Sample records for societal alignment strategy

  1. “Working to shape what society's expectations of us should be”: Philip Morris' societal alignment strategy

    PubMed Central

    Yang, J S; Malone, R E


    Background A key element of Philip Morris's (PM's) corporate social responsibility initiatives is “societal alignment”, defined as “strategies and programs to meet society's expectations of a responsible tobacco company”. This study explored the genesis and implementation of Philip Morris' (PM) societal alignment efforts. Methods The study retrieved and analysed approximately 375 previously undisclosed PM documents now available electronically. Using an iterative process, the study categorised themes and prepared a case analysis. Results Beginning in 1999, PM sought to become “societally aligned” by identifying expectations of a responsible tobacco company through public opinion research and developing and publicising programs to meet those expectations. Societal alignment was undertaken within the US and globally to ensure an environment favourable to PM's business objectives. Despite PM's claims to be “changing”, however, societal alignment in practice was highly selective. PM responded to public “expectations” largely by retooling existing positions and programs, while entirely ignoring other expectations that might have interfered with its business goals. It also appears that convincing employees of the value and authenticity of societal alignment was difficult. Conclusions As implementation of the Framework Convention on Tobacco Control proceeds, tobacco control advocates should closely monitor development of such “alignment” initiatives and expose the motivations and contradictions they reveal. PMID:18845623

  2. Internet advertising strategy alignment

    Microsoft Academic Search

    Marie-claude Boudreau; Richard T. Watson


    Purpose - Because the web can be an influential medium for attracting and retaining customers, it is critical to examine the connection between web advertising and corporate strategy. This is particularly true for multinational organizations, which face the most complex organizational environment. The purpose of this paper is to propose that multinational organizations should be concerned with alignment of their

  3. Personal and societal intervention strategies for successful ageing

    Microsoft Academic Search

    Douglas Friedrich


    The article explores contemporary and future options for better personal and societal ageing. The phenomena of significantly\\u000a more present and projected elders, especially the upcoming diverse American baby boomers, have generated peaked interest in\\u000a ageing-related issues from academic, practicing professional, business, governmental, and adult constituencies. Although much\\u000a of ageing-related theory, research, and practice remains discipline-specific, an integration of physical, psychological,

  4. Aligning for Innovation - Alignment Strategy to Drive Innovation

    NASA Technical Reports Server (NTRS)

    Johnson, Hurel; Teltschik, David; Bussey, Horace, Jr.; Moy, James


    With the sudden need for innovation that will help the country achieve its long-term space exploration objectives, the question of whether NASA is aligned effectively to drive the innovation that it so desperately needs to take space exploration to the next level should be entertained. Authors such as Robert Kaplan and David North have noted that companies that use a formal system for implementing strategy consistently outperform their peers. They have outlined a six-stage management systems model for implementing strategy, which includes the aligning of the organization towards its objectives. This involves the alignment of the organization from the top down. This presentation will explore the impacts of existing U.S. industrial policy on technological innovation; assess the current NASA organizational alignment and its impacts on driving technological innovation; and finally suggest an alternative approach that may drive the innovation needed to take the world to the next level of space exploration, with NASA truly leading the way.

  5. Green consumerism and the societal marketing concept: Marketing strategies for the 1990's

    Microsoft Academic Search

    Andrea Prothero


    This paper examines the impact of these trends on the role of the marketing department in the J990's. Essentially, when the buying habits of consumers are being strangely influenced by green and other environmental issues, the paper argues that the marketing concept and subsequent strategies need to be rethought. The paper then imaginatively develops the concept of societal marketing within

  6. Alignment strategy for the ATLAS tracker

    SciTech Connect

    ATLAS; Golling, T.


    The ATLAS experiment is a multi-purpose particle detector that will study high-energy particle collisions produced by the Large Hadron Collider. For the reconstruction of charged particles, and their production and their decay vertices, ATLAS is equipped with a sophisticated tracking system, unprecedented in size and complexity. Full exploitation of both the Inner Detector and the muon spectrometer requires an accurate alignment. The challenge of aligning the ATLAS tracking devices is discussed, and the ATLAS alignment strategy is presented and illustrated with both data and Monte Carlo results.

  7. Strategies and tools for whole genome alignments

    SciTech Connect

    Couronne, Olivier; Poliakov, Alexander; Bray, Nicolas; Ishkhanov,Tigran; Ryaboy, Dmitriy; Rubin, Edward; Pachter, Lior; Dubchak, Inna


    The availability of the assembled mouse genome makespossible, for the first time, an alignment and comparison of two largevertebrate genomes. We have investigated different strategies ofalignment for the subsequent analysis of conservation of genomes that areeffective for different quality assemblies. These strategies were appliedto the comparison of the working draft of the human genome with the MouseGenome Sequencing Consortium assembly, as well as other intermediatemouse assemblies. Our methods are fast and the resulting alignmentsexhibit a high degree of sensitivity, covering more than 90 percent ofknown coding exons in the human genome. We have obtained such coveragewhile preserving specificity. With a view towards the end user, we havedeveloped a suite of tools and websites for automatically aligning, andsubsequently browsing and working with whole genome comparisons. Wedescribe the use of these tools to identify conserved non-coding regionsbetween the human and mouse genomes, some of which have not beenidentified by other methods.

  8. Word Association Models and Search Strategies for Discriminative Word Alignment

    E-print Network

    Lambert, Patrik

    Word Association Models and Search Strategies for Discriminative Word Alignment Patrik Lambert1 association models as well as search strategies. We compare various low-computational-cost word as- sociation Strategies Search aims at finding the alignment (i.e. the set of links between source and target words) which

  9. Aligning Staff Development with Implementation Strategies.

    ERIC Educational Resources Information Center

    Kenney, Jane L.; Roberts, Jane M. E.

    This report provides the results of a comprehensive 4-year study of a statewide instructional improvement effort in Maryland; presents the characteristics of successful staff development for each of four implementation strategies (active teaching, mastery learning, student team learning, and teaching variables); and identifies the relationships…

  10. Chemical strategies for die/wafer submicron alignment and bonding.

    SciTech Connect

    Martin, James Ellis; Baca, Alicia I.; Chu, Dahwey; Rohwer, Lauren Elizabeth Shea


    This late-start LDRD explores chemical strategies that will enable sub-micron alignment accuracy of dies and wafers by exploiting the interfacial energies of chemical ligands. We have micropatterned commensurate features, such as 2-d arrays of micron-sized gold lines on the die to be bonded. Each gold line is functionalized with alkanethiol ligands before the die are brought into contact. The ligand interfacial energy is minimized when the lines on the die are brought into registration, due to favorable interactions between the complementary ligand tails. After registration is achieved, standard bonding techniques are used to create precision permanent bonds. We have computed the alignment forces and torque between two surfaces patterned with arrays of lines or square pads to illustrate how best to maximize the tendency to align. We also discuss complex, aperiodic patterns such as rectilinear pad assemblies, concentric circles, and spirals that point the way towards extremely precise alignment.

  11. An alignment strategy for the optics of LINC-NIRVANA

    NASA Astrophysics Data System (ADS)

    Meschke, Daniel; Bertram, Thomas; Bizenberger, Peter


    LINC-NIRVANA is an instrument to combine the light from both LBT primary mirrors in an imaging Fizeau interferometer. The goals in terms of resolution and field of view are quite ambitious, which leads to a complex instrument consisting of a bunch of subsystems. The layer oriented MCAO system alone is already quite complicated and to get everything working together properly is not a small challenge. As we are reaching the completion of LINC-NIRVANA's subsystems, it becomes more and more important to define a strategy to align all these various subsystems. The specific layout of LINC-NIRVANA imposes some restrictions and difficulties on the sequence and the method of this alignment. The main problem for example is that we have to get two perfectly symmetrical focal planes to be able to properly combine them interferometrically. This is the major step on which all further alignment is based on, since all the subsystems (collimator and camera optics, wavefront sensors, cold IR optics, etc.) rely on these focal planes as a reference. I will give a small introduction on the optics of the instrument and line out the resulting difficulties as well as the strategy that we want to apply in order to overcome these.

  12. Improving Business and Information Strategy Alignment: Learning from the Banking Industry

    Microsoft Academic Search

    Marianne Broadbent; Peter Weill


    An empirical study that explored business and information strategy alignment in the information-intensive and competitive Australian banking industry is featured in this paper. The aim of the study was to identify organizational practices that contribute to and enhance such alignment. Multiple sources of information were used to collect data about business and information strategies from the major firms dominating Australian

  13. Aligning Transition and Standards-Based Education: Issues and Strategies.

    ERIC Educational Resources Information Center

    Kochhar-Bryant, Carol, Ed.; Bassett, Diane S., Ed.

    Eleven papers address issues in the alignment of standards-based education and individualized transition planning and service development for students with disabilities including differences in assumptions and principles, the transition planning model as a framework for achieving this alignment, and educational practices resulting from this…

  14. Perspectives: Societal Issues in Science

    NSDL National Science Digital Library

    Patrick L. Brown


    When students investigate local issues in science class, they gain research and critical-thinking skills while improving their attitudes toward science. However, since many societal issues are controversial, it is important to create a safe and risk-free classroom climate where students can discuss their ideas, personal needs, experiences, and responsibilities. This article discribes some strategies that will help students to use science to make personal and societal decisions.

  15. The exploration of attributes aligning supply chain strategy & resilience execution

    E-print Network

    Cope, Alexander Randon


    This research aims to characterize and measure hierarchical, functional and geographical alignment within an organization in an effort to understand the individual's attributes of resilience within the broader organization's ...

  16. How successful firms go beyond aligning their IT strategy with business objectives

    E-print Network

    Goswami, Debangshu


    Information technology (IT) is vital to growth of all organizations. But getting value out of IT has been challenging. The companies, which fail to align their IT strategy with business objectives struggle with low or ...

  17. Aligning Knowledge Sharing Strategy With Organizational and Cultural Contexts: An Information System Perspective

    E-print Network

    Boyer, Edmond

    Aligning Knowledge Sharing Strategy With Organizational and Cultural Contexts: An Information highlights the importance of organizational and cultural contexts in the efficiency of knowledge of the organizational and cultural contexts, information system functionalities to develop or to promote in order

  18. Organizational performance, Marketing strategy, and Financial strategic alignment: an empirical study on Iranian pharmaceutical firms

    PubMed Central


    Background Strategic Functional-level planning should be aligned with business level and other functional strategies of a company. It is presumed that assimilating the strategies could have positive contribution to business performance, in this regard alignment between marketing strategy and financial strategy seems to be the most important strategies being studied. An empirical work in generic pharmaceutical manufacturing companies for evaluating effect of alignment between these two functions on organizational performance was developed in this paper. Methods All Iranian pharmaceutical generic manufactures listed in Tehran stock market have been tested for period of five years between 2006–2010 and their marketing strategies were determined by using Slater and Olson taxonomy and their financial strategies have been developed by calculating total risk and total return of sample companies for five years based on rate of risk and return in the frame of a 2 × 2 matrix. For the business performance three profitability indices including Q-Tubin (Rate of market value to net asset value), ROA (Return on Asset), ROE (Return on Equity) have been tested. For analysis, a series of one-way ANOVAs as a collection of statistical models within marketing strategies considering financial strategy as independent variable and the three performance measures as dependent variables was used. Results Results show strategic alignment between financial and marketing has significant impact on profitability of company resulting in arise of all three profitability indices. Q tubing’s rate were 2.33,2.09,2.29,2.58 and rate of ROA were 0.21,0.194,0.25,0.22 and rate of ROE were 0.44,0.46,0.45,0.42 for matched strategy types, respectively the rates shown here are more than average meaning that specific type of marketing strategy is fitted with specific type of financial strategy. Conclusion Managers should not consider decisions regarding marketing strategy independently of their financial strategy. PMID:23915467

  19. Electron Beam Alignment Strategy in the LCLS Undulators

    SciTech Connect

    Nuhn, H.-D.; Emma, P.J.; Gassner, G.L.; LeCocq, C.M.; Peters, E.; Ruland, R.E.; /SLAC


    The x-ray FEL process puts very tight tolerances on the straightness of the electron beam trajectory (2 {micro}m rms) through the LCLS undulator system. Tight but less stringent tolerances of 80 {micro}m rms vertical and 140 {micro}m rms horizontally are to be met for the placement of the individual undulator segments with respect to the beam axis. The tolerances for electron beam straightness can only be met through beam-based alignment (BBA) based on electron energy variations. Conventional alignment will set the start conditions for BBA. Precision-fiducialization of components mounted on remotely adjustable girders and the use of beam-finder wires (BFW) will satisfy placement tolerances. Girder movement due to ground motion and temperature changes will be monitored continuously by an alignment monitoring system (ADS) and remotely corrected. This stabilization of components as well as the monitoring and correction of the electron beam trajectory based on BPMs and correctors will increase the time between BBA applications. Undulator segments will be periodically removed from the undulator Hall and measured to monitor radiation damage and other effects that might degrade undulator tuning.

  20. Presentation, analysis, and simulation of active alignment strategies for the James Webb Space Telescope

    NASA Astrophysics Data System (ADS)

    Upton, Robert S.


    This paper presents three characteristics in the simulated active alignment strategy of the James Webb Space Telescope. The first includes the analysis and comparison of a baseline active alignment strategy with a damped least squares strategy. This baseline utilizes prior knowledge by means of direct human operator interaction to engage sets of telescope compensators to target specific aberration signatures. The baseline is compared to a damped least-squares strategy that utilizes simultaneous engagement of all telescope compensators without explicit human operator interaction to achieve a least-squares telescope compensation. Second, we discuss how the active alignment of the JWST is encapsulated in a linear optical model developed at the Space Telescope Science Institute. This linear optical model provides a framework for an efficient and robust description of the optical control properties of the JWST and clearly articulates the necessity for having a multi-instrument multifield wavefront sensing strategy to overcome control system non independence and the effects of non-common path errors in the main wavefront sensing camera. Finally, we present analytical results that explicitly map the telescope wavefront responses to the telescope control modes, and we present Monte-Carlo optical performance simulation results that demonstrate the efficacy of the damped least-squares active alignment and the priorknowledge active alignment schemes.

  1. A comparison of on-axis and off-axis heliostat alignment strategies

    SciTech Connect

    Jones, S.A.


    Heliostat installation and alignment costs will be an important element in future solar power tower projects. The predicted annual performances of on- and-off axis strategies are compared for 95 m{sup 2} flat-glass heliostats and an external, molten-salt receiver. Actual approaches to heliostat alignment that have been used in the past are briefly discussed, and relative strengths and limitations are noted. The optimal approach can vary with the application.

  2. Alignment strategies for fullerenes and their dimers using soft matter

    NASA Astrophysics Data System (ADS)

    Campbell, Katie

    The overall goal of this research was to achieve alignment of endohedral fullerene dimers defined as covalently linked pairs of fullerene cages where each fullerene cage encapsulates a spin-active atom. The first section will discuss polymer-fullerene interactions from the point of view of determining how various polymer functional groups enhance or hinder the miscibility of C60. In order to successfully incorporate fullerenes into a block copolymer system, we first need to understand the basic interactions that occur between polymers and fullerenes to anticipate the upper limit of fullerenes that may be incorporated in a given polymer and potential approaches to increase this quantity. In particular, studies conducted using wide angle x-ray scattering (WAXS) of vinyl polymer-fullerene blends indicated that an increasing number of phenyl rings in the vinyl side group of the polymer leads to an increase in the miscibility. In particular, poly(9-vinylphenanthrene) (P9VPh), having three phenyl rings in the side group, showed a 6-fold improvement in miscibility limit compared to the other systems studied, polystyrene (PS) and poly(2-vinylnaphathalene) (P2VN). The degree of increase in miscibility observed with P9VPh is attributed to the ability of the vinyl aromatic structure to essentially conform to the curvature of a fullerene molecule rather than the increased potential for pi-pi interactions. These results importantly suggest that a block copolymer system can be tuned to maximize fullerene content, particularly by considering the geometry of functional groups with respect to the fullerene cage and will be discussed further in Chapter III. Second, the use of block copolymers as templates for creating ordered arrays of fullerenes is discussed. The initial goal was to disperse the fullerenes in one block of a block copolymer system and by aligning the microphase separation structure, also align the incorporated fullerenes. There are several major challenges associated with incorporating fullerenes into a block copolymer including the limited miscibility discussed in Chapter III. Furthermore, overcoming the strong inter-fullerene interactions that lead to aggregation also proves to be challenging; aggregates can disrupt the microphase structure in a block copolymer and make alignment difficult to obtain. One potential method generically used to solubilize nanoparticles within a block copolymer is modification of the nanoparticles by grafting polymer chains to the surface to solubilize the nanoparticle in a specific block. As discussed in Chapter IV, the effects of nanoparticle size and concentration on the phase behavior of lamellar-forming dPS-PMMA systems as well as the location of the fullerene star within the dPS block were studied using neutron reflectivity (NR). The scheme above has the disadvantage that modification of the fullerene cage with polymer arms dilutes the overall quantity of fullerene in the system and in the case of endohedral systems, would dilute and severely limit the overall quantity of spins available for measurement in quantum computing. For this reason we chose to investigate the formation of monolayers of amphiphilic fullerene dimers at the air/water interface using the Langmuir technique. We also studied the behavior of these materials when transferred as monolayers and multilayers to solid substrates as Langmuir-Blodgett (LB) films. The fullerene dimers in this case were modified to have at least one hydrophilic, polyethylene glycol-based ligand to balance the inherently hydrophobic nature of the fullerene cage and allow for a molecule that more closely resembled typical LB materials. Results of these studies indicated that we can form stable, close-packed monolayers and also control the orientation of the dimer at the air/water interface as well as on solid substrates by tuning the ligand chemistry as shown in Chapter V. The final approach used to achieve alignment of fullerene materials involves the interaction of fullerenes with a chemically-modified substrate either covalently or non-covale

  3. Managing the Right Projects: Best Practices to Align Project and Corporate Strategies

    NASA Technical Reports Server (NTRS)

    Watkins, Bobby


    If there's a human endeavor that exemplifies teamwork, it is space exploration. And that teamwork absolutely cannot happen effectively if the boots on the ground the people doing the work - don't understand how their work aligns with the larger goal. This presentation will discuss some best management practices from NASA's Marshall Space Flight Center that have succeeded in helping employees become informed, engaged and committed to the space agency's important missions. Specific topics include: Alignment Criteria: Linking Projects To Corporate Strategy. Resource Management: Best Practices For Resource Management. Strategic Analysis: Supporting Decision Making In A Changing Environment. Communication Strategies: Best Practices To Communicate Change. Benefits Achieved And Lessons Learned.

  4. Aligning USGS senior leadership structure with the USGS science strategy

    USGS Publications Warehouse

    U.S. Geological Survey


    The U.S. Geological Survey (USGS) is realigning its management and budget structure to further enhance the work of its science programs and their interdisciplinary focus areas related to the USGS Science Strategy as outlined in 'Facing Tomorrow's Challenges-U.S. Geological Survey Science in the Decade 2007-2017' (U.S. Geological Survey, 2007). In 2007, the USGS developed this science strategy outlining major natural-science issues facing the Nation and focusing on areas where natural science can make a substantial contribution to the well being of the Nation and the world. These areas include global climate change, water resources, natural hazards, energy and minerals, ecosystems, and data integration.

  5. Alignment strategies for the entrainment of music and movement rhythms.


    Moens, Bart; Leman, Marc


    Theories of entrainment assume that spontaneous entrainment emerges from dynamic laws that operate via mediators on interactions, whereby entrainment is facilitated if certain conditions are fulfilled. In this study, we show that mediators can be built that affect the entrainment of human locomotion to music. More specifically, we built D-Jogger, a music player that functions as a mediator between music and locomotion rhythms. The D-Jogger makes it possible to manipulate the timing differences between salient moments of the rhythms (beats and footfalls) through the manipulation of the musical period and phase, which affect the condition in which entrainment functions. We conducted several experiments to explore different strategies for manipulating the entrainment of locomotion and music. The results of these experiments showed that spontaneous entrainment can be manipulated, thereby suggesting different strategies on how to embark. The findings furthermore suggest a distinction among different modalities of entrainment: finding the beat (the most difficult part of entrainment), keeping the beat (easier, as a temporal scheme has been established), and being in phase (no entrainment is needed because the music is always adapted to the human rhythm). This study points to a new avenue of research on entrainment and opens new perspectives for the neuroscience of music. PMID:25773621

  6. Enabling the business strategy of SMEs through e-business capabilities: A strategic alignment perspective

    Microsoft Academic Search

    Louis Raymond; François Bergeron


    Purpose – The present study aims at a deeper understanding of the performance outcomes of the alignment between the e-business capabilities of manufacturing small- and medium-sized enterprises (SMEs) and their business strategy in terms of Miles and Snow's recognised strategic typology that includes prospectors, analyzers, and defenders. Design\\/methodology\\/approach – From a contingency theory perspective, a survey of 107 Canadian manufacturers

  7. Societal assessment overview

    NASA Technical Reports Server (NTRS)

    Bloomquist, C. E.


    The decision to proceed with SPS depends on a political determination that commitment of the economic, institutional, and social energies required for its implementation is a worthwhile investment. This determination is national (and international) in scope and is based on knowledge of the environmental and societal impacts of the SPS, its projected economics and technological risks, expressed through the influence of contending segments of society. To assist the decision makers, an assessment of societal issues associated with the SPS was undertaken as part of the Concept Development and Evaluation Program. Results of the assessment are reported. The primary societal assessment objectives are to determine if the societal ramifications of an SPS might significantly impede its development, and to establish an information base regarding these issues. Estimates regarding SPS impacts commensurate with its stage of development and the needs of the decision makers are provided.

  8. Octree-Based SIMD Strategy for Icp Registration and Alignment of 3d Point Clouds

    NASA Astrophysics Data System (ADS)

    Eggert, D.; Dalyot, S.


    Matching and fusion of 3D point clouds, such as close range laser scans, is important for creating an integrated 3D model data infrastructure. The Iterative Closest Point algorithm for alignment of point clouds is one of the most commonly used algorithms for matching of rigid bodies. Evidently, scans are acquired from different positions and might present different data characterization and accuracies, forcing complex data-handling issues. The growing demand for near real-time applications also introduces new computational requirements and constraints into such processes. This research proposes a methodology to solving the computational and processing complexities in the ICP algorithm by introducing specific performance enhancements to enable more efficient analysis and processing. An Octree data structure together with the caching of localized Delaunay triangulation-based surface meshes is implemented to increase computation efficiency and handling of data. Parallelization of the ICP process is carried out by using the Single Instruction, Multiple Data processing scheme - based on the Divide and Conquer multi-branched paradigm - enabling multiple processing elements to be performed on the same operation on multiple data independently and simultaneously. When compared to the traditional non-parallel list processing the Octree-based SIMD strategy showed a sharp increase in computation performance and efficiency, together with a reliable and accurate alignment of large 3D point clouds, contributing to a qualitative and efficient application.

  9. Work-family boundary strategies: Stability and alignment between preferred and enacted boundaries

    PubMed Central

    Ammons, Samantha K.


    Are individuals bounding work and family the way they would like? Much of the work-family boundary literature focuses on whether employees are segmenting or integrating work with family, but does not explore the boundaries workers would like to have, nor does it examine the fit between desired and enacted boundaries, or assess boundary stability. In this study, 23 respondents employed at a large Fortune 500 company were interviewed about their work-family boundaries before and after their teams underwent a cultural change initiative that sought to loosen workplace norms and allow employees more autonomy to decide when and where they performed their job tasks. Four distinct boundary strategies emerged from the data, with men and parents of young children having better alignment between preferred and enacted boundaries than women and those without these caregiving duties. Implications for boundary theory and research are discussed. PMID:25620801

  10. Does alignment of constructivist teaching, curriculum, and assessment strategies promote meaningful learning?

    NASA Astrophysics Data System (ADS)

    Jimarez, Teresa

    Despite our national efforts to attract more students to the science, technology, engineering, and mathematics (STEM) fields, the number of students continues to be small. Empirical studies have suggested that in order to actively engage students in the science learning processes, lessons need to be designed which consider student prior experiences and provide a sound curriculum, within an environment promoting social interaction---that is, allowing for sharing and negotiation of those ideas which promote reflective thinking. These premises require an embedded assessment system that continuously provides feedback to both student and teacher. This technique allows adaptation and modification of lessons to better facilitate conceptual understanding. This study focused on the use of constructivist strategies that, when aligned, promoted conceptual understanding while facilitating development of science process skills. Skill development leads to meaningful learning, known to promote a change of attitude toward science. A mixed research design embedded in a case study approach was used to understand the complexity of the variables examined in this study. Both quantitative and qualitative methods of data collection were used to strengthen the validity and interpretation of the findings. Students from one of three ninth-grade physical science classes were selected for this study. The students numbered 29, 13 boys and 16 girls; the majority of these students were of Hispanic background. The analysis of data suggested that the use of constructivist strategies promotes conceptual understanding of science concepts and development of science process skills and a change of attitude towards science. This study concluded that selecting teaching and multiple assessment strategies is vital to engage students in science careers. Due to the limited nature of this case study, the researcher recommends a replication or followup with a different teacher and school, including a control group and student interviews to add validity to student written pieces of work.

  11. What Drives Societal Collapse?

    NSDL National Science Digital Library

    Harvey Weiss (Yale University; Departments of Anthropology)


    Access to the article is free, however registration and sign-in are required. The archaeological and historical record shows many instances of societal collapse. These events have traditionally been explained by a combination of social, political, and economic factors. In their Perspective, Weiss and Bradley argue that there is increasing evidence for climate as the primary agent in the collapse of prehistoric and early historic societies. They also consider the possible effects of future anthropogenic climate change.

  12. Marketing and societal welfare: A multiple stakeholder approach

    Microsoft Academic Search

    Margaret Matear; Peter A. Dacin


    This manuscript provides insights to help identify the nature, scope and domain of the business strategy–consumer behavior–societal welfare link, and ways to explore the trade-offs between individual and societal gains. In this manuscript, stakeholder theory serves as a lens to analyze these issues in the context of a case study of direct-to-consumer advertising (DTCA) for prescription drugs. The case study

  13. Overview of the control strategies for the TMT alignment and phasing system

    NASA Astrophysics Data System (ADS)

    Piatrou, Piotr; Chanan, Gary


    In this paper we present the current status of control algorithm development for the Thirty Meter Telescope (TMT) Alignment and Phasing System (APS).We discuss ways to address the main challenges inherent in the active control of extremely large segmented telescopes: high complexity of the control problem, disentangling the aberrations on the primary, secondary and tertiary mirrors, and the tight requirements for residual errors. We also present preliminary APS performance estimates derived from simulations. In particular, our simulations show that the tomographic aberration disentanglement is only marginally useful for TMT alignment.

  14. Overview of the control strategies for the TMT alignment and phasing system

    Microsoft Academic Search

    Piotr Piatrou; Gary Chanan


    In this paper we present the current status of control algorithm development for the Thirty Meter Telescope (TMT) Alignment and Phasing System (APS).We discuss ways to address the main challenges inherent in the active control of extremely large segmented telescopes: high complexity of the control problem, disentangling the aberrations on the primary, secondary and tertiary mirrors, and the tight requirements

  15. Enhancing the performance of marketing managers : Aligning strategy, structure and evaluation systems

    Microsoft Academic Search

    Vlasis Stathakopoulos


    This article examines the relationships among two types of strategy (defender and prospector), two types of evaluation systems (output-oriented and behavior-oriented), and one dimension of organizational structure (centralization) and their interactive effects on the job performance of marketing managers. Findings from an empirical study indicate that marketing strategies must be matched with the appropriate types of evaluation systems and structure

  16. The proactive alignment of sourcing with marketing and branding strategies: a food service case

    Microsoft Academic Search

    Andrew Cox; Daniel Chicksand; Tong Yang


    Purpose – The purpose of this paper is to show that a proactive sourcing strategy can be just as important as a proactive marketing strategy in achieving sustainable competitive advantage. Design\\/methodology\\/approach – The paper reports on action research carried out in the UK beef industry, with a focus on the food service supply chain. The methodology is inductive and qualitative,

  17. Societal Marketing and Philanthropy in Dutch Companies

    Microsoft Academic Search

    Cynthia van der Heyden; Gerrit van der Rijt


    In the concepts of societal marketing and social responsibility, it is assumed that profit companies should have an explicit policy to shape their societal involvement and their corporate philanthropy. One way to express their societal involvement is by corporate philanthropy, by supporting important societal causes. In order to find out how Dutch companies deal with corporate philanthropy and to what

  18. A Therapeutic Strategy for Spinal Cord Defect: Human Dental Follicle Cells Combined with Aligned PCL/PLGA Electrospun Material.


    Li, Xinghan; Yang, Chao; Li, Lei; Xiong, Jie; Xie, Li; Yang, Bo; Yu, Mei; Feng, Lian; Jiang, Zongting; Guo, Weihua; Tian, Weidong


    Stem cell implantation has been utilized for the repair of spinal cord injury; however, it shows unsatisfactory performance in repairing large scale lesion of an organ. We hypothesized that dental follicle cells (DFCs), which possess multipotential capability, could reconstruct spinal cord defect (SCD) in combination with biomaterials. In the present study, mesenchymal and neurogenic lineage characteristics of human DFCs (hDFCs) were identified. Aligned electrospun PCL/PLGA material (AEM) was fabricated and it would not lead to cytotoxic reaction; furthermore, hDFCs could stretch along the oriented fibers and proliferate efficiently on AEM. Subsequently, hDFCs seeded AEM was transplanted to restore the defect in rat spinal cord. Functional observation was performed but results showed no statistical significance. The following histologic analyses proved that AEM allowed nerve fibers to pass through, and implanted hDFCs could express oligodendrogenic lineage maker Olig2 in vivo which was able to contribute to remyelination. Therefore, we concluded that hDFCs can be a candidate resource in neural regeneration. Aligned electrospun fibers can support spinal cord structure and induce cell/tissue polarity. This strategy can be considered as alternative proposals for the SCD regeneration studies. PMID:25695050

  19. A Therapeutic Strategy for Spinal Cord Defect: Human Dental Follicle Cells Combined with Aligned PCL/PLGA Electrospun Material

    PubMed Central

    Yang, Chao; Li, Lei; Xiong, Jie; Xie, Li; Yang, Bo; Yu, Mei; Feng, Lian; Jiang, Zongting; Guo, Weihua; Tian, Weidong


    Stem cell implantation has been utilized for the repair of spinal cord injury; however, it shows unsatisfactory performance in repairing large scale lesion of an organ. We hypothesized that dental follicle cells (DFCs), which possess multipotential capability, could reconstruct spinal cord defect (SCD) in combination with biomaterials. In the present study, mesenchymal and neurogenic lineage characteristics of human DFCs (hDFCs) were identified. Aligned electrospun PCL/PLGA material (AEM) was fabricated and it would not lead to cytotoxic reaction; furthermore, hDFCs could stretch along the oriented fibers and proliferate efficiently on AEM. Subsequently, hDFCs seeded AEM was transplanted to restore the defect in rat spinal cord. Functional observation was performed but results showed no statistical significance. The following histologic analyses proved that AEM allowed nerve fibers to pass through, and implanted hDFCs could express oligodendrogenic lineage maker Olig2 in vivo which was able to contribute to remyelination. Therefore, we concluded that hDFCs can be a candidate resource in neural regeneration. Aligned electrospun fibers can support spinal cord structure and induce cell/tissue polarity. This strategy can be considered as alternative proposals for the SCD regeneration studies. PMID:25695050

  20. Labeling strategies for 13C-detected aligned-sample solid-state NMR of proteins

    NASA Astrophysics Data System (ADS)

    Filipp, Fabian V.; Sinha, Neeraj; Jairam, Lena; Bradley, Joel; Opella, Stanley J.


    13C-detected solid-state NMR experiments have substantially higher sensitivity than the corresponding 15N-detected experiments on stationary, aligned samples of isotopically labeled proteins. Several methods for tailoring the isotopic labeling are described that result in spatially isolated 13C sites so that dipole-dipole couplings among the 13C are minimized, thus eliminating the need for homonuclear 13C- 13C decoupling in either indirect or direct dimensions of one- or multi-dimensional NMR experiments that employ 13C detection. The optimal percentage for random fractional 13C labeling is between 25% and 35%. Specifically labeled glycerol and glucose can be used at the carbon sources to tailor the isotopic labeling, and the choice depends on the resonances of interest for a particular study. For investigations of the protein backbone, growth of the bacteria on [2- 13C]-glucose-containing media was found to be most effective.

  1. Strategy Precedes Operational Effectiveness: Aligning High Graduation Rankings with Competitive Graduation Grade Point Averages

    ERIC Educational Resources Information Center

    Apprey, Maurice; Bassett, Kimberley C.; Preston-Grimes, Patrice; Lewis, Dion W.; Wood, Beverly


    Two pivotal and interconnected claims are addressed in this article. First, strategy precedes program effectiveness. Second, graduation rates and rankings are insufficient in any account of academic progress for African American students. In this article, graduation is regarded as the floor and not the ceiling, as it were. The ideal situation in…

  2. Smartly aligning nanowires by a stretching strategy and their application as encoded sensors.


    Wu, Yuchen; Su, Bin; Jiang, Lei


    The nanotechnology world is being more and more attracted toward high aspect ratio one-dimensional nanostructures due to their potentials as building blocks for electronic/optical devices. Here, we propose a novel method to generate nanowire patterns with assistance of superhydrophobic flexible polydimethylsiloxane (PDMS) substrates. Micropillar gaps are tunable via a stretching process of the PDMS surface; thus, diverse nanowire patterns can be formed by stretching the same PDMS surface in various ways. Importantly, square nanowire loops with alternative compositions can be generated through a double-stretching process, showing an advanced methodology in controlling the alignment of nanowires. Since alternative fluorescent molecules will be quenched by diverse chemical substances, this alternative nanowire loop shows a selective detection for diverse target compounds, which greatly improves the application of this nanowire patterning approach. Furthermore, such alternative nanowire patterns can be transferred from pillar-structured surfaces to flat films, indicating further potentials in microcircuits, sensitive sensors, and other organic functional nanodevices. PMID:22984829

  3. Broader societal issues of nanotechnology

    Microsoft Academic Search

    M. C. Roco


    Nanoscale science and engineering are providing unprecedented understanding and control over the basic building blocks of matter, leading to increased coherence in knowledge, technology, and education. The main reason for developing nanotechnology is to advance broad societal goals such as improved comprehension of nature, increased productivity, better healthcare, and extending the limits of sustainable development and of human potential. This

  4. Design as a strategic resource : design's contributions to competitive advantage aligned with strategy models

    E-print Network

    Stevens, John Simon


    Chapter 2 Literature of Strategy and Design 2.1 Introduction 9 2.2 Design’s rising profile 10 2.2.1 Design skills and characteristics 2.2.2 The design-focused enterprise 2.2.3 Beyond designing for manufacture 2.2.4 Service Design 2.2.5 Wicked Problems... , key outputs, and their relation to the structure of this thesis. phase 2phase 1 Support activities MarginMarginOperationsInboundlogistics Outbound logistics Marketing & Sales ServicePrimary activitiesFirm infrastructureHuman resources management...

  5. Composite Growth Factor Supplementation Strategies to Enhance Tenocyte Bioactivity in Aligned Collagen-GAG Scaffolds

    PubMed Central

    Caliari, Steven R.


    Biomolecular environments encountered in vivo are complex and dynamic, with combinations of biomolecules presented in both freely diffusible (liquid-phase) and sequestered (bound to the extracellular matrix) states. Strategies for integrating multiple biomolecular signals into a biomimetic scaffold provide a platform to simultaneously control multiple cell activities, such as motility, proliferation, phenotype, and regenerative potential. Here we describe an investigation elucidating the influence of the dose and mode of presentation (soluble, sequestered) of five biomolecules (stromal cell-derived factor 1? [SDF-1?], platelet-derived growth factor BB [PDGF-BB], insulin-like growth factor 1 [IGF-1], basic fibroblast growth factor [bFGF], and growth/differentiation factor 5 [GDF-5]) on the recruitment, proliferation, collagen synthesis, and genomic stability of equine tenocytes within an anisotropic collagen-GAG scaffold for tendon regeneration applications. Critically, we found that single factors led to a dose-dependent trade-off between driving tenocyte proliferation (PDGF-BB, IGF-1) versus maintenance of a tenocyte phenotype (GDF-5, bFGF). We identified supplementation schemes using factor pairs (IGF-1, GDF-5) to rescue the tenocyte phenotype and gene expression profiles while simultaneously driving proliferation. These results suggest coincident application of multi-biomolecule cocktails has a significant value in regenerative medicine applications where control of cell proliferation and phenotype are required. Finally, we demonstrated an immobilization strategy that allows efficient sequestration of bioactive levels of these factors within the scaffold network. We showed sequestration can lead to a greater sustained bioactivity than soluble supplementation, making this approach particularly amenable to in vivo translation where diffusive loss is a concern and continuous biomolecule supplementation is not feasible. PMID:23157454

  6. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools

    Microsoft Academic Search

    Julie D. Thompson; Toby J. Gibson; Frédéric Plewniak; François Jeanmougin; Desmond G. Higgins


    CLUSTAL X is a new windows interface for the widely-used progressive multiple sequence alignment program CLUSTAL W. The new system is easy to use, providing an integrated system for performing multiple sequence and profile alignments and analysing the results. CLUSTAL X displays the sequence alignment in a window on the screen. A versatile sequence colouring scheme allows the user to

  7. DOUGLAS R. WHITE Societal Research Archives System

    E-print Network

    White, Douglas R.

    DOUGLAS R. WHITE Societal Research Archives System : Retrieval, quality control and analysis of comparative data* I N T R O D U C T I O N The Societal Research Archives System (SRAS) was created worked on the project. The original Societal Research Archive System, at Minnesota, is still operative

  8. The Interplay of Psychology and Societal Transformation

    Microsoft Academic Search

    Michael J. Stevens


    This special issue of the International Journal of Group Tensions examines the contribution of psychology to societal transformation worldwide and the impact of societal transformation on psychology. In this introduction, I review the aims and scope of the journal and the focus of the special issue. Second, I identify several key consequences of societal transformation that are not bounded by

  9. Correction and alignment strategies for the beam separator of thePEEM3 microscope

    SciTech Connect

    Schmid, Peter; Feng, Jun; Padmore, Howard; Robin, David; Rose,Harald; Schlueter, Ross; Wan, Weishi; Forest, Etienne; Wu, YingHarald; Schlueter, Ross; Wan, Weishi; Forest, Etienne; Wu, Ying


    A new high-resolution aberration corrected photoemission electron microscope (PEEM3) will be installed on an undulator beam line at the Advanced Light Source (ALS) at the Lawrence Berkeley National Laboratory. The aim of this instrument is to provide a substantial flux and resolution improvement by employing an electron mirror for correcting both the third-order spherical aberration and the primary chromatic aberration. In order to utilize this concept of correction, a beam separator is a prerequisite. Crucial to achieving a resolution of 5nm for the high resolution mode, and a sixteen-fold increase in throughput at the same resolution as its predecessor, PEEM2, specified as 20nm at 2% transmission, for the high flux mode is the double symmetric design of the beam separator, which eliminates all the second order geometric aberrations. Nonetheless, substantial tuning capabilities must be incorporated into the PEEM3 design to compensate for both systematic and random errors. In this paper, we investigate how to correct for non-systematic imperfections and for systematic uncertainties in the accuracy of the magnetic fields and focus on how degradation of the resolution and the field of view can be minimized. Finally, we outline a tentative correction strategy for PEEM3.

  10. Societal responses to the Anthropocene.


    Tickell, Crispin


    This article discusses the societal responses to the Anthropocene. First we need to confront the effects of our own population proliferation in all its aspects; next to look again at economics and replace consumerism as a goal; then to work out new ways of generating energy; to manage and adapt to what is in effect climate destabilization; to give higher priority to conservation of the natural world; and last to create the necessary institutional means of coping with global problems in a world in which society is more integrated than ever before. PMID:21282154

  11. Strategy-aligned fuzzy approach for market segment evaluation and selection: a modular decision support system by dynamic network process (DNP)

    NASA Astrophysics Data System (ADS)

    Mohammadi Nasrabadi, Ali; Hosseinpour, Mohammad Hossein; Ebrahimnejad, Sadoullah


    In competitive markets, market segmentation is a critical point of business, and it can be used as a generic strategy. In each segment, strategies lead companies to their targets; thus, segment selection and the application of the appropriate strategies over time are very important to achieve successful business. This paper aims to model a strategy-aligned fuzzy approach to market segment evaluation and selection. A modular decision support system (DSS) is developed to select an optimum segment with its appropriate strategies. The suggested DSS has two main modules. The first one is SPACE matrix which indicates the risk of each segment. Also, it determines the long-term strategies. The second module finds the most preferred segment-strategies over time. Dynamic network process is applied to prioritize segment-strategies according to five competitive force factors. There is vagueness in pairwise comparisons, and this vagueness has been modeled using fuzzy concepts. To clarify, an example is illustrated by a case study in Iran's coffee market. The results show that success possibility of segments could be different, and choosing the best ones could help companies to be sure in developing their business. Moreover, changing the priority of strategies over time indicates the importance of long-term planning. This fact has been supported by a case study on strategic priority difference in short- and long-term consideration.

  12. Cultural diversity, economic development and societal instability

    USGS Publications Warehouse

    Nettle, D.; Grace, J.B.; Choisy, M.; Cornell, H.V.; Guegan, J.-F.; Hochberg, M.E.


    Background. Social scientists have suggested that cultural diversity in a nation leads to societal instability. However, societal instability may be affected not only by within-nation on ?? diversity, but also diversity between a nation and its neighbours or ?? diversity. It is also necessary to distinguish different domains of diversity, namely linguistic, ethnic and religious, and to distinguish between the direct effects of diversity on societal instability, and effects that are mediated by economic conditions. Methodology/Principal Findings. We assembled a large cross-national dataset with information on ?? and ?? cultural diversity, economic conditions, and indices of societal instability. Structural equation modeling was used to evaluate the direct and indirect effects of cultural diversity on economics and societal stability. Results show that different type and domains of diversity have interacting effects. As previously documented, linguistic ?? diversity has a negative effect on economic performance, and we show that it is largely through this economic mechanism that it affects societal instability. For ?? diversity, the higher the linguistic diversity among nations in a region, the less stable the nation. But, religious ?? diversity has the opposite effect, reducing instability, particularly in the presence of high linguistic diversity. Conclusions. Within-nation linguistic diversity is associated with reduced economic performance, which, in turn, increases societal instability. Nations which differ linguistically from their neighbors are also less stable. However, religious diversity between, neighboring nations has the opposite effect, decreasing societal instability.

  13. Issues in societal optimal engineering decision making

    Microsoft Academic Search

    Michael H. Faber; Marc A. Maes


    Optimal decision making in the context of engineering is addressed from the perspective of society, with the aim of optimal decision making being understood as to provide an informed basis for the identification of sustainable societal developments. The paper begins with a discussion of the issues that are presently of main concern in engineering decision making from a societal perspective.

  14. Societal and Ethical Implications of Nanotechnology

    E-print Network

    Subramanian, Venkat

    Societal and Ethical Implications of Nanotechnology #12;What is SEI? · Social and Ethical Nanotechnology Research & Development Act of 2003 (PL 108-153) · Established a societal implications research of their research · Provides for public input into nanotechnology research and development #12;Areas of Society

  15. Societal health and urban sustainability indicators

    SciTech Connect

    Petrich, C.H.; Tonn, B.E.


    Without the social will, no city can successfully Undertake the planning and programs necessary for meaningful progress toward sustainability. Social will derives from wellsprings of vital societal health. This paper presents an approach to helping cities in APEC member economies initiate a program for developing indicators of sustainability. Representative indicators of social capital and other aspects of civic engagement, as proxies for societal health, are presented.

  16. MC64-ClustalWP2: A Highly-Parallel Hybrid Strategy to Align Multiple Sequences in Many-Core Architectures

    PubMed Central

    Díaz, David; Esteban, Francisco J.; Hernández, Pilar; Caballero, Juan Antonio; Guevara, Antonio


    We have developed the MC64-ClustalWP2 as a new implementation of the Clustal W algorithm, integrating a novel parallelization strategy and significantly increasing the performance when aligning long sequences in architectures with many cores. It must be stressed that in such a process, the detailed analysis of both the software and hardware features and peculiarities is of paramount importance to reveal key points to exploit and optimize the full potential of parallelism in many-core CPU systems. The new parallelization approach has focused into the most time-consuming stages of this algorithm. In particular, the so-called progressive alignment has drastically improved the performance, due to a fine-grained approach where the forward and backward loops were unrolled and parallelized. Another key approach has been the implementation of the new algorithm in a hybrid-computing system, integrating both an Intel Xeon multi-core CPU and a Tilera Tile64 many-core card. A comparison with other Clustal W implementations reveals the high-performance of the new algorithm and strategy in many-core CPU architectures, in a scenario where the sequences to align are relatively long (more than 10 kb) and, hence, a many-core GPU hardware cannot be used. Thus, the MC64-ClustalWP2 runs multiple alignments more than 18x than the original Clustal W algorithm, and more than 7x than the best x86 parallel implementation to date, being publicly available through a web service. Besides, these developments have been deployed in cost-effective personal computers and should be useful for life-science researchers, including the identification of identities and differences for mutation/polymorphism analyses, biodiversity and evolutionary studies and for the development of molecular markers for paternity testing, germplasm management and protection, to assist breeding, illegal traffic control, fraud prevention and for the protection of the intellectual property (identification/traceability), including the protected designation of origin, among other applications. PMID:24710354

  17. Achieving Alignment.

    ERIC Educational Resources Information Center

    Ananda, Sri


    Describes how school districts can implement alignment between student learning standards and assessments used to measure that learning. Focuses on alignment between standards and assessment in No Child Left Behind Act, the types of alignment studies requested by states and districts, and using the results of alignment studies to inform practice.…

  18. The contingent effects of top management teams on venture performance: Aligning founding team composition with innovation strategy and commercialization environment

    E-print Network

    Eesley, Charles E.

    How does the relationship between founding team composition and venture performance depend on the venture's strategy and business environment? Using data from a novel survey of 2,067 firms, we show that while diverse ...

  19. The Alignment of Partnering Strategy, Governance and Management in R&D Projects: The Role of Contract Choice

    E-print Network

    MacCormack, Alan

    Firms increasingly look outside their organizational boundaries to identify partners that can improve the effectiveness of R&D projects. The strategy for using partners, however, varies significantly across projects. In ...

  20. Making Health System Performance Measurement Useful to Policy Makers: Aligning Strategies, Measurement and Local Health System Accountability in Ontario

    PubMed Central

    Veillard, Jeremy; Huynh, Tai; Ardal, Sten; Kadandale, Sowmya; Klazinga, Niek S.; Brown, Adalsteinn D.


    This study examined the experience of the Ontario Ministry of Health and Long-Term Care in enhancing its stewardship and performance management role by developing a health system strategy map and a strategy-based scorecard through a process of policy reviews and expert consultations, and linking them to accountability agreements. An evaluation of the implementation and of the effects of the policy intervention has been carried out through direct policy observation over three years, document analysis, interviews with decision-makers and systematic discussion of findings with other authors and external reviewers. Cascading strategies at health and local health system levels were identified, and a core set of health system and local health system performance indicators was selected and incorporated into accountability agreements with the Local Health Integration Networks. despite the persistence of such challenges as measurement limitations and lack of systematic linkage to decision-making processes, these activities helped to strengthen substantially the ministry's performance management function. PMID:21286268

  1. Integration of Aerial and long-range Terrestrial Laser Scanner: alignment strategies and 3D models for landslide/rockslide description

    NASA Astrophysics Data System (ADS)

    Bertacchini, Eleonora; Rivola, Riccardo; Castagnetti, Cristina; Capra, Alessandro; Parmeggiani, Erika


    The purpose of this work is to integrate airborne and long-range (up to some kilometers) terrestrial laser scanning data in order to obtain a good and reliable description of the geomorphology of unstable slopes. 3D models derived from the integrated point clouds can be particularly useful to study and analyze complex morphology, vertical walls of rockslides and surfaces with sparse vegetation. Terrestrial Laser Scanning (TLS) and Airborne Laser Scanning (ALS) are very efficient techniques for characterizing the morphostructure of slopes; although both techniques individually show some limits, their integration can overcome these limits. For example, for vertical walls of rock, the TLS could be recommended because of its "frontal" point of view, that permits a description of vertical walls with a higher point density than ALS can reach. On the other hand, the power of the ALS methodology is highlighted when a large and flat area is involved and/or when a lot of vegetation covers the area. The ALS can easily reach the ground with respect to TLS due to its vertical position of measurement and this allows a more reliable result even if the last generation of terrestrial laser scanners has the skill to penetrate inside the vegetation thanks to a multi-echo technology. All the problems and difficulties encountered will be fully described. When a reliable description of the morphology is requested and involved distances are of some kilometers, the alignment strategies, the point cloud management and filtering, along with the DTM generation are crucial aspects that cannot be underestimate. Thus, different alignment techniques were examined (ICP - Iterative Closest Point, backsigthing orientation with GPS positioning, alignment with targets or homologous points). Results could be optimized only combining the different alignment approaches. In addition, the DTM generation was deeply analyzed, comparing TIN (Triangular Irregular Network) and grid mesh format, different point cloud densities, different grid dimensions and algorithms of interpolation. The challenge was the definition of a quantitative method for comparing 3D models obtained with the different approaches.

  2. Global alignment optimization strategies, procedures, and tools for the James Webb Space Telescope (JWST) Integrated Science Instrument Module (ISIM)

    NASA Astrophysics Data System (ADS)

    Bos, Brent J.; Howard, Joseph M.; Young, Philip J.; Gracey, Renee; Seals, Lenward T.; Ohl, Raymond G.


    During cryogenic vacuum testing of the James Webb Space Telescope (JWST) Integrated Science Instrument Module (ISIM), the global alignment of the ISIM with respect to the designed interface of the JWST optical telescope element (OTE) will be measured through a series of optical characterization tests. These tests will determine the locations and orientations of the JWST science instrument projected focal surfaces and entrance pupils with respect to their corresponding OTE optical interfaces. Thermal, finite element and optical modeling will then be used to predict the on-orbit optical performance of the observatory. If any optical performance non-compliances are identified, the ISIM will be adjusted to improve its performance. If this becomes necessary, ISIM has a variety of adjustments that can be made. The lengths of the six kinematic mount struts that attach the ISIM to the OTE can be modified and five science instrument focus positions and two pupil positions can be individually adjusted as well. In order to understand how to manipulate the ISIM’s degrees of freedom properly and to prepare for the ISIM flight model testing, we have completed a series of optical-mechanical analyses to develop and identify the best approaches for bringing a non-compliant ISIM Element back into compliance. During this work several unknown misalignment scenarios were produced and the simulated optical performance metrics were input into various mathematical modeling and optimization tools to determine how the ISIM degrees of freedom should be adjusted to provide the best overall optical performance.

  3. Atomoxetine's Effect on Societal Costs in Sweden

    ERIC Educational Resources Information Center

    Myren, Karl-Johan; Thernlund, Gunilla; Nylen, Asa; Schacht, Alexander; Svanborg, Par


    Objective: To compare societal costs between patients treated with atomoxetine and placebo in Sweden. Method: Ninety-nine pediatric ADHD patients were randomized to a 10-week double-blind treatment with atomoxetine (n = 49) or placebo (n = 50). All parents received four sessions of psycho-education. Parents filled out a resource utilization…

  4. Early Trauma, Societal Oppression and Coming Out

    Microsoft Academic Search

    Madeleine F. Price


    This paper is a journey into a relatively uncharted clinical landscape. The terrain in question is located at the intersection of three factors: early and cumulative trauma (where it exists), societal and familial stigma and oppression (an inescapable reality), and the normal developmental process of coming out as a bisexual female. In the bisexual or lesbian client, moreover, the clinical

  5. The societal impact value of risk

    SciTech Connect

    Simpson, D.E.


    A key ill-defined issue in the management and regulation of potentially hazardous conditions is that of the value to be associated with a reduction (or existence) of human health risks, such as radiation exposure or hazardous substance ingestion. Empirical observations of societal behavior patterns lead to a relationship for the quantitative value of societal risk impact which is consistent with general societal risk acceptance, is not inconsistent with ``de facto`` risk regulation, and is suitable and appropriate as a specification or guide for risk management and risk regulation. This societal risk impact expression is: Impact ($/year) = (8 {times} 10{sup 7}) NR{sub i}{sup 4/3} where Ri = individual annual mortality risk; N = number of persons in the population sharing the risk and benefits. The change in Impact which can be derived from a regulation or risk management activity is the value of annual benefit which society would expect to forego (or annual equivalent cost to incur) in consideration of the activity.

  6. Kant's Moral Grounding of Societal Duties

    Microsoft Academic Search

    Joyce Lazier


    With the knowledge of brutal acts like the mutilation of female genitalia, the search for an antidote to cultural relativism has begun. A logical place to turn would be Kant since his deontological moral theory is a serious contender to individual relativism. However, in the Metaphysics of Morals , Kant provides a confusing description of duties of Right (societal duties).

  7. Childhood obesity: a societal problem to solve

    Microsoft Academic Search

    M. B. Schwartz; R. Puhl


    Summary In contrast to other threats to American children's health, the treatment and prevention of childhood obesity are considered the responsibility of individual children and their parents. This pressure exists in the context of the societal stigmatization of overweight children and the powerful environmental induce- ments aimed directly at children to eat nutritionally poor foods. Parents of overweight children are

  8. Awareness of Societal Issues Among High School Biology Teachers Teaching Genetics

    NASA Astrophysics Data System (ADS)

    Lazarowitz, Reuven; Bloch, Ilit


    The purpose of this study was to investigate how aware high school biology teachers are of societal issues (values, moral, ethic, and legal issues) while teaching genetics, genetics engineering, molecular genetics, human heredity, and evolution. The study includes a short historical review of World War II atrocities during the Holocaust when scientists from all the above-mentioned disciplines had been involved in trying to support and develop the eugenics theories. It investigates pre- and postwar theories of the eugenics movement in the United States which were implemented successfully in Germany and a literature survey of the studies of societal issues related to these subjects. The sample consisted of 30 male and female biology teachers. Enclosed are teachers' answers in favor or against including debates about societal issues in their classrooms while teaching the disciplines mentioned above. Teachers' answers were analyzed in relation to three variables: years of teaching experience, gender, and religion faith. Data were collected from questionnaires and personal interviews and analyzed according to qualitative and quantitative methods. The results show that amongst the teachers there is a medium to low level of awareness of societal issues, while mainly emphasizing scientific subjects in preparation of matriculation examinations. The majority of the teachers do not include societal issues in their teaching, but if students raise these issues, teachers claimed to address them. No differences in teachers' opinions to societal issues were found in relation to gender or religious faith. Teachers with more years of teaching experience tend to teach with a more Science, Technology, and Society (STS) approach than novice teachers. The results are discussed in relation to teachers' professional development and teaching strategies are suggested to be used in their classrooms based on a STS approach, which includes the societal issues as a main goal.

  9. Bilingualism and biculturism as individual and as societal phenomena

    Microsoft Academic Search

    Joshua A. Fishman


    Just as diglossia is the stable, societal counterpart to individual bilingualism, so di?ethnia is the stable, societal counterpart to individual biculturism. Di?ethnia requires societal compartmentalization as well as institutionally protected functional specificity. These desiderata are hard to attain and to retain — both ideologically and structurally — under “modern”, interactive, mobile and individualistic urban industrial conditions. However, some groups have,

  10. Aligned-or Not?

    ERIC Educational Resources Information Center

    Roseman, Jo Ellen; Koppal, Mary


    When state leaders and national partners in the development of the Next Generation Science Standards met to consider implementation strategies, states and school districts wanted to know which materials were aligned to the new standards. The answer from the developers was short but not sweet: You won't find much now, and it's going to…

  11. Alignment validation

    SciTech Connect

    ALICE; ATLAS; CMS; LHCb; Golling, Tobias


    The four experiments, ALICE, ATLAS, CMS and LHCb are currently under constructionat CERN. They will study the products of proton-proton collisions at the Large Hadron Collider. All experiments are equipped with sophisticated tracking systems, unprecedented in size and complexity. Full exploitation of both the inner detector andthe muon system requires an accurate alignment of all detector elements. Alignmentinformation is deduced from dedicated hardware alignment systems and the reconstruction of charged particles. However, the system is degenerate which means the data is insufficient to constrain all alignment degrees of freedom, so the techniques are prone to converging on wrong geometries. This deficiency necessitates validation and monitoring of the alignment. An exhaustive discussion of means to validate is subject to this document, including examples and plans from all four LHC experiments, as well as other high energy experiments.

  12. The Influence Factors and Mechanism of Societal Risk Perception

    NASA Astrophysics Data System (ADS)

    Zheng, Rui; Shi, Kan; Li, Shu

    Risk perception is one of important subjects in management psychology and cognitive psychology. It is of great value in the theory and practice to investigate the societal hazards that the public cares a lot especially in Socio-economic transition period. A survey including 30 hazards and 6 risk attributes was designed and distributed to about 2, 485 residents of 8 districts, Beijing. The major findings are listed as following: Firstly, a scale of societal risk perception was designed and 2 factors were identified (Dread Risk & Unknown Risk). Secondly, structural equation model was used to analyze the influence factors and mechanism of societal risk perception. Risk preference, government support and social justice could influence societal risk perception directly. Government support fully moderated the relationship between government trust and societal risk perception. Societal risk perception influenced life satisfaction, public policy preferences and social development belief.

  13. Societal Implicit Memory and his Speed on Tracking Extrema over Dynamic Environments using Self-Regulatory Swarms

    Microsoft Academic Search

    Vitorino Ramos; Carlos Fernandes; Agostinho C. Rosa


    In order to overcome difficult dynamic optimization and environment extrema tracking problems, we propose a Self-Regulated Swarm (SRS) algorithm which hybridizes the advantageous characteristics of Swarm Intelligence as the emergence of a societal environmental memory or cognitive map via collective pheromone laying in the landscape (properly balancing the exploration\\/exploitation nature of the search strategy), with a simple Evolutionary mechanism that

  14. Societal drivers in the applications of telehealth.


    Doarn, Charles R; Yellowlees, Peter; Jeffries, Deborah A; Lordan, Denny; Davis, Sally; Hammack, Glenn; McClosky-Armstrong, Thelma; Kvedar, Joseph


    The application of telemedicine and e-health tools and the integration of these tools in healthcare is no longer a demonstration, pilot project, or idea. The changing landscape of humanity dictates that new solutions be implemented to address old problems. The landscape is changing with diminishing resources of fossil fuels, aging population, a shortage of skilled labor in healthcare (doctors, nurses, and allied health professionals), and emerging technologies for the personal space, culture, and consumer demand. All are key drivers in altering healthcare delivery, access, and education. The very foundation of medicine needs to change to meet these demands. Access using telehealth will widen and enable our ability to respond to public health issues. This paper addresses the many societal issues facing healthcare delivery and demonstrates how telehealth solutions are key components of the future of healthcare delivery across the globe. PMID:19035816

  15. Applications and societal benefits of plastics.


    Andrady, Anthony L; Neal, Mike A


    This article explains the history, from 1600 BC to 2008, of materials that are today termed 'plastics'. It includes production volumes and current consumption patterns of five main commodity plastics: polypropylene, polyethylene, polyvinyl chloride, polystyrene and polyethylene terephthalate. The use of additives to modify the properties of these plastics and any associated safety, in use, issues for the resulting polymeric materials are described. A comparison is made with the thermal and barrier properties of other materials to demonstrate the versatility of plastics. Societal benefits for health, safety, energy saving and material conservation are described, and the particular advantages of plastics in society are outlined. Concerns relating to littering and trends in recycling of plastics are also described. Finally, we give predictions for some of the potential applications of plastic over the next 20 years. PMID:19528050

  16. Applications and societal benefits of plastics

    PubMed Central

    Andrady, Anthony L.; Neal, Mike A.


    This article explains the history, from 1600 BC to 2008, of materials that are today termed ‘plastics’. It includes production volumes and current consumption patterns of five main commodity plastics: polypropylene, polyethylene, polyvinyl chloride, polystyrene and polyethylene terephthalate. The use of additives to modify the properties of these plastics and any associated safety, in use, issues for the resulting polymeric materials are described. A comparison is made with the thermal and barrier properties of other materials to demonstrate the versatility of plastics. Societal benefits for health, safety, energy saving and material conservation are described, and the particular advantages of plastics in society are outlined. Concerns relating to littering and trends in recycling of plastics are also described. Finally, we give predictions for some of the potential applications of plastic over the next 20 years. PMID:19528050

  17. Societal Benefits of Ocean Altimetry Data

    NASA Technical Reports Server (NTRS)

    Srinivasen, Margaret; Leben, Robert


    The NASA/CNES Jason satellite, follow-on to the highly successful TOPEX/Poseidon mission, continues to provide oceanographers and marine operators across the globe with a continuous twelve-year, high quality stream of sea surface height data. The mission is expected to extend through 2007, when the NASA/NOAA/CNES follow-on mission, OSTM, will be launched with the wide-swath ocean altimeter on board. This unprecedented resource of valuable ocean data is being used to map sea surface height, geostrophic velocity, significant wave height, and wind speed over the global oceans. Altimeter data products are currently used by hundreds of researchers and operational users to monitor ocean circulation and improve our understanding of the role of the oceans in climate and weather. Ocean altimeter data has many societal benefits and has proven invaluable in many practical applications including; a) Ocean forecasting systems; b) Climate research and forecasting; c) Ship routing; d) Fisheries management; e) Marine mammal habitat monitoring; f) Hurricane forecasting and tracking; g) Debris tracking; and h) Precision marine operations such as cable-laying and oil production. The data has been cited in nearly 2,000 research and popular articles since the launch of TOPEX/Poseidon in 1992, and almost 200 scientific users receive the global coverage altimeter data on a monthly basis. In addition to the scientific and operational uses of the data, the educational community has seized the unique concepts highlighted by these altimeter missions as a resource for teaching ocean science to students from grade school through college. This presentation will highlight societal benefits of ocean altimetry data in the areas of climate studies, marine operations, marine research, and non-ocean investigations.

  18. Girls, science and epistemology: A societal approach

    NASA Astrophysics Data System (ADS)

    Arner Welsh, Jennifer M.

    This study examines the ways in which girls' personal epistemologies are applied and modulated in relationship with scientific disciplinary epistemology in the context of their early science learning. The research takes a societal approach, assuming that both girls' reasoning and scientific disciplinary epistemology are socially constituted, emphasizing the role of gendered discourses, realities and experiences in the construction of girls' subjectivities and disciplinary epistemology. Initially, three research scientists were interviewed to provide a naturalized understanding of scientific disciplinary epistemology. Subsequently, over the course of spring semester, seven ninth-grade girls from a small middle-class town participated in a series of in-depth interviews about their reasoning in scientific contexts. The focus of the interview analysis is two-fold. Possible points of connection and contention are examined between the ways in which girls deploy their personal epistemologies and scientific disciplinary epistemology. Individual profiles of each girl are also developed, describing patterns and tensions in her reasoning. This study reveals the intersection between personal and disciplinary epistemology as a productive area for research, and further, shows that examining societal context and personal epistemologies provides new insight into the issues facing girls learning science. Results suggest that there are both significant disjuncts and points of connection between these girls' personal epistemologies and scientific disciplinary epistemology. In particular, the personal understandings of knowledge as perspectival and the role of experience as providing frameworks for thinking which were shown by the girls in this study could be meaningfully used in conjunction with contemporary trends in philosophy of science to enhance understanding of science and scientific disciplinary epistemology.

  19. Spiritual perspectives on individual, organizational and societal transformation

    Microsoft Academic Search

    Judith A. Neal; Benyamin M. Bergmann Lichtenstein; David Banner


    The article explores issues of what matters most in individual organizational and societal transformation – economic issues or spirit? Transformation is defined and literature on individual, organizational and societal transformation is presented. The article looks at the standard arguments that economics are the driving force in transformation and then postulates that spirituality may be as much – if not more

  20. Integrating Socioeconomic Data into GEOSS to Enable Societal Benefits

    Microsoft Academic Search

    R. S. Chen; G. Yetman


    Achieving the GEOSS vision of societal benefits from Earth observation data is a multi-faceted challenge. Linking Earth observation systems into an interoperable system of systems is an important first step, but not sufficient on its own to fulfill the ambitious GEOSS goal of improving decision making for disaster mitigation, public health, ecosystem and resource management, agriculture, and the other societal

  1. Societal lifetime cost of hydrogen fuel cell vehicles

    Microsoft Academic Search

    Yongling Sun; Joan Ogden; Mark Delucchi


    This paper employs societal lifetime cost for evaluating hydrogen fuel cell vehicles (FCVs) from a societal welfare perspective as compared to conventional gasoline vehicles. We employ a learning-curve model for fuel-cell system cost estimates over time. The delivered hydrogen fuel cost is estimated using the UC Davis SSCHISM hydrogen supply pathway model, and most vehicle costs are estimated using the

  2. Aligned kraft pulp fiber sheets for reinforcing mortar

    Microsoft Academic Search

    B. J. Mohr; H. Nanko; K. E. Kurtis


    In this research program, aligned pulp fiber sheets were used as reinforcement in cement-based matrices. Flexural testing results validate this reinforcement strategy by demonstrating that: (1) fiber sheet alignment does significantly affect mechanical behavior, indicating that fiber alignment is achieved by the production process, and (2) aligned fiber sheet composite exhibited significantly greater toughness than equivalent volumes of distributed fibers.

  3. Alignment fixture


    Bell, Grover C. (Norris, TN); Gibson, O. Theodore (Lenoir City, TN)


    A part alignment fixture is provided which may be used for precise variable lateral and tilt alignment relative to the fixture base of various shaped parts. The fixture may be used as a part holder for machining or inspection of parts or alignment of parts during assembly and the like. The fixture includes a precisely machined diameter disc-shaped hub adapted to receive the part to be aligned. The hub is nested in a guide plate which is adapted to carry two oppositely disposed pairs of positioning wedges so that the wedges may be reciprocatively positioned by means of respective micrometer screws. The sloping faces of the wedges contact the hub at respective quadrants of the hub periphery. The lateral position of the hub relative to the guide plate is adjusted by positioning the wedges with the associated micrometer screws. The tilt of the part is adjusted relative to a base plate, to which the guide plate is pivotally connected by means of a holding plate. Two pairs of oppositely disposed wedges are mounted for reciprocative lateral positioning by means of separate micrometer screws between flanges of the guide plate and the base plate. Once the wedges are positioned to achieve the proper tilt of the part or hub on which the part is mounted relative to the base plate, the fixture may be bolted to a machining, inspection, or assembly device.

  4. Societal issues as Mars mission impediments: planetary protection and contamination concerns.


    Race, M S


    Societal and non-scientific factors represent potentially significant impediments for future Mars missions, especially in areas involving planetary protection. This paper analyzes public concerns about forward contamination to Mars and back contamination to Earth, evaluates major areas where lack of information may lead to uncontrollable impacts on future missions, and concludes that NASA should adopt a strategy that actively plans both the generation and subsequent management of planetary protection information to ensure that key audiences obtain needed information in a timely manner. Delay or avoidance in dealing with societal issues early in mission planning will increase the likelihood of public opposition, cost increases and missed launch windows. While this analysis of social and non-scientific considerations focuses on future Mars missions, the findings are also relevant for RTG launches, nuclear propulsion and other NASA activities perceived to have health, safety or environmental implications. PMID:11539240

  5. Variations in societal characteristics of spatial disease clusters: examples of colon, lung and breast cancer in Japan

    PubMed Central

    Fukuda, Yoshiharu; Umezaki, Masahiro; Nakamura, Keiko; Takano, Takehito


    Background Spatial analyses and ecological studies are essential for epidemiology and public health. The present study combining these two methods was performed to identify spatial clusters of selected types of cancer in Japan and to determine their societal characteristics focusing on homogeneity among clusters. Results Spatial clusters of high mortality rates of male colon and lung cancer and of female breast cancer were identified by the spatial scan statistic using Japanese municipal data (N = 3360) from 1993 to 1998 and also municipalities were divided into four societal clusters based on socioeconomic indicators and population density (urban-rich, suburban, rural-poor, and clutter). Five, seven, and four mortality clusters were identified for lung, colon and breast cancer, respectively. For colon and breast cancer, most municipalities of all except one cluster were included in a single societal cluster (urban-rich). The municipalities associated with mortality clusters for lung cancer belonged to various societal clusters. Conclusion Increased mortality rates of colon and breast cancer can be explained by homogenous societal characteristics related to urbanisation, although there were exceptional areas with higher mortality rates. The regional variation in lung cancer mortality rate appeared to be due to heterogeneous factors. These findings and the analysis performed in the present study will contribute to both nationwide and region-specific cancer prevention strategies. PMID:15953394

  6. Physical, Ecological, and Societal Indicators for the National Climate Assessment

    NASA Technical Reports Server (NTRS)

    Kenney, Melissa A.; Chen, Robert; Baptista, Sandra R.; Quattrochi, Dale; O'Brien, Sheila


    The National Climate Assessment (NCA) is being conducted under the auspices of the U.S. Global Change Research Program (USGCRP), pursuant to the Global Change Research Act of 1990, Section 106, which requires a report to Congress every 4 years. The current NCA ( differs in multiple ways from previous U.S. climate assessment efforts, being: (1) more focused on supporting the Nation s activities in adaptation and mitigation and on evaluating the current state of scientific knowledge relative to climate impacts and trends; (2) a long-term, consistent process for evaluation of climate risks and opportunities and providing information to support decision-making processes within regions and sectors; and (3) establishing a permanent assessment capacity both inside and outside of the federal government. As a part of ongoing, long-term assessment activities, the NCA intends to develop an integrated strategic framework and deploy climate-relevant physical, ecological, and societal indicators. The NCA indicators framework is underdevelopment by the NCA Development and Advisory Committee Indicators Working Group and are envisioned as a relatively small number of policy-relevant integrated indicators designed to provide a consistent, objective, and transparent overview of major variations in climate impacts, vulnerabilities, adaptation, and mitigation activities across sectors, regions, and timeframes. The potential questions that could be addressed by these indicators include: How do we know that there is a changing climate and how is it expected to change in the future? Are important climate impacts and opportunities occurring or predicted to occur in the future? Are we adapting successfully? What are the vulnerabilities and resiliencies given a changing climate? Are we preparing adequately for extreme events? It is not expected that the NCA societal indicators would be linked directly to a single decision or portfolio of decisions, but subsets of indicators, or the data supporting the indicator, might be used to inform decision-making processes such as the development and implementation of climate adaptation strategies in a particular sector or region.

  7. Image alignment


    Dowell, Larry Jonathan


    Disclosed is a method and device for aligning at least two digital images. An embodiment may use frequency-domain transforms of small tiles created from each image to identify substantially similar, "distinguishing" features within each of the images, and then align the images together based on the location of the distinguishing features. To accomplish this, an embodiment may create equal sized tile sub-images for each image. A "key" for each tile may be created by performing a frequency-domain transform calculation on each tile. A information-distance difference between each possible pair of tiles on each image may be calculated to identify distinguishing features. From analysis of the information-distance differences of the pairs of tiles, a subset of tiles with high discrimination metrics in relation to other tiles may be located for each image. The subset of distinguishing tiles for each image may then be compared to locate tiles with substantially similar keys and/or information-distance metrics to other tiles of other images. Once similar tiles are located for each image, the images may be aligned in relation to the identified similar tiles.

  8. Reducing societal vulnerability to drought: A methodology

    SciTech Connect

    Wilhite, D.A. [Univ. of Nebraska, Lincoln, NE (United States). International Drought Information Center


    Given worldwide experience with drought during the past several decades and the magnitude of associated impacts, it is apparent that vulnerability to extended periods of water shortage is escalating. Developing a national or provincial drought policy and preparedness plan is a complicated but essential first step toward reducing societal vulnerability. Until recently, nations had devoted little effort to drought preparedness, preferring instead the reactive or crisis management approach. Presently, an increasing number of nations are pursuing a more proactive approach that emphasizes the principles of risk management and sustainable development. Because of the multitude of impacts associated with drought and the numerous governmental agencies that have responsibility for some aspect of monitoring, assessment, mitigation, and planning, developing a policy and plan must be an integrated process within and between levels of government. This paper outlines a generic process that can be adopted by governments that desire to develop a more comprehensive and long-term approach to drought management and planning. Countries and states or provincial authorities that have adopted this approach is presented as case studies. This process is timely, given the declaration of the 1990s as the International Decade for Natural Disaster Reduction and the recent International Convention to Combat Desertification and Drought (June, 1994), an offshoot of deliberations at the United Nations Conference on Environment and Development.

  9. Economics and societal impacts of tornadoes

    NASA Astrophysics Data System (ADS)

    Bluestein, Howard B.


    During the spring of 2011, there were a record number of unusually strong and devastating tornadoes in the United States, which killed more than 500 people, the most in the country since 1953. Tornadoes are responsible for more than $1 billion annually (adjusted to 2007 U.S. dollars) in property damage and for disrupting thousands of lives and businesses. The most notable tornado this past spring devastated Joplin, Mo.; tornadoes also struck such diverse locations as Springfield, Mass.; Tuscaloosa, Ala.; Raleigh, N. C.; communities near Oklahoma City, Okla.; Minneapolis, Minn.; central and east Texas; Philadelphia, Pa.; and St. Louis, Mo. It is therefore timely to assess the economic and societal impacts of tornadoes. In this book the authors use various statistical techniques to evaluate the cost of tornadoes to society. They begin by reviewing the methodologies of formulating a tornado climatology across diverse regions according to tornado intensity, deaths, injuries, and property damage, and they then provide a history of the U.S. National Weather Service's (NWS) public warning efforts, describe tornado shelters and how the public responds to warnings, and suggest ways to reduce tornado risk.

  10. Risk management: Role of societal factors in major industrial accidents

    SciTech Connect

    Hovden, J.; Rausand, M. [Norwegian Inst. of Technology, Trondheim (Norway); Sergeev, G.


    The paper discusses factors influencing the occurrence of major accidents in complex technological systems. Societal factors are identified as most significant in this context. Important types of societal factors are pin-pointed and discussed. The safety situation in the former Soviet Union and in today`s Russian is described. The calamities at Chernobyl, Three Mile Island, and partly also Bhopal are discussed, and the role of societal factors identified. A main point of view is that it is not surprising that these catastrophes happened in the then existing conditions. What is surprising is that they did not happen earlier!

  11. IUS prerelease alignment

    NASA Technical Reports Server (NTRS)

    Evans, F. A.


    Space shuttle orbiter/IUS alignment transfer was evaluated. Although the orbiter alignment accuracy was originally believed to be the major contributor to the overall alignment transfer error, it was shown that orbiter alignment accuracy is not a factor affecting IUS alignment accuracy, if certain procedures are followed. Results are reported of alignment transfer accuracy analysis.

  12. Strategies and Lessons-Learned for the Successful Alignment of Contract Cost with the Contract Budget Base (CBB) within the First Year of Contract Award - 13154

    SciTech Connect

    Mullis, Jay [Oak Ridge Office of Environmental Management, U. S. Department of Energy, EM-90, Post Office Box 2001, Oak Ridge, TN 37831 (United States)] [Oak Ridge Office of Environmental Management, U. S. Department of Energy, EM-90, Post Office Box 2001, Oak Ridge, TN 37831 (United States); Rueter, Ken [URS - CH2M Oak Ridge LLC, Post Office Box 4699, K-1225, MS-7294, Oak Ridge, TN 37831-7294 (United States)] [URS - CH2M Oak Ridge LLC, Post Office Box 4699, K-1225, MS-7294, Oak Ridge, TN 37831-7294 (United States)


    In order to provide a sound basis and foundation for integrated Project and Contract change management, it is imperative to ensure the alignment of the Negotiated Contract Costs (NCC) with the Contract Budget Base (CBB), where CBB is defined as the Performance Measurement Baseline (PMB) plus Management Reserve (MR). The achievement of this alignment assures customer and contractor agreement on scope, requirements, quantities, schedule and cost, which facilitates the identification of change conditions and ultimate agreement on the value of changes to the NCC and the CBB. Delays in contract/CBB true up/reconciliation can negatively effect measurement of project progress, limiting owner understanding of liability, and may result in increased contract disagreements and potential claims. The Department of Energy Oak Ridge Office of Environmental Management (OR-EM) and URS - CH2M Oak Ridge LLC (UCOR) achieved alignment of the NCC with the CBB within 10 months of UCOR taking over work on the East Tennessee Technology Park (ETTP) cleanup contract by: 1. Managing as a discrete project; 2. Establishing expectations and setting tone of interactions; 3. Using personnel experienced with Federal Acquisition Regulation (FAR); 4. Partnering; 5. Establishing ombudsmen. (authors)

  13. Utilizing Earth Observations for Societal Issues

    NASA Technical Reports Server (NTRS)

    Habib, Shahid


    Over the last four decades a tremendous progress has been made in the Earth science space-based remote sensing observations, technologies and algorithms. Such advancements have improved the predictability by providing lead-time and accuracy of forecast in weather, climate, natural hazards, and natural resources. It has further reduced or bounded the overall uncertainties by partially improving our understanding of planet Earth as an integrated system that is governed by non-linear and chaotic behavior. Many countries such as the US, European Community, Japan, China, Russia, India has and others have invested billions of dollars in developing and launching space-based assets in the low earth (LEO) and geostationary (GEO) orbits. However, the wealth of this scientific knowledge that has potential of extracting monumental socio-economic benefits from such large investments have been slow in reaching the public and decision makers. For instance, there are a number of areas such as water resources and availability, energy forecasting, aviation safety, agricultural competitiveness, disaster management, air quality and public health, which can directly take advantage. Nevertheless, we all live in a global economy that depends on access to the best available Earth Science information for all inhabitants of this planet. This presentation discusses a process to transition Earth science data and products for societal needs including NASA's experience in achieving such objectives. It is important to mention that there are many challenges and issues that pertain to a number of areas such as: (1) difficulties in making a speedy transition of data and information from observations and models to relevant Decision Support Systems (DSS) or tools, (2) data and models inter-operability issues, (3) limitations of spatial, spectral and temporal resolution, (4) communication limitations as dictated by the availability of image processing and data compression techniques. Additionally, the most critical element amongst all is the organizational and management boundaries that must be resolved at local, state, national and international levels to implement and realize free flow of such vital information.

  14. Human Initiated Cascading Failures in Societal Infrastructures

    PubMed Central

    Barrett, Chris; Channakeshava, Karthik; Huang, Fei; Kim, Junwhan; Marathe, Achla; Marathe, Madhav V.; Pei, Guanhong; Saha, Sudip; Subbiah, Balaaji S. P.; Vullikanti, Anil Kumar S.


    In this paper, we conduct a systematic study of human-initiated cascading failures in three critical inter-dependent societal infrastructures due to behavioral adaptations in response to a crisis. We focus on three closely coupled socio-technical networks here: (i) cellular and mesh networks, (ii) transportation networks and (iii) mobile call networks. In crises, changes in individual behaviors lead to altered travel, activity and calling patterns, which influence the transport network and the loads on wireless networks. The interaction between these systems and their co-evolution poses significant technical challenges for representing and reasoning about these systems. In contrast to system dynamics models for studying these interacting infrastructures, we develop interaction-based models in which individuals and infrastructure elements are represented in detail and are placed in a common geographic coordinate system. Using the detailed representation, we study the impact of a chemical plume that has been released in a densely populated urban region. Authorities order evacuation of the affected area, and this leads to individual behavioral adaptation wherein individuals drop their scheduled activities and drive to home or pre-specified evacuation shelters as appropriate. They also revise their calling behavior to communicate and coordinate among family members. These two behavioral adaptations cause flash-congestion in the urban transport network and the wireless network. The problem is exacerbated with a few, already occurring, road closures. We analyze how extended periods of unanticipated road congestion can result in failure of infrastructures, starting with the servicing base stations in the congested area. A sensitivity analysis on the compliance rate of evacuees shows non-intuitive effect on the spatial distribution of people and on the loading of the base stations. For example, an evacuation compliance rate of 70% results in higher number of overloaded base stations than the evacuation compliance rate of 90%. PMID:23118847

  15. Aligning Multiword Terms Using a Hybrid Approach

    Microsoft Academic Search

    Arantza Casillas; Raquel Martínez


    In the context of parallel corpus alignment research between a pair of languages with various and important distinguishing\\u000a factors (e.g., structural, lexical, morpho-syntactical), this paper presents an approach that deals with multiword terms alignment.\\u000a Our system, ALINTEC, implements a hybrid strategy that adds various kinds of linguistic knowledge (an aligned corpus at the\\u000a sentence level, POS tagging, grammatical patterns, and

  16. Strategis

    NSDL National Science Digital Library


    Strategis is a web site developed by Industry Canada to provide business information resources to Canadian businesses. Resources available include a searchable database of Canadian companies, business information for each sector, a list of business support services, and a guide to business laws and regulation. The International Business Information Network offers information about business opportunities abroad; Trade Data Online provides Canadian and US trade data. A collection of research publications by Industry Canada and monthly economic indicators on the economy are additional economic resources found at this site. Users can view this site in French or English.

  17. Optimal alignments in linear space

    Microsoft Academic Search

    Eugene W. Myers; Webb Miller


    Space, not time, is often the limiting factor when computing optimal sequence alignments, and a number of recent papers in the biology literature have proposed space-saving strategies. How- ever, a 1975 computer science paper by Hirschberg presented a method that is superior to the newer proposals, both in theory and in practice. The goal of this note is to give

  18. Assessing the impact on chronic disease of incorporating the societal cost of greenhouse gases into the price of food: an econometric and comparative risk assessment modelling study

    PubMed Central

    Briggs, Adam D M; Kehlbacher, Ariane; Tiffin, Richard; Garnett, Tara; Rayner, Mike; Scarborough, Peter


    Objectives To model the impact on chronic disease of a tax on UK food and drink that internalises the wider costs to society of greenhouse gas (GHG) emissions and to estimate the potential revenue. Design An econometric and comparative risk assessment modelling study. Setting The UK. Participants The UK adult population. Interventions Two tax scenarios are modelled: (A) a tax of £2.72/tonne carbon dioxide equivalents (tCO2e)/100?g product applied to all food and drink groups with above average GHG emissions. (B) As with scenario (A) but food groups with emissions below average are subsidised to create a tax neutral scenario. Outcome measures Primary outcomes are change in UK population mortality from chronic diseases following the implementation of each taxation strategy, the change in the UK GHG emissions and the predicted revenue. Secondary outcomes are the changes to the micronutrient composition of the UK diet. Results Scenario (A) results in 7770 (95% credible intervals 7150 to 8390) deaths averted and a reduction in GHG emissions of 18?683 (14?665to 22?889) ktCO2e/year. Estimated annual revenue is £2.02 (£1.98 to £2.06) billion. Scenario (B) results in 2685 (1966 to 3402) extra deaths and a reduction in GHG emissions of 15?228 (11?245to 19?492) ktCO2e/year. Conclusions Incorporating the societal cost of GHG into the price of foods could save 7770 lives in the UK each year, reduce food-related GHG emissions and generate substantial tax revenue. The revenue neutral scenario (B) demonstrates that sustainability and health goals are not always aligned. Future work should focus on investigating the health impact by population subgroup and on designing fiscal strategies to promote both sustainable and healthy diets. PMID:24154517

  19. Teacher Perception of the Alignment of Enhancing Missouri's Instructional Networked Teaching Strategies (eMINTS) with the National Staff Development Council (NSDC) Standards

    ERIC Educational Resources Information Center

    Stanfill, Diana L.


    This study used the National Staff Development Council (NSDC) standards for staff development as a framework for measuring specific aspects of the enhancing Missouri's Instructional Networked Teaching Strategies (eMINTS) educational technology professional development program, as perceived by eMINTS teachers. The Technology Integration Cycle…

  20. Union of Science and Societal Objectives: Why Did CLARREO Resonate with NRC Decadal Survey Priorities?

    NASA Astrophysics Data System (ADS)

    Anderson, J. G.; Dykema, J. A.; Gero, J.; Leroy, S. S.; Revercomb, H. E.; Tobin, D. C.; Best, F. A.


    The NRC Decadal Survey prioritization process for the Earth sciences involved eight criteria: (1) Contribution to the most important scientific questions facing Earth sciences today (scientific merit, discovery, exploration). (2) Contribution to applications and policy making (societal benefits). (3) Contribution to long-term observational record of the Earth. (4) Ability to complement other observational systems, including national and international plans. (5) Affordability (cost considerations, either total costs for mission or costs per year). (6) Degree of readiness (technical, resources, people). (7) Risk mitigation and strategic redundancy (backup of other critical systems). (8) Significant contribution to more than one thematic application or scientific discipline. CLARREO addresses key societal objectives closely related to key scientific questions that include: (1) the essential responsibility to present and future generations to put in place a benchmark climate record that is global, accurate in perpetuity, tested against independent strategies that reveal systematic errors, and pinned to international standards; (2) the development of an operational climate forecast that is tested and trusted through a disciplined strategy using state-of-the-art observations with mathematically rigorous techniques to systematically improve those forecasts to establish credibility. The means by which these objectives are addressed by CLARREO are presented.

  1. DNA Align Editor: DNA Alignment Editor Tool

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The SNPAlignEditor is a DNA sequence alignment editor that runs on Windows platforms. The purpose of the program is to provide an intuitive, user-friendly tool for manual editing of multiple sequence alignments by providing functions for input, editing, and output of nucleotide sequence alignments....

  2. Societal Influences on Health and Life-styles

    PubMed Central

    Ulmer, David D.


    Strong sociocultural forces affect individual attitudes toward health and choice of life-style. Economic deprivation fosters negative health behaviors. Positive health habits are reinforced by discrete societal groups. The news media, particularly television, disseminate much useful health information, though the overall educational value is diminished by the content of commercial messages and programming. The automobile is a major societal influence, but neither individual drivers nor the car manufacturers give enough priority to highway safety, leaving that role to governmental regulation. American industry is becoming a positive influence in the encouragement of good health habits, and fashion is lately an important ally in personal health maintenance. PMID:6523860

  3. Societal influences on health and life-styles.


    Ulmer, D D


    Strong sociocultural forces affect individual attitudes toward health and choice of life-style. Economic deprivation fosters negative health behaviors. Positive health habits are reinforced by discrete societal groups. The news media, particularly television, disseminate much useful health information, though the overall educational value is diminished by the content of commercial messages and programming. The automobile is a major societal influence, but neither individual drivers nor the car manufacturers give enough priority to highway safety, leaving that role to governmental regulation. American industry is becoming a positive influence in the encouragement of good health habits, and fashion is lately an important ally in personal health maintenance. PMID:6523860

  4. Biodiesel and Integrated STEM: Vertical Alignment of High School Biology/Biochemistry and Chemistry

    ERIC Educational Resources Information Center

    Burrows, Andrea C.; Breiner, Jonathan M.; Keiner, Jennifer; Behm, Chris


    This article explores the vertical alignment of two high school classes, biology and chemistry, around the core concept of biodiesel fuel production. High school teachers and university faculty members investigated biodiesel as it relates to societal impact through a National Science Foundation Research Experience for Teachers. Using an action…

  5. Anticipating the Future, Influencing the Present: Assessing the Societal Implications of Emerging Technologies

    NASA Astrophysics Data System (ADS)

    Michelson, Evan S.

    A growing challenge for the American policymaking system is to respond effectively to a wide range of interconnected, complex, long-term science and technology issues. Simultaneously, current approaches and institutions of governance are ill suited to address these multidimensional challenges. As the next generation of innovations in science and technology is arriving at an accelerating rate, the governance system is lagging behind. This realization leads to a vital overarching consideration that steers this study: What approaches are well suited to anticipate the longer-term societal implications of emerging technologies in the 21st Century? This study identifies and examines strategies for anticipating the longer-term societal implications of emerging technologies by way of a qualitative case study. It explores one area of technology (nanotechnology), in one particular governance system (the United States), and with a focus on one high profile non-governmental organization (NGO) involved in addressing a range of nanotechnology's societal and policy implications: the Project on Emerging Nanotechnologies (PEN). Based at the Woodrow Wilson International Center for Scholars, PEN's goal was to ensure "that as nanotechnologies advance, possible risks are minimized, public and consumer engagement remains strong, and the potential benefits of these new technologies are realized." The conceptual framework of anticipatory governance guides the research, which offers a real-world example about how anticipatory governance applies in the nongovernmental sector and shows how this idea links to broader theoretical debates about the policymaking process. The study's main conclusion is that PEN utilized a set of interconnected strategies related to advancing foresight, operating in a boundary-spanning role, and promoting communications and public engagement in its attempt to influence, anticipate, and shape the societal implications of emerging technologies. The findings are informed by evidence from a range of sources, including document analysis, semi-structured interviews, and multiple media analyses. Finally, this study highlights a set of cross-cutting, transferable lessons that can be applied as future emerging technologies arise over time. The intention is that the insights gained from this study can help address these pressing issues as they rapidly unfold.

  6. Increasing Influence of Societal Response Variables in Coastal Evolution Projections (Invited)

    NASA Astrophysics Data System (ADS)

    Gayes, P. T.; McCoy, C. A.; Pietrafesa, L. J.


    Recent efforts to project changes in coastal erosion and vulnerability of the state of South Carolina’s (SC’s) oceanfront for different scenarios of future sea level have reinforced the significance of the influence of societal modifications and response to past and anticipated coastal change in these systems. For large reaches of the SC coast human interactions have been a dominant signal driving coastal change across annual to decadal scales. Over the last 20 years, SC’s shoreline has been advanced seawards in many areas due to a combination of sustained societal commitment to beach nourishment and to a lull in atmospheric storms; reversing the long-term erosional trend of shoreline change. Adjacent areas not yet threatened or where coastal defense is unsupported economically have continued to migrate landwards. Locally, efforts focused on stabilizing the subaerial beach have not moderated long-term shoreward migration of the shoreface changing the overall morphology of the coastal boundary waves and currents are operating against. These societal effects, coupled with realistic, substative assessments of future atmospheric storm activity and sea level variability, both over scales of seasons to multi-decades, require consideration to realistically project future coastal behavior across time and spatial scales for planning and resource management. As with future climate and sea level variability effects on the shoreline, the scale and intensity of societal response is not static or precisely projected spatially and temporally into the future. With continued expansion of coastal development and erosion into previously lightly developed and defended coastal areas, societal influences should be expected to increase. Increasing cost of larger scale defenses will likely drive pressure for hardened structures to enhance ”softer” nourishment strategies. However, this strategy would further modify the ability of nature to respond to natural forces. Nourishment programs are strongly cyclic and can act in or out of phase with natural cyclic (inlet migration, sea level variability) or stochastic (storms) drivers with significant effects on coastal response and predictions of coastal behavior. Economic cycles and events may similarly moderate timing and scale of coastal defense relative to natural drivers. Societal decisions to not, enhance and or even abandon and remove existing engineering structures as future forces and costs increase, can result in a disproportional response and potentially failure of a section of coast. Some communities have expressed confidence in the ability to maintain the oceanfront shoreline against most projections of sea level rise over the next 100 years. The long-term trend in sea level change may be less important than naturally occurring regional scale, seasonal to inter-annual to multi-decadal variability in sea level; and these are complex but deterministic. There is less confidence, however, in the ability to combat passive submergence and associated flooding issues behind the immediate oceanfront. To the extent that may influence commitment to defend the oceanfront could strongly influence coastal behavior and stability in the long term.

  7. Physical, Ecological, and Societal Indicators for the National Climate Assessment

    NASA Astrophysics Data System (ADS)

    O'Brien, S.; Kenney, M.; Chen, R. S.; Baptista, S. R.; Quattrochi, D. A.


    The National Climate Assessment (NCA) is being conducted under the auspices of the U.S. Global Change Research Program (USGCRP), pursuant to the Global Change Research Act of 1990, Section 106, which requires a report to Congress every 4 years. The current NCA ( differs in multiple ways from previous U.S. climate assessment efforts, being: (1) more focused on supporting the Nation's activities in adaptation and mitigation and on evaluating the current state of scientific knowledge relative to climate impacts and trends; (2) a long-term, consistent process for evaluation of climate risks and opportunities and providing information to support decision-making processes within regions and sectors; and (3) establishing a permanent assessment capacity both inside and outside of the federal government. As a part of ongoing, long-term assessment activities, the NCA intends to develop an integrated strategic framework and deploy climate-relevant physical, ecological, and societal indicators. The NCA indicators framework is underdevelopment by the NCA Development and Advisory Committee Indicators Working Group and are envisioned as a relatively small number of policy-relevant integrated indicators designed to provide a consistent, objective, and transparent overview of major variations in climate impacts, vulnerabilities, adaptation, and mitigation activities across sectors, regions, and timeframes. The potential questions that could be addressed by these indicators include: -How do we know that there is a changing climate and how is it expected to change in the future? -Are important climate impacts and opportunities occurring or predicted to occur in the future? -Are we adapting successfully? -What are the vulnerabilities and resiliencies given a changing climate? -Are we preparing adequately for extreme events? It is not expected that the NCA indicators would be linked directly to a single decision or portfolio of decisions, but subsets of indicators, or the data supporting the indicator, might be used to inform decision-making processes such as the development and implementation of climate adaptation strategies in a particular sector or region.

  8. Beyond Climate and Weather Science: Expanding the Forecasting Family to Serve Societal Needs

    NASA Astrophysics Data System (ADS)

    Barron, E. J.


    The ability to "anticipate" the future is what makes information from the Earth sciences valuable to society - whether it is the prediction of severe weather or the future availability of water resources in response to climate change. An improved ability to anticipate or forecast has the potential to serve society by simultaneously improving our ability to (1) promote economic vitality, (2) enable environmental stewardship, (3) protect life and property, as well as (4) improve our fundamental knowledge of the earth system. The potential is enormous, yet many appear ready to move quickly toward specific mitigation and adaptation strategies assuming that the science is settled. Five important weakness must be addressed first: (1) the formation of a true "climate services" function and capability, (2) the deliberate investment in expanding the family of forecasting elements to incorporate a broader array of environmental factors and impacts, (3) the investment in the sciences that connect climate to society, (4) a deliberate focus on the problems associated with scale, in particular the difference between the scale of predictive models and the scale associated with societal decisions, and (5) the evolution from climate services and model predictions to the equivalent of "environmental intelligence centers." The objective is to bring the discipline of forecasting to a broader array of environmental challenges. Assessments of the potential impacts of global climate change on societal sectors such as water, human health, and agriculture provide good examples of this challenge. We have the potential to move from a largely reactive mode in addressing adverse health outcomes, for example, to one in which the ties between climate, land cover, infectious disease vectors, and human health are used to forecast and predict adverse human health conditions. The potential exists for a revolution in forecasting, that entrains a much broader set of societal needs and solutions. The argument is made that (for example) the current capabilities in the prediction of environmental health is similar to the capabilities (and potential) of weather forecasting in the 1960's.

  9. Examining the Societal Impacts of Nanotechnology through Simulation: NANO SCENARIO

    ERIC Educational Resources Information Center

    Jarmon, Leslie; Keating, Elizabeth; Toprac, Paul


    This article describes a university-sponsored experiential-based simulation, the NANO SCENARIO, to increase the public's awareness and affect attitudes on the societal implications of nanoscience and nanotechnology by bringing together diverse stakeholders' perspectives in a participatory learning environment. Nanotechnology has the potential for…

  10. Improving Societal Outcomes of Extreme Weather in a

    E-print Network

    Neff, Jason

    Improving Societal Outcomes of Extreme Weather in a Changing Climate: An Integrated Perspective Despite hazard mitigation efforts and scientific and technological ad- vances, extreme weather events continue to cause substantial losses. The impacts of extreme weather result from complex interactions among

  11. White University Students' Responses to Societal Racism: A Qualitative Investigation

    ERIC Educational Resources Information Center

    Spanierman, Lisa A.; Oh, Euna; Poteat, V. Paul; Hund, Anita R.; McClair, Vetisha L.; Beer, Amanda M.; Clarke, Alexis M.


    The purpose of this investigation was to extend earlier conceptual and empirical literature on the ways in which White individuals respond to societal racism. To this end, the authors conducted in-depth interviews to examine 11 midwestern, non-Hispanic, White university students' reactions and experiences related to individual and institutional…

  12. Religious Influences on Personal and Societal Well-being

    Microsoft Academic Search

    Andrew Eungi Kim


    This paper examines religious influences on personal and societal well-being in South Korea by systematically analyzing recent research on the topic, and by comparing the findings with those of other countries, especially those of North America, to assess similarities and differences. In concert with generally accepted findings elsewhere, the paper shows that Koreans with religious faith generally have higher levels

  13. University Significant Cultural & Societal Issues Communicated Through Visual Awareness Imagery

    Microsoft Academic Search

    Denise Anne Humphrey


    Significant cultural and societal issues were documented through the use of simple, graphic, visual poster graphics. The five initial topics were AIDS, alcoholism, homophobia, racism, and sexual harassment. It was the primary goal of the project to gain attention from students who are overwhelmed by advertisement paraphernalia. All of the issues relate to the campus community in which self respect

  14. Interpersonal Communication, Human Interaction and Societal Relationships in Islam

    Microsoft Academic Search

    Rahman O. Olayiwola


    This paper seeks to propagate the idea that Islam is a communicative religion. Allah is communicative God Who takes keen interest in the affairs of His creatures. Interpersonal communication, human interaction and societal relationships in Islam are two way processes of sharing ideas and concerns in open and free environments of love and dedication. The paper is a discussion on

  15. Character and Citizenship Education: Conversations between Personal and Societal Values

    ERIC Educational Resources Information Center

    Sim, Jasmine B.-Y.; Low, Ee Ling


    The theme of this special issue is "Character and Citizenship Education: Conversations between Personal and Societal Values." Character education and citizenship education, taken separately or as a single entity are currently riding high on the political and educational policy agendas of several governments (Arthur, 2003; Berkowitz & Bier, 2007;…

  16. Societal acceptance of carbon capture and storage technologies

    Microsoft Academic Search

    Klaas van Alphen; Quirine van Voorst tot Voorst; Marko P. Hekkert; Ruud E. H. M. Smits


    For the actual implementation of carbon capture and storage (CCS) technologies, societal support is a crucial precondition. This paper describes an extensive study on the acceptance of CCS by stakeholders in the Netherlands and explores one of the determining factors in the acceptance of CCS by the lay public, i.e. the way the Dutch press perceives and portrays CCS. The

  17. Taking a Societal Sector Perspective on Youth Learning and Development

    ERIC Educational Resources Information Center

    McLaughlin, Milbrey; London, Rebecca A.


    A societal sector perspective looks to a broad array of actors and agencies responsible for creating the community contexts that affect youth learning and development. We demonstrate the efficacy of this perspective by describing the Youth Data Archive, which allows community partners to define issues affecting youth that transcend specific…

  18. Education in Alberta: Some Major Societal Trends. Revised.

    ERIC Educational Resources Information Center

    Alberta Dept. of Education, Edmonton. Planning and Policy Secretariat.

    The major societal trends happening in Alberta, Canada, have an impact on educational effectiveness in the region. Statistics are provided in the areas of demographics, family and society, Alberta's youth, labor force, and advances in science and technology. The section on demographics includes data on population growth, births, fertility rates,…

  19. The societal costs of intracerebral hemorrhage in Spain.


    Navarrete-Navarro, P; Hart, W M; Lopez-Bastida, J; Christensen, M C


    This study estimates the lifetime societal costs associated with incident intracerebral hemorrhage (ICH) in Spain. An epidemiological model of ICH incidence, survival and morbidity was developed using retrospective data from 28 hospitals in Andalusia and published data identified in a systematic literature review. Data on resource utilization and costs were obtained from five hospitals in the Canary Islands, whereas cost of outpatient care, informal care and lost productivity were obtained from standardized questionnaires completed by survivors of ICH. The lifetime societal costs of incident ICH in Spain is estimated at 46,193 euros per patient. Direct medical costs accounted for 32.7% of lifetime costs, whilst 67.3% were related to indirect costs. One-third of direct medical costs over the first year were attributable to follow-up care, including rehabilitation. Indirect costs were dominated by costs of informal care (71.2%). The aggregated lifetime societal costs for the estimated 12,534 Spanish patients with a first-ever ICH in 2004 was 579 million euros. ICH implies substantial costs to society primarily due to formal and informal follow-up care and support needed after hospital discharge. Interventions that offer survival benefits without improving patients' functional status are likely to further increase the societal costs of ICH. PMID:17437616

  20. Teachers' Conceptions about Their Understanding of Societal Science Issues.

    ERIC Educational Resources Information Center

    Martins, Isabel P.

    Teachers' scientific knowledge about societal science issues must be one of the prerequisites for the process of science teaching. Innovation in science teaching and its implications for students' scientific literacy depends on the understanding that teachers bring with them into the classroom. The purpose of this study was to investigate how…

  1. Major National Societal Trends Likely to Affect the Marin Community Colleges through the Year 2000. Societal Factors Affecting Education.

    ERIC Educational Resources Information Center

    Stetson, Nancy E.

    Societal trends likely to affect the Marin Community Colleges (MCC) through the year 2000 are examined in this study of college planning for the next 5 years. Following information on the background, significance, and procedures of the study, a review is presented of six publications, selected for their particular relevance to the community…

  2. Societal Risk Management (SRM) Faculty Department of Civil and Environmental Engineering

    E-print Network

    Minsker, Barbara S.

    1 Societal Risk Management (SRM) Faculty Department of Civil and Environmental Engineering Management The listings below highlight courses that the Societal Risk Management (SRM) Faculty deem) CEE 498 SRM Societal Risk Management Elective course Elective course Elective course Summer (take one

  3. The Influence Factors and Mechanism of Societal Risk Perception

    Microsoft Academic Search

    Rui Zheng; Kan Shi; Shu Li


    Risk perception is one of important subjects in management psychology and cognitive psychology. It is of great value in the\\u000a theory and practice to investigate the societal hazards that the public cares a lot especially in Socio-economic transition\\u000a period. A survey including 30 hazards and 6 risk attributes was designed and distributed to about 2, 485 residents of 8 districts,

  4. STELLAR: fast and exact local alignments

    PubMed Central


    Background Large-scale comparison of genomic sequences requires reliable tools for the search of local alignments. Practical local aligners are in general fast, but heuristic, and hence sometimes miss significant matches. Results We present here the local pairwise aligner STELLAR that has full sensitivity for ?-alignments, i.e. guarantees to report all local alignments of a given minimal length and maximal error rate. The aligner is composed of two steps, filtering and verification. We apply the SWIFT algorithm for lossless filtering, and have developed a new verification strategy that we prove to be exact. Our results on simulated and real genomic data confirm and quantify the conjecture that heuristic tools like BLAST or BLAT miss a large percentage of significant local alignments. Conclusions STELLAR is very practical and fast on very long sequences which makes it a suitable new tool for finding local alignments between genomic sequences under the edit distance model. Binaries are freely available for Linux, Windows, and Mac OS X at The source code is freely distributed with the SeqAn C++ library version 1.3 and later at PMID:22151882

  5. Shiva automatic pinhole alignment

    SciTech Connect

    Suski, G.J.


    This paper describes a computer controlled closed loop alignment subsystem for Shiva, which represents the first use of video sensors for large laser alignment at LLNL. The techniques used on this now operational subsystem are serving as the basis for all closed loop alignment on Nova, the 200 terawatt successor to Shiva.

  6. Intervention Strategies for Sexual Abuse.

    ERIC Educational Resources Information Center

    Rencken, Robert H.

    This book provides a framework for understanding the dimensions (scope, taxonomy, philosophy) and dynamics (individual, familial, and societal) of child sexual abuse. The major focus is on integrated intervention strategies for any professional who must work with incomplete information. Chapter 1 provides an overview of the problem of child sexual…

  7. Improved Lexical Alignment by Combining Multiple Reified Alignments

    Microsoft Academic Search

    Dan Tufi; Radu Ion; Alexandru Ceauu

    We describe a word alignment platform which ensures text pre-processing (to- kenization, POS-tagging, lemmatization, chunking, sentence alignment) as re- quired by an accurate word alignment. The platform combines two different methods, producing distinct alignments. The basic word aligners are described in some details and are individually evalu- ated. The union of the individual align- ments is subject to a filtering

  8. Girder Alignment Plan

    SciTech Connect

    Wolf, Zackary; Ruland, Robert; LeCocq, Catherine; Lundahl, Eric; Levashov, Yurii; Reese, Ed; Rago, Carl; Poling, Ben; Schafer, Donald; Nuhn, Heinz-Dieter; Wienands, Uli; /SLAC; ,


    The girders for the LCLS undulator system contain components which must be aligned with high accuracy relative to each other. The alignment is one of the last steps before the girders go into the tunnel, so the alignment must be done efficiently, on a tight schedule. This note documents the alignment plan which includes efficiency and high accuracy. The motivation for girder alignment involves the following considerations. Using beam based alignment, the girder position will be adjusted until the beam goes through the center of the quadrupole and beam finder wire. For the machine to work properly, the undulator axis must be on this line and the center of the undulator beam pipe must be on this line. The physics reasons for the undulator axis and undulator beam pipe axis to be centered on the beam are different, but the alignment tolerance for both are similar. In addition, the beam position monitor must be centered on the beam to preserve its calibration. Thus, the undulator, undulator beam pipe, quadrupole, beam finder wire, and beam position monitor axes must all be aligned to a common line. All relative alignments are equally important, not just, for example, between quadrupole and undulator. We begin by making the common axis the nominal beam axis in the girder coordinate system. All components will be initially aligned to this axis. A more accurate alignment will then position the components relative to each other, without incorporating the girder itself.

  9. Algorithms for Automatic Alignment of Arrays

    NASA Technical Reports Server (NTRS)

    Chatterjee, Siddhartha; Gilbert, John R.; Oliker, Leonid; Schreiber, Robert; Sheffler, Thomas J.


    Aggregate data objects (such as arrays) are distributed across the processor memories when compiling a data-parallel language for a distributed-memory machine. The mapping determines the amount of communication needed to bring operands of parallel operations into alignment with each other. A common approach is to break the mapping into two stages: an alignment that maps all the objects to an abstract template, followed by a distribution that maps the template to the processors. This paper describes algorithms for solving the various facets of the alignment problem: axis and stride alignment, static and mobile offset alignment, and replication labeling. We show that optimal axis and stride alignment is NP-complete for general program graphs, and give a heuristic method that can explore the space of possible solutions in a number of ways. We show that some of these strategies can give better solutions than a simple greedy approach proposed earlier. We also show how local graph contractions can reduce the size of the problem significantly without changing the best solution. This allows more complex and effective heuristics to be used. We show how to model the static offset alignment problem using linear programming, and we show that loop-dependent mobile offset alignment is sometimes necessary for optimum performance. We describe an algorithm with for determining mobile alignments for objects within do loops. We also identify situations in which replicated alignment is either required by the program itself or can be used to improve performance. We describe an algorithm based on network flow that replicates objects so as to minimize the total amount of broadcast communication in replication.

  10. Fairness hypothesis and managing the risks of societal technology choices

    SciTech Connect

    Cantor, R.; Rayner, S.


    Much of the literature on risk perception and management has asked how society should resolve the question, ''How safe is safe enough'' There has been political and technical disagreement over the types of answers that may be given, as well as over the social values attached to perceived probabilities and magnitudes of various outcomes. Despite controversy, there seems to have been a large measure of consensus that, ''How safe is safe enough'' is the right question to ask. This paper sets out to question that assumption. Various ingenious techniques of risk analysis have sought to discover the real risks inherent in various activities, but from a sociocultural viewpoint it can be seen that no single answer can be given to the problem of adequate safety in a complex society which contains a wide variety of perceptual biases about danger, expectations of the good life, and levels of demand for safety. The paper argues that, from a societal risk-management perspective, we should be addressing a different range of questions that views societal risk as a whole rather than as the sum of individual hazards. Resolving the question, ''How safe is safe enough'' is less important in making societal technology choices than ''How fair is safe enough.'' A recent empirical pilot study is reported which explored the fairness hypotheses in the context of nuclear power. The results indicate that the process of technology choice should recognize explicitly the preferred principles different parties hold with respect to obtaining consent from those affected by the risks, distributing the liabilities, and justifying trust in the relevant institutions. The paper closes with a discussion of future prospects for the fairness approach in areas such as noxious facility siting.

  11. Aligning parallel arrays to reduce communication

    NASA Technical Reports Server (NTRS)

    Sheffler, Thomas J.; Schreiber, Robert; Gilbert, John R.; Chatterjee, Siddhartha


    Axis and stride alignment is an important optimization in compiling data-parallel programs for distributed-memory machines. We previously developed an optimal algorithm for aligning array expressions. Here, we examine alignment for more general program graphs. We show that optimal alignment is NP-complete in this setting, so we study heuristic methods. This paper makes two contributions. First, we show how local graph transformations can reduce the size of the problem significantly without changing the best solution. This allows more complex and effective heuristics to be used. Second, we give a heuristic that can explore the space of possible solutions in a number of ways. We show that some of these strategies can give better solutions than a simple greedy approach proposed earlier. Our algorithms have been implemented; we present experimental results showing their effect on the performance of some example programs running on the CM-5.

  12. Societal Statistics by virtue of the Statistical Drake Equation

    NASA Astrophysics Data System (ADS)

    Maccone, Claudio


    The Drake equation, first proposed by Frank D. Drake in 1961, is the foundational equation of SETI. It yields an estimate of the number N of extraterrestrial communicating civilizations in the Galaxy given by the product N=Ns×fp×ne×fl×fi×fc×fL, where: Ns is the number of stars in the Milky Way Galaxy; fp is the fraction of stars that have planetary systems; ne is the number of planets in a given system that are ecologically suitable for life; fl is the fraction of otherwise suitable planets on which life actually arises; fi is the fraction of inhabited planets on which an intelligent form of life evolves; fc is the fraction of planets inhabited by intelligent beings on which a communicative technical civilization develops; and fL is the fraction of planetary lifetime graced by a technical civilization. The first three terms may be called "the astrophysical terms" in the Drake equation since their numerical value is provided by astrophysical considerations. The fourth term, fl, may be called "the origin-of-life term" and entails biology. The last three terms may be called "the societal terms" inasmuch as their respective numerical values are provided by anthropology, telecommunication science and "futuristic science", respectively. In this paper, we seek to provide a statistical estimate of the three societal terms in the Drake equation basing our calculations on the Statistical Drake Equation first proposed by this author at the 2008 IAC. In that paper the author extended the simple 7-factor product so as to embody Statistics. He proved that, no matter which probability distribution may be assigned to each factor, if the number of factors tends to infinity, then the random variable N follows the lognormal distribution (central limit theorem of Statistics). This author also proved at the 2009 IAC that the Dole (1964) [7] equation, yielding the number of Habitable Planets for Man in the Galaxy, has the same mathematical structure as the Drake equation. So the number of Habitable Planets follows the lognormal distribution as well. But the Dole equation is described by the first FOUR factors of the Drake equation. Thus, we may "divide" the 7-factor Drake equation by the 4-factor Dole equation getting the probability distribution of the last-3-factor Drake equation, i.e. the probability distribution of the SOCIETAL TERMS ONLY. These we study in detail in this paper, achieving new statistical results about the SOCIETAL ASPECTS OF SETI.

  13. What is acceptable risk: A statistical, ecological or societal value

    SciTech Connect

    Gaudet, C.; Milne, D. [Environment Canada, Hull, Quebec (Canada)


    As the scientific and technical basis for ecological risk assessment improves and the level of uncertainty in estimating risk decreases, the ability to clearly define and agree on a level of acceptable risk seems to be a moving target. Inconsistency in deciding an acceptable level of risk can promote inconsistency in decision-making irrespective of the scientific rigor of the ERA. The authors review approaches to establishing acceptable risk in development of risk-based sediment, soil and water criteria and in guidance on ecological risk assessments, including the role of societal values and economics in driving decisions.

  14. Marketing telehealth to align with strategy.


    Dansky, Kathryn H; Ajello, Jeffrey


    Telehealth is a twenty-first century solution to an old problem-how to deliver quality health services with shrinking resources. Telehealth enables healthcare providers to interact with and monitor patients remotely, thus adding value to service delivery models. On occasion, telehealth can substitute for live encounters, saving time and resources. Furthermore, as the geriatric population increases, telehealth will support independent living by supplementing the existing network of care. To be used most effectively, however, telehealth services must be carefully planned and executed. This study investigated management practices used to promote telehealth services, focusing on strategic goals for adopting telehealth. Interviews with senior managers from 19 home health agencies identified three strategic goals for adopting telehealth: (1) clinical excellence, (2) technological preeminence, and (3) cost containment. Organizational documents were analyzed to determine the extent to which the telehealth program was featured in marketing materials. Documents included the organization's brochure, newspaper ads and articles, and each home health agency's web site. Results showed that marketing practices vary widely but are correlated with motivations to adopt telehealth. The organizations with the highest marketing scores emphasize clinical excellence as a major reason for using telehealth, whereas those with the lowest marketing scores tend to focus on cost containment. Although this study focused on management practices in home health agencies, results are applicable to hospital and outpatient services as well as to other community-based programs. Using a strategic management framework, the authors offer recommendations to help organizations develop effective marketing approaches for telehealth programs. PMID:15729905

  15. Severe Space Weather Events--Understanding Societal and Economic Impacts: A Workshop Report - Extended Summary

    NASA Technical Reports Server (NTRS)


    The effects of space weather on modern technological systems are well documented in both the technical literature and popular accounts. Most often cited perhaps is the collapse within 90 seconds of northeastern Canada's Hydro-Quebec power grid during the great geomagnetic storm of March 1989, which left millions of people without electricity for up to 9 hours. This event exemplifies the dramatic impact that severe space weather can have on a technology upon which modern society critically depends. Nearly two decades have passed since the March 1989 event. During that time, awareness of the risks of severe space weather has increased among the affected industries, mitigation strategies have been developed, new sources of data have become available, new models of the space environment have been created, and a national space weather infrastructure has evolved to provide data, alerts, and forecasts to an increasing number of users. Now, 20 years later and approaching a new interval of increased solar activity, how well equipped are we to manage the effects of space weather? Have recent technological developments made our critical technologies more or less vulnerable? How well do we understand the broader societal and economic impacts of severe space weather events? Are our institutions prepared to cope with the effects of a 'space weather Katrina,' a rare, but according to the historical record, not inconceivable eventuality? On May 22 and 23, 2008, a one-and-a-half-day workshop held in Washington, D.C., under the auspices of the National Research Council's (NRC's) Space Studies Board brought together representatives of industry, the federal government, and the social science community to explore these and related questions. The key themes, ideas, and insights that emerged during the presentations and discussions are summarized in 'Severe Space Weather Events--Understanding Societal and Economic Impacts: A Workshop Report' (The National Academies Press, Washington, D.C., 2008), which was prepared by the Committee on the Societal and Economic Impacts of Severe Space Weather Events: A Workshop. The present document is an expanded summary of that report.

  16. Optical alignment and testing of the Michelle spectrometer

    Microsoft Academic Search

    Eli Ettedgui-Atad; Alistair C. Glasse; T. E. Baillie; Ian R. Bryson; Garry F. Morrison


    We describe the optical alignment and image quality testing of Michelle, the all-reflective mid-IR astronomical spectrometer and imager being built at the Royal Observatory Edinburgh for the UKIRT and GEMINI telescopes. The design strategy called for optical alignment by manufacture, with the only means for adjustment being the machining of sacrificial pads under key optical components. The success of this

  17. Traditional acupuncturists and higher education in Britain: The dual, paradoxical impact of biomedical alignment on the holistic view.


    Givati, Assaf; Hatton, Kieron


    Traditional acupuncturists' quest for external legitimacy in Britain involves the standardization of their knowledge bases through the development of training schools and syllabi, formal educational structures, and, since the 1990s, the teaching of undergraduate courses within (or validated by) Higher Education Institutions (HEIs), a process which entails biomedical alignment of the curriculum. However, as holistic discourses were commonly used as a rhetorical strategy by CAM practitioners to distance themselves from biomedicine and as a source of public appeal, this 'mainstreaming' process evoked practitioners' concerns that their holistic claims are being compromised. An additional challenge is being posed by a group of academics and scientists in Britain who launched an attack on CAM courses taught in HEIs, accusing them of being 'unscientific' and 'non-academic' in nature. This paper explores the negotiation of all these challenges during the formalization of traditional acupuncture education in Britain, with a particular focus on the role of HEIs. The in-depth qualitative investigation draws on several data sets: participant observation in a university validated acupuncture course; in-depth interviews; and documentary analysis. The findings show how, as part of the formalization process, acupuncturists in Britain (re)negotiate their holistic, anti-reductionist discourses and claims in relation to contemporary societal, political and cultural forces. Moreover, the teaching and validation of acupuncture courses by HEIs may contribute to broadening acupuncturists' 'holistic awareness' of societal and cultural influences on individuals' and communities' ill-health. This investigation emphasises the dynamic and context-specific (rather than fixed and essentialized) nature of acupuncture practice and knowledge. PMID:25779622

  18. Gold alignment & internal dissipation

    E-print Network

    A. Lazarian


    The measures of mechanical alignment were obtained for both prolate and oblate grains when their temperature is comparable with grain kinetic energy devided by k, the Boltzmann constant. For such grains, the alignment of angular momentum, J, with the axis of maximal inertia, a, is only partial. This substantially alters the alignment as compared with the results in Lazarian (1995) and Roberge, Hanany & Messinger (1996) obtained on the assumption of perfect alignment. We also describe the Gold alignment when the Barnett dissipation is suppressed and derive an analytical expression which relates the measure of alignment with parameters of grain nonsphericity and the direction of the gas - grain drift. This solution provides the lower limit for the alignment measure, while the upper limit is given by the analytics derived in Lazarian (1994). Using results of a recent study of incomplete internal relaxation in Lazarian & Roberge (1996), we find measures of alignment for the whole range of ratios of grain rotational energy to k over T_s, where T_s is the grain temperature. To describe alignment for mildly supersonic drifts, we suggest an analytical approach which provides good correspondence with the results of direct numerical simulations in Roberge, Hanany & Messinger (1995). We also extend our approach to account for the simultaneous action of the Gold and Davis-Greenstein mechanisms.

  19. Cultural estrangement: the role of personal and societal value discrepancies.


    Bernard, Mark M; Gebauer, Jochen E; Maio, Gregory R


    Study 1 examined whether cultural estrangement arises from discrepancies between personal and societal values (e.g., freedom) rather than from discrepancies in attitudes toward political (e.g., censorship) or mundane (e.g., pizza) objects. The relations between different types of value discrepancies, estrangement, subjective well-being, and need for uniqueness also were examined. Results indicated that personal-societal discrepancies in values and political attitudes predicted estrangement, whereas mundane attitude discrepancies were not related to estrangement. As expected, value discrepancies were the most powerful predictor of estrangement. Value discrepancies were not related to subjective well-being but fulfilled a need for uniqueness. Study 2 replicated the relations between value discrepancies, subjective well-being, and need for uniqueness while showing that a self-report measure of participants' values and a peer-report measure of the participants' values yielded the same pattern of value discrepancies. Together, the studies reveal theoretical and empirical benefits of conceptualizing cultural estrangement in terms of value discrepancies. PMID:16317190

  20. Development of an Updated Societal-Risk Goal for Nuclear Power Safety

    SciTech Connect

    Vicki Bier; Michael Corradini; Robert Youngblood; Caleb Roh; Shuji Liu


    This report briefly summarizes work done in FY 2013 on the subject LDRD. The working hypothesis is that societal disruption should be addressed in a safety goal. This is motivated by the point that the Fukushima disaster resulted in very little public dose, but enormous societal disruption; a goal that addressed societal disruption would fill a perceived gap in the US NRC safety goal structure. This year's work entailed analyzing the consequences of postulated accidents at various reactor sites in the US, specifically with a view to quantifying the number of people relocated and the duration of their relocation, to see whether this makes sense as a measure of societal disruption.

  1. Alignment of whole genomes

    Microsoft Academic Search

    Arthur L. Delcher; Simon Kasif; Robert D. Fleischmann; Jeremy Peterson; Owen White; Steven L. Salzberg


    A new system for aligning whole genome sequences is described. Using an efficient data structure called a suffix tree, the system is able to rapidly align sequences containing millions of nucleotides. Its use is demonstrated on two strains of Mycoplasma tuberculosis, on two less similar species of Mycoplasma bacteria and on two syntenic sequences from human chromosome 12 and mouse

  2. Reifying the Alignments

    Microsoft Academic Search

    Dan TufiÅŸ; Radu Ion; Alexandru CeauÅŸu; Dan ÅžtefÄnescu


    Reification is the process of dealing with abstract entities as if they have a concrete or material existence. A bitext word alignment is a set of links between textual units (phrases or words) which are reciprocal translations. We associate to every link of an alignment a complex object, represented by a featurevalue structure containing information about the linked lexical tokens

  3. Alignment of Optical Maps

    Microsoft Academic Search

    Anton Valouev; Lei Li; Yu-chi Liu; David C. Schwartz; Yi Yang; Yu Zhang; Michael S. Waterman


    We introduce a new scoring method for calculation of alignments of optical maps. Missing cuts, false cuts, and sizing errors present in optical maps are addressed by our alignment score through calculation of corresponding likelihoods. The size error model is derived through the application of Central Limit Theorem and validated by residual plots col- lected from real data. Missing cuts

  4. Alignment of Optical Maps

    Microsoft Academic Search

    Anton Valouev; Lei Li; Yu-chi Liu; David C. Schwartz; Yi Yang; Yu Zhang; Michael S. Waterman


    ABSTRACT We introduce a new scoring method for calculation of alignments of optical maps. Missing cuts, false cuts, and sizing errors present in optical maps are addressed by our alignment score through calculation of corresponding likelihoods. The size error model is derived through the application of Central Limit Theorem and validated by residual plots col- lected from real data. Missing

  5. Text-Translation Alignment

    Microsoft Academic Search

    Martin Kay; Martin Röscheisen


    We present an algorithm for aligning texts with their translations that is based only on internal evidence. The relaxation process rests on a notion of which word in one text corresponds to which word in the other text that is essentially based on the similarity of their distributions. It exploits a partial alignment of the word level to induce a

  6. Fast Statistical Alignment

    Microsoft Academic Search

    Robert K. Bradley; Adam Roberts; Michael Smoot; Sudeep Juvekar; Jaeyoung Do; Colin Dewey; Ian Holmes; Lior Pachter


    We describe a new program for the alignment of multiple biological sequences that is both statistically motivated and fast enough for problem sizes that arise in practice. Our Fast Statistical Alignment program is based on pair hidden Markov models which approximate an insertion\\/deletion process on a tree and uses a sequence annealing algorithm to combine the posterior probabilities estimated from

  7. Sequence alignment Tandy Warnow

    E-print Network


    Sequence alignment CS 394C Tandy Warnow Feb 15, 2012 #12;DNA Sequence Evolution AAGACTTDeletion ...ACCAGTCACCA... #12;Input: unaligned sequences S1 = AGGCTATCACCTGACCTCCA S2 = TAGCTATCACGACCGC S3 = TAGCTGACCGC S4 = TCACGACCGACA #12;Phase 1: Multiple Sequence Alignment S1 = -AGGCTATCACCTGACCTCCA S2 = TAG

  8. Space-based societal applications—Relevance in developing countries

    NASA Astrophysics Data System (ADS)

    Bhaskaranarayana, A.; Varadarajan, C.; Hegde, V. S.


    Space technology has the vast potential for addressing a variety of societal problems of the developing countries, particularly in the areas of communication, education and health sectors, land and water resources management, disaster management and weather forecasting. Both remote sensing and communication technologies can be used to achieve this goal. With its primary emphasis on application of space technology, on an end-to-end basis, towards national development, the Indian Space Programme has distinguished itself as one of the most cost-effective and development-oriented space programmes in the world. Developing nations are faced with the enormous task of carrying development-oriented education to the masses at the lower strata of their societies. One important feature of these populations is their large number and the spread over vast and remote areas of these nations, making the reaching out to them a difficult task. Satellite communication (Satcom) technology offers the unique capability of simultaneously reaching out to very large numbers, spread over vast areas, including the remote corners of the country. It is a strong tool to support development education. India has been amongst the first few nations to explore and put to use the Satcom technology for education and development-oriented services to the rural masses. Most of the developing countries have inadequate infrastructure to provide proper medical care to the rural population. Availability of specialist doctors in rural areas is a major bottleneck. Use of Satcom and information technology to connect rural clinics to urban hospitals through telemedicine systems is one of the solutions; and India has embarked upon an effective satellite-based telemedicine programme. Space technology is also useful in disaster warning and management related applications. Use of satellite systems and beacons for locating the distressed units on land, sea or air is well known to us. Indian Space Research Organisation (ISRO) is already a part of the International initiative called Satellite Aided Search and Rescue System. The programme to set up satellite-based Village Resource Centres (VRCs) across India, for providing a variety of services relevant to the rural communities, is also a unique societal application of space technology. The VRCs are envisaged as single window delivery mechanism for a variety of space-based products and services, such as tele-education; telemedicine; information on natural resources for planning and development at local level; interactive advisories on agriculture, fisheries, land and water resources management, livestock management, etc.; interactive vocational training towards alternative livelihood; e-governance; weather information; etc. This paper describes the various possibilities and potentials of Satcom and Remote Sensing technologies for societal applications. The initiatives taken by Indian Space Research Organisation in this direction are highlighted.

  9. Functional MRI-based lie detection: scientific and societal challenges.


    Farah, Martha J; Hutchinson, J Benjamin; Phelps, Elizabeth A; Wagner, Anthony D


    Functional MRI (fMRI)-based lie detection has been marketed as a tool for enhancing personnel selection, strengthening national security and protecting personal reputations, and at least three US courts have been asked to admit the results of lie detection scans as evidence during trials. How well does fMRI-based lie detection perform, and how should the courts, and society more generally, respond? Here, we address various questions — some of which are based on a meta-analysis of published studies — concerning the scientific state of the art in fMRI-based lie detection and its legal status, and discuss broader ethical and societal implications. We close with three general policy recommendations. PMID:24588019

  10. Factors influencing the alignment of accounting information systems in small and medium sized Malaysian manufacturing firms

    Microsoft Academic Search

    Noor Azizi Ismail; Malcolm King


    The concept of alignment or fit between information technology (IT) and business strategy has been discussed for many years, and strategic alignment is deemed crucial in increasing firm performance. Yet few attempts have been made to investigate the factors that influence alignment, especially in the context of small and medium sized firms (SMEs). This issue is important because results from

  11. The Need for Change in Industrial Arts Based on Societal and Industrial Conditions.

    ERIC Educational Resources Information Center

    Barry, Owen J.

    The author has presented a historical review of societal/industrial conditions affecting the development of manual education to determine if a need for change in industrial arts exists at the present time. Societal conditions, industrial conditions, and the resulting educational response are examined in: Russia (mid-19th century), Sweden (19th…

  12. Knowledge as a Common Good: The Societal Relevance of Scientific Research

    ERIC Educational Resources Information Center

    Bouter, Lex M.


    Universities are, to a large extent, publicly funded. It is reasonable to expect that society should benefit as a result. This means that scientific research should at least have a potential societal impact. Universities and individual researchers should therefore give serious thought to the societal relevance of their research activities and…

  13. EE x96 Writing Assignment Global, Societal, and Contemporary Issues Galen Sasaki August 26, 2010

    E-print Network

    Sasaki, Galen H.

    solutions in a global and societal context. It is important for engineers to understand these impacts so profession. (E.g., current domestic economy, globalization of the economy, global warming, energyEE x96 Writing Assignment Global, Societal, and Contemporary Issues Galen Sasaki August 26

  14. The Societal Dimension in German Science Education--From Tradition towards Selected Cases and Recent Developments

    ERIC Educational Resources Information Center

    Marks, Ralf; Stuckey, Marc; Belova, Nadja; Eilks, Ingo


    This paper reflects the theory and practice of societal-oriented science education in the past and present of German science teaching. Starting from a quite unique German justification for more thorough societal-oriented science education and some historical reflections a model for socio-scientific issues-based science teaching will be presented.…

  15. Societal and Economic Engagement of Universities in Finland: An Evaluation Model

    ERIC Educational Resources Information Center

    Ritsila, Jari; Nieminen, Mika; Sotarauta, Markku; Lahtonen, Jukka


    This paper is based on the work of an expert team invited by the Ministry of Education of Finland to develop criteria and an evaluation framework for societal and economic engagement for use in university performance management. The paper maps out possible indicators for the societal and economic engagement of universities in the light of national…

  16. Societal Culture and Teachers' Responses to Curriculum Reform: Experiences from China

    ERIC Educational Resources Information Center

    Yin, Hong-biao


    Educational change is intrinsically bound to the cultural characteristics of the society. However, the relationship between educational change and societal culture is rarely explored, especially in the context of mainland China. Following a 3-year qualitative research project, the present study explored the influence of societal culture on…

  17. Hybrid vehicle motor alignment


    Levin, Michael Benjamin (Ann Arbor, MI)


    A rotor of an electric motor for a motor vehicle is aligned to an axis of rotation for a crankshaft of an internal combustion engine having an internal combustion engine and an electric motor. A locator is provided on the crankshaft, a piloting tool is located radially by the first locator to the crankshaft. A stator of the electric motor is aligned to a second locator provided on the piloting tool. The stator is secured to the engine block. The rotor is aligned to the crankshaft and secured thereto.

  18. Practical Multiple Sequence Alignment

    NASA Astrophysics Data System (ADS)

    Rausch, Tobias; Reinert, Knut

    Multiple sequence alignment as a means of comparing DNA, RNA, or amino acid sequences is an essential precondition for various analyses, including structure prediction, modeling binding sites, phylogeny, or function prediction. This range of applications implies a demand for versatile, flexible, and specialized methods to compute accurate alignments. This chapter summarizes the key algorithmic insights gained in the past years to facilitate an easy understanding of the current multiple sequence alignment literature and to enable the readers to use and apply current tools in their own research.

  19. Precision alignment device


    Jones, N.E.


    Apparatus for providing automatic alignment of beam devices having an associated structure for directing, collimating, focusing, reflecting, or otherwise modifying the main beam. A reference laser is attached to the structure enclosing the main beam producing apparatus and produces a reference beam substantially parallel to the main beam. Detector modules containing optical switching devices and optical detectors are positioned in the path of the reference beam and are effective to produce an electrical output indicative of the alignment of the main beam. This electrical output drives servomotor operated adjustment screws to adjust the position of elements of the structure associated with the main beam to maintain alignment of the main beam. 5 figs.

  20. libgapmis: extending short-read alignments

    PubMed Central


    Background A wide variety of short-read alignment programmes have been published recently to tackle the problem of mapping millions of short reads to a reference genome, focusing on different aspects of the procedure such as time and memory efficiency, sensitivity, and accuracy. These tools allow for a small number of mismatches in the alignment; however, their ability to allow for gaps varies greatly, with many performing poorly or not allowing them at all. The seed-and-extend strategy is applied in most short-read alignment programmes. After aligning a substring of the reference sequence against the high-quality prefix of a short read--the seed--an important problem is to find the best possible alignment between a substring of the reference sequence succeeding and the remaining suffix of low quality of the read--extend. The fact that the reads are rather short and that the gap occurrence frequency observed in various studies is rather low suggest that aligning (parts of) those reads with a single gap is in fact desirable. Results In this article, we present libgapmis, a library for extending pairwise short-read alignments. Apart from the standard CPU version, it includes ultrafast SSE- and GPU-based implementations. libgapmis is based on an algorithm computing a modified version of the traditional dynamic-programming matrix for sequence alignment. Extensive experimental results demonstrate that the functions of the CPU version provided in this library accelerate the computations by a factor of 20 compared to other programmes. The analogous SSE- and GPU-based implementations accelerate the computations by a factor of 6 and 11, respectively, compared to the CPU version. The library also provides the user the flexibility to split the read into fragments, based on the observed gap occurrence frequency and the length of the read, thereby allowing for a variable, but bounded, number of gaps in the alignment. Conclusions We present libgapmis, a library for extending pairwise short-read alignments. We show that libgapmis is better-suited and more efficient than existing algorithms for this task. The importance of our contribution is underlined by the fact that the provided functions may be seamlessly integrated into any short-read alignment pipeline. The open-source code of libgapmis is available at PMID:24564250

  1. Hierarchical Alignment of Timelines

    NSDL National Science Digital Library

    ilyse resnick

    In the hierarchical alignment activity, students are given multiple opportunities to align time to space in a linear representation. They begin by scaling a familiar amount of time (e.g. a personal time line) to a spatial representation (e.g. a meter stick), and progressively align increasing/decreasing amounts until completing the target unfamiliar time line (e.g. geologic time). For example, in the hierarchical alignment of geologic time, students can work through 10 time lines: personal, human lifespan, American history, Recorded history, human evolution, Cenozoic, Phanerozoic, Proterozoic, Archean, and then Hadean. While the amount of time varies, the amount of space remains constant: in this example, students align all new temporal scales to one meter. For each time line, students are asked to locate specific events, hierarchicaly organized divisions of time, and the length of the time line in order to engage the students in thinking about that temporal scale. Additionally, every time students align a new temporal scale to space, they locate all previous scales relative to the current scale.

  2. PDV Probe Alignment Technique

    SciTech Connect

    Whitworth, T L; May, C M; Strand, O T


    This alignment technique was developed while performing heterodyne velocimetry measurements at LLNL. There are a few minor items needed, such as a white card with aperture in center, visible alignment laser, IR back reflection meter, and a microscope to view the bridge surface. The work was performed on KCP flyers that were 6 and 8 mils wide. The probes used were Oz Optics manufactured with focal distances of 42mm and 26mm. Both probes provide a spot size of approximately 80?m at 1550nm. The 42mm probes were specified to provide an internal back reflection of -35 to -40dB, and the probe back reflections were measured to be -37dB and -33dB. The 26mm probes were specified as -30dB and both measured -30.5dB. The probe is initially aligned normal to the flyer/bridge surface. This provides a very high return signal, up to -2dB, due to the bridge reflectivity. A white card with a hole in the center as an aperture can be used to check the reflected beam position relative to the probe and launch beam, and the alignment laser spot centered on the bridge, see Figure 1 and Figure 2. The IR back reflection meter is used to measure the dB return from the probe and surface, and a white card or similar object is inserted between the probe and surface to block surface reflection. It may take several iterations between the visible alignment laser and the IR back reflection meter to complete this alignment procedure. Once aligned normal to the surface, the probe should be tilted to position the visible alignment beam as shown in Figure 3, and the flyer should be translated in the X and Y axis to reposition the alignment beam onto the flyer as shown in Figure 4. This tilting of the probe minimizes the amount of light from the bridge reflection into the fiber within the probe while maintaining the alignment as near normal to the flyer surface as possible. When the back reflection is measured after the tilt adjustment, the level should be about -3dB to -6dB higher than the probes specified back reflection. This 3 to 6dB increase in back reflection from the surface relative to the probes specified back reflection is the optimal level for acquiring data from the flyer. Data obtained with the LLNL system is shown in Figure 5.

  3. The Jalview Java alignment editor

    Microsoft Academic Search

    Michele E. Clamp; James A. Cuff; Stephen M. J. Searle; Geoffrey J. Barton


    Summary: Multiple sequence alignment remains a crucial method for understanding the function of groups of related nucleic acid and protein sequences. However, it is known that automatic multiple sequence alignments can often be improved by manual editing. Therefore, tools are needed to view and edit multiple sequence alignments. Due to growth in the sequence databases, multiple sequence alignments can often

  4. Societal Adaptation to Decadal Climate Variability in the United States

    NASA Astrophysics Data System (ADS)

    Rosenberg, Norman J.; Mehta, Vikram M.; Olsen, J. Rolf; von Storch, Hans; Varady, Robert G.; Hayes, Michael J.; Wilhite, Donald


    CRCES Workshop on Societal Impacts of Decadal Climate Variability in the United States, 26-28 April 2007, Waikoloa, Hawaii The search for evidence of decadal climatic variability (DCV) has a very long history. In the past decade, a research community has coalesced around a series of roughly biennial workshops that have emphasized description of past DCV events; their causes and their ``teleconnections'' responsible for droughts, floods, and warm and cold spells around the world; and recently, the predictability of DCV events. Researchers studying climate change put great emphasis on prospective impacts, but the DCV community has yet to do so. To begin rectifying this deficiency, a short but ambitious workshop was convened in Waikoloa, near Kona, Hawaii, from 26-28 April 2007. This workshop, sponsored by the Center for Research on the Changing Earth System (CRCES), NOAA, the U.S. Geological Survey, and the U.S. Army Corps of Engineers, brought together climatologists and sectoral specialists representing agriculture, water resources, economics, the insurance industry, and developing country interests.

  5. Societal and economic valuation of technology-transfer deals

    NASA Astrophysics Data System (ADS)

    Holmes, Joseph S., Jr.


    The industrial adoption of concepts such as open innovation brings new legitimacy to activities technology-transfer professionals have conducted for over 20 years. This movement highlights the need for an increased understanding of the valuation of intellectual property (IP) and technology-transfer deals. Valuation, though a centerpiece of corporate finance, is more challenging when applied to the inherent uncertainty surrounding innovation. Technology-transfer professionals are often overwhelmed by the complexity and data requirements of valuation techniques and skeptical of their applicability to and utility for technology transfer. The market longs for an approach which bridges the gap between valuation fundamentals and technology-transfer realities. This paper presents the foundations of a simple, flexible, precise/accurate, and useful framework for considering the valuation of technology-transfer deals. The approach is predicated on a 12-factor model—a 3×4 value matrix predicated on categories of economic, societal, and strategic value. Each of these three categories consists of three core subcategories followed by a fourth "other" category to facilitate inevitable special considerations. This 12-factor value matrix provides a framework for harvesting data during deals and for the application of best-of-breed valuation techniques which can be employed on a per-factor basis. Future work will include framework implementation within a database platform.

  6. Universal Access to E-Mail: Feasibility and Societal Implications

    NSDL National Science Digital Library

    Anderson, Robert H.


    "Universal Access to E-Mail: Feasibility and Societal Implications" by Robert H. Anderson, Tora K. Bikson, Sally Ann Law, and Bridger M. Mitchell; 1995; Rand Corporation; 267 pages, 24 tables, 18 figures; bibliography, is available for downloading from Rand Corporation's Web site. "This is the final report of a two-year RAND study. It is designed as a sourcebook on key social, technical, economic, and international issues related to providing universal access to e-mail within the United States. It is our hope that this report will help stimulate public policy discussions regarding the feasibility, desirability, and implications of universal e-mail access. Decision makers involved with such public policy issues are the primary audience for this report, but it should also be of interest to academic and business professionals involved with telecommunications policy and its social implications." The report is available in both HTML and .PDF (Adobe Acrobat) format. A free Acrobat Reader download site is available from the page.

  7. Alignment telescope for Antares

    SciTech Connect

    Appert, Q.D.; Swann, T.A.; Ward, J.H.; Hardesty, C.; Wright, L.


    The Antares Automatic Alignment System employs a specially designed telescope for alignment of its laser beamlines. There are two telescopes in the system, and since each telescope is a primary alignment reference, stringent boresight accuracy and stability over the focus range were required. Optical and mechanical designs, which meet this requirement as well as that of image quality over a wide wavelength band, are described. Special test techniques for initial assembly and alignment of the telescope are also presented. The telescope, which has a 180-mm aperture FK51-KZF2 type glass doublet objective, requires a boresight accuracy of 2.8 at two focal lengths, and object distances between 11 meters and infinity. Travel of a smaller secondary doublet provides focus from 11 m to infinity with approximately 7.8 m effective focal length. By flipping in a third doublet, the effective focal length is reduced to 2.5 m. Telescope alignment was accomplished by using a rotary air bearing to establish an axis in front of the system and placing the focus of a Laser Unequal Path Interferometer (LUPI) at the image plane.

  8. Aligning Post-Secondary Educational Choices to Societal Needs: A New Scholarship System for Qatar. Technical Report

    ERIC Educational Resources Information Center

    Augustine, Catherine H.; Krop, Cathy


    Qatar is experiencing previously unprecedented social and economic development, linked to increased participation in the global market. Growing employment opportunities for Qatari nationals require greater attention to post-secondary education and the development of specific high-demand skills. Since the 1970s, Qatar has complemented its…

  9. Aligning Post-Secondary Educational Choices to Societal Needs: A New Scholarship System for Qatar. Technical Report Summary

    ERIC Educational Resources Information Center

    Augustine, Catherine H.; Krop, Cathy


    Qatar is experiencing previously unprecedented social and economic development, linked to increased participation in the global market. Growing employment opportunities for Qatari nationals require greater attention to post-secondary education and the development of specific high-demand skills. Since the 1970s, Qatar has complemented its…

  10. Improved docking alignment system

    NASA Technical Reports Server (NTRS)

    Monford, Leo G. (inventor)


    Improved techniques are provided for the alignment of two objects. The present invention is particularly suited for 3-D translation and 3-D rotational alignment of objects in outer space. A camera is affixed to one object, such as a remote manipulator arm of the spacecraft, while the planar reflective surface is affixed to the other object, such as a grapple fixture. A monitor displays in real-time images from the camera such that the monitor displays both the reflected image of the camera and visible marking on the planar reflective surface when the objects are in proper alignment. The monitor may thus be viewed by the operator and the arm manipulated so that the reflective surface is perpendicular to the optical axis of the camera, the roll of the reflective surface is at a selected angle with respect to the camera, and the camera is spaced a pre-selected distance from the reflective surface.

  11. Optics Alignment Panel

    NASA Technical Reports Server (NTRS)

    Schroeder, Daniel J.


    The Optics Alignment Panel (OAP) was commissioned by the HST Science Working Group to determine the optimum alignment of the OTA optics. The goal was to find the position of the secondary mirror (SM) for which there is no coma or astigmatism in the camera images due to misaligned optics, either tilt or decenter. The despace position was reviewed of the SM and the optimum focus was sought. The results of these efforts are as follows: (1) the best estimate of the aligned position of the SM in the notation of HDOS is (DZ,DY,TZ,TY) = (+248 microns, +8 microns, +53 arcsec, -79 arcsec), and (2) the best focus, defined to be that despace which maximizes the fractional energy at 486 nm in a 0.1 arcsec radius of a stellar image, is 12.2 mm beyond paraxial focus. The data leading to these conclusions, and the estimated uncertainties in the final results, are presented.

  12. Segment alignment control system

    NASA Technical Reports Server (NTRS)

    Aubrun, JEAN-N.; Lorell, Ken R.


    The segmented primary mirror for the LDR will require a special segment alignment control system to precisely control the orientation of each of the segments so that the resulting composite reflector behaves like a monolith. The W.M. Keck Ten Meter Telescope will utilize a primary mirror made up of 36 actively controlled segments. Thus the primary mirror and its segment alignment control system are directly analogous to the LDR. The problems of controlling the segments in the face of disturbances and control/structures interaction, as analyzed for the TMT, are virtually identical to those for the LDR. The two systems are briefly compared.

  13. Orientation and Alignment Echoes

    E-print Network

    Karras, G; Billard, F; Lavorel, B; Hartmann, J -M; Faucher, O; Gershnabel, E; Prior, Y; Averbukh, I Sh


    We present what is probably the simplest classical system featuring the echo phenomenon - a collection of randomly oriented free rotors with dispersed rotational velocities. Following excitation by a pair of time-delayed impulsive kicks, the mean orientation/alignment of the ensemble exhibits multiple echoes and fractional echoes. We elucidate the mechanism of the echo formation by kick-induced filamentation of phase space, and provide the first experimental demonstration of classical alignment echoes in a thermal gas of CO_2 molecules excited by a pair of femtosecond laser pulses.

  14. Critical Infrastructure for Ocean Research and Societal Needs in 2030

    SciTech Connect

    National Research Council


    The United States has jurisdiction over 3.4 million square miles of ocean�an expanse greater than the land area of all fifty states combined. This vast marine area offers researchers opportunities to investigate the ocean�s role in an integrated Earth system, but also presents challenges to society, including damaging tsunamis and hurricanes, industrial accidents, and outbreaks of waterborne diseases. The 2010 Gulf of Mexico Deepwater Horizon oil spill and 2011 Japanese earthquake and tsunami are vivid reminders that a broad range of infrastructure is needed to advance our still-incomplete understanding of the ocean. The National Research Council (NRC)�s Ocean Studies Board was asked by the National Science and Technology Council�s Subcommittee on Ocean Science and Technology, comprised of 25 U.S. government agencies, to examine infrastructure needs for ocean research in the year 2030. This request reflects concern, among a myriad of marine issues, over the present state of aging and obsolete infrastructure, insufficient capacity, growing technological gaps, and declining national leadership in marine technological development; issues brought to the nation�s attention in 2004 by the U.S. Commission on Ocean Policy. A 15-member committee of experts identified four themes that encompass 32 future ocean research questions�enabling stewardship of the environment, protecting life and property, promoting economic vitality, and increasing fundamental scientific understanding. Many of the questions in the report (e.g., sea level rise, sustainable fisheries, the global water cycle) reflect challenging, multidisciplinary science questions that are clearly relevant today, and are likely to take decades of effort to solve. As such, U.S. ocean research will require a growing suite of ocean infrastructure for a range of activities, such as high quality, sustained time series observations or autonomous monitoring at a broad range of spatial and temporal scales. Consequently, a coordinated national plan for making future strategic investments becomes an imperative to address societal needs. Such a plan should be based upon known priorities and should be reviewed every 5-10 years to optimize the federal investment. The committee examined the past 20 years of technological advances and ocean infrastructure investments (such as the rise in use of self-propelled, uncrewed, underwater autonomous vehicles), assessed infrastructure that would be required to address future ocean research questions, and characterized ocean infrastructure trends for 2030. One conclusion was that ships will continue to be essential, especially because they provide a platform for enabling other infrastructure � autonomous and remotely operated vehicles; samplers and sensors; moorings and cabled systems; and perhaps most importantly, the human assets of scientists, technical staff, and students. A comprehensive, long-term research fleet plan should be implemented in order to retain access to the sea. The current report also calls for continuing U.S. capability to access fully and partially ice-covered seas; supporting innovation, particularly the development of biogeochemical sensors; enhancing computing and modeling capacity and capability; establishing broadly accessible data management facilities; and increasing interdisciplinary education and promoting a technically-skilled workforce. The committee also provided a framework for prioritizing future investment in ocean infrastructure. They recommend that development, maintenance, or replacement of ocean research infrastructure assets should be prioritized in terms of societal benefit, with particular consideration given to usefulness for addressing important science questions; affordability, efficiency, and longevity; and ability to contribute to other missions or applications. These criteria are the foundation for prioritizing ocean research infrastructure investments by estimating

  15. AMISR in the Africa: Scientific and Societal Importance

    NASA Astrophysics Data System (ADS)

    Damtie, B.; Moldwin, M.; Yizengaw, E.; Coster, A. J.; Hysell, D. L.


    Much of our understanding of equatorial electrodynamics is primarily based on observations from the Jicamarca incoherent scatter radar (ISR) observatory (JRO), the only ISR in the equatorial region. The JRO is located in the American sector that is characterized by the large off-set in the magnetic to geodectic equators and the shift of the magnetic equator from the southern hemisphere to the northern hemisphere. In the African sector, the geomagnetic and geodetic equators are approximately parallel, separated by at most 10 degrees. Data from satellites (e.g. ROCSAT, C/NOFS, DMSP) have indicated that the equatorial ionosphere in the African sector responds differently than other sectors. For example, ionospheric bubbles have been observed to be much deeper and to occur more frequently in the African sector. It has also been reported that ionospheric depletions more frequently rise to higher altitudes (up to 1000+ km) in the African sector than those in other longitude sectors. However, these observations have not been confirmed, validated or studied in detail by observations from the ground due to lack of suitable ground-based instrumentation in Africa. Thus, the causes or driving mechanisms of the unique density irregularities, bubbles, and depletions in the African sector remain unresolved. To address these issues, the U.S. National Science Foundation recently sponsored a workshop that held at Boston College to consider the possibility of relocating an Advanced Modular Incoherent Scatter Radar (AMISR) to Ethiopia. Adding the ISR to the recently growing number of ground-based space science instruments on the continent, such as GPS, magnetometers, VHF, and Ionosonde, would be of significant scientific benefit and have a huge societal impact on the African space science community in particular and the science and engineering fields in general. The primary purpose of this workshop was to define the science goals motivating such a move and to examine the technical and logistical issues involved. This talk will summarize the findings of this workshop.

  16. AlignMe—a membrane protein sequence alignment web server

    PubMed Central

    Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.


    We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at PMID:24753425

  17. AlignMe--a membrane protein sequence alignment web server.


    Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R


    We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at PMID:24753425

  18. 76 FR 70971 - Proposed Information Collection; Comment Request; Societal Response to Tornado Warnings

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...SUMMARY: The National Weather Service, seeking to expand on existing...the societal response to the National Weather Service warning system. The agency currently...from the public regarding how they handle weather related phenomena, specifically...


    E-print Network

    Reichel, Philip L.


    Using the hypothetical natural history model suggested by Spector and Kitsuse, this paper reviews societal reactions to problem children in the nineteenth century. Humanitarian and class interests are highlighted in describing how those reactions...

  20. 76 FR 11437 - Application To Export Electric Energy; Societe Generale Energy Corp.

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...Societe Generale Corporate & Investment Banking, 1221 Avenue of the Americas, New York, NY 10020 and Vincenzo Franco, Van Ness Feldman, P.C., Seventh Floor, Washington, DC 20007. A final decision will be made on this application after the...

  1. How fair is safe enough. The cultural approach to societal technology choice

    SciTech Connect

    Rayner, S.; Cantor, R.


    This paper consists of an argument and a pilot study. First is a general, perhaps philosophical, argument against the National Academy's viewpoint that dealing with risk is a two-stage process consisting of (a) assessment of facts, and (b) evaluation of facts in sociopolitical context. They argue that societal risk intrinsically revolves around social relations as much as around evaluations of probability. Second, they outline one particular approach to analyzing societal risk management styles. They call this the fairness hypothesis. Rather than focusing on probabilities and magnitudes of undesired events, this approach emphasizes societal preferences for principles of achieving consent to a technology, distributing liabilities, and investing trust in institutions. Conflict rather than probability is the chief focus of this approach to societal risk management. This view is illustrated by a recent empirical pilot study that explored the fairness hypothesis in the context of new nuclear technologies.

  2. Societal institutions and HRM practices: an analysis of four European multinational subsidiaries in Bangladesh

    Microsoft Academic Search

    Shamsud D. Chowdhury; Monowar H. Mahmood


    Using the ‘societal-effect’ approach, a variant of the institutional theory developed and tested in Europe, this study investigates the impact of societal institutions on human resource management (HRM) practices of European multinational subsidiaries in Bangladesh, which is now on the list of the Next-11 economies of the world. In-depth case studies of four European multinational subsidiaries revealed the presence of

  3. Societal institutions and HRM practices: an analysis of four European multinational subsidiaries in Bangladesh

    Microsoft Academic Search

    Shamsud D. Chowdhury; Monowar H. Mahmood


    Using the ‘societal-effect’ approach, a variant of the institutional theory developed and tested in Europe, this study investigates the impact of societal institutions on human resource management (HRM) practices of European multinational subsidiaries in Bangladesh, which is now on the list of the Next-11 economies of the world. In-depth case studies of four European multinational subsidiaries revealed the presence of

  4. Pairwise alignment with rearrangements.


    Vinh, Le Sy; Varón, Andrés; Wheeler, Ward C


    The increase of available genomes poses new optimization problems in genome comparisons. A genome can be considered as a sequence of characters (loci) which are genes or segments of nucleotides. Genomes are subject to both nucleotide transformation and character order rearrangement processes. In this context, we define a problem of so-called pairwise alignment with rearrangements (PAR) between two genomes. The PAR generalizes the ordinary pairwise alignment by allowing the rearrangement of character order. The objective is to find the optimal PAR that minimizes the total cost which is composed of three factors: the edit cost between characters, the deletion/insertion cost of characters, and the rearrangement cost between character orders. To this end, we propose simple and effective heuristic methods: character moving and simultaneous character swapping. The efficiency of the methods is tested on Metazoa mitochondrial genomes. Experiments show that, pairwise alignments with rearrangements give better performance than ordinary pairwise alignments without rearrangements. The best proposed method, simultaneous character swapping, is implemented as an essential subroutine in our software POY version 4.0 to reconstruct genome-based phylogenies. PMID:17503387

  5. Optically Aligned Drill Press

    NASA Technical Reports Server (NTRS)

    Adderholdt, Bruce M.


    Precise drill press equipped with rotary-indexing microscope. Microscope and drill exchange places when turret rotated. Microscope axis first aligned over future hole, then rotated out of way so drill axis assumes its precise position. New procedure takes less time to locate drilling positions and produces more accurate results. Apparatus adapted to such other machine tools as milling and measuring machines.

  6. (Reverse) engineering vacuum alignment

    Microsoft Academic Search

    Clifford Cheung; Jesse Thaler


    In the presence of spontaneous symmetry breaking, the alignment of the vacuum with respect to the gauge group is often controlled by quadratically divergent operators in the low energy non-linear sigma model. In principle the magnitudes and signs of these operators can be changed by making different assumptions about the ultraviolet physics, but in practice all known ways of regulating

  7. GASOLINE: a Cytoscape app for multiple local alignment of PPI networks

    PubMed Central

    Micale, Giovanni; Continella, Andrea; Ferro, Alfredo; Giugno, Rosalba; Pulvirenti, Alfredo


    Comparing protein interaction networks can reveal interesting patterns of interactions for a specific function or process in distantly related species. In this paper we present GASOLINE, a Cytoscape app for multiple local alignments of PPI (protein-protein interaction) networks. The app is based on the homonymous greedy and stochastic algorithm. GASOLINE starts with the identification of sets of similar nodes, called seeds of the alignment. Alignments are then extended in a greedy manner and finally refined. Both the identification of seeds and the extension of alignments are performed through an iterative Gibbs sampling strategy. GASOLINE is a Cytoscape app for computing and visualizing local alignments, without requiring any post-processing operations. GO terms can be easily attached to the aligned proteins for further functional analysis of alignments. GASOLINE can perform the alignment task in few minutes, even for a large number of input networks. PMID:25324964

  8. Nuclear reactor alignment plate configuration


    Altman, David A; Forsyth, David R; Smith, Richard E; Singleton, Norman R


    An alignment plate that is attached to a core barrel of a pressurized water reactor and fits within slots within a top plate of a lower core shroud and upper core plate to maintain lateral alignment of the reactor internals. The alignment plate is connected to the core barrel through two vertically-spaced dowel pins that extend from the outside surface of the core barrel through a reinforcement pad and into corresponding holes in the alignment plate. Additionally, threaded fasteners are inserted around the perimeter of the reinforcement pad and into the alignment plate to further secure the alignment plate to the core barrel. A fillet weld also is deposited around the perimeter of the reinforcement pad. To accomodate thermal growth between the alignment plate and the core barrel, a gap is left above, below and at both sides of one of the dowel pins in the alignment plate holes through with the dowel pins pass.

  9. Critical Infrastructure for Ocean Research and Societal Needs in 2030

    NASA Astrophysics Data System (ADS)

    Glickson, D.; Barron, E. J.; Fine, R. A.; Bellingham, J. G.; Boss, E.; Boyle, E. A.; Edwards, M.; Johnson, K. S.; Kelley, D. S.; Kite-Powell, H.; Ramberg, S. E.; Rudnick, D. L.; Schofield, O.; Tamburri, M.; Wiebe, P. H.; Wright, D. J.; Committee on an Ocean Infrastructure StrategyU. S. Ocean Research in 2030


    At the request of the Subcommittee on Ocean Science and Technology, an expert committee was convened by the National Research Council to identify major research questions anticipated to be at the forefront of ocean science in 2030, define categories of infrastructure that should be included in planning, provide advice on criteria and processes that could be used to set priorities, and recommend ways to maximize the value of investments in ocean infrastructure. The committee identified 32 future ocean research questions in four themes: enabling stewardship of the environment, protecting life and property, promoting economic vitality, and increasing fundamental scientific understanding. Many of the questions reflect challenging, multidisciplinary science questions that are clearly relevant now and are likely to take decades to solve. U.S. ocean research will require a growing suite of ocean infrastructure for a range of activities, such as high quality, sustained time series observations and autonomous monitoring at a broad range of spatial and temporal scales. A coordinated national plan for making future strategic investments will be needed and should be based upon known priorities and reviewed every 5-10 years. After assessing trends in ocean infrastructure and technology development, the committee recommended implementing a comprehensive, long-term research fleet plan in order to retain access to the sea; continuing U.S. capability to access fully and partially ice-covered seas; supporting innovation, particularly the development of biogeochemical sensors; enhancing computing and modeling capacity and capability; establishing broadly accessible data management facilities; and increasing interdisciplinary education and promoting a technically-skilled workforce. They also recommended that development, maintenance, or replacement of ocean research infrastructure assets should be prioritized in terms of societal benefit. Particular consideration should be given to usefulness for addressing important science questions; affordability, efficiency, and longevity; and ability to contribute to other missions or applications. Estimating the economic costs and benefits of each potential infrastructure investment using these criteria would allow funding of investments that produce the largest expected net benefit over time.

  10. MUSE alignment onto VLT

    NASA Astrophysics Data System (ADS)

    Laurent, Florence; Renault, Edgard; Boudon, Didier; Caillier, Patrick; Daguisé, Eric; Dupuy, Christophe; Jarno, Aurélien; Lizon, Jean-Louis; Migniau, Jean-Emmanuel; Nicklas, Harald; Piqueras, Laure


    MUSE (Multi Unit Spectroscopic Explorer) is a second generation Very Large Telescope (VLT) integral field spectrograph developed for the European Southern Observatory (ESO). It combines a 1' x 1' field of view sampled at 0.2 arcsec for its Wide Field Mode (WFM) and a 7.5"x7.5" field of view for its Narrow Field Mode (NFM). Both modes will operate with the improved spatial resolution provided by GALACSI (Ground Atmospheric Layer Adaptive Optics for Spectroscopic Imaging), that will use the VLT deformable secondary mirror and 4 Laser Guide Stars (LGS) foreseen in 2015. MUSE operates in the visible wavelength range (0.465-0.93 ?m). A consortium of seven institutes is currently commissioning MUSE in the Very Large Telescope for the Preliminary Acceptance in Chile, scheduled for September, 2014. MUSE is composed of several subsystems which are under the responsibility of each institute. The Fore Optics derotates and anamorphoses the image at the focal plane. A Splitting and Relay Optics feed the 24 identical Integral Field Units (IFU), that are mounted within a large monolithic structure. Each IFU incorporates an image slicer, a fully refractive spectrograph with VPH-grating and a detector system connected to a global vacuum and cryogenic system. During 2012 and 2013, all MUSE subsystems were integrated, aligned and tested to the P.I. institute at Lyon. After successful PAE in September 2013, MUSE instrument was shipped to the Very Large Telescope in Chile where that was aligned and tested in ESO integration hall at Paranal. After, MUSE was directly transported, fully aligned and without any optomechanical dismounting, onto VLT telescope where the first light was overcame the 7th of February, 2014. This paper describes the alignment procedure of the whole MUSE instrument with respect to the Very Large Telescope (VLT). It describes how 6 tons could be move with accuracy better than 0.025mm and less than 0.25 arcmin in order to reach alignment requirements. The success of the MUSE alignment is demonstrated by the excellent results obtained onto MUSE image quality and throughput directly onto the sky.

  11. Basic local alignment search tool

    Microsoft Academic Search

    Stephen F. Altschul; Warren Gish; Webb C. Miller; Eugene W. Myers; David J. Lipman


    A new approach to rapid sequence comparison, basic local alignment search tool (BLAST),directly approsimates alignments that optimize a measure of local similarity, the maximal segment pair (3ISP) score. Recent mathematical results on the stochastic properties of MSP scores allow an anallrsis of the performance of this method as well as the statistical significance of alignments it generates. The basic algorithm

  12. Video Alignment for Change Detection

    Microsoft Academic Search

    Ferran Diego; Daniel Ponsa; Joan Serrat; Antonio M. Lopez


    In this work, we address the problem of aligning two video sequences. Such alignment refers to synchronization, i.e., the establishment of temporal correspondence between frames of the first and second video, followed by spatial registration of all the temporally corresponding frames. Video synchronization and alignment have been attempted before, but most often in the relatively simple cases of fixed or


    E-print Network

    Rathbun, Julie A.

    to provide stable base for antenna. Must avoid craters and slopes which would degrade thermal control o~ unit and Alignment Central Station Antenna Crew Deployment Description Leveling, Alignment, and Pointing Radioisotope #12;CENTRAL STATION DEPLOYMENT CONSTRAINTS PARAMETER Site Selection Leveling Alignment Thermal Control

  14. Alignment as a Teacher Variable

    ERIC Educational Resources Information Center

    Porter, Andrew C.; Smithson, John; Blank, Rolf; Zeidner, Timothy


    With the exception of the procedures developed by Porter and colleagues (Porter, 2002), other methods of defining and measuring alignment are essentially limited to alignment between tests and standards. Porter's procedures have been generalized to investigating the alignment between content standards, tests, textbooks, and even classroom…

  15. Alignment verification procedures

    NASA Technical Reports Server (NTRS)

    Edwards, P. R.; Phillips, E. P.; Newman, J. C., Jr.


    In alignment verification procedures each laboratory is required to align its test machines and gripping fixtures to produce a nearly uniform tensile stress field on an un-notched sheet specimen. The blank specimens (50 mm w X 305 mm l X 2.3 mm th) supplied by the coordinators were strain gauged. Strain gauge readings were taken at all gauges (n = 1 through 10). The alignment verification procedures are as follows: (1) zero all strain gauges while specimen is in a free-supported condition; (2) put strain-gauged specimen in the test machine so that specimen front face (face 1) is in contact with reference jaw (standard position of specimen), tighten grips, and at zero load measure strains on all gauges. (epsilon sub nS0 is strain at gauge n, standard position, zero load); (3) with specimen in machine and at a tensile load of 10 kN measure strains (specimen in standard position). (Strain = epsilon sub nS10); (4) remove specimen from machine. Put specimen in machine so that specimen back face (face 2) is in contact with reference jaw (reverse position of specimen), tighten grips, and at zero load measure strains on all gauges. (Strain - epsilon sub nR0); and (5) with specimen in machine and at tensile load of 10 kN measure strains (specimen in reverse position). (epsilon sub nR10 is strain at gauge n, reverse position, 10 kN load).

  16. Dynamic Alignment at SLS

    SciTech Connect

    Ruland, Robert E.


    The relative alignment of components in the storage ring of the Swiss Light Source (SLS) is guaranteed by mechanical means. The magnets are rigidly fixed to 48 girders by means of alignment rails with tolerances of less than {+-}15 {micro}m. The bending magnets, supported by 3 point ball bearings, overlap adjacent girders and thus establish virtual train links between the girders, located near the bending magnet centres. Keeping the distortion of the storage ring geometry within a tolerance of {+-}100 {micro}m in order to guarantee sufficient dynamic apertures, requires continuous monitoring and correction of the girder locations. Two monitoring systems for the horizontal and the vertical direction will be installed to measure displacements of the train link between girders, which are due to ground settings and temperature effects: The hydrostatic levelling system (HLS) gives an absolute vertical reference, while the horizontal positioning system (HPS), which employs low cost linear encoders with sub-micron resolution, measures relative horizontal movements. The girder mover system based on five DC motors per girder allows a dynamic realignment of the storage ring within a working window of more than {+-}1 mm for girder translations and {+-}1 mrad for rotations. We will describe both monitoring systems (HLS and HPS) as well as the applied correction scheme based on the girder movers. We also show simulations indicating that beam based girder alignment takes care of most of the static closed orbit correction.

  17. Docking alignment system

    NASA Technical Reports Server (NTRS)

    Monford, Leo G. (Inventor)


    Improved techniques are provided for alignment of two objects. The present invention is particularly suited for three-dimensional translation and three-dimensional rotational alignment of objects in outer space. A camera 18 is fixedly mounted to one object, such as a remote manipulator arm 10 of the spacecraft, while the planar reflective surface 30 is fixed to the other object, such as a grapple fixture 20. A monitor 50 displays in real-time images from the camera, such that the monitor displays both the reflected image of the camera and visible markings on the planar reflective surface when the objects are in proper alignment. The monitor may thus be viewed by the operator and the arm 10 manipulated so that the reflective surface is perpendicular to the optical axis of the camera, the roll of the reflective surface is at a selected angle with respect to the camera, and the camera is spaced a pre-selected distance from the reflective surface.

  18. Solar Alignments - Identification and Analysis

    NASA Astrophysics Data System (ADS)

    Belmonte, Juan Antonio

    The sun was such an important divinity in antiquity, and even today, that solar alignments should be expected within a large variety of places and cultures. These are probably the most conspicuous kind of astronomical alignments a field researcher can deal with. The need for a correct identification is thus evident. The different kind of solar phenomena susceptible of being determined by astronomical alignments will be scrutinized, following by the way in which such alignments can materialize in space. It will be shown that analyzing solar alignments is not always an easy task.

  19. Alignment of suprathermally rotating grains

    E-print Network

    A. Lazarian


    It is shown, that mechanical alignment can be efficient for suprathermally rotating grains, provided that they drift with supersonic velocities. Such a drift should be widely spread due to both Alfv\\'{e}nic waves and ambipolar diffusion. Moreover, if suprathermal rotation is caused by grain interaction with a radiative flux, it is shown, that mechanical alignment may be present even in the absence of supersonic drift. This means that the range of applicability of mechanical alignment is wider that it is generally accepted and it can rival the paramagnetic one. We also study the latter mechanism and reexamine the interplay between poisoning of active sites and desorption of molecules blocking the access to the active sites of H$_{2}$ formation in order to explain the observed poor alignment of small grains and good alignment of large grains. To have a more comprehensive picture of alignment we briefly discuss the alignment by radiation fluxes and caused by grain magnetic moments.

  20. Strategies for Success

    ERIC Educational Resources Information Center

    Pruitt, Lisa; McGeough, David


    "Training" magazine taps 2011 Training Top 125 winners to provide their learning and development best practices in each issue. This article looks at strategies for aligning training with business goals and creating models to measure return-on-investment (ROI) and other financial metrics pertaining to training.

  1. The how and why of societal publications for citizen science projects and scientists

    NASA Astrophysics Data System (ADS)

    van Vliet, Arnold J. H.; Bron, Wichertje A.; Mulder, Sara


    In the scientific community, the importance of communication to society is often underestimated. Scientists and scientific organisations often lack the skills to organise such communication effectively. The Dutch citizen science phenology network Nature's Calendar has been successful in communicating to the general public via numerous newspaper articles, television appearances, presentations, websites and social media. We refer to these publications as societal publications. Due to active communication to mass media, we frequently reach millions of people. This communication helped us to involve thousands of volunteers in recording the timing of phenological events like the start of flowering, leaf unfolding and bird migration, but also several health-related events like hay fever symptoms and tick bites. In this paper, we analyse and present our experiences with the Nature's Calendar project regarding societal publications. Based on this analysis, we explain the importance of societal publications for citizen science projects and scientists in general, and we show how scientists can increase the newsworthiness of scientific information and what factors and activities can increase the chances of media paying attention to this news. We show that societal publications help phenological networks by facilitating the recruitment, retention and instruction of observers. Furthermore, they stimulate the generation of new ideas and partners that lead to an increase in knowledge, awareness and behavioural change of the general public or specific stakeholders. They make projects, and scientists involved, better known to the public and increase their credibility and authority. Societal publications can catalyse the production of new publications, thereby enforcing the previous mentioned points.

  2. Reconciling societal and scientific definitions for the monsoon

    NASA Astrophysics Data System (ADS)

    Reeve, Mathew; Stephenson, David


    Science defines the monsoon in numerous ways. We can apply these definitions to forecast data, reanalysis data, observations, GCMs and more. In a basic research setting, we hope that this work will advance science and our understanding of the monsoon system. In an applied research setting, we often hope that this work will benefit a specific stakeholder or community. We may want to inform a stakeholder when the monsoon starts, now and in the future. However, what happens if the stakeholders cannot relate to the information because their perceptions do not align with the monsoon definition we use in our analysis? We can resolve this either by teaching the stakeholders or learning from them about how they define the monsoon and when they perceive it to begin. In this work we reconcile different scientific monsoon definitions with the perceptions of agricultural communities in Bangladesh. We have developed a statistical technique that rates different scientific definitions against the people's perceptions of when the monsoon starts and ends. We construct a probability mass function (pmf) around each of the respondent's answers in a questionnaire survey. We can use this pmf to analyze the time series of monsoon onsets and withdrawals from the different scientific definitions. We can thereby quantitatively judge which definition may be most appropriate for a specific applied research setting.

  3. TSGC and JSC Alignment

    NASA Technical Reports Server (NTRS)

    Sanchez, Humberto


    NASA and the SGCs are, by design, intended to work closely together and have synergistic Vision, Mission, and Goals. The TSGC affiliates and JSC have been working together, but not always in a concise, coordinated, nor strategic manner. Today we have a couple of simple ideas to present about how TSGC and JSC have started to work together in a more concise, coordinated, and strategic manner, and how JSC and non-TSG Jurisdiction members have started to collaborate: Idea I: TSGC and JSC Technical Alignment Idea II: Concept of Clusters.

  4. The fairness hypothesis and managing the risks of societal technology choices

    SciTech Connect

    Cantor, R.; Rayner, S.


    Much of the literature on risk perception and management published over the last few years has asked how society should resolve the question, ''How safe is safe enough.'' This paper argues that, from a societal risk-management perspective, we should be addressing a different range of questions that views societal risk as a whole rather than as the sum of individual hazards. Resolving the question, ''How safe is safe enough.'' is less important in making societal technology choices than ''How fair is safe enough.'' A recent empirical pilot study is reported which explored the fairness hypothesis in the context of nuclear power. The results indicate that the process of technology choice should recognize explicitly the preferred principles different parties hold with respect to obtaining consent from those affected by the risks, distributing the liabilities, and justifying trust in the relevant institutions. The paper closes with a discussion of future prospects for the fairness approach to areas such as noxious facility siting.

  5. Automated whole-genome multiple alignment of rat, mouse, and human

    SciTech Connect

    Brudno, Michael; Poliakov, Alexander; Salamov, Asaf; Cooper, Gregory M.; Sidow, Arend; Rubin, Edward M.; Solovyev, Victor; Batzoglou, Serafim; Dubchak, Inna


    We have built a whole genome multiple alignment of the three currently available mammalian genomes using a fully automated pipeline which combines the local/global approach of the Berkeley Genome Pipeline and the LAGAN program. The strategy is based on progressive alignment, and consists of two main steps: (1) alignment of the mouse and rat genomes; and (2) alignment of human to either the mouse-rat alignments from step 1, or the remaining unaligned mouse and rat sequences. The resulting alignments demonstrate high sensitivity, with 87% of all human gene-coding areas aligned in both mouse and rat. The specificity is also high: <7% of the rat contigs are aligned to multiple places in human and 97% of all alignments with human sequence > 100kb agree with a three-way synteny map built independently using predicted exons in the three genomes. At the nucleotide level <1% of the rat nucleotides are mapped to multiple places in the human sequence in the alignment; and 96.5% of human nucleotides within all alignments agree with the synteny map. The alignments are publicly available online, with visualization through the novel Multi-VISTA browser that we also present.

  6. Societal influences on body image dissatisfaction in younger and older women.


    Bedford, Jennifer L; Johnson, C Shanthi


    Few studies have examined older women's body image. This study compared body image dissatisfaction (BID) and weight control practices; evaluated associations among BID, societal influences and concern for appropriateness (CFA); and identified the most important correlate of BID among younger (19-23) and older women (65-74). Questionnaires obtained information on demographics, weight control practices, societal influences (SATAQ-3), CFA and BID using the Figure Rating Scale. Findings revealed no difference in the prevalence of BID. The number of weight control practices and SATAQ-3 and CFA scores were correlated to BID. Pressure from the media was the most significant correlate of BID. PMID:16635949

  7. Emergent Societal Effects of Crimino-Social Forces in an Animat Agent Model

    NASA Astrophysics Data System (ADS)

    Scogings, Chris J.; Hawick, Ken A.

    Societal behaviour can be studied at a causal level by perturbing a stable multi-agent model with new microscopic behaviours and observing the statistical response over an ensemble of simulated model systems. We report on the effects of introducing criminal and law-enforcing behaviours into a large scale animat agent model and describe the complex spatial agent patterns and population changes that result. Our well-established predator-prey substrate model provides a background framework against which these new microscopic behaviours can be trialled and investigated. We describe some quantitative results and some surprising conclusions concerning the overall societal health when individually anti-social behaviour is introduced.

  8. Nova laser alignment control system

    SciTech Connect

    Van Arsdall, P.J.; Holloway, F.W.; McGuigan, D.L.; Shelton, R.T.


    Alignment of the Nova laser requires control of hundreds of optical components in the ten beam paths. Extensive application of computer technology makes daily alignment practical. The control system is designed in a manner which provides both centralized and local manual operator controls integrated with automatic closed loop alignment. Menudriven operator consoles using high resolution color graphics displays overlaid with transport touch panels allow laser personnel to interact efficiently with the computer system. Automatic alignment is accomplished by using image analysis techniques to determine beam references points from video images acquired along the laser chain. A major goal of the design is to contribute substantially to rapid experimental turnaround and consistent alignment results. This paper describes the computer-based control structure and the software methods developed for aligning this large laser system.

  9. A rank-based sequence aligner with applications in phylogenetic analysis.


    Dinu, Liviu P; Ionescu, Radu Tudor; Tomescu, Alexandru I


    Recent tools for aligning short DNA reads have been designed to optimize the trade-off between correctness and speed. This paper introduces a method for assigning a set of short DNA reads to a reference genome, under Local Rank Distance (LRD). The rank-based aligner proposed in this work aims to improve correctness over speed. However, some indexing strategies to speed up the aligner are also investigated. The LRD aligner is improved in terms of speed by storing [Formula: see text]-mer positions in a hash table for each read. Another improvement, that produces an approximate LRD aligner, is to consider only the positions in the reference that are likely to represent a good positional match of the read. The proposed aligner is evaluated and compared to other state of the art alignment tools in several experiments. A set of experiments are conducted to determine the precision and the recall of the proposed aligner, in the presence of contaminated reads. In another set of experiments, the proposed aligner is used to find the order, the family, or the species of a new (or unknown) organism, given only a set of short Next-Generation Sequencing DNA reads. The empirical results show that the aligner proposed in this work is highly accurate from a biological point of view. Compared to the other evaluated tools, the LRD aligner has the important advantage of being very accurate even for a very low base coverage. Thus, the LRD aligner can be considered as a good alternative to standard alignment tools, especially when the accuracy of the aligner is of high importance. Source code and UNIX binaries of the aligner are freely available for future development and use at The software is implemented in C++ and Java, being supported on UNIX and MS Windows. PMID:25133391

  10. A Rank-Based Sequence Aligner with Applications in Phylogenetic Analysis

    PubMed Central


    Recent tools for aligning short DNA reads have been designed to optimize the trade-off between correctness and speed. This paper introduces a method for assigning a set of short DNA reads to a reference genome, under Local Rank Distance (LRD). The rank-based aligner proposed in this work aims to improve correctness over speed. However, some indexing strategies to speed up the aligner are also investigated. The LRD aligner is improved in terms of speed by storing -mer positions in a hash table for each read. Another improvement, that produces an approximate LRD aligner, is to consider only the positions in the reference that are likely to represent a good positional match of the read. The proposed aligner is evaluated and compared to other state of the art alignment tools in several experiments. A set of experiments are conducted to determine the precision and the recall of the proposed aligner, in the presence of contaminated reads. In another set of experiments, the proposed aligner is used to find the order, the family, or the species of a new (or unknown) organism, given only a set of short Next-Generation Sequencing DNA reads. The empirical results show that the aligner proposed in this work is highly accurate from a biological point of view. Compared to the other evaluated tools, the LRD aligner has the important advantage of being very accurate even for a very low base coverage. Thus, the LRD aligner can be considered as a good alternative to standard alignment tools, especially when the accuracy of the aligner is of high importance. Source code and UNIX binaries of the aligner are freely available for future development and use at The software is implemented in C++ and Java, being supported on UNIX and MS Windows. PMID:25133391

  11. Contact-based sequence alignment

    Microsoft Academic Search

    Jens Kleinjung; John Romein; Kuang Lin; Jaap Heringa


    This paper introduces the novel method of contact- based protein sequence alignment, where structural information in the form of contact mutation prob- abilities is incorporated into an alignment routine using contact-mutation matrices (CAO: Contact Accepted mutatiOn). The contact-based alignment routine optimizes the score of matched contacts, which involves four (two per contact) instead of two residues per match in pairwise

  12. Going Mobile: Perspectives on Aligning Learning and Teaching in Geography

    ERIC Educational Resources Information Center

    Jarvis, Claire H.; Dickie, Jennifer; Brown, Gavin


    There has been little consideration to date regarding how we might best adjust our assessment protocols so that the overall learning experience remains appropriately aligned to both content and teaching approach when adopting location-specific mobile learning. This paper explores the success of a novel strategy to design an assessment regime that…

  13. Organizational Alignment Supporting Distance Education in Post-Secondary Institutions.

    ERIC Educational Resources Information Center

    Prestera, Gustavo E.; Moller, Leslie A.


    Applies an established model of organizational alignment to distance education in postsecondary institutions and recommends performance-oriented approaches to support growth by analyzing goals, structure, and management practices across the organization. Presents performance improvement strategies such as benchmarking and documenting workflows,…

  14. Business and Information System Alignment: a Formal Solution for Telecom Services

    E-print Network

    Paris-Sud XI, Université de

    Business and Information System Alignment: a Formal Solution for Telecom Services Jacques Simonin1 to the company strategy. The business view represents the target organization of the considered company business view of telecom services. This solution is based on the definition of a strategic alignment

  15. Alignment of Moleculs in Solution

    NASA Astrophysics Data System (ADS)

    Shahkhatuni, Aleksan

    Various physical methods for achieving partial alignment of dissolved molecules have been briefly reviewed. They include the use of external magnetic or electric fields, electromagnetic or acoustic waves, flow, pressure, electric current, stretching or straining of microporous matrices, various liquid crystalline phases, and solutions of anisotropic disc- or rod-like particles. SR sources can be used in all stages of this research; for the study of partially aligning medium itself, the study of structure and properties of aligned solute molecules, and finally, SR radiation can be used as aligning agent.

  16. Gold Alignment and Internal Dissipation

    NASA Astrophysics Data System (ADS)

    Lazarian, A.


    The measures of mechanical alignment are obtained for both prolate and oblate grains whose temperatures are comparable to the grain kinetic energy divided by k, the Boltzmann constant. For such grains, the alignment of angular momentum, J, with the axis of maximal inertia, a, is only partial, which substantially alters the mechanical alignment as compared with the results obtained by Lazarian and Roberge, Hanany, & Messinger under the assumption of perfect alignment. We also describe Gold alignment when the Barnett dissipation is suppressed and derive an analytical expression that relates the measure of alignment to the parameters of grain nonsphericity and the direction of the gas-grain drift. This solution provides the lower limit for the measure of alignment, while the upper limit is given by the method derived by Lazarian. Using the results of a recent study of incomplete internal relaxation by Lazarian & Roberge, we find measures of alignment for the whole range of ratios of grain rotational energy to kTs, where Ts is the grain temperature. To describe alignment for mildly supersonic drifts, we suggest an analytical approach that provides good correspondence with the results of direct numerical simulations by Roberge, Hanany, & Messinger. We also extend our approach to account for simultaneous action of the Gold and Davis-Greenstein mechanisms.

  17. A Vision for E-Government Enabling Societal Networking Transforming Government Services How Governments Can Act In recent years, we have seen the beginnings of a societal shift brought about by information

    E-print Network

    Narasayya, Vivek

    A Vision for E-Government Enabling Societal Networking Transforming Government Services How Governments Can Act In recent years, we have seen the beginnings of a societal shift brought about of government, as the central role of social media in the 2008 United States presidential election and other

  18. Geological mapping goes 3-D in response to societal needs

    USGS Publications Warehouse

    Thorleifson, H.; Berg, R.C.; Russell, H.A.J.


    The transition to 3-D mapping has been made possible by technological advances in digital cartography, GIS, data storage, analysis, and visualization. Despite various challenges, technological advancements facilitated a gradual transition from 2-D maps to 2.5-D draped maps to 3-D geological mapping, supported by digital spatial and relational databases that can be interrogated horizontally or vertically and viewed interactively. Challenges associated with data collection, human resources, and information management are daunting due to their resource and training requirements. The exchange of strategies at the workshops has highlighted the use of basin analysis to develop a process-based predictive knowledge framework that facilitates data integration. Three-dimensional geological information meets a public demand that fills in the blanks left by conventional 2-D mapping. Two-dimensional mapping will, however, remain the standard method for extensive areas of complex geology, particularly where deformed igneous and metamorphic rocks defy attempts at 3-D depiction.

  19. Aligning Multiple Genomic Sequences With the Threaded Blockset Aligner

    PubMed Central

    Blanchette, Mathieu; Kent, W. James; Riemer, Cathy; Elnitski, Laura; Smit, Arian F.A.; Roskin, Krishna M.; Baertsch, Robert; Rosenbloom, Kate; Clawson, Hiram; Green, Eric D.; Haussler, David; Miller, Webb


    We define a “threaded blockset,” which is a novel generalization of the classic notion of a multiple alignment. A new computer program called TBA (for “threaded blockset aligner”) builds a threaded blockset under the assumption that all matching segments occur in the same order and orientation in the given sequences; inversions and duplications are not addressed. TBA is designed to be appropriate for aligning many, but by no means all, megabase-sized regions of multiple mammalian genomes. The output of TBA can be projected onto any genome chosen as a reference, thus guaranteeing that different projections present consistent predictions of which genomic positions are orthologous. This capability is illustrated using a new visualization tool to view TBA-generated alignments of vertebrate Hox clusters from both the mammalian and fish perspectives. Experimental evaluation of alignment quality, using a program that simulates evolutionary change in genomic sequences, indicates that TBA is more accurate than earlier programs. To perform the dynamic-programming alignment step, TBA runs a stand-alone program called MULTIZ, which can be used to align highly rearranged or incompletely sequenced genomes. We describe our use of MULTIZ to produce the whole-genome multiple alignments at the Santa Cruz Genome Browser. PMID:15060014

  20. Chp 3-Sequence Alignment SECTION II SEQUENCE ALIGNMENT

    E-print Network

    Schürmann, Michael

    Chp 3- Sequence Alignment SECTION II SEQUENCE ALIGNMENT Xiong: Chp 3 Pairwise Sequence Alignmentq g · Evolutionary Basis · Sequence Homology versus Sequence SimilaritySequence Homology versus Sequence Similarity · Sequence Similarity versus Sequence Identity · Methods - cont · Scoring Matrices · Statistical Significance

  1. Alignment robustness for 90 nm and 65 nm node through copper alignment mark integration optimization

    NASA Astrophysics Data System (ADS)

    Warrick, Scott; Hinnen, Paul; Morton, Rob; Cooper, Kevin; Sassoulas, Pierre-Olivier; Depre, Jerome; Navarro, Ramon; van Haren, Richard; Browning, Clyde; Reber, Doug; Megens, Henry


    In this paper, methods for stacking ASML scribe lane alignment marks (SPM) and improving the mark performance at initial copper metal levels are discussed. The new mark designs and the theoretical reasons for mark design and/or integration change are presented. In previous joint publications between ASML and Freescale Semiconductor [1], improved overlay performance and alignment robustness for Back End Of Line (BEOL) layers by the application of stacked scribe lane marks (SPM) was presented. In this paper, further improvements are demonstrated through the use of optimized Versatile Scribe Lane Mark design (VSPM). With the application of stacked optimized VSPM-marks, the alignment signal strength of marks in the copper metal layer is increased compared to stacked SPM marks. The gains in signal strength stability, which is typical for stacked marks, as well as significantly reduced scribe lane usage, are also maintained. Through the placement of specially designed orthogonal scatter-bars in selected layers under the VSPM-marks, the alignment performance of initial inlaid metal layers is improved as well. The integration of these marks has been evaluated for the 90 nm and 65 nm technology nodes as part of a joint development program between the Crolles2 Alliance and ASML. A measured overlay improvement of ~10-15% was obtained by a strategy change from floating copper marks to stacked optimized VSPM marks.

  2. Using multiple alignments to improve seeded local alignment algorithms

    PubMed Central

    Flannick, Jason; Batzoglou, Serafim


    Multiple alignments among genomes are becoming increasingly prevalent. This trend motivates the development of tools for efficient homology search between a query sequence and a database of multiple alignments. In this paper, we present an algorithm that uses the information implicit in a multiple alignment to dynamically build an index that is weighted most heavily towards the promising regions of the multiple alignment. We have implemented Typhon, a local alignment tool that incorporates our indexing algorithm, which our test results show to be more sensitive than algorithms that index only a sequence. This suggests that when applied on a whole-genome scale, Typhon should provide improved homology searches in time comparable to existing algorithms. PMID:16100379

  3. Space-Based Sensor Web for Earth Science Applications: An Integrated Architecture for Providing Societal Benefits

    NASA Technical Reports Server (NTRS)

    Habib, Shahid; Talabac, Stephen J.


    There is a significant interest in the Earth Science research and user remote sensing community to substantially increase the number of useful observations relative to the current frequency of collection. The obvious reason for such a push is to improve the temporal, spectral, and spatial coverage of the area(s) under investigation. However, there is little analysis available in terms of the benefits, costs and the optimal set of sensors needed to make the necessary observations. Classic observing system solutions may no longer be applicable because of their point design philosophy. Instead, a new intelligent data collection system paradigm employing both reactive and proactive measurement strategies with adaptability to the dynamics of the phenomena should be developed. This is a complex problem that should be carefully studied and balanced across various boundaries including: science, modeling, applications, and technology. Modeling plays a crucial role in making useful predictions about naturally occurring or human-induced phenomena In particular, modeling can serve to mitigate the potentially deleterious impacts a phenomenon may have on human life, property, and the economy. This is especially significant when one is interested in learning about the dynamics of, for example, the spread of forest fires, regional to large-scale air quality issues, the spread of the harmful invasive species, or the atmospheric transport of volcanic plumes and ash. This paper identifies and examines these challenging issues and presents architectural alternatives for an integrated sensor web to provide observing scenarios driving the requisite dynamic spatial, spectral, and temporal characteristics to address these key application areas. A special emphasis is placed on the observing systems and its operational aspects in serving the multiple users and stakeholders in providing societal benefits. We also address how such systems will take advantage of technological advancement in small spacecraft and emerging information technologies, and how sensor web options may be realized and made affordable. Specialized detector subsystems and precision flying techniques may still require substantial innovation, development time and cost: we have presented the considerations for these issues. Finally, data and information gathering and compression techniques are also briefly described.

  4. Carbon Nanotube Based Nanotechnology for NASA Mission Needs and Societal Applications

    NASA Technical Reports Server (NTRS)

    Li, Jing; Meyyappan, M.


    Carbon nanotubes (CNT) exhibit extraordinary mechanical properties and unique electronic properties and therefore, have received much attention for more than a decade now for a variety of applications ranging from nanoelectronics, composites to meeting needs in energy, environmental and other sectors. In this talk, we focus on some near term potential of CNT applications for both NASA and other Agency/societal needs. The most promising and successful application to date is a nano chem sensor at TRL 6 that uses a 16-256 sensor array in the construction of an electronic nose. Pristine, doped, functionalized and metal-loaded SWCNTs are used as conducting materials to provide chemical variation across the individual elements of the sensor array. This miniaturized sensor has been incorporated in an iPhone for homeland security applications. Gases and vapors relevant to leak detection in crew vehicles, biomedical, mining, chemical threats, industrial spills and others have been demonstrated. SWCNTs also respond to radiation exposure via a change in conductivity and therefore, a similar strategy is being pursued to construct a radiation nose to identify radiation sources (gamma, protons, neutrons, X-ray, etc.) with their energy levels. Carbon nanofibers (CNFs) grown using plasma enhanced CVD typically are vertical, individual, freestanding structures and therefore, are ideal for construction of nanoelectrodes. A nanoelectrode array (NEA) can be the basis for an affinity-based biosensor to meet the needs in applications such as lab-on-a-chip, environmental monitoring, cancer diagnostics, biothreat monitoring, water and food safety and others. A couple of demonstrations including detection of e-coli and ricin will be discussed. The NEA is also useful for implantation in the brain for deep brain stimulation and neuroengineering applications. Miniaturization of payload such as science instrumentation and power sources is critical to reduce launch costs. High current density (greater than 100 mA/per square centimeters) field emission capabilities of CNTs can be exploited for construction of electron gun for electron microscopy and X-ray tubes for spectrometers and baggage screening. A CNT pillar array configuration has been demonstrated, not only meeting the high current density needs but more importantly providing long term emitter stability. Finally, supercapacitors hold the promise to combine the high energy density of a battery with the high power density of capacitors. Traditional graphite electrodes have not delivered this promise yet. A novel design and processing approach using MWCNTs has shown a record 550 F/g capacitance along with significant device endurance. This supercapacitor is suitable for railgun launch application for NASA, powering rovers and robots, consumer electronics and future hybrid vehicles.

  5. SLU's strategy 20132016 Production: SLU Division of Communication, April 2012

    E-print Network

    SLU's strategy 2013­2016 Future challenges #12;Production: SLU Division of Communication, April, sustainable forestry, food supply, societal planning and sustainable urban and rural development, as wellLU's PROFiLE aND FUTURE ROLE 17 2.1 Key challenges 19 2.2 SLU's areas of strength 23 2.3 SLU's role

  6. Impact of Public Policy and Societal Risk Perception on U.S. Civilian Nuclear Power Plant Construction

    E-print Network

    Ford, David N.

    Impact of Public Policy and Societal Risk Perception on U.S. Civilian Nuclear Power Plant permit applications for 26 new nuclear power reactors. However, the previous generation of U.S. civilian of nuclear plants. Results point to the critical role societal perceptions of nuclear power risk play

  7. Awareness of Societal Issues among High School Biology Teachers Teaching Genetics

    ERIC Educational Resources Information Center

    Lazarowitz, Reuven; Bloch, Ilit


    The purpose of this study was to investigate how aware high school biology teachers are of societal issues (values, moral, ethic, and legal issues) while teaching genetics, genetics engineering, molecular genetics, human heredity, and evolution. The study includes a short historical review of World War II atrocities during the Holocaust when…

  8. Societal Education, Direct Action, and Working-Class Gains: An Anarchist Perspective

    Microsoft Academic Search

    John Asimakopoulos


    Using an anarchist theoretical framework, it is argued that the working class would obtain greater gains through militant direct action modeled on the labor movement of the past. The history of the 8-hour workday is reviewed as a case study showing that it was won because of radical leaders who challenged existing legal institutional frameworks through societal education, militant ideology,

  9. The Inter-Temporal Aspect of Well-Being and Societal Progress

    ERIC Educational Resources Information Center

    Sicherl, Pavle


    The perceptions on well-being and societal progress are influenced also by the quantitative indicators and measures used in the measurement, presentation and semantics of discussing these issues. The article presents a novel generic statistical measure S-time-distance, with clear interpretability that delivers a broader concept to look at data, to…

  10. National Contexts Influencing Principals' Time Use and Allocation: Economic Development, Societal Culture, and Educational System

    ERIC Educational Resources Information Center

    Lee, Moosung; Hallinger, Philip


    This study examines the impact of macro-context factors on the behavior of school principals. More specifically, the article illuminates how a nation's level of economic development, societal culture, and educational system influence the amount of time principals devote to their job role and shape their allocation of time to instructional…

  11. Realizing NASA's Goal of Societal Benefits From Earth Observations in Mesoamerica Through the SERVIR Project

    Microsoft Academic Search

    D. M. Hardin; D. Irwin; T. Sever; S. Graves


    One of the goals of NASA's Applied Sciences Program is to manifest societal benefits from the vast store of Earth Observations through partnerships with public, private and academic organizations. The SERVIR project represents an early success toward this goal. By combining Earth Observations from NASA missions, results from environmental models and decision support tools from its partners the SERVIR project

  12. Societal Burden of Clinically Anxious Youth Referred for Treatment: A Cost-of-Illness Study

    ERIC Educational Resources Information Center

    Bodden, Denise H. M.; Dirksen, Carmen D.; Bogels, Susan M.


    A prevalence-based cost-of-illness study using a societal perspective was conducted to investigate the cost-of-illness in clinically anxious youth aged 8-18 in The Netherlands. Discriminant validity of the cost diary used was obtained by comparing costs of families with an anxious child (n=118) to costs of families from the general population…

  13. Globalisation and Societal Culture: Redefining Schooling and School Leadership in the Twenty-First Century.

    ERIC Educational Resources Information Center

    Dimmock, Clive; Walker, Allan


    Discusses the concept of globalization and explores the relationship between globalization and societal culture. States the transfer between systems must be more culturally sensitive. Offers a list of cultural dimensions to gauge the influence of cultures. Argues that greater cultural sensitivity is necessary when raising issues on school reform…

  14. The interplay between societal concerns and the regulatory frame on GM crops in the European Union

    Microsoft Academic Search

    Yann Devos; Dirk Reheul; Danny De Waele; Linda Van Speybroeck


    Recapitulating how genetic modification technology and its agro-food products aroused strong societal oppo- sition in the European Union, this paper demonstrates how this opposition contributed to shape the European regulatory frame on GM crops. More specifically,it describes how this opposition contributed to a de facto mora- torium on the commercialization of new GM crop events in the end of the


    E-print Network

    since 2000. These forecasts include information on the individual severe weather hazards (tornado and observed societal impact. Future work will also be needed to examine the optimal communication of this type impacts due to a tornado in a dense urban area can be estimated through the combination of information

  16. Structural Determinants of the Divorce Rate: A Cross-Societal Analysis.

    ERIC Educational Resources Information Center

    Trent, Katherine; South, Scott J.


    Data from a sample of 66 countries were analyzed to investigate 4 hypothesized societal-level correlates of the divorce rate: socioeconomic development, female labor participation, the sex ratio, and dominant religion. Regression analyses revealed that all factors except religion had a significant effect on the crude divorce rate. Theoretical…

  17. Barriers to Considering Ethical and Societal Implications of Research: Perceptions of Life Scientists

    Microsoft Academic Search

    Jennifer Blair McCormick; Angie M. Boyce; Jennifer M. Ladd; Mildred K. Cho


    Background: As part of an empirical study investigating how life scientists think about ethical and societal implications of their work, and about life science research in general, we sought to elucidate barriers that scientists might face in considering such implications. Methods: Between 2005 and 2007, we conducted a study consisting of phone interviews, focus groups, and a national survey of

  18. Barriers to Considering Ethical and Societal Implications of Research: Perceptions of Life Scientists

    PubMed Central

    McCormick, Jennifer Blair; Boyce, Angie M.; Ladd, Jennifer M.; Cho, Mildred


    Background As part of an empirical study investigating how life scientists think about ethical and societal implications of their work, and about life science research in general, we sought to elucidate barriers that scientists might face in considering such implications. Method Between 2005 and 2007, we conducted a study consisting of phone interviews, focus groups, and a national survey of life scientists at biomedical research institutions. The study population included graduate students, postdoctoral fellows, faculty, clinical instructors, and research staff. We analyzed data through qualitative and quantitative methods. Results In analyzing the data, we found that life scientists do, in fact, face barriers to considering ethical and societal implications of research. We categorized these barriers as falling into four broad domains: (1) lack of awareness of ethical and societal implications; (2) lack of relevance of such concerns to their specific research; (3) self-confidence in their ability to resolve such concerns; and (4) aspects of the daily practice of science itself. Conclusions Life science researchers experience elements inherent in their training and in the conduct of science as barriers to thinking about ethical and societal implications related to their work. These findings suggest areas in which research ethics educators, bioethicists, and the scientific community can focus their efforts to improve social and ethical accountability in research. PMID:22866239

  19. Title: Societal Communication and Brand Equity Abstract: Previous research on corporate social responsibility generally acknowledges that

    E-print Network

    Boyer, Edmond

    , Nestlé, Nike) or brand websites (The Body Shop, Natura Brasil), through relationship marketing toolsTitle: Societal Communication and Brand Equity Abstract: Previous research on corporate social characteristics on brand equity. In this paper we draw on Keller's (2003) brand equity framework to derive

  20. Soil Carbon Sequestration in Grazing Lands: Societal Benefits and Policay Implications

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we examine the importance of ‘grazinglands’ in relation to the sequestration of soil organic carbon. Global estimates are that grazinglands occupy~ 3.6 billion ha and account for about one-fourth of potential C sequestration in world soils. Many environmental and societal benefits are provide...


    SciTech Connect



    This grant covered several areas of significant societal interest. It included an evaluation of the validity of scientific claims; developed an approach for stakeholder participation; and demonstrated the validity of the developed methods through the performance of a number of independent peer reviews.

  2. Teaching Societal and Ethical Implications of Nanotechnology to Engineering Students Through Science Fiction

    Microsoft Academic Search

    Rosalyn W. Berne; Joachim Schummer


    Societal and ethical implications of nanotechnology have become a hot topic of public debates in many countries because both revolutionary changes and strong public concerns are expected from its development. Because nanotechnology is, at this point, mostly articulated in visionary and futuristic terms, it is difficult to apply standard methods of technology assessment and even more difficult to consider it

  3. Predicted Fire Behavior and Societal Benefits in Three Eastern Sierra Nevada Vegetation Types

    Microsoft Academic Search

    Christopher A. Dicus; Kenneth Delfino; David R. Weise


    We investigated potential fire behavior and various societal benefits (air pollution remov - al, carbon sequestration, and carbon storage) provided by woodlands of pinyon pine (Pinus monophylla) and juniper (Juniperus californica), shrublands of Great Basin sage- brush (Artemisia tridentata) and rabbitbrush (Ericameria nauseosa), and recently burned annual grasslands near a wildland-urban interface (WUI) community in the high desert of the

  4. Citizens of the Academic Community? A Societal Perspective on Leadership in UK Higher Education

    ERIC Educational Resources Information Center

    Bolden, Richard; Gosling, Jonathan; O'Brien, Anne


    This paper presents a societal perspective on academic leadership by exploring the preoccupations of academics as citizens rather than as employees, managers or individuals. It uses a listening post methodology to ask "what is it like to be a citizen of an academic institution in contemporary Britain?" Three listening posts, comprising…

  5. Perceptions of Addictions as Societal Problems in Canada, Sweden, Finland and St. Petersburg, Russia

    Microsoft Academic Search

    Kari Holma; Anja Koski-Jännes; Kirsimarja Raitasalo; Jan Blomqvist; Irina Pervova; John A. Cunningham


    Aims: This study reports on the relative gravity people attribute to various addictive behaviors with respect to other societal concerns in four northern populations with different history, social policy and treatment alternatives for addicted individuals. Methods: Random population surveys were conducted in Canada, Sweden, Finland and St. Petersburg, Russia. In Finland and Sweden, the survey was conducted by mail, in

  6. Tolerance mechanisms in North American deserts: Biological and societal approaches to climate change

    E-print Network

    Denardo, Dale

    Review Tolerance mechanisms in North American deserts: Biological and societal approaches to climate change Z.R. Stahlschmidt a,*, D.F. DeNardo a , J.N. Holland b , B.P. Kotler c , M. Kruse-Peeples d for Desert Research, Ben-Gurion University of the Negev, Midreshet Ben-Gurion 84990, Israel d School of Human

  7. The Teaching and Societal Services Nexus: Academics' Experiences in Three Disciplines

    ERIC Educational Resources Information Center

    Holmén, Magnus; Ljungberg, Daniel


    In this paper, we investigate the perception of academics regarding how their experiences from societal interaction (third mission) inform their teaching and vice versa. We report on a phone survey of Swedish academics in three engineering-related disciplines. The findings show that there is a perceived positive and bidirectional relationship…

  8. Plant and Soil Nematodes: Societal Impact and Focus for the Future 1

    Microsoft Academic Search



    Plant and soil nematodes significandy impact our lives. Therefore, we must understand and manage these complex organisms so that we may continue to develop and sustain our food production systems, our natural resources, our environment, and our quality of life. This publication looks specifically at soil and plant nematology. First, the societal impact of nematodes and benefits of nematology research

  9. Teaching Societal and Ethical Implications of Nanotechnology to Engineering Students through Science Fiction

    ERIC Educational Resources Information Center

    Berne, Rosalyn W.; Schummer, Joachim


    Societal and ethical implications of nanotechnology have become a hot topic of public debates in many countries because both revolutionary changes and strong public concerns are expected from its development. Because nanotechnology is, at this point, mostly articulated in visionary and futuristic terms, it is difficult to apply standard methods of…

  10. Piecing Together the Puzzle: Development of the Societal Attitudes towards Autism (SATA) Scale

    ERIC Educational Resources Information Center

    Flood, Luci N.; Bulgrin, Amanda; Morgan, Betsy L.


    The rise in the prevalence of autism creates a need for a reliable and valid measure of attitudes towards autism. The current study describes the development of a brief 16-item measure of Societal Attitudes towards Autism (SATA) that exhibits sound psychometric properties and has a demonstrated ability to discriminate between expert and general…

  11. NANO SCENARIO: Role-Playing to Appreciate the Societal Effects of Nanotechnology

    ERIC Educational Resources Information Center

    Jarmon, Leslie; Keating, Elizabeth


    This article describes a university-sponsored experiential-based simulation, the NANO SCENARIO, to increase the public's awareness and affect attitudes on the societal implications of nanoscience and nanotechnology by bringing together diverse stakeholders' perspectives in a participatory learning environment. Nanotechnology has the potential for…

  12. Media Use and Children's Perceptions of Societal Threat and Personal Vulnerability

    ERIC Educational Resources Information Center

    Comer, Jonathan S.; Furr, Jami M.; Beidas, Rinad S.; Babyar, Heather M.; Kendall, Philip C.


    This study examined children's media use (i.e., amount of television and Internet usage) and relationships to children's perceptions of societal threat and personal vulnerability. The sample consisted of 90 community youth aged 7 to 13 years (M = 10.8; 52.2% male) from diverse economic backgrounds. Analyses found children's television use to be…

  13. Cost-Effectiveness Analysis of the Bivalent and Quadrivalent Human Papillomavirus Vaccines from a Societal Perspective in Colombia

    PubMed Central

    Aponte-González, Johanna; Fajardo-Bernal, Luisa; Diaz, Jorge; Eslava-Schmalbach, Javier; Gamboa, Oscar; Hay, Joel W.


    Objective To compare costs and effectiveness of three strategies used against cervical cancer (CC) and genital warts: (i) Screening for CC; (ii) Bivalent Human Papillomavirus (HPV) 16/18 vaccine added to screening; (iii) Quadrivalent HPV 6/11/16/18 vaccine added to screening. Methods A Markov model was designed in order to simulate the natural history of the disease from 12 years of age (vaccination) until death. Transition probabilities were selected or adjusted to match the HPV infection profile in Colombia. A systematic review was undertaken in order to derive efficacy values for the two vaccines as well as for the operational characteristics of the cytology test. The societal perspective was used. Effectiveness was measured in number of averted Disability Adjusted Life Years (DALYS). Results At commercial prices reported for 2010 the two vaccines were shown to be non-cost-effective alternatives when compared with the existing screening strategy. Sensitivity analyses showed that results are affected by the cost of vaccines and their efficacy values, making it difficult to determine with certainty which of the two vaccines has the best cost-effectiveness profile. To be ‘cost-effective’ vaccines should cost between 141 and 147 USD (Unite States Dollars) per vaccinated girl at the most. But at lower prices such as those recommended by WHO or the price of other vaccines in Colombia, HPV vaccination could be considered very cost-effective. Conclusions HPV vaccination could be a convenient alternative for the prevention of CC in Colombia. However, the price of the vaccine should be lower for this vaccination strategy to be cost-effective. It is also important to take into consideration the willingness to pay, budgetary impact, and program implications, in order to determine the relevance of a vaccination program in this country, as well as which vaccine should be selected for use in the program. PMID:24260441

  14. Lexical alignment in triadic communication.


    Foltz, Anouschka; Gaspers, Judith; Thiele, Kristina; Stenneken, Prisca; Cimiano, Philipp


    Lexical alignment refers to the adoption of one's interlocutor's lexical items. Accounts of the mechanisms underlying such lexical alignment differ (among other aspects) in the role assigned to addressee-centered behavior. In this study, we used a triadic communicative situation to test which factors may modulate the extent to which participants' lexical alignment reflects addressee-centered behavior. Pairs of naïve participants played a picture matching game and received information about the order in which pictures were to be matched from a voice over headphones. On critical trials, participants did or did not hear a name for the picture to be matched next over headphones. Importantly, when the voice over headphones provided a name, it did not match the name that the interlocutor had previously used to describe the object. Participants overwhelmingly used the word that the voice over headphones provided. This result points to non-addressee-centered behavior and is discussed in terms of disrupting alignment with the interlocutor as well as in terms of establishing alignment with the voice over headphones. In addition, the type of picture (line drawing vs. tangram shape) independently modulated lexical alignment, such that participants showed more lexical alignment to their interlocutor for (more ambiguous) tangram shapes compared to line drawings. Overall, the results point to a rather large role for non-addressee-centered behavior during lexical alignment. PMID:25762955

  15. Drive alignment pays maintenance dividends

    SciTech Connect

    Fedder, R. [Rexnord Industries, Milwaukee, WI (United States)


    Proper alignment of the motor and gear drive on conveying and processing equipment will result in longer bearing and coupling life, along with lower maintenance costs. Selecting an alignment free drive package instead of a traditional foot mounted drive and motor is a major advancement toward these goals. 4 photos.

  16. Predicting alignment performance Lars Ahrenberg

    E-print Network

    Ahrenberg, Lars

    Predicting alignment performance Lars Ahrenberg Department of Computer and Information Science Link¨oping University Abstract We present a planned project aimed at evaluating the performance to a third question: How well can we predict the performance of a word aligner, as measured by precision

  17. Lexical alignment in triadic communication

    PubMed Central

    Foltz, Anouschka; Gaspers, Judith; Thiele, Kristina; Stenneken, Prisca; Cimiano, Philipp


    Lexical alignment refers to the adoption of one’s interlocutor’s lexical items. Accounts of the mechanisms underlying such lexical alignment differ (among other aspects) in the role assigned to addressee-centered behavior. In this study, we used a triadic communicative situation to test which factors may modulate the extent to which participants’ lexical alignment reflects addressee-centered behavior. Pairs of naïve participants played a picture matching game and received information about the order in which pictures were to be matched from a voice over headphones. On critical trials, participants did or did not hear a name for the picture to be matched next over headphones. Importantly, when the voice over headphones provided a name, it did not match the name that the interlocutor had previously used to describe the object. Participants overwhelmingly used the word that the voice over headphones provided. This result points to non-addressee-centered behavior and is discussed in terms of disrupting alignment with the interlocutor as well as in terms of establishing alignment with the voice over headphones. In addition, the type of picture (line drawing vs. tangram shape) independently modulated lexical alignment, such that participants showed more lexical alignment to their interlocutor for (more ambiguous) tangram shapes compared to line drawings. Overall, the results point to a rather large role for non-addressee-centered behavior during lexical alignment.

  18. Alignment Tolerances for ALMA Optics

    Microsoft Academic Search

    B. Lazareff

    A tolerance analysis of the alignment of the ALMA FE optics is presented. The following performance criteria are taken into account: a) loss of on- axis efficiency from aperture plane misalignment; b) focal plane co- alignment of the two beams of each band; c) aberrations when off-axis mirrors operate between wavefronts not centered on the foci of the ellipsoid; d)

  19. Well-pump alignment system


    Drumheller, Douglas S. (Cedar Crest, NM)


    An improved well-pump for geothermal wells, an alignment system for a well-pump, and to a method for aligning a rotor and stator within a well-pump, wherein the well-pump has a whistle assembly formed at a bottom portion thereof, such that variations in the frequency of the whistle, indicating misalignment, may be monitored during pumping.

  20. The construction and use of log-odds substitution scores for multiple sequence alignment.


    Altschul, Stephen F; Wootton, John C; Zaslavsky, Elena; Yu, Yi-Kuo


    Most pairwise and multiple sequence alignment programs seek alignments with optimal scores. Central to defining such scores is selecting a set of substitution scores for aligned amino acids or nucleotides. For local pairwise alignment, substitution scores are implicitly of log-odds form. We now extend the log-odds formalism to multiple alignments, using Bayesian methods to construct "BILD" ("Bayesian Integral Log-odds") substitution scores from prior distributions describing columns of related letters. This approach has been used previously only to define scores for aligning individual sequences to sequence profiles, but it has much broader applicability. We describe how to calculate BILD scores efficiently, and illustrate their uses in Gibbs sampling optimization procedures, gapped alignment, and the construction of hidden Markov model profiles. BILD scores enable automated selection of optimal motif and domain model widths, and can inform the decision of whether to include a sequence in a multiple alignment, and the selection of insertion and deletion locations. Other applications include the classification of related sequences into subfamilies, and the definition of profile-profile alignment scores. Although a fully realized multiple alignment program must rely upon more than substitution scores, many existing multiple alignment programs can be modified to employ BILD scores. We illustrate how simple BILD score based strategies can enhance the recognition of DNA binding domains, including the Api-AP2 domain in Toxoplasma gondii and Plasmodium falciparum. PMID:20657661

  1. The Construction and Use of Log-Odds Substitution Scores for Multiple Sequence Alignment

    PubMed Central

    Altschul, Stephen F.; Wootton, John C.; Zaslavsky, Elena; Yu, Yi-Kuo


    Most pairwise and multiple sequence alignment programs seek alignments with optimal scores. Central to defining such scores is selecting a set of substitution scores for aligned amino acids or nucleotides. For local pairwise alignment, substitution scores are implicitly of log-odds form. We now extend the log-odds formalism to multiple alignments, using Bayesian methods to construct “BILD” (“Bayesian Integral Log-odds”) substitution scores from prior distributions describing columns of related letters. This approach has been used previously only to define scores for aligning individual sequences to sequence profiles, but it has much broader applicability. We describe how to calculate BILD scores efficiently, and illustrate their uses in Gibbs sampling optimization procedures, gapped alignment, and the construction of hidden Markov model profiles. BILD scores enable automated selection of optimal motif and domain model widths, and can inform the decision of whether to include a sequence in a multiple alignment, and the selection of insertion and deletion locations. Other applications include the classification of related sequences into subfamilies, and the definition of profile-profile alignment scores. Although a fully realized multiple alignment program must rely upon more than substitution scores, many existing multiple alignment programs can be modified to employ BILD scores. We illustrate how simple BILD score based strategies can enhance the recognition of DNA binding domains, including the Api-AP2 domain in Toxoplasma gondii and Plasmodium falciparum. PMID:20657661

  2. Paramagnetic alignment of fractal grains

    E-print Network

    A. Lazarian


    Paramagnetic alignment of fractal suprathermally rotating grains is discussed. It is shown that if the concentration of H$_{2}$formation sites is low and resurfacing is active, fractal structure of grains enhances their alignment. Studying the influence of grain surface physics and chemistry on the alignment we found that there exist two critical values of grain sizes, and the alignment of smaller grains is expected to decrease as compared to the predictions of the Purcell's theory (1979). One of the critical sizes is due to intensified poisoning of active sites, while the other is a result of a finite value of the imaginary part of magnetic susceptibility in the limit of high angular velocities. On the contrary, if active sites completely cover grain surface, suprathermal rotation, and therefore efficient alignment, is possible only for a limited range of grain sizes.

  3. Alignment of the MINOS FD

    SciTech Connect

    Becker, B.; /Minnesota U.; Boehnlein, D.; /Fermilab


    The results and procedure of the alignment of the MINOS Far Detector are presented. The far detector has independent alignments of SM1 and SM2. The misalignments have an estimated uncertainty of {approx}850 {micro}m for SM1 and {approx}750 {micro}m for SM2. The alignment has as inputs the average rotations of U and V as determined by optical survey and strip positions within modules measured from the module mapper. The output of this is a module-module correction for transverse mis-alignments. These results were verified by examining an independent set of data. These alignment constants on average contribute much less then 1% to the total uncertainty in the transverse strip position.

  4. Stellar Alignments - Identification and Analysis

    NASA Astrophysics Data System (ADS)

    Ruggles, Clive L. N.

    Fortuitous stellar alignments can be fitted to structural orientations with relative ease by the unwary. Nonetheless, cautious approaches taking into account a broader range of cultural evidence, as well as paying due attention to potential methodological pitfalls, have been successful in identifying credible stellar alignments—and constructing plausible assessments of their cultural significance—in a variety of circumstances. These range from single instances of alignments upon particular asterisms where the corroborating historical or ethnographic evidence is strong to repeated instances of oriented structures with only limited independent cultural information but where systematic, data-driven approaches can be productive. In the majority of cases, the identification and interpretation of putative stellar alignments relates to groups of similar monuments or complex single sites and involves a balance between systematic studies of the alignments themselves, backed up by statistical analysis where appropriate, and the consideration of a range of contextual evidence, either derived from the archaeological record alone or from other relevant sources.

  5. The how and why of societal publications for citizen science projects and scientists.


    van Vliet, Arnold J H; Bron, Wichertje A; Mulder, Sara


    In the scientific community, the importance of communication to society is often underestimated. Scientists and scientific organisations often lack the skills to organise such communication effectively. The Dutch citizen science phenology network Nature's Calendar has been successful in communicating to the general public via numerous newspaper articles, television appearances, presentations, websites and social media. We refer to these publications as societal publications. Due to active communication to mass media, we frequently reach millions of people. This communication helped us to involve thousands of volunteers in recording the timing of phenological events like the start of flowering, leaf unfolding and bird migration, but also several health-related events like hay fever symptoms and tick bites. In this paper, we analyse and present our experiences with the Nature's Calendar project regarding societal publications. Based on this analysis, we explain the importance of societal publications for citizen science projects and scientists in general, and we show how scientists can increase the news worthiness of scientific information and what factors and activities can increase the chances of media paying attention to this news. We show that societal publications help phenological networks by facilitating the recruitment, retention and instruction of observers. Furthermore, they stimulate the generation of new ideas and partners that lead to an increase in knowledge, awareness and behavioural change of the general public or specific stakeholders. They make projects, and scientists involved, better known to the public and increase their credibility and authority. Societal publications can catalyse the production of new publications, thereby enforcing the previous mentioned points. PMID:24705824

  6. Alignment-Annotator web server: rendering and annotating sequence alignments

    PubMed Central

    Gille, Christoph; Fähling, Michael; Weyand, Birgit; Wieland, Thomas; Gille, Andreas


    Alignment-Annotator is a novel web service designed to generate interactive views of annotated nucleotide and amino acid sequence alignments (i) de novo and (ii) embedded in other software. All computations are performed at server side. Interactivity is implemented in HTML5, a language native to web browsers. The alignment is initially displayed using default settings and can be modified with the graphical user interfaces. For example, individual sequences can be reordered or deleted using drag and drop, amino acid color code schemes can be applied and annotations can be added. Annotations can be made manually or imported (BioDAS servers, the UniProt, the Catalytic Site Atlas and the PDB). Some edits take immediate effect while others require server interaction and may take a few seconds to execute. The final alignment document can be downloaded as a zip-archive containing the HTML files. Because of the use of HTML the resulting interactive alignment can be viewed on any platform including Windows, Mac OS X, Linux, Android and iOS in any standard web browser. Importantly, no plugins nor Java are required and therefore Alignment-Anotator represents the first interactive browser-based alignment visualization. Availability: and PMID:24813445

  7. Business and IS/IT Strategic Alignment Framework

    NASA Astrophysics Data System (ADS)

    Cuenca, Llanos; Ortiz, Angel; Boza, Andres

    Incorporating information systems and information technology (IS/IT) in the organizations have considerable risks, and these risks are increased when a strategic plan for its incorporation is not done. The objective of this research is to contribute in the alignment between business and IS/IT strategies using concepts and techniques from engineering and enterprise architecture. To achieve this objective, this research proposes to define a modeling framework for business and IS/IT strategic alignment. The implementation of this proposal in a ceramic tile company has helped to validate its usefulness.

  8. Protein structure alignment beyond spatial proximity

    PubMed Central

    Wang, Sheng; Ma, Jianzhu; Peng, Jian; Xu, Jinbo


    Protein structure alignment is a fundamental problem in computational structure biology. Many programs have been developed for automatic protein structure alignment, but most of them align two protein structures purely based upon geometric similarity without considering evolutionary and functional relationship. As such, these programs may generate structure alignments which are not very biologically meaningful from the evolutionary perspective. This paper presents a novel method DeepAlign for automatic pairwise protein structure alignment. DeepAlign aligns two protein structures using not only spatial proximity of equivalent residues (after rigid-body superposition), but also evolutionary relationship and hydrogen-bonding similarity. Experimental results show that DeepAlign can generate structure alignments much more consistent with manually-curated alignments than other automatic tools especially when proteins under consideration are remote homologs. These results imply that in addition to geometric similarity, evolutionary information and hydrogen-bonding similarity are essential to aligning two protein structures. PMID:23486213

  9. Theory of grain alignment in molecular clouds

    NASA Technical Reports Server (NTRS)

    Roberge, Wayne G.


    Research accomplishments are presented and include the following: (1) mathematical theory of grain alignment; (2) super-paramagnetic alignment of molecular cloud grains; and (3) theory of grain alignment by ambipolar diffusion.

  10. Alignment positioning mechanism

    NASA Technical Reports Server (NTRS)

    Fantasia, Peter M. (inventor)


    An alignment positioning mechanism for correcting and compensating for misalignment of structures to be coupled is disclosed. The mechanism comprises a power screw with a base portion and a threaded shank portion. A mounting fixture is provided for rigidly coupling said base portion to the mounting interface of a supporting structure with the axis of the screw perpendicular thereto. A traveling ball nut threaded on the power screw is formed with an external annular arcuate surface configured in the form of a spherical segment and enclosed by a ball nut housing with a conforming arcuate surface for permitting gimballed motion thereon. The ball nut housing is provided with a mounting surface which is positionable in cooperable engagement with the mounting interface of a primary structure to be coupled to the supporting structure. Cooperative means are provided on the ball nut and ball nut housing, respectively, for positioning the ball nut and ball nut housing in relative gimballed position within a predetermined range of relative angular relationship whereby severe structural stresses due to unequal loadings and undesirable bending moments on the mechanism are avoided.

  11. Space Mirror Alignment System

    NASA Technical Reports Server (NTRS)

    Jau, Bruno M.; McKinney, Colin; Smythe, Robert F.; Palmer, Dean L.


    An optical alignment mirror mechanism (AMM) has been developed with angular positioning accuracy of +/-0.2 arcsec. This requires the mirror s linear positioning actuators to have positioning resolutions of +/-112 nm to enable the mirror to meet the angular tip/tilt accuracy requirement. Demonstrated capabilities are 0.1 arc-sec angular mirror positioning accuracy, which translates into linear positioning resolutions at the actuator of 50 nm. The mechanism consists of a structure with sets of cross-directional flexures that enable the mirror s tip and tilt motion, a mirror with its kinematic mount, and two linear actuators. An actuator comprises a brushless DC motor, a linear ball screw, and a piezoelectric brake that holds the mirror s position while the unit is unpowered. An interferometric linear position sensor senses the actuator s position. The AMMs were developed for an Astrometric Beam Combiner (ABC) optical bench, which is part of an interferometer development. Custom electronics were also developed to accommodate the presence of multiple AMMs within the ABC and provide a compact, all-in-one solution to power and control the AMMs.

  12. Contact-based sequence alignment.


    Kleinjung, Jens; Romein, John; Lin, Kuang; Heringa, Jaap


    This paper introduces the novel method of contact-based protein sequence alignment, where structural information in the form of contact mutation probabilities is incorporated into an alignment routine using contact-mutation matrices (CAO: Contact Accepted mutatiOn). The contact-based alignment routine optimizes the score of matched contacts, which involves four (two per contact) instead of two residues per match in pairwise alignments. The first contact refers to a real side-chain contact in a template sequence with known structure, and the second contact is the equivalent putative contact of a homologous query sequence with unknown structure. An algorithm has been devised to perform a pairwise sequence alignment based on contact information. The contact scores were combined with PAM-type (Point Accepted Mutation) substitution scores after parameterization of gap penalties and score weights by means of a genetic algorithm. We show that owing to the structural information contained in the CAO matrices, significantly improved alignments of distantly related sequences can be obtained. This has allowed us to annotate eight putative Drosophila IGF sequences. Contact-based sequence alignment should therefore prove useful in comparative modelling and fold recognition. PMID:15121903

  13. Fusion bonding and alignment fixture


    Ackler, Harold D. (Sunnyvale, CA); Swierkowski, Stefan P. (Livermore, CA); Tarte, Lisa A. (Livermore, CA); Hicks, Randall K. (Stockton, CA)


    An improved vacuum fusion bonding structure and process for aligned bonding of large area glass plates, patterned with microchannels and access holes and slots, for elevated glass fusion temperatures. Vacuum pumpout of all the components is through the bottom platform which yields an untouched, defect free top surface which greatly improves optical access through this smooth surface. Also, a completely non-adherent interlayer, such as graphite, with alignment and location features is located between the main steel platform and the glass plate pair, which makes large improvements in quality, yield, and ease of use, and enables aligned bonding of very large glass structures.

  14. Earth Observation in Environmental and Societal Impacts of Mineral Resources Exploitation

    NASA Astrophysics Data System (ADS)

    Chevrel, Stephane

    Several national and international initiatives, both from the private or the institutional sectors, arised to address the sustainable development of the extractive industry and the reduction of its environmental footprint. Meanwhile, the extractive industry is facing increasing environmental and societal pressures, being regulatory or not, during all phases of a project, from exploration to exploitation and closure. The social acceptability of a project is among the major key issues to be dealt with. The EO-MINERS project (Earth Observation for Monitoring and Observing Environmental and Societal Impacts of Mineral Resources Exploration and Exploitation) is a newly EU funded Research and Technological Development project started in February 2010. EO-MINERS scientific and technical objectives are to: i) assess policy requirements at macro (public) and micro (mining companies) levels and define environmental, socio-economic, societal and sustainable development criteria and indicators to be possibly dealt using EO (Earth Observation); ii) use existing EO knowledge and carry out new developments on demonstration sites to further demonstrate the capabilities of integrated EO-based methods and tools in monitoring, managing and contributing reducing the environmental and societal footprints of the extractive industry during all phases of a mining project, from the exploration to the exploitation and closure stages; iii) contribute making reliable and objective information about affected ecosystems, populations and societies, to serve as a basis for a sound "trialogue" between industrialists, governmental organisations and stakeholders. EO-MINERS also is designed to embed the outcomes of the project firmly in the GEO process through a review the existing GEO Tasks covering the 9 societal benefit and 5 transverse areas defined by GEO work plan 2007-2009. This analysis will be used to identify synergies and gaps between EO-MINERS and GEO, with the aim of mapping mining and environmental observa-tion systems into the 9 GEOSS Societal Benefit Areas, identifying EO-MINERS contributions to existing GEOSS targets and defining new, EO-MINERS activities in support of GEOSS. EO-MINERS will run a minerals workshop with GEO members and/or the GEO Secretariat.

  15. Antares automatic beam alignment system

    SciTech Connect

    Appert, Q.; Swann, T.; Sweatt, W.; Saxman, A.


    Antares is a 24-beam-line CO/sub 2/ laser system for controlled fusion research, under construction at Los Alamos Scientific Laboratory (LASL). Rapid automatic alignment of this system is required prior to each experiment shot. The alignment requirements, operational constraints, and a developed prototype system are discussed. A visible-wavelength alignment technique is employed that uses a telescope/TV system to view point light sources appropriately located down the beamline. Auto-alignment is accomplished by means of a video centroid tracker, which determines the off-axis error of the point sources. The error is nulled by computer-driven, movable mirrors in a closed-loop system. The light sources are fiber-optic terminations located at key points in the optics path, primarily at the center of large copper mirrors, and remotely illuminated to reduce heating effects.

  16. Fixture for aligning motor assembly


    Shervington, Roger M.; Vaghani, Vallabh V.; Vanek, Laurence D.; Christensen, Scott A.


    An alignment fixture includes a rotor fixture, a stator fixture and a sensor system which measures a rotational displacement therebetween. The fixture precisely measures rotation of a generator stator assembly away from a NULL position referenced by a unique reference spline on the rotor shaft. By providing an adjustable location of the stator assembly within the housing, the magnetic axes within each generator shall be aligned to a predetermined and controlled tolerance between the generator interface mounting pin and the reference spline on the rotor shaft. Once magnetically aligned, each generator is essentially a line replaceable unit which may be readily mounted to any input of a multi-generator gearbox assembly with the assurance that the magnetic alignment will be within a predetermined tolerance.

  17. The influence of world societal forces on social tolerance. A time comparative study of prejudices in 32 countries.


    Hadler, Markus


    Societal variation in xenophobia, homophobia, and other prejudices is frequently explained by the economic background and political history of different countries. This article expands these explanations by considering the influence of world societal factors on individual attitudes. The empirical analysis is based on survey data collected within the World Value Survey and European Values Study framework between 1989 and 2010. Data are combined to a three-wave cross-sectional design including about 130,000 respondents from 32 countries. Results show that xenophobia and homophobia are influenced by the national political history, societal affluence, and the presence of international organizations. Global forces, however, are of particular importance for homophobia. PMID:22616117

  18. Well-pump alignment system


    Drumheller, D.S.


    An improved well-pump for geothermal wells, an alignment system for a well-pump, and to a method for aligning a rotor and stator within a well-pump are disclosed, wherein the well-pump has a whistle assembly formed at a bottom portion thereof, such that variations in the frequency of the whistle, indicating misalignment, may be monitored during pumping. 6 figs.

  19. United States societal experiments via the Communications Technology Satellite. [antenna coverage

    NASA Technical Reports Server (NTRS)

    Donoughe, P. L.


    The Communications Technology Satellite (CTS) is a cooperative experimental program of the United States and Canadian governments. The CTS uses a high-power transponder at the frequencies of 14/12 GHz for two-way television and voice communication. The United States and Canada have agreed to share equally in the use of CTS. The U.S. program includes a variety of societal experiments. The ground stations for these experiments are located from the Atlantic to the Pacific. The satellite communications capabilities and the antenna coverage for the U.S. are summarized. Emphasis is placed on the U.S. societal experiments in the areas of education, health care, and community and special services; nine separate experiments are discussed.

  20. Sequence Alignment Tools: One Parallel Pattern to Rule Them All?

    PubMed Central


    In this paper, we advocate high-level programming methodology for next generation sequencers (NGS) alignment tools for both productivity and absolute performance. We analyse the problem of parallel alignment and review the parallelisation strategies of the most popular alignment tools, which can all be abstracted to a single parallel paradigm. We compare these tools to their porting onto the FastFlow pattern-based programming framework, which provides programmers with high-level parallel patterns. By using a high-level approach, programmers are liberated from all complex aspects of parallel programming, such as synchronisation protocols, and task scheduling, gaining more possibility for seamless performance tuning. In this work, we show some use cases in which, by using a high-level approach for parallelising NGS tools, it is possible to obtain comparable or even better absolute performance for all used datasets. PMID:25147803

  1. Projection-based volume alignment.


    Yu, Lingbo; Snapp, Robert R; Ruiz, Teresa; Radermacher, Michael


    When heterogeneous samples of macromolecular assemblies are being examined by 3D electron microscopy (3DEM), often multiple reconstructions are obtained. For example, subtomograms of individual particles can be acquired from tomography, or volumes of multiple 2D classes can be obtained by random conical tilt reconstruction. Of these, similar volumes can be averaged to achieve higher resolution. Volume alignment is an essential step before 3D classification and averaging. Here we present a projection-based volume alignment (PBVA) algorithm. We select a set of projections to represent the reference volume and align them to a second volume. Projection alignment is achieved by maximizing the cross-correlation function with respect to rotation and translation parameters. If data are missing, the cross-correlation functions are normalized accordingly. Accurate alignments are obtained by averaging and quadratic interpolation of the cross-correlation maximum. Comparisons of the computation time between PBVA and traditional 3D cross-correlation methods demonstrate that PBVA outperforms the traditional methods. Performance tests were carried out with different signal-to-noise ratios using modeled noise and with different percentages of missing data using a cryo-EM dataset. All tests show that the algorithm is robust and highly accurate. PBVA was applied to align the reconstructions of a subcomplex of the NADH: ubiquinone oxidoreductase (Complex I) from the yeast Yarrowia lipolytica, followed by classification and averaging. PMID:23410725

  2. Awareness of Societal Issues Among High School Biology Teachers Teaching Genetics

    Microsoft Academic Search

    Reuven Lazarowitz; Ilit Bloch


    The purpose of this study was to investigate how aware high school biology teachers are of societal issues (values, moral,\\u000a ethic, and legal issues) while teaching genetics, genetics engineering, molecular genetics, human heredity, and evolution.\\u000a The study includes a short historical review of World War II atrocities during the Holocaust when scientists from all the\\u000a above-mentioned disciplines had been involved

  3. The total assessment profile, volume 1. [including societal impact cost effectiveness, and economic analysis

    NASA Technical Reports Server (NTRS)

    Leininger, G.; Jutila, S.; King, J.; Muraco, W.; Hansell, J.; Lindeen, J.; Franckowiak, E.; Flaschner, A.


    A methodology is described for the evaluation of societal impacts associated with the implementation of a new technology. Theoretical foundations for the methodology, called the total assessment profile, are established from both the economic and social science perspectives. The procedure provides for accountability of nonquantifiable factors and measures through the use of a comparative value matrix by assessing the impacts of the technology on the value system of the society.

  4. Societal impact of a serious game on raising public awareness: the case of FloodSim

    Microsoft Academic Search

    Genaro Rebolledo-Mendez; Katerina Avramides; Sara de Freitas; Kam Memarzia


    This paper presents an evaluation of the societal impact of a simulation-based Serious Game. FloodSim was developed with the aim of raising awareness of issues surrounding flooding policy and citizen engagement in the UK. The game was played by a large number of users (N=25,701) in a period of 4 weeks. Quantitative and qualitative analyses (on a reduced data set)

  5. Societal and ethical issues in human biomonitoring – a view from science studies

    PubMed Central

    Bauer, Susanne


    Background Human biomonitoring (HBM) has rapidly gained importance. In some epidemiological studies, the measurement and use of biomarkers of exposure, susceptibility and disease have replaced traditional environmental indicators. While in HBM, ethical issues have mostly been addressed in terms of informed consent and confidentiality, this paper maps out a larger array of societal issues from an epistemological perspective, i.e. bringing into focus the conditions of how and what is known in environmental health science. Methods In order to analyse the effects of HBM and the shift towards biomarker research in the assessment of environmental pollution in a broader societal context, selected analytical frameworks of science studies are introduced. To develop the epistemological perspective, concepts from "biomedical platform sociology" and the notion of "epistemic cultures" and "thought styles" are applied to the research infrastructures of HBM. Further, concepts of "biocitizenship" and "civic epistemologies" are drawn upon as analytical tools to discuss the visions and promises of HBM as well as related ethical problematisations. Results In human biomonitoring, two different epistemological cultures meet; these are environmental science with for instance pollution surveys and toxicological assessments on the one hand, and analytical epidemiology investigating the association between exposure and disease in probabilistic risk estimation on the other hand. The surveillance of exposure and dose via biomarkers as envisioned in HBM is shifting the site of exposure monitoring to the human body. Establishing an HBM platform faces not only the need to consider individual decision autonomy as an ethics issue, but also larger epistemological and societal questions, such as the mode of evidence demanded in science, policy and regulation. Conclusion The shift of exposure monitoring towards the biosurveillance of human populations involves fundamental changes in the ways environment, health and disease are conceptualised; this may lead to an individualisation of responsibilities for health risks and preventive action. Attention to the conditions of scientific knowledge generation and to their broader societal context is critical in order to make HBM contribute to environmental justice. PMID:18541064

  6. Balancing consumer and societal requirements for sheep meat production: an Australasian perspective.


    Ferguson, D M; Schreurs, N M; Kenyon, P R; Jacob, R H


    Although there has been a decline in sheep numbers in Australia and New Zealand, both countries remain significant producers and exporters of sheep meat. The ongoing demand for more sustainable and ethical animal farming systems and practices requires sheep production industries to be both vigilant and responsive to consumer and the broader societal needs. Demonstration of continuous improvement in animal welfare is paramount and the welfare risks and challenges confronting Australasian sheep industries now and into the future are discussed. PMID:25015875

  7. BinAligner: a heuristic method to align biological networks

    PubMed Central


    The advances in high throughput omics technologies have made it possible to characterize molecular interactions within and across various species. Alignments and comparison of molecular networks across species will help detect orthologs and conserved functional modules and provide insights on the evolutionary relationships of the compared species. However, such analyses are not trivial due to the complexity of network and high computational cost. Here we develop a mixture of global and local algorithm, BinAligner, for network alignments. Based on the hypotheses that the similarity between two vertices across networks would be context dependent and that the information from the edges and the structures of subnetworks can be more informative than vertices alone, two scoring schema, 1-neighborhood subnetwork and graphlet, were introduced to derive the scoring matrices between networks, besides the commonly used scoring scheme from vertices. Then the alignment problem is formulated as an assignment problem, which is solved by the combinatorial optimization algorithm, such as the Hungarian method. The proposed algorithm was applied and validated in aligning the protein-protein interaction network of Kaposi's sarcoma associated herpesvirus (KSHV) and that of varicella zoster virus (VZV). Interestingly, we identified several putative functional orthologous proteins with similar functions but very low sequence similarity between the two viruses. For example, KSHV open reading frame 56 (ORF56) and VZV ORF55 are helicase-primase subunits with sequence identity 14.6%, and KSHV ORF75 and VZV ORF44 are tegument proteins with sequence identity 15.3%. These functional pairs can not be identified if one restricts the alignment into orthologous protein pairs. In addition, BinAligner identified a conserved pathway between two viruses, which consists of 7 orthologous protein pairs and these proteins are connected by conserved links. This pathway might be crucial for virus packing and infection. PMID:24266981

  8. Emerging research in micro and nano systems: opportunities and challenges for societal impact

    NASA Astrophysics Data System (ADS)

    Gianchandani, Yogesh B.


    In just a few decades, micro and nano technologies have changed the way that we live - how we work and communicate; the food and medicine that we consume; the clothing that we use; and the entertainment that we seek. While these technologies are being actively investigated in several research communities, the potential for continued societal impact is constrained by resources available for system-level research. Given the long time-lines and levels of investment that are typically necessary to develop functional systems, strategic prioritization of research directions from the perspective of societal needs can be helpful. This paper outlines the findings of an NSF-sponsored road-mapping workshop that was held in 2009, with the intention of initiating a conversation about the opportunities and challenges for micro and nano systems. Four areas of need were discussed: environmental sensing; health care; infrastructure monitoring; and energy alternatives. Possible research trajectories were identified by envisioning technological goals for the year 2040, and linking these to horizons for 2015 and 2025. This paper also provides few examples of current research in each of the four application domains. It is noted that a systems perspective can help to keep the research focused, accelerating and amplifying the societal gain with available resources. Practical and affordable solutions at the system level will require partnerships between specialists, and also between academia and industry.

  9. Individual and societal impact on earnings associated with serious mental illness in metropolitan China

    PubMed Central

    Lee, Sing; Tsang, Adley; Huang, Yue-qin; He, Yan-ling; Liu, Zhao-rui; Zhang, Ming-yuan; Shen, Yu-cun; Kessler, Ronald C.


    To evaluate individual-level and societal-level losses of income associated with serious mental illness in metropolitan China, a multi-stage probability survey was administered to adults aged 18–70 in Beijing and Shanghai. We used data to estimate individual-level expected earnings from a model that included information about the respondents’ education level, marital status, age, and gender. Expected earnings were compared to observed earnings among respondents with mental illness and serious disability. The result shows that the 12-month prevalence of such serious mental illness was 0.6%. Its impact on earnings was significant in the total sample and was higher for males (76% of gender-specific expected salary was lost) than females (32%). When projected to societal level, the annual impact was estimated to be 466 million Renminbi (RMB 8.27= USD 1), less than 0.2% of the Gross Domestic Product (GDP) of the two cities. Serious mental illness was associated with a substantial decrease in individual-level earnings, but the burden that resulted from societal-level loss of earnings was not large enough to help drive mental health policy and programs in China. PMID:20493555

  10. The linkage of technology strategy and overall strategy of multi business diversified groups: Literature review and theoritical framework

    Microsoft Academic Search

    Mohammad R. Arasti; Mahdi Khaleghi; Javad Noori


    This article deals with technology strategy and its linkage with overall strategy at multi-business, diversified groups. In the last two decades, the alignment of technology and business strategy has been one of the important research fields in strategy and technology management scopes. These researchs has been concentrated on single companies through which different frameworks, models & decision support tools have

  11. Mass Spectra Alignments and their Significance

    E-print Network

    Lonardi, Stefano

    ¨ocker, Kaltenbach Mass Spectra Alignments CPM 2005 #12;Overview Mass Spectrometry in Proteomics Protein Alignments CPM 2005 #12;Overview Mass Spectrometry in Proteomics Protein Identification via MS Alignment Mass Spectrometry in Proteomics Protein Identification via MS Alignment of Spectra Score Significance

  12. A Nonlinear Observer for Gyro Alignment Estimation

    NASA Technical Reports Server (NTRS)

    Thienel, J.; Sanner, R. M.


    A nonlinear observer for gyro alignment estimation is presented. The observer is composed of two error terms, an attitude error and an alignment error. The observer is globally stable with exponential convergence of the attitude errors. The gyro alignment estimate converges to the true alignment when the system is completely observable.

  13. Bitext Alignment for Statistical Machine Translation

    E-print Network

    Byrne, William

    Results 4 Conclusions Y. Deng (Johns Hopkins) Bitext Alignment for SMT 6 / 42 #12;Bitext Chunk Alignment M for Language and Speech Processing The Johns Hopkins University Baltimore, MD 21218 20th December 2005 Y. Deng (Johns Hopkins) Bitext Alignment for SMT 1 / 42 #12;Bitext and Bitext Alignment Bitext: a collection

  14. A Greedy Algorithm for Aligning DNA Sequences

    Microsoft Academic Search

    Scott Schwartz; Lukas Wagner; Webb Miller


    For aligning DNA sequences that differ only by sequencing errors, or by equivalent errors from other sources, a greedy algorithm can be much faster than traditional dynamic pro- gramming approaches and yet produce an alignment that is guaranteed to be theoretically optimal. We introduce a new greedy alignment algorithm withparticularly good performance and show that it computes the same alignment

  15. Alignment 2.0: Strategic Use of New Internet Technologies in Government

    ERIC Educational Resources Information Center

    Meijer, Albert; Thaens, Marcel


    This paper challenges the view that strategies for using Web 2.0 should primarily be based upon technological characteristics. The value of the organizational strategic alignment approach for developing specific operational Web 2.0 strategies for government organizations is explored both theoretically and empirically. On the basis of a review of…

  16. Redesigning and aligning assessment and evaluation for a federally funded math and science teacher educational program

    Microsoft Academic Search

    Patricia L. Hardré; Janis Slater; Mark Nanny


    This paper examines the redesign of evaluation components for a teacher professional development project funded by the National Science Foundation. It focuses on aligning evaluation instrumentation and strategies with program goals, research goals and program evaluation best practices. The study identifies weaknesses in the original (year 1) program evaluation design and implementation, develops strategies and tracks changes for year 2

  17. Development of a Societal-Risk Goal for Nuclear Power Safety

    SciTech Connect

    Vicki Bier; Michael Corradini; Robert Youngblood; Caleb Roh; Shuji Liu


    The safety-goal policy of the Nuclear Regulatory Commission (NRC) has never included a true societal-risk goal. The NRC did acknowledge that the original goal for the risk of latent cancer facilities “was an individual risk goal not related to the number of people involved,” and stated that “a true societal risk goal would place a limit on the aggregate number of people affected.” However, this limitation was never satisfactorily addressed. Moreover, the safety goal has historically focused primarily on fatalities and latent health effects, while experience with actual nuclear accidents has shown that societal disruption can be significant even in accidents that yield only small to modest numbers of fatalities. Therefore, we have evaluated the social disruption effects from severe reactor accidents as a basis to develop a societal-risk goal for nuclear power plants, considering both health effects and non-health concerns such as property damage and land interdiction. Our initial analysis considered six different nuclear power plant sites in the U.S. for Boiling Water Reactors and Pressurized Water Reactors. The accident sequences considered for these two reactor types were station blackout sequences (both short-term and long-term SBO) as well as an STSBO with RCIC failure for the BWR and a Steam Generator Tube Rupture for the PWR. The source term release was an input in a RASCAL calculation of the off-site consequences using actual site-based weather data for each of the six plant sites randomly selected over a two-year period. The source term release plumes were then compared to Geographical Information System data for each site to determine the population affected and that would need to be evacuated to meet current emergency preparedness regulations. Our results to date suggest that number of people evacuated to meet current protective action guidelines appears to be a good proxy for disruption -- and, unlike other measures of disruption, has the advantage of being relatively straightforward to calculate for a given accident scenario and a given geographical location and plant site. Revised safety goals taking into account the potential for societal disruption could in principle be applied to the current generation of nuclear plants, but could also be used in evaluating and siting new technologies, such as small modular light water reactors, advanced Gen-IV high-temperature reactors, as well as reactor designs with passive safety features such as filtered vented containments.

  18. Alignment method for parabolic trough solar concentrators


    Diver, Richard B. (Albuquerque, NM)


    A Theoretical Overlay Photographic (TOP) alignment method uses the overlay of a theoretical projected image of a perfectly aligned concentrator on a photographic image of the concentrator to align the mirror facets of a parabolic trough solar concentrator. The alignment method is practical and straightforward, and inherently aligns the mirror facets to the receiver. When integrated with clinometer measurements for which gravity and mechanical drag effects have been accounted for and which are made in a manner and location consistent with the alignment method, all of the mirrors on a common drive can be aligned and optimized for any concentrator orientation.

  19. Paramagnetic alignment of thermally rotating dust

    E-print Network

    A. Lazarian


    Paramagnetic alignment of thermally rotating oblate dust grains is studied analytically for finite ratios of grain to gas temperatures. For such ratios, the alignment of angular momentum J in respect to the grain axis of maximal inertia is only partial. We treat the alignment of J using perturbative methods and disentangle the problem of J alignment in grain body axes from that of J alignment in respect to magnetic field. This enables us to find the alignment of grain axes to magnetic field and thus relate our theory to polarimetric observations.Our present results are applicable to the alignment of both paramagnetic and superparamagnetic grains.

  20. SATe-II: very fast and accurate simultaneous estimation of multiple sequence alignments and phylogenetic trees.


    Liu, Kevin; Warnow, Tandy J; Holder, Mark T; Nelesen, Serita M; Yu, Jiaye; Stamatakis, Alexandros P; Linder, C Randal


    Highly accurate estimation of phylogenetic trees for large data sets is difficult, in part because multiple sequence alignments must be accurate for phylogeny estimation methods to be accurate. Coestimation of alignments and trees has been attempted but currently only SATé estimates reasonably accurate trees and alignments for large data sets in practical time frames (Liu K., Raghavan S., Nelesen S., Linder C.R., Warnow T. 2009b. Rapid and accurate large-scale coestimation of sequence alignments and phylogenetic trees. Science. 324:1561-1564). Here, we present a modification to the original SATé algorithm that improves upon SATé (which we now call SATé-I) in terms of speed and of phylogenetic and alignment accuracy. SATé-II uses a different divide-and-conquer strategy than SATé-I and so produces smaller more closely related subsets than SATé-I; as a result, SATé-II produces more accurate alignments and trees, can analyze larger data sets, and runs more efficiently than SATé-I. Generally, SATé is a metamethod that takes an existing multiple sequence alignment method as an input parameter and boosts the quality of that alignment method. SATé-II-boosted alignment methods are significantly more accurate than their unboosted versions, and trees based upon these improved alignments are more accurate than trees based upon the original alignments. Because SATé-I used maximum likelihood (ML) methods that treat gaps as missing data to estimate trees and because we found a correlation between the quality of tree/alignment pairs and ML scores, we explored the degree to which SATé's performance depends on using ML with gaps treated as missing data to determine the best tree/alignment pair. We present two lines of evidence that using ML with gaps treated as missing data to optimize the alignment and tree produces very poor results. First, we show that the optimization problem where a set of unaligned DNA sequences is given and the output is the tree and alignment of those sequences that maximize likelihood under the Jukes-Cantor model is uninformative in the worst possible sense. For all inputs, all trees optimize the likelihood score. Second, we show that a greedy heuristic that uses GTR+Gamma ML to optimize the alignment and the tree can produce very poor alignments and trees. Therefore, the excellent performance of SATé-II and SATé-I is not because ML is used as an optimization criterion for choosing the best tree/alignment pair but rather due to the particular divide-and-conquer realignment techniques employed. PMID:22139466

  1. Aligned Nanofibers for Regenerating Arteries, Nerves, and Muscles

    NASA Astrophysics Data System (ADS)

    McClendon, Mark Trosper

    Cells are the fundamental unit of the human body, and therefore the ability to control cell behavior is the most important challenge in regenerative medicine. Peptides are the language of biology which is why synthetic peptide amphiphile (PA) molecules hold great potential as a biomaterial. The work presented in this dissertation explores a variety of liquid crystalline PA nanofibers as a means for directing cell growth. Shaping the alignment of these nanofiber networks requires a deep understanding of their rheological properties which presents a difficult challenge as they exist in complex solid and liquid environments. Using PA molecules that self-assemble into high aspect ratio nanofibers and liquid crystalline solutions, this work investigates the influence of shear flow on macroscopic and microscopic nanofiber alignment. To this end, a shear force applied to PA solutions was systematically varied while the alignment was probed using small angle x-ray scattering. Nanofibers were found to respond to shear flow by aligning parallel to the flow direction. By changing pH and PA chemical sequence it was observed that increasing the interfiber electrostatic repulsive interactions resulted in a greater dependence on shear rate. Nanofiber solutions having greater repulsion did not drastically increase in alignment when the applied strain was increased by two orders of magnitude (1 s -1 to 100 s-1), while solutions with nanofibers having less repulsion increased there alignment four fold with the same strain increase. say exactly what you mean by resulted in greater dependence: did it result in fibers aligning under lower shear rates or higher rates--give the results Anionic PA solutions typically used to encapsulate living cells at neutral pH were found to require minimal shear rates, <1s-1, to achieve significant nanofiber alignment. In an effort to produce tubular hydrogels composed of circumferentially aligned nanofibers, a procedure was designed that used an annular gap containing PA solution with a rotating rod. Using the shear aligning properties of PA solutions this rotating surface in contact with the PA solution induced a high degree of alignment in the nanofibers which was subsequently locked in place by introducing gelating calcium ions. again say something about what this fabrication procedure entails Cells encapsulated within these tubes responded to the alignment by extending in the circumferential direction mimicking the same cellular alignment observed in native arteries. A similar design strategy was also used to align nanofibers within the core of biopolymer nerve conduits, and these scaffolds were implanted in a rat sciatic nerve model. Histological and behavioral observations confirmed that PA implants sustained regeneration rates comparable to autologous grafts and significantly better than empty biopolymer grafts. Furthermore, these nanofiber gels were used as a vehicle to deliver stem cells into muscle tissue. A specialized injector was designed to introduce aligned PA gels into mouse leg muscles in a 1cm long channel. Bioluminescence and histology showed that stem cell engraftment into myofibers was greatly enhanced when delivered by PA gels compared to saline solution. The final section of this thesis describes a new series of PA molecules designed to degrade upon exposure to UV lightstate here why is this of interest in the context of the work described in the thesis. This was done to understand the degradation behavior of PA nanofibers and provide a controlled approach to changing the rheological properties post gelation.The three PA molecules in this series contained the same peptide sequence V3A3E3, while varying the location of a nitrobenzyl UV-reactive group along the backbone of the molecule. This system allowed for a quick reaction that cleaves the molecule at the reactive nitrobenzyl site without introducing any other reactive molecules. While all three molecules produced nanofibers that remained intact upon UV exposure, the PA having its cleavage point nearest to the hydrophobic core r

  2. Gene order alignment on trees with multiOrthoAlign

    PubMed Central


    We relate the comparison of gene orders to an alignment problem. Our evolutionary model accounts for both rearrangement and content-modifying events. We present a heuristic based on dynamic programming for the inference of the median of three genomes and apply it in a phylogenetic framework. multiOrthoAlign is shown accurate on simulated and real datasets, and shown to significantly improve the running-time of DupLoCut, an "almost" exact algorithm based on linear programming, developed recently for the same problem. PMID:25572278

  3. Encouraging Spontaneous Synchronisation with D-Jogger, an Adaptive Music Player That Aligns Movement and Music

    PubMed Central

    Moens, Bart; Muller, Chris; van Noorden, Leon; Fran?k, Marek; Celie, Bert; Boone, Jan; Bourgois, Jan; Leman, Marc


    In this study we explore how music can entrain human walkers to synchronise to the musical beat without being instructed to do so. For this, we use an interactive music player, called D-Jogger, that senses the user's walking tempo and phase. D-Jogger aligns the music by manipulating the timing difference between beats and footfalls. Experiments are reported that led to the development and optimisation of four alignment strategies. The first strategy matched the music's tempo continuously to the runner's pace. The second strategy matched the music's tempo at the beginning of a song to the runner's pace, keeping the tempo constant for the remainder of the song. The third alignment starts a song in perfect phase synchrony and continues to adjust the tempo to match the runner's pace. The fourth and last strategy additionally adjusts the phase of the music so each beat matches a footfall. The first two strategies resulted in a minor increase of steps in phase synchrony with the main beat when compared to a random playlist, the last two strategies resulted in a strong increase in synchronised steps. These results may be explained in terms of phase-error correction mechanisms and motor prediction schemes. Finding the phase-lock is difficult due to fluctuations in the interaction, whereas strategies that automatically align the phase between movement and music solve the problem of finding the phase-locking. Moreover, the data show that once the phase-lock is found, alignment can be easily maintained, suggesting that less entrainment effort is needed to keep the phase-lock, than to find the phase-lock. The different alignment strategies of D-Jogger can be applied in different domains such as sports, physical rehabilitation and assistive technologies for movement performance. PMID:25489742

  4. Improving pairwise sequence alignment accuracy using near-optimal protein sequence alignments

    PubMed Central


    Background While the pairwise alignments produced by sequence similarity searches are a powerful tool for identifying homologous proteins - proteins that share a common ancestor and a similar structure; pairwise sequence alignments often fail to represent accurately the structural alignments inferred from three-dimensional coordinates. Since sequence alignment algorithms produce optimal alignments, the best structural alignments must reflect suboptimal sequence alignment scores. Thus, we have examined a range of suboptimal sequence alignments and a range of scoring parameters to understand better which sequence alignments are likely to be more structurally accurate. Results We compared near-optimal protein sequence alignments produced by the Zuker algorithm and a set of probabilistic alignments produced by the probA program with structural alignments produced by four different structure alignment algorithms. There is significant overlap between the solution spaces of structural alignments and both the near-optimal sequence alignments produced by commonly used scoring parameters for sequences that share significant sequence similarity (E-values < 10-5) and the ensemble of probA alignments. We constructed a logistic regression model incorporating three input variables derived from sets of near-optimal alignments: robustness, edge frequency, and maximum bits-per-position. A ROC analysis shows that this model more accurately classifies amino acid pairs (edges in the alignment path graph) according to the likelihood of appearance in structural alignments than the robustness score alone. We investigated various trimming protocols for removing incorrect edges from the optimal sequence alignment; the most effective protocol is to remove matches from the semi-global optimal alignment that are outside the boundaries of the local alignment, although trimming according to the model-generated probabilities achieves a similar level of improvement. The model can also be used to generate novel alignments by using the probabilities in lieu of a scoring matrix. These alignments are typically better than the optimal sequence alignment, and include novel correct structural edges. We find that the probA alignments sample a larger variety of alignments than the Zuker set, which more frequently results in alignments that are closer to the structural alignments, but that using the probA alignments as input to the regression model does not increase performance. Conclusions The pool of suboptimal pairwise protein sequence alignments substantially overlaps structure-based alignments for pairs with statistically significant similarity, and a regression model based on information contained in this alignment pool improves the accuracy of pairwise alignments with respect to structure-based alignments. PMID:20307279

  5. A New Algorithm for the Alignment of Inertial Measurement Units Without External Observation for Land Vehicle Applications

    Microsoft Academic Search

    Gamini Dissanayake; Eduardo Mario Nebot; Salah Sukkarieh; Hugh F. Durrant-whyte


    Describes a real time, on-the-fly, roll and pitch alignment algorithm for inertial measurement units (IMUs) mounted on land vehicles. Unlike conventional strategies, the alignment is achieved without external observations. This is achieved by exploiting the nonholonomic constraints that govern the motion of a vehicle on a surface to obtain the roll and pitch of the IMU. The position of the

  6. Grain Alignment in Starless Cores

    NASA Astrophysics Data System (ADS)

    Jones, T. J.; Bagley, M.; Krejny, M.; Andersson, B.-G.; Bastien, P.


    We present near-IR polarimetry data of background stars shining through a selection of starless cores taken in the K band, probing visual extinctions up to {{A}V}˜ 48. We find that {{P}K}/{{? }K} continues to decline with increasing AV with a power law slope of roughly -0.5. Examination of published submillimeter (submm) polarimetry of starless cores suggests that by {{A}V}? 20 the slope for P versus ? becomes ˜-1, indicating no grain alignment at greater optical depths. Combining these two data sets, we find good evidence that, in the absence of a central illuminating source, the dust grains in dense molecular cloud cores with no internal radiation source cease to become aligned with the local magnetic field at optical depths greater than {{A}V}˜ 20. A simple model relating the alignment efficiency to the optical depth into the cloud reproduces the observations well.

  7. Technology management competences supporting the business strategy

    Microsoft Academic Search

    Victoria E. Erosa; Pilar E. Arroyo


    The execution of the business strategy requires the integration of market conditions, organizational capabilities and direction. Under this principle, Top Management needs to align theirs and the firm's human resources competences with the business strategy and the characteristics of the business environment. Competences represent a dynamic combination of knowledge, expertise, attitudes and responsibilities acquired through professional studies that are used

  8. XUV ionization of aligned molecules

    SciTech Connect

    Kelkensberg, F.; Siu, W.; Gademann, G. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Rouzee, A.; Vrakking, M. J. J. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Max-Born-Institut, Max-Born Strasse 2A, D-12489 Berlin (Germany); Johnsson, P. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Department of Physics, Lund University, Post Office Box 118, SE-221 00 Lund (Sweden); Lucchini, M. [Department of Physics, Politecnico di Milano, Istituto di Fotonica e Nanotecnologie CNR-IFN, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Lucchese, R. R. [Department of Chemistry, Texas A and M University, College Station, Texas 77843-3255 (United States)


    New extreme-ultraviolet (XUV) light sources such as high-order-harmonic generation (HHG) and free-electron lasers (FELs), combined with laser-induced alignment techniques, enable novel methods for making molecular movies based on measuring molecular frame photoelectron angular distributions. Experiments are presented where CO{sub 2} molecules were impulsively aligned using a near-infrared laser and ionized using femtosecond XUV pulses obtained by HHG. Measured electron angular distributions reveal contributions from four orbitals and the onset of the influence of the molecular structure.

  9. Measurements of magnetic field alignment

    SciTech Connect

    Kuchnir, M.; Schmidt, E.E.


    The procedure for installing Superconducting Super Collider (SSC) dipoles in their respective cryostats involves aligning the average direction of their field with the vertical to an accuracy of 0.5 mrad. The equipment developed for carrying on these measurements is described and the measurements performed on the first few prototypes SSC magnets are presented. The field angle as a function of position in these 16.6 m long magnets is a characteristic of the individual magnet with possible feedback information to its manufacturing procedure. A comparison of this vertical alignment characteristic with a magnetic field intensity (by NMR) characteristic for one of the prototypes is also presented. 5 refs., 7 figs.

  10. Self-aligning pinhole system

    NASA Astrophysics Data System (ADS)

    Green, Evan D.; Farinas, Alejandro D.; Cordes, Andrew H.; Day, Timothy


    A practical self-aligning pinhole (SAP) system, capable of actively aligning a pinhole to an incident optical beam, has been demonstrated. The enabling technology for the SAP is a silicon micromachined pinhole (SiMP). The SiMP is an example of a simple optical element fabricated from silicon in order to take advantage of both the mechanical structure allowed by micromachining technology and the electrical structures allowed by semiconductor technology. To complete the transformation from an enabling technology to a working system, development was necessary in packaging, mechanical mounting and operation, and algorithms.

  11. The alignment-distribution graph

    NASA Technical Reports Server (NTRS)

    Chatterjee, Siddhartha; Gilbert, John R.; Schreiber, Robert


    Implementing a data-parallel language such as Fortran 90 on a distributed-memory parallel computer requires distributing aggregate data objects (such as arrays) among the memory modules attached to the processors. The mapping of objects to the machine determines the amount of residual communication needed to bring operands of parallel operations into alignment with each other. We present a program representation called the alignment distribution graph that makes these communication requirements explicit. We describe the details of the representation, show how to model communication cost in this framework, and outline several algorithms for determining object mappings that approximately minimize residual communication.

  12. The alignment-distribution graph

    NASA Technical Reports Server (NTRS)

    Chatterjee, Siddhartha; Gilbert, John R.; Schreiber, Robert


    Implementing a data-parallel language such as Fortran 90 on a distributed-memory parallel computer requires distributing aggregate data objects (such as arrays) among the memory modules attached to the processors. The mapping of objects to the machine determines the amount of residual communication needed to bring operands of parallel operations into alignment with each other. We present a program representation called the alignment-distribution graph that makes these communication requirements explicit. We describe the details of the representation, show how to model communication cost in this framework, and outline several algorithms for determining object mappings that approximately minimize residual communication.

  13. Provides overall leadership for and management of the University's human resources strategy. Responsible for planning, organizing, directing, implementing, and administering human resources strategy, policies and

    E-print Network

    Dasgupta, Dipankar

    . Responsible for planning, organizing, directing, implementing, and administering human resources strategyProvides overall leadership for and management of the University's human resources strategy to define, develop and deliver effective human resources practices that are aligned with the mission, vision

  14. Alignment strategies for drug product process development and manufacturing

    E-print Network

    Garvin, Christopher John


    The transfer of information between the drug product development and manufacturing organizations is fundamental to drug product commercialization. This information is used to characterize the product-process interaction ...

  15. Hydrogen Vehicles: Impacts of DOE Technical Targets on Market Acceptance and Societal Benefits

    SciTech Connect

    Lin, Zhenhong [ORNL; Dong, Jing [Iowa State University; Greene, David L [ORNL


    Hydrogen vehicles (H2V), including H2 internal combustion engine, fuel cell and fuel cell plugin hybrid, could greatly reduce petroleum consumption and greenhouse gas (GHG) emissions in the transportation sector. The U.S. Department of Energy has adopted targets for vehicle component technologies to address key technical barriers towidespread commercialization of H2Vs. This study estimates the market acceptance of H2Vs and the resulting societal benefits and subsidy in 41 scenarios that reflect a wide range of progress in meeting these technical targets. Important results include: (1) H2Vs could reach 20e70% market shares by 2050, depending on progress in achieving the technical targets.With a basic hydrogen infrastructure (w5% hydrogen availability), the H2V market share is estimated to be 2e8%. Fuel cell and hydrogen costs are the most important factors affecting the long-term market shares of H2Vs. (2) Meeting all technical targets on time could result in about an 80% cut in petroleumuse and a 62% (or 72% with aggressive electricity de-carbonization) reduction in GHG in 2050. (3) The required hydrogen infrastructure subsidy is estimated to range from $22 to $47 billion and the vehicle subsidy from $4 to $17 billion. (4) Long-term H2V market shares, societal benefits and hydrogen subsidies appear to be highly robust against delay in one target, if all other targets are met on time. R&D diversification could provide insurance for greater societal benefits. (5) Both H2Vs and plug-in electric vehicles could exceed 50% market shares by 2050, if all targets are met on time. The overlapping technology, the fuel cell plug-in hybrid electric vehicle, appears attractive both in the short and long runs, but for different reasons.

  16. Air Quality Management Using Modern Remote Sensing and Spatial Technologies and Associated Societal Costs

    PubMed Central

    Uddin, Waheed


    This paper presents a study of societal costs related to public health due to the degradation of air quality and the lack of physical activity, both affected by our built environment. The paper further shows road safety as another public health concern. Traffic fatalities are the number one cause of death in the world. Traffic accidents result in huge financial loss to the people involved and the related public health cost is a significant part of the total societal cost. Motor vehicle exhausts and industrial emissions, gasoline vapors, and chemical solvents as well as natural sources emit nitrogen oxides and volatile organic compounds, which are precursors to the formation of ground-level Ozone. High concentration values of ground-level Ozone in hot summer days produce smog and lead to respiratory problems and loss in worker’s productivity. These factors and associated economic costs to society are important in establishing public policy and decision-making for sustainable transportation and development of communities in both industrialized and developing countries. This paper presents new science models for predicting ground-level Ozone and related air quality degradation. The models include predictor variables of daily climatological data, traffic volume and mix, speed, aviation data, and emission inventory of point sources. These models have been implemented in the user friendly AQMAN computer program and used for a case study in Northern Mississippi. Life-cycle benefits from reduced societal costs can be used to implement sustainable transportation policies, enhance investment decision-making, and protect public health and the environment. PMID:16968969

  17. Societal and ethical implications of anti-spoofing technologies in biometrics.


    Rebera, Andrew P; Bonfanti, Matteo E; Venier, Silvia


    Biometric identification is thought to be less vulnerable to fraud and forgery than are traditional forms of identification. However biometric identification is not without vulnerabilities. In a 'spoofing attack' an artificial replica of an individual's biometric trait is used to induce a system to falsely infer that individual's presence. Techniques such as liveness-detection and multi-modality, as well as the development of new and emerging modalities, are intended to secure biometric identification systems against such threats. Unlike biometrics in general, the societal and ethical issues raised by spoofing and anti-spoofing techniques have not received much attention. This paper examines these issues. PMID:23579470

  18. Being who I am: effective teaching, learning, student support, and societal change through LGBQ faculty freedom.


    Orlov, Janice M; Allen, Katherine R


    Framed within the context of a heterosexist society in which not all sexual minority faculty feel professionally and/or personally safe stepping out of the classroom closet, this qualitative study examines the phenomenon of non-heterosexual faculty disclosing their sexual orientation to students in their classrooms. Findings demonstrate the depth and magnitude of impact the disclosure has on teaching, learning, student support, and societal change. Overarching is that faculty do not necessarily view the experience as "coming out in the classroom," but rather as "being who I am" in terms of freedom to present an authentic self, if so desired, to students. PMID:24325330

  19. The Virgo automatic alignment system

    Microsoft Academic Search

    F. Acernese; P. Amico; M. Al-Shourbagy; S. Aoudia; S. Avino; D. Babusci; G. Ballardin; R. Barillé; F. Barone; L. Barsotti; M. Barsuglia; F. Beauville; M. A. Bizouard; C. Boccara; F. Bondu; L. Bosi; C. Bradaschia; S. Braccini; A. Brillet; V. Brisson; L. Brocco; D. Buskulic; E. Calloni; E. Campagna; F. Cavalier; R. Cavalieri; G. Cella; E. Chassande-Mottin; C. Corda; A.-C. Clapson; F. Cleva; J.-P. Coulon; E. Cuoco; V. Dattilo; M. Davier; R. De Rosa; L. Di Fiore; A. Di Virgilio; B. Dujardin; A. Eleuteri; D. Enard; I. Ferrante; F. Fidecaro; I. Fiori; R. Flaminio; J.-D. Fournier; S. Frasca; F. Frasconi; A. Freise; L. Gammaitoni; A. Gennai; A. Giazotto; G. Giordano; L. Giordano; R. Gouaty; D. Grosjean; G. Guidi; S. Hebri; H. Heitmann; P. Hello; L. Holloway; S. Kreckelbergh; P. La Penna; V. Loriette; M. Loupias; G. Losurdo; J.-M. Mackowski; E. Majorana; C. N. Man; M. Mantovani; F. Marchesoni; F. Marion; J. Marque; F. Martelli; A. Masserot; M. Mazzoni; L. Milano; C. Moins; J. Moreau; N. Morgado; B. Mours; A. Pai; C. Palomba; F. Paoletti; S. Pardi; A. Pasqualetti; R. Passaquieti; D. Passuello; B. Perniola; F. Piergiovanni; L. Pinard; R. Poggiani; M. Punturo; P. Puppo; K. Qipiani; P. Rapagnani; V. Reita; A. Remillieux; F. Ricci; I. Ricciardi; P. Ruggi; G. Russo; S. Solimeno; A. Spallicci; R. Stanga; R. Taddei; D. Tombolato; M. Tonelli; A. Toncelli; E. Tournefier; F. Travasso; G. Vajente; D. Verkindt; F. Vetrano; A. Viceré; J.-Y. Vinet; H. Vocca; M. Yvert; Z. Zhang


    The automatic alignment system of the Virgo interferometer differs substantially from those used in similar experiments, since it uses a variant of the Anderson technique. This implies a completely different control topology with respect to other detectors, and the main feature is a strong coupling of different degrees of freedom in the optical signals. It also provides two extra output


    PubMed Central

    Mardia, Kanti V.; Fallaize, Christopher J.; Barber, Stuart; Jackson, Richard M.; Theobald, Douglas L.


    We develop a Bayesian model for the alignment of two point configurations under the full similarity transformations of rotation, translation and scaling. Other work in this area has concentrated on rigid body transformations, where scale information is preserved, motivated by problems involving molecular data; this is known as form analysis. We concentrate on a Bayesian formulation for statistical shape analysis. We generalize the model introduced by Green and Mardia for the pairwise alignment of two unlabeled configurations to full similarity transformations by introducing a scaling factor to the model. The generalization is not straight-forward, since the model needs to be reformulated to give good performance when scaling is included. We illustrate our method on the alignment of rat growth profiles and a novel application to the alignment of protein domains. Here, scaling is applied to secondary structure elements when comparing protein folds; additionally, we find that one global scaling factor is not in general sufficient to model these data and, hence, we develop a model in which multiple scale factors can be included to handle different scalings of shape components. PMID:24052809

  1. Alignments of Mitochondrial Genome Arrangements

    E-print Network

    Stadler, Peter F.

    Alignments of Mitochondrial Genome Arrangements: Applications to Metazoan Phylogeny Guido Fritzsch Mitochondrial genomes provide a valuable dataset for phylogenetic studies in partic­ ular of metazoan phylogeny in a straightforward approach. We apply this method to study the phylogeny of protostomes based exclusively on mitochon

  2. Alignments of Mitochondrial Genome Arrangements

    E-print Network

    Stadler, Peter F.

    Alignments of Mitochondrial Genome Arrangements: Applications to Metazoan Phylogeny Guido Fritzsch a valuable dataset for phylogenetic studies in partic- ular of metazoan phylogeny because of the extensive this method to study the phylogeny of protostomes based exclusively on mitochon- drial genome arrangements

  3. Macroscopic assemblies of aligned nanotubes

    E-print Network

    Paris-Sud 11, Université de

    1 Macroscopic assemblies of aligned nanotubes studied by X-ray diffraction and microdiffraction-walled carbon nanotube carpets Growth mechanisms 3. Single-walled carbon nanotube fibers Mechanical properties versus structural properties 4. Conclusion #12;4 1. Introduction Single-Walled carbon Nanotube (SWNT

  4. Construction regulations along metro alignment

    Microsoft Academic Search

    V Ghiasi; H Omar; J Rostami; B K Huat


    The purpose of the current study was to determine construction regulations along subway alignment.The study aims to expand the underground tunnelling technique, comparison of different tunnel excavation techniques, tunnelling machines. The aim of this study was to evaluate and validate construction hazards and mitigation measures, shafts sinking, tunnel, excavated material determination. In recent years, there has been an increasing interest

  5. Alignment-Free Phylogenetic Reconstruction

    NASA Astrophysics Data System (ADS)

    Daskalakis, Constantinos; Roch, Sebastien

    We introduce the first polynomial-time phylogenetic reconstruction algorithm under a model of sequence evolution allowing insertions and deletions (or indels). Given appropriate assumptions, our algorithm requires sequence lengths growing polynomially in the number of leaf taxa. Our techniques are distance-based and largely bypass the problem of multiple alignment.

  6. Alignment Uncertainty and Genomic Analysis

    E-print Network

    Suchard, Marc A.

    . A common theme in comparative genomics studies is a flow diagram, or chart, trac- ing the various steps and algorithms used during the analysis of a large number of genes. Flow charts can be quite sophisticatedAlignment Uncertainty and Genomic Analysis Karen M. Wong,1 Marc A. Suchard,2 John P. Huelsenbeck3

  7. Cosmic rays and grain alignment

    NASA Astrophysics Data System (ADS)

    Lazarian, A.; Roberge, W. G.


    The recent detection of interstellar polarization in the solid CO feature near 4.67mum shows that CO-mantled grains can be aligned in cold molecular clouds. These observations conflict with a theory of grain alignment which attributes the polarization in molecular clouds to the effects of cosmic rays: according to this theory, oblate spheroidal grains with H_2O- and CO_2-dominated ice mantles are spun up to suprathermal energies by molecular evaporation from cosmic ray impact sites, but spin-up does not occur for CO-mantled grains. Motivated by this conflict, we re-examine the effects of cosmic rays on the alignment of icy grains. We show that the systematic torques produced by cosmic rays are insufficient to cause suprathermal spin. In principle, the random torques due to cosmic rays can enhance the efficiency of Davis-Greenstein alignment by raising the grain rotational temperature. However, a significant enhancement would require cosmic ray fluxes 6-7 orders of magnitude larger than the flux in a typical cold cloud.

  8. Tonal Alignment in Irish Dialects

    ERIC Educational Resources Information Center

    Dalton, Martha; Ni Chasaide, Ailbhe


    A comparison of the contour alignment of nuclear and initial prenuclear accents was carried out for the Irish dialects of Gaoth Dobhair in Ulster (GD-U) and Cois Fharraige in Connaught (CF-C). This was done across conditions where the number of unstressed syllables following the nuclear and preceding the initial prenuclear accents was varied from…

  9. The estimated effect of mass or footprint reduction in recent light-duty vehicles on U.S. societal fatality risk per vehicle mile traveled.


    Wenzel, Tom


    The National Highway Traffic Safety Administration (NHTSA) recently updated its 2003 and 2010 logistic regression analyses of the effect of a reduction in light-duty vehicle mass on US societal fatality risk per vehicle mile traveled (VMT; Kahane, 2012). Societal fatality risk includes the risk to both the occupants of the case vehicle as well as any crash partner or pedestrians. The current analysis is the most thorough investigation of this issue to date. This paper replicates the Kahane analysis and extends it by testing the sensitivity of his results to changes in the definition of risk, and the data and control variables used in the regression models. An assessment by Lawrence Berkeley National Laboratory (LBNL) indicates that the estimated effect of mass reduction on risk is smaller than in Kahane's previous studies, and is statistically non-significant for all but the lightest cars (Wenzel, 2012a). The estimated effects of a reduction in mass or footprint (i.e. wheelbase times track width) are small relative to other vehicle, driver, and crash variables used in the regression models. The recent historical correlation between mass and footprint is not so large to prohibit including both variables in the same regression model; excluding footprint from the model, i.e. allowing footprint to decrease with mass, increases the estimated detrimental effect of mass reduction on risk in cars and crossover utility vehicles (CUVs)/minivans, but has virtually no effect on light trucks. Analysis by footprint deciles indicates that risk does not consistently increase with reduced mass for vehicles of similar footprint. Finally, the estimated effects of mass and footprint reduction are sensitive to the measure of exposure used (fatalities per induced exposure crash, rather than per VMT), as well as other changes in the data or control variables used. It appears that the safety penalty from lower mass can be mitigated with careful vehicle design, and that manufacturers can reduce mass as a strategy to increase their vehicles' fuel economy and reduce greenhouse gas emissions without necessarily compromising societal safety. PMID:23850544

  10. Multiple Sequence Alignment Errors and Phylogenetic Reconstruction

    E-print Network

    Graur, Dan

    Multiple Sequence Alignment Errors and Phylogenetic Reconstruction THESIS SUBMITTED FOR THE DEGREE and Ron Ophir. To them, my deepest gratitude. Time flies like an arrow Fruit flies like a banana - Groucho...................................................................................................6 Alignment Reconstruction

  11. Simultaneous alignment and folding of protein sequences

    E-print Network

    Waldispuhl, Jerome

    Accurate comparative analysis tools for low-homology proteins remains a difficult challenge in computational biology, especially sequence alignment and consensus folding problems. We presentpartiFold-Align, the first ...

  12. Threaded pilot insures cutting tool alignment

    NASA Technical Reports Server (NTRS)

    Goldman, R.; Schneider, W. E.


    Threaded pilot allows machining of a port component, or boss, after the reciprocating hole has been threaded. It is used to align cutting surfaces with the boss threads, thus insuring precision alignment.

  13. Alternative futures for societal change: The Shared Socio-Economic Pathways (SSPs) (Invited)

    NASA Astrophysics Data System (ADS)

    O'Neill, B. C.


    Deciding how best to respond to the challenge of climate change requires anticipating not only how climate might change in the future, but how society might change as well. Changes in population and economic growth, innovation, technological development, governance, culture, and lifestyle all will affect the energy use and land use that drive climate change, as well as society's capacity to reduce emissions or adapt to climate change impacts. Developing a set of alternative scenarios for societal development is one way to capture and explore the uncertainty in future conditions. The climate change research community has produced a new set of five such scenarios, called Shared Socio-Economic Pathways (SSPs), that is intended to underpin scientific studies, assessments, and policy dialogues for the next decade or more. The SSPs include both qualitative narratives and quantitative projections of key elements such as population, economic growth, urbanization, and educational attainment. They are designed to span a wide range of future conditions in terms of the challenges they present to both adaptation and mitigation. The SSPs are one component of a larger scenario framework which also includes a set of radiative forcing pathways and climate model simulations based on them. Alternative climate futures will be integrated with the alternative societal futures represented by the SSPs to investigate climate change impacts as well as mitigation and adaptation response options.

  14. Optimizing Societal Benefit using a Systems Engineering Approach for Implementation of the GEOSS Space Segment

    NASA Technical Reports Server (NTRS)

    Killough, Brian D., Jr.; Sandford, Stephen P.; Cecil, L DeWayne; Stover, Shelley; Keith, Kim


    The Group on Earth Observations (GEO) is driving a paradigm shift in the Earth Observation community, refocusing Earth observing systems on GEO Societal Benefit Areas (SBA). Over the short history of space-based Earth observing systems most decisions have been made based on improving our scientific understanding of the Earth with the implicit assumption that this would serve society well in the long run. The space agencies responsible for developing the satellites used for global Earth observations are typically science driven. The innovation of GEO is the call for investments by space agencies to be driven by global societal needs. This paper presents the preliminary findings of an analysis focused on the observational requirements of the GEO Energy SBA. The analysis was performed by the Committee on Earth Observation Satellites (CEOS) Systems Engineering Office (SEO) which is responsible for facilitating the development of implementation plans that have the maximum potential for success while optimizing the benefit to society. The analysis utilizes a new taxonomy for organizing requirements, assesses the current gaps in spacebased measurements and missions, assesses the impact of the current and planned space-based missions, and presents a set of recommendations.

  15. Role of liability preferences in societal technology choices: results of a pilot study

    SciTech Connect

    Cantor, R.; Rayner, S.; Braid, B.


    At the 1984 Annual Meeting of the Society for Risk Analysis, Steve Rayner presented a paper that challenged the conventional wisdom of risk management research. In that paper, he argued that resolving the question, ''How safe is safe enough.'' is less important in making societal technology choices than ''How fair is safe enough.'' Adopting the fairness question as the concern of risk management would imply that the process of technology choice explicitly recognize the preferred principles different parties hold with respect to obtaining consent from those affected by the risks, distributing the liabilities, and justifying trust in the relevant institutions. This paper discusses a recent empirical pilot study which explored the fairness hypothesis in the context of nuclear power. Individual interviews and focus groups were conducted to examine whether or not preferred principles for liability distributions were consistent with those suggested by the cultural characteristics of the constituency. The results suggest that for this type of societal technology choice, violation of these preferred principles may be a major source of the conflict between different constituencies. Additionally, the study contributes towards the development of a new approach in risk management that combines the cultural model of risk perceptions with the decision-theoretic approaches found in economics and psychology.

  16. MACSE: Multiple Alignment of Coding SEquences Accounting for Frameshifts and Stop Codons

    PubMed Central

    Ranwez, Vincent; Harispe, Sébastien; Delsuc, Frédéric; Douzery, Emmanuel J. P.


    Until now the most efficient solution to align nucleotide sequences containing open reading frames was to use indirect procedures that align amino acid translation before reporting the inferred gap positions at the codon level. There are two important pitfalls with this approach. Firstly, any premature stop codon impedes using such a strategy. Secondly, each sequence is translated with the same reading frame from beginning to end, so that the presence of a single additional nucleotide leads to both aberrant translation and alignment. We present an algorithm that has the same space and time complexity as the classical Needleman-Wunsch algorithm while accommodating sequencing errors and other biological deviations from the coding frame. The resulting pairwise coding sequence alignment method was extended to a multiple sequence alignment (MSA) algorithm implemented in a program called MACSE (Multiple Alignment of Coding SEquences accounting for frameshifts and stop codons). MACSE is the first automatic solution to align protein-coding gene datasets containing non-functional sequences (pseudogenes) without disrupting the underlying codon structure. It has also proved useful in detecting undocumented frameshifts in public database sequences and in aligning next-generation sequencing reads/contigs against a reference coding sequence. MACSE is distributed as an open-source java file executable with freely available source code and can be used via a web interface at: PMID:21949676

  17. Aligning Plasma-Arc Welding Oscillations

    NASA Technical Reports Server (NTRS)

    Norris, Jeff; Fairley, Mike


    Tool aids in alignment of oscillator probe on variable-polarity plasma-arc welding torch. Probe magnetically pulls arc from side to side as it moves along joint. Tensile strength of joint depends on alignment of weld bead and on alignment of probe. Operator installs new tool on front of torch body, levels it with built-in bubble glass, inserts probe in slot on tool, and locks probe in place. Procedure faster and easier and resulting alignment more accurate and repeatable.

  18. Carbon nanotube alignment using meniscus action

    Microsoft Academic Search

    Joshua D. Wood; Joseph W. Lyding


    Effective, large-scale alignment of single-walled carbon nanotubes (SWNTs) is necessary for making them a useful nanoelectronic technology. While techniques have been developed to align SWNTs during growth or through dielectrophoresis, no technique to date can align SWNTs on a large-scale while controlling SWNT density and taking advantage of chirally pure SWNTs. We present a novel alignment technique using mechanical action

  19. The Upper San Pedro Partnership: A Case Study of Successful Strategies to Connect Science to Societal Needs

    NASA Astrophysics Data System (ADS)

    Goodrich, D. C.; Richter, H.; Varady, R.; Browning-Aiken, A.; Shuttleworth, J.


    The Upper San Pedro Partnership (USPP) ( has been in existence since 1998. Its purpose is to coordinate and cooperate in the implementation of comprehensive policies and projects to meet the long-term water needs of residents within the U.S. side of the basin and of the San Pedro Riparian National Conservation Area. The Partnership consists of 21 local, state, and Federal agencies, NGO's and a private water company. In 2004 it was recognized by Congress in Section 321 of Public Law 108-136 and required to make annual reports to Congress on its progress in bringing the basin water budget into balance by 2011. The Partnership is dedicated to science-based decision making. This presentation will provide an overview of the evolution of natural resources research in the binational (U.S.-Mexico) San Pedro Basin into a mature example of integrated science and decision making embodied in the USPP. It will discuss the transition through science and research for understanding; to science for addressing a need; to integrated policy development and science. At each stage the research conducted becomes more interdisciplinary, first across abiotic disciplines (hydrology, remote sensing, atmospheric science), then a merging of abiotic and biotic disciplines (adding ecology and plant physiology), and finally a further merging with the social sciences and policy and decision making for resource management. Federal, university, and NSF SAHRA Science and Technology Center research has been planned and conducted directly with the USPP. Because of the success the San Pedro has been designated as an operational HELP (Hydrology for the Environment, Life, and Policy) demonstration basin—the most advanced category. Lessons learned from this experience will be reviewed with the intent providing guidance to ensure that hydrologic and watershed research is socially and scientifically relevant and will directly address the needs of policy makers and resource managers. Additionally, the successful examples of science-society linkages can provide helpful models for basins, especially transnational basins, elsewhere.

  20. The San Pedro Basin: A Case Study of US and Mexican Strategies to Connect Science to Societal Needs 1917

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The San Pedro River originates in northern Sonora near the town of Cananea and spans the U.S. – Mexico border into southeastern Arizona. The San Pedro Basin and perennial portions of its river support one of the most ecological diverse regions in the world. The regional groundwater aquifer which l...

  1. Visualization of near-optimal sequence alignments

    PubMed Central

    Smoot, Michael E.; Guerlain, Stephanie A.; Pearson, William R.


    Motivation Mathematically optimal alignments do not always properly align active site residues or well-recognized structural elements. Most near-optimal sequence alignment algorithms display alternative alignment paths, rather than the conventional residue-by-residue pairwise alignment. Typically, these methods do not provide mechanisms for finding effectively the most biologically meaningful alignment in the potentially large set of options. Results We have developed Web-based software that displays near optimal or alternative alignments of two protein or DNA sequences as a continuous moving picture. A WWW interface to a C++ program generates near optimal alignments, which are sent to a Java Applet, which displays them in a series of alignment frames. The Applet aligns residues so that consistently aligned regions remain at a fixed position on the display, while variable regions move. The display can be stopped to examine alignment details. Availability Available at noptalign. For source code contact the authors at Contact PMID:14751975

  2. Multiposition alignment of strapdown inertial navigation system

    Microsoft Academic Search

    J. G. Lee; C. G. Park; H. W. Park


    The authors demonstrate that the stationary alignment of strapdown inertial navigation system (SDINS) can be improved by employing the multiposition\\/technique. Using an observability analysis, it is shown that an optimal two-position alignment not only satisfies complete observability conditions but also minimizes alignment errors. This is done by analytic rank testing of the stripped observability matrix and numerical calculation of the

  3. FLAME: a program to flexibly align molecules.


    Cho, Sung Jin; Sun, Yaxiong


    Herein, we describe a method to flexibly align molecules (FLAME = FLexibly Align MolEcules). FLAME aligns two molecules by first finding maximum common pharmacophores between them using a genetic algorithm. The resulting alignments are then subjected to simultaneous optimizations of their internal energies and an alignment score. The utility of the method in pairwise alignment, multiple molecule flexible alignment, and database searching was examined. For pairwise alignment, two carboxypeptidase ligands (Protein Data Bank codes and ), two estrogen receptor ligands ( and ), and two thrombin ligands ( and ) were used as test sets. Alignments generated by FLAME starting from CONCORD structures compared very well to the X-ray structures (average root-mean-square deviation = 0.36 A) even without further minimization in the presence of the protein. For multiple flexible alignments, five structurally diverse D3 receptor ligands were used as a test set. The FLAME alignment automatically identified three common pharmacophores: a base, a hydrogen-bond acceptor, and a hydrophobe/aromatic ring. The best alignment was then used to search the MDDR database. The search results were compared to the results using atom pair and Daylight fingerprint similarity. A similar database search comparison was also performed using estrogen receptor modulators. In both cases, hits identified by FLAME were structurally more diverse compared to those from the atom pair and Daylight fingerprint methods. PMID:16426065

  4. Vertically aligned nanostructure scanning probe microscope tips


    Guillorn, Michael A.; Ilic, Bojan; Melechko, Anatoli V.; Merkulov, Vladimir I.; Lowndes, Douglas H.; Simpson, Michael L.


    Methods and apparatus are described for cantilever structures that include a vertically aligned nanostructure, especially vertically aligned carbon nanofiber scanning probe microscope tips. An apparatus includes a cantilever structure including a substrate including a cantilever body, that optionally includes a doped layer, and a vertically aligned nanostructure coupled to the cantilever body.

  5. Multiple Alignment Using Hidden Markov Models

    Microsoft Academic Search

    Sean R. Eddy


    A simulated annealing method is described for train- ing hidden Markov models and producing multiple se- quence alignments from initially unaligned protein or DNA sequences. Simulated annealing in turn uses a dynamic programming algorithm for correctly sam- pling suboptimal multiple alignments according to their probability and a Boltzmann temperature fac- tor. The quality of simulated annealing alignments is evaluated on

  6. Aligned 18S and Insect Phylogeny

    Microsoft Academic Search



    The nuclear small subunit rRNA (18S) has played a dominant role in the estimation of relationships among insect orders from molecular data. In previous studies, 18S sequences have been aligned by unadjusted automated approaches (computer alignments that are not manually readjusted), most recently with direct optimization (simultaneous alignment and tree building using a program called \\

  7. Geometrical Adjustment Towards the Alignment of Vector Databases

    NASA Astrophysics Data System (ADS)

    Dalyot, S.; Dahinden, T.; Schulze, M. J.; Boljen, J.; Sester, M.


    Comparison of geospatial databases presenting similar spatial extent might show substantial differences. This is the consequence of different factors, such as: accuracy, scale, data collection and processing methods, level-of-detail, data models - to name a few. The differences are reflected in the geometric structure of objects, location, topology and the accompanying information. Geometric discrepancies are emerging, and sometimes even contradictions exist between the various data sources. Thus, the demand for processes that enable alignment of different data sources while maintaining spatial consistency is growing. Global solution strategies, such as an affine transformation, are incomplete solutions since discrepancies are still likely to exist due to the inability of such a global solution to account for the remaining errors due to local distortions. In order to account for the resulting random distortions, e.g., geometric conflicts, a localized geometric alignment process is implemented in this research. During this process the distortions (deviations) are quantified locally via sets of specifically selected observation constraints, to assure the spatial consistency of the vector data. This strategy exploits local spatial topologic and geometric relationships between corresponding line-features prior to the implementation of Least Squares Adjustment for the alignment, and observes local distortions and ambiguities that might exist. The outcome presents a significant improvement of the initial state by resolving local geometric distortions and discrepancies, suggesting a reliable solution for the problem on a statistically sound basis.

  8. Band Alignment in Organic Materials

    NASA Astrophysics Data System (ADS)

    Flores, F.; Ortega, J.; Vázquez, H.

    Band alignment at metal/organic (MO) and organic/organic (OO) interfaces is discussed within a unified Induced Density of Interface States (IDIS) model, which incorporates most of the effects that can be expected to operate at weakly interacting organic interfaces: compression of the metal electron tails due to Pauli repulsion, orientation of molecular dipoles and electron charge transfer between the two media. This last mechanism tends to align the Charge Neutrality Level (CNL) of the organic material and the metal Fermi level (EF): electron charge transfer reduces the initial misalignment between the CNL and the metal work function (?M-CNL) to S(?M-CNL), where S is the interface screening parameter which is shown to also screen the `Pauli' and molecular interface dipoles. Results for several Au/organic and organic/organic interfaces are presented and discussed. PACS numbers: 79.60.Jv, 79.60.Dp, 73.40.Gk, 73.20.-r

  9. Aligned mesoporous architectures and devices.

    SciTech Connect

    Brinker, C. Jeffrey; Lu, Yunfeng (University of California Los Angeles, Los Angeles, CA)


    This is the final report for the Presidential Early Career Award for Science and Engineering - PECASE (LDRD projects 93369 and 118841) awarded to Professor Yunfeng Lu (Tulane University and University of California-Los Angeles). During the last decade, mesoporous materials with tunable periodic pores have been synthesized using surfactant liquid crystalline as templates, opening a new avenue for a wide spectrum of applications. However, the applications are somewhat limited by the unfavorabe pore orientation of these materials. Although substantial effort has been devoted to align the pore channels, fabrication of mesoporous materials with perpendicular pore channels remains challenging. This project focused on fabrication of mesoporous materials with perpendicularly aligned pore channels. We demonstrated structures for use in water purification, separation, sensors, templated synthesis, microelectronics, optics, controlled release, and highly selective catalysts.

  10. Prism Window for Optical Alignment

    NASA Technical Reports Server (NTRS)

    Tang, Hong


    A prism window has been devised for use, with an autocollimator, in aligning optical components that are (1) required to be oriented parallel to each other and/or at a specified angle of incidence with respect to a common optical path and (2) mounted at different positions along the common optical path. The prism window can also be used to align a single optical component at a specified angle of incidence. Prism windows could be generally useful for orienting optical components in manufacture of optical instruments. "Prism window" denotes an application-specific unit comprising two beam-splitter windows that are bonded together at an angle chosen to obtain the specified angle of incidence.

  11. Vacuum Alignment with more Flavors

    E-print Network

    Thomas A. Ryttov


    We study the alignment of the vacuum in gauge theories with $N_f$ Dirac fermions transforming according to a complex representation of the gauge group. The alignment of the vacuum is produced by adding a small mass perturbation to the theory. We study in detail the $N_f=2,3$ and $4$ case. For $N_f=2$ and $N_f=3$ we reproduce earlier known results including the Dashen phase with spontaneous violation of the combined charge conjugation and parity symmetry, CP. For $N_f=4$ we find regions with and without spontaneous CP violation. We then generalize to an arbitrary number of flavors. Here it is shown that at the point where $N_f-1$ flavors are degenerate with positive mass $m>0$ and the mass of the $N_f$'th flavor becomes negative and equal to $-m$ CP breaks spontaneously.

  12. How tangible is your strategy? How design thinking can turn your strategy into reality

    Microsoft Academic Search

    Matthew Holloway


    Purpose – Improving your company's ability to execute its strategy requires increase alignment, greater agility and a singular clarity regarding the desired outcomes. This paper aims to describe how the SAP Design Services Team uses design thinking and its principles to improve the organization's ability improve its ability to execute strategy and even evolve the way SAP identifies and defines

  13. SOAP: short oligonucleotide alignment program

    Microsoft Academic Search

    Ruiqiang Li; Yingrui Li; Karsten Kristiansen; Jun Wang


    Summary: We have developed a program SOAP for efficient gapped and ungapped alignment of short oligonucleotides onto reference sequences. The program is designed to handle the huge amounts of short reads generated by parallel sequencing using the new generation Illumina-Solexa sequencing technology. SOAP is compa- tible with numerous applications, including single-read or pair-end resequencing, small RNA discovery and mRNA tag

  14. To develop a high speed auto-alignment system by dual machine vision based alignment system

    NASA Astrophysics Data System (ADS)

    Chen, Chun-Jen; Jywe, Wenyuh; Teng, Yunfeng; Chen, Yi-Ju; Hung, Min-Wei


    In this paper, 2 sub machine vision based alignment systems were used to establish a high speed alignment system for screen printing. It can be used on the solar cell and flat display panel manufacture. The 2 sub alignment system can auto align target simultaneously. When one target was takes out, another target can implement auto alignment simultaneously. It can save the wait time for target take out procedure. The sub alignment system includes 4 CCD cameras, 4 lens, 4 outer coaxial LED light sources, a vacuum table and a 3 axis motorized stage. The alignment accuracy is about 1 ?m.

  15. Aligning Business Motivations in a Services Computing Design

    NASA Astrophysics Data System (ADS)

    Roach, T.; Low, G.; D'Ambra, J.

    The difficulty in aligning business strategies with the design of enterprise systems has been recognised as a major inhibitor of successful IT initiatives. Service-oriented architecture (SOA) initiatives imply an entirely new approach to enterprise process enablement and require significant architectural redesign. Successful SOA deployments are highly dependent on the degree to which flexible support for evolving business strategies is embedded into their designs. This chapter addresses the challenge of modelling business strategies in support of SOA designs. The proposed framework is derived from conceptual elements introduced in the OMG business motivation model and delivers an architectural view for business stakeholders in a computational-independent model (CIM). This model represents the first of three layers that will define a complete reference architecture for a service-based computing model.

  16. MSARC: Multiple sequence alignment by residue clustering

    PubMed Central


    Background Progressive methods offer efficient and reasonably good solutions to the multiple sequence alignment problem. However, resulting alignments are biased by guide-trees, especially for relatively distant sequences. Results We propose MSARC, a new graph-clustering based algorithm that aligns sequence sets without guide-trees. Experiments on the BAliBASE dataset show that MSARC achieves alignment quality similar to the best progressive methods. Furthermore, MSARC outperforms them on sequence sets whose evolutionary distances are difficult to represent by a phylogenetic tree. These datasets are most exposed to the guide-tree bias of alignments. Availability MSARC is available at PMID:24735785

  17. Pupil Alignment Measuring Technique and Alignment Reference for Instruments or Optical Systems

    NASA Technical Reports Server (NTRS)

    Hagopian, John G.


    A technique was created to measure the pupil alignment of instruments in situ by measuring calibrated pupil alignment references (PARs) in instruments. The PAR can also be measured using an alignment telescope or an imaging system. PAR allows the verification of the science instrument (SI) pupil alignment at the integrated science instrument module (ISIM) level of assembly at ambient and cryogenic operating temperature. This will allow verification of the ISIM+SI alignment, and provide feedback to realign the SI if necessary.

  18. Antares beam-alignment-system performance

    SciTech Connect

    Appert, Q.D.; Bender, S.C.


    The beam alignment system for the 24-beam-sector Antares CO/sub 2/ fusion laser automatically aligns more than 200 optical elements. A visible-wavelength alignment technique is employed which uses a telescope/TV system to view point-light sources appropriately located down the beamline. The centroids of the light spots are determined by a video tracker, which generates error signals used by the computer control system to move appropriate mirrors in a closed-loop system. Final touch-up alignment is accomplished by projecting a CO/sub 2/ alignment laser beam through the system and sensing its position at the target location. The techniques and control algorithms employed have resulted in alignment accuracies exceeding design requirements. By employing video processing to determine the centroids of diffraction images and by averaging over multiple TV frames, we achieve alignment accuracies better than 0.1 times system diffraction limits in the presence of air turbulence.

  19. Target alignment in the National Ignition Facility

    SciTech Connect

    Vann, C.S.; Bliss, E.S.; Murray, J.E.


    Accurate placement of hundreds of focused laser beams on target is necessary to achieve success in the National Ignition Facility (NIF). The current system requirement is {le}7 {mu}rad error in output pointing and {le}1 mm error in focusing. To accommodate several system shots per day, a target alignment system must be able to align the target to chamber center, inject an alignment beam to represent each shot beam, and point and focus the alignment beams onto the target in about one hour. At Lawrence Livermore National Laboratory, we have developed a target alignment concept and built a prototype to validate the approach. The concept comprises three systems: the chamber center reference, target alignment sensor, and target alignment beams.

  20. When Weather Matters: Science and Service to Meet Critical Societal Needs

    NASA Technical Reports Server (NTRS)


    The goal of weather prediction is to provide information people and organizations can use to reduce weather-related losses and enhance societal benefits, including protection of life and property, public health and safety, and support of economic prosperity and quality of life. In economic terms, the benefit of the investment in public weather forecasts and warnings is substantial: the estimated annualized benefit is about $31.5 billion, compared to the $5.1 billion cost of generating the information. Between 1980 and 2009, 96 weather disasters in the United States each caused at least $1 billion in damages, with total losses exceeding $700 billion. Between 1999 and 2008, there were an average of 629 direct weather fatalities per year. The annual impacts of adverse weather on the national highway system and roads are staggering: 1.5 million weather-related crashes with 7,400 deaths, more than 700,000 injuries, and $42 billion in economic losses.

  1. Hotspots of coastal vulnerability: A DPSIR analysis to find societal pathways and responses

    NASA Astrophysics Data System (ADS)

    Newton, Alice; Weichselgartner, Juergen


    Dramatic loss of life and economic losses in coastal zones have focused attention on natural and man-made hazards. The paper starts with a review of the coastal vulnerability terminology. Coastal zones are then presented as complex, socio-ecological systems. Four main coastal hotspots of vulnerability; namely Arctic coasts, small islands, river-mouth systems and urban coasts (including megacities) are analysed to demonstrate the complexity of coastal vulnerability. A DPSIR framework is used to explore the causes and consequences of coastal vulnerability. The paper then focuses in particular on societal, as well as floods, storm-surges and tsunamis to technological and engineering solutions. These include raising awareness, advancing forecasting, enhancing preparedness and improving governance.

  2. Naturally occurring radioactive materials (NORM): a matter of wide societal implication.


    Pescatore, C; Menon, S


    Naturally occurring radioactive materials are ubiquitous on Earth and their radioactivity may become concentrated as a result of human activities. Numerous industries produce concentrated radioactivity in their by-products: the coal industry, petroleum extraction and processing, water treatment, etc. The present reference system of radiation protection does not provide a complete framework for the coherent management of all types of radioactively contaminated materials. Inconsistencies in waste management policy and practice can be noted across the board, and especially vis-à-vis the management of radioactive waste from the nuclear industry. This article reviews the present societal approach to manage materials that are radioactive but are often not recognised as being such, and place the management of radioactive materials from the nuclear industry in perspective. PMID:11302258

  3. The Societal Impact of Extraterrestrial Life: The Relevance of History and the Social Sciences

    NASA Astrophysics Data System (ADS)

    Dick, Steven J.

    This chapter reviews past studies on the societal impact of extraterrestrial life and offers four related ways in which history is relevant to the subject: the history of impact thus far, analogical reasoning, impact studies in other areas of science and technology, and studies on the nature of discovery and exploration. We focus particularly on the promise and peril of analogical arguments, since they are by necessity widespread in the field. This chapter also summarizes the relevance of the social sciences, particularly anthropology and sociology, and concludes by taking a closer look at the possible impact of the discovery of extraterrestrial life on theology and philosophy. In undertaking this study we emphasize three bedrock principles: (1) we cannot predict the future; (2) society is not monolithic, implying many impacts depending on religion, culture and worldview; (3) the impact of any discovery of extraterrestrial life is scenario-dependent.

  4. Visions for the north sea: the societal dilemma behind specifying good environmental status.


    Gilbert, Alison J; McQuatters-Gollop, Abigail; Langmead, Olivia; Mee, Laurence; Vermaat, Jan


    We augment discussions about the Good Environmental Status of the North Sea by developing two extreme visions and assessing their societal benefits. One vision ('Then') assumes restoration of benthic functioning; we contend that trawling had already degraded the southern North Sea a century ago. Available information is used to speculate about benthic functioning in a relatively undisturbed southern North Sea. The second vision ('Now') draws on recent benthic functioning. The supply of five ecosystem services, supported by benthic functioning, is discussed. 'Then' offers confidence in the sustainable supply of diverse services but restoration of past function is uncertain and likely to be paired with costs, notably trawling restraints. 'Now' delivers known and valued services but sustained delivery is threatened by, for example, climate change. We do not advocate either vision. Our purpose is to stimulate debate about what society wants, and might receive, from the future southern North Sea. PMID:24859919

  5. Senior Seminar Focusing on Societal Issues Related to Chemistry and Biochemistry

    NASA Astrophysics Data System (ADS)

    White, Harold B., III; Johnston, Murray V.; Panar, Manuel


    The lack of a clearly defined content or structure provided the opportunity to transform a one-credit, pass-fail senior seminar course into a meaningful capstone experience for chemistry and biochemistry majors. In addition to individual and class exercises associated with employment, graduate school, communication skills, and professional ethics, small groups of students worked together to create informative Web sites that took positions on important societal issues related to chemistry. Each group presented a seminar and responded to questions from their peers and two or more unannounced visitors, "wild cards" who often had expertise in the seminar topic. Throughout the course, the instructors placed particular emphasis on developing students' ability to work cooperatively, locate and evaluate information, make informed judgments based on available information, and logically develop and defend their positions. Input from a retired industrial chemist helped define these skill elements.

  6. Societal impact of bilirubin-induced hearing impairment in resource-limited nations.


    Olusanya, Bolajoko O


    Infants with bilirubin-induced neurologic dysfunction (BIND) are characterized by several developmental disabilities including auditory impairments. This paper explores the societal impact of bilirubin-induced auditory impairments, inclusive of hearing impairments and auditory neuropathy spectrum disorders, on these infants, their families, and on the community in resource-limited countries (per capita income of US$6,000 or less). Auditory impairments have substantial emotional, social, and economic impact on the affected infants, their families and communities. The burden is exacerbated by widespread poverty, unfavorable community attitudes towards disabilities, and lack of requisite health, educational, and social services. Curtailing the incidence of avoidable severe hyperbilirubinemia through proactive and effective management of infants at risk or with severe hyperbilirubinemia is necessary at all levels of healthcare delivery. Early detection and intervention for unavoidable auditory impairments should be widely promoted to provide improved developmental trajectories for the affected infants. PMID:25573775

  7. The Societal Impacts of a Mars Mission in the Future of Space Exploration

    NASA Astrophysics Data System (ADS)

    Shaghaghi, Azam; Antonakopoulos, Konstantinos

    The human race has evolved, grown and expanded through the exploration of Earth. After initial steps on the Moon, our next challenge is to explore the solar system. From the Mars mission viewpoint stepping on this planet will bring social impacts which may influence the society to a great extent. Never before have there been so complex mission settings. This implies as an inherent impediment for the future of space exploration since it is most likely to be scrutinized and challenged by the public. The goal of this paper is to outline the societal impacts of a Mars mission in the future of space exploration by first introducing the existing challenges and then identifying the primary groups that form public opinion and concludes where efforts should be focused.

  8. Climate Change Impacts and Responses: Societal Indicators for the National Climate Assessment

    NASA Technical Reports Server (NTRS)

    Kenney, Melissa A.; Chen, Robert S.; Maldonado, Julie; Quattrochi, Dale


    The Climate Change Impacts and Responses: Societal Indicators for the National Climate Assessment workshop, sponsored by the National Aeronautics and Space Administration (NASA) for the National Climate Assessment (NCA), was held on April 28-29, 2011 at The Madison Hotel in Washington, DC. A group of 56 experts (see list in Appendix B) convened to share their experiences. Participants brought to bear a wide range of disciplinary expertise in the social and natural sciences, sector experience, and knowledge about developing and implementing indicators for a range of purposes. Participants included representatives from federal and state government, non-governmental organizations, tribes, universities, and communities. The purpose of the workshop was to assist the NCA in developing a strategic framework for climate-related physical, ecological, and socioeconomic indicators that can be easily communicated with the U.S. population and that will support monitoring, assessment, prediction, evaluation, and decision-making. The NCA indicators are envisioned as a relatively small number of policy-relevant integrated indicators designed to provide a consistent, objective, and transparent overview of major variations in climate impacts, vulnerabilities, adaptation, and mitigation activities across sectors, regions, and timeframes. The workshop participants were asked to provide input on a number of topics, including: (1) categories of societal indicators for the NCA; (2) alternative approaches to constructing indicators and the better approaches for NCA to consider; (3) specific requirements and criteria for implementing the indicators; and (4) sources of data for and creators of such indicators. Socioeconomic indicators could include demographic, cultural, behavioral, economic, public health, and policy components relevant to impacts, vulnerabilities, and adaptation to climate change as well as both proactive and reactive responses to climate change. Participants provided inputs through in-depth discussion in breakout sessions, plenary sessions on break-out results, and several panels that provided key insights about indicators, lessons learned through experience with developing and implementing indicators, and thoughts on how the NCA could proceed to develop indicators for the NCA.

  9. Societal costs of air pollution-related health hazards: A review of methods and results

    PubMed Central

    Pervin, Tanjima; Gerdtham, Ulf-G; Lyttkens, Carl Hampus


    This paper aims to provide a critical and systematic review of the societal costs of air pollution-related ill health (CAP), to explore methodological issues that may be important when assessing or comparing CAP across countries and to suggest ways in which future CAP studies can be made more useful for policy analysis. The methodology includes a systematic search based on the major electronic databases and the websites of a number of major international organizations. Studies are categorized by origin – OECD countries or non-OECD countries – and by publication status. Seventeen studies are included, eight from OECD countries and nine from non-OECD countries. A number of studies based on the ExternE methodology and the USA studies conducted by the Institute of Transportation are also summarized and discussed separately. The present review shows that considerable societal costs are attributable to air pollution-related health hazards. Nevertheless, given the variations in the methodologies used to calculate the estimated costs (e.g. cost estimation methods and cost components included), and inter-country differences in demographic composition and health care systems, it is difficult to compare CAP estimates across studies and countries. To increase awareness concerning the air pollution-related burden of disease, and to build links to health policy analyses, future research efforts should be directed towards theoretically sound and comprehensive CAP estimates with use of rich data. In particular, a more explicit approach should be followed to deal with uncertainties in the estimations. Along with monetary estimates, future research should also report all physical impacts and source-specific cost estimates, and should attempt to estimate 'avoidable cost' using alternative counterfactual scenarios. PMID:18786247

  10. The Needs of the Highly Able and the Needs of Society: A Multidisciplinary Analysis of Talent Differentiation and Its Significance to Gifted Education and Issues of Societal Inequality

    ERIC Educational Resources Information Center

    Persson, Roland S.


    Does gifted education affect societal inequality, and does societal inequality suppress and/or distort the development of high ability? Drawing from several academic disciplines and current political discourse, a differentiated use of terms used to describe the highly able is explored in this article. A social evolutionary framework is proposed as…

  11. Vacuum alignment and lattice artifacts

    E-print Network

    Maarten Golterman; Yigal Shamir


    When a subgroup of the flavor symmetry group of a gauge theory is weakly coupled to additional gauge fields, the vacuum tends to align such that the gauged subgroup is unbroken. At the same time, the lattice discretization typically breaks the flavor symmetry explicitly, and can give rise to new lattice-artifact phases with spontaneously broken symmetries. We discuss the interplay of these two phenomena, using chiral lagrangian techniques. Our first example is two-flavor Wilson QCD coupled to electromagnetism. We also consider examples of theories with staggered fermions, and demonstrate that recent claims in the literature based on the use of staggered fermions are incorrect.

  12. Method for protein structure alignment


    Blankenbecler, Richard; Ohlsson, Mattias; Peterson, Carsten; Ringner, Markus


    This invention provides a method for protein structure alignment. More particularly, the present invention provides a method for identification, classification and prediction of protein structures. The present invention involves two key ingredients. First, an energy or cost function formulation of the problem simultaneously in terms of binary (Potts) assignment variables and real-valued atomic coordinates. Second, a minimization of the energy or cost function by an iterative method, where in each iteration (1) a mean field method is employed for the assignment variables and (2) exact rotation and/or translation of atomic coordinates is performed, weighted with the corresponding assignment variables.

  13. Ridge effect and alignment phenomenon

    SciTech Connect

    Lokhtin, I. P., E-mail:; Managadze, A. K., E-mail:; Snigirev, A. M., E-mail: [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation)


    It is assumed that the ridge effect observed by the CMS Collaboration in proton-proton collisions at the LHC and the phenomenon observed by the Pamir Collaboration in emulsion experiments with cosmic rays and characterized by the alignment of spots on a film is a manifestation of the same as-yet-unknown mechanism of the emergence of a coplanar structure of events. A large coplanar effect at the LHC in the region of forward rapidities is predicted on the basis of this hypothesis and an analysis of experimental data.

  14. ARYANA: Aligning Reads by Yet Another Approach

    PubMed Central


    Motivation Although there are many different algorithms and software tools for aligning sequencing reads, fast gapped sequence search is far from solved. Strong interest in fast alignment is best reflected in the $106 prize for the Innocentive competition on aligning a collection of reads to a given database of reference genomes. In addition, de novo assembly of next-generation sequencing long reads requires fast overlap-layout-concensus algorithms which depend on fast and accurate alignment. Contribution We introduce ARYANA, a fast gapped read aligner, developed on the base of BWA indexing infrastructure with a completely new alignment engine that makes it significantly faster than three other aligners: Bowtie2, BWA and SeqAlto, with comparable generality and accuracy. Instead of the time-consuming backtracking procedures for handling mismatches, ARYANA comes with the seed-and-extend algorithmic framework and a significantly improved efficiency by integrating novel algorithmic techniques including dynamic seed selection, bidirectional seed extension, reset-free hash tables, and gap-filling dynamic programming. As the read length increases ARYANA's superiority in terms of speed and alignment rate becomes more evident. This is in perfect harmony with the read length trend as the sequencing technologies evolve. The algorithmic platform of ARYANA makes it easy to develop mission-specific aligners for other applications using ARYANA engine. Availability ARYANA with complete source code can be obtained from PMID:25252881

  15. Teacher Collaboration in Times of Uncertainty and Societal Change: The Case Study of Post-Soviet Ukraine

    ERIC Educational Resources Information Center

    Kutsyuruba, Benjamin


    The work of teachers is subject to changing not only policies and reforms but also the complexities and contradictions of societal transformations. This paper examines teachers' perceptions of the impact of post-Soviet transformations on teacher collaboration amid the changing education policies and reforms in Ukraine. Drawing on qualitative…

  16. Perceptions of the News Media's Societal Roles: How the Views of U.K. Journalism Students Changed during Their Education

    ERIC Educational Resources Information Center

    Hanna, Mark; Sanders, Karen


    A longitudinal study of U.K. journalism undergraduates records how their attitudes on societal roles of the news media changed during university education. Students became more likely to endorse an adversarial approach toward public officials and businesses as extremely important. Yet students did not support these roles as strongly as an older…

  17. FEDERAL POLICY IN LOCAL CONTEXT: The Influence of Local State-Societal Relations on Endangered Species Act Implementation

    Microsoft Academic Search

    Debra J. Davidson


    Current debates regarding the degree to which centralization or decentralization of environmental bureaucracies promotes more effective management of natural resources suggest the need for employing new methodologies to empirical analysis, in a variety of political and ecological settings. In this paper, recent state synergy scholarship is adopted to an analysis of the impact of state-societal relations on the implementation of

  18. The Evolution of English Language Teaching during Societal Transition in Finland--A Mutual Relationship or a Distinctive Process?

    ERIC Educational Resources Information Center

    Jaatinen, Riitta; Saarivirta, Toni


    This study describes the evolution of English language teaching in Finland and looks into the connections of the societal and educational changes in the country as explanatory factors in the process. The results of the study show that the language teaching methodology and the status of foreign languages in Finland are clearly connected to the…

  19. Effects of an Integrated Science and Societal Implication Intervention on Promoting Adolescents' Positive Thinking and Emotional Perceptions in Learning Science

    ERIC Educational Resources Information Center

    Hong, Zuway R.; Lin, Huann-Shyang; Lawrenz, Frances P.


    The goal of this study was to test the effectiveness of integrating science and societal implication on adolescents' positive thinking and emotional perceptions about learning science. Twenty-five eighth-grade Taiwanese adolescents (9 boys and 16 girls) volunteered to participate in a 12-week intervention and formed the experimental group.…

  20. Upcoming challenges for multiple sequence alignment methods in the high-throughput era

    PubMed Central

    Kemena, Carsten; Notredame, Cedric


    This review focuses on recent trends in multiple sequence alignment tools. It describes the latest algorithmic improvements including the extension of consistency-based methods to the problem of template-based multiple sequence alignments. Some results are presented suggesting that template-based methods are significantly more accurate than simpler alternative methods. The validation of existing methods is also discussed at length with the detailed description of recent results and some suggestions for future validation strategies. The last part of the review addresses future challenges for multiple sequence alignment methods in the genomic era, most notably the need to cope with very large sequences, the need to integrate large amounts of experimental data, the need to accurately align non-coding and non-transcribed sequences and finally, the need to integrate many alternative methods and approaches. Contact: PMID:19648142

  1. Automated interferometric alignment system for paraboloidal mirrors


    Maxey, L.C.


    A method is described for a systematic method of interpreting interference fringes obtained by using a corner cube retroreflector as an alignment aid when aligning a paraboloid to a spherical wavefront. This is applicable to any general case where such alignment is required, but is specifically applicable in the case of aligning an autocollimating test using a diverging beam wavefront. In addition, the method provides information which can be systematically interpreted such that independent information about pitch, yaw and focus errors can be obtained. Thus, the system lends itself readily to automation. Finally, although the method is developed specifically for paraboloids, it can be seen to be applicable to a variety of other aspheric optics when applied in combination with a wavefront corrector that produces a wavefront which, when reflected from the correctly aligned aspheric surface will produce a collimated wavefront like that obtained from the paraboloid when it is correctly aligned to a spherical wavefront. 14 figures.

  2. Multiple alignment using hidden Markov models

    SciTech Connect

    Eddy, S.R. [Washington Univ. School of Medicine, St. Louis, MO (United States)


    A simulated annealing method is described for training hidden Markov models and producing multiple sequence alignments from initially unaligned protein or DNA sequences. Simulated annealing in turn uses a dynamic programming algorithm for correctly sampling suboptimal multiple alignments according to their probability and a Boltzmann temperature factor. The quality of simulated annealing alignments is evaluated on structural alignments of ten different protein families, and compared to the performance of other HMM training methods and the ClustalW program. Simulated annealing is better able to find near-global optima in the multiple alignment probability landscape than the other tested HMM training methods. Neither ClustalW nor simulated annealing produce consistently better alignments compared to each other. Examination of the specific cases in which ClustalW outperforms simulated annealing, and vice versa, provides insight into the strengths and weaknesses of current hidden Maxkov model approaches.

  3. Trip Report RHBrown Calibration and Alignment

    E-print Network

    Rutledge, Steven

    and performed two solar alignment checks at 1645Z and 1915 Z. The 1645Z offsets were: El +0.3 deg, Az +0.45 deg. AT 1915 Z the offsets were: EL 0.0 deg, Az 1.5 deg. #12;8/25/01 A solar alignment check at 1535Z gave: El performed three solar alignment checks through the day. Elevation was consistently off by 0.6 degrees

  4. Magnetic alignment of grains. [in interstellar space

    NASA Technical Reports Server (NTRS)

    Hildebrand, Roger H.


    This paper reviews mechanisms that have been proposed to account for alignment of dust grains in diffuse clouds and in dense clouds. The mechanisms that have proved inadequate are considered, including alignment by nonmagnetic and magnetic processes. The results thus far favor the Davis-Greenstein mechanism, in which paramagnetic relaxation of spinning grains removes components of rotation perpendicular to the magnetic field. Polarization measurements showing the alignment of grains in cool dense clouds are discussed.

  5. A New Model for Global Multiple Alignment of Whole Genome Sequences

    Microsoft Academic Search

    Yue Ma; Cao An Wang


    We propose a new anchor-based model for global multiple alignment of whole genome sequences. The model includes three main phases. Firstly, an enhanced suffix array method is employed to find anchors. Next, a novel chaining strategy, which is based on the dynamic programming technique and the longest common subsequence idea, calculates an anchor-chain for the weighted anchors. Lastly, the progressive

  6. Children's Reasoning about Spatial Relational Similarity: The Effect of Alignment and Relational Complexity

    ERIC Educational Resources Information Center

    Hribar, Alenka; Haun, Daniel B. M.; Call, Josep


    We investigated 4- and 5-year-old children's mapping strategies in a spatial task. Children were required to find a picture in an array of three identical cups after observing another picture being hidden in another array of three cups. The arrays were either aligned one behind the other in two rows or placed side by side forming one line.…

  7. Liquid crystal alignment on polymer line gratings

    NASA Astrophysics Data System (ADS)

    Schenck, Walter; Ko, Doo-Hyun; Samulski, Edward


    Liquid crystal alignment on polymer line gratings fabricated by a soft lithography embossing process derived from PRINTTM (Pattern Replication In Nonwetting Template) is influenced by mold removal (peel-off direction). This indicates the existence of two competing alignment mechanisms: (1) topography (i.e., the Beremann mechanism) and (2) surface modification during peel-off. The degree to which mold removal influenced liquid crystal alignment was found to be dependent on the primary structures of the embossed polymer, and the chemical composition of the mold. These findings suggest alternate ways to affect liquid crystal alignment in roll-to-roll manufacturing.

  8. Low-altitude field-aligned electrons

    NASA Technical Reports Server (NTRS)

    Arnoldy, R. L.; Moore, T. E.; Cahill, L. J., Jr.


    Earlier measurements of field-aligned electrons are reexamined in the light of the more recent and comprehensive data available from both rocket and satellite observations. It is found that: (1) field aligned electrons are associated with evening, midnight, and cusp auroras; (2) rocket data associate the field aligned electrons with active auroral forms and on the edges of moving discrete arcs, predominantly the leading edge; and (3) the spatial/temporal scale of the field-aligned events seen by satellites is a few seconds or tens of kilometers, while the rocket time scale extends from seconds to hundreds of seconds. Recent acceleration mechanisms involving turbulence are discussed.

  9. Aligning carbon nano fibers using magnetic nanofluids

    NASA Astrophysics Data System (ADS)

    Parmar, Mayur A.; Virpura, Hiral A.; Dave, Vishaka; Patel, Rajesh J.


    Oleic acid coated magnetic nano particles and sodium dodecyl sulphate (SDS) coated carbon nano fibers are suspended in an aqueous medium. Under the application of very low magnetic field (˜500 Oe), the physically adsorbed magnetic nanoparticles with carbon nanofibers are spatially aligned. The external magnetic field aligns the magnetic moment of the particles and consequent body forces align the carbon nanofibers. This alignment is studied using a microscope attached with computer and using a capillary viscometry. This form of orientation may be very useful for various nanofluidics and nanoelectromechanical systems (NEMS).

  10. T r i p p U m b a c h ~ w w w . t r i p p u m b a c h . c o m The Economic and Societal Impact of

    E-print Network

    Thomas, David D.

    and outreach centers, and significant community and business collaborations statewide The Economic and Societal Impact of The University of Minnesota June 21 11 #12;ii THE ECONOMIC AND SOCIETAL IMPACT OF THE UNIVERSITY

  11. Realizing NASA's Goal of Societal Benefits From Earth Observations in Mesoamerica Through the SERVIR Project

    NASA Astrophysics Data System (ADS)

    Hardin, D. M.; Irwin, D.; Sever, T.; Graves, S.


    One of the goals of NASA's Applied Sciences Program is to manifest societal benefits from the vast store of Earth Observations through partnerships with public, private and academic organizations. The SERVIR project represents an early success toward this goal. By combining Earth Observations from NASA missions, results from environmental models and decision support tools from its partners the SERVIR project has produced an integrated systems solution that is yielding societal benefits for the region of Mesoamerica. The architecture of the SERVIR system consists of an operational facility in Panama with regional nodes in Costa Rica, Nicaragua, Honduras, Guatemala, El Salvador and Belize plus a Rapid Prototyping Center (RPC), located in Huntsville, Alabama. The RPC, funded by NASA's Applied Sciences Division, and developed by the Information Technology and Systems Center at the University of Alabama in Huntsville, and NASA Marshall Space Flight Center, produces scientifically strong decision support products and applications. When mature, the products and applications migrate to the operational center in Panama. There, they are available to environmental ministers and decision makers in Mesoamerica. In June 2004, the SERVIR project was contacted by the environmental ministry of El Salvador, which urgently requested remote sensing imagery of the location, direction, and extent of a HAB event off the coast of El Salvador and Guatemala. Using MODIS data the SERVIR team developed a value added product that predicts the location, direction, and extent of HABs. The products are produced twice daily and are used by the El Salvadoran and Guatemalan governments to alert their tourism and fishing industries of potential red tide events. This has enabled these countries to save millions of dollars for their industries as well as improve the health of harvested fish. In the area of short term weather forecasting the SERVIR team, in collaboration with the NASA Short-term Prediction Research and Transition (SpoRT) Center, generates 24 hour-forecasts twice daily utilizing the Weather Research and Forecast Model (WRF). Originally aimed at forecasts for the United States, the SPoRT team extended their work to cover the Mesoamerican region. Following testing at the RPC the system was installed in Panama and is currently producing forecasts that are used by tour guides, boat captains on river and ocean fishing tours, and cruise ship captains. This capability fits perfectly with NASA's goals since an existing project was modified, at minimal cost, to provide societal benefits to the population of a different geographic region. On June 30, 2006 several new applications matured and the inventory of decision support products was significantly expanded. As a result the SERVIR website was reorganized to reflect the changes. The degree of change was sufficient for the developers to designate it as a new release of SERVIR. The applications include a Real-Time Image Viewer, a customized version of NASA World Wind for Mesoamerica known as SERVIR- VIZ (developed by IAGT) and the SERVIR Data Portal (developed by the Water Center of the Humid Tropics Latin America and the Caribbean). The success of the SERVIR project is reflected by its choice by NASA as the decision support system for the Ecological Forecasting National Application. The SERVIR model is also under consideration for other regions of the globe. Potential areas for development are Africa, South America and the Caribbean.

  12. Lies, Damn Lies, and Alignment: Important Alignment Issues in the Common Core Era

    E-print Network

    Loudon, Catherine

    in the Common Core Era Guest Lecture by Morgan Polikoff Assistant Professor lays out important alignment issues in the Common Core era, presenting results focuses on the alignment of textbooks to the Common Core standards in elementary

  13. GramAlign: fast alignment driven by grammar-based phylogeny.


    Russell, David J


    Multiple sequence alignment involves identifying related subsequences among biological sequences. When matches are found, the associated pieces are shifted so that when sequences are presented as successive rows-one sequence per row-homologous residues line-up in columns. Exact alignment of more than a few sequences is known to be computationally prohibitive. Thus many heuristic algorithms have been developed to produce good alignments in an efficient amount of time by determining an order by which pairs of sequences are progressively aligned and merged. GRAMALIGN is such a progressive alignment algorithm that uses a grammar-based relative complexity distance metric to determine the alignment order. This technique allows for a computationally efficient and scalable program useful for aligning both large numbers of sequences and sets of long sequences quickly. The GRAMALIGN software is available at for both source code download and a web-based alignment server. PMID:24170402

  14. Personal genome testing: Test characteristics to clarify the discourse on ethical, legal and societal issues

    PubMed Central


    Background As genetics technology proceeds, practices of genetic testing have become more heterogeneous: many different types of tests are finding their way to the public in different settings and for a variety of purposes. This diversification is relevant to the discourse on ethical, legal and societal issues (ELSI) surrounding genetic testing, which must evolve to encompass these differences. One important development is the rise of personal genome testing on the basis of genetic profiling: the testing of multiple genetic variants simultaneously for the prediction of common multifactorial diseases. Currently, an increasing number of companies are offering personal genome tests directly to consumers and are spurring ELSI-discussions, which stand in need of clarification. This paper presents a systematic approach to the ELSI-evaluation of personal genome testing for multifactorial diseases along the lines of its test characteristics. Discussion This paper addresses four test characteristics of personal genome testing: its being a non-targeted type of testing, its high analytical validity, low clinical validity and problematic clinical utility. These characteristics raise their own specific ELSI, for example: non-targeted genetic profiling poses serious problems for information provision and informed consent. Questions about the quantity and quality of the necessary information, as well as about moral responsibilities with regard to the provision of information are therefore becoming central themes within ELSI-discussions of personal genome testing. Further, the current low level of clinical validity of genetic profiles raises questions concerning societal risks and regulatory requirements, whereas simultaneously it causes traditional ELSI-issues of clinical genetics, such as psychological and health risks, discrimination, and stigmatization, to lose part of their relevance. Also, classic notions of clinical utility are challenged by the newer notion of 'personal utility.' Summary Consideration of test characteristics is essential to any valuable discourse on the ELSI of personal genome testing for multifactorial diseases. Four key characteristics of the test - targeted/non-targeted testing, analytical validity, clinical validity and clinical utility - together determine the applicability and the relevance of ELSI to specific tests. The paper identifies and discusses four areas of interest for the ELSI-debate on personal genome testing: informational problems, risks, regulatory issues, and the notion of personal utility. PMID:21672210

  15. A genome alignment algorithm based on compression

    PubMed Central


    Background Traditional genome alignment methods consider sequence alignment as a variation of the string edit distance problem, and perform alignment by matching characters of the two sequences. They are often computationally expensive and unable to deal with low information regions. Furthermore, they lack a well-principled objective function to measure the performance of sets of parameters. Since genomic sequences carry genetic information, this article proposes that the information content of each nucleotide in a position should be considered in sequence alignment. An information-theoretic approach for pairwise genome local alignment, namely XMAligner, is presented. Instead of comparing sequences at the character level, XMAligner considers a pair of nucleotides from two sequences to be related if their mutual information in context is significant. The information content of nucleotides in sequences is measured by a lossless compression technique. Results Experiments on both simulated data and real data show that XMAligner is superior to conventional methods especially on distantly related sequences and statistically biased data. XMAligner can align sequences of eukaryote genome size with only a modest hardware requirement. Importantly, the method has an objective function which can obviate the need to choose parameter values for high quality alignment. The alignment results from XMAligner can be integrated into a visualisation tool for viewing purpose. Conclusions The information-theoretic approach for sequence alignment is shown to overcome the mentioned problems of conventional character matching alignment methods. The article shows that, as genomic sequences are meant to carry information, considering the information content of nucleotides is helpful for genomic sequence alignment. Availability Downloadable binaries, documentation and data can be found at PMID:21159205

  16. Alignment and Alignment Modulation of Single Wall Carbon Nanotubes Using Lyotropic Chromonic Liquid Crystals

    Microsoft Academic Search

    M. F. Islam; I. I. Smalyukh; O. D. Lavrentovich; A. G. Yodh


    We report alignment and local alignment modulation of single wall carbon nanotubes (SWNTs) dispersed in a nematic solvent of lyotropic chromonic liquid crystals (LCLCs). Polarized optical absorption suggests that when SWNTs are coated with surfactant molecules, e.g., sodium dodecyl benzene sulfonate (NaDDBS), the SWNTs align along the nematic director of the LCLCs, possibly due to elastic interaction between the anisotropic

  17. TM-align: a protein structure alignment algorithm based on the TM-score

    Microsoft Academic Search

    Yang Zhang; Jeffrey Skolnick


    We have developed TM-align, a new algorithm to identify the best structural alignment between protein pairs that combines the TM-score rotation matrix and Dynamic Programming (DP). The algo- rithm is ? 4 times faster than CE and 20 times faster than DALI and SAL. On average, the resulting struc- ture alignments have higher accuracy and coverage than those provided by

  18. Improving the Alignment Quality of Consistency Based Aligners with an Evaluation Function Using Synonymous Protein Words

    PubMed Central

    Lin, Hsin-Nan; Notredame, Cédric; Chang, Jia-Ming; Sung, Ting-Yi; Hsu, Wen-Lian


    Most sequence alignment tools can successfully align protein sequences with higher levels of sequence identity. The accuracy of corresponding structure alignment, however, decreases rapidly when considering distantly related sequences (<20% identity). In this range of identity, alignments optimized so as to maximize sequence similarity are often inaccurate from a structural point of view. Over the last two decades, most multiple protein aligners have been optimized for their capacity to reproduce structure-based alignments while using sequence information. Methods currently available differ essentially in the similarity measurement between aligned residues using substitution matrices, Fourier transform, sophisticated profile-profile functions, or consistency-based approaches, more recently. In this paper, we present a flexible similarity measure for residue pairs to improve the quality of protein sequence alignment. Our approach, called SymAlign, relies on the identification of conserved words found across a sizeable fraction of the considered dataset, and supported by evolutionary analysis. These words are then used to define a position specific substitution matrix that better reflects the biological significance of local similarity. The experiment results show that the SymAlign scoring scheme can be incorporated within T-Coffee to improve sequence alignment accuracy. We also demonstrate that SymAlign is less sensitive to the presence of structurally non-similar proteins. In the analysis of the relationship between sequence identity and structure similarity, SymAlign can better differentiate structurally similar proteins from non- similar proteins. We show that protein sequence alignments can be significantly improved using a similarity estimation based on weighted n-grams. In our analysis of the alignments thus produced, sequence conservation becomes a better indicator of structural similarity. SymAlign also provides alignment visualization that can display sub-optimal alignments on dot-matrices. The visualization makes it easy to identify well-supported alternative alignments that may not have been identified by dynamic programming. SymAlign is available at PMID:22163274

  19. Phylo: A Citizen Science Approach for Improving Multiple Sequence Alignment

    PubMed Central

    Kam, Alfred; Kwak, Daniel; Leung, Clarence; Wu, Chu; Zarour, Eleyine; Sarmenta, Luis; Blanchette, Mathieu; Waldispühl, Jérôme


    Background Comparative genomics, or the study of the relationships of genome structure and function across different species, offers a powerful tool for studying evolution, annotating genomes, and understanding the causes of various genetic disorders. However, aligning multiple sequences of DNA, an essential intermediate step for most types of analyses, is a difficult computational task. In parallel, citizen science, an approach that takes advantage of the fact that the human brain is exquisitely tuned to solving specific types of problems, is becoming increasingly popular. There, instances of hard computational problems are dispatched to a crowd of non-expert human game players and solutions are sent back to a central server. Methodology/Principal Findings We introduce Phylo, a human-based computing framework applying “crowd sourcing” techniques to solve the Multiple Sequence Alignment (MSA) problem. The key idea of Phylo is to convert the MSA problem into a casual game that can be played by ordinary web users with a minimal prior knowledge of the biological context. We applied this strategy to improve the alignment of the promoters of disease-related genes from up to 44 vertebrate species. Since the launch in November 2010, we received more than 350,000 solutions submitted from more than 12,000 registered users. Our results show that solutions submitted contributed to improving the accuracy of up to 70% of the alignment blocks considered. Conclusions/Significance We demonstrate that, combined with classical algorithms, crowd computing techniques can be successfully used to help improving the accuracy of MSA. More importantly, we show that an NP-hard computational problem can be embedded in casual game that can be easily played by people without significant scientific training. This suggests that citizen science approaches can be used to exploit the billions of “human-brain peta-flops” of computation that are spent every day playing games. Phylo is available at: PMID:22412834

  20. Alignment of developments in higher education

    Microsoft Academic Search

    John Cowan; Judith W. George; Andreia Pinheiro-Torres


    This study builds upon the concept of alignment within the curriculum(due to Biggs) and suggests, in the context of two current examples, anintegrated methodology for effectively aligned development activitieswithin universities. Higher Education institutions face importantchallenges. Firstly, quality enhancement of the curriculum is now aninstitutional concern, if not a priority, in the face of governmentalpressure and in a competitive environment. It


    Microsoft Academic Search

    Annamaria Mesaros; Tuomas Virtanen


    This paper proposes an algorithm for aligning singing in pol y- phonic music audio with textual lyrics. As preprocessing, t he sys- tem uses a voice separation algorithm based on melody transcrip- tion and sinusoidal modeling. The alignment is based on a hid- den Markov model speech recognizer where the acoustic model is adapted to singing voice. The textual input

  2. Increasing Sequence Search Sensitivity with Transitive Alignments

    PubMed Central

    Malde, Ketil; Furmanek, Tomasz


    Sequence alignment is an important bioinformatics tool for identifying homology, but searching against the full set of available sequences is likely to result in many hits to poorly annotated sequences providing very little information. Consequently, we often want alignments against a specific subset of sequences: for instance, we are looking for sequences from a particular species, sequences that have known 3d-structures, sequences that have a reliable (curated) function annotation, and so on. Although such subset databases are readily available, they only represent a small fraction of all sequences. Thus, the likelihood of finding close homologs for query sequences is smaller, and the alignments will in general have lower scores. This makes it difficult to distinguish hits to homologous sequences from random hits to unrelated sequences. Here, we propose a method that addresses this problem by first aligning query sequences against a large database representing the corpus of known sequences, and then constructing indirect (or transitive) alignments by combining the results with alignments from the large database against the desired target database. We compare the results to direct pairwise alignments, and show that our method gives us higher sensitivity alignments against the target database. PMID:23457449

  3. Segmented mirror, manufacturing and alignment tolerances (SMMAT)

    Microsoft Academic Search

    P. K. Manhart; J. Michael Rodgers


    An attempt is made to define surface errors, and hence wavelength aberrations or optical path differences, due to fabrication and alignment errors of mirror segments. A FORTRAN routine is written to help to understand the relationship between system performance (Strehl ratio, etc.) and manufacturing and alignment errors for Precision Segmented Reflectors and Large Deployable Reflector. The power of having compensation

  4. Pyramid sensor for segmented mirror alignment

    Microsoft Academic Search

    Simone Esposito; E. Pinna; A. Puglisi; A. Tozzi; P. Stefanini


    We report what is to our knowledge the first laboratory experiment that shows the use of a pyramid wavefront sensor to cophase and align segmented mirrors having three degrees of freedom per segment, i.e., piston, tip, and tilt. In the laboratory the iterative alignment procedure reached a wavefront residual error of about 10 nm. The residual error was equally distributed

  5. Phylogenetic Inference From Conserved sites Alignments

    SciTech Connect

    grundy, W.N.; Naylor, G.J.P.


    Molecular sequences provide a rich source of data for inferring the phylogenetic relationships among species. However, recent work indicates that even an accurate multiple alignment of a large sequence set may yield an incorrect phylogeny and that the quality of the phylogenetic tree improves when the input consists only of the highly conserved, motif regions of the alignment. This work introduces two methods of producing multiple alignments that include only the conserved regions of the initial alignment. The first method retains conserved motifs, whereas the second retains individual conserved sites in the initial alignment. Using parsimony analysis on a mitochondrial data set containing 19 species among which the phylogenetic relationships are widely accepted, both conserved alignment methods produce better phylogenetic trees than the complete alignment. Unlike any of the 19 inference methods used before to analyze this data, both methods produce trees that are completely consistent with the known phylogeny. The motif-based method employs far fewer alignment sites for comparable error rates. For a larger data set containing mitochondrial sequences from 39 species, the site-based method produces a phylogenetic tree that is largely consistent with known phylogenetic relationships and suggests several novel placements.

  6. Instructional Alignment under No Child Left Behind

    ERIC Educational Resources Information Center

    Polikoff, Morgan S.


    The alignment of instruction with the content of standards and assessments is the key mediating variable separating the policy of standards-based reform (SBR) from the outcome of improved student achievement. Few studies have investigated SBR's effects on instructional alignment, and most have serious methodological limitations. This research uses…

  7. Text-Translation Alignment Martin Kay*

    E-print Network

    Wicentowski, Richard

    process rests on a notion of which word in one text corresponds to which word in the other text that is essentially based on the similarity of their distributions. It exploits a partial alignment of the word level to induce a maximum likelihood alignment of the sentence level, which is in turn used, in the next iteration

  8. Reasoning with a Network of Aligned Ontologies

    Microsoft Academic Search

    Antoine Zimmermann; Chan Le Duc


    In the context of the Semantic Web or semantic peer to peer systems, many ontologies may exist and be developed independently. Ontology alignments help integrating, mediating or reasoning with a system of networked ontologies. Though different formalisms have already been defined to reason with such sys- tems, they do not consider ontology alignments as first class objects designed by third

  9. Graphlet alignment in protein interaction networks

    Microsoft Academic Search

    Mu-Fen Hsieh; Sing-Hoi Sze


    With the increased availability of genome-scale data, it becomes possible to study functional relationships of genes across multiple biological networks. While most previous approaches for studying conservation of patterns in networks are through the application of network alignment algorithms or the identification of network motifs, we show that it is possible to exhaustively enumerate all graphlet alignments, which consist of

  10. The GEM Detector projective alignment simulation system

    SciTech Connect

    Wuest, C.R.; Belser, F.C.; Holdener, F.R.; Roeben, M.D. [Lawrence Livermore National Lab., CA (United States); Paradiso, J.A. [Draper (Charles Stark) Lab., Inc., Cambridge, MA (United States); Mitselmakher, G.; Ostapchuk, A.; Pier-Amory, J. [Superconducting Super Collider Lab., Dallas, TX (United States)


    Precision position knowledge (< 25 microns RMS) of the GEM Detector muon system at the Superconducting Super Collider Laboratory (SSCL) is an important physics requirement necessary to minimize sagitta error in detecting and tracking high energy muons that are deflected by the magnetic field within the GEM Detector. To validate the concept of the sagitta correction function determined by projective alignment of the muon detectors (Cathode Strip Chambers or CSCs), the basis of the proposed GEM alignment scheme, a facility, called the ``Alignment Test Stand`` (ATS), is being constructed. This system simulates the environment that the CSCs and chamber alignment systems are expected to experience in the GEM Detector, albeit without the 0.8 T magnetic field and radiation environment. The ATS experimental program will allow systematic study and characterization of the projective alignment approach, as well as general mechanical engineering of muon chamber mounting concepts, positioning systems and study of the mechanical behavior of the proposed 6 layer CSCs. The ATS will consist of a stable local coordinate system in which mock-ups of muon chambers (i.e., non-working mechanical analogs, representing the three superlayers of a selected barrel and endcap alignment tower) are implemented, together with a sufficient number of alignment monitors to overdetermine the sagitta correction function, providing a self-consistency check. This paper describes the approach to be used for the alignment of the GEM muon system, the design of the ATS, and the experiments to be conducted using the ATS.

  11. Partial Automated Alignment and Integration System

    NASA Technical Reports Server (NTRS)

    Kelley, Gary Wayne (Inventor)


    The present invention is a Partial Automated Alignment and Integration System (PAAIS) used to automate the alignment and integration of space vehicle components. A PAAIS includes ground support apparatuses, a track assembly with a plurality of energy-emitting components and an energy-receiving component containing a plurality of energy-receiving surfaces. Communication components and processors allow communication and feedback through PAAIS.

  12. Vector Correlation and Alignment in Chemistry

    E-print Network

    Zare, Richard N.

    Vector Correlation and Alignment in Chemistry Edited by Gabriel G. Balint-Kurti Marcelo P. de Miranda #12;#12;Vector Correlation and Alignment in Chemistry Edited by Gabriel G. Balint-Kurti School. Balint-Kurti, Bristol M. P. de Miranda, Leeds September 2005 v #12;Previous booklets in the CCP6 Workshop

  13. Achieving Organisational Change through Values Alignment

    ERIC Educational Resources Information Center

    Branson, Christopher M.


    Purpose: The purpose of this paper is to, first, establish the interdependency between the successful achievement of organisational change and the attainment of values alignment within an organisation's culture and then, second, to describe an effective means for attaining such values alignment. Design/methodology/approach: Literature from the…

  14. Phonetic alignment and similarity Grzegorz Kondrak

    E-print Network

    Kondrak, Greg

    Phonetic alignment and similarity Grzegorz Kondrak Department of Computing Science April 4, 2003 Abstract. The computation of the optimal phonetic alignment and the phonetic similarity be that employs a scoring scheme for computing phonetic similarity between phonetic segments on the basis

  15. Aligning Protein Sequences with Predicted Secondary Structure

    E-print Network

    Wheeler, Travis

    and recovery error. We then evaluate these models by studying how accurately an optimal alignment under-Coffee (No- tredame et al., 2000), and MUSCLE (Edgar, 2004); (b) polishing, which iteratively refines the alignment by realigning subgroups, and is used by PRRN (Gotoh, 1996), MAFFT (Katoh et al., 2005), MUSCLE

  16. 12 Sequence Alignments Alexander K. Hartmann

    E-print Network

    Hartmann, Alexander K.

    12 Sequence Alignments Alexander K. Hartmann Institut fË?ur Theoretische Physik UniversitË?at G of proteins, see e.g. the contribution by U.H.E. Hansmann in chapter 13. Here, we are dealing with sequence align­ ments, which is a method to compare different biological sequences like genes or proteins. We

  17. Sequence Alignment and Statistical Physics Ralf Bundschuh

    E-print Network

    Bundschuh, Ralf

    1 Sequence Alignment and Statistical Physics Ralf Bundschuh Department of Physics, The Ohio State; Biological sequence data and what is a gene? #15; Sequence alignment #15; Relation to polymers, surface growth, and traÃ?c models #15; Statistical signi#12;cance #15; Conclusions #12; Biological sequence data

  18. Water Information System Platforms Addressing Critical Societal Needs in the Mena Region

    NASA Technical Reports Server (NTRS)

    Habib, Shahid; Kfouri, Claire; Peters, Mark


    The MENA region includes 18 countries, the occupied Palestinian territories and Western Sahara. However, the region of interest for this study has a strategic interest in countries adjacent to the Mediterranean Sea, which includes, Morocco, Tunisia, Egypt, Lebanon and Jordan. The 90% of the water in the MENA region is used for the agriculture use. By the end of this century. this region is projected to experience an increase of 3 C to 5 C in mean temperatures and a 20% decline in precipitation (lPCC, 2007). Due to lower precipitation, water run-off is projected to drop by 20% to 30% in most of MENA by 2050 Reduced stream flow and groundwater recharge might lead to a reduction in water supply of 10% or greater by 2050. Therefore, per IPCC projections in temperature rise and precipitation decline in the region, the scarcity of water will become more acute with population growth, and rising demand of food in the region. Additionally, the trans boundary water issues will continue to plague the region in terms of sharing data for better management of water resources. Such pressing issues have brought The World Bank, USAID and NASA to jointly collaborate for establishing integrated, modern, up to date NASA developed capabilities for countries in the MENA region for addressing water resource issues and adapting to climate change impacts for improved decision making and societal benefit. This initiative was launched in October 2011 and is schedule to be completed by the end of2015.

  19. Web-Based Geospatial Tools to Address Hazard Mitigation, Natural Resource Management, and Other Societal Issues

    USGS Publications Warehouse

    Hearn, Paul P.


    Federal, State, and local government agencies in the United States face a broad range of issues on a daily basis. Among these are natural hazard mitigation, homeland security, emergency response, economic and community development, water supply, and health and safety services. The U.S. Geological Survey (USGS) helps decision makers address these issues by providing natural hazard assessments, information on energy, mineral, water and biological resources, maps, and other geospatial information. Increasingly, decision makers at all levels are challenged not by the lack of information, but by the absence of effective tools to synthesize the large volume of data available, and to utilize the data to frame policy options in a straightforward and understandable manner. While geographic information system (GIS) technology has been widely applied to this end, systems with the necessary analytical power have been usable only by trained operators. The USGS is addressing the need for more accessible, manageable data tools by developing a suite of Web-based geospatial applications that will incorporate USGS and cooperating partner data into the decision making process for a variety of critical issues. Examples of Web-based geospatial tools being used to address societal issues follow.

  20. Summary proceedings of a workshop on Bioremediation and its Societal Implications and Concerns (BASIC)

    SciTech Connect

    Drell, D.W. [Department of Energy, Germantown, MD (United States). Office of Health and Environmental Research, Health Effects and Life Sciences Research Division; Metting, F.B. Jr. [Pacific Northwest National Lab., Richland, WA (United States); Wuy, L.D. [ed.] [Lawrence Berkeley National Lab., CA (United States)


    This document summarizes the proceedings of a workshop on Bioremediation and Its Societal Implications and Concerns (BASIC) held July 18-19, 1996 at the Airlie Center near Warrenton, Virginia. The workshop was sponsored by the Office of Health and Environmental Research (OHER), U.S. Department of Energy (DOE), as part of its fundamental research program in Natural and Accelerated Bioremediation Research (NABIR). The information summarized in these proceedings represents the general conclusions of the workshop participants, and not the opinions of workshop organizers or sponsors. Neither are they consensus opinions, as opinions differed among participants on a number of points. The general conclusions presented below were reached through a review, synthesis, and condensation of notes taken by NABIR Program Office staff and OHER program managers throughout the workshop. Specific contributions by participants during breakout sessions are recorded in bullet form in the appropriate sections, without attribution to the contributors. These contributions were transcribed as faithfully as possible from notes about the original discussions. They were edited only to make them grammatically correct, parallel in structure, and understandable to someone not familiar with the NABIR Program or BASIC element.

  1. Measuring the patient health, societal and economic benefits of US pediatric therapeutics legislation.


    Vernon, John A; Shortenhaus, Scott H; Mayer, Mark H; Allen, Albert J; Golec, Joseph H


    Through at least the mid-1990s, children were often referred to as 'therapeutic orphans' for whom many treatments were administered without the benefit of appropriate studies to guide drug labeling for dosing and other critical therapeutic decisions. At that time, there were no incentives for manufacturers to pursue such work, nor regulatory requirements to compel these studies. Congress addressed this by including an important provision titled the Best Pharmaceuticals for Children Act (BPCA) in the 1997 Food and Drug Administration Modernization and Accountability Act. This was complemented by another key piece of legislation, the Pediatric Research Equity Act (PREA) in 2003. The former Act and its successors created an incentive for firms to study on-patent drugs in pediatric populations by extending the market exclusivity of a medicine by 6 months. The latter was a requirement that provided the US FDA with the authority to require studies of drugs in children if an adult indication also occurs in children. In the current paper, we consider the effects of both pieces of legislation in terms of the health, societal, and economic benefits they have likely imparted and will continue to provide in the future. We conclude that the gains have been substantial - both in terms of safer and more effective use of medicines in children and in terms of new research that has been incentivized by the BPCA exclusivity provision. We estimate the gross economic benefits from the latter alone to be approximately $US360?billion. PMID:22775493

  2. Purchasing population health: aligning financial incentives to improve health outcomes.

    PubMed Central

    Kindig, D A


    OBJECTIVE: To review the concept of population health, including its definition, measurement, and determinants, and to suggest an approach for aligning financial incentives toward this goal. DATA SOURCE, STUDY DESIGN, DATA EXTRACTION. Literature review, policy analysis PRINCIPAL FINDINGS: The article presents the argument that a major reason for our slow progress toward health outcome improvement is that there is no operational definition of population health and that financial incentives are not aligned to this goal. Current attempts at process measures as indicators of quality or outcome are not adequate for the task. It is suggested that some measure of health-adjusted life expectancy be adopted for this purpose, and that integrated delivery systems and other agents responsible for nonmedical determinants be rewarded for improvement in this measure. This will require the development of an investment portfolio across the determinants of health based on relative marginal return to health, with horizontal integration strategies across sectoral boundaries. A 20-year three-phase development strategy is proposed, including components of research and acceptance, integrated health system implementation, and cross-sectoral integration. CONCLUSIONS: The U.S. healthcare system is a $1 trillion industry without a definition of its product. Until population outcome measures are developed and rewarded for, we will not solve the twenty-first century challenge of maximizing health outcome improvement for the resources available. Images Figure 1 PMID:9618669

  3. Reading Comprehension Strategies for Adult Literacy Outcomes

    ERIC Educational Resources Information Center

    Hock, Mike; Mellard, Daryl


    This study extends the knowledge garnered from work with younger populations to determine the reading comprehension strategies most important to adults' success on outcome measures and to align them with previously researched interventions. According to an analysis of competence-based standardized tests of literacy (such as the General Educational…

  4. BigFoot: Bayesian alignment and phylogenetic footprinting with MCMC

    Microsoft Academic Search

    Rahul Satija; Ádám Novák; István Miklós; Rune Lyngsø; Jotun Hein


    BACKGROUND: We have previously combined statistical alignment and phylogenetic footprinting to detect conserved functional elements without assuming a fixed alignment. Considering a probability-weighted distribution of alignments removes sensitivity to alignment errors, properly accommodates regions of alignment uncertainty, and increases the accuracy of functional element prediction. Our method utilized standard dynamic programming hidden markov model algorithms to analyze up to four

  5. Environmental Management Strategy: Four Forces Analysis

    NASA Astrophysics Data System (ADS)

    Doyle, Martin W.; Von Windheim, Jesko


    We develop an analytical approach for more systematically analyzing environmental management problems in order to develop strategic plans. This approach can be deployed by agencies, non-profit organizations, corporations, or other organizations and institutions tasked with improving environmental quality. The analysis relies on assessing the underlying natural processes followed by articulation of the relevant societal forces causing environmental change: (1) science and technology, (2) governance, (3) markets and the economy, and (4) public behavior. The four forces analysis is then used to strategize which types of actions might be most effective at influencing environmental quality. Such strategy has been under-used and under-valued in environmental management outside of the corporate sector, and we suggest that this four forces analysis is a useful analytic to begin developing such strategy.

  6. Environmental management strategy: four forces analysis.


    Doyle, Martin W; Von Windheim, Jesko


    We develop an analytical approach for more systematically analyzing environmental management problems in order to develop strategic plans. This approach can be deployed by agencies, non-profit organizations, corporations, or other organizations and institutions tasked with improving environmental quality. The analysis relies on assessing the underlying natural processes followed by articulation of the relevant societal forces causing environmental change: (1) science and technology, (2) governance, (3) markets and the economy, and (4) public behavior. The four forces analysis is then used to strategize which types of actions might be most effective at influencing environmental quality. Such strategy has been under-used and under-valued in environmental management outside of the corporate sector, and we suggest that this four forces analysis is a useful analytic to begin developing such strategy. PMID:25331643

  7. Cybersecurity Strategies

    E-print Network

    Cybenko, George

    Cybersecurity Strategies: The QuERIES Methodology Lawrence Carin Duke University George Cybenko-efficient cybersecurity strategies. O rganizations in both the private and public sectors have strug- gled to determine typically implemented cybersecurity investment strategies with- out useful guidance from a rigorous

  8. Semiautomatic beam-based LHC collimator alignment

    NASA Astrophysics Data System (ADS)

    Valentino, Gianluca; Aßmann, Ralph; Bruce, Roderik; Redaelli, Stefano; Rossi, Adriana; Sammut, Nicholas; Wollmann, Daniel


    Full beam-based alignment of the LHC collimation system was a time-consuming procedure (up to 28 hours) as the collimators were set up manually. A yearly alignment campaign has been sufficient for now, although in the future due to tighter tolerances this may lead to a decrease in the cleaning efficiency if machine parameters such as the beam orbit drift over time. Automating the collimator setup procedure can reduce the beam time for collimator setup and allow for more frequent alignments, therefore reducing the risk of performance degradation. This article describes the design and testing of a semiautomatic algorithm as a first step towards a fully automatic setup procedure. The parameters used to measure the accuracy and performance of the alignment are defined and determined from experimental data. A comparison of these measured parameters at 450 GeV and 3.5 TeV with manual and semiautomatic alignment is provided.

  9. Automated interferometric alignment system for paraboloidal mirrors


    Maxey, L. Curtis (Powell, TN)


    A method is described for a systematic method of interpreting interference fringes obtained by using a corner cube retroreflector as an alignment aid when aigning a paraboloid to a spherical wavefront. This is applicable to any general case where such alignment is required, but is specifically applicable in the case of aligning an autocollimating test using a diverging beam wavefront. In addition, the method provides information which can be systematically interpreted such that independent information about pitch, yaw and focus errors can be obtained. Thus, the system lends itself readily to automation. Finally, although the method is developed specifically for paraboloids, it can be seen to be applicable to a variety of other aspheric optics when applied in combination with a wavefront corrector that produces a wavefront which, when reflected from the correctly aligned aspheric surface will produce a collimated wavefront like that obtained from the paraboloid when it is correctly aligned to a spherical wavefront.

  10. Vane segment support and alignment device


    McLaurin, Leroy Dixon (Winter Springs, FL); Sizemore, John Derek (Orlando, FL)


    A support and alignment assembly for supporting and aligning a vane segment is provided. The support and alignment assembly comprises a torque plate which defines an opening for receiving an eccentric pin and a locking end member for receiving a lock socket member. An eccentric pin adjustably supported by the torque plate opening for supporting and aligning a vane segment is provided. A lock socket member adapted to securely receive the eccentric pin and rotated therewith, and adjustably engage the torque plate locking end is provided. The lock socket member receives the eccentric pin, such that when the eccentric pin is adjusted to align the vane segment, the lock socket member engages the torque plate locking end to secure the vane segment in the desired position.

  11. Accelerated large-scale multiple sequence alignment

    PubMed Central


    Background Multiple sequence alignment (MSA) is a fundamental analysis method used in bioinformatics and many comparative genomic applications. Prior MSA acceleration attempts with reconfigurable computing have only addressed the first stage of progressive alignment and consequently exhibit performance limitations according to Amdahl's Law. This work is the first known to accelerate the third stage of progressive alignment on reconfigurable hardware. Results We reduce subgroups of aligned sequences into discrete profiles before they are pairwise aligned on the accelerator. Using an FPGA accelerator, an overall speedup of up to 150 has been demonstrated on a large data set when compared to a 2.4 GHz Core2 processor. Conclusions Our parallel algorithm and architecture accelerates large-scale MSA with reconfigurable computing and allows researchers to solve the larger problems that confront biologists today. Program source is available from PMID:22151470

  12. Aligning Greek-English parallel texts

    NASA Astrophysics Data System (ADS)

    Galiotou, Eleni; Koronakis, George; Lazari, Vassiliki


    In this paper, we discuss issues concerning the alignment of parallel texts written in languages with different alphabets based on an experiment of aligning texts from the proceedings of the European Parliament in Greek and English. First, we describe our implementation of the k-vec algorithm and its application to the bilingual corpus. Then the output of the algorithm is used as a starting point for an alignment procedure at a sentence level which also takes into account mark-ups of meta-information. The results of the implementation are compared to those of the application of the Church and Gale alignment algorithm on the Europarl corpus. The conclusions of this comparison can give useful insights as for the efficiency of alignment algorithms when applied to the particular bilingual corpus.

  13. Laminar silk scaffolds for aligned tissue fabrication.


    Mandal, Biman B; Gil, Eun Seok; Panilaitis, Bruce; Kaplan, David L


    3D-biomaterial scaffolds with aligned architecture are of vital importance in tissue regeneration. A generic method is demonstrated to produce aligned biomaterial scaffolds using the physics of directional ice freezing. Homogeneously aligned 3D silk scaffolds with high porosity and alignment are prepared. The method can be adapted to a wide range of polymers and is devoid of any chemical reactions, thus avoiding potential complications associated with by-products. Mechanical properties and cellular responses with chondrocytes and bone-marrow-derived hMSCs are studied, assessing survival, proliferation, and differentiation. In vivo tests suggest biocompatibility of the matrices for future tissue engineering applications, specifically in areas where high cellular alignment is needed. PMID:23161731

  14. Vane segment support and alignment device


    McLaurin, L.D.; Sizemore, J.D.


    A support and alignment assembly for supporting and aligning a vane segment is provided. The support and alignment assembly comprises a torque plate which defines an opening for receiving an eccentric pin and a locking end member for receiving a lock socket member. An eccentric pin adjustably supported by the torque plate opening for supporting and aligning a vane segment is provided. A lock socket member adapted to securely receive the eccentric pin and rotated therewith, and adjustably engage the torque plate locking end is provided. The lock socket member receives the eccentric pin, such that when the eccentric pin is adjusted to align the vane segment, the lock socket member engages the torque plate locking end to secure the vane segment in the desired position. 5 figs.

  15. High quality protein sequence alignment by combining structural profile prediction and profile alignment using SABERTOOTH

    PubMed Central


    Background Protein alignments are an essential tool for many bioinformatics analyses. While sequence alignments are accurate for proteins of high sequence similarity, they become unreliable as they approach the so-called 'twilight zone' where sequence similarity gets indistinguishable from random. For such distant pairs, structure alignment is of much better quality. Nevertheless, sequence alignment is the only choice in the majority of cases where structural data is not available. This situation demands development of methods that extend the applicability of accurate sequence alignment to distantly related proteins. Results We develop a sequence alignment method that combines the prediction of a structural profile based on the protein's sequence with the alignment of that profile using our recently published alignment tool SABERTOOTH. In particular, we predict the contact vector of protein structures using an artificial neural network based on position-specific scoring matrices generated by PSI-BLAST and align these predicted contact vectors. The resulting sequence alignments are assessed using two different tests: First, we assess the alignment quality by measuring the derived structural similarity for cases in which structures are available. In a second test, we quantify the ability of the significance score of the alignments to recognize structural and evolutionary relationships. As a benchmark we use a representative set of the SCOP (structural classification of proteins) database, with similarities ranging from closely related proteins at SCOP family level, to very distantly related proteins at SCOP fold level. Comparing these results with some prominent sequence alignment tools, we find that SABERTOOTH produces sequence alignments of better quality than those of Clustal W, T-Coffee, MUSCLE, and PSI-BLAST. HHpred, one of the most sophisticated and computationally expensive tools available, outperforms our alignment algorithm at family and superfamily levels, while the use of SABERTOOTH is advantageous for alignments at fold level. Our alignment scheme will profit from future improvements of structural profiles prediction. Conclusions We present the automatic sequence alignment tool SABERTOOTH that computes pairwise sequence alignments of very high quality. SABERTOOTH is especially advantageous when applied to alignments of remotely related proteins. The source code is available at, free for academic users upon request. PMID:20470364

  16. Pin-Align: a new dynamic programming approach to align protein-protein interaction networks.


    Amir-Ghiasvand, Farid; Nowzari-Dalini, Abbas; Momenzadeh, Vida


    To date, few tools for aligning protein-protein interaction networks have been suggested. These tools typically find conserved interaction patterns using various local or global alignment algorithms. However, the improvement of the speed, scalability, simplification, and accuracy of network alignment tools is still the target of new researches. In this paper, we introduce Pin-Align, a new tool for local alignment of protein-protein interaction networks. Pin-Align accuracy is tested on protein interaction networks from IntAct, DIP, and the Stanford Network Database and the results are compared with other well-known algorithms. It is shown that Pin-Align has higher sensitivity and specificity in terms of KEGG Ortholog groups. PMID:25435900

  17. Pin-Align: A New Dynamic Programming Approach to Align Protein-Protein Interaction Networks

    PubMed Central


    To date, few tools for aligning protein-protein interaction networks have been suggested. These tools typically find conserved interaction patterns using various local or global alignment algorithms. However, the improvement of the speed, scalability, simplification, and accuracy of network alignment tools is still the target of new researches. In this paper, we introduce Pin-Align, a new tool for local alignment of protein-protein interaction networks. Pin-Align accuracy is tested on protein interaction networks from IntAct, DIP, and the Stanford Network Database and the results are compared with other well-known algorithms. It is shown that Pin-Align has higher sensitivity and specificity in terms of KEGG Ortholog groups. PMID:25435900


    E-print Network

    Paris-Sud XI, Université de

    COLLOQUE POLITIQUE ET ALTERITE : LA SOCIETE FRAN�AISE FACE AU RACISME Nice, 9,10,11 décembre 1999 Christian Rinaudo (SOLIIS-URMIS, CNRS et Université de Nice-Sophia Antipolis) Pratiques syndicales, racisme présentons ici les premiers éléments d'une recherche en cours sur le " racisme au travail ", pour reprendre

  19. Societal Costs of Risky Driving: An Economic Analysis of High-Risk Patients Visiting an Urban Emergency Department

    Microsoft Academic Search

    Benjamin D. Sommers; Jamison D. Fargo; Michael S. Lyons; Jean T. Shope; Marilyn S. Sommers


    Objectives: We estimated the societal costs imposed by and the relative contributions of risky driving, drinking–driving, and substance use among young adults visiting a large urban emergency department who exhibited both high-risk driving and problem drinking.Methods: Emergency department patients aged 18 to 44 who screened positive for risky driving and problem drinking (n = 275) were surveyed regarding driving behaviors,

  20. SPS microwave subsystem potential impacts and benefits. [environmental and societal effects of Solar Power System construction and operation

    NASA Technical Reports Server (NTRS)

    Dickinson, R. M.


    The paper examines the possible environmental and societal effects of the construction, installation, and operation of the space end and earth end of the microwave power transmission subsystem that delivers satellite power system (SPS) energy (at about 5 GW per beam) to the power grid on earth. The intervening propagation medium near the earth is also considered. Separate consideration is given to the spacecraft transmitting array, propagation in the ionosphere, and the ground-based rectenna. Radio frequency interference aspects are also discussed.

  1. Ethics in the Societal Debate on Genetically Modified Organisms: A (Re)Quest for Sense and Sensibility

    Microsoft Academic Search

    Yann Devos; Pieter Maeseele; Dirk Reheul; Linda Van Speybroeck; Danny De Waele


    Via a historical reconstruction, this paper primarily demonstrates how the societal debate on genetically modified organisms\\u000a (GMOs) gradually extended in terms of actors involved and concerns reflected. It is argued that the implementation of recombinant\\u000a DNA technology out of the laboratory and into civil society entailed a “complex of concerns.” In this complex, distinctions\\u000a between environmental, agricultural, socio-economic, and ethical

  2. Focus Mutual Information for medical image alignment in

    E-print Network

    Einmahl, Uwe

    Focus Mutual Information for medical image alignment in dentistry, orthodontics and craniofacial . . . . . . . . . . . 13 2.3.2 Mutual information image alignment . . . . . . . . . . 14 2.3.3 Information theory applied . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 3 Focus Mutual Information alignment 27 3.1 Introduction

  3. Structural Alignment Sensor Feasibility Demonstration

    NASA Technical Reports Server (NTRS)

    Anderson, R. H.; Huang, C. C.; Hodor, J. R.


    A structural alignment sensor (SAS) was developed for use with large deployable antenna systems for contour measurement and/or active control. The SAS is a laser ranging system using frequency modulation and accurate phase measurement to determine distance. Work was done with a CO2 and HeNe laser. The capability of the SAS to measure antenna rib contours was studied over ranges of 50 meters to a resolution of 100 microns. Initial resolution data was taken with the CO2 system. This data shows that it will indeed meet the SAS requirements. The development of the HeNe system was initiated because it offers substantial improvement in size, weight, and power over the CO2 system. The final demonstration was made with the HeNe system and it too showed that the SAS requirements could be met with this alternate approach. The projection of these results to a conceptual design for a flight system and its application are described.

  4. Sparse alignment for robust tensor learning.


    Lai, Zhihui; Wong, Wai Keung; Xu, Yong; Zhao, Cairong; Sun, Mingming


    Multilinear/tensor extensions of manifold learning based algorithms have been widely used in computer vision and pattern recognition. This paper first provides a systematic analysis of the multilinear extensions for the most popular methods by using alignment techniques, thereby obtaining a general tensor alignment framework. From this framework, it is easy to show that the manifold learning based tensor learning methods are intrinsically different from the alignment techniques. Based on the alignment framework, a robust tensor learning method called sparse tensor alignment (STA) is then proposed for unsupervised tensor feature extraction. Different from the existing tensor learning methods, L1- and L2-norms are introduced to enhance the robustness in the alignment step of the STA. The advantage of the proposed technique is that the difficulty in selecting the size of the local neighborhood can be avoided in the manifold learning based tensor feature extraction algorithms. Although STA is an unsupervised learning method, the sparsity encodes the discriminative information in the alignment step and provides the robustness of STA. Extensive experiments on the well-known image databases as well as action and hand gesture databases by encoding object images as tensors demonstrate that the proposed STA algorithm gives the most competitive performance when compared with the tensor-based unsupervised learning methods. PMID:25291733

  5. Multiple Sequence Alignment by Conformational Space Annealing

    PubMed Central

    Joo, Keehyoung; Lee, Jinwoo; Kim, Ilsoo; Lee, Sung Jong; Lee, Jooyoung


    We present a new method for multiple sequence alignment (MSA), which we call MSACSA. The method is based on the direct application of a global optimization method called the conformational space annealing (CSA) to a consistency-based score function constructed from pairwise sequence alignments between constituting sequences. We applied MSACSA to two MSA databases, the 82 families from the BAliBASE reference set 1 and the 366 families from the HOMSTRAD set. In all 450 cases, we obtained well optimized alignments satisfying more pairwise constraints producing, in consequence, more accurate alignments on average compared with a recent alignment method SPEM. One of the advantages of MSACSA is that it provides not just the global minimum alignment but also many distinct low-lying suboptimal alignments for a given objective function. This is due to the fact that conformational space annealing can maintain conformational diversity while searching for the conformations with low energies. This characteristics can help us to alleviate the problem arising from using an inaccurate score function. The method was the key factor for our success in the recent blind protein structure prediction experiment. PMID:18689453

  6. The Growth of Hydrological Understanding: Observations, Theories and Societal Influences that have Shaped the Field

    NASA Astrophysics Data System (ADS)

    Sivapalan, M.


    “Progress in science depends on new techniques, new discoveries and new ideas, probably in that order.” Sydney Brenner (1980). ______________ Science never progresses smoothly or uniformly on all fronts. History of science tells us that progress cannot be meticulously planned, and elaborate plans do not always end up at their intended targets. Breakthroughs tend to happen by themselves through human ingenuity, which cannot be precisely predicted nor pre-planned. All sciences go through periods of euphoria, stagnation, pessimism and then recovery. New theories/ideas, or new measurements/data sources or new analysis techniques have alternated in generating vital breakthroughs. Progress in science is also not immune from other societal and technological influences, including wars. Hydrology is no exception. However, at this point in time it is not clear if hydrologic science is limited by data (and our ability to measure or monitor water cycle dynamics) or by theories or vital ideas that can help us understand how the hydrologic system works and will evolve. We can map the surface of Mars in search of the presence of water, but cannot close the water balance here on Earth. We have instruments that can help us observe pore scale processes in the laboratory, but still cannot predict how these will evolve in time in real places, at much larger scales. We are dealing with a complex adaptive system that evolves at all time and space scales. There is a great need for data to close the water balance, but there is an even greater need to understand and predict in all places in such a dynamic environment. It sometimes happens that every time a new measurement technology or data analysis technique is introduced we get excited and pour enormous resources on their development only to be disappointed that we have gone down a narrow alley. In spite of occasional breakthroughs in our measurement capability, the bigger challenge remains our inability to extrapolate beyond the measurement points to ungauged, unmapped and unmeasured points, in a rapidly changing environment. Which path should we therefore pursue? Should we be guided by deeper questions, and then use appropriate instruments that fit the task in a balanced way? Or should we follow the opportunistic path provided by the potential of new measurement technologies or new forms of data analysis, and then hope for the best? In this talk I will trace the history of theory development, measurements and data, and model diagnostics in hydrology over the past 80 years, from the time of Robert Horton, to illustrate how the interactions and feedbacks between theories and measurements, on a broad front characterized by other societal and technological influences, including the 1991 Opportunities in the Hydrological Sciences Report (Blue Book), have shaped the development of hydrology as an earth science.

  7. Alignment Cube with One Diffractive Face

    NASA Technical Reports Server (NTRS)

    Ohl, Raymond G.; Sampler, Henry P.; Strojny, Carl R.; Hagopian, John G.; McMann, Joseph C.


    An enhanced alignment cube has been invented for use in a confined setting (e.g., a cryogenic chamber) in which optical access may be limited to a single line of sight. Whereas traditional alignment-cube practice entails the use of two theodolites aimed along two lines of sight, the enhanced alignment cube yields complete alignment information through use of a single theodolite aimed along a single line of sight. Typically, an alignment cube is placed in contact with a datum surface or other reference feature on a scientific instrument during assembly or testing of the instrument. The alignment cube is then used in measuring a small angular deviation of the feature from a precise required orientation. Commonly, the deviation is expressed in terms of rotations (Rx,Ry,Rz) of the cube about the corresponding Cartesian axes (x,y,z). In traditional practice, in order to measure all three rotations, it is necessary to use two theodolites aimed at two orthogonal faces of the alignment cube, as shown in the upper part of the figure. To be able to perform such a measurement, one needs optical access to these two faces. In the case of an alignment cube inside a cryogenic chamber or other enclosed space, the optical-access requirement translates to a requirement for two windows located along the corresponding two orthogonal lines of sight into the chamber. In a typical application, it is difficult or impossible to provide two windows. The present enhanced version of the alignment cube makes it possible to measure all three rotations by use of a single line of sight, thereby obviating a second window.

  8. The Economic impact of ME/CFS: Individual and societal costs

    PubMed Central

    Jason, Leonard A; Benton, Mary C; Valentine, Lisa; Johnson, Abra; Torres-Harding, Susan


    Background ME/CFS is characterized by debilitating fatigue in addition to other physical and cognitive symptoms. It is estimated to affect over 800,000 adults in the U.S. ME/CFS often results in diminished functionality and increased economic impact. The economic impact of an illness is generally divided into two categories: direct and indirect costs. Despite high prevalence rates and the disabling nature of the illness, few studies have examined the costs of ME/CFS at the individual and societal level. In fact, of the four studies examining the economic impact of ME/ME/CFS only two used a U. S. sample. The current study used community and tertiary samples to examine the direct costs of ME/CFS. Methods Using archival data, Study 1 examined the direct cost of ME/CFS in a community-based sample in Chicago. Study 2 estimated the direct cost of ME/CFS in a tertiary sample in Chicago. Both Study1 and Study 2 assessed direct costs using office visit costs, medical test costs, and medication costs. Results For Study 1, the annual direct total cost per ME/CFS patient was estimated to be $2,342, with the total annual direct cost of ME/CFS to society being approximately $2 billion. In Study 2, the annual direct was estimated to be $8,675 per ME/CFS patient, with the total annual direct cost of ME/CFS to society being approximately $7 billion. Conclusion Using ME/CFS prevalence data of 0.42 and indirect costs estimates from Reynolds et al. (2004), the direct and indirect cost of ME/CFS to society was estimated to be $18,677,912,000 for the community sample and $23,972,300,000 for the tertiary sample. These findings indicate that whether or not individuals are recruited from a community or tertiary sample, ME/CFS imposes substantial economic costs. PMID:18397528

  9. Societal Values and Policies May Curtail Preschool Children’s Physical Activity in Child Care Centers

    PubMed Central

    Sherman, Susan N.; Kendeigh, Cassandra A.; Kalkwarf, Heidi J.; Saelens, Brian E.


    BACKGROUND AND OBJECTIVES: Three-fourths of US preschool-age children are in child care centers. Children are primarily sedentary in these settings, and are not meeting recommended levels of physical activity. Our objective was to identify potential barriers to children’s physical activity in child care centers. METHODS: Nine focus groups with 49 child care providers (55% African American) were assembled from 34 centers (inner-city, suburban, Head Start, and Montessori) in Cincinnati, Ohio. Three coders independently analyzed verbatim transcripts for themes. Data analysis and interpretation of findings were verified through triangulation of methods. RESULTS: We identified 3 main barriers to children’s physical activity in child care: (1) injury concerns, (2) financial, and (3) a focus on “academics.” Stricter licensing codes intended to reduce children's injuries on playgrounds rendered playgrounds less physically challenging and interesting. In addition, some parents concerned about potential injury, requested staff to restrict playground participation for their children. Small operating margins of most child care centers limited their ability to install abundant playground equipment. Child care providers felt pressure from state mandates and parents to focus on academics at the expense of gross motor play. Because children spend long hours in care and many lack a safe place to play near their home, these barriers may limit children's only opportunity to engage in physical activity. CONCLUSIONS: Societal priorities for young children—safety and school readiness—may be hindering children’s physical development. In designing environments that optimally promote children’s health and development, child advocates should think holistically about potential unintended consequences of policies. PMID:22218842

  10. Infrastructure, human resources, international cooperation, research and development, environment and health, societal issues, industrial innovation, Infrastructure, human resources, international cooperation, research and development, environment and hea

    E-print Network

    Zürich, Universität

    Infrastructure, human resources, international cooperation, research and development, environment and health, societal issues, industrial innovation, Infrastructure, human resources, international Infrastructure, human resources, international cooperation, research and development, environment and health

  11. Self-aligning biaxial load frame


    Ward, Michael B. (Idaho Falls, ID); Epstein, Jonathan S. (Idaho Falls, ID); Lloyd, W. Randolph (Idaho Falls, ID)


    An self-aligning biaxial loading apparatus for use in testing the strength of specimens while maintaining a constant specimen centroid during the loading operation. The self-aligning biaxial loading apparatus consists of a load frame and two load assemblies for imparting two independent perpendicular forces upon a test specimen. The constant test specimen centroid is maintained by providing elements for linear motion of the load frame relative to a fixed crosshead, and by alignment and linear motion elements of one load assembly relative to the load frame.

  12. Bias Alignment of the VERITAS Telescopes

    NASA Astrophysics Data System (ADS)

    Toner, J. A.; Acciari, V. A.; Cesarini, A.; et al.

    The mirror facets on the VERITAS telescopes, which are of Davies-Cotton design, are aligned with the telescope axis in the horizontal position using a laser projector at the radius of curvature. The instrument used will be described. The mechanical design of the Optical Support Structure permits some gravitational slumping with elevation which can be counteracted by bias alignment (deliberate misalignment at 0 degree elevation). In practice this allows the optimum Point Spread Function (PSF) to be attained over an elevation range from 50 to 85 degree. The on and off axis PSFs, before and after bias alignment, will be presented.

  13. Alignment of chirped-pulse compressor

    SciTech Connect

    Yakovlev, I V [Institute of Applied Physics, Russian Academy of Sciences, Nizhny Novgorod (Russian Federation)


    An original method of alignment of grating compressors for ultrahigh-power CPA laser systems is proposed. The use of this method for adjustment of the grating compressor of a PEARL subpetawatt laser complex made it possible to align the diffraction gratings with a second accuracy in all three angular degrees of freedom, including alignment of the grooves, and to adjust the angles of beam incidence on the grating with a high accuracy. A simple method for measuring the difference in the groove densities of gratings with accuracy better than 0.005 lines mm{sup -1} is proposed and tested. (control of laser radiation parameters)

  14. Self-aligning biaxial load frame


    Ward, M.B.; Epstein, J.S.; Lloyd, W.R.


    An self-aligning biaxial loading apparatus for use in testing the strength of specimens while maintaining a constant specimen centroid during the loading operation. The self-aligning biaxial loading apparatus consists of a load frame and two load assemblies for imparting two independent perpendicular forces upon a test specimen. The constant test specimen centroid is maintained by providing elements for linear motion of the load frame relative to a fixed cross head, and by alignment and linear motion elements of one load assembly relative to the load frame. 3 figures.

  15. Computing posterior probabilities for score-based alignments using ppALIGN.


    Wolfsheimer, Stefan; Hartmann, Alexander; Rabus, Ralf; Nuel, Gregory


    Score-based pairwise alignments are widely used in bioinformatics in particular with molecular database search tools, such as the BLAST family. Due to sophisticated heuristics, such algorithms are usually fast but the underlying scoring model unfortunately lacks a statistical description of the reliability of the reported alignments. In particular, close to gaps, in low-score or low-complexity regions, a huge number of alternative alignments arise which results in a decrease of the certainty of the alignment. ppALIGN is a software package that uses hidden Markov Model techniques to compute position-wise reliability of score-based pairwise alignments of DNA or protein sequences. The design of the model allows for a direct connection between the scoring function and the parameters of the probabilistic model. For this reason it is suitable to analyze the outcomes of popular score based aligners and search tools without having to choose a complicated set of parameters. By contrast, our program only requires the classical score parameters (the scoring function and gap costs). The package comes along with a library written in C++, a standalone program for user defined alignments (ppALIGN) and another program (ppBLAST) which can process a complete result set of BLAST. The main algorithms essentially exhibit a linear time complexity (in the alignment lengths), and they are hence suitable for on-line computations. We have also included alternative decoding algorithms to provide alternative alignments. ppALIGN is a fast program/library that helps detect and quantify questionable regions in pairwise alignments. Due to its structure, the input/output interface it can to be connected to other post-processing tools. Empirically, we illustrate its usefulness in terms of correctly predicted reliable regions for sequences generated using the ROSE model for sequence evolution, and identify sensor-specific regions in the denitrifying betaproteobacterium Aromatoleum aromaticum. PMID:22628350

  16. PSAR: Measuring Multiple Sequence Alignment Reliability by Probabilistic Sampling

    NASA Astrophysics Data System (ADS)

    Kim, Jaebum; Ma, Jian

    Multiple sequence alignment (MSA), which is of fundamental importance for comparative genomics, is a difficult problem and error-prone. Therefore, it is essential to measure the reliability of the alignments and incorporate it into downstream analyses. Many studies have been conducted to find the extent, cause and effect of the alignment errors [4], and to heuristically estimate the quality of alignments without using the true alignment, which is unknown [2]. However, it is still unclear whether the heuristically chosen measures are general enough to take into account all alignment errors. In this paper, we present a new alignment reliability score, called PSAR (Probabilistic Sampling-based Alignment Reliability) score.

  17. Aligner for Elastic Collisions of Dropped Balls.

    ERIC Educational Resources Information Center

    Mellen, Walter Roy


    Discusses an aligner that permits dropping a stack of any number of balls of different sizes, elasticities, hardnesses, or types to observe the rebound of the top ball. Experimental results allow a reasonable comparison with theory. (MVL)

  18. Aligning Data to Support Transportation Emerging Challenges &

    E-print Network

    1 Aligning Data to Support Transportation Decisions Emerging Challenges & Opportunities, pricing & contracting ­ Performance: capacity, reliability, safety ­ Condition: aging, crumbling ­ Freight · Resilience · Safety · Security Decisions? Essential data elements? · Real time · Operations · Trends

  19. Continuous Growth of Vertically Aligned Carbon Nanotubes

    E-print Network

    Guzman de Villoria, R.

    Vertically aligned carbon nanotubes (VACNTs), sometimes called forests or carpets, are a promising material due to their unique physical and scale-dependent physical properties [1-3]. Continuous production of VACNTs is ...

  20. Alignment Stage for a Cryogenic Dilatometer

    NASA Technical Reports Server (NTRS)

    Dudik, Matthew; Moore, Donald


    A three-degree-of-freedom alignment stage has been designed and built for use in a cryogenic dilatometer that is used to measure thermal strains. The alignment stage enables precise adjustments of the positions and orientations of optical components to be used in the measurements and, once adjustments have been completed, keeps the components precisely aligned during cryogenic-dilatometer operations that can last as long as several days. The alignment stage includes a case, a circular tilt/tip platform, and a variety of flexural couplings between the case and the platform, all machined from a single block of the low-thermal-expansion iron/nickel alloy Invar, in order to minimize effects of temperature gradients and to obtain couplings that are free of stiction and friction. There are three sets of flexural couplings clocked at equal angles of 120 degrees around the platform, constituting a three-point kinematic support system.

  1. RNA-Seq read alignments with PALMapper.


    Jean, Géraldine; Kahles, André; Sreedharan, Vipin T; De Bona, Fabio; Rätsch, Gunnar


    Next-generation sequencing technologies have revolutionized genome and transcriptome sequencing. RNA-Seq experiments are able to generate huge amounts of transcriptome sequence reads at a fraction of the cost of Sanger sequencing. Reads produced by these technologies are relatively short and error prone. To utilize such reads for transcriptome reconstruction and gene-structure identification, one needs to be able to accurately align the sequence reads over intron boundaries. In this unit, we describe PALMapper, a fast and easy-to-use tool that is designed to accurately compute both unspliced and spliced alignments for millions of RNA-Seq reads. It combines the efficient read mapper GenomeMapper with the spliced aligner QPALMA, which exploits read-quality information and predictions of splice sites to improve the alignment accuracy. The PALMapper package is available as a command-line tool running on Unix or Mac OS X systems or through a Web interface based on Galaxy tools. PMID:21154708

  2. Probabilistic stratigraphic alignment of Pleistocene d18O records

    NASA Astrophysics Data System (ADS)

    Lawrence, C. E.; Lin, L.; Stern, J.; Lisiecki, L. E.


    Stratigraphic alignment is the primary way in which long marine climate records are placed on a common age model. We present a probabilistic pairwise alignment algorithm based on Hidden Markov models (HMM) to estimate alignment uncertainty and apply it to the alignment of Pleistocene benthic d18O records. This probabilistic algorithm improves upon the dynamic programming algorithm of Lisiecki and Lisiecki (2002) in the following ways: Maximum likelihood (MLE) or maximum a-posteriori parameter (MAP) estimation generates automatic parameter estimates directly from that data of the two input stratigraphic sequences; samples of alignments drawn directly and independently from posterior distributions along with probabilities of each sampled alignment; ensemble-based point estimates of alignments [Carvalho & Lawrence, 2008]; confidence limits on alignment parameter estimates; probabilities of all components of the alignments including marginal probabilities of the alignment of each pair of points within the two records and differences in sedimentation rates; and overall measures of alignment reliability using Bayesian confidence limits.

  3. Fiber optics welder having movable aligning mirror


    Higgins, Robert W. (Los Alamos, NM); Robichaud, Roger E. (Jemez Springs, NM)


    A system for welding fiber optic waveguides together. The ends of the two fibers to be joined together are accurately, collinearly aligned in a vertical orientation and subjected to a controlled, diffuse arc to effect welding and thermal conditioning. A front-surfaced mirror mounted at a angle to the optical axis of a stereomicroscope mounted for viewing the junction of the ends provides two orthogonal views of the interface during the alignment operation.

  4. Molecular alignment induced ultraviolet femtosecond pulse modulation.


    Li, Min; Li, Wenxue; Zeng, Heping


    Ultrashort ultraviolet pulses at 267 nm were generated through four-wave mixing processes in dual-color femtosecond filaments. The generated ultrashort ultraviolet pulses experienced intensity modulation due to molecular-alignment-induced spatial (de)focusing effects, and the output beam profiles were shown to vary observably at different molecular alignment revivals, facilitating all-optical field-free and ultrafast spatial shaping and profile optimization of the ultraviolet pulses. PMID:24514284

  5. Micromanipulation robot for automatic fiber alignment

    Microsoft Academic Search

    Liguo Chen; Weibin Rong; Lining Sun; Hui Xie


    Optical fiber alignment devices are highly necessary in optical communications. In this paper, we developed a micromanipulation robot for automatically performing optical fiber alignment task. The system consists of a precision parallel robot with 6 D.O.Fs, a nano positioning stage with 5 D.O.Fs, two microscopes, two CCD cameras, an optical power meter and a fusion device. Directed by the micro-vision

  6. Meta-Alignment with Crumble and Prune: Partitioning very large alignment problems for performance and parallelization

    PubMed Central


    Background Continuing research into the global multiple sequence alignment problem has resulted in more sophisticated and principled alignment methods. Unfortunately these new algorithms often require large amounts of time and memory to run, making it nearly impossible to run these algorithms on large datasets. As a solution, we present two general methods, Crumble and Prune, for breaking a phylogenetic alignment problem into smaller, more tractable sub-problems. We call Crumble and Prune meta-alignment methods because they use existing alignment algorithms and can be used with many current alignment programs. Crumble breaks long alignment problems into shorter sub-problems. Prune divides the phylogenetic tree into a collection of smaller trees to reduce the number of sequences in each alignment problem. These methods are orthogonal: they can be applied together to provide better scaling in terms of sequence length and in sequence depth. Both methods partition the problem such that many of the sub-problems can be solved independently. The results are then combined to form a solution to the full alignment problem. Results Crumble and Prune each provide a significant performance improvement with little loss of accuracy. In some cases, a gain in accuracy was observed. Crumble and Prune were tested on real and simulated data. Furthermore, we have implemented a system called Job-tree that allows hierarchical sub-problems to be solved in parallel on a compute cluster, significantly shortening the run-time. Conclusions These methods enabled us to solve gigabase alignment problems. These methods could enable a new generation of biologically realistic alignment algorithms to be applied to real world, large scale alignment problems. PMID:21569267

  7. PSAR: measuring multiple sequence alignment reliability by probabilistic sampling

    PubMed Central

    Kim, Jaebum; Ma, Jian


    Multiple sequence alignment, which is of fundamental importance for comparative genomics, is a difficult problem and error-prone. Therefore, it is essential to measure the reliability of the alignments and incorporate it into downstream analyses. We propose a new probabilistic sampling-based alignment reliability (PSAR) score. Instead of relying on heuristic assumptions, such as the correlation between alignment quality and guide tree uncertainty in progressive alignment methods, we directly generate suboptimal alignments from an input multiple sequence alignment by a probabilistic sampling method, and compute the agreement of the input alignment with the suboptimal alignments as the alignment reliability score. We construct the suboptimal alignments by an approximate method that is based on pairwise comparisons between each single sequence and the sub-alignment of the input alignment where the chosen sequence is left out. By using simulation-based benchmarks, we find that our approach is superior to existing ones, supporting that the suboptimal alignments are highly informative source for assessing alignment reliability. We apply the PSAR method to the alignments in the UCSC Genome Browser to measure the reliability of alignments in different types of regions, such as coding exons and conserved non-coding regions, and use it to guide cross-species conservation study. PMID:21576232

  8. HSA: A Heuristic Splice Alignment Tool

    PubMed Central


    Background RNA-Seq methodology is a revolutionary transcriptomics sequencing technology, which is the representative of Next generation Sequencing (NGS). With the high throughput sequencing of RNA-Seq, we can acquire much more information like differential expression and novel splice variants from deep sequence analysis and data mining. But the short read length brings a great challenge to alignment, especially when the reads span two or more exons. Methods A two steps heuristic splice alignment tool is generated in this investigation. First, map raw reads to reference with unspliced aligner - BWA; second, split initial unmapped reads into three equal short reads (seeds), align each seed to the reference, filter hits, search possible split position of read and extend hits to a complete match. Results Compare with other splice alignment tools like SOAPsplice and Tophat2, HSA has a better performance in call rate and efficiency, but its results do not as accurate as the other software to some extent. Conclusions HSA is an effective spliced aligner of RNA-Seq reads mapping, which is available at PMID:24564867

  9. Aligning Biomolecular Networks Using Modular Graph Kernels

    NASA Astrophysics Data System (ADS)

    Towfic, Fadi; Greenlee, M. Heather West; Honavar, Vasant

    Comparative analysis of biomolecular networks constructed using measurements from different conditions, tissues, and organisms offer a powerful approach to understanding the structure, function, dynamics, and evolution of complex biological systems. We explore a class of algorithms for aligning large biomolecular networks by breaking down such networks into subgraphs and computing the alignment of the networks based on the alignment of their subgraphs. The resulting subnetworks are compared using graph kernels as scoring functions. We provide implementations of the resulting algorithms as part of BiNA, an open source biomolecular network alignment toolkit. Our experiments using Drosophila melanogaster, Saccharomyces cerevisiae, Mus musculus and Homo sapiens protein-protein interaction networks extracted from the DIP repository of protein-protein interaction data demonstrate that the performance of the proposed algorithms (as measured by % GO term enrichment of subnetworks identified by the alignment) is competitive with some of the state-of-the-art algorithms for pair-wise alignment of large protein-protein interaction networks. Our results also show that the inter-species similarity scores computed based on graph kernels can be used to cluster the species into a species tree that is consistent with the known phylogenetic relationships among the species.

  10. Free space optical alignment system using GPS

    NASA Astrophysics Data System (ADS)

    Saw, Wee-Leong; Refai, Hazem H.; Sluss, James J., Jr.


    This paper presents results from an ongoing effort at the University of Oklahoma to develop a real-time active alignment system for free-space optical communication system. An initial prototype of a FSO active alignment system using Global Positioning System (GPS) sensors, two gimbals, and point-to-point spread spectrum RF communication is described. The positions of both FSO transceivers are exchanged over the radio frequency (RF) communication link. A controller uses the exchanged information to calculate azimuth and elevation bearings to achieve initial alignment between the transceivers. The gimbals are used to steer the beams. The paper also presents a binary scan algorithm developed to expedite the initial alignment process. The algorithm incorporates power measurements as feed back to the original transceiver for comparison. In minimizing convergence time, simulation results confirm that the algorithm performs better than raster scan, spiral scan, and raster spiral scan algorithms, all of which are used in laser satellite communications. The results also show that the initial design is not able to achieve real-time alignment. For real-time alignment, different augmenting technologies (for example, steering mirrors) should be considered.

  11. Global network alignment using multiscale spectral signatures

    PubMed Central

    Patro, Rob; Kingsford, Carl


    Motivation: Protein interaction networks provide an important system-level view of biological processes. One of the fundamental problems in biological network analysis is the global alignment of a pair of networks, which puts the proteins of one network into correspondence with the proteins of another network in a manner that conserves their interactions while respecting other evidence of their homology. By providing a mapping between the networks of different species, alignments can be used to inform hypotheses about the functions of unannotated proteins, the existence of unobserved interactions, the evolutionary divergence between the two species and the evolution of complexes and pathways. Results: We introduce GHOST, a global pairwise network aligner that uses a novel spectral signature to measure topological similarity between subnetworks. It combines a seed-and-extend global alignment phase with a local search procedure and exceeds state-of-the-art performance on several network alignment tasks. We show that the spectral signature used by GHOST is highly discriminative, whereas the alignments it produces are also robust to experimental noise. When compared with other recent approaches, we find that GHOST is able to recover larger and more biologically significant, shared subnetworks between species. Availability: An efficient and parallelized implementation of GHOST, released under the Apache 2.0 license, is available at Contact: PMID:23047556

  12. Societal-Equity-Enhancing Criteria and Facility-Host Incentives Supporting Five Key Elements in the January 2012 Blue Ribbon Commission Report - 13015

    SciTech Connect

    Eriksson, Leif G. [Nuclear Waste Dispositions, 535 N. Interlachen Avenue, Unit 303, Winter Park, Florida 32789 (United States)] [Nuclear Waste Dispositions, 535 N. Interlachen Avenue, Unit 303, Winter Park, Florida 32789 (United States); Dials, George E. [B and W Conversion Services LLC, 1020 Monarch Road, Suite 300, Lexington, Kentucky 40513 (United States)] [B and W Conversion Services LLC, 1020 Monarch Road, Suite 300, Lexington, Kentucky 40513 (United States); George, Critz H. [Retired DOE and Consultant, 1218 Countryside Lane, Albuquerque, New Mexico, 87114 (United States)] [Retired DOE and Consultant, 1218 Countryside Lane, Albuquerque, New Mexico, 87114 (United States)


    In February 2009, the Obama Administration announced it would abandon USA's only candidate SNF/HLW-disposal facility since 1987. In 2010, all related activities were stopped and the Blue Ribbon Commission on America's Nuclear Future was established 'to recommend a new strategy for managing the back end of the nuclear fuel cycle', which it did in January 2012, emphasizing eight key elements. However, Key Element 1, 'A new, consent-based approach to siting future nuclear facilities', is qualitative/indeterminate rather than quantitative/measurable. It is thus highly-susceptible to semantic permutations that could extend rather than, as intended, expedite the siting of future nuclear facilities unless it also defines: a) Whose consent is needed?; and b) What constitutes consent? The following 'generic', radiation-risk- and societal-equity-based criteria address these questions: 1. Identify areas affected by projected radiation and other health risks from: a. The proposed nuclear facility (facility stakeholders); and b. The related nuclear-materials-transportation routes (transportation stakeholders); then 2. Surround each stakeholder area with a buffer zone and use this enlarged foot print to identify: a. Stakeholder hosts; and b. Areas not hosting any stakeholder category (interested parties). 3. Define 'consent-based' as being at least 60 percent of the 'population' in the respective stakeholder category and apply this yardstick to both 'in favor' and 'against' votes. Although criteria 1 and 2 also need facility-based definitions to make Key Element 1 measurable, the described siting approach, augmented by related facility-host incentives, would expedite the schedule and reduce the cost for achieving Key Elements 4-6 and 8, politics permitting. (authors)

  13. Implications of spinopelvic alignment for the spine surgeon.


    Mehta, Vivek A; Amin, Anubhav; Omeis, Ibrahim; Gokaslan, Ziya L; Gottfried, Oren N


    The relation of the pelvis to the spine has previously been overlooked as a contributor to sagittal balance. However, it is now recognized that spinopelvic alignment is important to maintain an energy-efficient posture in normal and disease states. The pelvis is characterized by an important anatomic landmark, the pelvic incidence (PI). The PI does not change after adolescence, and it directly influences pelvic alignment, including the parameters of pelvic tilt (PT) and sacral slope (SS) (PI = PT + SS), [corrected] overall sagittal spinal balance, and lumbar lordosis. In the setting of an elevated PI, the spineadapts with increased lumbar lordosis. To prevent or limit sagittal imbalance, the spine may also compensate with increased PT or pelvic retroversion to attempt to maintain anupright posture. Abnormal spinopelvic parameters contribute to multiple spinal conditions including isthmic spondylolysis, degenerative spondylolisthesis, deformity, and impact outcome after spinal fusion. Sagittal balance, pelvic incidence, and all spinopelvic parameters are easily and reliably measured on standing, full-spine (lateral) radiographs, and it is essential to accurately assess and measure these sagittal values to understand their potential role in the disease process, and to promote spinopelvic balance at surgery. In this article, we provide a comprehensive review of the literature regarding the implications of abnormal spinopelvic parameters and discuss surgical strategies for correction of sagittal balance. Additionally, the authors rate and critique the quality of the literature cited in a systematic review approach to give the reader an estimate of the veracity of the conclusions reached from these reports. PMID:21937939

  14. MAP2: multiple alignment of syntenic genomic sequences

    Microsoft Academic Search

    Liang Ye; Xiaoqiu Huang


    We describe a multiple alignment program named MAP2 based on a generalized pairwise global align- ment algorithm for handling long, different intergenic and intragenic regions in genomic sequences. The MAP2 program produces an ordered list of local mul- tiple alignments of similar regions among sequences, where different regions between local alignments are indicated by reporting only similar regions. We propose

  15. Magnetically Aligned Anisotropic Conductive Adhesive for Microwave Applications

    Microsoft Academic Search

    Sungwook Moon; Hjalti H. Sigmarsson; Yilei Huang; Tim Bruemmer; S. Kummar Khanna; William J. Chappell


    Randomly dispersed particles in a material can be forced to align due to the presence of an externally applied field. These self-aligning materials are examples through which order is obtained through structure created internally which alters the bulk properties of the material. One such material is a magnetically aligned anisotropic conductive adhesive which uses the alignment of ferromagnetic particles in

  16. Gas flow effects on precision solder self-alignment

    Microsoft Academic Search

    Bingzhi Su; M. Gershovich; Y. C. Lee


    Self-aligning soldering technology is being developed for low cost, passive, precision optical alignments. To avoid contamination problems, the solder reflow process must use reacting or inert gas instead of chemical flux materials. Since the accuracy of these optical alignments should reach the range of a few micrometers (?m), the gas flow may affect the aligning process. Therefore, the effects of

  17. Gas flow effects on precision solder self-alignment

    Microsoft Academic Search

    Bingzhi Su; M. Gershovich; Y. C. Lee


    Self-aligning soldering technology is being developed for low cost, passive, precision optical alignments. To avoid contamination problems, a solder reflow process must use reacting or inert gas instead of chemical flux materials. Since the accuracy of these optical alignments should reach the range of a few ?m, the gas flow may affect the aligning process. Therefore, the effects of the

  18. Comparison of Beam-Based Alignment Algorithms for the ILC

    SciTech Connect

    Smith, J.C.; Gibbons, L.; Patterson, J.R.; Rubin, D.L.; /Cornell U., LEPP; Sagan, D.; /Cornell U., Phys. Dept.; Tenenbaum, P.; /SLAC


    The main linac of the International Linear Collider (ILC) requires more sophisticated alignment techniques than those provided by survey alone. Various Beam-Based Alignment (BBA) algorithms have been proposed to achieve the desired low emittance preservation. Dispersion Free Steering, Ballistic Alignment and the Kubo method are compared. Alignment algorithms are also tested in the presence of an Earth-like stray field.

  19. Laser Induced Selective Alignment of Water Spin Isomers

    E-print Network

    E. Gershnabel; I. Sh. Averbukh


    We consider laser alignment of ortho and para spin isomers of water molecules by using strong and short off-resonance laser pulses. A single pulse is found to create a distinct transient alignment and antialignment of the isomeric species. We suggest selective alignment of one isomeric species (leaving the other species randomly aligned) by a pair of two laser pulses.

  20. Dopant-Enhanced Vertical Alignment of Negative Liquid Crystals

    E-print Network

    Wu, Shin-Tson

    Dopant-Enhanced Vertical Alignment of Negative Liquid Crystals Chien-Hui Wen Benjamin Wu Sebastian, Florida, USA A simple method for achieving high-contrast vertical alignment of high birefringence (Dn$0 tolane liquid crystal host, an excellent vertical alignment was obtained. This alignment is stable

  1. Interactive software tool to comprehend the calculation of optimal sequence alignments with dynamic programming

    PubMed Central

    Ibarra, Ignacio L.; Melo, Francisco


    Summary: Dynamic programming (DP) is a general optimization strategy that is successfully used across various disciplines of science. In bioinformatics, it is widely applied in calculating the optimal alignment between pairs of protein or DNA sequences. These alignments form the basis of new, verifiable biological hypothesis. Despite its importance, there are no interactive tools available for training and education on understanding the DP algorithm. Here, we introduce an interactive computer application with a graphical interface, for the purpose of educating students about DP. The program displays the DP scoring matrix and the resulting optimal alignment(s), while allowing the user to modify key parameters such as the values in the similarity matrix, the sequence alignment algorithm version and the gap opening/extension penalties. We hope that this software will be useful to teachers and students of bioinformatics courses, as well as researchers who implement the DP algorithm for diverse applications. Availability and Implementation: The software is freely available at: http:/ The software is written in the Java computer language, thus it runs on all major platforms and operating systems including Windows, Mac OS X and LINUX. Contact: All inquiries or comments about this software should be directed to Francisco Melo at PMID:20472540

  2. RNA-Seq alignment to individualized genomes improves transcript abundance estimates in multiparent populations.


    Munger, Steven C; Raghupathy, Narayanan; Choi, Kwangbom; Simons, Allen K; Gatti, Daniel M; Hinerfeld, Douglas A; Svenson, Karen L; Keller, Mark P; Attie, Alan D; Hibbs, Matthew A; Graber, Joel H; Chesler, Elissa J; Churchill, Gary A


    Massively parallel RNA sequencing (RNA-seq) has yielded a wealth of new insights into transcriptional regulation. A first step in the analysis of RNA-seq data is the alignment of short sequence reads to a common reference genome or transcriptome. Genetic variants that distinguish individual genomes from the reference sequence can cause reads to be misaligned, resulting in biased estimates of transcript abundance. Fine-tuning of read alignment algorithms does not correct this problem. We have developed Seqnature software to construct individualized diploid genomes and transcriptomes for multiparent populations and have implemented a complete analysis pipeline that incorporates other existing software tools. We demonstrate in simulated and real data sets that alignment to individualized transcriptomes increases read mapping accuracy, improves estimation of transcript abundance, and enables the direct estimation of allele-specific expression. Moreover, when applied to expression QTL mapping we find that our individualized alignment strategy corrects false-positive linkage signals and unmasks hidden associations. We recommend the use of individualized diploid genomes over reference sequence alignment for all applications of high-throughput sequencing technology in genetically diverse populations. PMID:25236449

  3. RNA-Seq Alignment to Individualized Genomes Improves Transcript Abundance Estimates in Multiparent Populations

    PubMed Central

    Munger, Steven C.; Raghupathy, Narayanan; Choi, Kwangbom; Simons, Allen K.; Gatti, Daniel M.; Hinerfeld, Douglas A.; Svenson, Karen L.; Keller, Mark P.; Attie, Alan D.; Hibbs, Matthew A.; Graber, Joel H.; Chesler, Elissa J.; Churchill, Gary A.


    Massively parallel RNA sequencing (RNA-seq) has yielded a wealth of new insights into transcriptional regulation. A first step in the analysis of RNA-seq data is the alignment of short sequence reads to a common reference genome or transcriptome. Genetic variants that distinguish individual genomes from the reference sequence can cause reads to be misaligned, resulting in biased estimates of transcript abundance. Fine-tuning of read alignment algorithms does not correct this problem. We have developed Seqnature software to construct individualized diploid genomes and transcriptomes for multiparent populations and have implemented a complete analysis pipeline that incorporates other existing software tools. We demonstrate in simulated and real data sets that alignment to individualized transcriptomes increases read mapping accuracy, improves estimation of transcript abundance, and enables the direct estimation of allele-specific expression. Moreover, when applied to expression QTL mapping we find that our individualized alignment strategy corrects false-positive linkage signals and unmasks hidden associations. We recommend the use of individualized diploid genomes over reference sequence alignment for all applications of high-throughput sequencing technology in genetically diverse populations. PMID:25236449

  4. Creating Polymer Hydrogel Microfibres with Internal Alignment via Electrical and Mechanical Stretching

    PubMed Central

    Zhang, Shuming; Liu, Xi; Barreto-Ortiz, Sebastian F.; Yu, Yixuan; Ginn, Brian; DeSantis, Nicholas; Hutton, Daphne L; Grayson, Warren; Cui, Fu-Zhai; Korgel, Brian A.; Gerecht, Sharon; Mao, Hai-Quan


    Hydrogels have been widely used for 3-dimensional (3D) cell culture and tissue regeneration due to their tunable biochemical and physicochemical properties as well as their high water content, which resembles the aqueous microenvironment of the natural extracellular matrix. While many properties of natural hydrogel matrices are modifiable, their intrinsic isotropic structure limits the control over cellular organization, which is critical to restore tissue function. Here we report a generic approach to incorporate alignment topography inside the hydrogel matrix using a combination of electrical and mechanical stretching. Hydrogel fibres with uniaxial alignment were prepared from aqueous solutions of natural polymers such as alginate, fibrin, gelatin, and hyaluronic acid under ambient conditions. The unique internal alignment feature drastically enhances the mechanical properties of the hydrogel microfibres. Furthermore, the facile, organic solvent-free processing conditions are amenable to the incorporation of live cells within the hydrogel fibre or on the fibre surface; both approaches effectively induce cellular alignment. This work demonstrates a versatile and scalable strategy to create aligned hydrogel microfibres from various natural polymers. PMID:24439410

  5. 3D microband boundary alignments and transitions in a cold rolled commercial purity aluminum alloy

    SciTech Connect

    George, C.; Soe, B.; King, K. [Department of Engineering, Harvey Mudd College, Claremont, CA 91711 (United States); Quadir, M.Z. [School of Materials Science and Engineering, University of New South Wales, Sydney, NSW, 2052 (Australia); Electron Microscope Unit, University of New South Wales, Sydney, NSW, 2052 (Australia); Ferry, M. [School of Materials Science and Engineering, University of New South Wales, Sydney, NSW, 2052 (Australia); Bassman, L., E-mail: [Department of Engineering, Harvey Mudd College, Claremont, CA 91711 (United States); School of Materials Science and Engineering, University of New South Wales, Sydney, NSW, 2052 (Australia)


    In the study of microband formation during plastic deformation of face centered cubic metals and alloys, two theories have been proposed regarding the orientations of their boundaries: (i) they are aligned parallel to crystallographic planes associated with dislocation glide (i.e. (111) planes in FCC metals), or (ii) they are aligned in accordance with the macroscopic stress state generated during deformation. In this study, high resolution 3D electron backscatter diffraction (3D EBSD) was used to investigate the morphology and crystallographic nature of microband boundaries within a 19 × 9 × 8.6 ?m volume of a deformed grain in commercial purity aluminum cold rolled to 22% reduction. It was found that microband boundaries correspond to both theories of orientation. Additionally, a single surface may contain both crystallographic and non-crystallographic alignments. Misorientations across boundaries in the regions of microband triple junctions have been identified for both boundary alignments. - Highlights: ? Reconstruction of a 3D volume of crystallographic orientations from EBSD data ? Subgrain features accurately reconstructed using specially designed strategies. ? Microband boundaries contain crystallographic and non-crystallographic alignments. ? Boundaries form by crystallographic process but rotate to non-crystallographic.

  6. Addressing Contemporary Issues, Lifelong Learning, and the Impact of Engineering on Global and Societal Issues in the Classroom

    NSDL National Science Digital Library

    Van Treuren, Kenneth

    Whenever there is a discussion of outcomes a-k for ABET EC 2000, the outcomes least understood are those involving knowledge of contemporary issues, lifelong learning, and the impact of engineering on global and societal issues. Most faculty believe they understand the intent of these topics, but to identify where these criteria are supported in a curriculum is often difficult. A separate course or seminar is not necessarily the answer as most programs cannot afford the addition of more classroom hours. A simple method of addressing these issues used by the author for the past three years is to have students accomplish short presentations on topics of their choice related to the course. In the last year, explicitly adding a requirement to present on a topic related to contemporary issues and/or the impact of engineering on global and societal issues yielded more focused presentations. Having the students pick their own topics allowed them to pursue something that they find personally interesting and wished to present to the class. For the first two years, additional credit was given to students who have a range of reference materials, especially materials found in the library. This developed research skills beyond that of the worldwide web. Topics were very different and students were not allowed to give a presentation on a topic that had already been given. Many of the presentations naturally addressed topics dealing with contemporary, global or societal issues and this gave the opportunity for further discussion. For the heat transfer class in which this was implemented, topics have included energy production, biomedical applications, safety issues, and the impact of heat transfer on day-to-day living. Students clearly enjoyed the presentations and everyone, including the author, was exposed to topics that might not normally be included in the classroom.

  7. Job & Internship Search Strategies Strategies &

    E-print Network

    Barnes, Elizabeth A.

    Job & Internship Search Strategies Strategies & Tools What it is? How it helps? Advice COB CareerRAM COB CareerRAM is a CSU specific tool that allows you to get connected to available career opportunities, on-campus events, and recruiters who are specifically looking for you. As a student or alumni

  8. Strategies to Prevent Preterm Birth

    PubMed Central

    Newnham, John P.; Dickinson, Jan E.; Hart, Roger J.; Pennell, Craig E.; Arrese, Catherine A.; Keelan, Jeffrey A.


    After several decades of research, we now have evidence that at least six interventions are suitable for immediate use in contemporary clinical practice within high-resource settings and can be expected to safely reduce the rate of preterm birth. These interventions involve strategies to prevent non-medically indicated late preterm birth; use of maternal progesterone supplementation; surgical closure of the cervix with cerclage; prevention of exposure of pregnant women to cigarette smoke; judicious use of fertility treatments; and dedicated preterm birth prevention clinics. Quantification of the extent of success is difficult to predict and will be dependent on other clinical, cultural, societal, and economic factors operating in each environment. Further success can be anticipated in the coming years as other research discoveries are translated into clinical practice, including new approaches to treating intra-uterine infection, improvements in maternal nutrition, and lifestyle modifications to ameliorate maternal stress. The widespread use of human papillomavirus vaccination in girls and young women will decrease the need for surgical interventions on the cervix and can be expected to further reduce the risk of early birth. Together, this array of clinical interventions, each based on a substantial body of evidence, is likely to reduce rates of preterm birth and prevent death and disability in large numbers of children. The process begins with an acceptance that early birth is not an inevitable and natural feature of human reproduction. Preventative strategies are now available and need to be applied. The best outcomes may come from developing integrated strategies designed specifically for each health-care environment. PMID:25477878

  9. Societal and economic benefits 1 The challenges faced by the world today are complex and inter-

    E-print Network

    -cuttingthemes Globalchallenges Healthcare Energy Environment Security FacultyoFEnginEEring FacultyoFmEdicinE Facultyo | Strategy 2010­14 #12;>>> proFilE Healthcare Management Group The Healthcare Management Group within the Business School takes a multidisciplinary approach to the develop- ment of new knowledge about key issues

  10. An advanced method for flood risk analysis in river deltas, applied to societal flood fatality risk in the Netherlands

    NASA Astrophysics Data System (ADS)

    de Bruijn, K. M.; Diermanse, F. L. M.; Beckers, J. V. L.


    This paper discusses a new method for flood risk assessment in river deltas. Flood risk analysis of river deltas is complex, because both storm surges and river discharges may cause flooding and the effect of upstream breaches on downstream water levels and flood risk must be taken into account. This paper presents a Monte Carlo-based flood risk analysis framework for policy making, which considers both storm surges and river flood waves and includes effects from hydrodynamic interaction on flood risk. It was applied to analyse societal flood fatality risk in the Rhine-Meuse delta.

  11. An advanced method for flood risk analysis in river deltas, applied to societal flood fatality risks in the Netherlands

    NASA Astrophysics Data System (ADS)

    de Bruijn, K. M.; Diermanse, F. L. M.; Beckers, J. V. L.


    This paper discusses the new method developed to analyse flood risks in river deltas. Risk analysis of river deltas is complex, because both storm surges and river discharges may cause flooding and since the effect of upstream breaches on downstream water levels and flood risks must be taken into account. A Monte Carlo based flood risk analysis framework for policy making was developed, which considers both storm surges and river flood waves and includes hydrodynamic interaction effects on flood risks. It was applied to analyse societal flood fatality risks (the probability of events with more than N fatalities) in the Rhine-Meuse delta.

  12. PROTOGENE: turning amino acid alignments into bona fide CDS nucleotide alignments

    Microsoft Academic Search

    Sébastien Moretti; Frédéric Reinier; Olivier Poirot; Fabrice Armougom; Stéphane Audic; Vladimir Keduas; Cédric Notredame


    We describe Protogene, a server that can turn a pro- tein multiple sequence alignment into the equi- valent alignment of the original gene coding DNA. Protogene relies on a pipeline where every initial pro- tein sequence is BLASTed against RefSeq or NR. The annotation associated with potential matches is used to identify the gene sequence. This gene sequence is then

  13. Business-IT Alignment: A Current-State Evaluation of Strategic Alignment within the Hospital Organization

    ERIC Educational Resources Information Center

    Evers, Kevin W.


    More than thirty years of research has shown that the practical value of business-IT alignment is significant and that its importance derives from strategic impact on business outcomes. The purpose of this exploratory study is to identify the current-state of business-IT alignment maturity within the hospital organization. Data for this study was…

  14. Alignment of Standards and Assessment: A Theoretical and Empirical Study of Methods for Alignment

    ERIC Educational Resources Information Center

    Nasstrom, Gunilla; Henriksson, Widar


    Introduction: In a standards-based school-system alignment of policy documents with standards and assessment is important. To be able to evaluate whether schools and students have reached the standards, the assessment should focus on the standards. Different models and methods can be used for measuring alignment, i.e. the correspondence between…

  15. Look-Align: an interactive web-based multiple sequence alignment viewer with polymorphism analysis support

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have developed Look-Align, an interactive web-based viewer to display pre-computed multiple sequence alignments. Although initially developed to support the visualization needs of the maize diversity website Panzea (, the viewer is a generic stand-alone tool that can be easi...

  16. StatAlign: an extendable software package for joint Bayesian estimation of alignments and evolutionary trees

    Microsoft Academic Search

    Ádám Novák; István Miklós; Rune B. Lyngsø; Jotun Hein


    Motivation: Bayesian analysis is one of the most popular methods in phylogenetic inference. The most commonly used methods fix a single multiple alignment and consider only substitutions as phylogenetically informative mutations, though alignments and phylogenies should be inferred jointly as insertions and deletions also carry informative signals. Methods addressing these issues have been developed only recently and there has not

  17. Aligning Vision, ValuesAligning Vision, Values And Choices ForAnd Choices For

    E-print Network

    Kyte, Michael

    Aligning Vision, ValuesAligning Vision, Values And Choices ForAnd Choices For Sustainable. Broaden the context for choiceBroaden the context for choice ­­ scenario planning, visioning.scenario planning, visioning. Seek integration of disparate needsSeek integration of disparate needs­­ how can

  18. ALIGNEMENT PLUS RAPIDE Alignement IFT3290 H2006 UdeM Miklos Csuros 35

    E-print Network

    Csürös, Miklós

    ALIGNEMENT PLUS RAPIDE Alignement IFT3290 H2006 UdeM Mikl´os Csur¨os 35 1. m´ethodes heuristiques sequence analysis of human embryonic zeta-globin cDNA JOURNAL DNA 1 (4), 355-363 (1982) MEDLINE 83182021

  19. MM-align: a quick algorithm for aligning multiple-chain protein complex structures using iterative dynamic programming

    PubMed Central

    Mukherjee, Srayanta; Zhang, Yang


    Structural comparison of multiple-chain protein complexes is essential in many studies of protein–protein interactions. We develop a new algorithm, MM-align, for sequence-independent alignment of protein complex structures. The algorithm is built on a heuristic iteration of a modified Needleman–Wunsch dynamic programming (DP) algorithm, with the alignment score specified by the inter-complex residue distances. The multiple chains in each complex are first joined, in every possible order, and then simultaneously aligned with cross-chain alignments prevented. The alignments of interface residues are enhanced by an interface-specific weighting factor. MM-align is tested on a large-scale benchmark set of 205 × 3897 non-homologous multiple-chain complex pairs. Compared with a naïve extension of the monomer alignment program of TM-align, the alignment accuracy of MM-align is significantly higher as judged by the average TM-score of the physically-aligned residues. MM-align is about two times faster than TM-align because of omitting the cross-alignment zone of the DP matrix. It also shows that the enhanced alignment of the interfaces helps in identifying biologically relevant protein complex pairs. PMID:19443443

  20. Transcription factor map alignment of promoter regions.


    Blanco, Enrique; Messeguer, Xavier; Smith, Temple F; Guigó, Roderic


    We address the problem of comparing and characterizing the promoter regions of genes with similar expression patterns. This remains a challenging problem in sequence analysis, because often the promoter regions of co-expressed genes do not show discernible sequence conservation. In our approach, thus, we have not directly compared the nucleotide sequence of promoters. Instead, we have obtained predictions of transcription factor binding sites, annotated the predicted sites with the labels of the corresponding binding factors, and aligned the resulting sequences of labels--to which we refer here as transcription factor maps (TF-maps). To obtain the global pairwise alignment of two TF-maps, we have adapted an algorithm initially developed to align restriction enzyme maps. We have optimized the parameters of the algorithm in a small, but well-curated, collection of human-mouse orthologous gene pairs. Results in this dataset, as well as in an independent much larger dataset from the CISRED database, indicate that TF-map alignments are able to uncover conserved regulatory elements, which cannot be detected by the typical sequence alignments. PMID:16733547