADS)

    Willis, Jon

    2007-05-01

    The ZEN survey is a narrow J-band survey for Ly-alpha emitting galaxies at z > 7. I will briefly review the pros and cons of narrow band observations before summarising the ZEN1 and ZEN2 searches based upon deep ISAAC pointings. I will then present ZEN3, consisting of wide field, narrow band observations of two fields using the CFHT WIRCam facility. I will conclude by reviewing the current sample of candidates and what we have learned about the z > 7 Ly-alpha emitting population.

  6. Green Pea Galaxies Reveal Secrets of Ly$\\alpha$ Escape

    E-print Network

    Yang, Huan; Gronke, Max; Rhoads, James E; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark

    2015-01-01

    Star-formation in galaxies generates a lot of Ly$\\alpha$ photons. Understanding the escape of Ly$\\alpha$ photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Ly$\\alpha$. To understand Ly$\\alpha$ escape, it is valuable to study analogs of high redshift Ly$\\alpha$ emitters in nearby universe. However, most nearby analogs have too small a Ly$\\alpha$ equivalent width and escape fraction compared to high redshift Ly$\\alpha$ emitters. One different group of nearby analogs are "Green Pea" galaxies, selected by their high equivalent width optical emission lines. Here we show that Green Pea galaxies have strong Ly$\\alpha$ emission lines and high Ly$\\alpha$ escape fraction (see also Henry et al. 2015), providing an opportunity to solve Ly$\\alpha$ escape problem. Green Peas have a Ly$\\alpha$ equivalent width distribution similar to high redshift Ly$\\alpha$ emitters. The Ly$\\alpha$ escape fraction correlates with many quantities of Ly$\\alpha$ profile, especially the...

  7. Production of high-purity radium-223 from legacy actinium-beryllium neutron sources.

    PubMed

    Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2012-07-01

    Radium-223 is a short-lived alpha-particle-emitting radionuclide with potential applications in cancer treatment. Research to develop new radiopharmaceuticals employing (223)Ra has been hindered by poor availability due to the small quantities of parent actinium-227 available world-wide. The purpose of this study was to develop innovative and cost-effective methods to obtain high-purity (223)Ra from (227)Ac. We obtained (227)Ac from two surplus actinium-beryllium neutron generators. We retrieved the actinium/beryllium buttons from the sources and dissolved them in a sulfuric-nitric acid solution. A crude actinium solid was recovered from the solution by coprecipitation with thorium fluoride, leaving beryllium in solution. The crude actinium was purified to provide about 40 milligrams of actinium nitrate using anion exchange in methanol-water-nitric acid solution. The purified actinium was then used to generate high-purity (223)Ra. We extracted (223)Ra using anion exchange in a methanol-water-nitric acid solution. After the radium was separated, actinium and thorium were then eluted from the column and dried for interim storage. This single-pass separation produces high purity, carrier-free (223)Ra product, and does not disturb the (227)Ac/(227)Th equilibrium. A high purity, carrier-free (227)Th was also obtained from the actinium using a similar anion exchange in nitric acid. These methods enable efficient production of (223)Ra for research and new alpha-emitter radiopharmaceutical development. PMID:22697483

  8. Far-Infrared and Millimeter Continuum Studies of K Giants: Alpha Boo and Alpha Tau

    E-print Network

    Martin Cohen; Duane F. Carbon; William J. Welch; Tanya Lim; Bernhard Schulz; A. D. McMurry; James R. Forster; David Goorvitch; .

    2005-02-24

    We have imaged two normal, non-coronal, infrared-bright K giants, Alpha Tau and Alpha Boo, in the 1.4-mm and 2.8-mm continuum using the Berkeley Illinois Maryland Association millimeter array. These stars have been used as important absolute calibrators for several infrared infrared satellites. Our goals are: (1) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (2) to make a connection between millimeter wave and far-infrared absolute flux calibrations. To accomplish these goals we also present Infrared Space Observatory Long Wavelength Spectrometer measurements of both these K giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in Alpha Tau and Alpha Boo. We find that current photospheric models predict fluxes in reasonable agreement with those observed for wavelengths which sample the upper photosphere, namely <=125 microns in Alpha Tau and Alpha Boo. We clearly detect chromospheric radiation from both stars by 2.8mm (by 1.4mm in the case of Alpha Boo). Only additional observations can determine precisely where beyond 125 microns the purely radiative models fail. Until then, purely radiative models for these stars can only be used with confidence for calibration purposes below 125 microns.

  9. Factors governing helical preference of peptides containing multiple alpha,alpha-dialkyl amino acids.

    PubMed Central

    Marshall, G R; Hodgkin, E E; Langs, D A; Smith, G D; Zabrocki, J; Leplawy, M T

    1990-01-01

    The presence of multiple alpha,alpha-dialkyl amino acids such as alpha-methylalanine (alpha-aminoisobutyric acid, Aib) leads to predominantly helical structures, either with alpha-helical or 3(10)-helical hydrogen bonding patterns. The crystal structure of emerimicin-(1-9) benzyl ester (Ac-Phe-Aib-Aib-Aib-Val-Gly-Leu-Aib-Aib-OBzl) reported here shows essentially pure alpha-helical character, whereas other similar compounds show predominantly 3(10)-helical structures. The factors that govern helical preference include the inherent relative stability of the alpha-helix compared with the 3(10)-helix, the extra hydrogen bond seen with 3(10)-helices, and the enhanced electrostatic dipolar interaction of the 3(10)-helix when packed in a crystalline lattice. The balance of these forces, when combined with the steric requirements of the amino acid side chains, determines the relative stability of the two helical conformations under a given set of experimental conditions. Images PMID:2296604

  10. Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence

    NASA Technical Reports Server (NTRS)

    Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.

    1983-01-01

    Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

  11. Are you thinking of joining a coed fraternity? Alpha Theta, Phi Tau or The Tabard

    E-print Network

    Myers, Lawrence C.

    @dartmouth.edu TBA Are you thinking of joining an IFC fraternity? Alpha Chi Alpha, Alpha Delta, Beta Alpha OmegaAre you thinking of joining a coed fraternity? Alpha Theta, Phi Tau or The Tabard First you need session Coed Council Recruitment Dates (for each individual chapter) Alpha Theta 33 North Main St Alpha

  12. Temperature-dependent chaperone activity and structural properties of human alphaA- and alphaB-crystallins.

    PubMed

    Reddy, G B; Das, K P; Petrash, J M; Surewicz, W K

    2000-02-18

    The chaperone activity and biophysical properties of recombinant human alphaA- and alphaB-crystallins were studied by light scattering and spectroscopic methods. While the chaperone function of alphaA-crystallin markedly improves with an increase in temperature, the activity of alphaB homopolymer appears to change very little upon heating. Compared with alphaB-crystallin, the alphaA-homopolymer is markedly less active at low temperatures, but becomes a more active species at high temperatures. At physiologically relevant temperatures, the alphaB homopolymer appears to be modestly (two times or less) more potent chaperone than alphaA homopolymer. In contrast to very similar thermotropic changes in the secondary structure of both homopolymers, alphaA- and alphaB-crystallins markedly differ with respect to the temperature-dependent surface hydrophobicity profiles. Upon heating, alphaA-crystallin undergoes a conformational transition resulting in the exposure of additional hydrophobic sites, whereas no such transition occurs for alphaB-crystallin. The correlation between temperature-dependent changes in the chaperone activity and hydrophobicity properties of the individual homopolymers supports the view that the chaperone activity of alpha-crystallin is dependent on the presence of surface-exposed hydrophobic patches. However, the present data also show that the surface hydrophobicity is not the sole determinant of the chaperone function of alpha-crystallin. PMID:10671481

  13. Prediction of {alpha}-decay half-lives and Q{sub {alpha}} values of superheavy nuclei by a global potential for {alpha} + nucleus systems

    SciTech Connect

    Sahu, Basudeb [Department of Physics, North Orissa University, Baripada-757003 (India)

    2011-09-15

    An approach we have proposed recently for calculation of Q{sub {alpha}} energy and decay half-life T{sub 1/2}{sup {alpha}} on the {alpha} decay of radioactive heavy ions is applied to the evaluation of these two important parameters for the nuclei in the superheavy region Z = 112-118 for which experimental data are not available. It is shown that the {alpha} + nucleus potential represented by an exactly solvable potential used in the calculation could be expressed in terms of proton (Z) and neutron (N) numbers of the {alpha} emitter so that varieties of {alpha}-emitting nuclei differing in their Z and N values could be addressed for their decay properties without the help of any adjustable parameter and the results of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} for a nucleus are estimated without any prior knowledge of any one of these quantities. This procedure to obtain the values of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} works well to reproduce the known experimental results for superheavy nuclei and hence, the procedure is expected to provide proper information about these parameters in experiments on {alpha} decay of new nuclei in the superheavy region.

  14. Global acoustic oscillations on Alpha Bootis

    Microsoft Academic Search

    Juan A. Belmonte; Andrew R. Jones; Pere L. Palle; Teodoro Roca Cortes

    1990-01-01

    A two-week time series of precise radial velocity measurements of Alpha Bootis (Arcturus) covering 7-8 hr per night is reported. The radial barycentric velocity of the star is found to be -5021 + or - 5 m\\/s. When data from the whole run are jointly analyzed, several equispaced peaks in the frequency appear in the range of a few microhertz,

  15. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  16. Method of making nanocrystalline alpha alumina

    DOEpatents

    Siegel, Richard W. (Hinsdale, IL); Hahn, Horst (Champaign, IL); Eastman, Jeffrey A. (Woodridge, IL)

    1992-01-01

    Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

  17. Alpha labelings of straight simple polyominal caterpillars

    E-print Network

    Froncek, Dalibor

    and Minion [1] introduced the notion of snake polyomino graphs and proved that they admit an alpha labeling, and Computing in Boca Raton in March, 2014, Sarah Minion (an undergraduate student) presented her joint re report that later developed into the presented paper. Barrientos and Minion [1] define a snake polyomino

  18. Intelligence and Frequency of the Alpha Rhythm

    ERIC Educational Resources Information Center

    Ellingson, Robert J.; Lathrop, Gerald H.

    1973-01-01

    The alpha rhythm frequencies (8 to 13 cycles per second, occurring during a S's relaxed state with eyes closed, measured by the electroencephalogram) of three groups of Ss (30 Down's Syndrome residents, 21 psychiatric patients, and 10 university students) aged 13 to 24 years, were determined according to explicit criteria. (Author/MC)

  19. Role of alpha interferon in multiple myeloma

    Microsoft Academic Search

    D. E. Joshua; S. MacCallum; J. Gibson

    1997-01-01

    Interferons are soluble proteins produced by cells in response to viruses. Although they were first introduced as therapeutic agents for myeloma in 1979 their exact role in the management of myeloma remains to be precisely defined. Interferons have both anti-proliferative and immune regulation effects, but the predominant mode of action of interferons in myeloma is still unclear. Recombinant alpha interferon

  20. Alpha 97: Basic Education and Institutional Environments.

    ERIC Educational Resources Information Center

    Hautecoeur, Jean-Paul, Ed.

    This document was published by Alpha, a research program specializing in alternative, experimental approaches to adult basic education. It is an attempt to widen the field and examine the relationship between the micro and macro levels, between the diversity of different practices and the major policy orientations that foster or limit this…

  1. General dynamics of varying-alpha universes

    NASA Astrophysics Data System (ADS)

    Barrow, John D.; Graham, Alexander A. H.

    2013-11-01

    We introduce and study extensions of the varying alpha theory of Bekenstein-Sandvik-Barrow-Magueijo to allow for an arbitrary coupling function and self-interaction potential term in the theory. We study the full evolution equations without assuming that variations in alpha have a negligible effect on the expansion scale factor and the matter density evolution, as was assumed in earlier studies. The background Friedmann-Robertson-Walker cosmology of this model in the cases of zero and nonzero spatial curvature is studied in detail, using dynamical systems techniques, for a wide class of potentials and coupling functions. All the asymptotic behaviors are found, together with some new solutions. We study the cases where the electromagnetic parameter, zeta, is positive and negative, corresponding to magnetic and electrostatic energy domination in the nonrelativistic matter. In particular, we investigate the cases where the scalar field driving alpha variations has exponential and power-law self-interaction potentials and the behavior of theories where the coupling constant between matter and alpha variations is no longer a constant.

  2. alphaCertified Jonathan D. Hauenstein

    E-print Network

    Sottile, Frank

    Certified The program alphaCertified by Jonathan D. Hauenstein and Frank Sottile implements algorithms based on Smale's -theory to certify solutions to polynomial and polynomial-exponential systems. This manual provides in C and uses the GMP[3] and MPFR[2] libraries to perform rational and arbitrary floating point

  3. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  4. Electron Screening Effects on {alpha}-decay

    SciTech Connect

    Musumarra, A.; Bonasera, A.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Kimura, S.; Lattuada, M.; Pellegriti, M. G.; Scuderi, V.; Torresi, D. [INFN-LNS and University of Catania, Catania (Italy); Farinon, F.; Geissel, H.; Knoebel, R.; Prochazka, A.; Scheidenberger, C. [GSI, Darmstadt (Germany); Justus-Liebig Universitaet, Giessen (Germany); Nociforo, C.; Behr, K.-H.; Bosch, F.; Boutin, D.; Bruenle, A. [GSI, Darmstadt (Germany)] (and others)

    2009-08-26

    An open problem in Nuclear Astrophysics concerns the understanding of electron-screening effects on nuclear reaction rates at stellar energies. In this framework, we have proposed to investigate the influence of the electron cloud on {alpha}-decay by measuring Q-values and {alpha}-decay half-lives of fully stripped, H-like and He-like ions. These kinds of measurements have been feasible just recently for highly-charged radioactive nuclides by fragmentation of {sup 238}U at relativistic energies at the FRS-ESR facility at GSI. In this way it is possible to produce, efficiently separate and store highly-charged {alpha}-emitters. Candidates for the proposed investigation were carefully selected and will be studied by using the Schottky Mass Spectroscopy technique. In order to establish a solid reference data set, lifetimes and Q{sub {alpha}}-value measurements of the corresponding neutrals have been performed directly at the FRS, by implanting the separated ions into an active Silicon stopper.

  5. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2013-07-01

    The nearby Alpha Centauri triple system has two solar-type stars in a relatively close orbit (20 au separation), and a dim red dwarf companion -- Proxima -- about 10,000 au away, on the Sun-ward side of the group. The heaviest star -- Alpha Cen A -- is a close twin of the Sun. Its slightly less massive companion -- Alpha Cen B -- is a K-type dwarf, and is the closest star thought to host an exoplanet (Earth-sized, but in a much tighter orbit). The close pair has been scrutinized for more than a decade in X-rays by XMM and Chandra, on a semiannual basis since 2003 and 2005, respectively. However, in recent years only Chandra has been able to cleanly separate the pair, which are approaching closest separation on the sky (only a few arcseconds) in their 80-year orbit. For the past 3 years, the HST STIS spectrograph has joined the crowd, also capturing FUV snapshots of the pair every six months. The Alpha Cen stars provide an important complement to long-term studies of the Sun at high energies. The K-star has displayed a clear 8-year cycle in recent years, while the G-star remains mired in a Maunder-like minimum.

  6. Alpha Shapes --a Survey Herbert Edelsbrunner1

    E-print Network

    Edelsbrunner, Herbert

    generalized his planar convex hull algorithm to a method that generates something like the shape of a finite point set. We recall that this algorithm computes the convex hull one edge at a time, pivoting a line with a historical account and discusses geometric, algorithmic, topological, and combinatorial aspects of alpha

  7. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  8. Redefining Relative Biological Effectiveness in the Context of the EQDX Formalism: Implications for Alpha-Particle Emitter Therapy

    PubMed Central

    Hobbs, Robert F.; Howell, Roger W.; Song, Hong; Baechler, Sébastien; Sgouros, George

    2014-01-01

    Alpha-particle radiopharmaceutical therapy (?RPT) is currently enjoying increasing attention as a viable alternative to chemotherapy for targeting of disseminated micrometastatic disease. In theory, ?RPT can be personalized through pre-therapeutic imaging and dosimetry. However, in practice, given the particularities of ?-particle emissions, a dosimetric methodology that accurately predicts the thresholds for organ toxicity has not been reported. This is in part due to the fact that the biological effects caused by ?-particle radiation differ markedly from the effects caused by traditional external beam (photon or electron) radiation or ?-particle emitting radiopharmaceuticals. The concept of relative biological effectiveness (RBE) is used to quantify the ratio of absorbed doses required to achieve a given biological response with alpha particles versus a reference radiation (typically a beta emitter or external beam radiation). However, as conventionally defined, the RBE varies as a function of absorbed dose and therefore a single RBE value is limited in its utility because it cannot be used to predict response over a wide range of absorbed doses. Therefore, efforts are underway to standardize bioeffect modeling for different fractionation schemes and dose rates for both nuclear medicine and external beam radiotherapy. Given the preponderant use of external beams of radiation compared to nuclear medicine in cancer therapy, the more clinically relevant quantity, the 2 Gy equieffective dose, EQD2(?/?), has recently been proposed by the ICRU. In concert with EQD2(?/?), we introduce a new, redefined RBE quantity, named RBE2(?/?), as the ratio of the two linear coefficients that characterize the ? particle absorbed dose-response curve and the low-LET megavoltage photon 2 Gy fraction equieffective dose-response curve. The theoretical framework for the proposed new formalism is presented along with its application to experimental data obtained from irradiation of a breast cancer cell line. Radiobiological parameters are obtained using the linear quadratic model to fit cell survival data for MDA-MB-231 human breast cancer cells that were irradiated with either ? particles or a single fraction of low-LET 137Cs ? rays. From these, the linear coefficient for both the biologically effective dose (BED) and the EQD2(?/?) response lines were derived for fractionated irradiation. The standard RBE calculation, using the traditional single fraction reference radiation, gave RBE values that ranged from 2.4 for a surviving fraction of 0.82–6.0 for a surviving fraction of 0.02, while the dose-independent RBE2(4.6) value was 4.5 for all surviving fraction values. Furthermore, bioeffect modeling with RBE2(?/?) and EQD2(?/?) demonstrated the capacity to predict the surviving fraction of cells irradiated with acute and fractionated low-LET radiation, ? particles and chronic exponentially decreasing dose rates of low-LET radiation. RBE2(?/?) is independent of absorbed dose for ?-particle emitters and it provides a more logical framework for data reporting and conversion to equieffective dose than the conventional dose-dependent definition of RBE. Moreover, it provides a much needed foundation for the ongoing development of an ?-particle dosimetry paradigm and will facilitate the use of tolerance dose data available from external beam radiation therapy, thereby helping to develop ?RPT as a single modality as well as for combination therapies. PMID:24502376

  9. Relations between PET-derived measures of thalamic glucose metabolism and EEG alpha power

    E-print Network

    Wisconsin at Madison, University of

    , Madison, USA Abstract Electroencephalogram ~EEG! alpha power has been demonstrated to be inversely related, Positron emission tomography, Alpha, Thalamus Alpha electroencephalogram ~EEG! power is a commonly used

  10. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  11. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  12. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  13. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic...alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

  14. Precision determination of alpha_s using an unbiased global NLO parton set

    E-print Network

    Lionetti, Simone; Bertone, Valerio; Cerutti, Francesco; Del Debbio, Luigi; Forte, Stefano; Guffanti, Alberto; Latorre, Jose I; Rojo, Juan; Ubiali, Maria

    2011-01-01

    We determine the strong coupling alpha_s from a next-to-leading order analysis of processes used for the NNPDF2.1 parton determination, which includes data from neutral and charged current deep-inelastic scattering, Drell-Yan and inclusive jet production. We find alpha_s(M_Z)=0.1191+-0.0006 (exp), where the uncertainty includes all statistical and systematic experimental uncertainties, but not purely theoretical uncertainties. We study the dependence of the results on the dataset, by providing further determinations based respectively on deep-inelastic data only, and on HERA data only. The deep-inelastic fit gives the consistent result alpha_s(M_Z)=0.1177+-0.0009(exp), but the result of the HERA-only fit is only marginally consistent. We provide evidence that individual data subsets can have runaway directions due to poorly determined PDFs, thus suggesting that a global dataset is necessary for a reliable determination.

  15. Surrogate ratio method in the actinide region using the ({alpha},{alpha}{sup '}f) reaction

    SciTech Connect

    Lesher, S. R. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Burke, J. T.; Bernstein, L. A.; Dietrich, F. S.; Escher, J. E.; Moody, K. J.; Scielzo, N. D. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Ai, H. [Wright Nuclear Structure Laboratory, Yale University, New Haven, Connecticut 06520 (United States); Beausang, C. W. [Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Bleuel, D. L.; Wiedeking, M. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Clark, R. M.; Fallon, P.; Gibelin, J.; Lee, I. Y.; Macchiavelli, A. O.; McMahan, M. A.; Phair, L.; Rodriguez-Vieitez, E. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Goldblum, B. L. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States)] (and others)

    2009-04-15

    In the Surrogate Method, the measured decay probability of a compound nucleus formed via a direct reaction is used to extract the cross section for a reaction with a different entrance channel that proceeds through the same compound nucleus. An extension of the Surrogate Method, the Surrogate Ratio Method (SRM), uses a ratio of measured decay probabilities to infer an unknown cross section relative to a known one. To test the SRM we compare the direct-reaction-induced fission probability ratio of {sup 234}U({alpha},{alpha}{sup '}f) to {sup 236}U({alpha},{alpha}{sup '}f) with the ratio of cross sections of {sup 233}U(n,f) to {sup 235}U(n,f). These ratios were found to be in agreement over an equivalent neutron energy range of 0.4-18 MeV.

  16. Picrotoxin-mediated antagonism of alpha3beta4 and alpha7 acetylcholine receptors.

    PubMed

    Erkkila, Brian E; Weiss, David S; Wotring, Virginia E

    2004-08-26

    Picrotoxin (PTX) is a convulsant that antagonizes many inhibitory ligand-gated receptors. The mechanism of PTX block is believed to involve residues which line the pore in the second transmembrane domain (M2). The alpha(3)beta(4) and alpha(7) nicotinic acetylcholine receptors (nAChRs) have high homology to inhibitory LGICs in this M2 region and therefore could also be susceptible to block by PTX. Here, we report that PTX is an effective inhibitor at these nicotinic receptors (rat), with IC50 values of 96.1 +/- 5.5 and 194.9 +/- 19.2 microM for the alpha(3)beta(4) and alpha(7), respectively. These results provide insights into the structure-function relation of PTX-mediated antagonism in this family of ligand-activated receptors. Furthermore they should also be considered when employing PTX to selectively eliminate GABA- or glycine-mediated events. PMID:15305147

  17. Alpha-Alpha scattering, chiral symmetry and {sup 8}Be lifetime

    SciTech Connect

    Ruiz Arriola, E. [Departamento de Fisica Atomica, Molecular y Nuclear Universidad de Granada E-18071 Granada (Spain)

    2008-08-31

    Alpha-alpha scattering is discussed in terms of a chiral two pion exchange potential (TPE) which turns out to be attractive and singular at the origin, hence demanding renormalization. When {sup 8}Be is treated as a resonance state a model independent correlation between the Q-factor and lifetime 1/{gamma} for the decay into two alpha particles arises. For a wide range of parameters compatible with potential model analyses of low energy {pi}{alpha} scattering it is found {gamma} = 4.4(4)eV in fairly good agreement with the experimental value {gamma}{sub exp.} = 5.57(25)eV. The remaining discrepancy as well as the phase shift up to E{sub LAB} = 15 MeV could be accommodated by the leading nuclear peripheral contributions due to the {sup 3}H+p and {sup 3}He+n continuum.

  18. Aqueous chemical growth of alpha-Fe2O3-alpha-Cr203 nanocompositethin films

    Microsoft Academic Search

    Lionel Vayssieres; Jinghua Guo; Joseph Nordgren

    2001-01-01

    We are reporting here on the inexpensive fabrication and optical properties of an iron(III) oxide chromium(III) oxide nanocomposite thin film of corundum crystal structure. Its novel and unique-designed architecture consists of uniformed, well-defined and oriented nanorods of Hematite (alpha-Fe2O3) of 50 nm in diameter and 500nm in length and homogeneously distributed nonaggregated monodisperse spherical nanoparticles of Eskolaite (alpha-Cr2O3) of 250

  19. Antibody-mediated reduction of {alpha}-ketoamides

    DOEpatents

    Schultz, P.G.; Gallop, M.A.

    1998-06-09

    Monoclonal antibodies raised against a 4-nitrophenyl phosphonate hapten catalyze the stereospecific reduction of an {alpha}-ketoamide to the corresponding {alpha}-hydroxyamide in the presence of an appropriate reducing agent.

  20. An assay for intermolecular exchange of alpha crystallin

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    An affinity column of alpha crystallin linked to cyanogen bromide-activated Sepharose was developed to study the exchange of alpha subunits. Alpha crystallin bound to the Sepharose-alpha complex was dissociated with 8 mol/l urea, followed by quantitation using high-performance reverse-phase liquid chromatography. The time course of binding at 37 degrees C showed a hyperbolic binding pattern reaching equilibrium between 6-18 hr. Under these conditions, binding of beta and gamma crystallins to the same matrix was less than 10% of the alpha values, as was binding of alpha to glycine-coupled Sepharose. This assay was used to demonstrate changes in the subunit exchange of alpha crystallins present in high molecular weight versus lower molecular weight aggregates of the human lens. These results show that this binding procedure was a specific reproducible assay that might be used to study intermolecular interactions of the alpha crystallins.