Sample records for solvent-dependent conformational transitions

  1. Solvent-dependent transition states for decarboxylations.

    PubMed

    Sicinska, D; Truhlar, D G; Paneth, P

    2001-08-01

    The rate constants and kinetic isotope effects for decarboxylation of 4-pyridylacetic acid depend strongly on whether the solvent is water or dioxane, and the present paper interprets this finding. We calculate the solvent dependence of the free energy barrier and of the (13)C and (18)O kinetic isotope effects using a quantum mechanical solvation model based on class IV charges and semiempirical atomic surface tensions. The calculations provide a consistent interpretation of the experimental results, which provides a striking confirmation of the soundness of the solvation modeling. Even more significantly, the agreement of theory and experiment gives us confidence in the physical picture of the reaction provided by the model. This indicates that the location of the transition state, as measured by the length of the breaking C--C bond, is 0.24 A later than the gas phase in dioxane and 0.37 A later than the gas phase in water. Charge development at the transition state also depends strongly on the solvent; in particular the CO(2) moiety is 0.07 electronic charge units more negative at the transition state in dioxane than in water. PMID:11480991

  2. Water drives peptide conformational transitions

    E-print Network

    Nerukh, Dmitry

    2011-01-01

    Transitions between metastable conformations of a dipeptide are investigated using classical molecular dynamics simulation with explicit water molecules. The distribution of the surrounding water at different moments before the transitions and the dynamical correlations of water with the peptide's configurational motions indicate that water is the main driving force of the conformational changes.

  3. Nucleophilic Metal Complexes as Acylation Catalysts: Solvent-Dependent

    E-print Network

    Lectka, Thomas

    is demonstrated. Surprisingly, a solvent-dependent mechanistic "switch" results in a Lewis acid-based acylation operate as Lewis acids, as Lewis bases, or less commonly as a combination of the two.1 Almost unheard acid to a Lewis base or vice versa. For example, complex transition metal salts XmYn, in which both X

  4. Theory of conformational transitions of viral shells

    NASA Astrophysics Data System (ADS)

    Guérin, Thomas; Bruinsma, Robijn

    2007-12-01

    We propose a continuum theory for the conformational transitions of viral shells. Conformational transitions of viral shells, as encountered during viral maturation, are associated with a soft mode instability of the capsid proteins [F. Tama and C. L. Brooks, J. Mol. Biol. 345(2), 299 (2005)]. The continuum theory presented here is an adaptation of the Ginzburg-Landau theory of soft-mode structural phase transitions of solids to viral shells. The theory predicts that the conformational transitions are characterized by a pronounced softening of the shell elasticity in the critical region. We demonstrate that the thermodynamics of the conformational transition can be probed quantitatively by a micromechanical atomic force microscope study. The external force can drive a capsid into a state of phase coexistence characterized by a highly nonlinear force deformation curve.

  5. Electroweak phase transition in nearly conformal technicolor

    SciTech Connect

    Cline, James M.; Jaervinen, Matti; Sannino, Francesco [McGill University, Montreal, Quebec H3A 2T8 (Canada); High Energy Center, University of Southern Denmark, Campusvej 55, DK-5230 Odense M (Denmark)

    2008-10-01

    We examine the temperature-dependent electroweak phase transition in extensions of the standard model in which the electroweak symmetry is spontaneously broken via strongly coupled, nearly conformal dynamics. In particular, we focus on the low energy effective theory used to describe minimal walking technicolor at the phase transition. Using the one-loop effective potential with ring improvement, we identify significant regions of parameter space which yield a sufficiently strong first-order transition for electroweak baryogenesis. The composite particle spectrum corresponding to these regions can be produced and studied at the Large Hadron Collider experiment. We note the possible emergence of a second phase transition at lower temperatures. This occurs when the underlying technicolor theory possesses a nontrivial center symmetry.

  6. Conformational transitions of a weak polyampholyte

    NASA Astrophysics Data System (ADS)

    Narayanan Nair, Arun Kumar; Uyaver, Sahin; Sun, Shuyu

    2014-10-01

    Using grand canonical Monte Carlo simulations of a flexible polyelectrolyte where the charges are in contact with a reservoir of constant chemical potential given by the solution pH, we study the behavior of weak polyelectrolytes in poor and good solvent conditions for polymer backbone. We address the titration behavior and conformational properties of a flexible diblock polyampholyte chain formed of two oppositely charged weak polyelectrolyte blocks, each containing equal number of identical monomers. The change of solution pH induces charge asymmetry in a diblock polyampholyte. For diblock polyampholyte chains in poor solvents, we demonstrate that a discontinuous transition between extended (tadpole) and collapsed (globular) conformational states is attainable by varying the solution pH. The double-minima structure in the probability distribution of the free energy provides direct evidence for the first-order like nature of this transition. At the isoelectric point electrostatically driven coil-globule transition of diblock polyampholytes in good solvents is found to consist of different regimes identified with increasing electrostatic interaction strength. At pH values above or below the isoelectric point diblock chains are found to have polyelectrolyte-like behavior due to repulsion between uncompensated charges along the chain.

  7. Transitions to catalytically inactive conformations in EGFR kinase.

    PubMed

    Shan, Yibing; Arkhipov, Anton; Kim, Eric T; Pan, Albert C; Shaw, David E

    2013-04-30

    The epidermal growth factor receptor (EGFR) is a key protein in cellular signaling, and its kinase domain (EGFR kinase) is an intensely pursued target of small-molecule drugs. Although both catalytically active and inactive conformations of EGFR kinase have been resolved crystallographically, experimental characterization of the transitions between these conformations remains difficult. Using unbiased, all-atom molecular dynamics simulations, we observed EGFR kinase spontaneously transition from the active to the so-called "Src-like inactive" conformation by way of two sets of intermediate conformations: One corresponds to a previously identified locally disordered state and the other to previously undescribed "extended" conformations, marked by the opening of the ATP-binding site between the two lobes of the kinase domain. We also simulated the protonation-dependent transition of EGFR kinase to another ["Asp-Phe-Gly-out" ("DFG-out")] inactive conformation and observed similar intermediate conformations. A key element observed in the simulated transitions is local unfolding, or "cracking," which supports a prediction of energy landscape theory. We used hydrogen-deuterium (H/D) exchange measurements to corroborate our simulations and found that the simulated intermediate conformations correlate better with the H/D exchange data than existing active or inactive EGFR kinase crystal structures. The intermediate conformations revealed by our simulations of the transition process differ significantly from the existing crystal structures and may provide unique possibilities for structure-based drug discovery. PMID:23576739

  8. DNA Conformational Transitions Induced by Supercoiling Control Transcription in Chromatin

    PubMed Central

    Luchnik, Andrey N

    2014-01-01

    Regulation of transcription in eukaryotes is considered in the light of recent findings demonstrating the presence of negative and positive superhelical tension in chromatin. This tension induces conformational transitions in DNA duplex. Particularly, the transition into A-form renders DNA accessible and waylaying for initiation of transcription producing RNA molecules long known to belong to the A-conformation. Competition between conformational transitions in various DNA sequences for the energy of elastic spring opens a possibility for understanding of fine tuning of transcription at a distance. PMID:24653646

  9. Conformational transition states of a ?-hairpin peptide between the ordered and disordered conformations in explicit water

    PubMed Central

    Kamiya, Narutoshi; Higo, Junichi; Nakamura, Haruki

    2002-01-01

    The conformational transition states of a ?-hairpin peptide in explicit water were identified from the free energy landscapes obtained from the multicanonical ensemble, using an enhanced conformational sampling calculation. The ?-hairpin conformations were significant at 300 K in the landscape, and the typical nuclear Overhauser effect signals were reproduced, consistent with the previously reported experiment. In contrast, the disordered conformations were predominant at higher temperatures. Among the stable conformations at 300 K, there were several free energy barriers, which were not visible in the landscapes formed with the conventional parameters. We identified the transition states around the saddle points along the putative folding and unfolding paths between the ?-hairpin and the disordered conformations in the landscape. The characteristic features of these transition states are the predominant hydrophobic contacts and the several hydrogen bonds among the side-chains, as well as some of the backbone hydrogen bonds. The unfolding simulations at high temperatures, 400 K and 500 K, and their principal component analyses also provided estimates for the transition state conformations, which agreed well with those at 400 K and 500 K deduced from the current free energy landscapes at 400 K and 500 K, respectively. However, the transition states at high temperatures were much more widely distributed on the landscape than those at 300 K, and their conformations were different. PMID:12237452

  10. Atomistic simulations of the MS2 coat protein conformational transition

    NASA Astrophysics Data System (ADS)

    Perkett, Matthew; Pontiggia, Francesco; Hagan, Michael

    2012-02-01

    During the replication of many viruses, hundreds to thousands of proteins self-assemble to form a protective protein coat, called a capsid, around the viral nucleic acid. Often these proteins have identical amino acid sequences with slightly different, or quasi-equivalent, conformations, which join in precise spatial arrangements. Although the structure of completed capsids is known to atomic resolution, little is known about the assembly intermediates and how protein conformations are selected during assembly. In this talk, we will use all-atom simulations to investigate how protein-RNA interactions guide conformational transitions of capsid proteins from the single-stranded RNA bacteriophage MS2. Since conformational changes occur on timescales which are not accessible to all-atom simulations, we use enhanced sampling methods to sample probable transition pathways and corresponding free energy profiles. Specifically, we will present free energy profiles associated with the MS2 capsid protein conformation in the presence and absence of RNA.

  11. Water-Peptide Dynamics during Conformational Transitions Dmitry Nerukh*,

    E-print Network

    Nerukh, Dmitry

    Water-Peptide Dynamics during Conformational Transitions Dmitry Nerukh*, and Sergey Karabasov are investigated using classical molecular dynamics simulation with explicit water molecules. The distribution of the surrounding water at different moments before the transitions and the dynamical correlations of water

  12. Fluctuation Flooding Method (FFM) for accelerating conformational transitions of proteins

    NASA Astrophysics Data System (ADS)

    Harada, Ryuhei; Takano, Yu; Shigeta, Yasuteru

    2014-03-01

    A powerful conformational sampling method for accelerating structural transitions of proteins, "Fluctuation Flooding Method (FFM)," is proposed. In FFM, cycles of the following steps enhance the transitions: (i) extractions of largely fluctuating snapshots along anisotropic modes obtained from trajectories of multiple independent molecular dynamics (MD) simulations and (ii) conformational re-sampling of the snapshots via re-generations of initial velocities when re-starting MD simulations. In an application to bacteriophage T4 lysozyme, FFM successfully accelerated the open-closed transition with the 6 ns simulation starting solely from the open state, although the 1-?s canonical MD simulation failed to sample such a rare event.

  13. Conformational transitions in random heteropolymer models.

    PubMed

    Blavatska, Viktoria; Janke, Wolfhard

    2014-01-21

    We study the conformational properties of heteropolymers containing two types of monomers A and B, modeled as self-attracting self-avoiding random walks on a regular lattice. Such a model can describe in particular the sequences of hydrophobic and hydrophilic residues in proteins [K. F. Lau and K. A. Dill, Macromolecules 22, 3986 (1989)] and polyampholytes with oppositely charged groups [Y. Kantor and M. Kardar, Europhys. Lett. 28, 169 (1994)]. Treating the sequences of the two types of monomers as quenched random variables, we provide a systematic analysis of possible generalizations of this model. To this end we apply the pruned-enriched Rosenbluth chain-growth algorithm, which allows us to obtain the phase diagrams of extended and compact states coexistence as function of both the temperature and fraction of A and B monomers along the heteropolymer chain. PMID:25669411

  14. Conformational transitions in random heteropolymer models

    NASA Astrophysics Data System (ADS)

    Blavatska, Viktoria; Janke, Wolfhard

    2014-01-01

    We study the conformational properties of heteropolymers containing two types of monomers A and B, modeled as self-attracting self-avoiding random walks on a regular lattice. Such a model can describe in particular the sequences of hydrophobic and hydrophilic residues in proteins [K. F. Lau and K. A. Dill, Macromolecules 22, 3986 (1989)] and polyampholytes with oppositely charged groups [Y. Kantor and M. Kardar, Europhys. Lett. 28, 169 (1994)]. Treating the sequences of the two types of monomers as quenched random variables, we provide a systematic analysis of possible generalizations of this model. To this end we apply the pruned-enriched Rosenbluth chain-growth algorithm, which allows us to obtain the phase diagrams of extended and compact states coexistence as function of both the temperature and fraction of A and B monomers along the heteropolymer chain.

  15. Conformational Anisotropy and the Glass Transition in Polymer Thin Films

    Microsoft Academic Search

    Folusho Oyerokun; Anna Cavallo; Marcus Mueller; Kenneth Schweizer

    2006-01-01

    A segmental level theory of the ideal kinetic glass transition, or dynamic crossover, temperature ( Tc ) in confined polymer films has been developed. The theory is based on an anisotropic generalization of a coarse grained polymer mode coupling theory which utilizes conformational and thermodynamic information from anisotropic PRISM theory and computer simulations. Confinement is found to enhance the bulk

  16. Sequence Recognition of DNA by Protein-Induced Conformational Transitions

    E-print Network

    Williams, Loren

    Sequence Recognition of DNA by Protein-Induced Conformational Transitions Derrick Watkins1 The binding of proteins to specific sequences of DNA is an important feature of virtually all DNA transactions. Proteins recognize specific DNA sequences using both direct readout (sensing types and positions of DNA

  17. Conformational Transitions and Convergence of Absolute Binding Free Energy Calculations.

    PubMed

    Lapelosa, Mauro; Gallicchio, Emilio; Levy, Ronald M

    2012-01-10

    The Binding Energy Distribution Analysis Method (BEDAM) is employed to compute the standard binding free energies of a series of ligands to a FK506 binding protein (FKBP12) with implicit solvation. Binding free energy estimates are in reasonably good agreement with experimental affinities. The conformations of the complexes identified by the simulations are in good agreement with crystallographic data, which was not used to restrain ligand orientations. The BEDAM method is based on ? -hopping Hamiltonian parallel Replica Exchange (HREM) molecular dynamics conformational sampling, the OPLS-AA/AGBNP2 effective potential, and multi-state free energy estimators (MBAR). Achieving converged and accurate results depends on all of these elements of the calculation. Convergence of the binding free energy is tied to the level of convergence of binding energy distributions at critical intermediate states where bound and unbound states are at equilibrium, and where the rate of binding/unbinding conformational transitions is maximal. This finding mirrors similar observations in the context of order/disorder transitions as for example in protein folding. Insights concerning the physical mechanism of ligand binding and unbinding are obtained. Convergence for the largest FK506 ligand is achieved only after imposing strict conformational restraints, which however require accurate prior structural knowledge of the structure of the complex. The analytical AGBNP2 model is found to underestimate the magnitude of the hydrophobic driving force towards binding in these systems characterized by loosely packed protein-ligand binding interfaces. Rescoring of the binding energies using a numerical surface area model corrects this deficiency. This study illustrates the complex interplay between energy models, exploration of conformational space, and free energy estimators needed to obtain robust estimates from binding free energy calculations. PMID:22368530

  18. Theoretical study of large conformational transitions in DNA: the B A conformational change in water and ethanol\\/water

    Microsoft Academic Search

    Agnes Noy; Alberto Perez; Charles A. Laughton; Modesto Orozco

    2007-01-01

    We explore here the possibility of determining theoretically the free energy change associated with large conformational transitions in DNA, like the solvent-induced B$A conformational change. We find that a combination of targeted molecular dynamics (tMD) and the weighted histogram analysis method (WHAM) can be used to trace this transition in both water and ethanol\\/water mixture. The pathway of the transition

  19. An RNA Hairpin to G-Quadruplex Conformational Transition

    PubMed Central

    2012-01-01

    RNA molecules can fold into noncanonical structures such as the four-stranded structures known as G-quadruplexes. G-quadruplexes in the transcriptome have recently emerged as relevant regulatory elements of gene expression. Conformational transitions in RNA molecules offer an important way to regulate their biological functions. Here we report on the competition between a canonical hairpin structure and a G-quadruplex structure within an RNA molecule. We show that the conformational preference strongly depends on the relative amounts of mono- and divalent metal ions present in solution. In our system, the G-quadruplex, whose formation is not predicted by available predictive RNA folding programs, is the major conformer at physiologically relevant K+ and Mg2+ concentrations. Furthermore, we show that a synthetic small molecule can displace the structural dynamic equilibrium in favor of the hairpin conformer. This work highlights a new and important level of complexity in RNA folding that could be relevant to the biological functions and targeting of RNAs comprising G-quadruplex motifs. PMID:23190255

  20. Conformational freedom in tight binding enzymatic transition-state analogues.

    PubMed

    Motley, Matthew W; Schramm, Vern L; Schwartz, Steven D

    2013-08-22

    Transition-state analogues of bacterial 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidases (MTANs) disrupt quorum-sensing pathways in Escherichia coli and Vibrio cholerae, demonstrating the potential to limit pathogenicity without placing bacteria under intense selective pressure that leads to antibiotic resistance. Despite the similarity of the crystal structures of E. coli MTAN (EcMTAN) and V. cholerae MTAN (VcMTAN) bound to DADMe-Immucillin-A transition-state (TS) analogues, EcMTAN demonstrates femtomolar affinity for BuT-DADMe-Immucillin-A (BDIA) whereas VcMTAN possesses only picomolar affinity. Protein dynamic interactions are therefore implicated in this inhibitor affinity difference. We conducted molecular dynamics simulations of both EcMTAN and VcMTAN in complex with BDIA to explore differences in protein dynamic architecture. Simulations revealed that electrostatic and hydrophobic interactions with BDIA are similar for both enzymes and thus unlikely to account for the difference in inhibitor affinity. The EcMTAN-BDIA complex reveals a greater flexibility and conformational freedom of catalytically important atoms. We propose that conserved motions related to the EcMTAN transition state correlate with the increased affinity of BDIA for EcMTAN. Transition-state analogues permitting protein motion related to formation of the transition state are better mimics of the enzymatic transition state and can bind more tightly than those immobilizing catalytic site dynamics. PMID:23895500

  1. Conformal field theory of the integer quantum Hall plateau transition

    Microsoft Academic Search

    Martin R. Zirnbauer

    1999-01-01

    A solution to the long-standing problem of identifying the conformal field\\u000atheory governing the transition between quantized Hall plateaus of a disordered\\u000anoninteracting 2d electron gas, is proposed. The theory is a nonlinear sigma\\u000amodel with a Wess-Zumino-Novikov-Witten term, and fields taking values in a\\u000aRiemannian symmetric superspace based on H^3 x S^3. Essentially the same\\u000aconformal field theory appeared

  2. Broadband transition between microstrip line and conformal surface plasmon waveguide

    NASA Astrophysics Data System (ADS)

    Liao, Zhen; Zhao, Jie; Cao Pan, Bai; Shen, Xiao Peng; Cui, Tie Jun

    2014-08-01

    We propose a broadband and high-efficiency transition from a microstrip line to a conformal surface plasmon (CSP) waveguide that is made of an ultrathin corrugated metallic strip, to transform the guide wave into a spoof surface plasmon polariton (SPP) in the microwave region. The transition consists of three parts: a convertor which converts the direction of the electric field from perpendicular to parallel to the strip, a matching area with gradient corrugations and a flaring metallic line to match both the momentum and impedance, and a CSP waveguide to support the SPP waves. A back-to-back transition sample is fabricated using the proposed method. Experimental results of S parameters and near-field distributions verify the excellent performance of the sample to transform guided waves to SPPs and transmit SPP waves in a wide band. The sample exhibits low energy loss when the CSP waveguide is bent or even twisted. The proposed transition may have potential applications in integrating conventional microwave devices with the SPP devices.

  3. Picosecond spectroscopic measurement of a solvent dependent change of rotational diffusion rotor shape

    NASA Astrophysics Data System (ADS)

    Blanchard, G. J.

    1987-12-01

    The rotational diffusion behavior of cresyl violet is observed to be solvent dependent, producing an induced orientational anisotropy function with single exponential decays in both ethylene glycol at 26 °C and 1-dodecanol at 37 °C, but a two-component decay in 1-dodecanol at 26 °C. It is clear from this data that cresyl violet is experiencing significant changes in its local solvation environment. Without knowledge of the orientation of the transition moment within the molecule, however, the interpretation of these results is ambiguous. A simple calculation is presented which allows for the estimation of the intramolecular orientation of the transition moment, thereby removing ambiguity from the interpretation. The observed behavior is shown to be consistent with cresyl violet reorienting as an oblate rotor in ethylene glycol and 1-dodecanol at 37 °C, and as a prolate rotor in 1-dodecanol at 26 °C.

  4. Molecular dynamics studies on the conformational transitions of adenylate kinase: a computational evidence for the conformational selection mechanism.

    PubMed

    Ping, Jie; Hao, Pei; Li, Yi-Xue; Wang, Jing-Fang

    2013-01-01

    Escherichia coli adenylate kinase (ADK) is a monomeric phosphotransferase enzyme that catalyzes reversible transfer of phosphoryl group from ATP to AMP with a large-scale domain motion. The detailed mechanism for this conformational transition remains unknown. In the current study, we performed long time-scale molecular dynamics simulations on both open and closed states of ADK. Based on the structural analyses of the simulation trajectories, we detected over 20 times conformational transitions between the open and closed states of ADK and identified two novel conformations as intermediate states in the catalytic processes. With these findings, we proposed a possible mechanism for the large-scale domain motion of Escherichia coli ADK and its catalytic process: (1) the substrate free ADK adopted an open conformation; (2) ATP bound with LID domain closure; (3) AMP bound with NMP domain closure; (4) phosphoryl transfer occurred with ATP, and AMP converted into two ADPs, and no conformational transition was detected in the enzyme; (5) LID domain opened with one ADP released; (6) another ADP released with NMP domain open. As both open and closed states sampled a wide range of conformation transitions, our simulation strongly supported the conformational selection mechanism for Escherichia coli ADK. PMID:23936827

  5. Thermally induced conformational transitions in nascent branched amphiphilic Peptide capsules.

    PubMed

    Sukthankar, Pinakin; Whitaker, Susan K; Garcia, Macy; Herrera, Alvaro; Boatwright, Mark; Prakash, Om; Tomich, John M

    2015-03-17

    Branched amphiphilic peptide capsules (BAPCs) are biocompatible, bilayer delimited polycationic nanospheres that spontaneously form at room temperature through the coassembly of two amphiphilic branched peptides: bis(FLIVI)-K-K4 and bis(FLIVIGSII)-K-K4. BAPCs are readily taken up by cells in culture, where they escape and/or evade the endocytic pathway and accumulate in the perinuclear region, persisting there without apparent degradation or extravasation. Drugs, small proteins, and solutes as well as ? particle emitting radionuclides are stably encapsulated for extended periods of time. BAPC formation at room temperature proceeds via a fusogenic process and after 48 h a range of BAPCs sizes are observed, from 50 nm to a few microns in diameter. It was previously reported that cooling BAPCs from 25 to 4 °C and then back to 25 °C eliminated their fusogenic property. In this report, biophysical techniques reveal that BAPCs undergo thermosensitive conformational transitions as a function of both time and temperature and that the properties of BAPCs vary based on the temperature of assembly. The solvent dissociation properties of BAPCs were studied as well as the contributions of specific amino acid residues to the observed conformations. The roles of the potential stabilizing forces present within the bilayer that bestow the unusal stability of the BAPCs are discussed. Ultimately this study presents revised assembly protocols for preparing BAPCs with discrete sizes and solvent-induced extravasation properties. PMID:25719598

  6. Conformation transitions of eukaryotic polyribosomes during multi-round translation

    PubMed Central

    Afonina, Zhanna A.; Myasnikov, Alexander G.; Shirokov, Vladimir A.; Klaholz, Bruno P.; Spirin, Alexander S.

    2015-01-01

    Using sedimentation and cryo electron tomography techniques, the conformations of eukaryotic polyribosomes formed in a long-term cell-free translation system were analyzed over all the active system lifetime (20–30 translation rounds during 6–8 h in wheat germ extract at 25°C). Three distinct types of the conformations were observed: (i) circular polyribosomes, varying from ring-shaped forms to circles collapsed into double rows, (ii) linear polyribosomes, tending to acquire planar zigzag-like forms and (iii) densely packed 3D helices. At the start, during the first two rounds of translation mostly the circular (ring-shaped and double-row) polyribosomes and the linear (free-shaped and zigzag-like) polyribosomes were formed (‘juvenile phase’). The progressive loading of the polyribosomes with translating ribosomes induced the opening of the circular polyribosomes and the transformation of a major part of the linear polyribosomes into the dense 3D helices (‘transitional phase’). After 2 h from the beginning (about 8–10 rounds of translation) this compact form of polyribosomes became predominant, whereas the circular and linear polyribosome fractions together contained less than half of polysomal ribosomes (‘steady-state phase’). The latter proportions did not change for several hours. Functional tests showed a reduced translational activity in the fraction of the 3D helical polyribosomes. PMID:25520190

  7. Conformational transitions of polynucleotides in the presence of rhodium complexes.

    PubMed

    Thomas, T J; Thomas, T

    1990-06-01

    We studied the effects of hexammine and tris(ethylene diamine) complexes of rhodium on the conformation of poly(dG-dC).poly(dG-dC) and poly(dG-m5dC).poly(dG-m5dC) using spectroscopic techniques and an enzyme immunoassay. Circular dichroism spectroscopic measurements showed that Rh(NH3)6(3+) provoked a B-DNA----Z-DNA----psi-DNA conformational transition in poly(dG-dC).poly(dG-dC). Using the enzyme immunoassay technique with a monoclonal anti-Z-DNA antibody, we found that the left-handedness of the polynucleotide was maintained in the psi-DNA form. In addition, we compared the efficacy of Rh(NH3)6(3+) and Rh(en)3(3+) to provoke the Z-DNA conformation in poly(dG-dC).poly(dG-dC) and poly(dG-m5dC.poly(dG-m5dC). The concentrations of Rh(NH3)6(3+) and Rh(en)3(3+) at the midpoint B-DNA----Z-DNA transition of poly(dG-dC).poly(dG-dC) were 48 +/- 2 and 238 +/- 2 microM, respectively. The psi-DNA form of poly(dG-dC).poly(dG-dC) was stabilized at 500 microM Rh(NH3)6(3+). With poly(dG-m5dC).poly(dg-m5dC), both counterions provoked the Z-DNA form at approximately 5 microM and stabilized the polynucleotide in this form up to 1000 microM concentration. These results show that trivalent complexes of Rh have a profound influence on the conformation of poly(dG-dC).poly(dG-dC) and its methylated derivative. Furthermore, the Rh complexes are capable of maintaining the Z-DNA form at concentration ranges far higher than that of other trivalent complexes. Our results also demonstrate that the efficacy of trivalent inorganic complexes to induce the B-DNA to Z-DNA transition of poly(dG-dC).poly(dG-dC) and poly(dG-m5dC).poly(dG-m5dC) is dependent on the nature of the ligand as well as the polynucleotide modification. Differences in charge density and hydration levels of counterions or base sequence- and counterion-dependent specific interactions between DNA and metal complexes might be possible mechanisms for the observed effects. PMID:2194495

  8. Sequence Recognition of DNA by Protein-Induced Conformational Transitions

    SciTech Connect

    Watkins, Derrick; Mohan, Srividya; Koudelka, Gerald B.; Williams, Loren Dean (GIT); (SUNYB)

    2010-11-09

    The binding of proteins to specific sequences of DNA is an important feature of virtually all DNA transactions. Proteins recognize specific DNA sequences using both direct readout (sensing types and positions of DNA functional groups) and indirect readout (sensing DNA conformation and deformability). Previously we showed that the P22 c2 repressor N-terminal domain (P22R NTD) forces the central non-contacted 5{prime}-ATAT-3{prime} sequence of the DNA operator into the B{prime} state, a state known to affect DNA hydration, rigidity and bending. Usually the B{prime} state, with a narrow minor groove and a spine of hydration, is reserved for A-tract DNA (TpA steps disrupt A-tracts). Here, we have co-crystallized P22R NTD with an operator containing a central 5{prime}-ACGT-3{prime} sequence in the non-contacted region. C {center_dot} G base pairs have not previously been observed in the B{prime} state and are thought to prevent it. However, P22R NTD induces a narrow minor groove and a spine of hydration to 5{prime}-ACGT-3{prime}. We observe that C {center_dot} G base pairs have distinctive destabilizing and disordering effects on the spine of hydration. It appears that the reduced stability of the spine results in a higher energy cost for the B to B{prime} transition. The differential effect of DNA sequence on the barrier to this transition allows the protein to sense the non-contacted DNA sequence.

  9. Ligand-promoted solvent-dependent ionization and conformational equilibria of Re(CO)3Br[CH2(S-tim)2] (tim = 1-methylthioimidazolyl). Crystal structures of Re(CO)3Br[CH2(S-tim)2] and {Re(CO)3(CH3CN)[CH2(S-tim)2]}(PF6).

    PubMed

    Silva, Rosalice M; Liddle, Brendan J; Lindeman, Sergey J; Smith, Mark D; Gardinier, James R

    2006-08-21

    The compounds Re(CO)3Br[CH2(S-tim)2] (1) and {Re(CO)3(CH3CN)[CH2(S-tim)2]}(PF6) (2), where tim is 1-methylthioimidazolyl, were prepared in high yields and characterized both in the solid state and in solution. The solid-state structures show that the ligand acts in a chelating binding mode where the eight-member chelate ring adopts twist-boat conformations in both compounds. A comparison of both solid-state IR data for CO stretching frequencies and the solution-phase voltammetric measurements for the Re(1+/2+) couples between 1, 2, and related N,N-chelates of the rhenium tricarbonyl moiety indicate that the CH2(S-tim)2 ligand is a stronger donor than even the ubiquitous dipyridyl ligands. A combination of NMR spectroscopic studies and voltammetric studies revealed that compound 1 undergoes spontaneous ionization to form {Re(CO)3(CH3CN)[CH2(S-tim)2]+}(Br-) in acetonitrile. Ionization does not occur in solvents such as CH2Cl2 or acetone that are less polar and Lewis basic (less coordinating). The equilibrium constant at 293 K for the ionization of 1 in CH3CN is 4.3 x 10(-3). The eight-member chelate rings in each 1 and 2 were found to be conformationally flexible in all solvents, and boat-chair conformers could be identified. Variable-temperature NMR spectroscopic studies were used to elucidate the various kinetic and thermodynamic parameters associated with the energetically accessible twist-boat to twist-boat and twist-boat to boat-chair interconversions. PMID:16903736

  10. Identification of key residues for protein conformational transition using elastic network model

    NASA Astrophysics Data System (ADS)

    Su, Ji Guo; Jin Xu, Xian; Hua Li, Chun; Chen, Wei Zu; Wang, Cun Xin

    2011-11-01

    Proteins usually undergo conformational transitions between structurally disparate states to fulfill their functions. The large-scale allosteric conformational transitions are believed to involve some key residues that mediate the conformational movements between different regions of the protein. In the present work, a thermodynamic method based on the elastic network model is proposed to predict the key residues involved in protein conformational transitions. In our method, the key functional sites are identified as the residues whose perturbations largely influence the free energy difference between the protein states before and after transition. Two proteins, nucleotide binding domain of the heat shock protein 70 and human/rat DNA polymerase ?, are used as case studies to identify the critical residues responsible for their open-closed conformational transitions. The results show that the functionally important residues mainly locate at the following regions for these two proteins: (1) the bridging point at the interface between the subdomains that control the opening and closure of the binding cleft; (2) the hinge region between different subdomains, which mediates the cooperative motions between the corresponding subdomains; and (3) the substrate binding sites. The similarity in the positions of the key residues for these two proteins may indicate a common mechanism in their conformational transitions.

  11. The atomistic mechanism of conformational transition in adenylate kinase: a TEE-REX molecular dynamics study.

    PubMed

    Kubitzki, Marcus B; de Groot, Bert L

    2008-08-01

    We report on an atomistic molecular dynamics simulation of the complete conformational transition of Escherichia coli adenylate kinase (ADK) using the recently developed TEE-REX algorithm. Two phases characterize the transition pathway of ADK, which folds into the domains CORE and LID and the AMP binding domain AMPbd. Starting from the closed conformation, half-opening of the AMPbd precedes a partially correlated opening of the LID and AMPbd, defining the second phase. A highly stable salt bridge D118-K136 at the LID-CORE interface, contributing substantially to the total nonbonded LID-CORE interactions, was identified as a major factor that stabilizes the open conformation. Alternative transition pathways, such as AMPbd opening following LID opening, seem unlikely, as full transition events were not observed along this pathway. The simulation data indicate a high enthalpic penalty, possibly obstructing transitions along this route. PMID:18682219

  12. Monte Carlo analysis of conformational transitions in superhelical DNA Hongzhi Sun

    E-print Network

    Benham, Craig J.

    Monte Carlo analysis of conformational transitions in superhelical DNA Hongzhi Sun Department August 1995 Metropolis­Monte Carlo algorithms are developed to analyze the strand separation transition the results of Monte Carlo calculations that use shuffling operations are compared with those from statistical

  13. Colloidal particle motion as a diagnostic of DNA conformational transitions

    E-print Network

    Nelson, Philip

    work on theoretical prob- lems inherent in the interpretation of TPM experiments, both in equilibrium information. Tethered particle motion (TPM) is an experimental technique to monitor conformational changes Markov modeling to extract loop-formation kinetics from noisy TPM data. 2 TPM technique The TPM technique

  14. Mapping the conformational transition in Src activation by cumulating the information from multiple molecular dynamics trajectories

    PubMed Central

    Yang, Sichun; Banavali, Nilesh K.; Roux, Benoît

    2009-01-01

    The Src-family kinases are allosteric enzymes that play a key role in the regulation of cell growth and proliferation. In response to cellular signals, they undergo large conformational changes to switch between distinct inactive and active states. A computational strategy for characterizing the conformational transition pathway is presented to bridge the inactive and active states of the catalytic domain of Hck. The information from a large number (78) of independent all-atom molecular dynamics trajectories with explicit solvent is combined together to assemble a connectivity map of the conformational transition. Two intermediate states along the activation pathways are identified, and their structural features are characterized. A coarse free-energy landscape is built in terms of the collective motions corresponding to the opening of the activation loop (A-loop) and the rotation of the ?C helix. This landscape shows that the protein can adopt a multitude of conformations in which the A-loop is partially open, while the ?C helix remains in the orientation characteristic of the inactive conformation. The complete transition leading to the active conformation requires a concerted movement involving further opening of the A-loop, the relative alignment of N-lobe and C-lobe, and the rotation of the ?C helix needed to recruit the residues necessary for catalysis in the active site. The analysis leads to a dynamic view of the full-length kinase activation, whereby transitions of the catalytic domain to intermediate configurations with a partially open A-loop are permitted, even while the SH2-SH3 clamp remains fully engaged. These transitions would render Y416 available for the transphosphorylation event that ultimately locks down the active state. The results provide a broad framework for picturing the conformational transitions leading to kinase activation. PMID:19225111

  15. Rigid-Cluster Models of Conformational Transitions in Macromolecular Machines and Assemblies

    Microsoft Academic Search

    Moon K. Kim; Robert L. Jernigan; Gregory S. Chirikjianz

    2005-01-01

    We present a rigid-body-based technique (called rigid-cluster elastic network interpolation) to generate feasible transition pathways between two distinct conformations of a macromolecular assembly. Many biological molecules and assemblies consist of domains which act more or less as rigid bodies during large conformational changes. These collective motions are thought to be strongly related with the functions of a system. This fact

  16. Pressure-induced conformation transition of o-phenylene solvated in bulk hydrocarbons.

    PubMed

    Riello, Massimo; Doni, Giovanni; Filip, Sorin V; Gold, Martin; De Vita, Alessandro

    2014-11-26

    The conformational behavior of o-phenylene 8-mers and 10-mers solvated in a series of linear alkane solvents by means of classical molecular dynamics and first-principles calculations was studied. Irrespective of the solvent used, we find that at ambient pressure the molecule sits in the well-defined close-helical arrangement previously observed in light polar solvents. However, for pressures greater than 50 atm, and for tetradecane or larger solvent molecules, our simulations predict that o-phenylene undergoes a conformational transition to an uncoiled, extended geometry with a 35% longer head-to-tail distance and a much larger overlap between its lateral aromatic ring groups. The free energy barrier for the transition was studied as a function of pressure and temperature for both solute molecules in butane and hexadecane. Gas-phase density functional theory-based nudged elastic band calculations on 8-mer and 10-mer o-phenylene were used to estimate how the pressure-induced transition energy barrier changes with solute length. Our results indicate that a sufficiently large solvent molecule size is the key factor enabling a configuration transition upon pressure changes and that longer solute molecules associate with higher conformation transition energy barriers. This suggests the possibility of designing systems in which a solute molecule can be selectively "activated" by a controlled conformation transition achieved at a predefined set of pressure and temperature conditions. PMID:25380225

  17. Anomalous conformational transitions in cytochrome C adsorbing to Langmuir-Blodgett films

    NASA Astrophysics Data System (ADS)

    Sankaranarayanan, Kamatchi; Nair, B. U.; Dhathathreyan, A.

    2013-05-01

    Helix to beta conformational transitions in proteins has attracted much attention due to their relevance to fibril formation which is implicated in many neurological diseases. This study reports on unusual conformational transition of cytochrome C adsorbing to hydrophilic surface containing pure cationic lipid and mixed Langmuir-Blodgett films (LB films) of cationic and neutral lipids. Evidence for conformational changes of the protein from its native helical state to beta sheet comes from Circular dichroic spectroscopy (CD spectroscopy). Analysis of these samples using High resolution TEM (HRTEM) shows a typical fibrillar pattern with each strand spacing of about 0.41 nm across which can be attributed to the repeat distance of interdigitated neighboring hydrogen-bonded ribbons in a beta sheet. Changes in contact angles of protein adsorbing to the LB films together with the increased mass uptake of water using quartz crystal microbalance (QCM) confirm the role of positive charges in the conformational transition. Dehydration of the protein resulting from the excess water entrainment in the polar planes of the cationic lipid in hydrophilic surface seems to trigger the refolding of the protein to beta sheet while it retains its native conformation in hydrophobic films. The results suggest that drastic conformational changes in CytC adsorbing to cationic lipids may be of significance in its role as a peripheral membrane protein.

  18. Modeling conformational transitions in kinases by molecular dynamics simulations: achievements, difficulties, and open challenges

    PubMed Central

    D'Abramo, Marco; Besker, Neva; Chillemi, Giovanni; Grottesi, Alessandro

    2014-01-01

    Protein kinases work because their flexibility allows to continuously switch from inactive to active form. Despite the large number of structures experimentally determined in such states, the mechanism of their conformational transitions as well as the transition pathways are not easily to capture. In this regard, computational methods can help to shed light on such an issue. However, due to the intrinsic sampling limitations, much efforts have been done to model in a realistic way the conformational changes occurring in protein kinases. In this review we will address the principal biological achievements and structural aspects in studying kinases conformational transitions and will focus on the main challenges related to computational approaches such as molecular modeling and MD simulations. PMID:24860596

  19. Investigation of the influence on conformational transition of DNA induced by cationic lipid vesicles

    NASA Astrophysics Data System (ADS)

    Zhang, Zheling; Huang, Weimin; Wang, Erkang; Dong, Shaojun

    2003-01-01

    Recent studies have focused on the structural features of DNA-lipid assemblies. In this paper we take nile blue A (NBA) as a probe molecule to study the influence of the conformational transition of DNA induced by didodecyldimethylammonium bromide (DDAB) cationic vesicles to the interaction between DNA and the probe molecules. We find that upon binding to DNA, a secondary conformational transition of DNA induced by the cationic liposome from the native B-form to the C-form resulted in the change of binding modes of NBA to DNA and different complexes are formed between DNA, DDAB and NBA.

  20. Constrained proper sampling of conformations of transition state ensemble of protein folding

    NASA Astrophysics Data System (ADS)

    Lin, Ming; Zhang, Jian; Lu, Hsiao-Mei; Chen, Rong; Liang, Jie

    2011-02-01

    Characterizing the conformations of protein in the transition state ensemble (TSE) is important for studying protein folding. A promising approach pioneered by Vendruscolo et al. [Nature (London) 409, 641 (2001)] to study TSE is to generate conformations that satisfy all constraints imposed by the experimentally measured ? values that provide information about the native likeness of the transition states. Faísca et al. [J. Chem. Phys. 129, 095108 (2008)] generated conformations of TSE based on the criterion that, starting from a TS conformation, the probabilities of folding and unfolding are about equal through Markov Chain Monte Carlo (MCMC) simulations. In this study, we use the technique of constrained sequential Monte Carlo method [Lin et al., J. Chem. Phys. 129, 094101 (2008); Zhang et al. Proteins 66, 61 (2007)] to generate TSE conformations of acylphosphatase of 98 residues that satisfy the ?-value constraints, as well as the criterion that each conformation has a folding probability of 0.5 by Monte Carlo simulations. We adopt a two stage process and first generate 5000 contact maps satisfying the ?-value constraints. Each contact map is then used to generate 1000 properly weighted conformations. After clustering similar conformations, we obtain a set of properly weighted samples of 4185 candidate clusters. Representative conformation of each of these cluster is then selected and 50 runs of Markov chain Monte Carlo (MCMC) simulation are carried using a regrowth move set. We then select a subset of 1501 conformations that have equal probabilities to fold and to unfold as the set of TSE. These 1501 samples characterize well the distribution of transition state ensemble conformations of acylphosphatase. Compared with previous studies, our approach can access much wider conformational space and can objectively generate conformations that satisfy the ?-value constraints and the criterion of 0.5 folding probability without bias. In contrast to previous studies, our results show that transition state conformations are very diverse and are far from nativelike when measured in cartesian root-mean-square deviation (cRMSD): the average cRMSD between TSE conformations and the native structure is 9.4 Å for this short protein, instead of 6 Å reported in previous studies. In addition, we found that the average fraction of native contacts in the TSE is 0.37, with enrichment in native-like ?-sheets and a shortage of long range contacts, suggesting such contacts form at a later stage of folding. We further calculate the first passage time of folding of TSE conformations through calculation of physical time associated with the regrowth moves in MCMC simulation through mapping such moves to a Markovian state model, whose transition time was obtained by Langevin dynamics simulations. Our results indicate that despite the large structural diversity of the TSE, they are characterized by similar folding time. Our approach is general and can be used to study TSE in other macromolecules.

  1. Conformational transition of DNA induced by cationic lipid vesicle in acidic solution: spectroscopy investigation.

    PubMed

    Zhang, Zheling; Huang, Weimin; Tang, Jilin; Wang, Erkang; Dong, Shaojun

    2002-05-23

    The conformational transition of DNA induced by the interaction between DNA and a cationic lipid vesicle, didodecyldimethylammonium bromide (DDAB), had been investigated by circular dichroism (CD) and UV spectroscopy methods. We used singular value decomposition least squares method (SVDLS) to analyze the experimental CD spectra. Although pH value influenced the conformation of DNA in solution, the results showed that upon binding to double helical DNA, positively charged liposomes induced a conformational transition of DNA molecules from the native B-form to more compact conformations. At the same time, no obvious conformational changes occurred at single-strand DNA (ssDNA). While the cationic lipid vesicles and double-strand DNA (dsDNA) were mixed at a high molar ratio of DDAB vesicles to dsDNA, the conformation of dsDNA transformed from the B-form to the C-form resulting in an increase in duplex stability (DeltaT(m)=8+/-0.4 degrees C). An increasing in T(m) was also observed while the cationic lipid vesicles interacted with ssDNA. PMID:12052491

  2. Constrained Proper Sampling of Conformations of Transition State Ensemble during Protein Folding

    E-print Network

    Dai, Yang

    Constrained Proper Sampling of Conformations of Transition State Ensemble during Protein Folding) is important for studying protein folding. A promising approach pioneered by Vendruscolo et al40 to study TSE to understand how proteins fold to its native state8,29,37 . Protein folding is a complex process that involves

  3. Conformational Transition Pathways in Signaling and Enzyme Catalysis Explored by Computational Methods

    Microsoft Academic Search

    Dimitar V. Pachov

    2010-01-01

    Biomolecules are dynamic in nature and visit a number of states while performing their biological function. However, understanding how they interconvert between functional substates is a challenging task. In this thesis, we employ enhanced computational strategies to reveal in atomistic resolution transition states and molecular mechanism along conformational pathways of the signaling protein Nitrogen Regulatory Protein C (NtrC) and the

  4. Lithium Diisopropylamide-Mediated Enolizations: Solvent-Dependent Mixed Aggregation Effects

    E-print Network

    Collum, David B.

    Lithium Diisopropylamide-Mediated Enolizations: Solvent-Dependent Mixed Aggregation Effects Xiufeng spectroscopic investigations of lithium diisopropylamide-mediated ester enolization in THF, t-BuOMe, HMPA that the metalations by lithium diisopropylamide (LDA) homonuclear dimers proceed at nearly solvent-independent rates

  5. The impact of N-terminal phosphorylation on LHCII conformation in state transition

    NASA Astrophysics Data System (ADS)

    Ding, Jin-Hong; Li, Ning; Wang, Man-Liu; Zhang, Yan; Lü, Shou-Qin; Long, Mian

    2014-06-01

    State transition is an important protection mechanism of plants for maintaining optimal efficiency through redistributing unbalanced excitation energy between photo-system II (PSII) and photosystem I (PSI). This process depends on the reversible phosphorylation/dephosphorylation of the major light-harvesting complex II (LHCII) and its bi-directional migration between PSII and PSI. But it remains unclear how phosphorylation/dephosphorylation modulates the LHCII conformation and further regulates its reversible migration. Here molecular dynamics simulations (MDS) were employed to elucidate the impact of phosphorylation on LHCII conformation. The results indicated that N-terminal phosphorylation loosened LHCII trimer with decreased hydrogen bond (H-bond) interactions and extended the distances between neighboring monomers, which stemmed from the conformational adjustment of each monomer itself. Global conformational change of LHCII monomer started from its stromal Nterminal (including the phosphorylation sites) by enhancing its interaction to lipid membrane and by adjusting the interaction network with surrounded inter-monomer and intra-monomer transmembrane helixes of B, C, and A, and finally triggered the reorientation of transmembrane helixes and transferred the conformational change to luminal side helixes and loops. These results further our understanding in molecular mechanism of LHCII migration during state transition from the phosphorylation-induced microstructural feature of LHCII.

  6. Exploring the conformational transitions of biomolecular systems using a simple two-state anisotropic network model.

    PubMed

    Das, Avisek; Gur, Mert; Cheng, Mary Hongying; Jo, Sunhwan; Bahar, Ivet; Roux, Benoît

    2014-04-01

    Biomolecular conformational transitions are essential to biological functions. Most experimental methods report on the long-lived functional states of biomolecules, but information about the transition pathways between these stable states is generally scarce. Such transitions involve short-lived conformational states that are difficult to detect experimentally. For this reason, computational methods are needed to produce plausible hypothetical transition pathways that can then be probed experimentally. Here we propose a simple and computationally efficient method, called ANMPathway, for constructing a physically reasonable pathway between two endpoints of a conformational transition. We adopt a coarse-grained representation of the protein and construct a two-state potential by combining two elastic network models (ENMs) representative of the experimental structures resolved for the endpoints. The two-state potential has a cusp hypersurface in the configuration space where the energies from both the ENMs are equal. We first search for the minimum energy structure on the cusp hypersurface and then treat it as the transition state. The continuous pathway is subsequently constructed by following the steepest descent energy minimization trajectories starting from the transition state on each side of the cusp hypersurface. Application to several systems of broad biological interest such as adenylate kinase, ATP-driven calcium pump SERCA, leucine transporter and glutamate transporter shows that ANMPathway yields results in good agreement with those from other similar methods and with data obtained from all-atom molecular dynamics simulations, in support of the utility of this simple and efficient approach. Notably the method provides experimentally testable predictions, including the formation of non-native contacts during the transition which we were able to detect in two of the systems we studied. An open-access web server has been created to deliver ANMPathway results. PMID:24699246

  7. Exploring the Conformational Transitions of Biomolecular Systems Using a Simple Two-State Anisotropic Network Model

    PubMed Central

    Jo, Sunhwan; Bahar, Ivet; Roux, Benoît

    2014-01-01

    Biomolecular conformational transitions are essential to biological functions. Most experimental methods report on the long-lived functional states of biomolecules, but information about the transition pathways between these stable states is generally scarce. Such transitions involve short-lived conformational states that are difficult to detect experimentally. For this reason, computational methods are needed to produce plausible hypothetical transition pathways that can then be probed experimentally. Here we propose a simple and computationally efficient method, called ANMPathway, for constructing a physically reasonable pathway between two endpoints of a conformational transition. We adopt a coarse-grained representation of the protein and construct a two-state potential by combining two elastic network models (ENMs) representative of the experimental structures resolved for the endpoints. The two-state potential has a cusp hypersurface in the configuration space where the energies from both the ENMs are equal. We first search for the minimum energy structure on the cusp hypersurface and then treat it as the transition state. The continuous pathway is subsequently constructed by following the steepest descent energy minimization trajectories starting from the transition state on each side of the cusp hypersurface. Application to several systems of broad biological interest such as adenylate kinase, ATP-driven calcium pump SERCA, leucine transporter and glutamate transporter shows that ANMPathway yields results in good agreement with those from other similar methods and with data obtained from all-atom molecular dynamics simulations, in support of the utility of this simple and efficient approach. Notably the method provides experimentally testable predictions, including the formation of non-native contacts during the transition which we were able to detect in two of the systems we studied. An open-access web server has been created to deliver ANMPathway results. PMID:24699246

  8. Large-scale allosteric conformational transitions of adenylate kinase appear to involve a population-shift mechanism.

    PubMed

    Arora, Karunesh; Brooks, Charles L

    2007-11-20

    Large-scale conformational changes in proteins are often associated with the binding of a substrate. Because conformational changes may be related to the function of an enzyme, understanding the kinetics and energetics of these motions is very important. We have delineated the atomically detailed conformational transition pathway of the phosphotransferase enzyme adenylate kinase (AdK) in the absence and presence of an inhibitor. The computed free energy profiles associated with conformational transitions offer detailed mechanistic insights into, as well as kinetic information on, the ligand binding mechanism. Specifically, potential of mean force calculations reveal that in the ligand-free state, there is no significant barrier separating the open and closed conformations of AdK. The enzyme samples near closed conformations, even in the absence of its substrate. The ligand binding event occurs late, toward the closed state, and transforms the free energy landscape. In the ligand-bound state, the closed conformation is energetically most favored with a large barrier to opening. These results emphasize the underlying dynamic nature of the enzyme and indicate that the conformational transitions in AdK are more intricate than a mere two-state jump between the crystal-bound and -unbound states. Based on the existence of the multiple conformations of the enzyme in the open and closed states, a different viewpoint of ligand binding is presented. Our estimated activation energy barrier for the conformational transition is also in reasonable accord with the experimental findings. PMID:18000050

  9. Conformational Transition Pathways in Signaling and Enzyme Catalysis Explored by Computational Methods

    NASA Astrophysics Data System (ADS)

    Pachov, Dimitar V.

    Biomolecules are dynamic in nature and visit a number of states while performing their biological function. However, understanding how they interconvert between functional substates is a challenging task. In this thesis, we employ enhanced computational strategies to reveal in atomistic resolution transition states and molecular mechanism along conformational pathways of the signaling protein Nitrogen Regulatory Protein C (NtrC) and the enzyme Adenylate Kinase (Adk). Targeted Molecular Dynamics (TMD) simulations and NMR experiments have previously found the active/inactive interconversion of NtrC is stabilized by non-native transient contacts. To find where along the conformational pathway they lie and probe the existence of multiple intermediates, a beyond 8mus-extensive mapping of the conformational landscape was performed by a multitude of straightforward MD simulations relaxed from the biased TMD pathway. A number of metastable states stabilized by local interactions was found to underline the conformational pathway of NtrC. Two spontaneous transitions of the last stage of the active-to-inactive conversion were identified and used in path sampling procedures to generate an ensemble of truly dynamic reactive pathways. The transition state ensemble (TSE) and mechanistic descriptors of this transition were revealed in atomic detail and verified by committor analysis. By analyzing how pressure affects the dynamics and function of two homologous Adk proteins - the P.Profundum Adk surviving at 700atm pressure in the deep sea, and the E. coli Adk that lives at ambient pressures - we indirectly obtained atomic information about the TSE of the large-amplitude rate-limiting conformational opening of the Adk lids. Guided by NMR experiments showing significantly decreased activation volumes of the piezophile compared to its mesophilic counterpart, TMD simulations revealed the formation of an extended hydrogen-bonded water network in the transition state of the piezophile that can explain the experimentally measured activation volume differences. The transition state of the conformational change was proposed to lie close to the closed state. Additionally, a number of descriptors were used to characterize the free energy landscape of the mesophile. It was found that the features of landscape are highly sensitive to the binding of different ligands, their protonation states and the presence of magnesium.

  10. Finite-Size Conformational Transitions: A Unifying Concept Underlying Chromosome Dynamics

    NASA Astrophysics Data System (ADS)

    Bertrand, R. Caré; Pascal, Carrivain; Thierry, Forné; Jean-Marc, Victor; Annick, Lesne

    2014-10-01

    Investigating average thermodynamic quantities is not sufficient to understand conformational transitions of a finite-size polymer. We propose that such transitions are better described in terms of the probability distribution of some finite-size order parameter, and the evolution of this distribution as a control parameter varies. We demonstrate this claim for the coil-globule transition of a linear polymer and its mapping onto a two-state model. In a biological context, polymer models delineate the physical constraints experienced by the genome at different levels of organization, from DNA to chromatin to chromosome. We apply our finite-size approach to the formation of plectonemes in a DNA segment submitted to an applied torque and the ensuing helix-coil transition that can be numerically observed, with a coexistence of the helix and coil states in a range of parameters. Polymer models are also essential to analyze recent in vivo experiments providing the frequency of pairwise contacts between genomic loci. The probability distribution of these contacts yields quantitative information on the conformational fluctuations of chromosome regions. The changes observed in the shape of the distribution when the cell type or the physiological conditions vary may reveal an epigenetic modulation of the conformational constraints experienced by the chromosomes.

  11. Transitions between elongated conformations of ubiquitin [M+11H]11+ enhance hydrogen/deuterium exchange.

    PubMed

    Bohrer, Brian C; Atlasevich, Natalya; Clemmer, David E

    2011-04-21

    Hydrogen/deuterium (H/D) exchange reactions between different elongated conformations of [M + 11H](11+) ions of ubiquitin and D(2)O are studied by a combination of ion mobility spectrometry (IMS) and mass spectrometry techniques. Three conformers (B, C, and D), resolved in the IMS separation, each exchange ?27 hydrogens upon exposure to 0.06 Torr of D(2)O vapor for ?35 to 40 ms. However, a region of the IMS spectrum that appears between the C and D states (corresponding to ions that undergo a structural transition during the mobility separation) undergoes substantially more exchanges (?39 total sites, 44% more than the B, C, and D states). Selection and activation of the individual B, C, and D states reveals that the increased H/D exchange occurs during the transition between structures. Overall, these studies suggest a key process in establishing the maximum exchange levels involves structural transitions, which allow protected sites to be exposed for some fraction of the reaction time. Analysis of changes in exchange levels upon structural transitions can provide insight about common regions of structure that exist in the B, C, and D conformations. PMID:21449553

  12. Transitions between Elongated Conformations of Ubiquitin [M+11H]11+ Enhance Hydrogen/Deuterium Exchange

    PubMed Central

    Bohrer, Brian C.; Atlasevich, Natalya; Clemmer, David E.

    2011-01-01

    Hydrogen/deuterium (H/D) exchange reactions between different elongated conformations of [M+11H]11+ ions of ubiquitin and D2O are studied by a combination of ion mobility spectrometry (IMS) and mass spectrometry techniques. Three conformers (B, C, and D), resolved in the IMS separation, each exchange ~27 hydrogens upon exposure to 0.06 torr of D2O vapor for ~35 to 40 ms. However, a region of the IMS spectrum that appears between the C and D states (corresponding to ions that undergo a structural transition during the mobility separation) undergoes substantially more exchanges (~39 total sites, 44% more than the B, C, and D states). Selection and activation of the individual B, C, and D states reveals that the increased H/D exchange occurs during the transition between structures. Overall, these studies suggest a key process in establishing the maximum exchange levels involves structural transitions, which allow protected sites to be exposed for some fraction of the reaction time. Analysis of changes in exchange levels upon structural transitions can provide insight about common regions of structure that exist in the B, C, and D conformations. PMID:21449553

  13. Mechanistic picture for conformational transition of a membrane transporter at atomic resolution.

    PubMed

    Moradi, Mahmoud; Tajkhorshid, Emad

    2013-11-19

    During their transport cycle, ATP-binding cassette (ABC) transporters undergo large-scale conformational changes between inward- and outward-facing states. Using an approach based on designing system-specific reaction coordinates and using nonequilibrium work relations, we have performed extensive all-atom molecular dynamics simulations in the presence of explicit membrane/solvent to sample a large number of mechanistically distinct pathways for the conformational transition of MsbA, a bacterial ABC exporter whose structure has been solved in multiple functional states. The computational approach developed here is based on (i) extensive exploration of system-specific biasing protocols (e.g., using collective variables designed based on available low-resolution crystal structures) and (ii) using nonequilibrium work relations for comparing the relevance of the transition pathways. The most relevant transition pathway identified using this approach involves several distinct stages reflecting the complex nature of the structural changes associated with the function of the protein. The opening of the cytoplasmic gate during the outward- to inward-facing transition of apo MsbA is found to be disfavored when the periplasmic gate is open and facilitated by a twisting motion of the nucleotide-binding domains that involves a dramatic change in their relative orientation. These results highlight the cooperativity between the transmembrane and the nucleotide-binding domains in the conformational transition of ABC exporters. The approach introduced here provides a framework to study large-scale conformational changes of other membrane transporters whose computational investigation at an atomic resolution may not be currently feasible using conventional methods. PMID:24191018

  14. The Conformational Transition Pathways of ATP-Binding Cassette Transporter BtuCD Revealed by Targeted Molecular Dynamics Simulation

    PubMed Central

    Weng, Jingwei; Fan, Kangnian; Wang, Wenning

    2012-01-01

    BtuCD is a member of the ATP-binding cassette transporters in Escherichia coli that imports vitamin B12 into the cell by utilizing the energy of ATP hydrolysis. Crystal structures of BtuCD and its homologous protein HI1470/1 in various conformational states support the “alternating access” mechanism which proposes the conformational transitions of the substrate translocation pathway at transmembrane domain (TMD) between the outward-facing and inward-facing states. The conformational transition at TMD is assumed to couple with the movement of the cytoplasmic nucleotide-binding domains (NBDs) driven by ATP hydrolysis/binding. In this study, we performed targeted molecular dynamics (MD) simulations to explore the atomic details of the conformational transitions of BtuCD importer. The outward-facing to inward-facing (O?I) transition was found to be initiated by the conformational movement of NBDs. The subsequent reorientation of the substrate translocation pathway at TMD began with the closing of the periplasmic gate, followed by the opening of the cytoplamic gate in the last stage of the conformational transition due to the extensive hydrophobic interactions at this region, consistent with the functional requirement of unidirectional transport of the substrates. The reverse inward-facing to outward-facing (I?O) transition was found to exhibit intrinsic diversity of the conformational transition pathways and significant structural asymmetry, suggesting that the asymmetric crystal structure of BtuCD-F is an intermediate state in this process. PMID:22272354

  15. Solid-to-hybrid transitioning armature railgun with non-conforming-to-prejudice bore profile

    DOEpatents

    Solberg, Jerome Michael

    2012-12-04

    An improved railgun, railgun barrel, railgun projectile, and railgun system for accelerating a solid-to-hybrid transitioning armature projectile using a barrel having a bore that does not conform to a cross-sectional profile of the projectile, to contact and guide the projectile only by the rails in a low pressure bore volume so as to minimize damage, failure, and/or underperformance caused by plasma armatures, insulator ablation, and/or restrikes.

  16. STIM1 couples to ORAI1 via an intramolecular transition into an extended conformation

    PubMed Central

    Muik, Martin; Fahrner, Marc; Schindl, Rainer; Stathopulos, Peter; Frischauf, Irene; Derler, Isabella; Plenk, Peter; Lackner, Barbara; Groschner, Klaus; Ikura, Mitsuhiko; Romanin, Christoph

    2011-01-01

    Stromal interaction molecule (STIM1) and ORAI1 are key components of the Ca2+ release-activated Ca2+ (CRAC) current having an important role in T-cell activation and mast cell degranulation. CRAC channel activation occurs via physical interaction of ORAI1 with STIM1 when endoplasmic reticulum Ca2+ stores are depleted. Here we show, utilizing a novel STIM1-derived Förster resonance energy transfer sensor, that the ORAI1 activating small fragment (OASF) undergoes a C-terminal, intramolecular transition into an extended conformation when activating ORAI1. The C-terminal rearrangement of STIM1 does not require a functional CRAC channel, suggesting interaction with ORAI1 as sufficient for this conformational switch. Extended conformations were also engineered by mutations within the first and third coiled-coil domains in the cytosolic portion of STIM1 revealing the involvement of hydrophobic residues in the intramolecular transition. Corresponding full-length STIM1 mutants exhibited enhanced interaction with ORAI1 inducing constitutive CRAC currents, even in the absence of store depletion. We suggest that these mutant STIM1 proteins imitate a physiological activated state, which mimics the intramolecular transition that occurs in native STIM1 upon store depletion. PMID:21427704

  17. Solvent dependent supramolecular self-assembly and surface reversal of a modified porphyrin.

    PubMed

    Zhang, Xuemei; Xu, Haijun; Shen, Yongtao; Wang, Yibing; Shen, Zhen; Zeng, Qingdao; Wang, Chen

    2013-08-14

    In this paper, a novel core-modified porphyrin with meso-aryl substituents and phenanthrene-fused pyrrole rings (N2S2-OR) is synthesized. Scanning tunneling microscopy (STM) has been used to probe its self-assembly behavior on a highly-oriented pyrolytic graphite (HOPG) surface. Our STM results have shown that there is an obvious solvent-dependent self-assembly for the surface-confined target molecules. In n-tetradecane, N2S2-OR assembles into a perfect alternating structure. At the 1-phenyloctane-graphite interface, disordered structures are formed and nonperiodic alternation is observed, whereas the target molecule in 1-heptanoic acid is assumed to form homogeneous close-packed monolayers with no alternating. Interestingly, such solvent-dependent supramolecular assembled behavior also involves the structural transformation of the backbone of the core-modified porphyrin derivative from saddle to reversed-saddle in these three solvents with different polarities. PMID:23764927

  18. EB1 Accelerates Two Conformational Transitions Important for Microtubule Maturation and Dynamics

    PubMed Central

    Maurer, Sebastian P.; Cade, Nicholas I.; Bohner, Gerg?; Gustafsson, Nils; Boutant, Emmanuel; Surrey, Thomas

    2014-01-01

    Summary Background The dynamic properties of microtubules depend on complex nanoscale structural rearrangements in their end regions. Members of the EB1 and XMAP215 protein families interact autonomously with microtubule ends. EB1 recruits several other proteins to growing microtubule ends and has seemingly antagonistic effects on microtubule dynamics: it induces catastrophes, and it increases growth velocity, as does the polymerase XMAP215. Results Using a combination of in vitro reconstitution, time-lapse fluorescence microscopy, and subpixel-precision image analysis and convolved model fitting, we have studied the effects of EB1 on conformational transitions in growing microtubule ends and on the time course of catastrophes. EB1 density distributions at growing microtubule ends reveal two consecutive conformational transitions in the microtubule end region, which have growth-velocity-independent kinetics. EB1 binds to the microtubule after the first and before the second conformational transition has occurred, positioning it several tens of nanometers behind XMAP215, which binds to the extreme microtubule end. EB1 binding accelerates conformational maturation in the microtubule, most likely by promoting lateral protofilament interactions and by accelerating reactions of the guanosine triphosphate (GTP) hydrolysis cycle. The microtubule maturation time is directly linked to the duration of a growth pause just before microtubule depolymerization, indicating an important role of the maturation time for the control of dynamic instability. Conclusions These activities establish EB1 as a microtubule maturation factor and provide a mechanistic explanation for its effects on microtubule growth and catastrophe frequency, which cause microtubules to be more dynamic. PMID:24508171

  19. Distribution, Transition and Thermodynamic Stability of Protein Conformations in the Denaturant-Induced Unfolding of Proteins

    PubMed Central

    Bian, Liujiao; Ji, Xu

    2014-01-01

    Background Extensive and intensive studies on the unfolding of proteins require appropriate theoretical model and parameter to clearly illustrate the feature and characteristic of the unfolding system. Over the past several decades, four approaches have been proposed to describe the interaction between proteins and denaturants, but some ambiguity and deviations usually occur in the explanation of the experimental data. Methodology/Principal Findings In this work, a theoretical model was presented to show the dependency of the residual activity ratio of the proteins on the molar denaturant concentration. Through the characteristic unfolding parameters ki and ?mi in this model, the distribution, transition and thermodynamic stability of protein conformations during the unfolding process can be quantitatively described. This model was tested with the two-state unfolding of bovine heart cytochrome c and the three-state unfolding of hen egg white lysozyme induced by both guanidine hydrochloride and urea, the four-state unfolding of bovine carbonic anhydrase b induced by guanidine hydrochloride and the unfolding of some other proteins induced by denaturants. The results illustrated that this model could be used accurately to reveal the distribution and transition of protein conformations in the presence of different concentrations of denaturants and to evaluate the unfolding tendency and thermodynamic stability of different conformations. In most denaturant-induced unfolding of proteins, the unfolding became increasingly hard in next transition step and the proteins became more unstable as they attained next successive stable conformation. Conclusions/Significance This work presents a useful method for people to study the unfolding of proteins and may be used to describe the unfolding and refolding of other biopolymers induced by denaturants, inducers, etc. PMID:24603868

  20. Reaction path study of conformational transitions and helix formation in a tetrapeptide.

    PubMed Central

    Czerminski, R; Elber, R

    1989-01-01

    Conformational transitions between the 112 stable states of the tetrapeptide isobutyryl-Ala3-NH-methyl (IAN) are studied theoretically. The objective of the investigation is to advance the understanding of helix formation and of conformational transitions in polypeptides. The possible reaction paths between extended chain and helical configurations are examined in detail. The study of the multiple reaction paths in this 48-atom molecule became possible due to development of a new computational algorithm. It is shown that the helix-coil transitions in IAN follow a sequence of local dihedral flips and that the number of the available routes for the transition is significantly lower than in a random search. A quasi-melting point is obtained at 5 +/- 1 kcal (1 cal = 4.18 J)/mol above the lowest energy minimum. Below this point the molecule is trapped in one or very few minima, and above it the molecule hops between a large number of configurations. PMID:2780552

  1. Application of Conformal Invariance to the Investigation of Second Order Surface Phase Transitions.

    NASA Astrophysics Data System (ADS)

    Hentschke, Reinhard

    Using the consequences of conformal invariance of critical correlation functions, the effects of finite size, shape and boundary conditions on scattering functions S(vec{rm K}), susceptibilities, correlation lengths and specific heat correction terms for 2D Ising systems at criticality were investigated (Hentschke, Kleban and Akinci, 1986; Kleban, Akinci, Hentschke and Brownstein, 1986). Very good agreement was found with specific model calculations using Monte Carlo and transfer matrix resutls (Bartelt and Einstein, 1986) for the scattering functions and susceptibilities of fully finite, two dimensional rectangular and circular geometries as well as for the infinite strip with periodic boundary conditions. The decay of S(vec{rm K}) according to the power law 1/k ^{2-eta_{rm app} } with an apparent exponent eta _{rm app} not= eta in the intermediate k-regime is discussed and modeled analytically for the circular geometry (Kleban and Hentschke, 1986). The concepts of conformal invariance are reviewed, and a dynamical LEED (low energy electron diffraction) theory at the critical point is proposed for adsorbates or reconstructing undergoing a second order phase transition. The method employed combines conformal invariance with the standard dynamical LEED theory as found in Pendry (1974). An explicit expression for the scattering intensity at the bulk (infinite system) critical temperature is given for transitions belonging to the Ising universality class. The formulas are evaluated in s-wave approximation using the (1 times 1)Leftrightarrow p(2 times 1) transition on a simple cubic substrate as an example. In addition the extension of this method to other universality classes is discussed in some detail. These results are of interest for several reasons. (i) They are directly applicable to the experiment, allowing a test of some fundamental aspects of the conformal principle. (ii) The predictions are universal, in the sense that they do not depend on the details of the forces responsible for the transition. They are determined by the universality class of the transition, which is generally specified by easily observable symmetry breaking. (iii) The predicted intimate relation between finite size and the detailed dependence of the scattering on experimental parameters (incoming energy, angles, etc.) may prove useful for surface characterization.

  2. The solvent dependent shift of the amide I band of a fully solvated peptide in methanol/water mixtures as a local probe for the solvent composition in the peptide/solvent interface

    SciTech Connect

    Gnanakaran, S [Los Alamos National Laboratory

    2008-01-01

    We determine the shift and line-shape of the amide I band of a model AK-peptide from molecular dynamics (MD) simulations of the peptide dissolved in methanol/water mixtures with varying composition. The IR-spectra are determined from a transition dipole coupling exciton model. A simplified empirical model Hamiltonian is employed, taking both the effect of hydrogen bonding, as well as intramolecular vibrational coupling into account. We consider a single isolated AK-peptide in a mostly helical conformation, while the solvent is represented by 2600 methanol or water molecules, simulated for a pressure of 1 bar and a temperature of 300 K. Over the course of the simulations minor reversible conformational changes at the termini are observed, which are found to only slightly affect the calculated spectral properties. Over the entire composition range, varying from pure water to the pure methanol solvent, a monotonous blue-shift of the IR amide I band of about 8 wavenumbers is observed. The shift is found to be caused by two counter-compensating effects: An intramolecular red-shift of about 1.2 wavenumbers, due to stronger intramolecular hydrogen-bonding in a methanol-rich environment. Dominating, however, is the intermolecular solvent-dependent blue-shift of about 10 wavenumbers, being attributed to the less effective hydrogen bond donor capabilities of methanol compared to water. The importance of solvent-contribution to the IR-shift, as well as the significantly different hydrogen formation capabilities of water and methanol make the amide I band sensitive to composition changes in the local environment close the peptide/solvent interface. This allows, in principle, an experimental determination of the composition of the solvent in close proximity to the peptide surface. For the AK-peptide case they observe at low methanol concentrations a significantly enhanced methanol concentration at the peptide/solvent-interface, supposedly promoted by the partially hydrophobic character of the AK-peptide's solvent accessible surface.

  3. Modeling protein conformational transitions by a combination of coarse-grained normal mode analysis and robotics-inspired methods

    PubMed Central

    2013-01-01

    Background Obtaining atomic-scale information about large-amplitude conformational transitions in proteins is a challenging problem for both experimental and computational methods. Such information is, however, important for understanding the mechanisms of interaction of many proteins. Methods This paper presents a computationally efficient approach, combining methods originating from robotics and computational biophysics, to model protein conformational transitions. The ability of normal mode analysis to predict directions of collective, large-amplitude motions is applied to bias the conformational exploration performed by a motion planning algorithm. To reduce the dimension of the problem, normal modes are computed for a coarse-grained elastic network model built on short fragments of three residues. Nevertheless, the validity of intermediate conformations is checked using the all-atom model, which is accurately reconstructed from the coarse-grained one using closed-form inverse kinematics. Results Tests on a set of ten proteins demonstrate the ability of the method to model conformational transitions of proteins within a few hours of computing time on a single processor. These results also show that the computing time scales linearly with the protein size, independently of the protein topology. Further experiments on adenylate kinase show that main features of the transition between the open and closed conformations of this protein are well captured in the computed path. Conclusions The proposed method enables the simulation of large-amplitude conformational transitions in proteins using very few computational resources. The resulting paths are a first approximation that can directly provide important information on the molecular mechanisms involved in the conformational transition. This approximation can be subsequently refined and analyzed using state-of-the-art energy models and molecular modeling methods. PMID:24564964

  4. Solvent-Dependent Divergent Functions of Sc(OTf)3 in Stereoselective Epoxide-Opening Spiroketalizations

    PubMed Central

    2015-01-01

    A stereocontrolled synthesis of benzannulated spiroketals has been developed using solvent-dependent Sc(OTf)3-mediated spirocyclizations of exo-glycal epoxides having alcohol side chains. In THF, the reaction proceeds via Lewis acid catalysis under kinetic control with inversion of configuration at the anomeric carbon. In contrast, in CH2Cl2, Brønsted acid catalysis under thermodynamic control leads to retention of configuration. The reactions accommodate a variety of aryl substituents and ring sizes and provide stereochemically diverse spiroketals. PMID:24742081

  5. Thermodynamic and conformational insights into the phase transition of a single flexible homopolymer chain using replica exchange Monte Carlo method.

    PubMed

    Wang, Lei; Li, Ningning; Xiao, Shiyan; Liang, Haojun

    2014-07-01

    The phase transition of a single flexible homopolymer chain in the limit condition of dilute solution is systematically investigated using a coarse-grained model. Replica exchange Monte Carlo method is used to enhance the performance of the conformation space exploration, and thus detailed investigation of phase behavior of the system can be provided. With the designed potentials, the coil-globule transition and the liquid-solid-like transition are identified, and the transition temperatures are measured with the conformational and thermodynamic analyses. Additionally, by extrapolating the coil-globule transition temperature, T ? , and the liquid-solid-like transition temperature T(L ? S) to the thermodynamic limit, N????, we found no "tri-critical" point in the current model. PMID:24961896

  6. Conformational and phase transitions in DNA-photosensitive surfactant solutions: Experiment and modeling.

    PubMed

    Kasyanenko, N; Lysyakova, L; Ramazanov, R; Nesterenko, A; Yaroshevich, I; Titov, E; Alexeev, G; Lezov, A; Unksov, I

    2015-02-01

    DNA binding to trans- and cis-isomers of azobenzene containing cationic surfactant in 5 mM NaCl solution was investigated by the methods of dynamic light scattering (DLS), low-gradient viscometry (LGV), atomic force microscopy (AFM), circular dichroism (CD), gel electrophoresis (GE), flow birefringence (FB), UV-Vis spectrophotometry. Light-responsive conformational transitions of DNA in complex with photosensitive surfactant, changes in DNA optical anisotropy and persistent length, phase transition of DNA into nanoparticles induced by high surfactant concentration, as well as transformation of surfactant conformation under its binding to macromolecule were studied. Computer simulations of micelles formation for cis- and trans-isomers of azobenzene containing surfactant, as well as DNA-surfactant interaction, were carried out. Phase diagram for DNA-surfactant solutions was designed. The possibility to reverse the DNA packaging induced by surfactant binding with the dilution and light irradiation was shown. © 2014 Wiley Periodicals, Inc. Biopolymers 103: 109-122, 2015. PMID:25302479

  7. Solvent-dependent structure of molecular iodine probed by picosecond X-ray solution scattering.

    PubMed

    Kim, Kyung Hwan; Ki, Hosung; Lee, Jae Hyuk; Park, Sungjun; Kong, Qingyu; Kim, Jeongho; Kim, Joonghan; Wulff, Michael; Ihee, Hyotcherl

    2015-04-14

    The effect of solute-solvent interaction on molecular structure and reaction dynamics has been a target of intense studies in solution-phase chemistry, but it is often challenging to characterize the subtle effect of solute-solvent interaction even for the simplest diatomic molecules. Since the I2 molecule has only one structural parameter and exhibits solvatochromism, it is a good model system for investigating the solvent dependence of the solute structure. By using X-rays as a probe, time-resolved X-ray liquidography (TRXL) can directly elucidate the structures of reacting molecules in solution and can thus determine the solvent-dependent structural change with atomic resolution. Here, by applying TRXL, we characterized the molecular structure of I2 in methanol and cyclohexane with sub-angstrom accuracy. Specifically, we found that the I-I bond length of I2 is longer in the polar solvent (methanol) by ?0.2 Å than in nonpolar solvents (cyclohexane and CCl4). Density functional theory (DFT) using 22 explicit methanol molecules well reproduces the longer I-I bond of molecular iodine in methanol and reveals that the larger bond length originates from partial negative charge filled in an antibonding ?* orbital through solvent-to-solute charge transfer. PMID:25760386

  8. Solvent-dependent luminescent Cu(I) framework based on 5-(4-pyridyl)tetrazole

    SciTech Connect

    Wang Fei; Yu Rongmin; Zhang Qisheng; Zhao Zhenguo; Wu Xiaoyuan; Xie Yiming; Qin Li; Chen Shanci [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, Chinese Academy of Sciences, Fuzhou, Fujian 35002 (China); Lu Canzhong, E-mail: czlu@fjirsm.ac.c [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, Chinese Academy of Sciences, Fuzhou, Fujian 35002 (China)

    2009-09-15

    A new Cu(IOTA) coordination compound, Cu{sub 4}(L){sub 4}.2EtOH (1), has been obtained from the solvothermal reaction of CuBr, HL (L=5-(4-pyridyl) tetrazole), EtOH and NH{sub 3}.H{sub 2}O. The structure determination reveals that 1 has a 2D network, where each Cu(I) atom adopts a trigonal coordination mode. The 2D networks stacked in an ABAB sequence through the pi-pi interaction to form a 3D supramolecular framework, giving a 1D channel along the b-axis. The TGA and powder XRD measurements reveal that the framework is stable after removal of the guest molecules. Gas (N{sub 2}) adsorption measurement was carried out for the framework. Framework 1 shows II sorption profile with N{sub 2}, which indicates that N{sub 2} molecules cannot diffuse into the micropore and only surface adsorption occurs. The photoluminescent research shows that compound 1 displays an interesting solvent-dependent luminescence. - Abstract: A new Cu(I) compound, Cu{sub 4}(L){sub 4}.2EtOH (1) (L=5-(4-pyridyl) tetrazole), was synthesized under solvothermal method, which displays an interesting solvent-dependent luminescence. Display Omitted

  9. Distinguishing Unfolding and Functional Conformational Transitions of Calmodulin Using Ultraviolet Resonance Raman Spectroscopy

    SciTech Connect

    Jones, Eric M.; Balakrishnan, G.; Squier, Thomas C.; Spiro, Thomas

    2014-06-14

    Calmodulin (CaM) is a ubiquitous moderator protein for calcium signaling in all eukaryotic cells. This small calcium-binding protein exhibits a broad range of structural transitions, including domain opening and folding-unfolding, that allow it to recognize a wide variety of binding partners in vivo. While the static structures of CaM associated with its various binding activities are fairly well known, it has been challenging to examine the dynamics of transition between these structures in real-time, due to a lack of suitable spectroscopic probes of CaM structure. In this paper, we examine the potential of ultraviolet resonance Raman (UVRR) spectroscopy for clarifying the nature of structural transitions in CaM. We find that the UVRR spectral change (with 229 nm excitation) due to thermal unfolding of CaM is qualitatively different from that associated with opening of the C-terminal domain in response to Ca2+ binding. This spectral difference is entirely due to differences in teritary contacts at the inter-domain tyrosine residue Tyr138, toward which other spectroscopic methods are not sensitive. We conclude that UVRR is ideally suited to identifying the different types of structural transitions in CaM and other proteins with conformation-sensitive tyrosine residues, opening a path to time-resolved studies of CaM dynamics using Raman spectroscopy.

  10. Temperature-induced conformational transition of a model elastin-like peptide GVG(VPGVG)(3) in water.

    PubMed

    Krukau, Aliaksei; Brovchenko, Ivan; Geiger, Alfons

    2007-07-01

    The conformation of a single elastin-like peptide GVG(VPGVG)3 in liquid water is studied by computer simulations in the temperature interval between 280 and 440 K. Two main conformational states of the peptide can be distinguished: a rigid conformational state, dominating at low temperatures, and a flexible conformational state, dominating at high temperatures. A temperature-induced transition between these states occurs at about 310 K, rather close to a transition temperature seen in experiments. This transition is accompanied by the thermal breaking of the hydrogen-bonded spanning network of the hydration water via a percolation transition upon heating. This finding indicates that the H-bond clustering structure of the hydration water plays an important role in the conformational stability of biomolecules. A second important observation is the Gaussian distribution of the end-to-end distance in the high-temperature state, which supports the idea of a rubber-like elasticity of the studied elastin-like peptide. Finally our results challenge the idea of the folding of elastin-like peptides upon heating. PMID:17567170

  11. Symmetry- and solvent-dependent photophysics of fluorenes containing donor and acceptor groups.

    PubMed

    Stewart, David J; Dalton, Matthew J; Swiger, Rachel N; Fore, Jennifer L; Walker, Mark A; Cooper, Thomas M; Haley, Joy E; Tan, Loon-Seng

    2014-07-17

    Three two-photon absorption (2PA) dyes (donor-?-donor (DPA2F), donor-?-acceptor (AF240), and acceptor-?-acceptor (BT2F); specifically, D is Ph2N-, A is 2-benzothiazoyl, and the ?-linker is 9,9-diethylfluorene) are examined in a variety of aprotic solvents. Because the 2PA cross section is sensitive to the polarity of the local environment, this report examines the solvent-dependent linear photophysics of the dyes, which are important to understand before probing more complex solid-state systems. The symmetrical dyes show little solvent dependence; however, AF240 has significant solvatochromism observed in the fluorescence spectra and lifetimes and also the transient absorption spectra. A 114 nm bathochromic shift is observed in the fluorescence maximum when going from n-hexane to acetonitrile, whereas the lifetimes increase from 1.25 to 3.12 ns. The excited-state dipole moment for AF240 is found to be 20.1 D using the Lippert equation, with smaller values observed for the symmetrical dyes. Additionally, the femtosecond transient absorption (TA) spectra at time zero show little solvent dependence for DPA2F or BT2F, but AF240 shows a 52 nm hypsochromic shift from n-hexane to acetonitrile. Coupled with the solvatochromism in the fluorescence and large excited-state dipole moment, this is attributed to formation of an intramolecular charge-transfer (ICT) state in polar solvents. By 10 ps in AF240, the maximum TA in acetonitrile has shifted 30 nm, providing direct evidence of a solvent-stabilized ICT state, whose formation occurs in 0.85-2.71 ps, depending on solvent. However, AF240 in nonpolar solvents and the symmetrical dyes in all solvents show essentially no shifts due to a predominantly locally excited (LE) state. Preliminary temperature-dependent fluorescence using frozen glass media supports significant solvent reorganization around the AF240 excited state in polar solvents, and may also support a twisted intramolecular charge-transfer (TICT)-state contribution to the stabilization. Finally, time-dependent density functional theory calculations support ICT in AF240 in polar media and also allow prediction of the 2PA cross sections in the 0-0 band, which are much larger for AF240 than the symmetrical dyes. PMID:24972335

  12. Particular behavior of the adenine and guanine ring-breathing modes upon the DNA conformational transitions.

    PubMed

    Ghomi, M; Letellier, R; Taillandier, E

    1988-06-01

    Harmonic dynamics calculations performed on the deoxyguanosine (dG) and deoxyadenosine (dA) residues, based on a reliable force field, show that the breathing motions of both guanine and adenine residues are involved in two different vibration modes (750-500 cm-1 spectral region). The calculated results reveal a strong coupling of these modes with the sugar pucker motions. This effect has been verified for the dG residue by the Raman spectra of polyd(G-C). As far as the dA residue is concerned, the particular behavior of the adenine residue breathing mode predicted by these calculations, has been confirmed by Raman spectra of polyd(A-T) undergoing a B----Z conformational transition. PMID:3139101

  13. Diepoxide-triggered conformational transition of silk fibroin: formation of hydrogels.

    PubMed

    Karakutuk, Ilknur; Ak, Fatih; Okay, Oguz

    2012-04-01

    Silk fibroin hydrogels with tunable properties could be obtained from aqueous fibroin solutions (4.2 w/v %) in a short period of time. This was achieved by the addition of ethylene glycol diglycidyl ether (EGDE) into the reaction solution. Introduction of EGDE cross-links between the fibroin molecules decreases the mobility of the chains, which triggers the conformational transition from random-coil to ?-sheet structure and hence fibroin gelation. Dynamic rheological measurements conducted at 50 °C show the formation of strong to weak hydrogels depending on the pH of the reaction solution. Although EGDE attacks the amino groups of fibroin and forms interstrand cross-links, ?-sheets acting as physical cross-links dominate the elasticity of the hydrogels. Mechanical response of low-modulus fibroin hydrogels formed above pH 9.7 is highly nonlinear with strong strain hardening behavior (700%) arising from the alignment of the crystallizable amino acid segments. PMID:22360530

  14. Conformational transition of membrane-associated terminally-acylated HIV-1 Nef

    PubMed Central

    Akgun, Bulent; Satija, Sushil; Nanda, Hirsh; Pirrone, Gregory F.; Shi, Xiaomeng; Engen, John R.; Kent, Michael S.

    2013-01-01

    Many proteins are post-translationally modified by acylation targetting them to lipid membranes. While methods such as X-ray crystallography and NMR are available to determine the structure of folded proteins in solution, the precise position of folded domains relative to a membrane remains largely unknown. We used neutron and X-ray reflection methods to measure the displacement of the core domain of HIV Nef from lipid membranes upon insertion of the N-terminal myristate group. Nef is one of several HIV-1 accessory proteins and an essential factor in AIDS progression. Upon insertion of the myristate and residues from the N-terminal arm, Nef transitions from a closed to open conformation that positions the core domain 70 Å from the lipid headgroups. This work rules out speculation that the Nef core remains closely associated with the membrane to optimize interactions with the cytoplasmic domain of MHC-1. PMID:24035710

  15. Detection of an en masse and reversible B- to A-DNA conformational transition in prokaryotes in response to desiccation

    PubMed Central

    Whelan, Donna R.; Hiscox, Thomas J.; Rood, Julian I.; Bambery, Keith R.; McNaughton, Don; Wood, Bayden R.

    2014-01-01

    The role that DNA conformation plays in the biochemistry of cells has been the subject of intensive research since DNA polymorphism was discovered. B-DNA has long been considered the native form of DNA in cells although alternative conformations of DNA are thought to occur transiently and along short tracts. Here, we report the first direct observation of a fully reversible en masse conformational transition between B- and A-DNA within live bacterial cells using Fourier transform infrared (FTIR) spectroscopy. This biospectroscopic technique allows for non-invasive and reagent-free examination of the holistic biochemistry of samples. For this reason, we have been able to observe the previously unknown conformational transition in all four species of bacteria investigated. Detection of this transition is evidence of a previously unexplored biological significance for A-DNA and highlights the need for new research into the role that A-DNA plays as a cellular defence mechanism and in stabilizing the DNA conformation. Such studies are pivotal in understanding the role of A-DNA in the evolutionary pathway of nucleic acids. Furthermore, this discovery demonstrates the exquisite capabilities of FTIR spectroscopy and opens the door for further investigations of cell biochemistry with this under-used technique. PMID:24898023

  16. Conformational transition pathway and free energy analyses of proteins by parallel cascade selection molecular dynamics (PaCS-MD)

    NASA Astrophysics Data System (ADS)

    Harada, Ryuhei; Nishihara, Yasutaka; Wakai, Nobuhiko; Kitao, Akio

    2014-10-01

    Parallel Cascade Selection Molecular Dynamics (PaCS-MD) was recently proposed to generate conformational transition pathways of proteins under the condition that a certain target quantity to be reached is introduced (R. Harada and A. Kitao, J. Chem. Phys., 139, 035103 2013). In PaCS-MD, the cycle of short multiple independent molecular dynamics simulations and selection of the structures close to the target quantity for the next cycle are repeated until the simulated structures move sufficiently close to the target. Conformational sampling efficiency is demonstrated in the cases of mini-protein folding/unfolding and protein large conformational transitions. The result of PaCS-MD was further utilized to calculate free energy landscape by the combination with weighted-histogram analysis method or Markov state model.

  17. Gating Mechanisms of Mechanosensitive Channels of Large Conductance, II: Systematic Study of Conformational Transitions

    PubMed Central

    Tang, Yuye; Yoo, Jejoong; Yethiraj, Arun; Cui, Qiang; Chen, Xi

    2008-01-01

    Part II of this study is based on the continuum mechanics-based molecular dynamics-decorated finite element method (MDeFEM) framework established in Part I. In Part II, the gating pathways of Escherichia coli-MscL channels under various basic deformation modes are simulated. Upon equibiaxial tension (which is verified to be the most effective mode for gating), the MDeFEM results agree well with both experiments and all-atom simulations in literature, as well as the analytical continuum models and elastic network models developed in Part I. Different levels of model sophistication and effects of structural motifs are explored in detail, where the importance of mechanical roles of transmembrane helices, cytoplasmic helices, and loops are discussed. The conformation transitions under complex membrane deformations are predicted, including bending, torsion, cooperativity, patch clamp, and indentation. Compared to atom-based molecular dynamics simulations and elastic network models, the MDeFEM framework is unusually well-suited for simulating complex deformations at large length scales. The versatile hierarchical framework can be further applied to simulate the gating transition of other mechanosensitive channels and other biological processes where mechanical perturbation is important. PMID:18390625

  18. Computation of conformational transitions in proteins by virtual atom molecular mechanics as validated in application to adenylate kinase.

    PubMed

    Korkut, Anil; Hendrickson, Wayne A

    2009-09-15

    Many proteins function through conformational transitions between structurally disparate states, and there is a need to explore transition pathways between experimentally accessible states by computation. The sizes of systems of interest and the scale of conformational changes are often beyond the scope of full atomic models, but appropriate coarse-grained approaches can capture significant features. We have designed a comprehensive knowledge-based potential function based on a C alpha representation for proteins that we call the virtual atom molecular mechanics (VAMM) force field. Here, we describe an algorithm for using the VAMM potential to describe conformational transitions, and we validate this algorithm in application to a transition between open and closed states of adenylate kinase (ADK). The VAMM algorithm computes normal modes for each state and iteratively moves each structure toward the other through a series of intermediates. The move from each side at each step is taken along that normal mode showing greatest engagement with the other state. The process continues to convergence of terminal intermediates to within a defined limit--here, a root-mean-square deviation of 1 A. Validations show that the VAMM algorithm is highly effective, and the transition pathways examined for ADK are compatible with other structural and biophysical information. We expect that the VAMM algorithm can address many biological systems. PMID:19706894

  19. Picosecond laser studies of the solvent-dependent nonradiative pathways in near-IR fluorescent dyes: implications on their use in ultrasensitive analysis

    Microsoft Academic Search

    Steven A. Soper; Quincy L. Mattingly; Benjamin L. Legendre

    1994-01-01

    Photophysical investigations using steady-state and picosecond, time-resolved fluorescence techniques on several NIR polymethine dyes were performed in order to elucidate solvent- dependent nonradiative pathways.

  20. Probing Structural Determinants of ATP-Binding Cassette Exporter Conformational Transition Using Coarse-Grained Molecular Dynamics.

    PubMed

    Wang, Zi; Liao, Jie-Lou

    2015-01-29

    ATP-binding cassette (ABC) exporters pump various substrates across the cell membrane by alternating between inward-facing (IF) and outward-facing (OF) conformations of the transmembrane domains (TMDs). However, the structural determinants of the conformational transition and their functional roles are not fully understood. In this study, we carried out coarse-grained molecular dynamics (CG-MD) simulations with umbrella sampling for the multidrug transporter P-glycoprotein from Caenorhabditis elegans in the presence of the membrane and explicit water molecules. The potential of mean force (PMF) is obtained to identify a reliable pathway where the predicted OF and IF structures are in good agreement with available experiments. The CG-MD simulations reveal that the different transmembrane (TM) helices play distinct but highly cooperative roles in the large-scale conformational changes. Most notably, the CG-MD trajectories show that the periplasmic gate is closed before the cytoplasmic gate is opened during the OF to IF conformational transition in response to the dissociation of the nucleotide-binding domains (NBDs), capturing the unidirectional feature of substrate translocation through the exporter. The structural and dynamical analyses identify the structural determinants and their functional roles in the structural transition. The present work sheds light on how the mechanical force generated upon the NBD dissociation is transferred to the periplasmic end at a distance over 70 Å to close the gate, and subsequently to open the cytoplasmic gate. These results extend our understanding of the ABC transport mechanism. PMID:25549041

  1. Solvent-dependent properties of poly(vinylidene fluoride) monolayers at the air-water interface.

    PubMed

    Zhu, Huie; Matsui, Jun; Yamamoto, Shunsuke; Miyashita, Tokuji; Mitsuishi, Masaya

    2015-02-25

    The present work addresses the solvent-dependent properties of Langmuir films of poly(vinylidene fluoride) (PVDF) and amphiphilic poly(N-dodecylacrylamide) (pDDA) at different mixing ratios. After introducing pDDA nanosheets, PVDF Langmuir films obtain a tremendously enhanced modulus as well as high transfer ratios using the vertical dipping method caused by the support of the pDDA two-dimensional hydrogen bonding network. Brewster angle microscopy (BAM) was used to investigate PVDF monolayers at the air-water interface in situ. Spreading from different solvents, the PVDF molecules take completely different aggregation states at the air-water interface. The PVDF molecules aggregate to become large domains when spread from N-methyl-2-pyrrolidone (NMP). However, the volatile and low-polarity methylethyl ketone (MEK) made the PVDF molecules more dispersive on the water surface. This study also discovers a versatile crystallization control of PVDF homopolymer from complete ? phase (NMP) to complete ? phase (MEK) at the air-water interface, thereby eliciting useful information for further manipulation of film morphologies and film applications. PMID:25622932

  2. Remarkable solvent-dependent excited-state chirality: a molecular modulator of circularly polarized luminescence.

    PubMed

    van Delden, Richard A; Huck, Nina P M; Piet, Jacob J; Warman, John M; Meskers, Stefan C J; Dekkers, Harry P J M; Feringa, Ben L

    2003-12-17

    The photochemical control of ground- and excited-state chirality of (M)-cis-(1) and (P)-trans-(2)-2-nitro-7-(dimethylamino)-9-(2',3'-dihydro-1'H-naphtho[2,1-b]-thiopyran-1'-ylidene)-9H-thioxanthene is described. It is shown that while ground state chirality can be controlled photochemically by irradiation with light of different wavelengths, the excited state chirality can be tuned either photochemically in a similar way or by appropriate choice of solvent. In benzene solution, circularly polarized luminescence of the two isomers with opposite ground-state helicity, (M)-cis-1 and (P)-trans-2, revealed corresponding excited states of opposite helicity. On the contrary, in n-hexane solution, circularly polarized luminescence was identical for the two forms indicating identical excited state chirality. Circularly polarized luminescence (CPL), steady-state and time-dependent fluorescence, and time-resolved microwave conductivity (TRMC) measurements in both n-hexane and benzene are reported, which provide an explanation for the remarkable solvent dependence of excited-state chirality. PMID:14664615

  3. Hierarchical analysis of conformational dynamics in biomolecules: Transition networks of meta-stable states

    SciTech Connect

    Noe, F [University of Heidelberg; Horenko, Illia [Freie Universitat Berlin; Schuette, C. [University of Heidelberg; Smith, Jeremy C [ORNL

    2007-04-01

    Molecular dynamics simulation generates large quantities of data that must be interpreted using physically meaningful analysis. A common approach is to describe the system dynamics in terms of transitions between coarse partitions of conformational space. In contrast to previous work that partitions the space according to geometric proximity, the authors examine here clustering based on kinetics, merging configurational microstates together so as to identify long-lived, i.e., dynamically metastable, states. As test systems microsecond molecular dynamics simulations of the polyalanines Ala{sub 8} and Ala{sub 12} are analyzed. Both systems clearly exhibit metastability, with some kinetically distinct metastable states being geometrically very similar. Using the backbone torsion rotamer pattern to define the microstates, a definition is obtained of metastable states whose lifetimes considerably exceed the memory associated with interstate dynamics, thus allowing the kinetics to be described by a Markov model. This model is shown to be valid by comparison of its predictions with the kinetics obtained directly from the molecular dynamics simulations. In contrast, clustering based on the hydrogen-bonding pattern fails to identify long-lived metastable states or a reliable Markov model. Finally, an approach is proposed to generate a hierarchical model of networks, each having a different number of metastable states. The model hierarchy yields a qualitative understanding of the multiple time and length scales in the dynamics of biomolecules.

  4. Hierarchical analysis of conformational dynamics in biomolecules: Transition networks of metastable states

    SciTech Connect

    Noe, F [University of Heidelberg; Horenko, Illia [Freie Universitat Berlin; Schuette, C. [University of Heidelberg; Smith, Jeremy C [ORNL

    2007-04-01

    Molecular dynamics simulation generates large quantities of data that must be interpreted using physically meaningful analysis. A common approach is to describe the system dynamics in terms of transitions between coarse partitions of conformational space. In contrast to previous work that partitions the space according to geometric proximity, the authors examine here clustering based on kinetics, merging configurational microstates together so as to identify long-lived, i.e., dynamically metastable, states. As test systems microsecond molecular dynamics simulations of the polyalanines Ala{sub 8} and Ala{sub 12} are analyzed. Both systems clearly exhibit metastability, with some kinetically distinct metastable states being geometrically very similar. Using the backbone torsion rotamer pattern to define the microstates, a definition is obtained of metastable states whose lifetimes considerably exceed the memory associated with interstate dynamics, thus allowing the kinetics to be described by a Markov model. This model is shown to be valid by comparison of its predictions with the kinetics obtained directly from the molecular dynamics simulations. In contrast, clustering based on the hydrogen-bonding pattern fails to identify long-lived metastable states or a reliable Markov model. Finally, an approach is proposed to generate a hierarchical model of networks, each having a different number of metastable states. The model hierarchy yields a qualitative understanding of the multiple time and length scales in the dynamics of biomolecules.

  5. An analysis of stable forms of CL-20: A DFT study of conformational transitions, infrared and Raman spectra

    NASA Astrophysics Data System (ADS)

    Kholod, Yana; Okovytyy, Sergiy; Kuramshina, Gulnara; Qasim, Mohammad; Gorb, Leonid; Leszczynski, Jerzy

    2007-10-01

    The most stable forms of 2,4,6,8,10,12-hexanitro-2,4,6,8,10,12-hexaazaisowurtzitane (CL-20) were analyzed at the B3LYP/6-31G+(d,p) level of theory. The mechanism of conformational transformations was clarified. The activation energies of those transitions were found to be quite low and lie in the range 1.2-4.0 kcal mol -1. IR and Raman spectra of the studied CL-20 forms were simulated. The predicted vibrational modes were used for comparison with the experimental values. The unique peaks for each of the conformers in IR and Raman spectra were found. These peaks can be used as the "signatures" of the studied conformers and for identification of different polymorphs of CL-20 in mixtures.

  6. Increasing the sampling efficiency of protein conformational transition using velocity-scaling optimized hybrid explicit/implicit solvent REMD simulation

    NASA Astrophysics Data System (ADS)

    Yu, Yuqi; Wang, Jinan; Shao, Qiang; Shi, Jiye; Zhu, Weiliang

    2015-03-01

    The application of temperature replica exchange molecular dynamics (REMD) simulation on protein motion is limited by its huge requirement of computational resource, particularly when explicit solvent model is implemented. In the previous study, we developed a velocity-scaling optimized hybrid explicit/implicit solvent REMD method with the hope to reduce the temperature (replica) number on the premise of maintaining high sampling efficiency. In this study, we utilized this method to characterize and energetically identify the conformational transition pathway of a protein model, the N-terminal domain of calmodulin. In comparison to the standard explicit solvent REMD simulation, the hybrid REMD is much less computationally expensive but, meanwhile, gives accurate evaluation of the structural and thermodynamic properties of the conformational transition which are in well agreement with the standard REMD simulation. Therefore, the hybrid REMD could highly increase the computational efficiency and thus expand the application of REMD simulation to larger-size protein systems.

  7. All-or-none switching of transcriptional activity on single DNA molecules caused by a discrete conformational transition

    NASA Astrophysics Data System (ADS)

    Yamada, Ayako; Kubo, Koji; Nakai, Tonau; Yoshikawa, Kenichi; Tsumoto, Kanta

    2005-05-01

    Recently, it has been confirmed that long duplex DNA molecules with a size larger than several tens of kilo-base pairs (kbp), exhibit a discrete conformational transition from an unfolded coil state to a folded compact state upon the addition of various kinds of chemical species that usually induce DNA condensation. In this study, we performed a single-molecule observation on a large DNA, Lambda ZAP II DNA (˜41kbp), in a solution containing RNA polymerase and substrates along with spermine, a tetravalent cation, at different concentrations, by use of fluorescence staining of both DNA and RNA. We found that transcription, or RNA production, is completely inhibited in the compact globule state, but is actively performed in the unfolded coil state. Such an all-or-none effect on transcriptional activity induced by the discrete conformational transition of single DNA molecules is discussed in relation to the mechanism of the regulation of large-scale genetic activity.

  8. ?-Fluorophosphonates reveal how a phosphomutase conserves transition state conformation over hexose recognition in its two-step reaction

    PubMed Central

    Jin, Yi; Bhattasali, Debabrata; Pellegrini, Erika; Forget, Stephanie M.; Baxter, Nicola J.; Cliff, Matthew J.; Bowler, Matthew W.; Jakeman, David L.; Blackburn, G. Michael; Waltho, Jonathan P.

    2014-01-01

    ?-Phosphoglucomutase (?PGM) catalyzes isomerization of ?-d-glucose 1-phosphate (?G1P) into d-glucose 6-phosphate (G6P) via sequential phosphoryl transfer steps using a ?-d-glucose 1,6-bisphosphate (?G16BP) intermediate. Synthetic fluoromethylenephosphonate and methylenephosphonate analogs of ?G1P deliver novel step 1 transition state analog (TSA) complexes for ?PGM, incorporating trifluoromagnesate and tetrafluoroaluminate surrogates of the phosphoryl group. Within an invariant protein conformation, the ?-d-glucopyranose ring in the ?G1P TSA complexes (step 1) is flipped over and shifted relative to the G6P TSA complexes (step 2). Its equatorial hydroxyl groups are hydrogen-bonded directly to the enzyme rather than indirectly via water molecules as in step 2. The (C)O–P bond orientation for binding the phosphate in the inert phosphate site differs by ?30° between steps 1 and 2. By contrast, the orientations for the axial O–Mg–O alignment for the TSA of the phosphoryl group in the catalytic site differ by only ?5°, and the atoms representing the five phosphorus-bonded oxygens in the two transition states (TSs) are virtually superimposable. The conformation of ?G16BP in step 1 does not fit into the same invariant active site for step 2 by simple positional interchange of the phosphates: the TS alignment is achieved by conformational change of the hexose rather than the protein. PMID:25104750

  9. ?-Fluorophosphonates reveal how a phosphomutase conserves transition state conformation over hexose recognition in its two-step reaction.

    PubMed

    Jin, Yi; Bhattasali, Debabrata; Pellegrini, Erika; Forget, Stephanie M; Baxter, Nicola J; Cliff, Matthew J; Bowler, Matthew W; Jakeman, David L; Blackburn, G Michael; Waltho, Jonathan P

    2014-08-26

    ?-Phosphoglucomutase (?PGM) catalyzes isomerization of ?-D-glucose 1-phosphate (?G1P) into D-glucose 6-phosphate (G6P) via sequential phosphoryl transfer steps using a ?-D-glucose 1,6-bisphosphate (?G16BP) intermediate. Synthetic fluoromethylenephosphonate and methylenephosphonate analogs of ?G1P deliver novel step 1 transition state analog (TSA) complexes for ?PGM, incorporating trifluoromagnesate and tetrafluoroaluminate surrogates of the phosphoryl group. Within an invariant protein conformation, the ?-D-glucopyranose ring in the ?G1P TSA complexes (step 1) is flipped over and shifted relative to the G6P TSA complexes (step 2). Its equatorial hydroxyl groups are hydrogen-bonded directly to the enzyme rather than indirectly via water molecules as in step 2. The (C)O-P bond orientation for binding the phosphate in the inert phosphate site differs by ? 30° between steps 1 and 2. By contrast, the orientations for the axial O-Mg-O alignment for the TSA of the phosphoryl group in the catalytic site differ by only ? 5°, and the atoms representing the five phosphorus-bonded oxygens in the two transition states (TSs) are virtually superimposable. The conformation of ?G16BP in step 1 does not fit into the same invariant active site for step 2 by simple positional interchange of the phosphates: the TS alignment is achieved by conformational change of the hexose rather than the protein. PMID:25104750

  10. Instantaneous Normal Modes as an Unforced Reaction Coordinate for Protein Conformational Transitions

    E-print Network

    Zhang, Liqing

    for functional conformational motions. For example, a recent study on adenylate kinase (AdK) shows landscape (5). A comparison between a thermophilic and mesophilic AdK suggests that fast timescale local

  11. Exploring transition pathway and free-energy profile of large-scale protein conformational change by combining normal mode analysis and umbrella sampling molecular dynamics.

    PubMed

    Wang, Jinan; Shao, Qiang; Xu, Zhijian; Liu, Yingtao; Yang, Zhuo; Cossins, Benjamin P; Jiang, Hualiang; Chen, Kaixian; Shi, Jiye; Zhu, Weiliang

    2014-01-01

    Large-scale conformational changes of proteins are usually associated with the binding of ligands. Because the conformational changes are often related to the biological functions of proteins, understanding the molecular mechanisms of these motions and the effects of ligand binding becomes very necessary. In the present study, we use the combination of normal-mode analysis and umbrella sampling molecular dynamics simulation to delineate the atomically detailed conformational transition pathways and the associated free-energy landscapes for three well-known protein systems, viz., adenylate kinase (AdK), calmodulin (CaM), and p38? kinase in the absence and presence of respective ligands. For each protein under study, the transient conformations along the conformational transition pathway and thermodynamic observables are in agreement with experimentally and computationally determined ones. The calculated free-energy profiles reveal that AdK and CaM are intrinsically flexible in structures without obvious energy barrier, and their ligand binding shifts the equilibrium from the ligand-free to ligand-bound conformation (population shift mechanism). In contrast, the ligand binding to p38? leads to a large change in free-energy barrier (??G ? 7 kcal/mol), promoting the transition from DFG-in to DFG-out conformation (induced fit mechanism). Moreover, the effect of the protonation of D168 on the conformational change of p38? is also studied, which reduces the free-energy difference between the two functional states of p38? and thus further facilitates the conformational interconversion. Therefore, the present study suggests that the detailed mechanism of ligand binding and the associated conformational transition is not uniform for all kinds of proteins but correlated to their respective biological functions. PMID:24350625

  12. Conformational Transition Pathway of Polymerase /DNA upon Binding Correct Incoming Karunesh Arora and Tamar Schlick*

    E-print Network

    Schlick, Tamar

    with microscopic, coupled quantum mechanical/molecular mechanical (QM/MM) methods6 (e.g., EVB7,8), or "steered fidelity. These changes involve key residues that differentiate the open from the closed conformation (Asp insights into structure and function of biomolecular systems,3-5 routine applications of standard dynamics

  13. Resolution of the electronic transitions of cytochrome c oxidase: evidence for two conformational states of ferrous cytochrome alpha.

    PubMed Central

    Sherman, D; Kotake, S; Ishibe, N; Copeland, R A

    1991-01-01

    Second-derivative absorption spectra are reported for a variety of oxidation and ligation states of bovine cytochrome c oxidase (ferrocytochrome-c:oxygen oxidoreductase, EC 1.9.3.1). The high resolving power of the second-derivative method allows us to assign the individual electronic transitions of cytochrome alpha and cytochrome alpha 3 in many of these states. In the fully reduced enzyme, one observes a single electronic transition at 444 nm, corresponding to the Soret transition for both ferrous cytochrome alpha and ferrous cytochrome alpha 3. When the cytochrome alpha 3 site is occupied by an exogenous ligand (CN or CO), one observes two absorption bands assignable to the ferrous cytochrome alpha chromophore, one at ca, 443 nm and the other at ca, 450 nm. The appearance of the 450-nm band is dependent only on ligand occupancy at the cytochrome alpha 3 site and not on the oxidation state of the cytochrome alpha 3 iron. These results can be interpreted either in terms of a heterogeneous mixture of two ferrous cytochrome alpha conformers in the cytochrome alpha 3-ligated enzyme or in terms of a reduction in the effective molecular symmetry of the ferrous cytochrome alpha site that results in a lifting of the degeneracy of the lowest unoccupied molecular orbital associated with the Soret pi,pi* transition of cytochrome alpha. In either case, the present data indicate that ferrous cytochrome alpha can adopt two distinct conformations. One possible structural difference between these two states could be related to differences in the strength of hydrogen bonding between the ferrous cytochrome alpha formyl oxygen and a proton donor from an unidentified amino acid side chain of the enzyme. The implications of such modulation of hydrogen-bond strength are discussed in terms of possible mechanisms of proton translocation and electron transfer in the enzyme. PMID:1852001

  14. Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition.

    PubMed

    Brath, Ulrika; Akke, Mikael

    2009-03-20

    FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. The macrolide FK506 is a transition-state analog of the catalyzed reaction and displaces FKBP12 from its natural target proteins. We compared the conformational exchange dynamics of the backbone and methyl-bearing side chains of FKBP12 in the free and FK506-bound states using NMR relaxation-dispersion experiments. Our results show that the free enzyme exchanges between the ground state and an excited state that resembles the ligand-bound state or Michaelis complex. In FK506-bound FKBP12, the backbone is confined to a single conformation, while conformational exchange prevails for many methyl groups. The residual side-chain dynamics in the transition-state analog-bound state suggests that the transition-state ensemble involves multiple conformations, a finding that challenges the long-standing concept of conformational restriction in the transition-state complex. Furthermore, exchange between alternative conformations is observed in the bound state for an extended network of methyl groups that includes locations remote from the active site. Several of these locations are known to be important for interactions with cellular target proteins, including calcineurin and the ryanodine receptor, suggesting that the conformational heterogeneity might play a role in the promiscuous binding of FKBP12 to different targets. PMID:19361439

  15. Conformational Transitions and Stop-and-Go Nanopore Transport of Single Stranded DNA on Charged Graphene

    PubMed Central

    Shankla, Manish; Aksimentiev, Aleksei

    2014-01-01

    Control over interactions with biomolecules holds the key to applications of graphene in biotechnology. One such application is nanopore sequencing, where a DNA molecule is electrophoretically driven through a graphene nanopore. Here, we investigate how interactions of single-stranded DNA and a graphene membrane can be controlled by electrically biasing the membrane. The results of our molecular dynamics simulations suggest that electric charge on graphene can force a DNA homopolymer to adopt a range of strikingly different conformations. The conformational response is sensitive to even very subtle nucleotide modifications, such as DNA methylation. The speed of DNA motion through a graphene nanopore is strongly affected by the graphene charge: a positive charge accelerates the motion whereas a negative charge arrests it. As a possible application of the effect, we demonstrate stop-and-go transport of DNA controlled by the charge of graphene. Such on-demand transport of DNA is essential for realizing nanopore sequencing. PMID:25296960

  16. Modulation of Calmodulin Lobes by Different Targets: An Allosteric Model with Hemiconcerted Conformational Transitions

    PubMed Central

    Lai, Massimo; Brun, Denis; Edelstein, Stuart J.; Le Novère, Nicolas

    2015-01-01

    Calmodulin is a calcium-binding protein ubiquitous in eukaryotic cells, involved in numerous calcium-regulated biological phenomena, such as synaptic plasticity, muscle contraction, cell cycle, and circadian rhythms. It exibits a characteristic dumbell shape, with two globular domains (N- and C-terminal lobe) joined by a linker region. Each lobe can take alternative conformations, affected by the binding of calcium and target proteins. Calmodulin displays considerable functional flexibility due to its capability to bind different targets, often in a tissue-specific fashion. In various specific physiological environments (e.g. skeletal muscle, neuron dendritic spines) several targets compete for the same calmodulin pool, regulating its availability and affinity for calcium. In this work, we sought to understand the general principles underlying calmodulin modulation by different target proteins, and to account for simultaneous effects of multiple competing targets, thus enabling a more realistic simulation of calmodulin-dependent pathways. We built a mechanistic allosteric model of calmodulin, based on an hemiconcerted framework: each calmodulin lobe can exist in two conformations in thermodynamic equilibrium, with different affinities for calcium and different affinities for each target. Each lobe was allowed to switch conformation on its own. The model was parameterised and validated against experimental data from the literature. In spite of its simplicity, a two-state allosteric model was able to satisfactorily represent several sets of experiments, in particular the binding of calcium on intact and truncated calmodulin and the effect of different skMLCK peptides on calmodulin’s saturation curve. The model can also be readily extended to include multiple targets. We show that some targets stabilise the low calcium affinity T state while others stabilise the high affinity R state. Most of the effects produced by calmodulin targets can be explained as modulation of a pre-existing dynamic equilibrium between different conformations of calmodulin’s lobes, in agreement with linkage theory and MWC-type models. PMID:25611683

  17. Turn-directed ?-? conformational transition of ?-syn12 peptide at different pH revealed by unbiased molecular dynamics simulations.

    PubMed

    Liu, Lei; Cao, Zanxia

    2013-01-01

    The transition from ?-helical to ?-hairpin conformations of ?-syn12 peptide is characterized here using long timescale, unbiased molecular dynamics (MD) simulations in explicit solvent models at physiological and acidic pH values. Four independent normal MD trajectories, each 2500 ns, are performed at 300 K using the GROMOS 43A1 force field and SPC water model. The most clustered structures at both pH values are ?-hairpin but with different turns and hydrogen bonds. Turn9-6 and four hydrogen bonds (HB9-6, HB6-9, HB11-4 and HB4-11) are formed at physiological pH; turn8-5 and five hydrogen bonds (HB8-5, HB5-8, HB10-3, HB3-10 and HB12-1) are formed at acidic pH. A common folding mechanism is observed: the formation of the turn is always before the formation of the hydrogen bonds, which means the turn is always found to be the major determinant in initiating the transition process. Furthermore, two transition paths are observed at physiological pH. One of the transition paths tends to form the most-clustered turn and improper hydrogen bonds at the beginning, and then form the most-clustered hydrogen bonds. Another transition path tends to form the most-clustered turn, and turn5-2 firstly, followed by the formation of part hydrogen bonds, then turn5-2 is extended and more hydrogen bonds are formed. The transition path at acidic pH is as the same as the first path described at physiological pH. PMID:23708094

  18. Direct visualization of flow-induced conformational transitions of single actin filaments in entangled solutions

    E-print Network

    Inka Kirchenbuechler; Donald Guu; Nicholas A. Kurniawan; Gijsje H. Koenderink; M. Paul Lettinga

    2015-01-09

    While semi-flexible polymers and fibers are an important class of material due to their rich mechanical properties, it remains unclear how these properties relate to the microscopic conformation of the polymers. Actin filaments constitute an ideal model polymer system due to their micron-sized length and relatively high stiffness that allow imaging at the single filament level. Here we study the effect of entanglements on the conformational dynamics of actin filaments in shear flow. We directly measure the full three-dimensional conformation of single actin filaments, using confocal microscopy in combination with a counter-rotating cone-plate shear cell. We show that initially entangled filaments form disentangled orientationally ordered hairpins, confined in the flow-vorticity plane. In addition, shear flow causes stretching and shear alignment of the hairpin tails, while the filament length distribution remains unchanged. These observations explain the strain-softening and shear-thinning behavior of entangled F-actin solutions, which aids the understanding of the flow behavior of complex fluids containing semi-flexible polymers.

  19. The purple to blue transition of bacteriorhodopsin is accompanied by a loss of the hexagonal lattice and a conformational change

    SciTech Connect

    Heyn, M.P.; Dudda, C.; Otto, H.; Seiff, F.; Wallat, I. (Freie Universitaet Berlin (Germany, F.R.))

    1989-11-14

    X-ray diffraction measurements show that in contrast to the purple membrane, the bacteriorhodopsin molecules are not organized in a hexagonal lattice in the deionized blue membrane. Addition of Ca{sup 2+} restores both the purple color and the normal (63 {angstrom}) hexagonal protein lattice. In the blue state, the circular dichroism spectrum in the visible has the typical exciton features indicating that a trimeric structure is retained. Time-resolved linear dichrosim measurements show that the blue patch rotates in aqueous suspension with a mean correlation time of 11 ms and provide no evidence for rotational mobility of bacteriorhodopsin within the membrane. The circular dichroism spectra of the blue and the Ca{sup 2+}-regenerated purple state in the far-UV are different, indicating a small change in secondary structure. The thermal stability of the blue membrane is much smaller than that of the purple membrane. At pH 5.0, the irreversible denaturation transition of the blue form has a midpoint at 61{degree}C. The photocycle of the blue membrane ({lambda}{sub ex} 590 nm) has an L intermediate around 540 nm whose decay is slowed down into the millisecond time range (5 ms). Light-dark adaptation in the blue membrane is rapid with an exponential decay time of 38 s at 25{degree}C. The purple to blue transition apparently involves a conformational change in the protein leading to a change in the aggregation state from a highly ordered and stable hexagonal lattice to a disordered array of thermally more labile trimers. The conformational change is of a subtle nature, with only a minor effect on the secondary structure but with a major effect on the opsin shift and the photocycle. It is suggested that the transition involves an equilibrium between two states which is shifted by a change in the surface pH.

  20. Simulations of CRP:(cAMP)2 in noncrystalline environments show a subunit transition from the open to the closed conformation.

    PubMed Central

    García, A. E.; Harman, J. G.

    1996-01-01

    The CRP:cAMP complex functions as a transcription factor that facilitates RNA polymerase recognition of several bacterial promoters. Detailed crystal structure information is available for CRP:(cAMP)2 and for CRP:(cAMP)2 complexed with DNA. In the crystalline environment, CRP:(cAMP)2 subunits are asymmetrically related; one subunit has a closed conformation and the other has an open conformation. The CRP:(cAMP)2 complexed with DNA shows both subunits in a closed conformation. We have studied the molecular dynamics of CRP:(cAMP)2 in noncrystalline environments. CRP:(cAMP)2 was simulated for 625 ps in vacuo and for 140 ps in solution. The crystal structure of CRP:(cAMP)2 in the absence of DNA was used as the initial conformation. Molecule optimal dynamic coordinates (MODCs) (García A, 1992, Phys Rev Lett 68:2696) were used to analyze protein conformations sampled during the course of the simulations. Two MODCs define a transition of the open subunit to a closed subunit conformation during the first 125 ps of simulation in vacuo; the resulting subunit conformation is similar to that observed in CRP:(cAMP)2:DNA crystals. Simulation of CRP:(cAMP)2 in solution showed that a transition from the open to the closed state also occurs when water is explicitly included in the calculations. These calculations suggest that the asymmetric conformation of CRP:(cAMP)2 is stabilized by crystal lattice interactions. The predicted solution conformation is more symmetric, with both subunits in a closed conformation. PMID:8771197

  1. Ionic liquid-induced all-? to ? + ? conformational transition in cytochrome c with improved peroxidase activity in aqueous medium.

    PubMed

    Bharmoria, Pankaj; Trivedi, Tushar J; Pabbathi, Ashok; Samanta, Anunay; Kumar, Arvind

    2015-04-01

    Choline dioctylsulfosuccinate [Cho][AOT] (a surface active ionic liquid) has been found to induce all-? to ? + ? conformational transition in the secondary structure of enzyme cytochrome c (Cyt c) with an enhanced peroxidase activity in its aqueous vesicular phase at pH 7.0. [Cho][AOT] interacted with Cyt c distinctly at three critical concentrations (aggregation C1, saturation C2 and vesicular C3) as detected from isothermal titration calorimetric analysis. Oxidation of heme iron was observed from the disappearance of the Q band in the UV-vis spectra of Cyt c upon [Cho][AOT] binding above C3. Circular dichroism analysis (CD) has shown the loss in both the secondary (190-240 nm) and tertiary (250-300 nm) structure of Cyt c in the monomeric regime until C1, followed by their stabilization until the pre-vesicular regime (C1 ? C3). Loss in both the secondary and tertiary structure has been observed in the post-vesicular regime with the change in Cyt c conformation from all-? to ? + ? which is similar to the conformational changes of Cyt c upon binding with mitochondrial membrane (Biochemistry 1998, 37, 6402-6409), thus citing the potential utility of [Cho][AOT] membranes as an artificial analog for in vitro bio-mimicking. Fluorescence correlation spectroscopy (FCS) measurements confirm the unfolding of Cyt c in the vesicular phase. Dynamic light scattering experiments have shown the contraction of [Cho][AOT] vesicles upon Cyt c binding driven by electrostatic interactions observed by charge neutralization from zeta potential measurements. [Cho][AOT] has been found to enhance the peroxidase activity of Cyt c with maximum activity at C3, observed using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt as the substrate in the presence of hydrogen peroxide. This result shows the relevance of tuning ionic liquids to surfactants for bio-mimicking of specific membrane protein-lipid interactions. PMID:25798458

  2. Molecular dynamics simulation of phosphorylation-induced conformational transitions in the mycobacterium tuberculosis response regulator PrrA

    SciTech Connect

    Chen, Guo [Los Alamos National Laboratory; Mcmahon, Benjamin H [Los Alamos National Laboratory; Tung, Chang - Shung [Los Alamos National Laboratory

    2008-01-01

    Phosphorylation-activated modulation of response regulators (RR) is predominantly used by bacteria as a strategy in regulating their two-component signaling (TCS) systems, the underlying molecular mechanisms are however far from fully understood. In this work we have conducted a molecular dynamics (MD) simulation of the phosphorylation-induced conformational transitions of RRs with the Mycobacterium Tuberculosis PrrA as a particular example. Starting from the full-length inactive structure of PrrA we introduced a local disturbance by phosphorylating the conserved aspartic acid residue, Asp-58, in the regulatory domain. A Go-model-type algorithm packaged with AMBER force fields was then applied to simulate the dynamics upon phosphorylation. The MD simulation shows that the phosphorylation of Asp-58 facilitates PrrA, whose inactive state has a compact conformation with a closed interdomain interface, to open up with its interdomain separation being increased by an average of about 1.5 {angstrom} for a simulation of 20 ns. The trans-activation loop, which is completely buried within the interdomain interface in the inactive PrrA, is found to become more exposed with the phosphorylated structure as well. These results provide more structural details of how the phosphorylation of a local aspartate activates PrrA to undergo a global conformational rearrangement toward its extended active state. This work also indicates that MD simulations can serve as a fast tool to unravel the regulation mechanisms of all RRs, which is especially valuable when the structures of full-length active RRs are currently unavailable.

  3. dNTP-dependent Conformational Transitions in the Fingers Subdomain of Klentaq1 DNA Polymerase

    PubMed Central

    Rothwell, Paul J.; Allen, William J.; Sisamakis, Evangelos; Kalinin, Stanislav; Felekyan, Suren; Widengren, Jerker; Waksman, Gabriel; Seidel, Claus A. M.

    2013-01-01

    DNA polymerases are responsible for the accurate replication of DNA. Kinetic, single-molecule, and x-ray studies show that multiple conformational states are important for DNA polymerase fidelity. Using high precision FRET measurements, we show that Klentaq1 (the Klenow fragment of Thermus aquaticus DNA polymerase 1) is in equilibrium between three structurally distinct states. In the absence of nucleotide, the enzyme is mostly open, whereas in the presence of DNA and a correctly base-pairing dNTP, it re-equilibrates to a closed state. In the presence of a dNTP alone, with DNA and an incorrect dNTP, or in elevated MgCl2 concentrations, an intermediate state termed the “nucleotide-binding” state predominates. Photon distribution and hidden Markov modeling revealed fast dynamic and slow conformational processes occurring between all three states in a complex energy landscape suggesting a mechanism in which dNTP delivery is mediated by the nucleotide-binding state. After nucleotide binding, correct dNTPs are transported to the closed state, whereas incorrect dNTPs are delivered to the open state. PMID:23525110

  4. The 32 kDa Enamelin Undergoes Conformational Transitions upon Calcium Binding

    PubMed Central

    Fan, Daming; Lakshminarayanan, Rajamani; Moradian-Oldak, Janet

    2008-01-01

    The 32 kDa hydrophilic and acidic enamelin, the most stable cleavage fragment of the enamel specific glycoprotein, is believed to play vital roles in controlling crystal nucleation or growth during enamel biomineralization. Circular dichroism and Fourier transform infrared spectra demonstrate that the secondary structure of the 32 kDa enamelin has a high content of ?-helix (81.5%). Quantitative analysis on the circular dichroism data revealed that the 32 kDa enamelin undergoes conformational changes with a structural preference to ?-sheet as a function of calcium ions. We suggest that the increase of ?-sheet conformation upon presence of Ca2+ may allow preferable interaction of the 32 kDa enamelin with apatite crystal surfaces during enamel biomineralization. The calcium association constant of the 32 kDa enamelin calculated from the fitting curve of ellipticity at 222 nm is Ka = 1.55 (±0.13) × 103 M?1, indicating a relatively low affinity. Our current biophysical studies on the 32 kDa enamelin structure provide novel insights towards understanding the enamelin-mineral interaction and subsequently the functions of enamelin during enamel formation. PMID:18508280

  5. Solvent-dependent turn-on probe for dual monitoring of Ag(+) and Zn(2+) in living biological samples.

    PubMed

    Yang, Zheng; She, Mengyao; Yin, Bing; Hao, Likai; Obst, Martin; Liu, Ping; Li, Jianli

    2015-04-01

    A novel, solvent-dependent "off-on" probe with benzoylthiourea moiety as the functional receptor and fluorescein as the fluorophore was designed for monitoring of Ag(+) in EtOH-H2O (2:8, v/v) solution and Zn(2+) in CH3CN-H2O (2:8, v/v) solution at physiological range with sufficient selectivity and sensitivity. The Ag(+) promoted desulfurization of thiosemicarbazide functionality in formation of the 1,3,4-oxadiazole and the coordination of Zn(2+) to the O atom and N atom of the spoirolactam moiety and the S atom of the benzoylthiourea moiety were investigated to be the power that promoted the fluorescent enhancement. This probe was tested highly suitable for mapping Ag(+) and Zn(2+) in living human osteosarcoma MG-63 cells and microbial cell-EPS-mineral aggregates, thus, providing a wonderful candidate for tracking Ag(+) and Zn(2+) in biological organisms and processes. PMID:25813234

  6. Thermodynamic Analysis of the Disorder-to-?-Helical Transition of 18.5-kDa Myelin Basic Protein Reveals an Equilibrium Intermediate Representing the Most Compact Conformation.

    PubMed

    Vassall, Kenrick A; Jenkins, Andrew D; Bamm, Vladimir V; Harauz, George

    2015-05-22

    The intrinsically disordered, 18.5-kDa isoform of myelin basic protein (MBP) is a peripheral membrane protein that is essential to proper myelin formation in the central nervous system. MBP acts in oligodendrocytes both to adjoin membrane leaflets to each other in forming myelin and as a hub in numerous protein-protein and protein-membrane interaction networks. Like many intrinsically disordered proteins (IDPs), MBP multifunctionality arises from its high conformational plasticity and its ability to undergo reversible disorder-to-order transitions. One such transition is the disorder-to-?-helical conformational change that is induced upon MBP-membrane binding. Here, we have investigated the disorder-to-?-helical transition of MBP-derived ?-peptides and the full-length 18.5-kDa protein. This transition was induced through titration of the membrane-mimetic solvent trifluoroethanol into both protein and peptide solutions, and conformational change was monitored using circular dichroism spectroscopy, 1-anilinonaphthalene-8-sulfonic acid binding, tryptophan fluorescence quenching, and Förster (fluorescence) resonance energy transfer measurements. The data suggest that the disorder-to-?-helical transition of MBP follows a 3-state model: disordered?intermediate??-helical, with each of the identified equilibrium states likely representing a conformational ensemble. The disordered state is characterized by slight compaction with little regular secondary structure, whereas the intermediate is also disordered but globally more compact. Surprisingly, the ?-helical conformation is less compact than the intermediate. This study suggests that multifunctionality in MBP could arise from differences in the population of energetically distinct ensembles under different conditions and also provides an example of an IDP that undergoes cooperative global conformation change. PMID:25816771

  7. Structures of the xylose-water complex: Energetics, transitions between conformers and spectroscopy

    NASA Astrophysics Data System (ADS)

    Jin, Lin; Simons, John P.; Gerber, R. Benny

    2011-12-01

    Structure optimization, ab initio molecular dynamics (AIMD) simulation of transitions between structures, vibrational self-consistent field (VSCF) calculations of vibrational spectra and infrared ion dip (IRID) experiments have been used to explore the potential energy landscape of isomeric xylose·H2O (and D2O). The VSCF predictions are in close correspondence with the experimental data but the spectra associated with their two low energy isomers are too similar to permit an unequivocal structural assignment. At cryogenic temperatures several low energy isomers could be 'frozen in' but at 300 K the AIMD simulations predict rapid transitions between them and in consequence, a highly fluxional system.

  8. Tariquidar inhibits P-glycoprotein drug efflux but activates ATPase activity by blocking transition to an open conformation.

    PubMed

    Loo, Tip W; Clarke, David M

    2014-12-15

    P-glycoprotein (P-gp, ABCB1) is a drug pump that confers multidrug resistance. Inhibition of P-gp would improve chemotherapy. Tariquidar is a potent P-gp inhibitor but its mechanism is unknown. Here, we tested our prediction that tariquidar inhibits P-gp cycling between the open and closed states during the catalytic cycle. Transition of P-gp to an open state can be monitored in intact cells using reporter cysteines introduced into extracellular loops 1 (A80C) and 4 (R741C). Residues A80C/R741C come close enough (<7?) to spontaneously cross-link in the open conformation (<7?) but are widely separated (>30?) in the closed conformation. Cross-linking of A80C/R741C can be readily detected because it causes the mutant protein to migrate slower on SDS-PAGE gels. We tested whether drug substrates or inhibitors could inhibit cross-linking of the mutant. It was found that only tariquidar blocked A80C/R741C cross-linking. Tariquidar was also a more potent pharmacological chaperone than other P-gp substrates/modulators such as cyclosporine A. Only tariquidar promoted maturation of misprocessed mutant F804D to yield mature P-gp. Tariquidar interacted with the transmembrane domains because it could rescue a misprocessed truncation mutant lacking the nucleotide-binding domains. These results show that tariquidar is a potent pharmacological chaperone and inhibits P-gp drug efflux by blocking transition to the open state during the catalytic cycle. PMID:25456855

  9. Computation of conformational transitions in proteins by virtual atom molecular mechanics as validated

    E-print Network

    Hendrickson, Wayne A.

    open and closed states of adenylate kinase (ADK). The VAMM algorithm computes normal modes for each, and the transition pathways examined for ADK are compatible with other structural and biophysical information. We of proteins to their function. Adenylate kinase (ADK) is prototypic of proteins that undergo large

  10. A Conformational Phase Transition in a Langmuir Film of an Amphiphilic Azacrown David Gidalevitz, Oksana Y. Mindyuk, MacKenzie R. Stetzer, and Paul A. Heiney*

    E-print Network

    Kurnaz, Levent

    A Conformational Phase Transition in a Langmuir Film of an Amphiphilic Azacrown David Gidalevitz to study an amphiphilic azacrown derivative at the air-water interface. The compound studied has a ring with this rearrangement, the film develops long-range in-plane structural order. 1. Introduction Amphiphilic rod

  11. Intrinsic Free Energy of the Conformational Transition of the KcsA Signature Peptide from Conducting to Nonconducting State

    PubMed Central

    Khavrutskii, Ilja V.; Fajer, Mikolai; McCammon, J. Andrew

    2010-01-01

    We explore a conformational transition of the TATTVGYG signature peptide of the KcsA ion selectivity filter and its GYG to AYA mutant from the conducting ?-strand state into the nonconducting pII-like state using a novel technique for multidimensional optimization of transition path ensembles and free energy calculations. We find that the wild type peptide, unlike the mutant, intrinsically favors the conducting state due to G77 backbone propensities and additional hydrophobic interaction between the V76 and Y78 side chains in water. The molecular mechanical free energy profiles in explicit water are in very good agreement with the corresponding adiabatic energies from the Generalized Born Molecular Volume (GBMV) implicit solvent model. However comparisons of the energies to higher level B3LYP/6–31G(d) Density Functional Theory calculations with Polarizable Continuum Model (PCM) suggest that the nonconducting state might be more favorable than predicted by molecular mechanics simulations. By extrapolating the single peptide results to the tetrameric channel, we propose a novel hypothesis for the ion selectivity mechanism. PMID:20357907

  12. pH-dependent conformational transitions in conalbumin (ovotransferrin), a metalloproteinase from hen egg white.

    PubMed

    Rabbani, Gulam; Ahmad, Ejaz; Zaidi, Nida; Khan, Rizwan Hasan

    2011-12-01

    Acid unfolding pathway of conalbumin (CA), a monomeric glycoprotein from hen egg white, has been investigated using far- and near-UV CD spectroscopy, intrinsic fluorescence emission, extrinsic fluorescence probe 1-anilino-8-napthalene sulfonate (ANS) and dynamic light scattering (DLS). We observe pH-dependent changes in secondary and tertiary structure of CA. It has native-like ?-helical secondary structure at pH 4.0 but loss structure at pH 3.0. The CA existed exclusively as a pre-molten globule state and molten globule state in solution at pH 4.0 and pH 3.0, respectively. The effect of pH on the conformation and thermostability of CA points toward its heat resistance at neutral pH. DLS results show that MG state existed as compact form in aqueous solutions with hydrodynamic radii of 4.7 nm. Quenching of tryptophan fluorescence by acrylamide further confirmed the accumulation of an intermediate state, partly unfolded, in-between native and unfolded states. PMID:21833676

  13. Single-Molecule Analysis of Protein Large-Amplitude Conformational Transitions

    NASA Astrophysics Data System (ADS)

    Yang, Haw

    2011-03-01

    Proteins have evolved to harness thermal fluctuations, rather than frustrated by them, to carry out chemical transformations and mechanical work. What are, then, the operation and design principles of protein machines? To frame the problem in a tractable way, several basic questions have been formulated to guide the experimental design: (a) How many conformational states can a protein sample on the functionally important timescale? (b) What are the inter-conversion rates between states? (c) How do ligand binding or interactions with other proteins modulate the motions? (d) What are the structural basis of flexibility and its underlying molecular mechanics? Guided by this framework, we have studied protein tyrosine phosphatase B, PtpB, from M. tuberculosis (a virulence factor of tuberculosis and a potential drug target) and adenylate kinase, AK, from E. coli (a ubiquitous energy-balancing enzyme in cells). These domain movements have been followed in real time on their respective catalytic timescales using high-resolution single-molecule F"orster resonance energy transfer (FRET) spectroscopy. It is shown quantitatively that both PtpB and AK are capable of dynamically sampling two distinct states that correlate well with those observed by x-ray crystallography. Integrating these microscopic dynamics into macroscopic kinetics allows us to place the experimentally measured free-energy landscape in the context of enzymatic turnovers.

  14. Na(+) transport, and the E(1)P-E(2)P conformational transition of the Na(+)/K(+)-ATPase.

    PubMed Central

    Babes, A; Fendler, K

    2000-01-01

    We have used admittance analysis together with the black lipid membrane technique to analyze electrogenic reactions within the Na(+) branch of the reaction cycle of the Na(+)/K(+)-ATPase. ATP release by flash photolysis of caged ATP induced changes in the admittance of the compound membrane system that are associated with partial reactions of the Na(+)/K(+)-ATPase. Frequency spectra and the Na(+) dependence of the capacitive signal are consistent with an electrogenic or electroneutral E(1)P <--> E(2)P conformational transition which is rate limiting for a faster electrogenic Na(+) dissociation reaction. We determine the relaxation rate of the rate-limiting reaction and the equilibrium constants for both reactions at pH 6.2-8.5. The relaxation rate has a maximum value at pH 7.4 (approximately 320 s(-1)), which drops to acidic (approximately 190 s(-1)) and basic (approximately 110 s(-1)) pH. The E(1)P <--> E(2)P equilibrium is approximately at a midpoint position at pH 6.2 (equilibrium constant approximately 0.8) but moves more to the E(1)P side at basic pH 8.5 (equilibrium constant approximately 0.4). The Na(+) affinity at the extracellular binding site decreases from approximately 900 mM at pH 6.2 to approximately 200 mM at pH 8.5. The results suggest that during Na(+) transport the free energy supplied by the hydrolysis of ATP is mainly used for the generation of a low-affinity extracellular Na(+) discharge site. Ionic strength and lyotropic anions both decrease the relaxation rate. However, while ionic strength does not change the position of the conformational equilibrium E(1)P <--> E(2)P, lyotropic anions shift it to E(1)P. PMID:11053130

  15. Conformational Transitions Underlying Pore Opening and Desensitization in Membrane-embedded Gloeobacter violaceus Ligand-gated Ion Channel (GLIC)

    PubMed Central

    Velisetty, Phanindra; Chalamalasetti, Sreevatsa V.; Chakrapani, Sudha

    2012-01-01

    Direct structural insight into the mechanisms underlying activation and desensitization remain unavailable for the pentameric ligand-gated channel family. Here, we report the structural rearrangements underlying gating transitions in membrane-embedded GLIC, a prokaryotic homologue, using site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopy. We particularly probed the conformation of pore-lining second transmembrane segment (M2) under conditions that favor the closed and the ligand-bound desensitized states. The spin label mobility, intersubunit spin-spin proximity, and the solvent-accessibility parameters in the two states clearly delineate the underlying protein motions within M2. Our results show that during activation the extracellular hydrophobic region undergoes major changes involving an outward translational movement, away from the pore axis, leading to an increase in the pore diameter, whereas the lower end of M2 remains relatively immobile. Most notably, during desensitization, the intervening polar residues in the middle of M2 move closer to form a solvent-occluded barrier and thereby reveal the location of a distinct desensitization gate. In comparison with the crystal structure of GLIC, the structural dynamics of the channel in a membrane environment suggest a more loosely packed conformation with water-accessible intrasubunit vestibules penetrating from the extracellular end all the way to the middle of M2 in the closed state. These regions have been implicated to play a major role in alcohol and drug modulation. Overall, these findings represent a key step toward understanding the fundamentals of gating mechanisms in this class of channels. PMID:22977232

  16. Conformational transition of the lid helix covering the protease active site is essential for the ATP-dependent protease activity of FtsH.

    PubMed

    Suno, Ryoji; Shimoyama, Masakazu; Abe, Akiko; Shimamura, Tatsuro; Shimodate, Natsuka; Watanabe, Yo-hei; Akiyama, Yoshinori; Yoshida, Masasuke

    2012-09-21

    When bound to ADP, ATP-dependent protease FtsH subunits adopt either an "open" or "closed" conformation. In the open state, the protease catalytic site is located in a narrow space covered by a lidlike helix. This space disappears in the closed form because the lid helix bends at Gly448. Here, we replaced Gly448 with various residues that stabilize helices. Most mutants retained low ATPase activity and bound to the substrate protein, but lost protease activity. However, a mutant proline substitution lost both activities. Our study shows that the conformational transition of the lid helix is essential for the function of FtsH. PMID:23166924

  17. Solvent annealing induced phase separation and dewetting in PMMA/SAN blend film: Film thickness and solvent dependence

    NASA Astrophysics Data System (ADS)

    You, Jichun; Zhang, Shuangshuang; Huang, Gang; Shi, Tongfei; Li, Yongjin

    2013-06-01

    The competition between "dewetting" and "phase separation" behaviors in polymer blend films attracts significant attention in the last decade. The simultaneous phase separation and dewetting in PMMA/SAN [poly(methyl methacrylate) and poly(styrene-ran-acrylonitrile)] blend ultrathin films upon solvent annealing have been observed for the first time in our previous work. In this work, film thickness and annealing solvent dependence of phase behaviors in this system has been investigated using atomic force microscopy and grazing incidence small-angle X-ray scattering (GISAXS). On one hand, both vertical phase separation and dewetting take place upon selective solvent vapor annealing, leading to the formation of droplet/mimic-film structures with various sizes (depending on original film thickness). On the other hand, the whole blend film dewets the substrate and produces dispersed droplets on the silicon oxide upon common solvent annealing. GISAXS results demonstrate the phase separation in the big dewetted droplets resulted from the thicker film (39.8 nm). In contrast, no period structure is detected in small droplets from the thinner film (5.1 nm and 9.7 nm). This investigation indicates that dewetting and phase separation in PMMA/SAN blend film upon solvent annealing depend crucially on the film thickness and the atmosphere during annealing.

  18. Environmental polarity induces conformational transitions in a helical peptide sequence from bacteriophage T4 lysozyme and its tandem duplicate: a molecular dynamics simulation study.

    PubMed

    Kaur, Harpreet; Sasidhar, Yellamraju U

    2015-04-01

    Our recent molecular dynamics (MD) simulation of an insertion/duplication mutant 'L20' of bacteriophage T4 lysozyme demonstrated a solvent induced ??? transition in a loosely held duplicate helical region, while ?-helical conformation in the parent region was relatively stabilized by its tertiary interactions with the neighboring residues. The solution NMR of the parent helical sequence, sans its protein context, showed no inherent tendency to adopt a particular secondary structure in pure water but showed ?-helical propensity in TFE/water and SDS micelles. In this study we investigate the conformational preference of the 'parent' and 'duplicate' sequences, sans the protein context, in pure water and an apolar TFE/water solution. Apolar TFE/water solution is a model for non-polar protein context. We performed MD simulations of the two peptides, in explicit water and 80 % (v/v) TFE/water, using GROMOS 53a6 force field, at 300 K and 1 bar (under NPT conditions). We show that in TFE/water mixture, salt bridges are stabilized by apolar TFE molecules and main chain-main chain hydrogen bonds promote the ?-helical conformation, particularly in the duplicate peptide. Solvent exposure, in pure water, resulted in an ??? transition to form a triple stranded ?-sheet structure in the 'duplicate' sequence, with a rare psi-loop topology, while a mixture of turn/bend conformations were adopted by the 'parent' sequence. Thus the differences in conformational preference of the parent and duplicate sequence sans protein context, in pure water and TFE/water, implicate the importance of the environment polarity in dictating the peptide conformation. Mechanism of folding of the observed psi-loop in the duplicate sequence gives insights into folding of this rare ?-sheet topology. PMID:25773700

  19. External Ba2+ block of the two-pore domain potassium channel TREK-1 defines conformational transition in its selectivity filter.

    PubMed

    Ma, Xiao-Yun; Yu, Jin-Mei; Zhang, Shu-Zhuo; Liu, Xiao-Yan; Wu, Bao-Hong; Wei, Xiao-Li; Yan, Jia-Qing; Sun, Hong-Liang; Yan, Hai-Tao; Zheng, Jian-Quan

    2011-11-18

    TREK-1 is a member of the two-pore domain potassium channel family that is known as a leak channel and plays a key role in many physiological and pathological processes. The conformational transition of the selectivity filter is considered as an effective strategy for potassium channels to control the course of potassium efflux. It is well known that TREK-1 is regulated by a large volume of extracellular and intracellular signals. However, until now, little was known about the selectivity filter gating mechanism of the channel. In this research, it was found that Ba(2+) blocked the TREK-1 channel in a concentration- and time-dependent manner. A mutagenesis analysis showed that overlapped binding of Ba(2+) at the assumed K(+) binding site 4 (S4) within the selectivity filter was responsible for the inhibitory effects on TREK-1. Then, Ba(2+) was used as a probe to explore the conformational transition in the selectivity filter of the channel. It was confirmed that collapsed conformations were induced by extracellular K(+)-free and acidification at the selectivity filters, leading to nonconductive to permeable ions. Further detailed characterization demonstrated that the two conformations presented different properties. Additionally, the N-terminal truncated isoform (?N41), a product derived from alternative translation initiation, was identified as a constitutively nonconductive variant. Together, these results illustrate the important role of selectivity filter gating in the regulation of TREK-1 by the extracellular K(+) and proton. PMID:21965685

  20. Solvent-dependent excited-state hydrogen transfer and intersystem crossing in 2-(2'-hydroxyphenyl)-benzothiazole.

    PubMed

    Aly, Shawkat M; Usman, Anwar; AlZayer, Maytham; Hamdi, Ghada A; Alarousu, Erkki; Mohammed, Omar F

    2015-02-12

    The excited-state intramolecular hydrogen transfer (ESIHT) of 2-(2'-hydroxyphenyl) benzothiazole (HBT) has been investigated in a series of nonpolar, polar aprotic, and polar protic solvents. A variety of state-of-the-art experimental methods were employed, including femto- and nanosecond transient absorption and fluorescence upconversion spectroscopy with broadband capabilities. We show that the dynamics and mechanism of ESIHT of the singlet excited HBT are strongly solvent-dependent. In nonpolar solvents, the data demonstrate that HBT molecules adopt a closed form stabilized by O-H···N chelated hydrogen bonds with no twisting angle, and the photoinduced H transfer occurs within 120 fs, leading to the formation of a keto tautomer. In polar solvents, owing to dipole-dipole cross talk and hydrogen bonding interactions, the H transfer process is followed by ultrafast nonradiative deactivation channels, including ultrafast internal conversion (IC) and intersystem crossing (ISC). This is likely to be driven by the twisting motion around the C-C bond between the hydroxyphenyl and thiazole moieties, facilitating the IC back to the enol ground state or to the keto triplet state. In addition, our femtosecond time-resolved fluorescence experiments indicate, for the first time, that the lifetime of the enol form in ACN is approximately 280 fs. This observation indicates that the solvent plays a crucial role in breaking the H bond and deactivating the excited state of the HBT. Interestingly, the broadband transient absorption and fluorescence up-conversion data clearly demonstrate that the intermolecular proton transfer from the excited HBT to the DMSO solvent is about 190 fs, forming the HBT anion excited state. PMID:25325788

  1. Retinoic acid biosynthesis catalyzed by retinal dehydrogenases relies on a rate-limiting conformational transition associated with substrate recognition.

    PubMed

    Bchini, Raphaël; Vasiliou, Vasilis; Branlant, Guy; Talfournier, François; Rahuel-Clermont, Sophie

    2013-02-25

    Retinoic acid (RA), a metabolite of vitamin A, exerts pleiotropic effects throughout life in vertebrate organisms. Thus, RA action must be tightly regulated through the coordinated action of biosynthetic and degrading enzymes. The last step of retinoic acid biosynthesis is irreversibly catalyzed by the NAD-dependent retinal dehydrogenases (RALDH), which are members of the aldehyde dehydrogenase (ALDH) superfamily. Low intracellular retinal concentrations imply efficient substrate molecular recognition to ensure high affinity and specificity of RALDHs for retinal. This study addresses the molecular basis of retinal recognition in human ALDH1A1 (or RALDH1) and rat ALDH1A2 (or RALDH2), through the comparison of the catalytic behavior of retinal analogs and use of the fluorescence properties of retinol. We show that, in contrast to long chain unsaturated substrates, the rate-limiting step of retinal oxidation by RALDHs is associated with acylation. Use of the fluorescence resonance energy transfer upon retinol interaction with RALDHs provides evidence that retinal recognition occurs in two steps: binding into the substrate access channel, and a slower structural reorganization with a rate constant of the same magnitude as the kcat for retinal oxidation: 0.18 vs. 0.07 and 0.25 vs. 0.1 s(-1) for ALDH1A1 and ALDH1A2, respectively. This suggests that the conformational transition of the RALDH-retinal complex significantly contributes to the rate-limiting step that controls the kinetics of retinal oxidation, as a prerequisite for the formation of a catalytically competent Michaelis complex. This conclusion is consistent with the general notion that structural flexibility within the active site of ALDH enzymes has been shown to be an integral component of catalysis. PMID:23220587

  2. Retinoic acid biosynthesis catalyzed by retinal dehydrogenases relies on a rate-limiting conformational transition associated with substrate recognition

    PubMed Central

    Bchini, Raphaël; Vasiliou, Vasilis; Branlant, Guy; Talfournier, François; Rahuel-Clermont, Sophie

    2012-01-01

    Retinoic acid (RA), a metabolite of vitamin A, exerts pleiotropic effects throughout life in vertebrate organisms. Thus, RA action must be tightly regulated through the coordinated action of biosynthetic and degradating enzymes. The last step of retinoic acid biosynthesis is irreversibly catalyzed by the NAD-dependent retinal dehydrogenases (RALDH), which are members of the aldehyde dehydrogenase (ALDH) superfamily. Low intracellular retinal concentrations imply efficient substrate molecular recognition to ensure high affinity and specificity of RALDHs for retinal. This study addresses the molecular basis of retinal recognition in human ALDH1A1 (or RALDH1) and rat ALDH1A2 (or RALDH2), through the comparison of the catalytic behavior of retinal analogs and use of the fluorescence properties of retinol. We show that, in contrast to long chain unsaturated substrates, the rate-limiting step of retinal oxidation by RALDHs is associated with acylation. Use of the fluorescence resonance energy transfer upon retinol interaction with RALDHs provides evidence that retinal recognition occurs in two steps: binding into the substrate access channel, and a slower structural reorganization with a rate constant of the same magnitude as the kcat for retinal oxidation: 0.18 vs. 0.07 s?1 and 0.25 vs. 0.1 s?1 for ALDH1A1 and ALDH1A2, respectively. This suggests that the conformational transition of the RALDH-retinal complex significantly contributes to the rate-limiting step that controls the kinetics of retinal oxidation, as a prerequisite for the formation of a catalytically competent Michaelis complex. This conclusion is consistent with the general notion that structural flexibility within the active site of ALDH enzymes has been shown to be an integral component of catalysis. PMID:23220587

  3. Structure Transition in PSS/Lysozyme Complexes: A Chain-Conformation-Driven Process, as Directly Seen by Small Angle Neutron Scattering

    E-print Network

    Jérémie Gummel; Fabrice Cousin; François Boué

    2009-03-30

    Measurements of chain conformation in proteins/polyelectrolytes complexes (lysozyme and PSSNa) show that the crossover observed between an open structure -a chain network crosslinked by the proteins, and a globular one - dense globules of ~ 10 nm aggregated in a fractal way, results from a conformation modification prior to the transition. Before showing this, we have widened the parameters range for the observation of the transition. We had shown before that the two structures can be formed depending on chain length (for a given [PSS]/[lysozyme] ratio): gel for large chains, globules for short chains. We show here that the crossover between these two regimes can also be reached as a function of chains concentration or salinity of the buffer. Since all these crossover parameters act on chains overlapping concentration c*, we reinforce the idea of a transition from the dilute to the semi-dilute regime, but c* is shifted compared to pure PSS solutions. In order to understand this, we have measured by SANS the conformation of a single chain of PSS in presence of proteins within the complexes. This is achieved by a specific labeling trick where we take advantage of the fact that lysozyme and hydrogenated PSS chains have the same neutron scattering length density. In the gel structure, the PSS chains keep a wormlike structure as in pure solutions, but their persistence length is strongly reduced, from 50 {\\AA} without proteins to 20 {\\AA} in average with lysozyme. With this value of 20 {\\AA}, we calculate new overlapping thresholds (concentration, mass, ionic strength) in agreement with observed ones. In a second stage, after the globular structure is formed, the PSS chains get a third conformation, no longer wormlike, but more collapsed, within the globules.

  4. Unusual solvent-dependent photophysical and self-assembly properties of NO2 substituted T-shaped phenazines.

    PubMed

    Lee, Dong-Chan; Brownell, Lacie V; Jang, Kyoungmi; Han, Seung Ju; Robins, Kathleen A

    2015-01-28

    This paper investigates the importance of substituent placement when designing low-molecular mass ?-organogelators. The electron-deficient NO2 substituent was systematically added to novel T-shaped phenazines to examine electronic as well as assembly properties. This T-shaped molecular platform promotes selective electronic tuning, which can be theoretically analyzed by examining the system's frontier molecular orbitals. Electronic properties were characterized by UV-vis spectroscopy and cyclic voltammetry, and comparisons were made based on number and placement of the NO2 group. Computational chemistry (B3LYP/6-31G*) was employed for geometry optimizations, and to generate molecular orbital diagrams for all systems. The most noticeable influence of NO2 position was found for two molecules with four NO2 groups placed at different locations about the molecule (T-34dNT and T-35dNT). A 0.13 eV difference in ELUMO was observed while EHOMO was not significantly impacted by this change only in NO2 placement. Interestingly and unexpectedly, the photophysical properties and solvent-dependent gelation properties were considerably different for T-34dNT and T-35dNT. T-34dNT exhibited a unique fluorescence (FL) solvatochromism, with FL intensity and maxima dependent on solvent polarity. This result is indicative of intramolecular charge transfer. In addition, long tailing at the solid-state absorption of T-34dNT suggests the presence of intermolecular charge transfer. The gelation of T-34dNT produced chromism ranging from red to orange to yellow when the solvents changed from acetonitrile to ethyl acetate to cyclohexane, respectively. T-35dNT gels in these solvents did not exhibit any of the same properties. Xerogel morphology characterizations were carried out using three different solvents for both T-34dNT and T-35dNT. In the case of T-34dNT, striking differences in the morphology were detected by field-emission scanning electron microscopy (FE-SEM). We conclude that numbers of substituents are not the only consideration in effective molecular design for organogelators, but that substituent position plays a critical role in certain fundamental properties of these systems. PMID:25491727

  5. UV resonance Raman investigation of the conformations and lowest energy allowed electronic excited states of tri- and tetraalanine: charge transfer transitions.

    PubMed

    Sharma, Bhavya; Asher, Sanford A

    2010-05-20

    UV resonance Raman excitation profiles and Raman depolarization ratios were measured for trialanine and tetraalanine between 198 and 210 nm. Excitation within the pi --> pi* electronic transitions of the peptide bond results in UVRR spectra dominated by amide peptide bond vibrations. In addition to the resonance enhancement of the normal amide vibrations, we find enhancement of the symmetric terminal COO(-) vibration. The Ala(3) UVRR AmIII(3) band frequencies indicate that poly-proline II and 2.5(1) helix conformations and type II turns are present in solution. We also find that the conformation of the interior peptide bond of Ala(4) is predominantly poly-proline-II-like. The Raman excitation profiles of both Ala(3) and Ala(4) reveal a charge transfer electronic transition at 202 nm, where electron transfer occurs from the terminal nonbonding carboxylate orbital to the adjacent peptide bond pi* orbital. Raman depolarization ratio measurements support this assignment. An additional electronic transition is found in Ala(4) at 206 nm. PMID:20420366

  6. Conformational transitions regulate the exposure of a DNA-binding domain in the RuvBL1–RuvBL2 complex

    PubMed Central

    López-Perrote, Andrés; Muñoz-Hernández, Hugo; Gil, David; Llorca, Oscar

    2012-01-01

    RuvBL1 and RuvBL2, also known as Pontin and Reptin, are AAA+ proteins essential in small nucleolar ribonucloprotein biogenesis, chromatin remodelling, nonsense-mediated messenger RNA decay and telomerase assembly, among other functions. They are homologous to prokaryotic RuvB, forming single- and double-hexameric rings; however, a DNA binding domain II (DII) is inserted within the AAA+ core. Despite their biological significance, questions remain regarding their structure. Here, we report cryo-electron microscopy structures of human double-ring RuvBL1–RuvBL2 complexes at ?15 Å resolution. Significantly, we resolve two coexisting conformations, compact and stretched, by image classification techniques. Movements in DII domains drive these conformational transitions, extending the complex and regulating the exposure of DNA binding regions. DII domains connect with the AAA+ core and bind nucleic acids, suggesting that these conformational changes could impact the regulation of RuvBL1–RuvBL2 containing complexes. These findings resolve some of the controversies in the structure of RuvBL1–RuvBL2 by revealing a mechanism that extends the complex by adjustments in DII. PMID:23002137

  7. A?Z conformational transition in poly(rA?rU) and structure marker bands in UV resonance Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Tomkova, Alena; Chinsky, Laurent; Miskovsky, Pavol; Turpin, Pierre-Yves

    1994-03-01

    Ultraviolet resonance Raman (RR) spectra of poly(rA?rU), poly(dA?dU) and poly(rA)·poly(rU) in aqueous solutions, excited at 257 and 281 nm wavelengths, have been reported in the spectral region between 400 and 1800 cm -1. In comparing the RR data of these various A?U duplexes, conformational marker bands of the right-handed A structure have been determined. In addition, a conformational transition of poly(rA?rU) has been monitored in the presence of a high concentration of NH 4F in aqueous solution. This transition has also been observed by CD spectroscopy (M. Vorlickova, J. Kypr and T.M. Jovin, Biopolymers, 27 (1988) 351) without any clearcut conclusion as to the final structure adopted by the polymer. The present RR data, compared with previous RR results obtained from other alternating purine—pyrimidine duplexes (polyribo- and polydeoxyribonucleotides), show that the final structure of the polyribonucleotide in highly concentrated NH 4F solution is a left-handed Z helix. Moreover, the current study allowed RR structure marker bands of Z form duplexes to be determined in a general manner.

  8. Conformational transition between native and reactive center cleaved forms of. alpha. sub 1 -antitrypsin by Fourier transform infrared spectroscopy and small-angle neutron scattering

    SciTech Connect

    Haris, P.I.; Chapman, D.; Smith K.F.; Perkins, S.J. (Royal Free Hospital School of Medicine, London (England)); Harrison, R.A. (MRC Centre, Cambridge (England))

    1990-02-13

    {alpha}{sub 1}-Antitrypsin ({alpha}{sub 1}-AT) is the best-characterized member of the serpin superfamily of plasma proteins. Protease inhibitor members of this family undergo a characteristic reactive-center cleavage during expression of their inhibitory activity. The physical basis of this transition in {alpha}{sub 1}-AT from the stressed native conformation to the more stable reactive center cleaved (split) form was studied by Fourier transform infrared (FT-IR) spectroscopy and neutron scattering. The FT-IR spectra show that, while split {alpha}{sub 1}-AT has three intense well-resolved components associated with the presence of antiparallel {beta}-sheet and {alpha}-helix conformations, the amide I band of native {alpha}{sub 1}-AT has only one intense component, associated with the presence of {beta}-sheet structure. {sup 1}H-{sup 2}H exchange within the polypeptide backbone, studied by FT-IR and NMR spectroscopy, shows that the native form undergoes greater exchange than the split form. Under the same conditions, neutron scattering shows no differences in the radius of gyration R{sub G} of the native and the split forms. In contrast, in high concentrations of phosphate approaching those used for crystallization, the native form (unlike the split form) undergoes dimerization. These data indicate that the conformational transition largely involves localized secondary and tertiary structure rearrangements. The authors propose that the energetically stressed native {alpha}{sub 1}-AT structure is the consequence of a significantly reduced number of hydrogen bonds in secondary structure components and that reactive-site cleavage between Met358 and Ser359 is the key for the development of the fully hydrogen bonded more stable serpin structure.

  9. Conformational transitions and stop-and-go nanopore transport of single-stranded DNA on charged graphene

    NASA Astrophysics Data System (ADS)

    Shankla, Manish; Aksimentiev, Aleksei

    2014-10-01

    Control over interactions with biomolecules holds the key to applications of graphene in biotechnology. One such application is nanopore sequencing, where a DNA molecule is electrophoretically driven through a graphene nanopore. Here we investigate how interactions of single-stranded DNA and a graphene membrane can be controlled by electrically biasing the membrane. The results of our molecular dynamics simulations suggest that electric charge on graphene can force a DNA homopolymer to adopt a range of strikingly different conformations. The conformational response is sensitive to even very subtle nucleotide modifications, such as DNA methylation. The speed of DNA motion through a graphene nanopore is strongly affected by the graphene charge: a positive charge accelerates the motion, whereas a negative charge arrests it. As a possible application of the effect, we demonstrate stop-and-go transport of DNA controlled by the charge of graphene. Such on-demand transport of DNA is essential for realizing nanopore sequencing.

  10. Conformational dynamic of fibrinogen by dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Berest, Vladimir P.; Gatash, Sergiy V.

    1999-12-01

    The information concerning the structural changes of fibrinogen molecule at temperatures form 4 to 52 degrees C has ben obtained by means of dielectric-spectroscopy method. Besides the known conformational transition II, under physiological conditions conformational transition at 20-22 degrees C has been observed in fibrinogen. This transition might be connected with structural transition in peripheral domain of fibrinogen. Revealed conformational transition, probably, determines the character of the temperature dependence of blood platelet aggregation.

  11. A conformational transition in the structure of a 2'-thiomethyl-modified DNA visualized at high resolution

    SciTech Connect

    Pallan, Pradeep S.; Prakash, Thazha P.; Li, Feng; Eoff, Robert L.; Manoharan, Muthiah; Egli, Martin; (Isis Pharm.); (Alnylam Pharm.); (Vanderbilt)

    2009-06-17

    Crystal structures of A-form and B-form DNA duplexes containing 2'-S-methyl-uridines reveal that the modified residues adopt a RNA-like C3'-endo pucker, illustrating that the replacement of electronegative oxygen at the 2'-carbon of RNA by sulfur does not appear to fundamentally alter the conformational preference of the sugar in the oligonucleotide context and sterics trump stereoelectronics.

  12. Ligand noninnocence of thiolate/disulfide in dinuclear copper complexes: solvent-dependent redox isomerization and proton-coupled electron transfer.

    PubMed

    Thomas, Andrew M; Lin, Bo-Lin; Wasinger, Erik C; Stack, T Daniel P

    2013-12-18

    Copper thiolate/disulfide interconversions are related to the functions of several important proteins such as human Sco1, Cu-Zn superoxide dismutase (SOD1), and mammalian zinc-bonded metallothionein. The synthesis and characterization of well-defined synthetic analogues for such interconversions are challenging yet provide important insights into the mechanisms of such redox processes. Solvent-dependent redox isomerization and proton-coupled electron transfer mimicking these interconversions are observed in two structurally related dimeric ?,?(2):?(2)-thiolato Cu(II)Cu(II) complexes by various methods, including X-ray diffraction, XAS, NMR, and UV-vis. Spectroscopic evidence shows that a solvent-dependent equilibrium exists between the dimeric ?-thiolato Cu(II)Cu(II) state and its redox isomeric ?-disulfido Cu(I)Cu(I) form. Complete formation of ?-disulfido Cu(I)Cu(I) complexes, however, only occurs after the addition of 2 equiv of protons, which promote electron transfer from thiolate to Cu(II) and formation of disulfide and Cu(I) via protonation of the coordinating ligand. Proton removal reverses this reaction. The reported unusual reductive protonation/oxidative deprotonation of the metal centers may serve as a new chemical precedent for how related proteins manage Cu ions in living organisms. PMID:24279864

  13. FTIR/PCA study of propanol in argon matrix: The initial stage of clustering and conformational transitions

    NASA Astrophysics Data System (ADS)

    Doroshenko, Iryna; Balevicius, Vytautas; Pitsevich, George; Aidas, Kestutis; Sablinskas, Valdas; Pogorelov, Valeriy

    2014-12-01

    FTIR spectra of 1-propanol in an argon matrix were studied in the range 11-30 K. Principal component analysis of dynamic FTIR spectra and nonlinear band shape fitting has been carried out. The peaks of monomer, open dimer, mixed propanol-water dimer and those of higher H-bond clusters have been resolved and analyzed. The attribution of certain FTIR peaks has been supported by proper density functional theory calculations. Analyzing dependences of the integral band intensities of various aggregates on temperature it has been deduced that in the initial stage of clustering monomers and dimers are the basic building blocks forming higher H-bond clusters. The peaks assigned to two conformers of monomers and mixed propanol-water dimers were investigated processing the temperature dependences of their integral intensities in Arrhenius plot. The obtained values of 0.18 kJ.mol-1 for propanol monomer and 0.26 kJ.mol-1 for mixed dimer are well comparable with the energy differences between the global minimum conformation of 1-propanol (Gt) and some other energetically higher structures (Tt or Tg).

  14. Structural basis of conformational transitions in the active site and 80's loop in the FK506-binding protein FKBP12.

    PubMed

    Mustafi, Sourajit M; Brecher, Matthew; Zhang, Jing; Li, Hongmin; Lemaster, David M; Hernández, Griselda

    2014-03-15

    The extensive set of NMR doublings exhibited by the immunophilin FKBP12 (FK506-binding protein 12) arose from a slow transition to the cis-peptide configuration at Gly89 near the tip of the 80's loop, the site for numerous protein-recognition interactions for both FKBP12 and other FKBP domain proteins. The 80's loop also exhibited linebroadening, indicative of microsecond to millisecond conformational dynamics, but only in the trans-peptide state. The G89A variant shifted the trans-cis peptide equilibrium from 88:12 to 33:67, whereas a proline residue substitution induced fully the cis-peptide configuration. The 80's loop conformation in the G89P crystal structure at 1.50 Å resolution differed from wild-type FKBP12 primarily at residues 88, 89 and 90, and it closely resembled that reported for FKBP52. Structure-based chemical-shift predictions indicated that the microsecond to millisecond dynamics in the 80's loop probably arose from a concerted main chain (?88 and ?89) torsion angle transition. The indole side chain of Trp59 at the base of the active-site cleft was reoriented ~90o and the adjacent backbone was shifted in the G89P crystal structure. NOE analysis of wild-type FKBP12 demonstrated that this indole populates the perpendicular orientation at 20%. The 15N relaxation analysis was consistent with the indole reorientation occurring in the nanosecond timeframe. Recollection of the G89P crystal data at 1.20 Å resolution revealed a weaker wild-type-like orientation for the indole ring. Differences in the residues that underlie the Trp59 indole ring and altered interactions linking the 50's loop to the active site suggested that reorientation of this ring may be disfavoured in the other six members of the FKBP domain family that bear this active-site tryptophan residue. PMID:24405377

  15. Nonequilibrium Phase Transitions and a Nonequilibrium Critical Point from Anti-de Sitter Space and Conformal Field Theory Correspondence

    E-print Network

    Shin Nakamura

    2012-10-04

    We find novel phase transitions and critical phenomena that occur only outside the linear-response regime of current-driven nonequilibrium states. We consider the strongly-interacting (3+1)-dimensional N=4 large-Nc SU(Nc) supersymmetric Yang-Mills theory with a single flavor of fundamental N=2 hypermultiplet as a microscopic theory. We compute its nonlinear non-ballistic quark-charge conductivity by using the AdS/CFT correspondence. We find that the system exhibits a novel nonequilibrium first-order phase transition where the conductivity jumps and the sign of the differential conductivity flips at finite current density. A nonequilibrium critical point is discovered at the end point of the first-order regime. We propose a nonequilibrium steady-state analogue of thermodynamic potential in terms of the gravity-dual theory in order to define the transition point. Nonequilibrium analogues of critical exponents are proposed as well. The critical behavior of the conductivity is numerically confirmed on the basis of these proposals. The present work provides a new example of nonequilibrium phase transitions and nonequilibrium critical points.

  16. 40 CFR 93.104 - Frequency of conformity determinations.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...2014-07-01 2013-07-01 true Frequency of conformity determinations. 93...the Federal Transit Laws § 93.104 Frequency of conformity determinations. ...applicable implementation plan. (b) Frequency of conformity determinations for...

  17. Binding, Conformational Transition and Dimerization of Amyloid-? Peptide on GM1-Containing Ternary Membrane: Insights from Molecular Dynamics Simulation

    PubMed Central

    Manna, Moutusi; Mukhopadhyay, Chaitali

    2013-01-01

    Interactions of amyloid-? (A?) with neuronal membrane are associated with the progression of Alzheimer’s disease (AD). Ganglioside GM1 has been shown to promote the structural conversion of A? and increase the rate of peptide aggregation; but the exact nature of interaction driving theses processes remains to be explored. In this work, we have carried out atomistic-scale computer simulations (totaling 2.65 µs) to investigate the behavior of A? monomer and dimers in GM1-containing raft-like membrane. The oligosaccharide head-group of GM1 was observed to act as scaffold for A?-binding through sugar-specific interactions. Starting from the initial helical peptide conformation, a ?-hairpin motif was formed at the C-terminus of the GM1-bound A?-monomer; that didn’t appear in absence of GM1 (both in fluid POPC and liquid-ordered cholesterol/POPC bilayers and also in aqueous medium) within the simulation time span. For A?-dimers, the ?-structure was further enhanced by peptide-peptide interactions, which might influence the propensity of A? to aggregate into higher-ordered structures. The salt-bridges and inter-peptide hydrogen bonds were found to account for dimer stability. We observed spontaneous formation of intra-peptide D23-K28 salt-bridge and a turn at V24GSN27 region - long been accepted as characteristic structural-motifs for amyloid self-assembly. Altogether, our results provide atomistic details of A?-GM1 and A?-A? interactions and demonstrate their importance in the early-stages of GM1-mediated A?-oligomerisation on membrane surface. PMID:23951128

  18. Transitions.

    ERIC Educational Resources Information Center

    Field, David; And Others

    1992-01-01

    Includes four articles: "Career Aspirations" (Field); "Making the Transition to a New Curriculum" (Baker, Householder); "How about a 'Work to School' Transition?" (Glasberg); and "Technological Improvisation: Bringing CNC to Woodworking" (Charles, McDuffie). (SK)

  19. Accounting for conformational flexibility and torsional anharmonicity in the H + CH{sub 3}CH{sub 2}OH hydrogen abstraction reactions: A multi-path variational transition state theory study

    SciTech Connect

    Meana-Pañeda, Rubén; Fernández-Ramos, Antonio, E-mail: qf.ramos@usc.es [Department of Physical Chemistry and Center for Research in Biological Chemistry and Molecular Materials, University of Santiago de Compostela, 15706 Santiago de Compostela (Spain)] [Department of Physical Chemistry and Center for Research in Biological Chemistry and Molecular Materials, University of Santiago de Compostela, 15706 Santiago de Compostela (Spain)

    2014-05-07

    This work reports a detailed theoretical study of the hydrogen abstraction reactions from ethanol by atomic hydrogen. The calculated thermal rate constants take into account torsional anharmonicity and conformational flexibility, in addition to the variational and tunneling effects. Specifically, the kinetics calculations were performed by using multi-path canonical variational transition state theory with least-action path tunneling corrections, to which we have added the two-dimensional non-separable method to take into account torsional anharmonicity. The multi-path thermal rate constant is expressed as a sum over conformational reaction channels. Each of these channels includes all the transition states that can be reached by internal rotations. The results show that, in the interval of temperatures between 250 and 2500 K, the account for multiple paths leads to higher thermal rate constants with respect to the single path approach, mainly at low and at high temperatures. In addition, torsional anharmonicity enhances the slope of the Arrhenius plot in this range of temperatures. Finally, we show that the incorporation of tunneling into the hydrogen abstraction reactions substantially changes the contribution of each of the transition states to the conformational reaction channel.

  20. The Transition from Closed to Open Conformation of Treponema pallidum Outer Membrane-associated Lipoprotein TP0453 Involves Membrane Sensing and Integration by Two Amphipathic Helices*

    PubMed Central

    Luthra, Amit; Zhu, Guangyu; Desrosiers, Daniel C.; Eggers, Christian H.; Mulay, Vishwaroop; Anand, Arvind; McArthur, Fiona A.; Romano, Fabian B.; Caimano, Melissa J.; Heuck, Alejandro P.; Malkowski, Michael G.; Radolf, Justin D.

    2011-01-01

    The molecular architecture and composition of the outer membrane (OM) of Treponema pallidum (Tp), the noncultivable agent of venereal syphilis, differ considerably from those of typical Gram-negative bacteria. Several years ago we described TP0453, the only lipoprotein associated with the inner leaflet of the Tp OM. Whereas polypeptides of other treponemal lipoproteins are hydrophilic, non-lipidated TP0453 can integrate into membranes, a property attributed to its multiple amphipathic helices (AHs). Furthermore, membrane integration of the TP0453 polypeptide was found to increase membrane permeability, suggesting the molecule functions in a porin-like manner. To better understand the mechanism of membrane integration of TP0453 and its physiological role in Tp OM biogenesis, we solved its crystal structure and used mutagenesis to identify membrane insertion elements. The crystal structure of TP0453 consists of an ?/?/?-fold and includes five stably folded AHs. In high concentrations of detergent, TP0453 transitions from a closed to open conformation by lateral movement of two groups of AHs, exposing a large hydrophobic cavity. Triton X-114 phase partitioning, liposome floatation assay, and bis-1-anilino-8-naphthalenesulfonate binding revealed that two adjacent AHs are critical for membrane sensing/integration. Using terbium-dipicolinic acid complex-loaded large unilamellar vesicles, we found that TP0453 increased efflux of fluorophore only at acidic pH. Gel filtration and cross-linking experiments demonstrated that one AH critical for membrane sensing/insertion also forms a dimeric interface. Based on structural dynamics and comparison with Mycobacterium tuberculosis lipoproteins LprG and LppX, we propose that TP0453 functions as a carrier of lipids, glycolipids, and/or derivatives during OM biogenesis. PMID:21965687

  1. Effects of PKA Phosphorylation of Cardiac Troponin I and Strong Crossbridge on Conformational Transitions of the N-Domain of Cardiac Troponin C in Regulated Thin Filaments

    PubMed Central

    Dong, Wen-Ji; Jayasundar, Jayant James; An, Jianli; Xing, Jun; Cheung, Herbert C.

    2008-01-01

    Regulation of cardiac muscle function is initiated by binding of Ca2+ to troponin C (cTnC) which induces a series of structural changes in cTnC and other thin filament proteins. These structural changes are further modulated by crossbridge formation and fine tuned by phosphorylation of cTnI. The objective of the present study is to use a new Förster Resonance Energy Transfer-based structural marker to distinguish structural and kinetic effects of Ca2+ binding, crossbridge interaction and protein kinase A phosphorylation of cTnI on the conformational changes of the cTnC N-domain. The FRET-based structural marker was generated by attaching AEDANS to one cysteine of a double-cysteine mutant cTnC(13C/51C) as a FRET donor and attaching DDPM to the other cysteine as the acceptor. The doubly labeled cTnC mutant was reconstituted into the thin filament by adding cTnI, cTnT, tropomyosin and actin. Changes in the distance between Cys13 and Cys51 induced by Ca2+ binding/dissociation were determined by FRET-sensed Ca2+ titration and stopped-flow studies, and time-resolved fluorescence measurements. The results showed that the presence of both Ca2+ and strong binding of myosin head to actin was required to achieve a fully open structure of the cTnC N-domain in regulated thin filaments. Equilibrium and stopped-flow studies suggested that strongly bound myosin head significantly increased the Ca2+ sensitivity and changed the kinetics of the structural transition of the cTnC N-domain. PKA phosphorylation of cTnI impacted the Ca2+ sensitivity and kinetics of the structural transition of the cTnC N-domain but showed no global structural effect on cTnC opening. These results provide an insight into the modulation mechanism of strong crossbridge and cTnI phosphorylation in cardiac thin filament activation/relaxation processes. PMID:17676764

  2. Conformal House

    E-print Network

    Thomas A Ryttov; Francesco Sannino

    2009-06-01

    We investigate the gauge dynamics of nonsupersymmetric SU(N) gauge theories featuring the simultaneous presence of fermionic matter transforming according to two distinct representations of the underlying gauge group. We bound the regions of flavors and colors which can yield a physical infrared fixed point. As a consistency check we recover the previously investigated conformal windows bounds when restricting to a single matter representation. The earlier conformal windows can be imagined to be part now of the new conformal house. We predict the nonperturbative anomalous dimensions at the infrared fixed points. We further investigate the effects of adding mass terms to the condensates on the conformal house chiral dynamics and construct the simplest instanton induced effective Lagrangian terms.

  3. Ionic channels with conformational substates.

    PubMed Central

    Läuger, P

    1985-01-01

    Recent studies of protein dynamics suggest that ionic channels can assume many conformational substates. Long-lived substates have been directly observed in single-channel current records. In many cases, however, the lifetimes of conformational states will be far below the theoretical limit of time resolution of single-channel experiments. The existence of such hidden substates may strongly influence the observable (time-averaged) properties of a channel, such as the concentration dependence of conductance. A channel exhibiting fast, voltage-dependent transitions between different conductance states may behave as an intrinsic rectifier. In the presence of more than one permeable ion species, coupling between ionic fluxes may occur, even when the channel has only a single ion-binding site. In special situations the rate of ion translocation becomes limited by the rate of conformational transitions, meaning that the channel approaches the kinetic behavior of a carrier. As a result of the strong coulombic interaction between an ion in a binding site and polar groups of the protein, rate constants of conformational transitions may depend on the occupancy of the binding site. Under this condition a nonequilibrium distribution of conformational states is created when ions are driven through the channel by an external force. This may lead to an apparent violation of microscopic reversibility, i.e., to a situation in which the frequency of transitions from state A to state B is no longer equal to the transition frequency from state B to state A. PMID:2410042

  4. Redox-dependent conformational transition of catalytic domain of protein disulfide isomerase indicated by crystal structure-based molecular dynamics simulation

    NASA Astrophysics Data System (ADS)

    Inagaki, Koya; Satoh, Tadashi; Itoh, Satoru G.; Okumura, Hisashi; Kato, Koichi

    2015-01-01

    Protein disulfide isomerase is a multidomain protein operating as an essential folding catalyst. The b? and a? domains of this enzyme exhibit a domain rearrangement depending on the redox states of the a? domain, which is coupled with an open-closed conformational change of substrate-binding hydrophobic surface. Here we performed crystallographic analysis along with molecular dynamics simulations to study the structural mechanisms underlying this domain rearrangement. Based on our data, we propose that oxidization of the a? active site induces conformational changes in its b?-interacting segments, which is concealed by crystal packing, resulting in segregation of these two domains.

  5. New insights into the geometry of resorc[4]arenes: solvent-mediated supramolecular conformational and chiroptical control.

    PubMed

    Schiel, Christian; Hembury, Guy A; Borovkov, Victor V; Klaes, Michael; Agena, Ceno; Wada, Takehiko; Grimme, Stefan; Inoue, Yoshihisa; Mattay, Jochen

    2006-02-01

    The conformations of inherently chiral resorc[4]arenes were studied by circular dichroism (CD) spectroscopy. Whereas in aprotic solvents the crown conformation (C4) is preferred, protic solvents favor the boat conformation (C2). As a result of electronic coupling of the lowest L(b) state of the resorcinol unit in the resorc[4]arene, the CD spectra show a strong dependence on the conformation of the macrocycle. For the first time the solvent dependence of the CD spectra was qualitatively analyzed and simulated by using theoretical methods. We have thus demonstrated not only that the conformation of the calixarene is dramatically manipulated by the solvent but also that the joint use of chiroptical measurements and theoretical calculations is a powerful and versatile tool for elucidating structural variations in supramolecular chemistry. PMID:16438509

  6. Modeling conformational changes in cyclosporin A.

    PubMed Central

    O'Donohue, M. F.; Burgess, A. W.; Walkinshaw, M. D.; Treutlein, H. R.

    1995-01-01

    NMR and X-ray structures for the immunosuppressant cyclosporin A (CsA) reveal a remarkable difference between the unbound (free) conformation in organic solvents and the conformation bound to cyclophilin. We have performed computer simulations of the molecular dynamics of CsA under a variety of conditions and confirmed the stability of these two conformations at room temperature in water and in vacuum. However, when the free conformation was modeled in vacuum at 600 K, a transition pathway leading to the bound conformation was observed. This involved a change in the cis MeLeu-9 peptide bond to a trans conformation and the movement of the side chains forming the dominant hydrophobic cluster (residues MeBmt-1, MeLeu-4, MeLeu-6, and MeLeu-10) to the opposite side of the plane formed by the backbone atoms in the molecular ring. The final conformation had a backbone RMS deviation from the bound conformation of 0.53 A and was as stable in dynamics simulations as the bound conformation. Our calculations allowed us to make a detailed analysis of a transition pathway between the free and the bound conformations of CsA and to identify two distinct regions of coordinated movement in CsA, both of which underwent transitions independently. PMID:8535256

  7. Generalization of Conformal Transformations

    E-print Network

    G. I. Garas'ko

    2005-09-19

    Conformal transformations of a Euclidean (complex) plane have some kind of completeness (sufficiency) for the solution of many mathematical and physical-mathematical problems formulated on this plane. There is no such completeness in the case of Euclidean, pseudo-Euclidean and polynumber spaces of dimension greater than two. In the present paper we show that using the concepts of analogical geometries allows us to generalize conformal transformations not only to the case of Euclidean or pseudo-Euclidean spaces, but also to the case of Finsler spaces, analogous to the spaces of affine connectedness. Examples of such transformations in the case of complex and hypercomplex numbers H_4 are presented. In the general case such transformations form a group of transitions, the elements of which can be viewed as transitions between projective Euclidean geometries of a distinguished class fixed by the choice of metric geometry admitting affine coordinates. The correlation between functions realizing generalized conformal transformations and generalized analytical functions can appear to be productive for the solution of fundamental problems in theoretical and mathematical physics.

  8. Effect of pH and copper(II) on the conformation transitions of silk fibroin based on EPR, NMR, and Raman spectroscopy.

    PubMed

    Zong, Xiao-Hong; Zhou, Ping; Shao, Zheng-Zhong; Chen, Shi-Ming; Chen, Xin; Hu, Bing-Wen; Deng, Feng; Yao, Wen-Hua

    2004-09-28

    Much attention has been paid to the natural mechanism of silkworm spinning due to the impressive mechanical properties of the natural fibers. Our results in the present work show that the fractional changes of the conformational components in regenerated silk fibroin (SF) extracted from Bombyx mori fibers is remarkably pH- and Cu(II)-dependent as demonstrated by Cu(II) EPR, (13)C NMR, and Raman spectroscopy. Cu(II) coordination atoms in SF are changed from four nitrogens to two nitrogens and two oxygens as well as to one nitrogen and three oxygens when the pH is lowered from 8.0 to 4.0. The addition of a given amount of Cu(II) into a SF solution could induce efficiently the SF conformational fractional change from silk I, a soluble helical conformation, to silk II, an insoluble beta-sheet conformation. This behavior is strikingly similar to that seen in prion protein and amyloid beta-peptide. On the basis of the similarity in the relevant sequence in SF to the octapeptide PHGGGWGQ in PrP, we suggest that at basic and neutral pH polypeptide AHGGYSGY in SF may form a 1:1 complex with Cu(II) by coordination of imidazole N(pi) of His together with two deprotonated main-chain nitrogens from two glycine residues and one nitrogen or oxygen from serine. Such a type of coordination may make the interaction between two adjacent beta-form polypeptide chains more difficult, thereby leading to an amorphous structure. Under weakly acidic conditions, however, Cu(II)-amide linkages may be broken and Cu(II) may switch to bind two N(tau) from two histidines in adjacent peptide chains, forming an intermolecular His(N(tau))-Cu(II)-His(N(tau)) bridge. This type of coordination may induce beta-sheet formation and aggregation, leading to a crystalline structure. PMID:15379533

  9. Conformation analysis and computation of energy barrier to rotation about Csbnd N bond in para-methylphenyl carbamate and its solvent dependence in comparison with tertiary carbamates and tertiary amides

    NASA Astrophysics Data System (ADS)

    Modarresi-Alam, Ali Reza; Nowroozi, Alireza; Najafi, Parisa; Movahedifar, Fahimeh; Hajiabadi, Hossein

    2014-11-01

    Barrier to rotation about conjugated Csbnd N bond in p-Methyl phenyl carbamate (PMPC) was computed 14-16 kcal/mol at three levels of HF, B3LYP and MP2 using 6-311++G?? basis set. The solvent effect and energy barriers about Csbnd N bond in PMPC were compared to the case of tertiary carbamates and tertiary amides. Moreover, it is shown that in primary carbamates such as PMPC and tertiary amides isomerisation process passes through TS2 and TS1 respectively, while in tertiary carbamates goes through a combination of both TSs. Furthermore, X-ray analysis which is reported for the first time for primary aryl carbamates demonstrated that the inclusive plane of carbamate functional group is perpendicular to the plane of phenyl ring. The results of computations are completely in agreement with the X-ray data.

  10. Conformable seal

    DOEpatents

    Neef, W.S.; Lambert, D.R.

    1982-08-10

    Sealing apparatus and method, comprising first and second surfaces or membranes, at least one of which surfaces is deformable, placed in proximity to one another. Urging means cause these surfaces to contact one another in a manner such that the deformable surface deforms to conform to the geometry of the other surface, thereby creating a seal. The seal is capable of undergoing multiple cycles of sealing and unsealing.

  11. Self-assembly in a near-frictionless granular material: conformational structures and transitions in uniaxial cyclic compression of hydrogel spheres.

    PubMed

    Walker, David M; Tordesillas, Antoinette; Brodu, Nicolas; Dijksman, Joshua A; Behringer, Robert P; Froyland, Gary

    2015-03-01

    We use a Markov transition matrix-based analysis to explore the structures and structural transitions in a three-dimensional assembly of hydrogel spheres under cyclic uniaxial compression. We apply these methods on experimental data obtained from a packing of nearly frictionless hydrogel balls. This allows an exploration of the emergence and evolution of mesoscale internal structures - a key micromechanical property that governs self-assembly and self-organization in dense granular media. To probe the mesoscopic force network structure, we consider two structural state spaces: (i) a particle and its contacting neighbours, and (ii) a particle's local minimal cycle topology summarized by a cycle vector. In both spaces, our analysis of the transition dynamics reveals which structures and which sets of structures are most prevalent and most likely to transform into each other during the compression/decompression of the material. In compressed states, structures rich in 3-cycle or triangle topologies form in abundance. In contrast, in uncompressed states, transitions comprising poorly connected structures are dominant. An almost-invariant transition set within the cycle vector space is discovered that identifies an intermediate set of structures crucial to the material's transition from weakly jammed to strongly jammed, and vice versa. Preferred transition pathways are also highlighted and discussed with respect to thermo-micro-mechanical constitutive formulations. PMID:25634109

  12. Random loops and conformal field theory

    NASA Astrophysics Data System (ADS)

    Doyon, Benjamin

    2014-02-01

    This is a review of results obtained by the author concerning the relation between conformally invariant random loops and conformal field theory. This review also attempts to provide a physical context in which to interpret these results by making connections with aspects of the nucleation theory of phase transitions and with general properties of criticality.

  13. Eukaryotic translation initiation factor eIF5 promotes the accuracy of start codon recognition by regulating Pi release and conformational transitions of the preinitiation complex

    PubMed Central

    Saini, Adesh K.; Nanda, Jagpreet S.; Martin-Marcos, Pilar; Dong, Jinsheng; Zhang, Fan; Bhardwaj, Monika; Lorsch, Jon R.; Hinnebusch, Alan G.

    2014-01-01

    eIF5 is the GTPase activating protein (GAP) for the eIF2·GTP·Met-tRNAiMet ternary complex with a critical role in initiation codon selection. Previous work suggested that the eIF5 mutation G31R/SUI5 elevates initiation at UUG codons by increasing GAP function. Subsequent work implicated eIF5 in rearrangement of the preinitiation complex (PIC) from an open, scanning conformation to a closed state at AUG codons, from which Pi is released from eIF2·GDP·Pi. To identify eIF5 functions crucial for accurate initiation, we investigated the consequences of G31R on GTP hydrolysis and Pi release, and the effects of intragenic G31R suppressors on these reactions, and on the partitioning of PICs between open and closed states. eIF5-G31R altered regulation of Pi release, accelerating it at UUG while decreasing it at AUG codons, consistent with its ability to stabilize the closed complex at UUG. Suppressor G62S mitigates both defects of G31R, accounting for its efficient suppression of UUG initiation in G31R,G62S cells; however suppressor M18V impairs GTP hydrolysis with little effect on PIC conformation. The strong defect in GTP hydrolysis conferred by M18V likely explains its broad suppression of Sui? mutations in numerous factors. We conclude that both of eIF5's functions, regulating Pi release and stabilizing the closed PIC conformation, contribute to stringent AUG selection in vivo. PMID:25114053

  14. Eukaryotic translation initiation factor eIF5 promotes the accuracy of start codon recognition by regulating Pi release and conformational transitions of the preinitiation complex.

    PubMed

    Saini, Adesh K; Nanda, Jagpreet S; Martin-Marcos, Pilar; Dong, Jinsheng; Zhang, Fan; Bhardwaj, Monika; Lorsch, Jon R; Hinnebusch, Alan G

    2014-09-01

    eIF5 is the GTPase activating protein (GAP) for the eIF2 · GTP · Met-tRNAi (Met) ternary complex with a critical role in initiation codon selection. Previous work suggested that the eIF5 mutation G31R/SUI5 elevates initiation at UUG codons by increasing GAP function. Subsequent work implicated eIF5 in rearrangement of the preinitiation complex (PIC) from an open, scanning conformation to a closed state at AUG codons, from which Pi is released from eIF2 · GDP · Pi. To identify eIF5 functions crucial for accurate initiation, we investigated the consequences of G31R on GTP hydrolysis and Pi release, and the effects of intragenic G31R suppressors on these reactions, and on the partitioning of PICs between open and closed states. eIF5-G31R altered regulation of Pi release, accelerating it at UUG while decreasing it at AUG codons, consistent with its ability to stabilize the closed complex at UUG. Suppressor G62S mitigates both defects of G31R, accounting for its efficient suppression of UUG initiation in G31R,G62S cells; however suppressor M18V impairs GTP hydrolysis with little effect on PIC conformation. The strong defect in GTP hydrolysis conferred by M18V likely explains its broad suppression of Sui(-) mutations in numerous factors. We conclude that both of eIF5's functions, regulating Pi release and stabilizing the closed PIC conformation, contribute to stringent AUG selection in vivo. PMID:25114053

  15. Perturbed Conformal Field Theory: A Tool for Investigating Integrable

    E-print Network

    Perturbed Conformal Field Theory: A Tool for Investigating Integrable Models Marco Ameduri Newman of perturbed conformal field theory is reviewed, and its applications to the analysis of new families]. #12; CONFORMAL FIELD THEORY A physical system at a second order phase transition can be described

  16. Theoretical modeling of UV-Vis absorption and emission spectra in liquid state systems including vibrational and conformational effects: Explicit treatment of the vibronic transitions

    SciTech Connect

    D’Abramo, Marco [Supercomputing Applications and Innovation, CINECA, Via dei Tizii, 6, 00185 Rome (Italy) [Supercomputing Applications and Innovation, CINECA, Via dei Tizii, 6, 00185 Rome (Italy); Dipartimento di Chimica, Universitá Sapienza, P.le Aldo Moro, 5, 00185, Rome (Italy); Aschi, Massimiliano [Department of Physical and Chemical Sciences, University of Aquila, via Vetoio (Coppito 1), 67010 Aquila (Italy)] [Department of Physical and Chemical Sciences, University of Aquila, via Vetoio (Coppito 1), 67010 Aquila (Italy); Amadei, Andrea, E-mail: andrea.amadei@uniroma2.it [Dipartimento di Scienze e Tecnologie Chimiche Universita’ di Roma, Tor Vergata, via della Ricerca Scientifica 1, I-00133 Roma (Italy)] [Dipartimento di Scienze e Tecnologie Chimiche Universita’ di Roma, Tor Vergata, via della Ricerca Scientifica 1, I-00133 Roma (Italy)

    2014-04-28

    Here, we extend a recently introduced theoretical-computational procedure [M. D’Alessandro, M. Aschi, C. Mazzuca, A. Palleschi, and A. Amadei, J. Chem. Phys. 139, 114102 (2013)] to include quantum vibrational transitions in modelling electronic spectra of atomic molecular systems in condensed phase. The method is based on the combination of Molecular Dynamics simulations and quantum chemical calculations within the Perturbed Matrix Method approach. The main aim of the presented approach is to reproduce as much as possible the spectral line shape which results from a subtle combination of environmental and intrinsic (chromophore) mechanical-dynamical features. As a case study, we were able to model the low energy UV-vis transitions of pyrene in liquid acetonitrile in good agreement with the experimental data.

  17. Crystal structure analysis of oxidized Pseudomonas aeruginosa azurin at pH 5.5 and pH 9.0. A pH-induced conformational transition involves a peptide bond flip.

    PubMed

    Nar, H; Messerschmidt, A; Huber, R; van de Kamp, M; Canters, G W

    1991-10-01

    The X-ray crystal structure of recombinant wild-type azurin from Pseudomonas aeruginosa was determined by difference Fourier techniques using phases derived from the structure of the mutant His35Leu. Two data sets were collected from a single crystal of oxidized azurin soaked in mother liquor buffered at pH 5.5 and pH 9.0, respectively. Both data sets extend to 1.93 A resolution. The two pH forms were refined independently to crystallographic R-factors of 17.6% (pH 5.5) and 17.5% (pH 9.0). The conformational transition previously attributed to the protonation/deprotonation of residue His35 (pKa(red) = 7.3, pKa(ox) = 6.2), which lies in a crevice of the protein close to the copper binding site, involves a concomitant Pro36-Gly37 main-chain peptide bond flip. At the lower pH, the protonated imidazole N delta 1 of His35 forms a strong hydrogen bond with the carbonyl oxygen from Pro36, while at alkaline pH the deprotonated N delta 1 acts as an acceptor of a weak hydrogen bond from HN Gly37. The structure of the remainder of the azurin molecule, including the copper binding site, is not significantly affected by this transition. PMID:1942029

  18. Solvent dependent branching between C-I and C-Br bond cleavage following 266 nm excitation of CH2BrI

    NASA Astrophysics Data System (ADS)

    Anderson, Christopher P.; Spears, Kenneth G.; Wilson, Kaitlynn R.; Sension, Roseanne J.

    2013-11-01

    It is well known that ultraviolet photoexcitation of halomethanes results in halogen-carbon bond cleavage. Each halogen-carbon bond has a dominant ultraviolet (UV) absorption that promotes an electron from a nonbonding halogen orbital (nX) to a carbon-halogen antibonding orbital (?*C-X). UV absorption into specific transitions in the gas phase results primarily in selective cleavage of the corresponding carbon-halogen bond. In the present work, broadband ultrafast UV-visible transient absorption studies of CH2BrI reveal a more complex photochemistry in solution. Transient absorption spectra are reported spanning the range from 275 nm to 750 nm and 300 fs to 3 ns following excitation of CH2BrI at 266 nm in acetonitrile, 2-butanol, and cyclohexane. Channels involving formation of CH2Br + I radical pairs, iso-CH2Br-I, and iso-CH2I-Br are identified. The solvent environment has a significant influence on the branching ratios, and on the formation and stability of iso-CH2Br-I. Both iso-CH2Br-I and iso-CH2I-Br are observed in cyclohexane with a ratio of ˜2.8:1. In acetonitrile this ratio is 7:1 or larger. The observation of formation of iso-CH2I-Br photoproduct as well as iso-CH2Br-I following 266 nm excitation is a novel result that suggests complexity in the dissociation mechanism. We also report a solvent and concentration dependent lifetime of iso-CH2Br-I. At low concentrations the lifetime is >4 ns in acetonitrile, 1.9 ns in 2-butanol and ˜1.4 ns in cyclohexane. These lifetimes decrease with higher initial concentrations of CH2BrI. The concentration dependence highlights the role that intermolecular interactions can play in the quenching of unstable isomers of dihalomethanes.

  19. Conformal Tachyons

    NASA Astrophysics Data System (ADS)

    Tomaschitz, Roman

    We study tachyons conformally coupled to the background geometry of a Milne universe. The causality of superluminal signal transfer is scrutinized in this context. The cosmic time of the comoving frame determines a distinguished time order for events connected by superluminal signals. An observer can relate his rest frame to the galaxy frame, and compare so the time order of events in his proper time to the cosmic time order. All observers can in this way arrive at identical conclusions on the causality of events connected by superluminal signals. An unambiguous energy concept for tachyonic rays is defined by means of the cosmic time of the comoving reference frame, without resorting to an antiparticle interpretation. On that basis we give an explicit proof that no signals can be sent into the past of observers. Causality violating signals are energetically forbidden, as they would have negative energy in the rest frame of the emitting observer. If an observer emits a superluminal signal, the tachyonic response of a second observer cannot reach him prior to the emission, i.e. no predetermination can occur.

  20. Solvent dependent switching of 3MLLCT and 1IL luminescent states in [ClRe(CO)3(bathocuproinedisulfonate)]2-: spectroscopic and computational study.

    PubMed

    Martinez Saavedra, Hector H; Ragone, Fabricio; Ruiz, Gustavo T; Gara, Pedro M David; Wolcan, Ezequiel

    2014-10-16

    Steady state and time-resolved luminescence experiments and calorimetric studies, as well as time-dependent density functional theory calculations performed on [ClRe(CO)(3)(Bathocuproinedisulfonate)](2-), show that the photophysical properties of the Re(I) anionic complex are determined by the balance between intraligand ((1)IL) and metal-ligand-to-ligand charge transfer ((3)MLLCT) excited states. In organic solvents, (3)MLLCT states prevail and the usual expected behavior is observed: bathochromic shift of the emission maximum, a reduced luminescence quantum yield and the shortening of the excited-state lifetime upon increasing the polarity of the solvent. In addition, singlet oxygen ((1)O2) is generated with high quantum yields (?(?) ? 0.5 in CH(3)CN) due to the quenching of the (3)MLLCT luminescence by (3)O2. The total quenching rate constant of triplet state by oxygen, k(q), reach values between 2.2 and 2.4 × 10(9) M(-1) s(-1) for the organic solvents studied. In CH(3)CN, the fraction of triplet states quenched by O2 which yield (1)O2, f(O2)T, is nearly unity. In aqueous solution, where no singlet oxygen is generated, the luminescence of the Re(I) complex is of (1)IL character with a emission quantum yield (?(em)) strongly pH dependent: ?(em,(pH=2))/?(em,(pH=10)) ? 5.6. The variation of the pH of the solution tunes the photophysical properties of the Re(I) complex by changing the relative amount of the different species existing in aqueous solutions: [ClRe(CO)3(BCS)](2-), [(OH)Re(CO)3(BCS)](2-) and [(H2O)Re(CO)3(BCS)](?). TD-DFT calculations show that the percentage of charge transfer character of the electronic transitions is substantially higher in the organic solvents than in aqueous solutions, in agreement with the increase of (1)IL character of HOMO in [(H2O)Re(CO)3(BCS)](?) relative to [ClRe(CO)3(BCS)](2-). PMID:25233269

  1. Solvent dependent branching between C-I and C-Br bond cleavage following 266 nm excitation of CH2BrI.

    PubMed

    Anderson, Christopher P; Spears, Kenneth G; Wilson, Kaitlynn R; Sension, Roseanne J

    2013-11-21

    It is well known that ultraviolet photoexcitation of halomethanes results in halogen-carbon bond cleavage. Each halogen-carbon bond has a dominant ultraviolet (UV) absorption that promotes an electron from a nonbonding halogen orbital (nX) to a carbon-halogen antibonding orbital (?*C-X). UV absorption into specific transitions in the gas phase results primarily in selective cleavage of the corresponding carbon-halogen bond. In the present work, broadband ultrafast UV-visible transient absorption studies of CH2BrI reveal a more complex photochemistry in solution. Transient absorption spectra are reported spanning the range from 275 nm to 750 nm and 300 fs to 3?ns following excitation of CH2BrI at 266 nm in acetonitrile, 2-butanol, and cyclohexane. Channels involving formation of CH2Br + I radical pairs, iso-CH2Br-I, and iso-CH2I-Br are identified. The solvent environment has a significant influence on the branching ratios, and on the formation and stability of iso-CH2Br-I. Both iso-CH2Br-I and iso-CH2I-Br are observed in cyclohexane with a ratio of ~2.8:1. In acetonitrile this ratio is 7:1 or larger. The observation of formation of iso-CH2I-Br photoproduct as well as iso-CH2Br-I following 266 nm excitation is a novel result that suggests complexity in the dissociation mechanism. We also report a solvent and concentration dependent lifetime of iso-CH2Br-I. At low concentrations the lifetime is >4 ns in acetonitrile, 1.9 ns in 2-butanol and ~1.4 ns in cyclohexane. These lifetimes decrease with higher initial concentrations of CH2BrI. The concentration dependence highlights the role that intermolecular interactions can play in the quenching of unstable isomers of dihalomethanes. PMID:24320326

  2. Solvent dependent branching between C-I and C-Br bond cleavage following 266 nm excitation of CH{sub 2}BrI

    SciTech Connect

    Anderson, Christopher P.; Spears, Kenneth G.; Wilson, Kaitlynn R.; Sension, Roseanne J. [Department of Chemistry and Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States)] [Department of Chemistry and Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States)

    2013-11-21

    It is well known that ultraviolet photoexcitation of halomethanes results in halogen-carbon bond cleavage. Each halogen-carbon bond has a dominant ultraviolet (UV) absorption that promotes an electron from a nonbonding halogen orbital (n{sub X}) to a carbon-halogen antibonding orbital (?*{sub C-X}). UV absorption into specific transitions in the gas phase results primarily in selective cleavage of the corresponding carbon-halogen bond. In the present work, broadband ultrafast UV-visible transient absorption studies of CH{sub 2}BrI reveal a more complex photochemistry in solution. Transient absorption spectra are reported spanning the range from 275 nm to 750 nm and 300 fs to 3 ns following excitation of CH{sub 2}BrI at 266 nm in acetonitrile, 2-butanol, and cyclohexane. Channels involving formation of CH{sub 2}Br + I radical pairs, iso-CH{sub 2}Br-I, and iso-CH{sub 2}I-Br are identified. The solvent environment has a significant influence on the branching ratios, and on the formation and stability of iso-CH{sub 2}Br-I. Both iso-CH{sub 2}Br-I and iso-CH{sub 2}I-Br are observed in cyclohexane with a ratio of ?2.8:1. In acetonitrile this ratio is 7:1 or larger. The observation of formation of iso-CH{sub 2}I-Br photoproduct as well as iso-CH{sub 2}Br-I following 266 nm excitation is a novel result that suggests complexity in the dissociation mechanism. We also report a solvent and concentration dependent lifetime of iso-CH{sub 2}Br-I. At low concentrations the lifetime is >4 ns in acetonitrile, 1.9 ns in 2-butanol and ?1.4 ns in cyclohexane. These lifetimes decrease with higher initial concentrations of CH{sub 2}BrI. The concentration dependence highlights the role that intermolecular interactions can play in the quenching of unstable isomers of dihalomethanes.

  3. Crystal structures of progressive Ca2+ binding states of the Ca2+ sensor Ca2+ binding domain 1 (CBD1) from the CALX Na+/Ca2+ exchanger reveal incremental conformational transitions.

    PubMed

    Wu, Mousheng; Le, Hoa Dinh; Wang, Meitian; Yurkov, Vladimir; Omelchenko, Alexander; Hnatowich, Mark; Nix, Jay; Hryshko, Larry V; Zheng, Lei

    2010-01-22

    Na(+)/Ca(2+) exchangers (NCX) constitute a major Ca(2+) export system that facilitates the re-establishment of cytosolic Ca(2+) levels in many tissues. Ca(2+) interactions at its Ca(2+) binding domains (CBD1 and CBD2) are essential for the allosteric regulation of Na(+)/Ca(2+) exchange activity. The structure of the Ca(2+)-bound form of CBD1, the primary Ca(2+) sensor from canine NCX1, but not the Ca(2+)-free form, has been reported, although the molecular mechanism of Ca(2+) regulation remains unclear. Here, we report crystal structures for three distinct Ca(2+) binding states of CBD1 from CALX, a Na(+)/Ca(2+) exchanger found in Drosophila sensory neurons. The fully Ca(2+)-bound CALX-CBD1 structure shows that four Ca(2+) atoms bind at identical Ca(2+) binding sites as those found in NCX1 and that the partial Ca(2+) occupancy and apoform structures exhibit progressive conformational transitions, indicating incremental regulation of CALX exchange by successive Ca(2+) binding at CBD1. The structures also predict that the primary Ca(2+) pair plays the main role in triggering functional conformational changes. Confirming this prediction, mutagenesis of Glu(455), which coordinates the primary Ca(2+) pair, produces dramatic reductions of the regulatory Ca(2+) affinity for exchange current, whereas mutagenesis of Glu(520), which coordinates the secondary Ca(2+) pair, has much smaller effects. Furthermore, our structures indicate that Ca(2+) binding only enhances the stability of the Ca(2+) binding site of CBD1 near the hinge region while the overall structure of CBD1 remains largely unaffected, implying that the Ca(2+) regulatory function of CBD1, and possibly that for the entire NCX family, is mediated through domain interactions between CBD1 and the adjacent CBD2 at this hinge. PMID:19815561

  4. STEADY-STATE AND TIME-RESOLVED FLUORESCENCE QUENCHING WITH TRANSITION METAL IONS AS SHORT-DISTANCE PROBES FOR PROTEIN CONFORMATION

    PubMed Central

    Posokhov, Yevgen O.; Kyrychenko, Alexander; Ladokhin, Alexey S.

    2011-01-01

    A series of model dye-labeled histidine-containing peptides was used to investigate the nature of the quenching mechanism with Cu2+ and Ni2+. The strong reduction in steady-state fluorescence was found to be unaccompanied by any noticeable changes in lifetime kinetics. This static nature of quenching is not consistent with the dynamic FRET phenomenon, which was assumed to dominate the quenching mechanism, and is likely caused by shorter range orbital coupling. Our results indicate that the FRET-like 6th power of distance dependence of quenching cannot be automatically assumed for transition metal ions, and time-resolved measurements should be used to distinguish various quenching mechanisms. PMID:20707982

  5. Logarithmic Conformal Field Theory

    E-print Network

    Flohr, Michael

    #12;#12;Aspects of Logarithmic Conformal Field Theory Der Fakult¨at f¨ur Mathematik und Physik der various aspects of logarithmic conformal field theories (LCFTs). After recalling some important definitions and relations of (logarithmic) conformal field theories we study possible extensions of conformal

  6. Conformations and conformational interconversions of diastereomeric cyclic tetraprolines.

    PubMed

    Link, U; Mästle, W; Rothe, M

    1993-11-01

    Cyclic tetrapeptides exclusively composed of L- and D-Pro have been studied by theoretical means (conformational searches and molecular mechanics calculations using the CHARMM program) supported by 1H-NMR spectroscopy, X-ray analysis and chiroptical measurements. We explored the entire conformational space of the diastereomers cyclo(LLLL-Pro4) (I), cyclo(LDLD-Pro4) (II) and cyclo(LLDD-Pro4) (III) including the low-energy conformations and the related interconversion paths. The conformational interconversions were found to be restricted to cis/trans isomerisations of the amide bonds. Owing to the polycyclic nature of cyclo(Pro4) most of the cis/trans transitions are hindered by energy barriers higher than 30 kcal/mol (up to 150-200 kcal/mol). A few transitions are characterized by computed energy barriers comparable to those found in linear -Xxx-Pro- sequences (approximately 18 kcal/mol), and are therefore experimentally significant. Experimental evidence has been obtained in the case of cyclo(LDLD-Pro4), where two enantiomers are interconverted by a series of 4 cis/trans isomerisations ctct-->cttt-->tttt-->tctt-->tctc. The Erying activation parameters of this reaction were determined in H2O and in DMF by chiroptical measurements (delta H not equal to = 44 and 28 kcal/mol; delta S not equal to = 59 and 22 cal K-1 mol-1, respectively), and correlated with the calculated barriers. In I and III comparable series of four cis/trans isomerisations relate two main conformations with the peptide bond sequences ctct and tctc. In compound I pseudorotational images are interconverted via ctct-->ccct-->cctt-->cctc-->tctc.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8106200

  7. Protein conformational populations and functionally relevant substates.

    PubMed

    Ramanathan, Arvind; Savol, Andrej; Burger, Virginia; Chennubhotla, Chakra S; Agarwal, Pratul K

    2014-01-21

    Functioning proteins do not remain fixed in a unique structure, but instead they sample a range of conformations facilitated by motions within the protein. Even in the native state, a protein exists as a collection of interconverting conformations driven by thermodynamic fluctuations. Motions on the fast time scale allow a protein to sample conformations in the nearby area of its conformational landscape, while motions on slower time scales give it access to conformations in distal areas of the landscape. Emerging evidence indicates that protein landscapes contain conformational substates with dynamic and structural features that support the designated function of the protein. Nuclear magnetic resonance (NMR) experiments provide information about conformational ensembles of proteins. X-ray crystallography allows researchers to identify the most populated states along the landscape, and computational simulations give atom-level information about the conformational substates of different proteins. This ability to characterize and obtain quantitative information about the conformational substates and the populations of proteins within them is allowing researchers to better understand the relationship between protein structure and dynamics and the mechanisms of protein function. In this Account, we discuss recent developments and challenges in the characterization of functionally relevant conformational populations and substates of proteins. In some enzymes, the sampling of functionally relevant conformational substates is connected to promoting the overall mechanism of catalysis. For example, the conformational landscape of the enzyme dihydrofolate reductase has multiple substates, which facilitate the binding and the release of the cofactor and substrate and catalyze the hydride transfer. For the enzyme cyclophilin A, computational simulations reveal that the long time scale conformational fluctuations enable the enzyme to access conformational substates that allow it to attain the transition state, therefore promoting the reaction mechanism. In the long term, this emerging view of proteins with conformational substates has broad implications for improving our understanding of enzymes, enzyme engineering, and better drug design. Researchers have already used photoactivation to modulate protein conformations as a strategy to develop a hypercatalytic enzyme. In addition, the alteration of the conformational substates through binding of ligands at locations other than the active site provides the basis for the design of new medicines through allosteric modulation. PMID:23988159

  8. Microwave Spectrum and Conformation in 2-Fluorophenylisothiocyanate.

    PubMed

    Chakrabarti; Jaman

    2000-08-01

    The microwave rotational spectra of 2-fluorophenylisothiocyanate have been investigated in the frequency region of 26.0-38.0 GHz. Analysis of a-type R-branch transitions confirmed the existence of two conformers: cis and trans. Rotational and centrifugal distortion constants for both conformers have been derived. The observed inertial defect values demonstrate their planarity. From the relative intensity ratio the cis form was shown to be more stable than the trans form by about 208 cm(-1). Finally, molecular geometries for both conformers have been proposed. Copyright 2000 Academic Press. PMID:10877952

  9. Solvent dependent photophysical properties of dimethoxy curcumin

    NASA Astrophysics Data System (ADS)

    Barik, Atanu; Indira Priyadarsini, K.

    2013-03-01

    Dimethoxy curcumin (DMC) is a methylated derivative of curcumin. In order to know the effect of ring substitution on photophysical properties of curcumin, steady state absorption and fluorescence spectra of DMC were recorded in organic solvents with different polarity and compared with those of curcumin. The absorption and fluorescence spectra of DMC, like curcumin, are strongly dependent on solvent polarity and the maxima of DMC showed red shift with increase in solvent polarity function (?f), but the above effect is prominently observed in case of fluorescence maxima. From the dependence of Stokes' shift on solvent polarity function the difference between the excited state and ground state dipole moment was estimated as 4.9 D. Fluorescence quantum yield (?f) and fluorescence lifetime (?f) of DMC were also measured in different solvents at room temperature. The results indicated that with increasing solvent polarity, ?f increased linearly, which has been accounted for the decrease in non-radiative rate by intersystem crossing (ISC) processes.

  10. Fake conformal symmetry in conformal cosmological models

    NASA Astrophysics Data System (ADS)

    Jackiw, R.; Pi, So-Young

    2015-03-01

    We examine the local conformal invariance (Weyl invariance) in tensor-scalar theories used in recently proposed conformal cosmological models. We show that the Noether currents associated with Weyl invariance in these theories vanish. We assert that the corresponding Weyl symmetry does not have any dynamical role.

  11. Quantum massive conformal gravity

    E-print Network

    Faria, F F

    2015-01-01

    We first find the linear approximation of the second plus fourth order derivatives massive conformal gravity action. Then we reduce the linearized action to three separated second order derivatives terms, which allows us to quantize the massive conformal gravity fields by using the usual first order canonical quantization method. Finally, using the correct conformal normalization of the massive conformal gravity states, we show that the theory is unitary.

  12. Applied Conformal Field Theory

    Microsoft Academic Search

    Paul Ginsparg

    1988-01-01

    These lectures consisted of an elementary introduction to conformal field theory, with some applications to statistical mechanical systems, and fewer to string theory. Contents: 1. Conformal theories in d dimensions 2. Conformal theories in 2 dimensions 3. The central charge and the Virasoro algebra 4. Kac determinant and unitarity 5. Identication of m = 3 with the critical Ising model

  13. Superspace conformal field theory

    NASA Astrophysics Data System (ADS)

    Quella, Thomas; Schomerus, Volker

    2013-12-01

    Conformal sigma models and Wess-Zumino-Witten (WZW) models on coset superspaces provide important examples of logarithmic conformal field theories. They possess many applications to problems in string and condensed matter theory. We review recent results and developments, including the general construction of WZW models on type-I supergroups, the classification of conformal sigma models and their embedding into string theory.

  14. Irrational conformal field theory

    Microsoft Academic Search

    M. B. Halpern; E. Kiritsis; N. A. Obers; K. Clubok

    1996-01-01

    This is a review of irrational conformal field theory, which includes rational conformal field theory as a small subspace. Central topics of the review include the Virasoro master equation, its solutions and the dynamics of irrational conformal field theory. Discussion of the dynamics includes the generalized Knizhnik-Zamolodchikov equations on the sphere, the corresponding heat-like systems on the torus and the

  15. Superspace conformal field theory

    E-print Network

    Thomas Quella; Volker Schomerus

    2014-09-23

    Conformal sigma models and WZW models on coset superspaces provide important examples of logarithmic conformal field theories. They possess many applications to problems in string and condensed matter theory. We review recent results and developments, including the general construction of WZW models on type I supergroups, the classification of conformal sigma models and their embedding into string theory.

  16. Mapping Conformational Dynamics of Proteins Using Torsional Dynamics Simulations

    PubMed Central

    Gangupomu, Vamshi K.; Wagner, Jeffrey R.; Park, In-Hee; Jain, Abhinandan; Vaidehi, Nagarajan

    2013-01-01

    All-atom molecular dynamics simulations are widely used to study the flexibility of protein conformations. However, enhanced sampling techniques are required for simulating protein dynamics that occur on the millisecond timescale. In this work, we show that torsional molecular dynamics simulations enhance protein conformational sampling by performing conformational search in the low-frequency torsional degrees of freedom. In this article, we use our recently developed torsional-dynamics method called Generalized Newton-Euler Inverse Mass Operator (GNEIMO) to study the conformational dynamics of four proteins. We investigate the use of the GNEIMO method in simulations of the conformationally flexible proteins fasciculin and calmodulin, as well as the less flexible crambin and bovine pancreatic trypsin inhibitor. For the latter two proteins, the GNEIMO simulations with an implicit-solvent model reproduced the average protein structural fluctuations and sample conformations similar to those from Cartesian simulations with explicit solvent. The application of GNEIMO with replica exchange to the study of fasciculin conformational dynamics produced sampling of two of this protein’s experimentally established conformational substates. Conformational transition of calmodulin from the Ca2+-bound to the Ca2+-free conformation occurred readily with GNEIMO simulations. Moreover, the GNEIMO method generated an ensemble of conformations that satisfy about half of both short- and long-range interresidue distances obtained from NMR structures of holo to apo transitions in calmodulin. Although unconstrained all-atom Cartesian simulations have failed to sample transitions between the substates of fasciculin and calmodulin, GNEIMO simulations show the transitions in both systems. The relatively short simulation times required to capture these long-timescale conformational dynamics indicate that GNEIMO is a promising molecular-dynamics technique for studying domain motion in proteins. PMID:23663843

  17. Microwave spectrum, conformation, and dipole moment of divinyl ether

    Microsoft Academic Search

    Chiaki Hirose; R. F. Curl

    1971-01-01

    The microwave spectrum of divinyl ether has been observed and a, b, and c type rotational transitions of one conformer assigned. This conformer has rotational constants closely related to the cis-trans planar form. The inertial defect and dipole moment reveal that it is not planar. This nonplanarity almost certainly results because of strong repulsion between the beta hydrogen of the

  18. Conformal and near-conformal field theories

    NASA Astrophysics Data System (ADS)

    Hasenfratz, Anna

    2013-03-01

    Non-Abelian gauge fermion systems could be chirally broken and confining or conformal, depending on the number of fermions and their representation. Models near the conformal boundary are important as they could be relevant in describing physics beyond the Standard Model. These models are strongly coupled and require non-perturbative investigations. Lattice techniques that were developed for QCD studies can be used to simulate these systems but there is growing evidence that new observables, new approaches are needed to study the properties of conformal or near conformal models. In this talk I will briefly summarize the most promising models and describe some standard and some promising new methods to study their properties.

  19. Toward TeV Conformality

    E-print Network

    Appelquist, Thomas; Babich, Ron; Brower, Richard C; Cheng, Michael; Clark, Michael A; Cohen, Saul D; Fleming, George T; Kiskis, Joseph; Neil, Ethan T; Osborn, James C; Rebbi, Claudio; Schaich, David; Soltz, Ron; Vranas, Pavlos

    2009-01-01

    We study the chiral condensate $$ for an SU(3) gauge theory with $N_f$ massless Dirac fermions in the fundamental representation when $N_f$ is increased from 2 to 6. For $N_f=2$, our lattice simulations of $/F^3$, where $F$ is the Nambu-Goldstone-boson decay constant, agree with the measured QCD value. For $N_f = 6$, this ratio shows significant enhancement, presaging an even larger enhancement anticipated as $N_f$ increases further, toward the critical value for transition from confinement to infrared conformality.

  20. Toward TeV conformality.

    PubMed

    Appelquist, T; Avakian, A; Babich, R; Brower, R C; Cheng, M; Clark, M A; Cohen, S D; Fleming, G T; Kiskis, J; Neil, E T; Osborn, J C; Rebbi, C; Schaich, D; Vranas, P

    2010-02-19

    We study the chiral properties of an SU(3) gauge theory with N{f} massless Dirac fermions in the fundamental representation when N{f} is increased from 2 to 6. For N{f}=2, our lattice simulations lead to a value of psi psi/F{3}, where F is the Nambu-Goldstone-boson decay constant and psi psi is the chiral condensate, which agrees with the measured QCD value. For N{f}=6, this ratio shows significant enhancement, presaging an even larger enhancement anticipated as N{f} increases further, toward the critical value for transition from confinement to infrared conformality. PMID:20366870

  1. Toward TeV Conformality

    SciTech Connect

    Appelquist, T; Avakian, A; Babich, R; Brower, R C; Cheng, M; Clark, M A; Cohen, S D; Fleming, G T; Kiskis, J; Neil, E T; Osborn, J C; Rebbi, C; Schaich, D; Soltz, R; Vranas, P

    2009-11-30

    We study the chiral condensate <{bar {psi}}{psi}> for an SU(3) gauge theory with N{sub f} massless Dirac fermions in the fundamental representation when N{sub f} is increased from 2 to 6. For N{sub f} = 2, our lattice simulations of <{bar {psi}}{psi}>/F{sup 3}, where F is the Nambu-Goldstone-boson decay constant, agree with the measured QCD value. For N{sub f} = 6, this ratio shows significant enhancement, presaging an even larger enhancement anticipated as N{sub f} increases further, toward the critical value for transition from confinement to infrared conformality.

  2. Toward TeV Conformality

    E-print Network

    Thomas Appelquist; Adam Avakian; Ron Babich; Richard C. Brower; Michael Cheng; Michael A. Clark; Saul D. Cohen; George T. Fleming; Joseph Kiskis; Ethan T. Neil; James C. Osborn; Claudio Rebbi; David Schaich; Pavlos Vranas

    2010-02-19

    We study the chiral condensate $$ for an SU(3) gauge theory with $N_f$ massless Dirac fermions in the fundamental representation when $N_f$ is increased from 2 to 6. For $N_f=2$, our lattice simulations of $/F^3$, where $F$ is the Nambu-Goldstone-boson decay constant, agree with the measured QCD value. For $N_f = 6$, this ratio shows significant enhancement, presaging an even larger enhancement anticipated as $N_f$ increases further, toward the critical value for transition from confinement to infrared conformality.

  3. Toward TeV Conformality

    SciTech Connect

    Appelquist, T.; Fleming, G. T.; Neil, E. T. [Department of Physics, Sloane Laboratory, Yale University, New Haven, Connecticut 06520 (United States); Avakian, A.; Babich, R.; Brower, R. C.; Cohen, S. D.; Rebbi, C.; Schaich, D. [Department of Physics, Boston University, Boston, Massachusetts 02215 (United States); Cheng, M.; Vranas, P. [Physical Sciences Directorate, Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Clark, M. A. [Harvard-Smithsonian Center for Astrophysics, Cambridge, Massachusetts 02138 (United States); Initiative in Innovative Computing, Harvard University School of Engineering and Applied Sciences, Cambridge, Massachusetts 02138 (United States); Kiskis, J. [Department of Physics, University of California, Davis, California 95616 (United States); Osborn, J. C. [Argonne Leadership Computing Facility, Argonne, Illinois 60439 (United States)

    2010-02-19

    We study the chiral properties of an SU(3) gauge theory with N{sub f} massless Dirac fermions in the fundamental representation when N{sub f} is increased from 2 to 6. For N{sub f}=2, our lattice simulations lead to a value of /F{sup 3}, where F is the Nambu-Goldstone-boson decay constant and is the chiral condensate, which agrees with the measured QCD value. For N{sub f}=6, this ratio shows significant enhancement, presaging an even larger enhancement anticipated as N{sub f} increases further, toward the critical value for transition from confinement to infrared conformality.

  4. Conformational isomers of linear rotaxanes.

    PubMed

    Sevick, Edith M; Williams, David R M

    2014-09-21

    We examine a simple model of rotaxane structure, with 3 asymmetric rings interacting via repulsive power-law forces. This interlocked molecule exhibits conformational isomerisation which is different from that of molecules whose connectedness is through covalent bonds. The rings are free to translate along and rotate around the axle, and hence weak interaction forces between the rings can lead to distinct rotamer states. We use energy minimisation to determine these states exactly, and show that there can be transitions from asymmetric to symmetric states by varying the bond lengths. We also use classical statistical mechanics to show the effect of thermal noise. PMID:25240369

  5. Conformational isomers of linear rotaxanes

    NASA Astrophysics Data System (ADS)

    Sevick, Edith M.; Williams, David R. M.

    2014-09-01

    We examine a simple model of rotaxane structure, with 3 asymmetric rings interacting via repulsive power-law forces. This interlocked molecule exhibits conformational isomerisation which is different from that of molecules whose connectedness is through covalent bonds. The rings are free to translate along and rotate around the axle, and hence weak interaction forces between the rings can lead to distinct rotamer states. We use energy minimisation to determine these states exactly, and show that there can be transitions from asymmetric to symmetric states by varying the bond lengths. We also use classical statistical mechanics to show the effect of thermal noise.

  6. Galilean conformal electrodynamics

    NASA Astrophysics Data System (ADS)

    Bagchi, Arjun; Basu, Rudranil; Mehra, Aditya

    2014-11-01

    Maxwell's Electrodynamics admits two distinct Galilean limits called the Electric and Magnetic limits. We show that the equations of motion in both these limits are invariant under the Galilean Conformal Algebra in D = 4, thereby exhibiting non-relativistic conformal symmetries. Remarkably, the symmetries are infinite dimensional and thus Galilean Electrodynamics give us the first example of an infinitely extended Galilean Conformal Field Theory in D > 2. We examine details of the theory by looking at purely non-relativistic conformal methods and also use input from the limit of the relativistic theory.

  7. Galilean Conformal Electrodynamics

    E-print Network

    Bagchi, Arjun; Mehra, Aditya

    2014-01-01

    Maxwell's Electrodynamics admits two distinct Galilean limits called the Electric and Magnetic limits. We show that the equations of motion in both these limits are invariant under the Galilean Conformal Algebra in D=4, thereby exhibiting non-relativistic conformal symmetries. Remarkably, the symmetries are infinite dimensional and thus Galilean Electrodynamics give us the first example of an infinitely extended Galilean Conformal Field Theory in D>2. We examine details of the theory by looking at purely non-relativistic conformal methods and also use input from the limit of the relativistic theory.

  8. Conformal geodesics in general relativity

    Microsoft Academic Search

    H. Friedrich; B. G. Schmidt

    1987-01-01

    Conformal geodesics, space-time curves which are related to conformal structures in a similar way as geodesics are related to metric structures, are discussed. `Conformal normal coordinates', `conformal Gauss systems' and their associated `normal connections', `normal frames' and `normal metrics' are introduced and used to study: (i) asymptotically simple solutions of Ric(g) = Lambda g near conformal infinity, (ii) asymptotically simple

  9. Structure and Conformation of Carbohydrates

    NASA Astrophysics Data System (ADS)

    Grindley, T. Bruce

    The conformational analysis of monosaccharides, disaccharides, and oligosaccharides is reviewed. Conformational terms are introduced through examination of the conformations of cyclohexane and cyclopentane then applied to the pyranose, furanose , and septanose rings. Concepts such as the anomeric effect are discussed. Topics of current interest, such as hydroxymethyl group and hydroxyl group rotation and disaccharide conformations are summarized. Physical methods for studying conformation are outlined.

  10. Massive-Conformal Dictionary

    E-print Network

    Ezer Melzer

    1993-11-10

    The finite-volume spectrum of an integrable massive perturbation of a rational conformal field theory interpolates between massive multi-particle states in infinite volume (IR limit) and conformal states, which are approached at zero volume (UV limit). Each state is labeled in the IR by a set of `Bethe Ansatz quantum numbers', while in the UV limit it is characterized primarily by the conformal dimensions of the conformal field creating it. We present explicit conjectures for the UV conformal dimensions corresponding to any IR state in the $\\phi_{1,3}$-perturbed minimal models $M(2,5)$ and $M(3,5)$. The conjectures, which are based on a combinatorial interpretation of the Rogers-Ramanujan-Schur identities, are consistent with numerical results obtained previously for low-lying energy levels.

  11. The conformal window of deformed conformal field theories in the planar limit

    SciTech Connect

    Vecchi, Luca [Theoretical Division T-2, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    2010-08-15

    We discuss in the planar approximation the effect of double-trace deformations on conformal field theories. We show that this large class of models posses a conformal window describing a nontrivial flow between two fixed points of the renormalization group and reveal the presence of a resonance which we associate to the remnant of a dilaton pole. As the conformal window shrinks to zero measure, the theory undergoes a conformal phase transition separating a symmetric from a nonsymmetric phase. The recently conjectured strongly coupled branch of nonsupersymmetric, non-Abelian gauge theories with a large number of flavors is analyzed in light of these results, and a model for the strong branch is proposed. Some phenomenological implications in the context of unparticle physics are also emphasized.

  12. Essential role of conformational selection in ligand binding

    PubMed Central

    Vogt, Austin D.; Pozzi, Nicola; Chen, Zhiwei; Di Cera, Enrico

    2013-01-01

    Two competing and mutually exclusive mechanisms of ligand recognition – conformational selection and induced fit - have dominated our interpretation of ligand binding in biological macromolecules for almost six decades. Conformational selection posits the pre-existence of multiple conformations of the macromolecule from which the ligand selects the optimal one. Induced fit, on the other hand, postulates the existence of conformational rearrangements of the original conformation into an optimal one that is induced by binding of the ligand. In the former case, conformational transitions precede the binding event; in the latter, conformational changes follow the binding step. Kineticists have used a facile criterion to distinguish between the two mechanisms based on the dependence of the rate of relaxation to equilibrium, kobs, on the ligand concentration, [L]. A value of kobs decreasing hyperbolically with [L] is seen as diagnostic of conformational selection, while a value of kobs increasing hyperbolically with [L] is considered diagnostic of induced fit. However, this simple conclusion is only valid in the rather unrealistic assumption of conformational transitions being much slower than binding and dissociation events. In general, induced fit only produces values of kobs that increase with [L] but conformational selection is more versatile and is associated with values of kobs that increase, decrease with or are independent of [L]. The richer repertoire of kinetic properties of conformational selection applies to kinetic mechanisms with single or multiple saturable relaxations and explains the behavior of nearly all experimental systems reported in the literature thus far. Conformational selection is always sufficient and often necessary to account for the relaxation kinetics of ligand binding to a biological macromolecule and is therefore an essential component of any binding mechanism. On the other hand, induced fit is never necessary and only sufficient in a few cases. Therefore, the long assumed importance and preponderance of induced fit as a mechanism of ligand binding should be reconsidered. PMID:24113284

  13. Spectral function of a localized fermion coupled to the Wilson-Fisher conformal field theory

    E-print Network

    Spectral function of a localized fermion coupled to the Wilson-Fisher conformal field theory Andrea-Fisher conformal field theory (CFT) describes the quan- tum phase transition of a number of boson and insulating field theory (CFT) describing the quantum phase transition of a bosonic order parameter with N

  14. Conformal Carroll groups

    NASA Astrophysics Data System (ADS)

    Duval, C.; Gibbons, G. W.; Horvathy, P. A.

    2014-08-01

    Conformal extensions of Lévy-Leblond's Carroll group, based on geometric properties analogous to those of Newton-Cartan space-time are proposed. The extensions are labeled by an integer k. This framework includes and extends our recent study of the Bondi-Metzner-Sachs (BMS) and Newman-Unti (NU) groups. The relation to conformal Galilei groups is clarified. Conformal Carroll symmetry is illustrated by ‘Carrollian photons’. Motion both in the Newton-Cartan and Carroll spaces may be related to that of strings in the Bargmann space.

  15. Spinning Conformal Correlators

    E-print Network

    Miguel S. Costa; Joao Penedones; David Poland; Slava Rychkov

    2015-01-23

    We develop the embedding formalism for conformal field theories, aimed at doing computations with symmetric traceless operators of arbitrary spin. We use an index-free notation where tensors are encoded by polynomials in auxiliary polarization vectors. The efficiency of the formalism is demonstrated by computing the tensor structures allowed in n-point conformal correlation functions of tensors operators. Constraints due to tensor conservation also take a simple form in this formalism. Finally, we obtain a perfect match between the number of independent tensor structures of conformal correlators in d dimensions and the number of independent structures in scattering amplitudes of spinning particles in (d+1)-dimensional Minkowski space.

  16. The Transition from a Neutral-pH Double Helix to a Low-pH Triple Helix Induces a Conformational Switch in the CCCG Tetraloop Closing a Watson-Crick Stem

    Microsoft Academic Search

    Maria J. P. van Dongen; Sybren S. Wijmenga; Gijs A. van der Marel; Jacques H. van Boom; Cornelis W. Hilbers

    1996-01-01

    The CCCG-loop in a DNA fragment, which is capable of forming an intramolecular triple helix as well as a hairpin structure, was investigated by NMR and molecular modeling studies. The structure of this loop is found as a type II conformation, one of the three commonly observed folding patterns of tetraloops, irrespective of the geometry of the underlying helix. In

  17. Logarithmic conformal field theory

    NASA Astrophysics Data System (ADS)

    Gainutdinov, Azat; Ridout, David; Runkel, Ingo

    2013-12-01

    Conformal field theory (CFT) has proven to be one of the richest and deepest subjects of modern theoretical and mathematical physics research, especially as regards statistical mechanics and string theory. It has also stimulated an enormous amount of activity in mathematics, shaping and building bridges between seemingly disparate fields through the study of vertex operator algebras, a (partial) axiomatisation of a chiral CFT. One can add to this that the successes of CFT, particularly when applied to statistical lattice models, have also served as an inspiration for mathematicians to develop entirely new fields: the Schramm-Loewner evolution and Smirnov's discrete complex analysis being notable examples. When the energy operator fails to be diagonalisable on the quantum state space, the CFT is said to be logarithmic. Consequently, a logarithmic CFT is one whose quantum space of states is constructed from a collection of representations which includes reducible but indecomposable ones. This qualifier arises because of the consequence that certain correlation functions will possess logarithmic singularities, something that contrasts with the familiar case of power law singularities. While such logarithmic singularities and reducible representations were noted by Rozansky and Saleur in their study of the U (1|1) Wess-Zumino-Witten model in 1992, the link between the non-diagonalisability of the energy operator and logarithmic singularities in correlators is usually ascribed to Gurarie's 1993 article (his paper also contains the first usage of the term 'logarithmic conformal field theory'). The class of CFTs that were under control at this time was quite small. In particular, an enormous amount of work from the statistical mechanics and string theory communities had produced a fairly detailed understanding of the (so-called) rational CFTs. However, physicists from both camps were well aware that applications from many diverse fields required significantly more complicated non-rational theories. Examples include critical percolation, supersymmetric string backgrounds, disordered electronic systems, sandpile models describing avalanche processes, and so on. In each case, the non-rationality and non-unitarity of the CFT suggested that a more general theoretical framework was needed. Driven by the desire to better understand these applications, the mid-1990s saw significant theoretical advances aiming to generalise the constructs of rational CFT to a more general class. In 1994, Nahm introduced an algorithm for computing the fusion product of representations which was significantly generalised two years later by Gaberdiel and Kausch who applied it to explicitly construct (chiral) representations upon which the energy operator acts non-diagonalisably. Their work made it clear that underlying the physically relevant correlation functions are classes of reducible but indecomposable representations that can be investigated mathematically to the benefit of applications. In another direction, Flohr had meanwhile initiated the study of modular properties of the characters of logarithmic CFTs, a topic which had already evoked much mathematical interest in the rational case. Since these seminal theoretical papers appeared, the field has undergone rapid development, both theoretically and with regard to applications. Logarithmic CFTs are now known to describe non-local observables in the scaling limit of critical lattice models, for example percolation and polymers, and are an integral part of our understanding of quantum strings propagating on supermanifolds. They are also believed to arise as duals of three-dimensional chiral gravity models, fill out hidden sectors in non-rational theories with non-compact target spaces, and describe certain transitions in various incarnations of the quantum Hall effect. Other physical applications range from two-dimensional turbulence and non-equilibrium systems to aspects of the AdS/CFT correspondence and describing supersymmetric sigma models beyond the topological sector. We refer the reader to the

  18. Conformal and non conformal dilaton gravity

    NASA Astrophysics Data System (ADS)

    Alvarez, Enrique; Herrero-Valea, Mario; Martín, C. P.

    2014-10-01

    The quantum dynamics of the gravitational field non-minimally coupled to an (also dynamical) scalar field is studied in the broken phase. For a particular value of the coupling the system is classically conformal, and can actually be understood as the group averaging of Einstein-Hilbert's action under conformal transformations. Conformal invariance implies a simple Ward identity asserting that the trace of the equation of motion for the graviton is the equation of motion of the scalar field. We perform an explicit one-loop computation to show that the DeWitt effective action is not UV divergent on shell and to find that the Weyl symmetry Ward identity is preserved on shell at that level. We also discuss the fate of this Ward identity at the two-loop level — under the assumption that the two-loop UV divergent part of the effective action can be retrieved from the Goroff-Sagnotti counterterm — and show that its preservation in the renormalized theory requires the introduction of counterterms which exhibit a logarithmic dependence on the dilaton field.

  19. Axiomatic Conformal Field Theory

    Microsoft Academic Search

    Matthias R. Gaberdiel; Peter Goddard

    2000-01-01

    :  A new rigourous approach to conformal field theory is presented. The basic objects are families of complex-valued amplitudes,\\u000a which define a meromorphic conformal field theory (or chiral algebra) and which lead naturally to the definition of topological\\u000a vector spaces, between which vertex operators act as continuous operators. In fact, in order to develop the theory, Möbius\\u000a invariance rather than full

  20. Assemblies of Conformal Tanks

    NASA Technical Reports Server (NTRS)

    DeLay, Tom

    2009-01-01

    Assemblies of tanks having shapes that conform to each other and/or conform to other proximate objects have been investigated for use in storing fuels and oxidizers in small available spaces in upper stages of spacecraft. Such assemblies might also prove useful in aircraft, automobiles, boats, and other terrestrial vehicles in which space available for tanks is limited. The basic concept of using conformal tanks to maximize the utilization of limited space is not new in itself: for example, conformal tanks are used in some automobiles to store windshield -washer liquid and coolant that overflows from radiators. The novelty of the present development lies in the concept of an assembly of smaller conformal tanks, as distinguished from a single larger conformal tank. In an assembly of smaller tanks, it would be possible to store different liquids in different tanks. Even if the same liquid were stored in all the tanks, the assembly would offer an advantage by reducing the mechanical disturbance caused by sloshing of fuel in a single larger tank: indeed, the requirement to reduce sloshing is critical in some applications. The figure shows a prototype assembly of conformal tanks. Each tank was fabricated by (1) copper plating a wax tank mandrel to form a liner and (2) wrapping and curing layers of graphite/epoxy composite to form a shell supporting the liner. In this case, the conformal tank surfaces are flat ones where they come in contact with the adjacent tanks. A band of fibers around the outside binds the tanks together tightly in the assembly, which has a quasi-toroidal shape. For proper functioning, it would be necessary to maintain equal pressure in all the tanks.

  1. Conformational sampling techniques.

    PubMed

    Hatfield, Marcus P D; Lovas, Sándor

    2014-01-01

    The potential energy hyper-surface of a protein relates the potential energy of the protein to its conformational space. This surface is useful in determining the native conformation of a protein or in examining a statistical-mechanical ensemble of structures (canonical ensemble). In determining the potential energy hyper-surface of a protein three aspects must be considered; reducing the degrees of freedom, a method to determine the energy of each conformation and a method to sample the conformational space. For reducing the degrees of freedom the choice of solvent, coarse graining, constraining degrees of freedom and periodic boundary conditions are discussed. The use of quantum mechanics versus molecular mechanics and the choice of force fields are also discussed, as well as the sampling of the conformational space through deterministic and heuristic approaches. Deterministic methods include knowledge-based statistical methods, rotamer libraries, homology modeling, the build-up method, self-consistent electrostatic field, deformation methods, tree-based elimination and eigenvector following routines. The heuristic methods include Monte Carlo chain growing, energy minimizations, metropolis monte carlo and molecular dynamics. In addition, various methods to enhance the conformational search including the deformation or smoothing of the surface, scaling of system parameters, and multi copy searching are also discussed. PMID:23947647

  2. Conformations of antipyrines.

    PubMed

    Roumanos, Michael; Kertesz, Miklos

    2011-05-12

    Reliable conformational energetics is essential in interpreting and predicting structures of molecular crystals. We provide a combined density functional theory (DFT)-structural database study, demonstrating that this combination can be used as a foundation for this purpose. A subtle problem of nitrogen pyramidalization is used as the example in antipyrines, a group of bioactive molecules. Nitrogen pyramidalization on the two adjacent sp(3) nitrogens directly affects the orientation of the methyl and phenyl substituents, which tend toward opposite sides of the heteroaromatic ring, affecting crystal packing. Accordingly, the overwhelming majority of the structures of antipyrines in the Cambridge Structural Database (CSD) are either nearly planar or have substituents on the opposite sides of the ring. Recent powder X-ray structures by Lemmerer et al. identified propyphenazone, an antipyrine, to have two substituents on the same side in an apparently sterically crowded conformation. We show that the new structure, although counterintuitive, is not an outlier on the conformational map. A distribution of the conformations of all antipyrines listed in the CSD is in good agreement with the computed conformational map. We also examine the role of the hysteretic property of the phenyl torsion in propyphenazone and its indirect effects on its overall conformation. PMID:21491880

  3. Two-Dimensional Heterospectral Correlation Analysis of the Redox-Induced Conformational Transition in Cytochrome c Using Surface-Enhanced Raman and Infrared Absorption Spectroscopies on a Two-Layer Gold Surface

    PubMed Central

    2013-01-01

    The heme protein cytochrome c adsorbed to a two-layer gold surface modified with a self-assembled monolayer of 2-mercaptoethanol was analyzed using a two-dimensional (2D) heterospectral correlation analysis that combined surface-enhanced infrared absorption spectroscopy (SEIRAS) and surface-enhanced Raman spectroscopy (SERS). Stepwise increasing electric potentials were applied to alter the redox state of the protein and to induce conformational changes within the protein backbone. We demonstrate herein that 2D heterospectral correlation analysis is a particularly suitable and useful technique for the study of heme-containing proteins as the two spectroscopies address different portions of the protein. Thus, by correlating SERS and SEIRAS data in a 2D plot, we can obtain a deeper understanding of the conformational changes occurring at the redox center and in the supporting protein backbone during the electron transfer process. The correlation analyses are complemented by molecular dynamics calculations to explore the intramolecular interactions. PMID:23930980

  4. Helical conformations of semiflexible polymers confined between two concentric cylinders.

    PubMed

    Zhang, Dong; Yang, Zhiyong; Wen, Xiaohui; Xiang, Zhangheng; He, Linli; Ran, Shiyong; Zhang, Linxi

    2011-12-15

    An off-lattice Monte Carlo method was used to study the conformational properties of semiflexible chains confined between two concentric cylinders. The conformations of confined semiflexible chains depend on the bending energy as well as the size of confinement, and the semiflexible chains with particular rigidities confined in the appropriate spaces can form helical structures under entropically driven. The inner cylinder plays a key role in the formation of helical conformations, whereas the outer cylinder affects the size of confinement. Furthermore, the helical structures keep fluctuating like a harmonic oscillation, and the clockwise or counterclockwise helical conformations will appear with the same possibility in the processes of relaxation-helix transitions. This study can help us understand the conformational behaviors of biological macromolecules in confined space. PMID:22011331

  5. An extensive galactic search for conformer II glycine

    NASA Technical Reports Server (NTRS)

    Snyder, L. E.; Hollis, J. M.; Brown, L. W.; Buhl, D.; Suenram, R. D.; Lovas, F. J.

    1983-01-01

    The most extensive galactic search reported to date for conformer II glycine, a higher energy form of the simplest amino acid has been conducted. The search utilized four glycine transitions at centimeter wavelengths and 21 at millimeter wavelengths to observe 18 galactic molecular sources and one comet. No conformer II glycine lines were detected, and measurements of representative sources were used to compute upper limits on total column densities. Several unidentified lines were detected and are reported here with some suggested possible identifications.

  6. Protein Conformational Populations and Functionally Relevant Sub-states

    SciTech Connect

    Agarwal, Pratul K [ORNL; Burger, Virginia [University of Pittsburgh School of Medicine, Pittsburgh PA; Savol, Andrej [University of Pittsburgh School of Medicine, Pittsburgh PA; Ramanathan, Arvind [ORNL; Chennubhotla, Chakra [University of Pittsburgh School of Medicine, Pittsburgh PA

    2013-01-01

    Functioning proteins do not remain fixed in a unique structure, but instead they sample a range of conformations facilitated by motions within the protein. Even in the native state, a protein exists as a collection of interconverting conformations driven by thermodynamic fluctuations. Motions on the fast time scale allow a protein to sample conformations in the nearby area of its conformational landscape, while motions on slower time scales give it access to conformations in distal areas of the landscape. Emerging evidence indicates that protein landscapes contain conformational substates with dynamic and structural features that support the designated function of the protein. Nuclear magnetic resonance (NMR) experiments provide information about conformational ensembles of proteins. X-ray crystallography allows researchers to identify the most populated states along the landscape, and computational simulations give atom-level information about the conformational substates of different proteins. This ability to characterize and obtain quantitative information about the conformational substates and the populations of proteins within them is allowing researchers to better understand the relationship between protein structure and dynamics and the mechanisms of protein function. In this Account, we discuss recent developments and challenges in the characterization of functionally relevant conformational populations and substates of proteins. In some enzymes, the sampling of functionally relevant conformational substates is connected to promoting the overall mechanism of catalysis. For example, the conformational landscape of the enzyme dihydrofolate reductase has multiple substates, which facilitate the binding and the release of the cofactor and substrate and catalyze the hydride transfer. For the enzyme cyclophilin A, computational simulations reveal that the long time scale conformational fluctuations enable the enzyme to access conformational substates that allow it to attain the transition state, therefore promoting the reaction mechanism. In the long term, this emerging view of proteins with conformational substates has broad implications for improving our understanding of enzymes, enzyme engineering, and better drug design. Researchers have already used photoactivation to modulate protein conformations as a strategy to develop a hypercatalytic enzyme. In addition, the alteration of the conformational substates through binding of ligands at locations other than the active site provides the basis for the design of new medicines through allosteric modulation.

  7. Doubled Conformal Compactification

    E-print Network

    Zhao Yong Sun; Yu Tian

    2014-10-16

    We use Weyl transformations between the Minkowski spacetime and dS/AdS spacetime to show that one cannot well define the electrodynamics globally on the ordinary conformal compactification of the Minkowski spacetime (or dS/AdS spacetime), where the electromagnetic field has a sign factor (and thus is discountinuous) at the light cone. This problem is intuitively and clearly shown by the Penrose diagrams, from which one may find the remedy without too much difficulty. We use the Minkowski and dS spacetimes together to cover the compactified space, which in fact leads to the doubled conformal compactification. On this doubled conformal compactification, we obtain the globally well-defined electrodynamics.

  8. Compact conformal manifolds

    NASA Astrophysics Data System (ADS)

    Buican, Matthew; Nishinaka, Takahiro

    2015-01-01

    In this note we begin a systematic study of compact conformal manifolds of SCFTs in four dimensions (our notion of compactness is with respect to the topology induced by the Zamolodchikov metric). Supersymmetry guarantees that such manifolds are Kähler, and so the simplest possible non-trivial compact conformal manifold in this set of geometries is a complex one-dimensional projective space. We show that such a manifold is indeed realized and give a general prescription for constructing complex N-dimensional projective space conformal manifolds as certain small breaking deformations of strongly interacting SCFTs. In many cases, our prescription reduces the construction of such spaces to a study of the chiral ring. We also give an algorithm for constructing more general compact spaces of SCFTs.

  9. Compact Conformal Manifolds

    E-print Network

    Matthew Buican; Takahiro Nishinaka

    2014-11-14

    In this note we begin a systematic study of compact conformal manifolds of SCFTs in four dimensions (our notion of compactness is with respect to the topology induced by the Zamolodchikov metric). Supersymmetry guarantees that such manifolds are Kahler, and so the simplest possible non-trivial compact conformal manifold in this set of geometries is a complex one-dimensional projective space. We show that such a manifold is indeed realized and give a general prescription for constructing complex N-dimensional projective space conformal manifolds as certain small N=2->N=1 breaking deformations of strongly interacting N=2 SCFTs. In many cases, our prescription reduces the construction of such spaces to a study of the N=2 chiral ring. We also give an algorithm for constructing more general compact spaces of SCFTs.

  10. Conformal symmetry and unification

    SciTech Connect

    Pawlowski, Marek [Soltan Institute for Nuclear Studies, Warsaw (Poland)

    1998-12-15

    The Weyl-Weinberg-Salam model is presented. It is based on the local conformal gauge symmetry. The model identifies the Higgs scalar field in SM with the Penrose-Chernikov-Tagirov scalar field of the conformal theory of gravity. Higgs mechanism for generation of particle masses is replaced by the originated in Weyl's ideas conformal gauge scale fixing. Scalar field is no longer a dynamical field of the model and does not lead to quantum particle-like excitations that could be observed in HE experiments. Cosmological constant is naturally generated by the scalar quadric term. Weyl vector bosons can be present in the theory and can mix with photon--Z-boson system.

  11. Conformal Random Geometry

    E-print Network

    Bertrand Duplantier

    2006-08-23

    In these Notes, a comprehensive description of the universal fractal geometry of conformally-invariant scaling curves or interfaces, in the plane or half-plane, is given. The present approach focuses on deriving critical exponents associated with interacting random paths, by exploiting their underlying quantum gravity structure. The latter relates exponents in the plane to those on a random lattice, i.e., in a fluctuating metric, using the so-called Knizhnik, Polyakov and Zamolodchikov (KPZ) map. This is accomplished within the framework of random matrix theory and conformal field theory, with applications to geometrical critical models, like Brownian paths, self-avoiding walks, percolation, and more generally, the O(N) or Q-state Potts models and, last but not least, Schramm's Stochastic Loewner Evolution (SLE_kappa). These Notes can be considered as complementary to those by Wendelin Werner (2006 Fields Medalist!), ``Some Recent Aspects of Random Conformally Invariant Systems,'' arXiv:math.PR/0511268.

  12. Conformal General Relativity

    E-print Network

    V. Pervushin; D. Proskurin

    2001-06-03

    The inflation-free solution of problems of the modern cosmology (horizon, cosmic initial data, Planck era, arrow of time, singularity,homogeneity, and so on) is considered in the conformal-invariant unified theory given in the space with geometry of similarity where we can measure only the conformal-invariant ratio of all quantities. Conformal General Relativity is defined as the $SU_c(3)\\times SU(2)\\times U(1)$-Standard Model where the dimensional parameter in the Higgs potential is replaced by a dilaton scalar field described by the negative Penrose-Chernikov-Tagirov action. Spontaneous SU(2) symmetry breaking is made on the level of the conformal-invariant angle of the dilaton-Higgs mixing, and it allows us to keep the structure of Einstein's theory with the equivalence principle. We show that the lowest order of the linearized equations of motion solves the problems mentioned above and describes the Cold Universe Scenario with the constant temperature T and z-history of all masses with respect to an observable conformal time. A new fact is the intensive cosmic creation of $W,Z$-vector bosons due to their mass singularity. In the rigid state, this effect is determined by the integral of motion $(m_w^2H_{\\rm hubble})^{1/3}=2.7 K k_B$ that coincides with the CMB temperature and has the meaning of the primordial Hubble parameter. The created bosons are enough to consider their decay as an origin of the CMB radiation and all observational matter with the observational element abundances and the baryon asymmetry. Recent Supernova data on the relation between the luminosity distance and redshift (including the point $z=1.7$) do not contradict the dominance of the rigid state of the dark matter in the Conformal Cosmology.

  13. Boundary Conformal Field Theory

    E-print Network

    John Cardy

    2008-02-20

    Boundary conformal field theory (BCFT) is simply the study of conformal field theory (CFT) in domains with a boundary. It gains its significance because, in some ways, it is mathematically simpler: the algebraic and geometric structures of CFT appear in a more straightforward manner; and because it has important applications: in string theory in the physics of open strings and D-branes, and in condensed matter physics in boundary critical behavior and quantum impurity models. In this article, however, I describe the basic ideas from the point of view of quantum field theory, without regard to particular applications nor to any deeper mathematical formulations.

  14. Charged conformal Killing spinors

    NASA Astrophysics Data System (ADS)

    Lischewski, Andree

    2015-01-01

    We study the twistor equation on pseudo-Riemannian Spinc-manifolds whose solutions we call charged conformal Killing spinors (CCKSs). We derive several integrability conditions for the existence of CCKS and study their relations to spinor bilinears. A construction principle for Lorentzian manifolds admitting CCKS with nontrivial charge starting from CR-geometry is presented. We obtain a partial classification result in the Lorentzian case under the additional assumption that the associated Dirac current is normal conformal and complete the classification of manifolds admitting CCKS in all dimensions and signatures ?5 which has recently been initiated in the study of supersymmetric field theories on curved space.

  15. Characterization of DNA conformation inside bacterial viruses

    NASA Astrophysics Data System (ADS)

    Petrov, Anton S.; Locker, C. Rebecca; Harvey, Stephen C.

    2009-08-01

    In this study we develop a formalism to describe the organization of DNA inside bacteriophage capsids during genome packaging. We have previously shown that DNA inside bacteriophage phi29 (?29) is organized into folded toroids [A. S. Petrov and S. C. Harvey, Structure 15, 21 (2007)], whereas epsilon15 (?15) reveals the coaxial organization of the genetic material [A. S. Petrov, K. Lim-Hing, and S. C. Harvey, Structure 15, 807 (2007)]. We now show that each system undergoes two consecutive transitions. The first transition corresponds to the formation of global conformations and is analogous to a disorder-order conformational transition. The second transition is characterized by a significant loss of DNA mobility at the local level leading to glasslike dynamic behavior. Packing genetic material inside bacteriophages can be used as a general model to study the behavior of semiflexible chains inside confined spaces, and the proposed formalism developed here can be used to study other systems of linear polymer chains confined to closed spaces.

  16. Galilean conformal and superconformal symmetries

    SciTech Connect

    Lukierski, J., E-mail: lukier@ift.uni.wroc.pl [University of Wroclaw, Institute for Theoretical Physics (Poland)

    2012-10-15

    Firstly we discuss briefly three different algebras named as nonrelativistic (NR) conformal: Schroedinger, Galilean conformal, and infinite algebra of local NR conformal isometries. Further we shall consider in some detail Galilean conformal algebra (GCA) obtained in the limit c{yields}{infinity} from relativistic conformal algebraO(d+1, 2) (d-number of space dimensions). Two different contraction limits providing GCA and some recently considered realizations will be briefly discussed. Finally by considering NR contraction of D = 4 superconformal algebra the Galilei conformal superalgebra (GCSA) is obtained, in the formulation using complexWeyl supercharges.

  17. Computation of Conformational Coupling in Allosteric Proteins

    PubMed Central

    Kidd, Brian A.; Baker, David; Thomas, Wendy E.

    2009-01-01

    In allosteric regulation, an effector molecule binding a protein at one site induces conformational changes, which alter structure and function at a distant active site. Two key challenges in the computational modeling of allostery are the prediction of the structure of one allosteric state starting from the structure of the other, and elucidating the mechanisms underlying the conformational coupling of the effector and active sites. Here we approach these two challenges using the Rosetta high-resolution structure prediction methodology. We find that the method can recapitulate the relaxation of effector-bound forms of single domain allosteric proteins into the corresponding ligand-free states, particularly when sampling is focused on regions known to change conformation most significantly. Analysis of the coupling between contacting pairs of residues in large ensembles of conformations spread throughout the landscape between and around the two allosteric states suggests that the transitions are built up from blocks of tightly coupled interacting sets of residues that are more loosely coupled to one another. PMID:19714199

  18. Metamaterials with conformational nonlinearity

    E-print Network

    Metamaterials with conformational nonlinearity Mikhail Lapine1,2 , Ilya V. Shadrivov1,2 , David A development, metamaterials became a prominent area of research, bridging theoretical and applied electrodynamics, electrical engineering and material science. Being man-made structures, metamaterials offer

  19. Nonrelativistic conformal field theories

    Microsoft Academic Search

    Yusuke Nishida; Dam T. Son

    2007-01-01

    We study representations of the Schrödinger algebra in terms of operators in nonrelativistic conformal field theories. We prove a correspondence between primary operators and eigenstates of few-body systems in a harmonic potential. Using the correspondence we compute analytically the energy of fermions at unitarity in a harmonic potential near two and four spatial dimensions. We also compute the energy of

  20. Nonrational conformal field theory

    E-print Network

    J. Teschner

    2008-03-06

    We discuss the problem to develop a mathematical theory of a certain class of nonrational conformal field theories (CFT) which contain the unitary CFT. A variant of the concept of a modular functor is proposed that appears to be suitable for such CFT.

  1. Conformal transformation optics

    NASA Astrophysics Data System (ADS)

    Xu, Lin; Chen, Huanyang

    2015-01-01

    The field of transformation optics shows that media containing gradients in optical properties are equivalent to curved geometries of spacetime for the propagation of light. Conformal transformation optics -- a particular variant of this feature -- can be used to design devices with novel functionalities from inhomogeneous, isotropic dielectric media.

  2. Conforming polygonal finite elements

    Microsoft Academic Search

    N. Sukumar; A. Tabarraei

    2004-01-01

    SUMMARY In this paper, conforming finite elements on polygon meshes are developed. Polygonal finite elements provide greater flexibility in mesh generation and are better-suited for applications in solid mechanics which involve a significant change in the topology of the material domain. In this study, recent advances in meshfree approximations, computational geometry, and computer graphics are used to construct different trial

  3. CONFORMANCE IMPROVEMENT USING GELS

    Microsoft Academic Search

    Randall S. Seright

    2004-01-01

    This report describes work performed during the third and final year of the project, ''Conformance Improvement Using Gels.'' Corefloods revealed throughput dependencies of permeability reduction by polymers and gels that were much more prolonged during oil flow than water flow. This behavior was explained using simple mobility ratio arguments. A model was developed that quantitatively fits the results and predicts

  4. Electronically Rich N-Substituted Tetrahydroisoquinoline 3-Carboxylic Acid Esters: Concise Synthesis and Conformational Studies

    PubMed Central

    Al-Horani, Rami A.; Desai, Umesh R.

    2012-01-01

    Recent work in our laboratory has shown that the highly substituted, electronically rich 1,2,3,4–tetrahydroisoquinoline–3–carboxylic acid (THIQ3CA) scaffold is a key building block for a novel class of promising anticoagulants (Al-Horani et al. J. Med. Chem. 2011, 54, 6125–6138). The synthesis of THIQ3CA analogs, especially containing specific, electronically rich substituents, has been a challenge and essentially no efficient methods have been reported in the literature. We describe three complementary, glycine donor-based strategies for high yielding synthesis of highly substituted, electronically rich THIQ3CA esters. Three glycine donors studied herein include hydantoin 1, (±)-Boc-?-phosphonoglycine trimethyl ester 2 and (±)-Z-?-phosphonoglycine trimethyl ester 3. Although the synthesis of THIQ3CA analogs could be achieved using either of the three, an optimal, high yielding approach for the desired THIQ3CA esters was best achieved using 3 in three mild, efficient steps. Using this approach, a focused library of advanced N-arylacyl, N-arylalkyl, and bis-THIQ3CA analogs was synthesized. Variable temperature and solvent-dependent NMR chemical shift studies indicated the presence of two major conformational rotamers in 3:1 proportion for N–arylacyl–THIQ3CA analogs, which were separated by a high kinetic barrier of ~17 kcal/mol. In contrast, N–arylalkyl and bis–THIQ3CA variants displayed no rotamerism, which implicates restricted rotation around the amide bond as the origin for high-barrier conformational interconversion. This phenomenon is of major significance because structure-based drug design typically utilizes only one conformation. Overall, the work presents fundamental studies on the synthesis and conformational properties of highly substituted, electronically rich THIQ3CA analogs. PMID:22665943

  5. Atomic cranks and levers control sugar ring conformations

    NASA Astrophysics Data System (ADS)

    Zhang, Qingmin; Lee, Gwangrog; Marszalek, Piotr E.

    2005-05-01

    In this paper we review the conformational analysis of sugar rings placed under tension during mechanical manipulations of single polysaccharide molecules with the atomic force microscope and during steered molecular dynamics simulations. We examine the role of various chemical bonds and linkages between sugar rings in inhibiting or promoting their conformational transitions by means of external forces. Small differences in the orientation of one chemical bond on the sugar ring can produce significantly different mechanical properties at the polymer level as exemplified by two polysaccharides: cellulose, composed of ?-1\\to 4 -linked D-glucose, and amylose, composed of ?-1\\to 4 -linked D-glucose. In contrast to ?-glucose rings, which are mechanically stable and produce simple entropic elasticity of the chain, ?-glucose rings flip under tension from their chair to a boat-like structure and these transitions produce deviations of amylose elasticity from the freely jointed chain model. We also examine the deformation of two mechanically complementary 1 \\to 6 -linked polysaccharides: pustulan, a ?-1\\to 6 -linked glucan, and dextran, a ?-1\\to 6 -linked glucan. Forced rotations about the C5-C6 bonds govern the elasticity of pustulan, and complex conformational transitions that involve simultaneous C5-C6 rotations and chair-boat transitions govern the elasticity of dextran. Finally, we discuss the likelihood of various conformational transitions in sugar rings in biological settings and speculate on their significance.

  6. Solid state NMR measurements of conformation and conformational

    E-print Network

    Weliky, David

    Solid state NMR measurements of conformation and conformational distributions in the membrane Lansing, MI, USA The solid state NMR lineshape of a protein backbone carbonyl nucleus is a general conformation in the distri- bution. These types of solid state NMR methodologies have been applied

  7. CONFORMAL INVARIANT QUANTUM FIELD THEORY CONFORMAL INVARIANT QUANTUM FIELD THEORY

    E-print Network

    Boyer, Edmond

    CONFORMAL INVARIANT QUANTUM FIELD THEORY CONFORMAL INVARIANT QUANTUM FIELD THEORY G. MACK Institut invariant quantum field theory (QFT). Such a theory, if it exists, has a good chance of being relevant will address ourselves to the question of the construction and properties of a non-trivial exactly conformal

  8. Determination of conformational free energies of peptides by multidimensional adaptive umbrella sampling

    NASA Astrophysics Data System (ADS)

    Wang, Jun; Gu, Yan; Liu, Haiyan

    2006-09-01

    We improve the multidimensional adaptive umbrella sampling method for the computation of conformational free energies of biomolecules. The conformational transition between the ?-helical and ?-hairpin conformational states of an alanine decapeptide is used as an example. Convergence properties of the weighted-histogram-analysis-based adaptive umbrella sampling can be improved by using multiple replicas in each adaptive iteration and by using adaptive updating of the bounds of the umbrella potential. Using positional root-mean-square deviations from structures of the ?-helical and ?-hairpin reference states as reaction coordinates, we obtained well-converged free energy surfaces of both the in-vacuum and in-solution decapeptide systems. From the free energy surfaces well-converged relative free energies between the two conformational states can be derived. Advantages and disadvantages of different methods for obtaining conformational free energies as well as implications of our results in studying conformational transitions of proteins and in improving force field are discussed.

  9. Loop Virasoro Lie conformal algebra

    SciTech Connect

    Wu, Henan, E-mail: wuhenanby@163.com; Chen, Qiufan; Yue, Xiaoqing [Department of Mathematics, Tongji University, Shanghai 200092 (China)] [Department of Mathematics, Tongji University, Shanghai 200092 (China)

    2014-01-15

    The Lie conformal algebra of loop Virasoro algebra, denoted by CW, is introduced in this paper. Explicitly, CW is a Lie conformal algebra with C[?]-basis (L{sub i} | i?Z) and ?-brackets [L{sub i}?{sub ?}?L{sub j}] = (???2?)L{sub i+j}. Then conformal derivations of CW are determined. Finally, rank one conformal modules and Z-graded free intermediate series modules over CW are classified.

  10. Relaxation time of non-conformal plasma

    E-print Network

    Alex Buchel

    2009-11-27

    We study effective relaxation time of viscous hydrodynamics of strongly coupled non-conformal gauge theory plasma using gauge theory/string theory correspondence. We compute leading corrections to the conformal plasma relaxation time from the relevant deformations due to dim-2 and dim-3 operators. We discuss in details the relaxation time tau_eff of N=2^* plasma. For a certain choice of masses this theory undergoes a phase transition with divergent specific heat c_V ~ |1-T_c/T|^(-1/2). Although the bulk viscosity remains finite all the way to the critical temperature, we find that tau_eff diverges near the critical point as tau_eff ~ |1-T_c/T|^(-1/2).

  11. An Expression of Periodic Phenomena of Fashion on Sexual Selection Model with Conformity Genes and Memes

    NASA Astrophysics Data System (ADS)

    Mutoh, Atsuko; Tokuhara, Shinya; Kanoh, Masayoshi; Oboshi, Tamon; Kato, Shohei; Itoh, Hidenori

    It is generally thought that living things have trends in their preferences. The mechanism of occurrence of another trends in successive periods is concerned in their conformity. According to social impact theory, the minority is always exists in the group. There is a possibility that the minority make the transition to the majority by conforming agents. Because of agent's promotion of their conform actions, the majority can make the transition. We proposed an evolutionary model with both genes and memes, and elucidated the interaction between genes and memes on sexual selection. In this paper, we propose an agent model for sexual selection imported the concept of conformity. Using this model we try an environment where male agents and female agents are existed, we find that periodic phenomena of fashion are expressed. And we report the influence of conformity and differentiation on the transition of their preferences.

  12. Conformation of Oligo(Ethylene Glycol) grafted Poly(Norbornene) in solutions: A Small Angle Neutron Scattering Study

    SciTech Connect

    Cheng, Gang [ORNL; Melnichenko, Yuri B [ORNL; Hua, Fengjun [ORNL; Hong, Kunlun [ORNL; Wignall, George D [ORNL; Hammouda, B. [National Institute of Standards and Technology (NIST); Mays, Jimmy [ORNL

    2008-01-01

    The structure of thermo sensitive poly(methoxyoligo(ethylene glycol) norbornenyl esters) homopolymers in dilute solution was investigated by Small Angle Neutron Scattering (SANS). The homopolymers consist of a polynorbornene (PNB) backbone with a degree of polymerization (DP) of 50, and each backbone monomer has a grafted Ethylene Glycol (EG) side chain with an average DP of 6.6. The hydrophobic backbone and hydrophilic side chains interact differently with solvents depending on their polarity, which makes the conformation very sensitive to the solvent quality. The polymer conformation was studied in two solvents, d-toluene and D2O, with the aim of understanding the influence of solvent/polymer interactions on the resulting structures. It was found that in a 0.5 wt. % solution in d-toluene the polymers assume wormlike chains and gradually contract with increasing polymer concentration. In a 0.5 wt. % solution in D2O, the polymers are partially contracted at room temperature and their conformation can be described by the form factor of a rigid cylinder. The volume of the cylinder shows no concentration dependence. Furthermore, the polymers in D2O collapse at higher temperatures due to decreasing solubility of the side chains in water.

  13. Ambient connections realising conformal Tractor

    E-print Network

    Olver, Peter

    Ambient connections realising conformal Tractor holonomy Thomas Leistner, University of Adelaide in the holonomy of the normal conformal Tractor connection, Holp(T , T ) := {P T | loop around p}. 2 #12;Ambient Metrics Let : Q Mn be a conformal structure. Mn+2 is an ambient manifold if free R+-action on M

  14. CONFORMAL FIELD THEORY Krzysztof Gawedzki

    E-print Network

    LECTURES on CONFORMAL FIELD THEORY Krzysztof Gaw¸edzki C.N.R.S., I.H.E.S., 91440 Bures­sur­Yvette, France Introduction Over the last decade and a half, conformal field theory (CFT) has been one of the theory of conformally invariant quantum fields in two space­time dimensions. The two­dimensional CFT

  15. Substrate conformations set the rate of enzymatic acrylation by lipases.

    PubMed

    Syrén, Per-Olof; Hult, Karl

    2010-04-12

    Acrylates represent a class of alpha,beta-unsaturated compounds of high industrial importance. We investigated the influence of substrate conformations on the experimentally determined reaction rates of the enzyme-catalysed transacylation of methyl acrylate and derivatives by ab initio DFT B3LYP calculations and molecular dynamics simulations. The results supported a least-motion mechanism upon the sp(2) to sp(3) substrate transition to reach the transition state in the enzyme active site. This was in accordance with our hypothesis that acrylates form productive transition states from their low-energy s-sis/s-trans conformations. Apparent k(cat) values were measured for Candida antarctica lipase B (CALB), Humicola insolens cutinase and Rhizomucor miehei lipase and were compared to results from computer simulations. More potent enzymes for acryltransfer, such as the CALB mutant V190A and acrylates with higher turnover numbers, showed elevated populations of productive transition states. PMID:20301160

  16. The detection of conformational disorder by thermal analysis

    SciTech Connect

    Wunderlich, B.

    1988-01-01

    Conformational disorder in crystals is found in many molecules that possess a plurality of conformational isomers. Typical examples are linear macromolecules such as polyethylene, polytetrafluoroethylene and trans-1,4-polybutadiene; and small molecules such as paraffins, cycloparaffins, soaps, lipids and many liquid-crystal forming molecules. Conformational motion is often coupled with the cooperative creation of disorder. In this case a heat and entropy of transition is observed by thermal analysis. Levels of transition entropies can be estimated, assuming most of the disorder can be traced to conformational isomerism. In case there is conformational disorder frozen-in at low temperature, thermal analysis can be used to find the glass transition of a condis crystal. An Advanced Thermal Analysis System has been developed, and will be described that permits a detailed interpretation of the thermal analysis traces. It rests with the establishment of high quality heat capacity for the rigid solid state (vibration only) and the mobile liquid state (vibrations and large amplitude cooperative motion). 36 refs., 3 figs.

  17. Conformal gripping device

    NASA Technical Reports Server (NTRS)

    Vranish, John M. (Inventor)

    2009-01-01

    The present invention relates to a conformal gripping device. In an embodiment of the present invention a conformal gripper device may be disclosed comprising a frame that includes an array of movable pins. The device may also include a roller locking and unlocking system within the frame. The system may comprise a pair of locking rollers for each row of gripper pins to facilitate locking and unlocking the array of gripper pins on a column-by-column basis. The system may also include a striker element that may force the locking rollers to roll along an angled roll surface to facilitate unlocking of the array of pins on a column-by-column basis. The system may further include an electromagnetic actuator or solenoid and permanent magnets to facilitate movement of the striker element and the locking rollers.

  18. Nonrelativistic conformal field theories

    E-print Network

    Yusuke Nishida; Dam T. Son

    2007-10-31

    We study representations of the Schr\\"odinger algebra in terms of operators in nonrelativistic conformal field theories. We prove a correspondence between primary operators and eigenstates of few-body systems in a harmonic potential. Using the correspondence we compute analytically the energy of fermions at unitarity in a harmonic potential near two and four spatial dimensions. We also compute the energy of anyons in a harmonic potential near the bosonic and fermionic limits.

  19. Nonrelativistic conformal field theories

    SciTech Connect

    Nishida, Yusuke; Son, Dam T. [Institute for Nuclear Theory, University of Washington, Seattle, Washington 98195-1550 (United States)

    2007-10-15

    We study representations of the Schroedinger algebra in terms of operators in nonrelativistic conformal field theories. We prove a correspondence between primary operators and eigenstates of few-body systems in a harmonic potential. Using the correspondence we compute analytically the energy of fermions at unitarity in a harmonic potential near two and four spatial dimensions. We also compute the energy of anyons in a harmonic potential near the bosonic and fermionic limits.

  20. Metric-Torsional Conformal Gravity

    E-print Network

    Luca Fabbri

    2014-04-10

    When in general geometric backgrounds the metric is accompanied by torsion, the metric conformal properties should correspondingly be followed by analogous torsional conformal properties; however a combined metric torsional conformal structure has never been found which provides a curvature that is both containing metric-torsional degree of freedom and conformally invariant: in this paper we construct such a metric-torsional conformal curvature. We proceed by building the most general action, then deriving the most general system of field equations; we check their consistency by showing that both conservation laws and trace condition are verified. Final considerations and comments are outlined.

  1. Dissecting conformational contributions to glycosidase catalysis and inhibition

    PubMed Central

    Speciale, Gaetano; Thompson, Andrew J; Davies, Gideon J; Williams, Spencer J

    2014-01-01

    Glycoside hydrolases (GHs) are classified into >100 sequence-based families. These enzymes process a wide variety of complex carbohydrates with varying stereochemistry at the anomeric and other ring positions. The shapes that these sugars adopt upon binding to their cognate GHs, and the conformational changes that occur along the catalysis reaction coordinate is termed the conformational itinerary. Efforts to define the conformational itineraries of GHs have focussed upon the critical points of the reaction: substrate-bound (Michaelis), transition state, intermediate (if relevant) and product-bound. Recent approaches to defining conformational itineraries that marry X-ray crystallography of enzymes bound to ligands that mimic the critical points, along with advanced computational methods and kinetic isotope effects are discussed. PMID:25016573

  2. Overlapping double turn conformations adopted by tetrapeptides containing non-coded alpha-amino isobutyric acid (Aib) and formation of tape-like structures through supramolecular helix mediated self-assembly.

    PubMed

    Kar, Sudeshna; Dutta, Arpita; Drew, M G B; Koley, Pradyot; Pramanik, Animesh

    2009-01-01

    Single crystal X-ray diffraction studies and solvent dependent (1)H NMR titrations reveal that a set of four tetrapeptides with general formula Boc-Xx(1)-Aib(2)-Yy(3)-Zz(4)-OMe, where Xx, Yy and Zz are coded L-amino acids, adopt equivalent conformations that can be described as overlapping double turn conformations stabilized by two 4-->1 intramolecular hydrogen bonds between Yy(3)-NH and Boc C=O and Zz(4)-NH and Xx(1)C=O. In the crystalline state, the double turn structures are packed in head-to-tail fashion through intermolecular hydrogen bonds to create supramolecular helical structures. Field emission scanning electron microscopic (FE-SEM) images of the tetrapeptides in the solid state reveal that they can form flat tape-like structures. The results establish that synthetic Aib containing supramolecular helices can form highly ordered self-aggregated amyloid plaque like human amylin. PMID:19508219

  3. Conformal superalgebras via tractor calculus

    NASA Astrophysics Data System (ADS)

    Lischewski, Andree

    2015-01-01

    We use the manifestly conformally invariant description of a Lorentzian conformal structure in terms of a parabolic Cartan geometry in order to introduce a superalgebra structure on the space of twistor spinors and normal conformal vector fields formulated in purely algebraic terms on parallel sections in tractor bundles. Via a fixed metric in the conformal class, one reproduces a conformal superalgebra structure that has been considered in the literature before. The tractor approach, however, makes clear that the failure of this object to be a Lie superalgebra in certain cases is due to purely algebraic identities on the spinor module and to special properties of the conformal holonomy representation. Moreover, it naturally generalizes to higher signatures. This yields new formulas for constructing new twistor spinors and higher order normal conformal Killing forms out of existing ones, generalizing the well-known spinorial Lie derivative. Moreover, we derive restrictions on the possible dimension of the space of twistor spinors in any metric signature.

  4. 40 CFR 93.106 - Content of transportation plans and timeframe of conformity determinations.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...2012-07-01 false Content of transportation plans and timeframe of conformity...or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed...Transit Laws § 93.106 Content of transportation plans and timeframe of...

  5. 40 CFR 93.106 - Content of transportation plans and timeframe of conformity determinations.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...2013-07-01 false Content of transportation plans and timeframe of conformity...or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed...Transit Laws § 93.106 Content of transportation plans and timeframe of...

  6. 40 CFR 93.106 - Content of transportation plans and timeframe of conformity determinations.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...2013-07-01 true Content of transportation plans and timeframe of conformity...or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed...Transit Laws § 93.106 Content of transportation plans and timeframe of...

  7. 40 CFR 93.106 - Content of transportation plans and timeframe of conformity determinations.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...2011-07-01 false Content of transportation plans and timeframe of conformity...or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed...Transit Laws § 93.106 Content of transportation plans and timeframe of...

  8. The QCD string spectrum and conformal field theory

    SciTech Connect

    Keisuke Jimmy Juge; Julius Kuti; Colin Morningstar

    2002-12-19

    The low energy excitation spectrum of the critical Wilson surface is discussed between the roughening transition and the continuum limit of lattice QCD. The fine structure of the spectrum is interpreted within the framework of two-dimensional conformal field theory.

  9. Conformations of amphiphilic polyelectrolyte stars with diblock copolymer arms

    E-print Network

    Alexey A. Polotsky; Tatiana M. Birshtein; Mohamed Daoud; Oleg V. Borisov

    2012-05-12

    We consider conformations and intra-molecular conformational transitions in amphiphilic starlike polymers formed by diblock copolymer arms with inner hydrophobic and outer polyelectrolyte blocks. A combination of an analytical mean-field theory with the assumption-free numerical self-consistent field (SCF) modeling approach is applied. It is demonstrated that unimolecular micelles with collapsed hydrophobic cores and swollen polyelectrolyte coronae are formed in dilute aqueous solutions at high ionic strength or/and low degree of ionization of the outer hydrophilic block. An intra-molecular conformational transition related to the unfolding of the hydrophobic core of the unimolecular micelles can be triggered by a decrease in the ionic strength of the solution or/and increase in the degree of ionization of the coronal blocks. In the stars with large number of diblock copolymer arms the transition between conformations with collapsed or stretched core-forming blocks occurs continuously by progressive unfolding of the core domain. By contrast, in the stars with relatively small number of arms the continuous unfolding of the core is interrupted by an abrupt unravelling transition. A detailed SCF analysis indicates that under both unfolding scenario the arms of the star are extended fairly equally, i.e., no intra-molecular disproportionation occurs.

  10. Metamaterials with conformational nonlinearity

    PubMed Central

    Lapine, Mikhail; Shadrivov, Ilya V.; Powell, David A.; Kivshar, Yuri S.

    2011-01-01

    Within a decade of fruitful development, metamaterials became a prominent area of research, bridging theoretical and applied electrodynamics, electrical engineering and material science. Being man-made structures, metamaterials offer a particularly useful playground to develop interdisciplinary concepts. Here we demonstrate a novel principle in metamaterial assembly which integrates electromagnetic, mechanical, and thermal responses within their elements. Through these mechanisms, the conformation of the meta-molecules changes, providing a dual mechanism for nonlinearity and offering nonlinear chirality. Our proposal opens a wide road towards further developments of nonlinear metamaterials and photonic structures, adding extra flexibility to their design and control. PMID:22355655

  11. Metamaterials with conformational nonlinearity

    E-print Network

    Lapine, Mikhail; Powell, David A; Kivshar, Yuri S

    2011-01-01

    Within a decade of fruitful developments, metamaterials became a prominent area of research, bridging theoretical and applied electrodynamics, electrical engineering and material science. Being man-made structures, metamaterials offer a particularly useful playground to develop novel interdisciplinary concepts. Here we demonstrate a novel principle in metamaterial assembly which integrates electromagnetic, mechanical, and thermal responses within their elements. Through these mechanisms, the conformation of the meta-molecules changes, providing a dual mechanism for nonlinearity and offering nonlinear chirality. Our proposal opens a wide road towards further developments of nonlinear metamaterials and photonic structures, adding extra flexibility to their design and control.

  12. Parafermionic conformal field theory on the lattice

    NASA Astrophysics Data System (ADS)

    Mong, Roger S. K.; Clarke, David J.; Alicea, Jason; Lindner, Netanel H.; Fendley, Paul

    2014-11-01

    Finding the precise correspondence between lattice operators and the continuum fields that describe their long-distance properties is a largely open problem for strongly interacting critical points. Here, we solve this problem essentially completely in the case of the three-state Potts model, which exhibits a phase transition described by a strongly interacting ‘parafermion’ conformal field theory. Using symmetry arguments, insights from integrability, and extensive simulations, we construct lattice analogues of nearly all the relevant and marginal physical fields governing this transition. This construction includes chiral fields such as the parafermion. Along the way we also clarify the structure of operator product expansions between order and disorder fields, which we confirm numerically. Our results both suggest a systematic methodology for attacking non-free field theories on the lattice and find broader applications in the pursuit of exotic topologically ordered phases of matter.

  13. Transition States and transition state analogue interactions with enzymes.

    PubMed

    Schramm, Vern L

    2015-04-21

    Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding. PMID:25848811

  14. Conformal positive mass theorems

    E-print Network

    Walter Simon

    2000-03-29

    We show the following two extensions of the standard positive mass theorem (one for either sign): Let (N,g) and (N,g') be asymptotically flat Riemannian 3-manifolds with compact interior and finite mass, such that g and g' are twice Hoelder differentiable and related via the conformal rescaling g' = (phi^4).g, with a twice Hoelder differentiable function phi>0. Assume further that the corresponding Ricci scalars satisfy either R + (phi^4).R' >= 0 or R - (phi^4).R' >= 0. Then the corresponding masses satisfy m + m' >= 0 or m - m' >= 0, respectively. Moreover, in the case of the minus signs, equality holds iff g and g' are isometric, whereas for the plus signs equality holds iff both (N,g) and (N,g') are flat Euclidean spaces. While the proof of the case with the minus signs is rather obvious, the case with the plus signs requires a subtle extension of Witten's proof of the standard positive mass theorem. The idea for this extension is due to Masood-ul-Alam who, in the course of an application, proved the rigidity part m + m' = 0 of this theorem, for a special conformal factor. We observe that Masood-ul-Alam's method extends to the general situation.

  15. Algebraic Coset Conformal Field Theories

    Microsoft Academic Search

    Feng Xu

    2000-01-01

    :  All unitary Rational Conformal Field Theories (RCFT) are conjectured to be related to unitary coset Conformal Field Theories,\\u000a i.e., gauged Wess–Zumino–Witten (WZW) models with compact gauge groups. In this paper we use subfactor theory and ideas of\\u000a algebraic quantum field theory to approach coset Conformal Field Theories. Two conjectures are formulated and their consequences\\u000a are discussed. Some results are presented

  16. Conformational dynamics in a truncated epidermal growth factor receptor ectodomain.

    PubMed

    Kozer, Noga; Rothacker, Julie; Burgess, Antony W; Nice, Edouard C; Clayton, Andrew H A

    2011-06-14

    Structural studies have revealed two forms of the monomeric epidermal growth factor receptor (EGFR) ectodomain: a compact (tethered) form stabilized by interdomain interactions and an extended (untethered) form in the presence of ligand. An important question is whether the ligand induces a conformational transition from a tethered to untethered form or whether there is a preexisting conformational equilibrium between tethered and untethered states. To distinguish between these two possibilities, we investigated a truncated receptor, EGFR501 (spanning residues 1-501), that contains the minimal elements required for high-affinity ligand binding in solution. Conformational transitions and dynamics were inferred by means of fluorescence from five internal tryptophan residues that are located within or close to the ligand-binding domains of EGFR501. A preexisting conformational equilibrium between tethered and untethered states in EGFR501 was deduced from (1) the nonlinear Arrhenius temperature dependence of fluorescence and (2) fluorescence polarization showing independently mobile domains. In contrast, the ligand-EGFR501 complex revealed a linear Arrhenius temperature dependence of fluorescence and increased fluorescence polarization due to a lack of significant interdomain motions. The data suggest that the role of the ligand is to trap the EGFR501 in the untethered state that is transiently formed in solution through a preexisting conformational equilibrium. PMID:21591616

  17. Conformational analysis and circular dichroism of bilirubin, the yellow pigment of jaundice

    NASA Astrophysics Data System (ADS)

    Lightner, David A.; Person, Richard; Peterson, Blake; Puzicha, Gisbert; Pu, Yu-Ming; Bojadziev, Stefan

    1991-06-01

    Conformational analysis of (4Z, 15Z)-bilirubin-IX(alpha) by molecular mechanics computations reveals a global energy minimum folded conformation. Powerful added stabilization is achieved through intramolecular hydrogen bonding. Theoretical treatment of bilirubin as a molecular exciton predicts an intense bisignate circular dichroism spectrum for the folded conformation: (Delta) (epsilon) is congruent to 270 L (DOT) mole-1 (DOT) cm-1 for the $OM450 nm electronic transition(s). Synthesis of bilirubin analogs with propionic acid groups methylated at the (alpha) or (beta) position introduces an allosteric effect that allows for an optical resolution of the pigments, with enantiomers exhibiting the theoretically predicted circular dichroism.

  18. Analysis of the stability of looped-out and stacked-in conformations of an adenine bulge in DNA using a continuum model for solvent and ions.

    PubMed Central

    Zacharias, M; Sklenar, H

    1997-01-01

    A combination of conformational search, energy minimization, and energetic evaluation using a continuum solvent treatment has been employed to study the stability of various conformations of the DNA fragment d(CGCAGAA)/d(TTCGCG) containing a single adenine bulge. The extra-helical (looped-out) bulge conformation derived from a published x-ray structure and intra-helical (stacked bulge base) model structures partially based on nuclear magnetic resonance (NMR) data were used as start structures for the conformational search. Solvent-dependent contributions to the stability of the conformations were calculated from the solvent exposed molecular surface area and by using the finite difference Poisson-Boltzmann approach. Three classes (I-III) of bulge conformations with calculated low energies can be distinguished. The lowest-energy conformations were found in class I, corresponding to structures with the bulge base stacked between flanking helices, and class II, composed of structures forming a triplet of the bulge base and a flanking base pair. All extra-helical bulge structures, forming class III, were found to be less stable compared with the lowest energy structures of class I and II. The results are consistent with NMR data on an adenine bulge in the same sequence context indicating an intra-helical or triplet bulge conformation in solution. Although the total energies and total electrostatic energies of the low-energy conformations show only relatively modest variations, the energetic contributions to the stability were found to vary significantly among the classes of bulge structures. All intra-helical bulge structures are stabilized by a more favorable Coulomb charge-charge interaction but destabilized by a larger electrostatic reaction field contribution compared with all extra-helical and most triplet bulge structures. Van der Waals packing interactions and nonpolar surface-area-dependent contributions appear to favor triplet class II structures and to a lesser degree also the intra-helical stacked bulge conformations. The large conformational variation found for class III conformers might add a favorable entropic contribution to the stability of the extra-helical bulge form. PMID:9414214

  19. Logarithmic Conformal Field Theory Through Nilpotent Conformal Dimensions

    E-print Network

    Moghimi-Araghi, S; Saadat, M

    2001-01-01

    We study logarithmic conformal field theories (LCFTs) through the introduction of nilpotent conformal weights. Using this device, we derive the properties of LCFT's such as the transformation laws, singular vectors and the structure of correlation functions. We discuss the emergence of an extra energy momentum tensor, which is the logarithmic partner of the energy momentum tensor.

  20. Conformational Dynamics of a Ligand-Free Adenylate Kinase

    PubMed Central

    Song, Hyun Deok; Zhu, Fangqiang

    2013-01-01

    Adenylate kinase (AdK) is a phosphoryl-transfer enzyme with important physiological functions. Based on a ligand-free open structure and a ligand-bound closed structure solved by crystallography, here we use molecular dynamics simulations to examine the stability and dynamics of AdK conformations in the absence of ligands. We first perform multiple simulations starting from the open or the closed structure, and observe their free evolutions during a simulation time of 100 or 200 nanoseconds. In all seven simulations starting from the open structure, AdK remained stable near the initial conformation. The eight simulations initiated from the closed structure, in contrast, exhibited large variation in the subsequent evolutions, with most (seven) undergoing large-scale spontaneous conformational changes and approaching or reaching the open state. To characterize the thermodynamics of the transition, we propose and apply a new sampling method that employs a series of restrained simulations to calculate a one-dimensional free energy along a curved pathway in the high-dimensional conformational space. Our calculated free energy profile features a single minimum at the open conformation, and indicates that the closed state, with a high (?13 kcal/mol) free energy, is not metastable, consistent with the observed behaviors of the unrestrained simulations. Collectively, our simulations suggest that it is energetically unfavorable for the ligand-free AdK to access the closed conformation, and imply that ligand binding may precede the closure of the enzyme. PMID:23861846

  1. Conformational dynamics of a ligand-free adenylate kinase.

    PubMed

    Song, Hyun Deok; Zhu, Fangqiang

    2013-01-01

    Adenylate kinase (AdK) is a phosphoryl-transfer enzyme with important physiological functions. Based on a ligand-free open structure and a ligand-bound closed structure solved by crystallography, here we use molecular dynamics simulations to examine the stability and dynamics of AdK conformations in the absence of ligands. We first perform multiple simulations starting from the open or the closed structure, and observe their free evolutions during a simulation time of 100 or 200 nanoseconds. In all seven simulations starting from the open structure, AdK remained stable near the initial conformation. The eight simulations initiated from the closed structure, in contrast, exhibited large variation in the subsequent evolutions, with most (seven) undergoing large-scale spontaneous conformational changes and approaching or reaching the open state. To characterize the thermodynamics of the transition, we propose and apply a new sampling method that employs a series of restrained simulations to calculate a one-dimensional free energy along a curved pathway in the high-dimensional conformational space. Our calculated free energy profile features a single minimum at the open conformation, and indicates that the closed state, with a high (?13 kcal/mol) free energy, is not metastable, consistent with the observed behaviors of the unrestrained simulations. Collectively, our simulations suggest that it is energetically unfavorable for the ligand-free AdK to access the closed conformation, and imply that ligand binding may precede the closure of the enzyme. PMID:23861846

  2. UV spectroscopic study and conformational analysis of domperidone

    NASA Astrophysics Data System (ADS)

    Cignitti, Maurizio; Ramusino, Marina Cotta; Rufini, Leandro

    1995-04-01

    The UV absorption spectra of domperidone, 2-(3 H)-benzimidazolone and 5-Cl-2-(3 H)-benzimidazolone in CH 3CN have been studied both in the absence and in the presence of hard acids. A theoretical analysis of the electronic transitions of 2-(3 H)-benzimidazolone has also been performed by means of quantum-mechanical methods. Molecular mechanics (force field) calculations have been carried out to characterize the conformational space of domperidone. The results show a large number of conformers lying with 3 kcal mol -1 with respect to the lowest energy structure.

  3. Holographic Dual of a Boundary Conformal Field Theory

    SciTech Connect

    Takayanagi, Tadashi [Institute for the Physics and Mathematics of the Universe (IPMU), University of Tokyo, Kashiwa, Chiba 277-8582 (Japan)

    2011-09-02

    We propose a holographic dual of a conformal field theory defined on a manifold with boundaries, i.e., boundary conformal field theory (BCFT). Our new holography, which may be called anti-de Sitter BCFT, successfully calculates the boundary entropy or g function in two-dimensional BCFTs and it agrees with the finite part of the holographic entanglement entropy. Moreover, we can naturally derive a holographic g theorem. We also analyze the holographic dual of an interval at finite temperature and show that there is a first order phase transition.

  4. Replacement between conformity and counter-conformity in consumption decisions.

    PubMed

    Chou, Ting-Jui; Chang, En-Chung; Dai, Qi; Wong, Veronica

    2013-02-01

    This study assessed, in a Chinese context, how self-esteem interacts with perceived similarity and uniqueness to yield cognitive dissonance, and whether the dissonance leads to self-reported conformity or counter-conformity behavior. Participants were 408 respondents from 4 major Chinese cities (M age = 33.0 yr., SD = 4.3; 48% men). Self-perceptions of uniqueness, similarity, cognitive dissonance, self-esteem and need to behave in conformity or counter-conformity were measured. A theoretical model was assessed in four situations, relating the ratings of self-esteem and perceived similarity/uniqueness to the way other people at a wedding were dressed, and the resultant cognitive dissonance and conformity/ counter-conformity behavior. Regardless of high or low self-esteem, all participants reported cognitive dissonance when they were told that they were dressed extremely similarly to or extremely differently from the other people attending the wedding. However, the conforming/counter-conforming strategies used by participants to resolve the cognitive dissonance differed. When encountering dissonance induced by the perceived extreme uniqueness of dress, participants with low self-esteem tended to say they would dress next time so as to conform with the way others were dressed, while those with high self-esteem indicated they would continue their counter-conformity in attire. When encountering dissonance induced by the perceived extreme similarity to others, both those with high and low self-esteem tended to say they would dress in an unorthodox manner to surprise other people in the future. PMID:23654033

  5. Thermal insulating conformal blanket

    NASA Technical Reports Server (NTRS)

    Barney, Andrea (Inventor); Whittington, Charles A (Inventor); Eilertson, Bryan (Inventor); Siminski, Zenon (Inventor)

    2003-01-01

    The conformal thermal insulating blanket may have generally rigid batting material covered by an outer insulating layer formed of a high temperature resistant woven ceramic material and an inner insulating layer formed of a woven ceramic fiber material. The batting and insulating layers may be fastened together by sewing or stitching using an outer mold layer thread fabricated of a high temperature resistant material and an inner mold layer thread of a ceramic fiber material. The batting may be formed to a composite structure that may have a firmness factor sufficient to inhibit a pillowing effect after the stitching to not more than 0.03 inch. The outer insulating layer and an upper portion of the batting adjacent the outer insulating layer may be impregnated with a ceramic coating material.

  6. Dendrites and conformal symmetry

    E-print Network

    Juan M. Romero; Carlos Trenado

    2014-05-11

    Progress toward characterization of structural and biophysical properties of neural dendrites together with recent findings emphasizing their role in neural computation, has propelled growing interest in refining existing theoretical models of electrical propagation in dendrites while advocating novel analytic tools. In this paper we focus on the cable equation describing electric propagation in dendrites with different geometry. When the geometry is cylindrical we show that the cable equation is invariant under the Schr\\"odinger group and by using the dendrite parameters, a representation of the Schr\\"odinger algebra is provided. Furthermore, when the geometry profile is parabolic we show that the cable equation is equivalent to the Schr\\"odinger equation for the 1-dimensional free particle, which is invariant under the Schr\\"odinger group. Moreover, we show that there is a family of dendrite geometries for which the cable equation is equivalent to the Schr\\"odinger equation for the 1-dimensional conformal quantum mechanics.

  7. Capturing Chromosome Conformation

    NASA Astrophysics Data System (ADS)

    Dekker, Job; Rippe, Karsten; Dekker, Martijn; Kleckner, Nancy

    2002-02-01

    We describe an approach to detect the frequency of interaction between any two genomic loci. Generation of a matrix of interaction frequencies between sites on the same or different chromosomes reveals their relative spatial disposition and provides information about the physical properties of the chromatin fiber. This methodology can be applied to the spatial organization of entire genomes in organisms from bacteria to human. Using the yeast Saccharomyces cerevisiae, we could confirm known qualitative features of chromosome organization within the nucleus and dynamic changes in that organization during meiosis. We also analyzed yeast chromosome III at the G1 stage of the cell cycle. We found that chromatin is highly flexible throughout. Furthermore, functionally distinct AT- and GC-rich domains were found to exhibit different conformations, and a population-average 3D model of chromosome III could be determined. Chromosome III emerges as a contorted ring.

  8. Conformal Fermi Coordinates

    E-print Network

    Dai, Liang; Schmidt, Fabian

    2015-01-01

    Fermi Normal Coordinates (FNC) are a useful frame for isolating the locally observable, physical effects of a long-wavelength spacetime perturbation. Their cosmological application, however, is hampered by the fact that they are only valid on scales much smaller than the horizon. We introduce a generalization that we call Conformal Fermi Coordinates (CFC). CFC preserve all the advantages of FNC, but in addition are valid outside the horizon. They allow us to calculate the coupling of long- and short-wavelength modes on all scales larger than the sound horizon of the cosmological fluid, starting from the epoch of inflation until today, by removing the complications of the second order Einstein equations to a large extent, and eliminating all gauge ambiguities. As an application, we present a calculation of the effect of long-wavelength tensor modes on small scale density fluctuations. We recover previous results, but clarify the physical content of the individual contributions in terms of locally measurable ef...

  9. Fabrication challenges associated with conformal optics

    Microsoft Academic Search

    John Schaefer; Richard A. Eichholtz; Frank C. Sulzbach

    2001-01-01

    A conformal optic is typically an optical window that conforms smoothly to the external shape of a system platform to improve aerodynamics. Conformal optics can be on-axis, such as an ogive missile dome, or off-axis, such as in a free form airplane wing. A common example of conformal optics is the automotive head light window that conforms to the body

  10. Anisotropic universes with conformal motion

    E-print Network

    Roy Maartens; Conrad Mellin

    1996-02-09

    By imposing natural geometrical and kinematical conditions on a conformal Killing vector in Bianchi I spacetime, we show that a class of axisymmetric metrics admits a conformal motion. This class contains new exact solutions of Einstein's equations, including anisotropic radiation universes that isotropise at late times.

  11. Conformal Transformations and Space Travel

    Microsoft Academic Search

    Suraj N. Gupta

    1961-01-01

    Conformal transformations are applied to the motion of a space ship experiencing a constant acceleration. The role of proper time is interpreted in terms of atomic periods, and the relationship between the conformal transformations and the general theory of relativity is clarified.

  12. Naturality in conformal field theory

    Microsoft Academic Search

    Gregory Moore; Nathan Seiberg

    1989-01-01

    We discuss constraints on the operator product coefficients in diagonal and nondiagonal rational conformal field theories. Nondiagonal modular invariants always arise from automorphisms of the fusion rule algebra or from extensions of the chiral algebra. Moreover, when the chiral algebra has been maximally extended a strong form of the naturality principle of field theory can be proven for rational conformal

  13. Sewing conformal field theories I

    Microsoft Academic Search

    Hidenori Sonoda

    1988-01-01

    There is a well-defined prescription for sewing two Riemann surfaces. When a conformal field theory is defined on the original surfaces, how to extend the theory to the sewn surface becomes a problem. In this paper we treat the problem field theoretically, present a prescription for sewing, and check its consistency. We also show that any conformal field theory admits

  14. Methods to differentiate protein conformers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Discrimination and quantitation of protein conformers is an unsolved scientific problem. Many proteins are known to exist in two or more conformations (e.g. PrPc and PrPsc in CJD, CWD, BSE, TME, scrapies; sup35 and ure2p in yeast; CPEB in long term memory formation; huntington and A-beta in neurolog...

  15. Molecular insight into conformational transmission of human P-glycoprotein

    SciTech Connect

    Chang, Shan-Yan [Department of Biochemical Engineering and Key Laboratory of Systems Bioengineering of the Ministry of Education, School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China)] [Department of Biochemical Engineering and Key Laboratory of Systems Bioengineering of the Ministry of Education, School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Liu, Fu-Feng, E-mail: fufengliu@tju.edu.cn, E-mail: ysun@tju.edu.cn; Dong, Xiao-Yan; Sun, Yan, E-mail: fufengliu@tju.edu.cn, E-mail: ysun@tju.edu.cn [Department of Biochemical Engineering and Key Laboratory of Systems Bioengineering of the Ministry of Education, School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China) [Department of Biochemical Engineering and Key Laboratory of Systems Bioengineering of the Ministry of Education, School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China)

    2013-12-14

    P-glycoprotein (P-gp), a kind of ATP-binding cassette transporter, can export candidates through a channel at the two transmembrane domains (TMDs) across the cell membranes using the energy released from ATP hydrolysis at the two nucleotide-binding domains (NBDs). Considerable evidence has indicated that human P-gp undergoes large-scale conformational changes to export a wide variety of anti-cancer drugs out of the cancer cells. However, molecular mechanism of the conformational transmission of human P-gp from the NBDs to the TMDs is still unclear. Herein, targeted molecular dynamics simulations were performed to explore the atomic detail of the conformational transmission of human P-gp. It is confirmed that the conformational transition from the inward- to outward-facing is initiated by the movement of the NBDs. It is found that the two NBDs move both on the two directions (x and y). The movement on the x direction leads to the closure of the NBDs, while the movement on the y direction adjusts the conformations of the NBDs to form the correct ATP binding pockets. Six key segments (KSs) protruding from the TMDs to interact with the NBDs are identified. The relative movement of the KSs along the y axis driven by the NBDs can be transmitted through ?-helices to the rest of the TMDs, rendering the TMDs to open towards periplasm in the outward-facing conformation. Twenty eight key residue pairs are identified to participate in the interaction network that contributes to the conformational transmission from the NBDs to the TMDs of human P-gp. In addition, 9 key residues in each NBD are also identified. The studies have thus provided clear insight into the conformational transmission from the NBDs to the TMDs in human P-gp.

  16. Molecular insight into conformational transmission of human P-glycoprotein

    NASA Astrophysics Data System (ADS)

    Chang, Shan-Yan; Liu, Fu-Feng; Dong, Xiao-Yan; Sun, Yan

    2013-12-01

    P-glycoprotein (P-gp), a kind of ATP-binding cassette transporter, can export candidates through a channel at the two transmembrane domains (TMDs) across the cell membranes using the energy released from ATP hydrolysis at the two nucleotide-binding domains (NBDs). Considerable evidence has indicated that human P-gp undergoes large-scale conformational changes to export a wide variety of anti-cancer drugs out of the cancer cells. However, molecular mechanism of the conformational transmission of human P-gp from the NBDs to the TMDs is still unclear. Herein, targeted molecular dynamics simulations were performed to explore the atomic detail of the conformational transmission of human P-gp. It is confirmed that the conformational transition from the inward- to outward-facing is initiated by the movement of the NBDs. It is found that the two NBDs move both on the two directions (x and y). The movement on the x direction leads to the closure of the NBDs, while the movement on the y direction adjusts the conformations of the NBDs to form the correct ATP binding pockets. Six key segments (KSs) protruding from the TMDs to interact with the NBDs are identified. The relative movement of the KSs along the y axis driven by the NBDs can be transmitted through ?-helices to the rest of the TMDs, rendering the TMDs to open towards periplasm in the outward-facing conformation. Twenty eight key residue pairs are identified to participate in the interaction network that contributes to the conformational transmission from the NBDs to the TMDs of human P-gp. In addition, 9 key residues in each NBD are also identified. The studies have thus provided clear insight into the conformational transmission from the NBDs to the TMDs in human P-gp.

  17. The logarithmic conformal field theories

    E-print Network

    Tabar, M R R; Khorrami, M

    1996-01-01

    We study the correlation functions of logarithmic conformal field theories. First, assuming conformal invariance, we explicitly calculate two- and three- point functions. This calculation is done for the general case of more than one logarithmic field in a block, and more than one set of logarithmic fields. Then we show that one can regard the logarithmic field as a formal derivative of the ordinary field with respect to its conformal weight. This enables one to calculate any n-point function containing the logarithmic field in terms of ordinary n-point functions. At last, we calculate the OPE coefficients of a logarithmic conformal field theory, and show that these can be obtained from the corresponding coefficients of ordinary conformal theory by a simple derivation.

  18. 40 CFR 52.938 - General conformity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 2010-07-01 false General conformity. 52.938 Section 52.938 Protection...IMPLEMENTATION PLANS Kentucky § 52.938 General conformity. The General Conformity regulations were submitted on November...

  19. 40 CFR 93.154 - Conformity analysis.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section...PROGRAMS (CONTINUED) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR...IMPLEMENTATION PLANS Determining Conformity of General Federal Actions...

  20. 40 CFR 51.854 - Conformity analysis.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 2010-07-01 false Conformity analysis. 51.854 Section 51...OF IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State...Implementation Plans § 51.854 Conformity analysis. Link to an amendment...

  1. Conformal Field Theory Between Supersymmetry and Indecomposable

    E-print Network

    Flohr, Michael

    Conformal Field Theory Between Supersymmetry and Indecomposable Structures Dissertation zur;Abstract This thesis considers conformal field theory in its supersymmetric extension as well as in its relaxation to logarithmic conformal field theory. Compactification of superstring theory on four

  2. Conformational activation of visual rhodopsin in native disc membranes.

    PubMed

    Malmerberg, Erik; M Bovee-Geurts, Petra H; Katona, Gergely; Deupi, Xavier; Arnlund, David; Wickstrand, Cecilia; Johansson, Linda C; Westenhoff, Sebastian; Nazarenko, Elena; X Schertler, Gebhard F; Menzel, Andreas; de Grip, Willem J; Neutze, Richard

    2015-01-01

    Rhodopsin is the G protein-coupled receptor (GPCR) that serves as a dim-light receptor for vision in vertebrates. We probed light-induced conformational changes in rhodopsin in its native membrane environment at room temperature using time-resolved wide-angle x-ray scattering. We observed a rapid conformational transition that is consistent with an outward tilt of the cytoplasmic portion of transmembrane helix 6 concomitant with an inward movement of the cytoplasmic portion of transmembrane helix 5. These movements were considerably larger than those reported from the basis of crystal structures of activated rhodopsin, implying that light activation of rhodopsin involves a more extended conformational change than was previously suggested. PMID:25759477

  3. Tracing conformational changes in proteins

    PubMed Central

    2010-01-01

    Background Many proteins undergo extensive conformational changes as part of their functionality. Tracing these changes is important for understanding the way these proteins function. Traditional biophysics-based conformational search methods require a large number of calculations and are hard to apply to large-scale conformational motions. Results In this work we investigate the application of a robotics-inspired method, using backbone and limited side chain representation and a coarse grained energy function to trace large-scale conformational motions. We tested the algorithm on four well known medium to large proteins and we show that even with relatively little information we are able to trace low-energy conformational pathways efficiently. The conformational pathways produced by our methods can be further filtered and refined to produce more useful information on the way proteins function under physiological conditions. Conclusions The proposed method effectively captures large-scale conformational changes and produces pathways that are consistent with experimental data and other computational studies. The method represents an important first step towards a larger scale modeling of more complex biological systems. PMID:20487508

  4. Solution conformations of a trimannoside from nuclear magnetic resonance and molecular dynamics simulations.

    PubMed Central

    Sayers, E W; Prestegard, J H

    2000-01-01

    N-linked oligosaccharides often act as ligands for receptor proteins in a variety of cell recognition processes. Knowledge of the solution conformations, as well as protein-bound conformations, of these oligosaccharides is required to understand these important interactions. In this paper we present a model for the solution conformations sampled by a simple trimannoside, methyl 3, 6-di-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside, which contains two of the most commonly found glycosidic linkages in N-linked oligosaccharides. This model was derived from simulated annealing protocols incorporating distance restraints extracted from NOESY spectra along with torsional restraints computed from three-bond (1)H-(13)C coupling constants measured across the glycosidic bonds. The model was refined in light of unrestrained molecular dynamics simulations conducted in the presence of solvent water. The resulting model depicts a molecule undergoing conformational averaging in solution, adopting four major and two minor conformations. The four major conformations arise from a pair of two-state transitions, one each at the alpha(1-->3) and alpha(1-->6) linkages, whereas the minor conformations result from an additional transition of the alpha(1-->6) linkage. Our data also suggest that the alpha(1-->3) transition is fast and changes the molecular shape slightly, whereas the alpha(1-->6) is much slower and alters the molecular shape dramatically. PMID:11106634

  5. Dynamics of protein conformations

    NASA Astrophysics Data System (ADS)

    Stepanova, Maria

    2010-10-01

    A novel theoretical methodology is introduced to identify dynamic structural domains and analyze local flexibility in proteins. The methodology employs a multiscale approach combining identification of essential collective coordinates based on the covariance analysis of molecular dynamics trajectories, construction of the Mori projection operator with these essential coordinates, and analysis of the corresponding generalized Langevin equations [M.Stepanova, Phys.Rev.E 76(2007)051918]. Because the approach employs a rigorous theory, the outcomes are physically transparent: the dynamic domains are associated with regions of relative rigidity in the protein, whereas off-domain regions are relatively soft. This also allows scoring the flexibility in the macromolecule with atomic-level resolution [N.Blinov, M.Berjanskii, D.S.Wishart, and M.Stepanova, Biochemistry, 48(2009)1488]. The applications include the domain coarse-graining and characterization of conformational stability in protein G and prion proteins. The results are compared with published NMR experiments. Potential applications for structural biology, bioinformatics, and drug design are discussed.

  6. Conformational substates in azurin.

    PubMed Central

    Ehrenstein, D; Nienhaus, G U

    1992-01-01

    Azurin is a small blue copper protein in the electron transfer chain of denitrifying bacteria. It forms a photolabile complex with nitric oxide (NO) at low temperatures. We studied the temperature dependence of the ligand binding equilibrium and the kinetics of the association reaction after photodissociation over a wide range of temperature (80-280 K) and time (10(-6)-10(2) s). The nonexponential rebinding below 200 K is independent of the NO concentration and is interpreted as internal recombination. The rebinding can be modeled with the Arrhenius law by using a single preexponential factor of 6.3 x 10(8) s-1 and a Gaussian distribution of enthalpy barriers centered at 23 kJ/mol with a width of 11 kJ/mol. Above 200 K, a slower, exponential rebinding process appears. The dependence of the kinetics on the NO concentration characterizes this reaction as bimolecular rebinding. The binding kinetics of NO to azurin show impressive analogies to the binding of carbon monoxide to myoglobin. We conclude that conformational substates occur not only in heme proteins but also in proteins with different active sites and secondary structures. PMID:1409682

  7. Warped Conformal Field Theory

    E-print Network

    Stephane Detournay; Thomas Hartman; Diego M. Hofman

    2012-10-15

    We study field theories in two spacetime dimensions invariant under a chiral scaling symmetry that acts only on right-movers. The local symmetries include one copy of the Virasoro algebra and a U(1) current algebra. This differs from the 2d conformal group, but in some respects is equally powerful in constraining the theory. In particular, the symmetries on a torus lead to modular covariance of the partition function, which is used to derive a universal formula for the asymptotic density of states. For an application we turn to the holographic description of black holes in quantum gravity, motivated by the fact that the symmetries in the near horizon geometry of any extremal black hole are identical to those of a 2d field theory with chiral scaling. We consider two examples: black holes in warped AdS_3 in topologically massive gravity, and in string theory. In both cases, the density of states in the 2d field theory reproduces the Bekenstein-Hawking entropy of black holes in the gravity theory.

  8. 6d Conformal matter

    NASA Astrophysics Data System (ADS)

    Del Zotto, Michele; Heckman, Jonathan J.; Tomasiello, Alessandro; Vafa, Cumrun

    2015-02-01

    A single M5-brane probing G, an ADE-type singularity, leads to a system which has G × G global symmetry and can be viewed as "bifundamental" ( G, G) matter. For the A N series, this leads to the usual notion of bifundamental matter. For the other cases it corresponds to a strongly interacting (1 , 0) superconformal system in six dimensions. Similarly, an ADE singularity intersecting the Ho?ava-Witten wall leads to a superconformal matter system with E 8 × G global symmetry. Using the F-theory realization of these theories, we elucidate the Coulomb/tensor branch of ( G, G') conformal matter. This leads to the notion of fractionalization of an M5-brane on an ADE singularity as well as fractionalization of the intersection point of the ADE singularity with the Ho?ava-Witten wall. Partial Higgsing of these theories leads to new 6d SCFTs in the infrared, which we also characterize. This generalizes the class of (1 , 0) theories which can be perturbatively realized by suspended branes in IIA string theory. By reducing on a circle, we arrive at novel duals for 5d affine quiver theories. Introducing many M5-branes leads to large N gravity duals.

  9. Warped conformal field theory

    NASA Astrophysics Data System (ADS)

    Detournay, Stéphane; Hartman, Thomas; Hofman, Diego M.

    2012-12-01

    We study field theories in two spacetime dimensions invariant under a chiral scaling symmetry that acts only on right-movers. The local symmetries include one copy of the Virasoro algebra and a U(1) current algebra. This differs from the two-dimensional conformal group but in some respects is equally powerful in constraining the theory. In particular, the symmetries on a torus lead to modular covariance of the partition function, which is used to derive a universal formula for the asymptotic density of states. For an application we turn to the holographic description of black holes in quantum gravity, motivated by the fact that the symmetries in the near-horizon geometry of any extremal black hole are identical to those of a two-dimensional field theory with chiral scaling. We consider two examples: black holes in warped AdS3 in topologically massive gravity and in string theory. In both cases, the density of states in the two-dimensional field theory reproduces the Bekenstein-Hawking entropy of black holes in the gravity theory.

  10. Conformal Fermi Coordinates

    E-print Network

    Liang Dai; Enrico Pajer; Fabian Schmidt

    2015-02-06

    Fermi Normal Coordinates (FNC) are a useful frame for isolating the locally observable, physical effects of a long-wavelength spacetime perturbation. Their cosmological application, however, is hampered by the fact that they are only valid on scales much smaller than the horizon. We introduce a generalization that we call Conformal Fermi Coordinates (CFC). CFC preserve all the advantages of FNC, but in addition are valid outside the horizon. They allow us to calculate the coupling of long- and short-wavelength modes on all scales larger than the sound horizon of the cosmological fluid, starting from the epoch of inflation until today, by removing the complications of the second order Einstein equations to a large extent, and eliminating all gauge ambiguities. As an application, we present a calculation of the effect of long-wavelength tensor modes on small scale density fluctuations. We recover previous results, but clarify the physical content of the individual contributions in terms of locally measurable effects and "projection" terms.

  11. Conformational changes of adsorbed proteins

    NASA Astrophysics Data System (ADS)

    Allen, Scott

    2005-03-01

    The adsorption of bovine serum albumin (BSA) and pepsin to gold surfaces has been studied using surface plasmon resonance (SPR). Proteins are adsorbed from solution onto a gold surface and changes in the conformation of the adsorbed proteins are induced by changing the buffer solution. We selected pH and ionic strength values for the buffer solutions that are known from our circular dichroism measurements to cause conformational changes of the proteins in bulk solution. We find that for both BSA and pepsin the changes in conformation are impeded by the interaction of the protein with the gold surface.

  12. Hunting for the Conformal Window

    E-print Network

    A. Deuzeman; M. P. Lombardo; E. Pallante

    2008-10-17

    Undeniably, the imminent activity of LHC and the quest for the nature of physics beyond the standard model have raised renewed interest in the conformal and quasi-conformal behaviour of gauge field theories with matter content. Theoretically driven questions seem to now acquire a strong experimental appeal and might guide us towards a more realistic string theory to field theory connection, originally inspired by the AdS/CFT conjecture. In this brief report, we discuss the state of the art of our search for the conformal window in the SU(3) colour-gauge theory with fermions in the fundamental representation.

  13. Conformational Landscape of Nicotinoids: Solving the "conformational - Rity" of Anabasine

    NASA Astrophysics Data System (ADS)

    Lesarri, Alberto; Cocinero, Emilio J.; Evangelisti, Luca; Suenram, Richard D.; Caminati, Walther; Grabow, Jens-Uwe

    2010-06-01

    The conformational landscape of the alkaloid anabasine (neonicotine) has been investigated using rotational spectroscopy and ab initio calculations. The results allow a detailed comparison of the structural properties of the prototype piperidinic and pyrrolidinic nicotinoids (anabasine vs. nicotine). Anabasine adopts two most stable conformations in isolation conditions, for which we determined accurate rotational and nuclear quadrupole coupling parameters. The preferred conformations are characterized by an equatorial pyridine moiety and additional N-H equatorial stereochemistry at the piperidine ring (Eq-Eq). The two rings of anabasine are close to a bisecting arrangement, with the observed conformations differing in a ca. 180° rotation of the pyridine subunit, denoted either Syn or Anti. The preference of anabasine for the Eq-Eq-Syn conformation has been established by relative intensity measurements (Syn/Anti˜5(2)). The conformational preferences of free anabasine are directed by a N\\cdot\\cdot\\cdotH-C weak hydrogen bond interaction between the nitrogen lone pair at piperidine and the closest hydrogen bond in pyridine, with N\\cdot\\cdot\\cdotN distances ranging from 4.750 Å (Syn) to 4.233 Å (Anti). R. J. Lavrich, R. D. Suenram, D. F. Plusquellic and S. Davis, 58^th OSU Int. Symp. on Mol. Spectrosc., Columbus, OH, 2003, Comm. RH13.

  14. Allosteric transitions of Torpedo acetylcholine receptor in lipids, detergent and amphipols

    E-print Network

    Allosteric transitions of Torpedo acetylcholine receptor in lipids, detergent and amphipols, in the detergent CHAPS, and after complexation by amphipathic polymers (`amphipols'). Binding kinetics was similar: Nicotinic acetylcholine receptor; Conformational transition; Membrane protein; Detergent; Amphipol 1

  15. Rationality in conformal field theory

    Microsoft Academic Search

    Greg Anderson; Greg Moore

    1988-01-01

    We show that if the one-loop partition function of a modular invariant conformal field theory can be expressed as a finite sum of holomorphically factorized terms thenc and all values ofh are rational.

  16. Einstein Gravity from Conformal Gravity

    E-print Network

    Juan Maldacena

    2011-06-09

    We show that that four dimensional conformal gravity plus a simple Neumann boundary condition can be used to get the semiclassical (or tree level) wavefunction of the universe of four dimensional asymptotically de-Sitter or Euclidean anti-de Sitter spacetimes. This simple Neumann boundary condition selects the Einstein solution out of the more numerous solutions of conformal gravity. It thus removes the ghosts of conformal gravity from this computation. In the case of a five dimensional pure gravity theory with a positive cosmological constant we show that the late time superhorizon tree level probability measure, $|\\Psi [ g ]|^2$, for its four dimensional spatial slices is given by the action of Euclidean four dimensional conformal gravity.

  17. Lattice Simulations and Infrared Conformality

    SciTech Connect

    Appelquist, Thomas; Fleming, George T.; Lin, Meifeng; Neil, Ethan T.; Schaich, David A.

    2011-09-01

    We examine several recent lattice-simulation data sets, asking whether they are consistent with infrared conformality. We observe, in particular, that for an SU(3) gauge theory with 12 Dirac fermions in the fundamental representation, recent simulation data can be described assuming infrared conformality. Lattice simulations include a fermion mass m which is then extrapolated to zero, and we note that this data can be fit by a small-m expansion, allowing a controlled extrapolation. We also note that the conformal hypothesis does not work well for two theories that are known or expected to be confining and chirally broken, and that it does work well for another theory expected to be infrared conformal.

  18. Conformational elasticity can facilitate TALE-DNA recognition

    PubMed Central

    Lei, Hongxing; Sun, Jiya; Baldwin, Enoch P.; Segal, David J.; Duan, Yong

    2015-01-01

    Sequence-programmable transcription activator-like effector (TALE) proteins have emerged as a highly efficient tool for genome engineering. Recent crystal structures depict a transition between an open unbound solenoid and more compact DNA-bound solenoid formed by the 34 amino acid repeats. How TALEs switch conformation between these two forms without substantial energetic compensation, and how the repeat-variable di-residues (RVDs) discriminate between the cognate base and other bases still remain unclear. Computational analysis on these two aspects of TALE-DNA interaction mechanism has been conducted in order to achieve a better understanding of the energetics. High elasticity was observed in the molecular dynamics simulations of DNA-free TALE structure that started from the bound conformation where it sampled a wide range of conformations including the experimentally determined apo- and bound- conformations. This elastic feature was also observed in the simulations starting from the apo form which suggests low free energy barrier between the two conformations and small compensation required upon binding. To analyze binding specificity, we performed free energy calculations of various combinations of RVDs and bases using Poisson-Boltzmann/surface area (PBSA) and other approaches. The PBSA calculations indicated that the native RVD-base structures had lower binding free energy than mismatched structures for most of the RVDs examined. Our theoretical analyses provided new insight on the dynamics and energetics of TALE-DNA binding mechanism. PMID:24629191

  19. A novel approach to the study of conformality in the SU(3) theory with multiple flavors

    E-print Network

    Richard Brower; Anna Hasenfratz; Claudio Rebbi; Evan Weinberg; Oliver Witzel

    2014-10-16

    We investigate the transition between spontaneous chiral symmetry breaking and conformal behavior in the SU(3) theory with multiple fermion flavors. We propose a new strategy for studying this transition. Instead of changing the number of flavors, we lift the mass of a subset of the fermions, keeping the rest of the fermions near to the massless chiral limit in order to probe the transition. Dedicated to the 60th birthday of Academician Valery Rubakov.

  20. STRUCTURE NOTE Conformational Variation of Calcium-Bound Troponin C

    E-print Network

    Phillips, George N. Jr.

    (TnC) which binds Ca2 specifically, troponin I (TnI), and troponin T (TnT). When TnC binds 4 Ca2 ions, it under- goes a conformational transition which is transmitted to TnI, causing TnI to release its that a region of TnI may then bind to this patch. The recent crystal structures of 2-Ca2 chicken N-TnC5 and 4-Ca

  1. Null decomposition of conformal algebras

    SciTech Connect

    Mihai, Dana; Sparling, George A. J. [Department of Mathematical Sciences, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Department of Mathematics, University of Pittsburgh, Pittsburgh, Pennsylvania 15213 (United States)

    2007-05-15

    We analyze the decomposition of the enveloping algebra of the conformal algebra in arbitrary dimension with respect to the mass-squared operator. It emerges that the subalgebra that commutes with the mass-squared operator is generated by its Poincare subalgebra together with a vector operator. The special cases of the conformal algebras of two and three dimensions are described in detail, including the construction of their Casimir operators.

  2. Spinons in conformal field theory

    Microsoft Academic Search

    D. Bernard; V. Pasquier; D. Serban

    1994-01-01

    We study the su(2) conformal field theory in its spinon description, adapted to the yangian invariance. By evaluating the action of the yangian generators on the primary fields, we find a new connection between this conformal field theory and the Calogero-Sutherland model with su(2) spin. We use this connection to describe how the spinons are the quasi-particles spanning the irreducible

  3. Conformal Geometry and Brain Flattening

    Microsoft Academic Search

    Sigurd Angenent; Steven Haker; Allen Tannenbaum; Ron Kikinis

    1999-01-01

    \\u000a In this paper, using certain conformal mappings from complex function theory, we give an explicit method for flattening the\\u000a brain surface in a way which is bijective and which preserves angles. The conformal equivalence arises as the solution of\\u000a a certain elliptic equation on the surface. Then from a triangulated surface representation of the cortex, we indicate how\\u000a the procedure

  4. Scale invariance vs conformal invariance

    NASA Astrophysics Data System (ADS)

    Nakayama, Yu

    2015-03-01

    In this review article, we discuss the distinction and possible equivalence between scale invariance and conformal invariance in relativistic quantum field theories. Under some technical assumptions, we can prove that scale invariant quantum field theories in d = 2 space-time dimensions necessarily possess the enhanced conformal symmetry. The use of the conformal symmetry is well appreciated in the literature, but the fact that all the scale invariant phenomena in d = 2 space-time dimensions enjoy the conformal property relies on the deep structure of the renormalization group. The outstanding question is whether this feature is specific to d = 2 space-time dimensions or it holds in higher dimensions, too. As of January 2014, our consensus is that there is no known example of scale invariant but non-conformal field theories in d = 4 space-time dimensions under the assumptions of (1) unitarity, (2) Poincaré invariance (causality), (3) discrete spectrum in scaling dimensions, (4) existence of scale current and (5) unbroken scale invariance in the vacuum. We have a perturbative proof of the enhancement of conformal invariance from scale invariance based on the higher dimensional analogue of Zamolodchikov's c-theorem, but the non-perturbative proof is yet to come. As a reference we have tried to collect as many interesting examples of scale invariance in relativistic quantum field theories as possible in this article. We give a complementary holographic argument based on the energy-condition of the gravitational system and the space-time diffeomorphism in order to support the claim of the symmetry enhancement. We believe that the possible enhancement of conformal invariance from scale invariance reveals the sublime nature of the renormalization group and space-time with holography. This review is based on a lecture note on scale invariance vs conformal invariance, on which the author gave lectures at Taiwan Central University for the 5th Taiwan School on Strings and Fields.

  5. Extensive conformational heterogeneity within protein cores.

    PubMed

    Bowman, Gregory R; Geissler, Phillip L

    2014-06-19

    Basic principles of statistical mechanics require that proteins sample an ensemble of conformations at any nonzero temperature. However, it is still common to treat the crystallographic structure of a protein as the structure of its native state, largely because high-resolution structural characterization of protein flexibility remains a profound challenge. To assess the typical degree of conformational heterogeneity within folded proteins, we construct Markov state models describing the thermodynamics and kinetics of proteins ranging from 72 to 263 residues in length. Each of these models is built from hundreds of microseconds of atomically detailed molecular dynamics simulations. Examination of the side-chain degrees of freedom reveals that almost every residue visits at least two rotameric states over this time frame, with rotamer transition rates spanning a wide range of time scales (from nanoseconds to tens of microseconds). We also report substantial backbone dynamics on time scales longer than are typically addressed by experimental measures of protein flexibility, such as NMR order parameters. Finally, we demonstrate that these extensive rearrangements are consistent with NMR and crystallographic data, which supports the validity of our models. Altogether, these results depict the interior of proteins not as well-ordered solids, as is often imagined, but instead as dense fluids, which undergo substantial structural fluctuations despite their high packing fraction. PMID:24564338

  6. Sequential conformational rearrangements in flavivirus membrane fusion

    PubMed Central

    Chao, Luke H; Klein, Daryl E; Schmidt, Aaron G; Peña, Jennifer M; Harrison, Stephen C

    2014-01-01

    The West Nile Virus (WNV) envelope protein, E, promotes membrane fusion during viral cell entry by undergoing a low-pH triggered conformational reorganization. We have examined the mechanism of WNV fusion and sought evidence for potential intermediates during the conformational transition by following hemifusion of WNV virus-like particles (VLPs) in a single particle format. We have introduced specific mutations into E, to relate their influence on fusion kinetics to structural features of the protein. At the level of individual E subunits, trimer formation and membrane engagement of the threefold clustered fusion loops are rate-limiting. Hemifusion requires at least two adjacent trimers. Simulation of the kinetics indicates that availability of competent monomers within the contact zone between virus and target membrane makes trimerization a bottleneck in hemifusion. We discuss the implications of the model we have derived for mechanisms of membrane fusion in other contexts. DOI: http://dx.doi.org/10.7554/eLife.04389.001 PMID:25479384

  7. From anti-conformism to extremism

    E-print Network

    Weisbuch, Gérard

    2015-01-01

    We here present a model of the dynamics of extremism based on opinion dynamics in order to understand the circumstances which favour its emergence and development in large fractions of the general public. Our model is based on the bounded confidence hypothesis and on the evolution of initially anti-conformist agents to extreme positions. Numerical analyses demonstrate that a few anti-conformists are able to drag a large fraction of conformists agents to their position provided that they express their views more often than the conformists. The most influential parameter controlling the outcome of the dynamics is the uncertainty of the conformist agents; the higher their uncertainty, the higher is the influence of anti-conformists. Systematic scans of the parameter space show the existence of two regime transitions, one following the conformists uncertainty parameter and the other one following the anti-conformism strength.

  8. Transition Planning

    ERIC Educational Resources Information Center

    Statfeld, Jenna L.

    2011-01-01

    Post-school transition is the movement of a child with disabilities from school to activities that occur after the completion of school. This paper provides information about: (1) post-school transition; (2) transition plan; (3) transition services; (4) transition planning; (5) vocational rehabilitation services; (6) services that are available…

  9. Conformational control of benzyl-o-carboranylbenzene derivatives and molecular encapsulation of acetone in the dynamically formed space of 1,3,5-tris(2-benzyl-o-carboran-1-yl)benzene.

    PubMed

    Songkram, Chalermkiat; Ohta, Kiminori; Yamaguchi, Kentaro; Pichierri, Fabio; Endo, Yasuyuki

    2010-12-01

    A 1,3,5-substituted benzene platform has been widely used in the fields of supramolecular chemistry and molecular recognition. Here, we show that 1,3,5-tris(2-benzyl-o-carboran-1-yl)benzene 6 exhibits solvent-dependent conformation in the crystalline state. Recrystallization from dichloromethane-n-pentane gave the anti conformation 6-anti, while recrystallization from methanol-acetone gave the syn conformation 6-syn, in which the three benzyl-o-carboranyl moieties are located to one side of the central benzene ring. Interestingly, one acetone molecule is captured in the ?-rich space of 6-syn and two complexes facing each other encapsulate two acetone molecules in a ?-rich container formed by the eight benzene rings. The inclusion involves several weak interactions, that is, T-shaped C-H···? interactions, and C-H···O and C-H···? interactions. Two C-H···O interactions involving benzylic C-H hydrogens activated by the electron-withdrawing character of the o-carborane cage and the oxygen atom of the acetone seem to be the most important. DFT calculations indicate that the binding energy for entrapment of acetone is 6.6 kcal/mol. Inclusion of acetone is achieved through not only multiple C-H···O interactions but also a number of C-H···? interactions. The third benzyl-o-carborane moiety is fixed in the syn conformation by intramolecular and intermolecular C-H···? interactions. PMID:21058729

  10. Conformal Field Theory and Operator Algebras

    E-print Network

    Kawahigashi, Yasuyuki

    Conformal Field Theory and Operator Algebras Yasuyuki Kawahigashi Department of Mathematical spacetime symme- try, conformal symmetry, we have conformal field theory and there we have seen many new approach to conformal field theory, that is, theory of vertex operator algebras. Supported in part by JSPS

  11. Scholarly conformity: Origins, framework, applications and implications

    E-print Network

    Menczer, Filippo

    by the most formal and official way to show "attachment" and "conformity" to authorities and/or popularities are also provided. Keywords Social conformity, scholarly conformity, citation behavior INTRODUCTION Conformity, as a cornerstone of human culture, is regarded to accelerate and maintain the spread of behavior

  12. Cyclic AMP Analog Blocks Kinase Activation by Stabilizing Inactive Conformation: Conformational Selection Highlights a New Concept in Allosteric Inhibitor Design*

    PubMed Central

    Badireddy, Suguna; Yunfeng, Gao; Ritchie, Mark; Akamine, Pearl; Wu, Jian; Kim, Choel W.; Taylor, Susan S.; Qingsong, Lin; Swaminathan, Kunchithapadam; Anand, Ganesh S.

    2011-01-01

    The regulatory (R) subunit of protein kinase A serves to modulate the activity of protein kinase A in a cAMP-dependent manner and exists in two distinct and structurally dissimilar, end point cAMP-bound “B” and C-subunit-bound “H”-conformations. Here we report mechanistic details of cAMP action as yet unknown through a unique approach combining x-ray crystallography with structural proteomics approaches, amide hydrogen/deuterium exchange and ion mobility mass spectrometry, applied to the study of a stereospecific cAMP phosphorothioate analog and antagonist((Rp)-cAMPS). X-ray crystallography shows cAMP-bound R-subunit in the B form but surprisingly the antagonist Rp-cAMPS-bound R-subunit crystallized in the H conformation, which was previously assumed to be induced only by C-subunit-binding. Apo R-subunit crystallized in the B form as well but amide exchange mass spectrometry showed large differences between apo, agonist and antagonist-bound states of the R-subunit. Further ion mobility reveals the apo R-subunit as an ensemble of multiple conformations with collisional cross-sectional areas spanning both the agonist and antagonist-bound states. Thus contrary to earlier studies that explained the basis for cAMP action through “induced fit” alone, we report evidence for conformational selection, where the ligand-free apo form of the R-subunit exists as an ensemble of both B and H conformations. Although cAMP preferentially binds the B conformation, Rp-cAMPS interestingly binds the H conformation. This reveals the unique importance of the equatorial oxygen of the cyclic phosphate in mediating conformational transitions from H to B forms highlighting a novel approach for rational structure-based drug design. Ideal inhibitors such as Rp-cAMPS are those that preferentially “select” inactive conformations of target proteins by satisfying all “binding” constraints alone without inducing conformational changes necessary for activation. PMID:21081668

  13. CONFORMANCE IMPROVEMENT USING GELS

    SciTech Connect

    Randall S. Seright

    2004-09-30

    This report describes work performed during the third and final year of the project, ''Conformance Improvement Using Gels.'' Corefloods revealed throughput dependencies of permeability reduction by polymers and gels that were much more prolonged during oil flow than water flow. This behavior was explained using simple mobility ratio arguments. A model was developed that quantitatively fits the results and predicts ''clean up'' times for oil productivity when production wells are returned to service after application of a polymer or gel treatment. X-ray computed microtomography studies of gels in strongly water-wet Berea sandstone and strongly oil-wet porous polyethylene suggested that oil penetration through gel-filled pores occurs by a gel-dehydration mechanism, rather than gel-ripping or gel-displacement mechanisms. In contrast, analysis of data from the University of Kansas suggests that the gel-ripping or displacement mechanisms are more important in more permeable, strongly water-wet sandpacks. These findings help to explain why aqueous gels can reduce permeability to water more than to oil under different conditions. Since cement is the most commonly used material for water shutoff, we considered when gels are preferred over cements. Our analysis and experimental results indicated that cement cannot be expected to completely fill (top to bottom) a vertical fracture of any width, except near the wellbore. For vertical fractures with apertures less than 4 mm, the cement slurry will simply not penetrate very far into the fracture. For vertical fractures with apertures greater than 4 mm, the slurry may penetrate a substantial distance into the bottom part of the fracture. However, except near the wellbore, the upper part of the fracture will remain open due to gravity segregation. We compared various approaches to plugging fractures using gels, including (1) varying polymer content, (2) varying placement (extrusion) rate, (3) using partially formed gels, (4) using combinations of high and low molecular weight (Mw) polymers, (5) using secondary crosslinking reactions, (6) injecting un-hydrated polymer particles, and (7) incorporating particulates. All of these methods showed promise in some aspects, but required performance improvements in other aspects. All materials investigated to date showed significant performance variations with fracture width. High pressure gradients and limited distance of penetration are common problems in tight fractures. Gravity segregation and low resistance to breaching are common problems in wide fractures. These will be key issues to address in future work. Although gels can exhibit disproportionate permeability reduction in fractures, the levels of permeability reduction for oil flow are too high to allow practical exploitation in most circumstances. In contrast, disproportionate permeability reduction provided by gels that form in porous rock (adjacent to the fractures) has considerable potential in fractured systems.

  14. CONFORMANCE IMPROVEMENT USING GELS

    SciTech Connect

    Randall S. Seright

    2004-03-01

    This technical progress report describes work performed from September 1, 2003, through February 29, 2004, for the project, ''Conformance Improvement Using Gels.'' We examined the properties of several ''partially formed'' gels that were formulated with a combination of high and low molecular weight HPAM polymers. After placement in 4-mm-wide fractures, these gels required about 25 psi/ft for brine to breach the gel (the best performance to date in fractures this wide). After this breach, stabilized residual resistance factors decreased significantly with increased flow rate. Also, residual resistance factors were up to 9 times greater for water than for oil. Nevertheless, permeability reduction factors were substantial for both water and oil flow. Gel with 2.5% chopped fiberglass effectively plugged 4-mm-wide fractures if a 0.5-mm-wide constriction was present. The ability to screen-out at a constriction appears crucial for particulate incorporation to be useful in plugging fractures. In addition to fiberglass, we examined incorporation of polypropylene fibers into gels. Once dispersed in brine or gelant, the polypropylene fibers exhibited the least gravity segregation of any particulate that we have tested to date. In fractures with widths of at least 2 mm, 24-hr-old gels (0.5% high molecular weight HPAM) with 0.5% fiber did not exhibit progressive plugging during placement and showed extrusion pressure gradients similar to those of gels without the fiber. The presence of the fiber roughly doubled the gel's resistance to first breach by brine flow. The breaching pressure gradients were not as large as for gels made with high and low molecular weight polymers (mentioned above). However, their material requirements and costs (i.e., polymer and/or particulate concentrations) were substantially lower than for those gels. A partially formed gel made with 0.5% HPAM did not enter a 0.052-mm-wide fracture when applying a pressure gradient of 65 psi/ft. This result suggests a lower limit of fracture width for entry of formed or partially formed gels (when reasonable pressure gradients are applied). In unfractured porous rock, we investigated the time dependence of oil and water permeabilities during various cycles of oil and water injection after placement of a Cr(III)-acetate-HPAM gel. Permeability to water stabilized rapidly (within 1 pore volume, PV), while permeability to oil stabilized gradually over the course of 100 PV. The behavior was surprisingly insensitive to core material (strongly water-wet Berea sandstone and strongly oil-wet porous polyethylene), core permeability (740 to 10,000 md), and applied pressure gradient (10 to 100 psi/ft).

  15. Conformations of n-butyl imidazole: Matrix isolation infrared and DFT studies.

    PubMed

    Ramanathan, N; Sundararajan, K; Sankaran, K

    2015-03-15

    Conformations of n-butyl imidazole (B-IMID) were studied using matrix isolation infrared spectroscopy by trapping in argon, xenon and nitrogen matrixes using an effusive nozzle source. The experimental studies were supported by DFT computations performed at the B3LYP/6-311++G(d,p) level. Computations identified nine unique minima for B-IMID, corresponding to conformers with tg(±)tt, tg(±)g(?)t, tg(±)g(±)t, tg(±)tg(±), tg(±)tg(?), tg(±)g(?)g(?), tg(±)g(±)g(±), tg(±)g(?)g(±) and tg(±)g(±)g(?) structures, given in order of increasing energy. Computations of the transition state structures connecting the higher energy conformers to the global minimum, tg(±)tt structure were carried out. The barriers for the conformer inter-conversion were found to be ?2kcal/mol. Natural Bond Orbital (NBO) analysis was performed to understand the reasons for conformational preferences in B-IMID. PMID:25554955

  16. Conformational transformations of sulfur-containing rings: 2-methyltetrahydrothiophene gas-phase structures.

    PubMed

    Van, Vinh; Dindic, Christina; Nguyen, Ha Vinh Lam; Stahl, Wolfgang

    2015-02-01

    Stable conformations of five-member rings with the prototype cyclopentane are well-known to exist as twist or envelope structures and are of general interest in chemistry. Here, we report on the conformational analysis of the sulfur-containing ring 2-methyltetrahydrothiophene studied by a combination of molecular beam Fourier transform microwave (MB-FTMW) spectroscopy and quantum chemistry. Two twist conformers were observed, whereby highly accurate molecular parameters could be determined. In addition, the (34) S-isotopologue of the most stable conformer was assigned in natural abundances. Geometry optimizations were performed at different levels of theory and the calculated rotational constants were compared with experimental values. Two transition states optimized at the MP2/6-311++G(d,p) level using the Berny algorithm could illustrate the intramolecular conversion between both conformers. PMID:25376652

  17. Catalytic site conformations in human PNP by 19F-NMR and crystallography.

    PubMed

    Suarez, Javier; Haapalainen, Antti M; Cahill, Sean M; Ho, Meng-Chiao; Yan, Funing; Almo, Steven C; Schramm, Vern L

    2013-02-21

    Purine nucleoside phosphorylase (PNP) is a target for leukemia, gout, and autoimmune disorders. Dynamic motion of catalytic site loops has been implicated in catalysis, but experimental evidence was lacking. We replaced catalytic site groups His257 or His64 with 6-fluoro-tryptophan (6FW) as site-specific NMR probes. Conformational adjustments in the 6FW-His257-helical and His64-6FW-loop regions were characterized in PNP phosphate-bound enzyme and in complexes with catalytic site ligands, including transition state analogs. Chemical shift and line-shape changes associated with these complexes revealed dynamic coexistence of several conformational states in these regions in phosphate-bound enzyme and altered or single conformations in other complexes. These conformations were also characterized by X-ray crystallography. Specific (19)F-Trp labels and X-ray crystallography provide multidimensional characterization of conformational states for free, catalytic, and inhibited complexes of human PNP. PMID:23438750

  18. Conformational property of carvone as studied by laser-jet spectroscopy and theoretical calculations

    NASA Astrophysics Data System (ADS)

    Mineyama, Masahiro; Egawa, Toru

    2005-01-01

    The (1+1) resonance enhanced multiphoton ionization (REMPI) spectrum of carvone was measured in the supersonic free jet. In the low vibrational energy region, transitions arising from the internal rotation of isopropenyl group that causes the conformational variation were observed. With the aid of the MP2 and CIS calculations, the peak positions were assigned and it was found that this compound has three stable conformers in the S 0 electronic state.

  19. CONFORMANCE IMPROVEMENT USING GELS

    SciTech Connect

    Randall S. Seright

    2003-09-01

    This report describes work performed during the second year of the project, ''Conformance Improvement Using Gels.'' The project has two objectives. The first objective is to identify gel compositions and conditions that substantially reduce flow through fractures that allow direct channeling between wells, while leaving secondary fractures open so that high fluid injection and production rates can be maintained. The second objective is to optimize treatments in fractured production wells, where the gel must reduce permeability to water much more than that to oil. Pore-level images from X-ray computed microtomography were re-examined for Berea sandstone and porous polyethylene. This analysis suggests that oil penetration through gel-filled pores occurs by a gel-dehydration mechanism, rather than a gel-ripping mechanism. This finding helps to explain why aqueous gels can reduce permeability to water more than to oil. We analyzed a Cr(III)-acetate-HPAM gel treatment in a production well in the Arbuckle formation. The availability of accurate pressure data before, during, and after the treatment was critical for the analysis. After the gel treatment, water productivity was fairly constant at about 20% of the pre-treatment value. However, oil productivity was stimulated by a factor of 18 immediately after the treatment. During the six months after the treatment, oil productivity gradually decreased to approach the pre-treatment value. To explain this behavior, we proposed that the fracture area open to oil flow was increased substantially by the gel treatment, followed by a gradual closing of the fractures during subsequent production. For a conventional Cr(III)-acetate-HPAM gel, the delay between gelant preparation and injection into a fracture impacts the placement, leakoff, and permeability reduction behavior. Formulations placed as partially formed gels showed relatively low pressure gradients during placement, and yet substantially reduced the flow capacity of fractures (with widths from 1 to 4 mm) during brine and oil flow after placement. Regardless of gel age before placement, very little gel washed out from the fractures during brine or oil flow. However, increased brine or oil flow rate and cyclic injection of oil and water significantly decreased the level of permeability reduction. A particular need exists for gels that can plug large apertures (e.g., wide fractures and vugs). Improved mechanical strength and stability were demonstrated (in 1- to 4-mm-wide fractures) for a gel that contained a combination of high- and low-molecular weight polymers. This gel reduced the flow capacity of 2- and 4-mm-wide fractures by 260,000. In a 1-mm-wide fracture, it withstood 26 psi/ft without allowing any brine flow through the fracture. Cr(III)-acetate-HPAM gels exhibited disproportionate permeability reduction in fractures. The effect was most pronounced when the gel was placed as gelant or partially formed gels. The effect occurred to a modest extent with concentrated gels and with gels that were ''fully formed'' when placed. The effect was not evident in tubes. We explored swelling polymers for plugging fractures. Polymer suspensions were quickly prepared and injected. In concept, the partially dissolved polymer would lodge and swell to plug the fracture. For three types of swelling polymers, behavior was promising. However, additional development is needed before their performance will be superior to that of conventional gels.

  20. Conformational Changes in Acetylcholine Binding Protein Investigated by Temperature Accelerated Molecular Dynamics

    PubMed Central

    Mohammad Hosseini Naveh, Zeynab; Malliavin, Therese E.; Maragliano, Luca; Cottone, Grazia; Ciccotti, Giovanni

    2014-01-01

    Despite the large number of studies available on nicotinic acetylcholine receptors, a complete account of the mechanistic aspects of their gating transition in response to ligand binding still remains elusive. As a first step toward dissecting the transition mechanism by accelerated sampling techniques, we study the ligand-induced conformational changes of the acetylcholine binding protein (AChBP), a widely accepted model for the full receptor extracellular domain. Using unbiased Molecular Dynamics (MD) and Temperature Accelerated Molecular Dynamics (TAMD) simulations we investigate the AChBP transition between the apo and the agonist-bound state. In long standard MD simulations, both conformations of the native protein are stable, while the agonist-bound structure evolves toward the apo one if the orientation of few key sidechains in the orthosteric cavity is modified. Conversely, TAMD simulations initiated from the native conformations are able to produce the spontaneous transition. With respect to the modified conformations, TAMD accelerates the transition by at least a factor 10. The analysis of some specific residue-residue interactions points out that the transition mechanism is based on the disruption/formation of few key hydrogen bonds. Finally, while early events of ligand dissociation are observed already in standard MD, TAMD accelerates the ligand detachment and, at the highest TAMD effective temperature, it is able to produce a complete dissociation path in one AChBP subunit. PMID:24551117

  1. Conformational disorder of conjugated polymers.

    PubMed

    Westenhoff, Sebastian; Beenken, Wichard J D; Yartsev, Arkady; Greenham, Neil C

    2006-10-21

    Conformational disorder of conjugated polymers is an important issue to be understood and quantified. In this paper we present a new method to assess the chain conformation of conjugated polymers based on measurements of intrachain energy transfer. The chain conformation is modeled on the basis of monomer-monomer interactions, such as torsion, bending, and stretching of the connecting bond. The latter two potentials are assumed to be harmonic, while the torsional potential was calculated by density functional theory using B3-LYP functional with the SVP basis set. The energy transfer dynamics of excitons on these chains are quantitatively simulated using Forster-type line-dipole energy transfer. This allows us to compare the simulated ground state conformation of single polymer chains to ultrafast depolarization experiments of poly [3-(2,5-dioctylphenyl)thiophene] in solution. We identify torsional rotation as the main contributor to conformational disorder and find that this disorder is mainly controlled by the energy difference between syn and anti bonds. PMID:17059289

  2. Conformational disorder of conjugated polymers

    NASA Astrophysics Data System (ADS)

    Westenhoff, Sebastian; Beenken, Wichard J. D.; Yartsev, Arkady; Greenham, Neil C.

    2006-10-01

    Conformational disorder of conjugated polymers is an important issue to be understood and quantified. In this paper we present a new method to assess the chain conformation of conjugated polymers based on measurements of intrachain energy transfer. The chain conformation is modeled on the basis of monomer-monomer interactions, such as torsion, bending, and stretching of the connecting bond. The latter two potentials are assumed to be harmonic, while the torsional potential was calculated by density functional theory using B3-LYP functional with the SVP basis set. The energy transfer dynamics of excitons on these chains are quantitatively simulated using Förster-type line-dipole energy transfer. This allows us to compare the simulated ground state conformation of single polymer chains to ultrafast depolarization experiments of poly [3-(2,5-dioctylphenyl)thiophene] in solution. We identify torsional rotation as the main contributor to conformational disorder and find that this disorder is mainly controlled by the energy difference between syn and anti bonds.

  3. Self-Dual Conformal Gravity

    NASA Astrophysics Data System (ADS)

    Dunajski, Maciej; Tod, Paul

    2014-10-01

    We find necessary and sufficient conditions for a Riemannian four-dimensional manifold ( M, g) with anti-self-dual Weyl tensor to be locally conformal to a Ricci-flat manifold. These conditions are expressed as the vanishing of scalar and tensor conformal invariants. The invariants obstruct the existence of parallel sections of a certain connection on a complex rank-four vector bundle over M. They provide a natural generalisation of the Bach tensor which vanishes identically for anti-self-dual conformal structures. We use the obstructions to demonstrate that LeBrun's anti-self-dual metrics on connected sums of s are not conformally Ricci-flat on any open set. We analyze both Riemannian and neutral signature metrics. In the latter case we find all anti-self-dual metrics with a parallel real spinor which are locally conformal to Einstein metrics with non-zero cosmological constant. These metrics admit a hyper-surface orthogonal null Killing vector and thus give rise to projective structures on the space of ?-surfaces.

  4. Patterns and conformations in molecularly thin films

    NASA Astrophysics Data System (ADS)

    Basnet, Prem B.

    Molecularly thin films have been a subject of great interest for the last several years because of their large variety of industrial applications ranging from micro-electronics to bio-medicine. Additionally, molecularly thin films can be used as good models for biomembrane and other systems where surfaces are critical. Many different kinds of molecules can make stable films. My research has considered three such molecules: a polymerizable phospholipid, a bent-core molecules, and a polymer. One common theme of these three molecules is chirality. The phospolipid molecules studied here are strongly chiral, which can be due to intrinsically chiral centers on the molecules and also due to chiral conformations. We find that these molecules give rise to chiral patterns. Bent-core molecules are not intrinsically chiral, but individual molecules and groups of molecules can show chiral structures, which can be changed by surface interactions. One major, unconfirmed hypothesis for the polymer conformation at surface is that it forms helices, which would be chiral. Most experiments were carried out at the air/water interface, in what are called Langmuir films. Our major tools for studying these films are Brewster Angle Microscopy (BAM) coupled with the thermodynamic information that can be deduced from surface pressure isotherms. Phospholipids are one of the important constituents of liposomes -- a spherical vesicle com-posed of a bilayer membrane, typically composed of a phospholipid and cholesterol bilayer. The application of liposomes in drug delivery is well-known. Crumpling of vesicles of polymerizable phospholipids has been observed. With BAM, on Langmuir films of such phospholipids, we see novel spiral/target patterns during compression. We have found that both the patterns and the critical pressure at which they formed depend on temperature (below the transition to a i¬‘uid layer). Bent-core liquid crystals, sometimes knows as banana liquid crystals, have drawn increasing attention because of the richness in phases that they exhibit. Due to the unique coupling between dipole properties and the packing constraints placed by the bent shape, these molecules are emerging as strong candidates in electromechanical devices. However, most applications require that the molecules be aligned, which has proved difficult. Our group has tested such molecules both as Langmuir layers and, when transferred to a solid, as alignment layers with some limited success. However, these molecules do not behave well with the surfaces and the domains at the air/water interface tend to form ill-controlled multilayer structures since attraction with the surfaces is relatively weak. New bent-core molecules obtained from Prof. Dr. C. Tsehiemke from Department of Chemistry Institute of Organic Chemistry, Martin-Luther-University, Germany, have a hydrophilic group at one end. We expect this molecule to behave better on the surface because of the stronger attraction of the hydrophilic group towards the surface than for the bent-core molecules without the hydrophilic group. Polydimethylsiloxane (PDMS) is a polymer which finds many applications in modifying surface properties. It is used in manufacturing lubricants, protective coatings, hair conditioner and glass-coating. However its properties are not well understood. This polymer has been proposed to follow either helical or caterpillar conformations on a surface. The orientational order of CH3 side groups can test for these conformations (they would be predominantly up/down for the caterpillar conformation, but rotating through the entire 360 degree for the helical one). Thus previous work on the Langmuir polymer films at the air/water interface were complemented by deuterium NMR studies to probe their conformations at a surface. These experiments were performed using humid porous solids, in order to provide sufficient surface area for the technique. Previous tests in this group at room temperature were suggestive but inconclusive because of the rapid averaging motion of the molecules. Here, we attempt t

  5. Laser spectroscopy of a chiral drug in a supersonic beam: conformation and complexation of S-(+)- Naproxen

    NASA Astrophysics Data System (ADS)

    Lahmani, Françoise; Le Barbu-Debus, Katia; Seurre, Nathalie; Zehnacker-Rentien, Anne

    2003-07-01

    The S 0-S 1 electronic transition of jet-cooled Naproxen has been investigated by laser-induced fluorescence excitation and emission spectroscopy. Two electronic transitions separated by 102 cm -1 have been evidenced and attributed to the presence of two conformers. With the help of DFT calculations, the structure of these conformers has been shown to correspond to a rotation by 180° of the chiral substituent with respect to the aromatic plane. When associated with alcohols, both conformers of the chromophore form complexes which give rise to different microscopic solvent shifts of the S 0-S 1 transition. In the case of complexation with R- or S-2-butanol, the hetero- and homo-chiral pairs are characterised by different spectroscopic patterns, which allow a clear discrimination between them.

  6. Phase transitions in M-theory and F-theory

    Microsoft Academic Search

    Edward Witten

    1996-01-01

    Phase transitions are studied in M-theory and F-theory. In M-theory compactification to five dimensions on a Calabi-Yau, one can find topology-changing transitions similar to those seen in conformal field theory, but the non-geometrical phases known in conformal field theory are absent. At boundaries of moduli space where such phases might have been expected, the moduli space ends, by a conventional

  7. Conformally Invariant Equations for Graviton

    E-print Network

    Mohsen Fathi

    2012-11-12

    Recent astrophysical data indicate that our universe might currently be in a de Sitter (dS) phase. The importance of dS space has been primarily ignited by the study of the inflationary model of the universe and the quantum gravity. As we know Einstein's theory of gravitation (with a nonzero cosmological constant) can be interpreted as a theory of a metric field; that is, a symmetric tensor field of rank-2 on a fixed de Sitter background. It has been shown that the massless spin-2 Fierz-Pauli wave equation (or the linearized Einstein equation) is not conformally invariant. This result is in contrary with what we used to expect for massless theories. In this thesis we obtain conformally invariant wave equation for the massless spin-2 in the dS space. This study is motivated by the belief that conformal invariance may be the key to a future theory of quantum gravity.

  8. Universality class in conformal inflation

    SciTech Connect

    Kallosh, Renata; Linde, Andrei, E-mail: kallosh@stanford.edu, E-mail: alinde@stanford.edu [Department of Physics and SITP, Stanford University, Stanford, California 94305 (United States)

    2013-07-01

    We develop a new class of chaotic inflation models with spontaneously broken conformal invariance. Observational consequences of a broad class of such models are stable with respect to strong deformations of the scalar potential. This universality is a critical phenomenon near the point of enhanced symmetry, SO(1,1), in case of conformal inflation. It appears because of the exponential stretching of the moduli space and the resulting exponential flattening of scalar potentials upon switching from the Jordan frame to the Einstein frame in this class of models. This result resembles stretching and flattening of inhomogeneities during inflationary expansion. It has a simple interpretation in terms of velocity versus rapidity near the Kähler cone in the moduli space, similar to the light cone of special theory of relativity. This effect makes inflation possible even in the models with very steep potentials. We describe conformal and superconformal versions of this cosmological attractor mechanism.

  9. Quantum diffeomorphisms and conformal symmetry

    NASA Astrophysics Data System (ADS)

    Antoniadis, Ignatios; Mazur, Pawel O.; Mottola, Emil

    1997-04-01

    We analyze the constraints of general coordinate invariance for quantum theories possessing conformal symmetry in four dimensions. The character of these constraints simplifies enormously on the Einstein universe R×S3. The SO(4,2) global conformal symmetry algebra of this space determines uniquely a finite shift in the Hamiltonian constraint from its classical value. In other words, the global Wheeler-De Witt equation is modified at the quantum level in a well-defined way in this case. We argue that the higher moments of T00 should not be imposed on the physical states a priori either, but only the weaker condition =0. We present an explicit example of the quantization and diffeomorphism constraints on R×S3 for a free conformal scalar field.

  10. Theoretical Study of the Conformation and Energy of Supercoiled DNA

    NASA Astrophysics Data System (ADS)

    Hunt, Nathaniel George

    The two sugar-phosphate backbones of the DNA molecule wind about each other in helical paths. For circular DNA molecules (plasmids), or for linear pieces of DNA with the ends anchored, the two strands have a well-defined linking number, Lk. If Lk differs from the equilibrium linking number Lk_0, the molecule is supercoiled. The linking difference Delta Lk = Lk - Lk_0 is partitioned between torsional deformation of the DNA, or twist (DeltaTw), and a winding of the DNA axis about itself known as writhe (Wr). In this dissertation, the conformation and energy of supercoiled DNA are examined by treating DNA as an elastic cylinder. Finite-length and entropic effects are ignored, and all extensive quantities (e.g. writhe, bend energy) are treated as linear densities (writhe per unit length, bend energy per unit length). Two classes of conformation are considered: the plectonemic or interwound form, in which the axis of the DNA double helix winds about itself in a double superhelix, and the toroidal shape in which the axis is wrapped around a torus. Minimum energy conformations are found. For biologically relevant values of specific linking difference, the plectonemic conformation is energetically favored over toroidal conformations. For plectonemic DNA, the superhelical pitch angle alpha is in the range 45^circ < alpha <= 90^circ . For low values of specific linking difference |sigma| ( sigma = DeltaLk/Lk _0), most linking difference is in writhe. As |sigma| increases, a greater proportion of linking difference is in twist. Interaction between DNA strands is treated first as a hard-body excluded volume and then as a screened electrostatic repulsion. Ionic strength is found to have a large effect, resulting in significantly greater torsional stress in supercoiled DNA at low ionic strength. Results are compared with electron microscopy data and measurements of supercoiling-induced DNA conformational transitions. Good agreement with experimental results is found for DNA in monovalent salt solutions.

  11. Analysing the visible conformational substates of the FK506-binding protein FKBP12.

    PubMed

    Mustafi, Sourajit M; Chen, Hui; Li, Hongmin; Lemaster, David M; Hernández, Griselda

    2013-08-01

    The 1H-15N 2D NMR correlation spectrum of the widely studied FK506-binding protein FKBP12 (FK506-binding protein of 12 kDa) contains previously unreported peak doublings for at least 31 residues that arise from a minor conformational state (12% of total) which exchanges with the major conformation with a time constant of 3.0 s at 43°C. The largest differences in chemical shift occur for the 80's loop that forms critical recognition interactions with many of the protein partners for the FKBP family. The residues exhibiting doubling extend into the adjacent strands of the ?-sheet, across the active site to the ?-helix and into the 50's loop. Each of the seven proline residues adopts a trans-peptide linkage in both the major and minor conformations, indicating that this slow transition is not the result of prolyl isomerization. Many of the residues exhibiting resonance doubling also participate in conformational line-broadening transition(s) that occur ~105-fold more rapidly, proposed previously to arise from a single global process. The 1.70 Å (1 Å=0.1 nm) resolution X-ray structure of the H87V variant is strikingly similar to that of FKBP12, yet this substitution quenches the slow conformational transition throughout the protein while quenching the line-broadening transition for residues near the 80's loop. Line-broadening was also decreased for the residues in the ?-helix and 50's loop, whereas line-broadening in the 40's loop was unaffected. The K44V mutation selectively reduces the line-broadening in the 40's loop, verifying that at least three distinct conformational transitions underlie the line-broadening processes of FKBP12. PMID:23688288

  12. The conformational analysis of 2-halocyclooctanones.

    PubMed

    Rozada, Thiago C; Gauze, Gisele F; Rosa, Fernanda A; Favaro, Denize C; Rittner, Roberto; Pontes, Rodrigo M; Basso, Ernani A

    2015-02-25

    The establishment of the most stable structures of eight membered rings is a challenging task to the field of conformational analysis. In this work, a series of 2-halocyclooctanones were synthesized (including fluorine, chlorine, bromine and iodine derivatives) and submitted to conformational studies using a combination of theoretical calculation and infrared spectroscopy. For each compound, four conformations were identified as the most important ones. These conformations are derived from the chair-boat conformation of cyclooctanone. The pseudo-equatorial (with respect to the halogen) conformer is preferred in vacuum and in low polarity solvents for chlorine, bromine and iodine derivatives. For 2-fluorocyclooctanone, the preferred conformation in vacuum is pseudo-axial. In acetonitrile, the pseudo-axial conformer becomes the most stable for the chlorine derivative. According to NBO calculations, the conformational preference is not dictated by electron delocalization, but by classical electrostatic repulsions. PMID:25218227

  13. The conformational analysis of 2-halocyclooctanones

    NASA Astrophysics Data System (ADS)

    Rozada, Thiago C.; Gauze, Gisele F.; Rosa, Fernanda A.; Favaro, Denize C.; Rittner, Roberto; Pontes, Rodrigo M.; Basso, Ernani A.

    2015-02-01

    The establishment of the most stable structures of eight membered rings is a challenging task to the field of conformational analysis. In this work, a series of 2-halocyclooctanones were synthesized (including fluorine, chlorine, bromine and iodine derivatives) and submitted to conformational studies using a combination of theoretical calculation and infrared spectroscopy. For each compound, four conformations were identified as the most important ones. These conformations are derived from the chair-boat conformation of cyclooctanone. The pseudo-equatorial (with respect to the halogen) conformer is preferred in vacuum and in low polarity solvents for chlorine, bromine and iodine derivatives. For 2-fluorocyclooctanone, the preferred conformation in vacuum is pseudo-axial. In acetonitrile, the pseudo-axial conformer becomes the most stable for the chlorine derivative. According to NBO calculations, the conformational preference is not dictated by electron delocalization, but by classical electrostatic repulsions.

  14. Molecular mechanics conformational analysis of tylosin

    NASA Astrophysics Data System (ADS)

    Ivanov, Petko M.

    1998-01-01

    The conformations of the 16-membered macrolide antibiotic tylosin were studied with molecular mechanics (AMBER? force field) including modelling of the effect of the solvent on the conformational preferences (GB/SA). A Monte Carlo conformational search procedure was used for finding the most probable low-energy conformations. The present study provides complementary data to recently reported analysis of the conformations of tylosin based on NMR techniques. A search for the low-energy conformations of protynolide, a 16-membered lactone containing the same aglycone as tylosin, was also carried out, and the results were compared with the observed conformation in the crystal as well as with the most probable conformations of the macrocyclic ring of tylosin. The dependence of the results on force field was also studied by utilizing the MM3 force field. Some particular conformations were computed with the semiempirical molecular orbital methods AM1 and PM3.

  15. Epigenetic Dominance of Prion Conformers

    PubMed Central

    Saijo, Eri; Kang, Hae-Eun; Bian, Jifeng; Bowling, Kristi G.; Browning, Shawn; Kim, Sehun; Hunter, Nora; Telling, Glenn C.

    2013-01-01

    Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP) primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg) mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A) at (OvPrP-A136) infected with SSBP/1 scrapie prions propagated a relatively stable (S) prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V) at 136 (OvPrP-V136) infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U), diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb) PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to the otherwise unfavorable U conformer. This epigenetic mechanism thus expands the range of selectable conformations that can be adopted by PrP, and therefore the variety of options for strain propagation. PMID:24204258

  16. Dark Matter Candidate from Conformality

    E-print Network

    P. H. Frampton

    2006-09-26

    Abelian quiver gauge theories provide candidates for the conformality approach to physics beyond the standard model which possess novel cancellation mechanisms for quadratic divergences. A $Z_2$ symmetry (R parity) can be imposed and leads naturally to a dark matter candidate which is the Lightest Conformality Particle (LCP), a neutral spin-1/2 state with weak interaction annihilation cross section, mass in the 100 GeV region and relic density of non-baryonic dark matter $\\Omega_{dm}$ which can be consistent with the observed value $\\Omega_{dm} \\simeq 0.24$.

  17. Conformal relativity with hypercomplex variables

    E-print Network

    S. Ulrych

    2014-09-13

    Majorana's arbitrary spin theory is considered in a hyperbolic complex representation. The underlying differential equation is embedded into the gauge field theories of Sachs and Carmeli. In particular, the approach of Sachs can serve as a unified theory of general relativity and electroweak interactions. The method is extended to conformal space with the intention to introduce the strong interaction. It is then possible to use the wave equation, operating on representation functions of the conformal group, to describe the dynamics of matter fields. The resulting gauge groups resemble closely the gauge symmetries of Glashow-Salam-Weinberg and the Standard Model.

  18. Transiting Exoplanets

    NASA Astrophysics Data System (ADS)

    Haswell, Carole A.

    2010-07-01

    1. Our solar system from afar; 2. Exoplanet discoveries by the transit method; 3. What the transit lightcurve tells us; 4. The transiting exoplanet population; 5. Transmission spectroscopy and Rossiter-McLaughlin effect; 6. Secondary eclipses and phase variations; 7. Transit timing variations and orbital dynamics; 8. Brave new worlds: the future; Index.

  19. Transit Tracks

    NSDL National Science Digital Library

    2012-07-11

    In this space science activity, learners explore transits and the conditions when a transit may be seen. Learners use models to investigate how a planet's size and distance from its star affects the behavior of transits. Learners also use mathematics to interpret graphs of brightness vs. time to deduce information about planet-star systems. This lesson includes educator instructions, photocopy masters for Transit Light Curves, Option Math for Transit Tracks, Kepler’s 3rd Law graphs, cube root tables, an account of Jeremiah Horrocks' 1639 observation of the transit of Venus, and an answer key for the Transit Tracks Light Curves.

  20. Effects of macromolecular crowding on protein conformational changes.

    PubMed

    Dong, Hao; Qin, Sanbo; Zhou, Huan-Xiang

    2010-01-01

    Many protein functions can be directly linked to conformational changes. Inside cells, the equilibria and transition rates between different conformations may be affected by macromolecular crowding. We have recently developed a new approach for modeling crowding effects, which enables an atomistic representation of "test" proteins. Here this approach is applied to study how crowding affects the equilibria and transition rates between open and closed conformations of seven proteins: yeast protein disulfide isomerase (yPDI), adenylate kinase (AdK), orotidine phosphate decarboxylase (ODCase), Trp repressor (TrpR), hemoglobin, DNA beta-glucosyltransferase, and Ap(4)A hydrolase. For each protein, molecular dynamics simulations of the open and closed states are separately run. Representative open and closed conformations are then used to calculate the crowding-induced changes in chemical potential for the two states. The difference in chemical-potential change between the two states finally predicts the effects of crowding on the population ratio of the two states. Crowding is found to reduce the open population to various extents. In the presence of crowders with a 15 A radius and occupying 35% of volume, the open-to-closed population ratios of yPDI, AdK, ODCase and TrpR are reduced by 79%, 78%, 62% and 55%, respectively. The reductions for the remaining three proteins are 20-44%. As expected, the four proteins experiencing the stronger crowding effects are those with larger conformational changes between open and closed states (e.g., as measured by the change in radius of gyration). Larger proteins also tend to experience stronger crowding effects than smaller ones [e.g., comparing yPDI (480 residues) and TrpR (98 residues)]. The potentials of mean force along the open-closed reaction coordinate of apo and ligand-bound ODCase are altered by crowding, suggesting that transition rates are also affected. These quantitative results and qualitative trends will serve as valuable guides for expected crowding effects on protein conformation changes inside cells. PMID:20617196

  1. Conformal Field Theories: From Old to New

    SciTech Connect

    Halpern, M.B.; Schwartz, C.

    1998-02-11

    In a short review of recent work, we discuss the general problem of constructing the actions of new conformal field theories from old conformal field theories. Such a construction follows when the old conformal field theory admits new conformal stress tensors in its chiral algebra, and it turns out that the new conformal field theory is generically a new spin-two gauge theory. As an example we discuss the new spin-two gauged sigma models which arise in this fashion from the general conformal non-linear sigma model.

  2. Second Order Symmetries of the Conformal Laplacian

    NASA Astrophysics Data System (ADS)

    Michel, Jean-Philippe; Radoux, Fabian; Šilhan, Josef

    2014-02-01

    Let (M,g) be an arbitrary pseudo-Riemannian manifold of dimension at least 3. We determine the form of all the conformal symmetries of the conformal (or Yamabe) Laplacian on (M,g), which are given by differential operators of second order. They are constructed from conformal Killing 2-tensors satisfying a natural and conformally invariant condition. As a consequence, we get also the classification of the second order symmetries of the conformal Laplacian. Our results generalize the ones of Eastwood and Carter, which hold on conformally flat and Einstein manifolds respectively. We illustrate our results on two families of examples in dimension three.

  3. Transitions of tethered chain molecules under tension

    NASA Astrophysics Data System (ADS)

    Luettmer-Strathmann, Jutta; Binder, Kurt

    2014-09-01

    An applied tension force changes the equilibrium conformations of a polymer chain tethered to a planar substrate and thus affects the adsorption transition as well as the coil-globule and crystallization transitions. Conversely, solvent quality and surface attraction are reflected in equilibrium force-extension curves that can be measured in experiments. To investigate these effects theoretically, we study tethered chains under tension with Wang-Landau simulations of a bond-fluctuation lattice model. Applying our model to pulling experiments on biological molecules we obtain a good description of experimental data in the intermediate force range, where universal features dominate and finite size effects are small. For tethered chains in poor solvent, we observe the predicted two-phase coexistence at transitions from the globule to stretched conformations and also discover direct transitions from crystalline to stretched conformations. A phase portrait for finite chains constructed by evaluating the density of states for a broad range of solvent conditions and tensions shows how increasing tension leads to a disappearance of the globular phase. For chains in good solvents tethered to hard and attractive surfaces we find the predicted scaling with the chain length in the low-force regime and show that our results are well described by an analytical, independent-bond approximation for the bond-fluctuation model for the highest tensions. Finally, for a hard or slightly attractive surface the stretching of a tethered chain is a conformational change that does not correspond to a phase transition. However, when the surface attraction is sufficient to adsorb a chain it will undergo a desorption transition at a critical value of the applied force. Our results for force-induced desorption show the transition to be discontinuous with partially desorbed conformations in the coexistence region.

  4. Transitions of tethered chain molecules under tension

    E-print Network

    Jutta Luettmer-Strathmann; Kurt Binder

    2014-09-09

    An applied tension force changes the equilibrium conformations of a polymer chain tethered to a planar substrate and thus affects the adsorption transition as well as the coil-globule and crystallization transitions. Conversely, solvent quality and surface attraction are reflected in equilibrium force-extension curves that can be measured in experiments. To investigate these effects theoretically, we study tethered chains under tension with Wang-Landau simulations of a bond-fluctuation lattice model. Applying our model to pulling experiments on biological molecules we obtain a good description of experimental data in the intermediate force range, where universal features dominate and finite size effects are small. For tethered chains in poor solvent, we observe the predicted two-phase coexistence at transitions from the globule to stretched conformations and also discover direct transitions from crystalline to stretched conformations. A phase portrait for finite chains constructed by evaluating the density of states for a broad range of solvent conditions and tensions shows how increasing tension leads to a disappearance of the globular phase. For chains in good solvents tethered to hard and attractive surfaces we find the predicted scaling with the chain length in the low-force regime and show that our results are well described by an analytical, independent-bond approximation for the bond-fluctuation model for the highest tensions. Finally, for a hard or slightly attractive surface the stretching of a tethered chain is a conformational change that does not correspond to a phase transition. However, when the surface attraction is sufficient to adsorb a chain it will undergo a desorption transition at a critical value of the applied force. Our results for force-induced desorption show the transition to be discontinuous with partially desorbed conformations in the coexistence region.

  5. Density functional theory study of the relative energies and structures of the chair, twist, and boat conformations of stannacyclohexane, 1-methylstannacyclohexane, and 1,1-dimethylstannacyclohexane

    NASA Astrophysics Data System (ADS)

    Freeman, Fillmore; Fang, Christine; Hoang, David V.; Trinh, Khue M.

    The relative energies and structures of the chair, twist, and boat conformations of stannacyclohexane, 1-methylstannacyclohexane, and 1,1-dimethylstannacyclohexane have been investigated using density functional theory (DFT) (BLYP, B3LYP, B3P86, B3PW91) and hybrid Hartree-Fock/DFT (BH and HLYP) methods with the SDD basis set. The five levels of theory predicted similar energy differences (Erel) among the respective conformations of the stannacyclohexanes. Similar equilibrium geometries were also predicted at the five theoretical levels, with BLYP giving the longest bonds and BH and HLYP giving the shortest bonds. B3LYP predicted the chair conformer of stannacyclohexane to be 3.09, 3.47, and 4.27 kcal/mol, respectively, more stable than the 1,4-twist and 2,5-twist conformers and the 2,5-boat transition state. The chair conformer of axial 1-methylstannacyclohexane is 2.85, 3.40, and 4.46 kcal/mol, respectively, more stable than the 1,4-twist and 2,5-twist conformers and the 2,5-boat transition state and the chair conformer of equatorial 1-methylstannacyclohexane is 3.05, 3.52, and 4.56 kcal/mol, respectively, more stable than the 1,4-twist and 2,5-twist conformers and the 2,5-boat transition state. The chair conformer of axial 1-methylstannacyclohexane is 0.19 kcal/mol less stable than the equatorial chair conformer, and the chair conformer of 1,1-dimethylstannacyclohexane is 2.94, 3.49, and 4.21 kcal/mol, respectively, more stable than the 1,4-twist and 2,5-twist conformers and the 2,5-boat transition state. The relative energies (Erel) of the conformers of the stannacyclohexanes are also compared with the available experimental and theoretical relative energies of the corresponding cyclohexanes and silacyclohexanes.

  6. Phase transition in the Sznajd model with independence

    NASA Astrophysics Data System (ADS)

    Sznajd-Weron, K.; Tabiszewski, M.; Timpanaro, A. M.

    2011-11-01

    We propose a model of opinion dynamics which describes two major types of social influence —conformity and independence. Conformity in our model is described by the so-called outflow dynamics (known as Sznajd model). According to sociologists' suggestions, we introduce also a second type of social influence, known in social psychology as independence. Various social experiments have shown that the level of conformity depends on the society. We introduce this level as a parameter of the model and show that there is a continuous phase transition between conformity and independence.

  7. Temperature-cycle microscopy reveals single-molecule conformational heterogeneity.

    PubMed

    Yuan, Haifeng; Gaiduk, Alexander; Siekierzycka, Joanna R; Fujiyoshi, Satoru; Matsushita, Michio; Nettels, Daniel; Schuler, Benjamin; Seidel, Claus A M; Orrit, Michel

    2015-02-18

    Our previous temperature-cycle study reported FRET transitions between different states on FRET-labeled polyprolines [Yuan et al., PCCP, 2011, 13, 1762]. The conformational origin of such transitions, however, was left open. In this work, we apply temperature-cycle microscopy of single FRET-labeled polyproline and dsDNA molecules and compare their responses to resolve the conformational origin of different FRET states. We observe different steady-state FRET distributions and different temperature-cycle responses in the two samples. Our temperature-cycle results on single molecules resemble the results in steady-state measurements but reveal a dark state which could not be observed otherwise. By comparing the timescales and probabilities of different FRET states in temperature-cycle traces, we assign the conformational heterogeneity reflected by different FRET states to linker dynamics, dye-chain and dye-dye interactions. The dark state and low-FRET state are likely due to dye-dye interactions at short separations. PMID:25659944

  8. Conformal dynamics for vortex motions

    Microsoft Academic Search

    Bernard Legras; Vladimir Zeitlin

    1992-01-01

    A new method to describe the dynamics of constant vorticity domains on the plane is proposed. The parameters of conformal mappings of the standard domain onto those latter are the new variables and a dynamical equation for their evolution is given. A perturbation theory around a basic elliptic shape of the vortex is formulated within this framework. As an illustration,

  9. Bondi metric and conformal motions

    SciTech Connect

    Di Prisco, A.; Herrera, L.; Jimenez, J.; Galina, V.; Ibanez, J.

    1987-11-01

    It is shown that there exist no physically significant solutions of the Einstein vacuum field equations, except the trivial one (i.e., Minkowski), for axially and reflection symmetric space-times (Bondi metric) admitting a one-parameter group of conformal motions globally defined on S/sup 2/.

  10. Conformal Relativity: Theory and Observations

    E-print Network

    V. Pervushin; V. Zinchuk; A. Zorin

    2004-11-22

    Theoretical and observational arguments are listed in favor of a new principle of relativity of units of measurements as the basis of a conformal-invariant unification of General Relativity and Standard Model by replacement of all masses with a scalar (dilaton) field. The relative units mean conformal observables: the coordinate distance, conformal time, running masses, and constant temperature. They reveal to us a motion of a universe along its hypersurface in the field space of events like a motion of a relativistic particle in the Minkowski space, where the postulate of the vacuum as a state with minimal energy leads to arrow of the geometric time. In relative units, the unified theory describes the Cold Universe Scenario, where the role of the conformal dark energy is played by a free minimal coupling scalar field in agreement with the most recent distance-redshift data from type Ia supernovae. In this Scenario, the evolution of the Universe begins with the effect of intensive creation of primordial W-Z-bosons explaining the value of CMBR temperature, baryon asymmetry, tremendous deficit of the luminosity masses in the COMA-type superclusters and large-scale structure of the Universe.

  11. Electrostatic imaging via conformal mapping

    Microsoft Academic Search

    Ibrahim Akduman; Rainer Kress

    2002-01-01

    We present the solution of an inverse boundary value problem for harmonic functions arising in electrostatic imaging through conformal mapping techniques. The numerical method consists of two parts. In a first step, by successive approximations a nonlinear equation is solved to determine the boundary values of a holomorphic function on the outer boundary circle of an annulus. Then in a

  12. Free fructose is conformationally locked.

    PubMed

    Cocinero, Emilio J; Lesarri, Alberto; Écija, Patricia; Cimas, Álvaro; Davis, Benjamin G; Basterretxea, Francisco J; Fernández, José A; Castaño, Fernando

    2013-02-20

    Fructose has been examined under isolation conditions using a combination of UV ultrafast laser vaporization and Fourier-transform microwave (FT-MW) spectroscopy. The rotational spectra for the parent, all (six) monosubstituted (13)C species, and two single D species reveal unambiguously that the free hexoketose is conformationally locked in a single dominant ?-pyranose structure. This six-membered-chair skeleton adopts a (2)C(5) configuration (equivalent to (1)C(4) in aldoses). The free-molecule structure sharply contrasts with the furanose form observed in biochemically relevant polysaccharides, like sucrose. The structure of free fructose has been determined experimentally using substitution and effective structures. The enhanced stability of the observed conformation is primarily attributed to a cooperative network of five intramolecular O-H···O hydrogen bonds and stabilization of both endo and exo anomeric effects. Breaking a single intramolecular hydrogen bond destabilizes the free molecule by more than 10 kJ mol(-1). The structural results are compared to ribose, recently examined with rotational resolution, where six different conformations coexist with similar conformational energies. In addition, several DFT and ab initio methods and basis sets are benchmarked with the experimental data. PMID:23346993

  13. Temperature: Human Regulating, Ants Conforming

    ERIC Educational Resources Information Center

    Clopton, Joe R.

    2007-01-01

    Biological processes speed up as temperature rises. Procedures for demonstrating this with ants traveling on trails, and data gathered by students on the Argentine ant ("Linepithema humile") are presented. The concepts of temperature regulation and conformity are detailed with a focus on the processes rather than on terms that label the organisms.

  14. Finding Transition Pathways on Manifolds

    E-print Network

    Tiejun Li; Xiaoguang Li; Xiang Zhou

    2014-08-13

    We consider noise-induced transition paths in randomly perturbed dynami- cal systems on a smooth manifold. The classical Freidlin-Wentzell large devia- tion theory in Euclidean spaces is generalized and new forms of action functionals are derived in the spaces of functions and the space of curves to accommodate the intrinsic constraints associated with the manifold. Numerical meth- ods are proposed to compute the minimum action paths for the systems with constraints. The examples of conformational transition paths for a single and double rod molecules arising in polymer science are numerically investigated.

  15. Conformational activation of ADAMTS13

    PubMed Central

    South, Kieron; Luken, Brenda M.; Crawley, James T. B.; Phillips, Rebecca; Thomas, Mari; Collins, Richard F.; Deforche, Louis; Vanhoorelbeke, Karen; Lane, David A.

    2014-01-01

    A disintegrin and metalloprotease with thrombospondin motifs 13 (ADAMTS13) is a metalloprotease that regulates von Willebrand factor (VWF) function. ADAMTS13-mediated proteolysis is determined by conformational changes in VWF, but also may depend on its own conformational activation. Kinetic analysis of WT ADAMTS13 revealed ?2.5-fold reduced activity compared with ADAMTS13 lacking its C-terminal tail (MDTCS) or its CUB1-2 domains (WT?CUB1-2), suggesting that the CUB domains naturally limit ADAMTS13 function. Consistent with this suggestion, WT ADAMTS13 activity was enhanced ?2.5-fold by preincubation with either an anti-CUB mAb (20E9) or VWF D4CK (the natural binding partner for the CUB domains). Furthermore, the isolated CUB1-2 domains not only bound MDTCS, but also inhibited activity by up to 2.5-fold. Interestingly, a gain-of-function (GoF) ADAMTS13 spacer domain variant (R568K/F592Y/R660K/Y661F/Y665F) was ?2.5-fold more active than WT ADAMTS13, but could not be further activated by 20E9 mAb or VWF D4CK and was unable to bind or to be inhibited by the CUB1-2 domains, suggesting that the inhibitory effects of the CUB domains involve an interaction with the spacer domain that is disrupted in GoF ADAMTS13. Electron microscopy demonstrated a “closed” conformation of WT ADAMTS13 and suggested a more “open” conformation for GoF ADAMTS13. The cryptic spacer domain epitope revealed by conformational unfolding also represents the core antigenic target for autoantibodies in thrombotic thrombocytopenic purpura. We propose that ADAMTS13 circulates in a closed conformation, which is maintained by a CUB–spacer domain binding interaction. ADAMTS13 becomes conformationally activated on demand through interaction of its C-terminal CUB domains with VWF, making it susceptible to immune recognition. PMID:25512499

  16. Conformational behavior of pheromones and analogues Part I. 3-methyl-2-buten-1-ol, 3,3,6-trimethyl-1, 5- heptadien-4-ol and 2-methyl-6-methylene-2,7-octadien-4- on

    NASA Astrophysics Data System (ADS)

    Ko?a, Jaroslav; Carlsen, Per H. J.

    1991-06-01

    Conformational potential energy hypersurface paths of three molecules, 3-methyl-2-buten-1-ol, 3,3,6-trimethyl-1,5-heptadien-4-ol and 2-methyl-6-methylene-2,7-octadien-4-on, and conformational softness have been computed using the program system DAISY. The molecular mechanics method has been used for energy calculations in conjunction with DAISY. Low energy conformations as well as an approximation of "transition states" for conformational changes are presented.

  17. 40 CFR 52.2133 - General conformity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...IMPLEMENTATION PLANS (CONTINUED) South Carolina § 52.2133 General conformity...Conformity regulations adopted into the South Carolina State Implementation Plan which...submitted on November 8, 1996. South Carolina incorporated by reference...

  18. 40 CFR 52.2133 - General conformity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...IMPLEMENTATION PLANS (CONTINUED) South Carolina § 52.2133 General conformity...Conformity regulations adopted into the South Carolina State Implementation Plan which...submitted on November 8, 1996. South Carolina incorporated by reference...

  19. 40 CFR 52.2133 - General conformity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...IMPLEMENTATION PLANS (CONTINUED) South Carolina § 52.2133 General conformity...Conformity regulations adopted into the South Carolina State Implementation Plan which...submitted on November 8, 1996. South Carolina incorporated by reference...

  20. 40 CFR 52.2133 - General conformity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...IMPLEMENTATION PLANS (CONTINUED) South Carolina § 52.2133 General conformity...Conformity regulations adopted into the South Carolina State Implementation Plan which...submitted on November 8, 1996. South Carolina incorporated by reference...

  1. 40 CFR 52.2133 - General conformity.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...IMPLEMENTATION PLANS (CONTINUED) South Carolina § 52.2133 General conformity...Conformity regulations adopted into the South Carolina State Implementation Plan which...submitted on November 8, 1996. South Carolina incorporated by reference...

  2. Classical and quantum conformal field theory

    Microsoft Academic Search

    Gregory Moore; Nathan Seiberg

    1989-01-01

    We define chiral vertex operators and duality matrices and review the fundamental identities they satisfy. In order to understand the meaning of these equations, and therefore of conformal field theory, we define the classical limit of a conformal field theory as a limit in which the conformal weights of all primary fields vanish. The classical limit of the equations for

  3. Polynomial equations for rational conformal field theories

    Microsoft Academic Search

    Gregory Moore; Nathan Seiberg

    1988-01-01

    Duality of the conformal blocks of a rational conformal field theory defines matrices which may be used to construct representations of all monodromies and modular transformations in the theory. These duality matrices satisfy a finite number of independent polynomial equations, which imply constraints on monodromies allowed in rational conformal field theories. The equations include a key identity needed to prove

  4. Logarithmic Conformal Field Theory with Supersymmetry

    E-print Network

    Flohr, Michael

    Logarithmic Conformal Field Theory with Supersymmetry Diplomarbeit Angefertigt am Institut f . . . . . . . . . . . . . . . . . . . . . 59 Conclusions and Outlook 62 1 #12;Chapter 1 Introduction Conformal field theories (CFTs) are the class of quantum field theories which in addition to the Poincar´e group are invariant under conformal

  5. Boundary States in Logarithmic Conformal Field Theory

    E-print Network

    Flohr, Michael

    Boundary States in Logarithmic Conformal Field Theory -- A novel Approach -- Diploma Thesis states in ordinary conformal field theories but extendible to cases that have a more complicated structure, such as rank-2 indecomposable Jordan cells as in logarithmic conformal field theories

  6. Reinforcement Learning Signal Predicts Social Conformity

    Microsoft Academic Search

    Vasily Klucharev; Kaisa Hytönen; Mark Rijpkema; Ale Smidts; Guillén Fernández

    2009-01-01

    SUMMARY We often change our decisions and judgments to conform with normative group behavior. However, the neural mechanisms of social conformity remain unclear. Here we show, using functional magnetic resonance imaging, that conformity is based on mechanisms that comply with principles of reinforce- ment learning. We found that individual judgments of facial attractiveness are adjusted in line with group opinion.

  7. An extension theorem for conformal gauge singularities

    SciTech Connect

    Luebbe, Christian [Mathematical Institute, Oxford OX1 3LB (United Kingdom); Queen Mary University of London, London E1 4NS (United Kingdom); Tod, Paul [Mathematical Institute, Oxford OX1 3LB (United Kingdom); St. John's College, Oxford OX1 3JP (United Kingdom)

    2009-11-15

    We analyze conformal gauge, or isotropic, singularities in cosmological models in general relativity. Using the calculus of tractors, we find conditions in terms of tractor curvature for a local extension of the conformal structure through a cosmological singularity and prove a local extension theorem along a congruence of timelike conformal geodesics.

  8. Conformal techniques in cosmology: Conformal Killing horizons and cosmological black holes

    Microsoft Academic Search

    Joseph Sultana

    2003-01-01

    This study investigates the use of conformal Killing horizons in time dependent black hole spacetimes, particularly expanding black holes in a FLRW universe. It examines the use of conformal techniques to generate these cosmological black hole models. The role played by conformal techniques in generating black holes with non-spherical event horizons is also studied. The concept of conformal Killing horizons

  9. Transition & Beyond

    MedlinePLUS

    ... About NDSS Mission & Vision NDSS History Our Team Media Kit Financials Newsroom Donate Home » Resources » Transition & Beyond Transition & Beyond Issues that effect adolescents and adults with Down syndrome and their families ...

  10. Mg2+-induced conformational changes in the btuB riboswitch from E. coli

    PubMed Central

    Choudhary, Pallavi K.; Sigel, Roland K.O.

    2014-01-01

    Mg2+ has been shown to modulate the function of riboswitches by facilitating the ligand-riboswitch interactions. The btuB riboswitch from Escherichia coli undergoes a conformational change upon binding to its ligand, coenzyme B12 (adenosyl-cobalamine, AdoCbl), and down-regulates the expression of the B12 transporter protein BtuB in order to control the cellular levels of AdoCbl. Here, we discuss the structural folding attained by the btuB riboswitch from E. coli in response to Mg2+ and how it affects the ligand binding competent conformation of the RNA. The btuB riboswitch notably adopts different conformational states depending upon the concentration of Mg2+. With the help of in-line probing, we show the existence of at least two specific conformations, one being achieved in the complete absence of Mg2+ (or low Mg2+ concentration) and the other appearing above ?0.5 mM Mg2+. Distinct regions of the riboswitch exhibit different dissociation constants toward Mg2+, indicating a stepwise folding of the btuB RNA. Increasing the Mg2+ concentration drives the transition from one conformation toward the other. The conformational state existing above 0.5 mM Mg2+ defines the binding competent conformation of the btuB riboswitch which can productively interact with the ligand, coenzyme B12, and switch the RNA conformation. Moreover, raising the Mg2+ concentration enhances the ratio of switched RNA in the presence of AdoCbl. The lack of a AdoCbl-induced conformational switch experienced by the btuB riboswitch in the absence of Mg2+ indicates a crucial role played by Mg2+ for defining an active conformation of the riboswitch. PMID:24243114

  11. Conformal invariance from nonconformal gravity

    SciTech Connect

    Meissner, Krzysztof A. [Institute of Theoretical Physics, Faculty of Physics University of Warsaw, Hoza 69, 00-681 Warsaw (Poland); Nicolai, Hermann [Max-Planck-Institut fuer Gravitationsphysik (Albert-Einstein-Institut), Muehlenberg 1, D-14476 Potsdam (Germany)

    2009-10-15

    We discuss the conditions under which classically conformally invariant models in four dimensions can arise out of nonconformal (Einstein) gravity. As an 'existence proof' that this is indeed possible we show how to derive N=4 super Yang-Mills theory with any compact gauge group G from nonconformal gauged N=4 supergravity as a special flat space limit. We stress the role that the anticipated UV finiteness of the (so far unknown) underlying theory of quantum gravity would have to play in such a scheme, as well as the fact that the masses of elementary particles would have to arise via quantum gravitational effects which mimic the conformal anomalies of standard (flat space) UV divergent quantum field theory.

  12. New criterion for conformational polymorphism

    SciTech Connect

    Serezhkin, V. N., E-mail: serezhkin@ssu.samara.ru; Serezhkina, L. B. [Samara State University (Russian Federation)

    2012-01-15

    An analysis of nonvalent interactions in 29 crystal structures of compounds that have the C{sub a}H{sub b}N{sub c}O{sub d} composition (salicylaldoxime, glycine, and 2,4,6,8,10,12-hexaazaisowurzitane) and form polymorphic modifications is performed using molecular Voronoi-Dirichlet polyhedra. It is found that each conformational polymorph is characterized by a unique combination of the types of intramolecular and intermolecular nonvalent interactions. It is shown that a criterion which takes into account the total number of intramolecular nonvalent contacts and their distribution depending on the nature of neighboring atoms and the rank of faces of molecular Voronoi-Dirichlet polyhedra can be used to reveal conformational polymorphs.

  13. The Conformational Behaviour of Glucosamine

    NASA Astrophysics Data System (ADS)

    Peña, Isabel; Kolesniková, Lucie; Cabezas, Carlos; Bermúdez, Celina; Berdakin, Matías; Simao, Alcides; Alonso, José L.

    2014-06-01

    A laser ablation method has been successfully used to vaporize the bioactive amino monosaccharide D-glucosamine. Three cyclic ?-4C1 pyranose forms have been identified using a combination of CP-FTMW and LA-MB-FTMW spectroscopy. Stereoelectronic hyperconjugative factors, like those associated with anomeric or gauche effects, as well as the cooperative OH\\cdotsO, OH\\cdotsN and NH\\cdotsO chains, extended along the entire molecule, are the main factors driving the conformational behavior. All observed conformers exhibit a counter-clockwise arrangement (cc) of the network of intramolecular hydrogen bonds. The results are compared with those recently obtained for D-glucose. J. L. Alonso, M. A. Lozoya, I. Peña, J. C. López, C. Cabezas, S. Mata, S. Blanco, Chem. Sci. 2014, 5, 515.

  14. Guiding light with conformal transformations.

    PubMed

    Landy, Nathan I; Padilla, Willie J

    2009-08-17

    The past decade has seen a revolution in electromagnetics due to the development of metamaterials. These artificial composites have been fashioned to exhibit exotic effects such as a negative index of refraction. However, the full potential of metamaterial devices has only been hinted at. By combining metamaterials with transformation optics (TO), researchers have demonstrated an invisibility cloak. Subsequently, quasi-conformal mapping was used to create a device that exhibited a broadband cloaking effect. Here we extend this latter approach to a strictly conformal mapping to create reflection less, inherently isotropic, and broadband photonic devices. Our method combines the novel effects of TO with the practicality of all-dielectric construction. We show that our structures are capable of guiding light in an almost arbitrary fashion over an unprecedented range of frequencies. PMID:19687966

  15. Coarse-Grained Free Energy Functions for Studying Protein Conformational Changes: A Double-Well Network Model

    PubMed Central

    Chu, Jhih-Wei; Voth, Gregory A.

    2007-01-01

    In this work, a double-well network model (DWNM) is presented for generating a coarse-grained free energy function that can be used to study the transition between reference conformational states of a protein molecule. Compared to earlier work that uses a single, multidimensional double-well potential to connect two conformational states, the DWNM uses a set of interconnected double-well potentials for this purpose. The DWNM free energy function has multiple intermediate states and saddle points, and is hence a “rough” free energy landscape. In this implementation of the DWNM, the free energy function is reduced to an elastic-network model representation near the two reference states. The effects of free energy function roughness on the reaction pathways of protein conformational change is demonstrated by applying the DWNM to the conformational changes of two protein systems: the coil-to-helix transition of the DB-loop in G-actin and the open-to-closed transition of adenylate kinase. In both systems, the rough free energy function of the DWNM leads to the identification of distinct minimum free energy paths connecting two conformational states. These results indicate that while the elastic-network model captures the low-frequency vibrational motions of a protein, the roughness in the free energy function introduced by the DWNM can be used to characterize the transition mechanism between protein conformations. PMID:17704151

  16. Boundary conforming Delaunay mesh generation

    Microsoft Academic Search

    Hang Si; K. Gärtner; J. Fuhrmann

    2010-01-01

    A boundary conforming Delaunay mesh is a partitioning of a polyhedral domain into Delaunay simplices such that all boundary simplices satisfy the generalized Gabriel property. It’s dual is a Voronoi partition of the same domain which is preferable for Voronoi-box based finite volume schemes. For arbitrary 2D polygonal regions, such meshes can be generated in optimal time and size. For

  17. More transition amplitudes on the Riemann sphere

    SciTech Connect

    Dimock, J. [Department of Mathematics, SUNY at Buffalo, Buffalo, New York 14260 (United States)

    2008-06-15

    We consider a conformal field theory for bosons on the Riemann sphere. Correlation functions are defined as singular limits of functional integrals. The main result is that these amplitudes define transition amplitudes, that is multilinear Hilbert-Schmidt functionals on a fixed Hilbert space.

  18. Brownian Loops and Conformal Fields

    E-print Network

    Federico Camia

    2015-01-20

    The main topic of these lecture notes is the continuum scaling limit of planar lattice models. One reason why this topic occupies an important place in the theory of probability and mathematical statistical physics is that scaling limits provide the link between statistical mechanics and (Euclidean) field theory. In order to explain the main ideas behind the concept of scaling limit, I will focus on a "toy" model that exhibits the typical behavior of statistical mechanical models at and near the critical point. This model, known as the random walk loop soup, is actually interesting in its own right. It can be described as a Poissonian ensemble of lattice loops, or a lattice gas of loops since it fits within the ideal gas framework of statistical mechanics. After introducing the model and discussing some interesting connections with the discrete Gaussian free field, I will present some results concerning its scaling limit, which leads to a Poissonian ensemble of continuum loops known as the Brownian loop soup. The latter was introduced by Lawler and Werner and is a very interesting object with connections to the Schramm-Loewner Evolution and various models of statistical mechanics. In the second part of the lectures, I will use the Brownian loop soup to construct a family of functions that behave like correlation functions of a conformal field. I will then use these functions and their derivation to introduce the concept of conformal field and to explore the connection between scaling limits and conformal fields.

  19. The Conformational Landscape of Serinol

    NASA Astrophysics Data System (ADS)

    Sanz, M. Eugenia; Loru, Donatella; Peña, Isabel; Alonso, José L.

    2014-06-01

    The rotational spectrum of the amino alcohol serinol CH_2OH--CH(NH_2)--CH_2OH, which constitutes the hydrophilic head of the lipid sphingosine, has been investigated using chirped-pulsed Fourier transform microwave spectroscopy in combination with laser ablation Five different forms of serinol have been observed and conclusively identified by the comparison between the experimental values of their rotational and 14N quadrupole coupling constants and those predicted by ab initio calculations. In all observed conformers several hydrogen bonds are established between the two hydroxyl groups and the amino groups in a chain or circular arrangement. The most abundant conformer is stabilised by O--H···N and N--H···O hydrogen bonds forming a chain rather than a cycle. One of the detected conformers presents a tunnelling motion of the hydrogen atoms of the functional groups similar to that observed in glycerol. S. Mata, I. Peña, C. Cabezas, J. C. López, J. L. Alonso, J. Mol. Spectrosc. 2012, 280, 91 V. V. Ilyushin, R. A. Motiyenko, F. J. Lovas, D. F. Plusquellic, J. Mol. Spectrosc. 2008, 251, 129.

  20. Electrophysiological precursors of social conformity

    PubMed Central

    Rieskamp, Jörg; Tugin, Sergey; Ossadtchi, Alexey; Krutitskaya, Janina; Klucharev, Vasily

    2013-01-01

    Humans often change their beliefs or behavior due to the behavior or opinions of others. This study explored, with the use of human event-related potentials (ERPs), whether social conformity is based on a general performance-monitoring mechanism. We tested the hypothesis that conflicts with a normative group opinion evoke a feedback-related negativity (FRN) often associated with performance monitoring and subsequent adjustment of behavior. The experimental results show that individual judgments of facial attractiveness were adjusted in line with a normative group opinion. A mismatch between individual and group opinions triggered a frontocentral negative deflection with the maximum at 200 ms, similar to FRN. Overall, a conflict with a normative group opinion triggered a cascade of neuronal responses: from an earlier FRN response reflecting a conflict with the normative opinion to a later ERP component (peaking at 380 ms) reflecting a conforming behavioral adjustment. These results add to the growing literature on neuronal mechanisms of social influence by disentangling the conflict-monitoring signal in response to the perceived violation of social norms and the neural signal of a conforming behavioral adjustment. PMID:22683703

  1. Electrophysiological precursors of social conformity.

    PubMed

    Shestakova, Anna; Rieskamp, Jörg; Tugin, Sergey; Ossadtchi, Alexey; Krutitskaya, Janina; Klucharev, Vasily

    2013-10-01

    Humans often change their beliefs or behavior due to the behavior or opinions of others. This study explored, with the use of human event-related potentials (ERPs), whether social conformity is based on a general performance-monitoring mechanism. We tested the hypothesis that conflicts with a normative group opinion evoke a feedback-related negativity (FRN) often associated with performance monitoring and subsequent adjustment of behavior. The experimental results show that individual judgments of facial attractiveness were adjusted in line with a normative group opinion. A mismatch between individual and group opinions triggered a frontocentral negative deflection with the maximum at 200 ms, similar to FRN. Overall, a conflict with a normative group opinion triggered a cascade of neuronal responses: from an earlier FRN response reflecting a conflict with the normative opinion to a later ERP component (peaking at 380 ms) reflecting a conforming behavioral adjustment. These results add to the growing literature on neuronal mechanisms of social influence by disentangling the conflict-monitoring signal in response to the perceived violation of social norms and the neural signal of a conforming behavioral adjustment. PMID:22683703

  2. Conformational Substates of Myoglobin Intermediate Resolved by Picosecond X-ray Solution Scattering

    PubMed Central

    2015-01-01

    Conformational substates of proteins are generally considered to play important roles in regulating protein functions, but an understanding of how they influence the structural dynamics and functions of the proteins has been elusive. Here, we investigate the structural dynamics of sperm whale myoglobin associated with the conformational substates using picosecond X-ray solution scattering. By applying kinetic analysis considering all of the plausible candidate models, we establish a kinetic model for the entire cycle of the protein transition in a wide time range from 100 ps to 10 ms. Four structurally distinct intermediates are formed during the cycle, and most importantly, the transition from the first intermediate to the second one (B ? C) occurs biphasically. We attribute the biphasic kinetics to the involvement of two conformational substates of the first intermediate, which are generated by the interplay between the distal histidine and the photodissociated CO. PMID:24761190

  3. Conformal nets and local field theory

    E-print Network

    Arthur Bartels; Christopher L. Douglas; André G. Henriques

    2010-10-10

    We describe a coordinate-free notion of conformal nets as a mathematical model of conformal field theory. We define defects between conformal nets and introduce composition of defects, thereby providing a notion of morphism between conformal field theories. Altogether we characterize the algebraic structure of the collection of conformal nets as a symmetric monoidal tricategory. Dualizable objects of this tricategory correspond to conformal-net-valued 3-dimensional local topological quantum field theories. We prove that the dualizable conformal nets are the finite sums of irreducible nets with finite \\mu-index. This classification provides a variety of 3-dimensional local field theories, including local field theories associated to central extensions of the loop groups of the special unitary groups.

  4. Investigations into Sequence and Conformational Dependence of Backbone Entropy, Inter-basin

    E-print Network

    Berry, R. Stephen

    Investigations into Sequence and Conformational Dependence of Backbone Entropy, Inter-basin The populations and transitions between Ramachandran basins are stu- died for combinations of the standard 20 and employing seven commonly used force-fields. Both the basin populations and inter-conversion rates

  5. Study of Carrageenan Conformation Using Time-Dependent Light Scattering and Viscometry

    Microsoft Academic Search

    Erica Sharp; David Norwood

    2003-01-01

    Polysaccharides of the carrageenan family are believed to undergo a conformational transformation when varying either or both of temperature and concentration of added salt. Specifically, increasing ionic strength at fixed temperature or decreasing temperature at fixed ionic strength results in a transition from random coil to a helix. It is a point of contention as to whether this helix is

  6. 78 FR 5745 - Nonsubstantive, Editorial or Conforming Amendments of the Commission's Rules

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-28

    ...expired transition periods: This Order deletes Sec. 51.319(a)(1)(i), which references ``line sharing'' as a UNE that is subject to unbundling, to conform to judicial decision. See United States Telecom Ass'n v. FCC, 290 F.3d...

  7. Parity Doubling and the S Parameter Below the Conformal Window

    SciTech Connect

    Appelquist, T; Babich, R; Brower, R C; Cheng, M; Clark, M A; Cohen, S D; Fleming, G T; Kiskis, J; Lin, M F; Neil, E T; Osborn, J C; Rebbi, C; Schaich, D; Vranas, P M

    2011-10-21

    We describe a lattice simulation of the masses and decay constants of the lowest-lying vector and axial resonances, and the electroweak S parameter, in an SU(3) gauge theory with N{sub f} = 2 and 6 fermions in the fundamental representation. The spectrum becomes more parity doubled and the S parameter per electroweak doublet decreases when N{sub f} is increased from 2 to 6, motivating study of these trends as N{sub f} is increased further, toward the critical value for transition from confinement to infrared conformality.

  8. Parity Doubling and the S Parameter Below the Conformal Window

    E-print Network

    Thomas Appelquist; Ron Babich; Richard C. Brower; Michael Cheng; Michael A. Clark; Saul D. Cohen; George T. Fleming; Joe Kiskis; Meifeng Lin; Ethan T. Neil; James C. Osborn; Claudio Rebbi; David Schaich; Pavlos Vranas

    2010-09-29

    We describe a lattice simulation of the masses and decay constants of the lowest-lying vector and axial resonances, and the electroweak S parameter, in an SU(3) gauge theory with $N_f = 2$ and 6 fermions in the fundamental representation. The spectrum becomes more parity doubled and the S parameter per electroweak doublet decreases when $N_f$ is increased from 2 to 6, motivating study of these trends as $N_f$ is increased further, toward the critical value for transition from confinement to infrared conformality.

  9. Parity doubling and the S parameter below the conformal window.

    PubMed

    Appelquist, T; Babich, R; Brower, R C; Cheng, M; Clark, M A; Cohen, S D; Fleming, G T; Kiskis, J; Lin, M F; Neil, E T; Osborn, J C; Rebbi, C; Schaich, D; Vranas, P M

    2011-06-10

    We describe a lattice simulation of the masses and decay constants of the lowest-lying vector and axial resonances, and the electroweak S parameter, in an SU(3) gauge theory with N(f)=2 and 6 fermions in the fundamental representation. The spectrum becomes more parity doubled and the S parameter per electroweak doublet decreases when N(f) is increased from 2 to 6, motivating study of these trends as N(f) is increased further, toward the critical value for transition from confinement to infrared conformality. PMID:21770495

  10. Parity Doubling and the S Parameter below the Conformal Window

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Babich, R.; Brower, R. C.; Cheng, M.; Clark, M. A.; Cohen, S. D.; Fleming, G. T.; Kiskis, J.; Lin, M. F.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Schaich, D.; Vranas, P. M.

    2011-06-01

    We describe a lattice simulation of the masses and decay constants of the lowest-lying vector and axial resonances, and the electroweak S parameter, in an SU(3) gauge theory with Nf=2 and 6 fermions in the fundamental representation. The spectrum becomes more parity doubled and the S parameter per electroweak doublet decreases when Nf is increased from 2 to 6, motivating study of these trends as Nf is increased further, toward the critical value for transition from confinement to infrared conformality.

  11. Opposing auxiliary conformations produce the same torquoselectivity in an oxazolidinone-directed Nazarov cyclization.

    PubMed

    Flynn, Bernard L; Manchala, Narasimhulu; Krenske, Elizabeth H

    2013-06-19

    Most applications of chiral oxazolidinone auxiliaries in asymmetric synthesis operate through a common set of stereocontrol principles. That is, the oxazolidinone is made to adopt a specific, coplanar conformation with respect to the prochiral substrate, and reaction occurs preferentially at whichever stereoheterotopic face is not blocked by the substituents on the oxazolidinone. In contrast to these principles, we report here the discovery of an alternative mechanism of oxazolidinone-based stereocontrol that does not require coplanarity and is driven instead by allylic strain. This pathway has been uncovered through computational studies of an asymmetric Nazarov cyclization. Chiral oxazolidinone auxiliaries provide essentially complete control over the torquoselectivity of ring closure and the regioselectivity of subsequent deprotonation. Density functional theory calculations (M06-2X//B3LYP) reveal that in the transition state of 4? electrocyclic ring closure, the oxazolidinone ring and the cyclizing pentadienyl cation are distorted from coplanarity in a manner that gives two transition state conformations of similar energy. These two conformers are distinguished by a 180° flip in the auxiliary orientation such that in one conformer the oxazolidinone carbonyl is oriented toward the OH of the pentadienyl cation (syn-conformer) and in the other it is oriented away from this OH (anti-conformer). Surprisingly, both conformations induce the same sense of torquoselectivity, with a 3-5 kcal/mol preference for the C5-? epimer of the ring-closed cation. In both conformations, the conrotatory mode that leads to the C5-? epimer is disfavored due to higher levels of allylic strain between the oxazolidinone substituent and adjacent groups on the pentadienyl cation (R(4) and OH). The excellent torquoselectivities obtained in the oxazolidinone-directed Nazarov cyclization suggest that the allylic strain-driven stereoinduction pathway represents a viable alternative mechanism of stereocontrol for reactions of sterically congested substrates that lie outside of the traditional coplanar (N-acyloxazolidinone) paradigm. PMID:23758343

  12. Logarithmic conformal field theory: a lattice approach

    NASA Astrophysics Data System (ADS)

    Gainutdinov, A. M.; Jacobsen, J. L.; Read, N.; Saleur, H.; Vasseur, R.

    2013-12-01

    Logarithmic conformal field theories (LCFT) play a key role, for instance, in the description of critical geometrical problems (percolation, self-avoiding walks, etc), or of critical points in several classes of disordered systems (transition between plateaux in the integer and spin quantum Hall effects). Much progress in their understanding has been obtained by studying algebraic features of their lattice regularizations. For reasons which are not entirely understood, the non-semi-simple associative algebras underlying these lattice models—such as the Temperley-Lieb algebra or the blob algebra—indeed exhibit, in finite size, properties that are in full correspondence with those of their continuum limits. This applies not only to the structure of indecomposable modules, but also to fusion rules, and provides an ‘experimental’ way of measuring couplings, such as the ‘number b’ quantifying the logarithmic coupling of the stress-energy tensor with its partner. Most results obtained so far have concerned boundary LCFTs and the associated indecomposability in the chiral sector. While the bulk case is considerably more involved (mixing in general left and right moving sectors), progress has also recently been made in this direction, uncovering fascinating structures. This study provides a short general review of our work in this area.

  13. Conformal invariance and the conformal-traceless decomposition of the gravitational field

    SciTech Connect

    Brown, J. David [Department of Physics, North Carolina State University, Raleigh, North Carolina 27695 (United States)

    2005-05-15

    Einstein's theory of general relativity is written in terms of the variables obtained from a conformal-traceless decomposition of the spatial metric and extrinsic curvature. The determinant of the conformal metric is not restricted, so the action functional and equations of motion are invariant under conformal transformations. With this approach the conformal-traceless variables remain free of density weights. The conformal invariance of the equations of motion can be broken by imposing an evolution equation for the determinant of the conformal metric g. Two conditions are considered, one in which g is constant in time and one in which g is constant along the unit normal to the spacelike hypersurfaces. This approach is used to write the Baumgarte-Shapiro-Shibata-Nakamura system of evolution equations in conformally invariant form. The presentation includes a discussion of the conformal thin sandwich construction of gravitational initial data, and the conformal flatness condition as an approximation to the evolution equations.

  14. Conformance Testing: Measurement Decision Rules

    NASA Technical Reports Server (NTRS)

    Mimbs, Scott M.

    2010-01-01

    The goal of a Quality Management System (QMS) as specified in ISO 9001 and AS9100 is to provide assurance to the customer that end products meet specifications. Measuring devices, often called measuring and test equipment (MTE), are used to provide the evidence of product conformity to specified requirements. Unfortunately, processes that employ MTE can become a weak link to the overall QMS if proper attention is not given to the measurement process design, capability, and implementation. Documented "decision rules" establish the requirements to ensure measurement processes provide the measurement data that supports the needs of the QMS. Measurement data are used to make the decisions that impact all areas of technology. Whether measurements support research, design, production, or maintenance, ensuring the data supports the decision is crucial. Measurement data quality can be critical to the resulting consequences of measurement-based decisions. Historically, most industries required simplistic, one-size-fits-all decision rules for measurements. One-size-fits-all rules in some cases are not rigorous enough to provide adequate measurement results, while in other cases are overly conservative and too costly to implement. Ideally, decision rules should be rigorous enough to match the criticality of the parameter being measured, while being flexible enough to be cost effective. The goal of a decision rule is to ensure that measurement processes provide data with a sufficient level of quality to support the decisions being made - no more, no less. This paper discusses the basic concepts of providing measurement-based evidence that end products meet specifications. Although relevant to all measurement-based conformance tests, the target audience is the MTE end-user, which is anyone using MTE other than calibration service providers. Topics include measurement fundamentals, the associated decision risks, verifying conformance to specifications, and basic measurement decisions rules.

  15. Snapshots of Conformal Field Theory

    E-print Network

    Katrin Wendland

    2014-04-11

    In snapshots, this exposition introduces conformal field theory, with a focus on those perspectives that are relevant for interpreting superconformal field theory by Calabi-Yau geometry. It includes a detailed discussion of the elliptic genus as an invariant which certain superconformal field theories share with the Calabi-Yau manifolds. K3 theories are (re)viewed as prime examples of superconformal field theories where geometric interpretations are known. A final snapshot addresses the K3-related Mathieu Moonshine phenomena, where a lead role is predicted for the chiral de Rham complex.

  16. Conformal transformations and accelerated cosmologies

    SciTech Connect

    Crooks, James L.; Frampton, Paul H. [University of North Carolina, Chapel Hill, North Carolina 27599-3255 (United States)

    2006-06-15

    A cosmological theory that predicts a late-time accelerated attractor with a constant dark matter to dark energy ratio can be said to solve the coincidence problem. Such cosmologies are naturally generated in the context of nonstandard gravity theories under conformal transformation because of the resulting couplings between scalar fields and matter. The present work examines four classes of these transformed theories and finds that only a small subset-those with a single scalar field-are capable of solving the coincidence problem.

  17. Conformance Verification of Privacy Policies

    NASA Astrophysics Data System (ADS)

    Fu, Xiang

    Web applications are both the consumers and providers of information. To increase customer confidence, many websites choose to publish their privacy protection policies. However, policy conformance is often neglected. We propose a logic based framework for formally specifying and reasoning about the implementation of privacy protection by a web application. A first order extension of computation tree logic is used to specify a policy. A verification paradigm, built upon a static control/data flow analysis, is presented to verify if a policy is satisfied.

  18. Terbium luminescence-lifetime heterogeneity and protein equilibrium conformational dynamics.

    PubMed Central

    Austin, R H; Stein, D L; Wang, J

    1987-01-01

    The fluorescence decay of the rare earth terbium when bound to the protein calmodulin changes from a simple exponential decay to a complex nonexponential decay as the temperature is lowered below 200 K. We have fit the observed decay curves by assuming that the terbium emission is a forced electric dipole transition and proteins have a distribution of continuous conformational states. Quantitative fits to the data indicate that the root-mean-square configurational deviation of the atoms surrounding the terbium ion is 0.2 A, in good agreement with other measurements. We further point out that because the protein seems to undergo a glass transition yet retains configurational order at room temperature, the proper name for the physical state of a protein at room temperature is the rubber-like state. PMID:3470740

  19. Conformational dependence of a protein kinase phosphate transfer reaction

    PubMed Central

    Henkelman, Graeme; LaBute, Montiago X.; Tung, Chang-Shung; Fenimore, P. W.; McMahon, Benjamin H.

    2005-01-01

    Atomic motions and energetics for a phosphate transfer reaction catalyzed by the cAMP-dependent protein kinase are calculated by plane-wave density functional theory, starting from structures of proteins crystallized in both the reactant conformation (RC) and the transition-state conformation (TC). In TC, we calculate that the reactants and products are nearly isoenergetic with a 20-kJ/mol barrier, whereas phosphate transfer is unfavorable by 120 kJ/mol in the RC, with an even higher barrier. With the protein in TC, the motions involved in reaction are small, with only P? and the catalytic proton moving >0.5 Å. Examination of the structures reveals that in the RC the active site cleft is not completely closed and there is insufficient space for the phosphorylated serine residue in the product state. Together, these observations imply that the phosphate transfer reaction occurs rapidly and reversibly in a particular conformation of the protein, and that the reaction can be gated by changes of a few tenths of an angstrom in the catalytic site. PMID:16227439

  20. Conformational diversity in prion protein variants influences intermolecular ?-sheet formation

    PubMed Central

    Lee, Seungjoo; Antony, Lizamma; Hartmann, Rune; Knaus, Karen J; Surewicz, Krystyna; Surewicz, Witold K; Yee, Vivien C

    2010-01-01

    A conformational transition of normal cellular prion protein (PrPC) to its pathogenic form (PrPSc) is believed to be a central event in the transmission of the devastating neurological diseases known as spongiform encephalopathies. The common methionine/valine polymorphism at residue 129 in the PrP influences disease susceptibility and phenotype. We report here seven crystal structures of human PrP variants: three of wild-type (WT) PrP containing V129, and four of the familial variants D178N and F198S, containing either M129 or V129. Comparison of these structures with each other and with previously published WT PrP structures containing M129 revealed that only WT PrPs were found to crystallize as domain-swapped dimers or closed monomers; the four mutant PrPs crystallized as non-swapped dimers. Three of the four mutant PrPs aligned to form intermolecular ?-sheets. Several regions of structural variability were identified, and analysis of their conformations provides an explanation for the structural features, which can influence the formation and conformation of intermolecular ?-sheets involving the M/V129 polymorphic residue. PMID:19927125

  1. Conformal gravity in the Schwarzschild metric

    E-print Network

    R. K. Nesbet

    2014-10-30

    Conformal gravity theory is a version of general relativity based on replacing Ricci scalar R in the Einstein-Hilbert variational action integral by the conformal Weyl Lagrangian density. In the Schwarzschild metric, relevant to a static spherically symmetric galactic model, conformal gravity has recently been shown to imply a remarkable fit to anomalous rotation data for 138 galaxies. Recent criticism suggests failure of this formalism to reproduce standard subgalactic phenomenology and to account for the relative signs of implied Newtonian and nonclassical acceleration parameters inferred from galactic rotational velocity data. These problems are resolved here by combining conformal gravity with a conformal modification of the Higgs scalar field model, relevant to Hubble expansion. The resulting universal conformal theory establishes relationships between parameters for distinct phenomena that are shown here to be consistent with observed data.

  2. A Short Introduction to Conformal Invariance

    NASA Astrophysics Data System (ADS)

    Henkel, Malte; Karevski, Dragi

    An easily readable introduction to the main concepts and techniques of conformal invariance is provided. Starting from the global scale-invariance at a critical point, it is argued, through the local conformal Ward identities, that under mild conditions an extension to a local form of scale-invariance, namely conformally invariance, is in general possible. In two space dimensions, the particular role of the infinite-dimensional Lie algebra of conformal transformations is outlined and the main concepts, namely those of a primary scaling operator, the conformal energy-momentum tensor, the Virasoro algebra and the central charge and the main facts of their unitary and/or minimal representations will be presented. Some simple applications for the explicit calculation of two-point functions will be given. The free boson will be used as a paradigmatic illustration and we shall close with an outline of surface critical phenomena and their description in terms of boundary conformal field-theory.

  3. Combined effect of confinement and affinity of crowded environment on conformation switching of adenylate kinase.

    PubMed

    Li, Min; Xu, Weixin; Zhang, John Z H; Xia, Fei

    2014-12-01

    The actual conformation switching of proteins in the crowded cellular environment is completely different from that in vitro. Proteins in cytoplasm are continually subject to confinement and/or attraction to other molecules in their surroundings due to the existence of various biological species. To gain insight into the nature of crowded environments, we investigated the effects of confinement and affinity on the conformation switching of adenylate kinase (ADK) in a spherical cavity. It was found that even a small degree of confinement reduces the entropy of the open state and stabilizes the closed state, which leads to increased energy barriers for transition. Furthermore, the analysis of transition temperatures and mean first passage times indicates that the proper affinity can promote the transition of ADK from closed state to open state. This study reveals that the crowded cellular environment plays an important role in the thermodynamics and kinetics of proteins in vivo. PMID:25432855

  4. Metrics with Galilean conformal isometry

    SciTech Connect

    Bagchi, Arjun [School of Mathematics, University of Edinburgh, Edinburgh, EH9 3JZ (United Kingdom); Kundu, Arnab [Theory Group, Department of Physics, University of Texas at Austin, Austin, Texas 78712 (United States)

    2011-03-15

    The Galilean conformal algebra (GCA) arises in taking the nonrelativistic limit of the symmetries of a relativistic conformal field theory in any dimensions. It is known to be infinite dimensional in all spacetime dimensions. In particular, the 2d GCA emerges out of a scaling limit of linear combinations of two copies of the Virasoro algebra. In this paper, we find metrics in dimensions greater than 2 which realize the finite 2d GCA (the global part of the infinite algebra) as their isometry by systematically looking at a construction in terms of cosets of this finite algebra. We list all possible subalgebras consistent with some physical considerations motivated by earlier work in this direction and construct all possible higher-dimensional nondegenerate metrics. We briefly study the properties of the metrics obtained. In the standard one higher-dimensional ''holographic'' setting, we find that the only nondegenerate metric is Minkowskian. In four and five dimensions, we find families of nontrivial metrics with a rather exotic signature. A curious feature of these metrics is that all but one of them are Ricci-scalar flat.

  5. Generative Models of Conformational Dynamics

    PubMed Central

    Langmead, Christopher James

    2014-01-01

    Atomistic simulations of the conformational dynamics of proteins can be performed using either Molecular Dynamics or Monte Carlo procedures. The ensembles of three-dimensional structures produced during simulation can be analyzed in a number of ways to elucidate the thermodynamic and kinetic properties of the system. The goal of this chapter is to review both traditional and emerging methods for learning generative models from atomistic simulation data. Here, the term ‘generative’ refers to a model of the joint probability distribution over the behaviors of the constituent atoms. In the context of molecular modeling, generative models reveal the correlation structure between the atoms, and may be used to predict how the system will respond to structural perturbations. We begin by discussing traditional methods, which produce multivariate Gaussian models. We then discuss GAMELAN (GrAphical Models of Energy LANdscapes), which produces generative models of complex, non-Gaussian conformational dynamics (e.g., allostery, binding, folding, etc) from long timescale simulation data. PMID:24446358

  6. Metrics with Galilean Conformal Isometry

    E-print Network

    Arjun Bagchi; Arnab Kundu

    2010-11-23

    The Galilean Conformal Algebra (GCA) arises in taking the non-relativistic limit of the symmetries of a relativistic Conformal Field Theory in any dimensions. It is known to be infinite-dimensional in all spacetime dimensions. In particular, the 2d GCA emerges out of a scaling limit of linear combinations of two copies of the Virasoro algebra. In this paper, we find metrics in dimensions greater than two which realize the finite 2d GCA (the global part of the infinite algebra) as their isometry by systematically looking at a construction in terms of cosets of this finite algebra. We list all possible sub-algebras consistent with some physical considerations motivated by earlier work in this direction and construct all possible higher dimensional non-degenerate metrics. We briefly study the properties of the metrics obtained. In the standard one higher dimensional "holographic" setting, we find that the only non-degenerate metric is Minkowskian. In four and five dimensions, we find families of non-trivial metrics with a rather exotic signature. A curious feature of these metrics is that all but one of them are Ricci-scalar flat.

  7. Metrics with Galilean Conformal Isometry

    E-print Network

    Bagchi, Arjun

    2010-01-01

    The Galilean Conformal Algebra (GCA) arises in taking the non-relativistic limit of the symmetries of a relativistic Conformal Field Theory in any dimensions. It is known to be infinite-dimensional in all spacetime dimensions. In particular, the 2d GCA emerges out of a scaling limit of linear combinations of two copies of the Virasoro algebra. In this paper, we find metrics in dimensions greater than two which realize the finite 2d GCA (the global part of the infinite algebra) as their isometry by systematically looking at a construction in terms of cosets of this finite algebra. We list all possible sub-algebras consistent with some physical considerations motivated by earlier work in this direction and construct all possible higher dimensional non-degenerate metrics. We briefly study the properties of the metrics obtained. In the standard one higher dimensional "holographic" setting, we find that the only non-degenerate metric is Minkowskian. In four and five dimensions, we find families of non-trivial metr...

  8. On conformal reflections in compactified phase space

    SciTech Connect

    Budinich, P. [International School for Advances Studies and International Center for Theoretical Physics, Strada Costiera 13, 34014 Trieste (Italy)

    1998-12-15

    Some results from arguments of research dealt with R. Raczka are exposed and extended. In particular new arguments are brought in favor of the conjecture, formulated with him, that both space-time and momentum may be conformally compactified, building up a compact phase space of automorphism for the conformal group, where conformal reflections determine a convolution between space-time and momentum space which may have consequence of interest for both classical and quantum physics.

  9. Kinase conformations: a computational study of the effect of ligand binding.

    PubMed Central

    Helms, V.; McCammon, J. A.

    1997-01-01

    Protein function is often controlled by ligand-induced conformational transitions. Yet, in spite of the increasing number of three-dimensional crystal structures of proteins in different conformations, not much is known about the driving forces of these transitions. As an initial step toward exploring the conformational and energetic landscape of protein kinases by computational methods, intramolecular energies and hydration free energies were calculated for different conformations of the catalytic domain of cAMP-dependent protein kinase (cAPK) with a continuum (Poisson) model for the electrostatics. Three protein kinase crystal structures for ternary complexes of cAPK with the peptide inhibitor PKI(5-24) and ATP or AMP-PNP were modeled into idealized intermediate and open conformations. Concordant with experimental observation, we find that the binding of PKI(5-24) is more effective in stabilizing the closed and intermediate forms of cAPK than ATP. PKI(5-24) seems to drive the final closure of the active site cleft from intermediate to closed state because ATP does not distinguish between these two states. Binding of PKI(5-24) and ATP is energetically additive. PMID:9385635

  10. Logarithmic operators and logarithmic conformal field theories

    NASA Astrophysics Data System (ADS)

    Gurarie, Victor

    2013-12-01

    Logarithmic operators and logarithmic conformal field theories are reviewed. Prominent examples considered here include c = -2 and c = 0 logarithmic conformal field theories. c = 0 logarithmic conformal field theories are especially interesting since they describe some of the critical points of a variety of longstanding problems involving a two dimensional quantum particle moving in a spatially random potential, as well as critical two dimensional self-avoiding random walks and percolation. Lack of classification of logarithmic conformal field theories remains a major impediment to progress towards finding complete solutions to these problems.

  11. Noncommutative geometry and twisted conformal symmetry

    SciTech Connect

    Matlock, Peter [Institute of Mathematical Sciences, Chennai (India)

    2005-06-15

    The twist-deformed conformal algebra is constructed as a Hopf algebra with twisted coproduct. This allows for the definition of conformal symmetry in a noncommutative background geometry. The twisted coproduct is reviewed for the Poincare algebra and the construction is then extended to the full conformal algebra. The case of Moyal-type noncommutativity of the coordinates is considered. It is demonstrated that conformal invariance need not be viewed as incompatible with noncommutative geometry; the noncommutativity of the coordinates appears as a consequence of the twisting, as has been shown in the literature in the case of the twisted Poincare algebra.

  12. Pyrrolidine nucleotide analogs with a tunable conformation

    PubMed Central

    Poštová Slav?tínská, Lenka; Rejman, Dominik

    2014-01-01

    Summary Conformational preferences of the pyrrolidine ring in nucleotide analogs 7–14 were investigated by means of NMR and molecular modeling. The effect of the relative configuration of hydroxy and nucleobase substituents as well as the effect of the alkylation or acylation of the pyrrolidine nitrogen atom on the conformation of the pyrrolidine ring were studied. The results of a conformational analysis show that the alkylation/acylation can be effectively used for tuning the pyrrolidine conformation over the whole pseudorotation cycle. PMID:25246956

  13. Rotational Spectroscopy Unveils Eleven Conformers of Adrenaline

    NASA Astrophysics Data System (ADS)

    Cabezas, C.; Cortijo, V.; Mata, S.; Lopez, J. C.; Alonso, J. L.

    2013-06-01

    Recent improvements in our LA-MB-FTMW instrumentation have allowed the characterization of eleven and eight conformers for the neurotransmitters adrenaline and noradrenaline respectively. The observation of this rich conformational behavior is in accordance with the recent observation of seven conformers for dopamine and in sharp contrast with the conformational reduction proposed for catecholamines. C. Cabezas, I. Peña, J. C. López, J. L. Alonso J. Phys. Chem. Lett. 2013, 4, 486. H. Mitsuda, M. Miyazaki, I. B. Nielsen, P. Carcabal,C. Dedonder, C. Jouvet, S. Ishiuchi, M. Fujii J. Phys. Chem. Lett. 2010, 1, 1130.

  14. Ordered conformations of cationic polypeptides in anionic surfactant solutions.

    PubMed

    Ikeda, K; Yang, J T

    1980-09-01

    Ionic poly(L-ornithine) at 45 degrees adopts a helical conformation in the presence of sodium dodecyl sulfonate or phosphate just as it is in sodium dodecyl sulfate solution as evidenced from circular dichroic spectra. But the polypeptide remains unordered in sodium tridecanate. Under similar conditions ionic poly(L-lysine) assumes the beta-form in all four anionic surfactant solutions. In sodium dodecyl phosphate solution at 45 degrees (Lys)n also undergoes a beta-to-helix transition in alkaline solution with a midpoint at pH 9.2, noting that dodecyl phosphoric acid has two dissociation constants with pKa of about 3 and 8. Raising the pH of the solution above 11 at 45 degrees converts the helical conformation back to the beta-form. This contrasts with a single beta-to-helix transition at pH 10.9 at 45 degrees for (Lys)n in sodium dodecyl sulfate solution. PMID:7461904

  15. Bootstrapping phase transitions in QCD and frustrated spin systems

    NASA Astrophysics Data System (ADS)

    Nakayama, Yu; Ohtsuki, Tomoki

    2015-01-01

    In view of its physical importance in predicting the order of chiral phase transitions in QCD and frustrated spin systems, we perform the conformal bootstrap program of [O (n )×O (2 ) ]-symmetric conformal field theories in d =3 dimensions with a special focus on n =3 and 4. The existence of renormalization group fixed points with these symmetries has been controversial over the years, but our conformal bootstrap program provides nonperturbative evidence. In both the n =3 and 4 cases, we find singular behaviors in the bounds of scaling dimensions of operators in two different sectors, which we claim correspond to chiral and collinear fixed points, respectively. In contrast to the cases with larger values of n , we find no evidence for the antichiral fixed point. Our results indicate the possibility that the chiral phase transitions in QCD and frustrated spin systems are continuous with the critical exponents that we predict from the conformal bootstrap program.

  16. Bootstrapping phase transitions in QCD and frustrated spin systems

    E-print Network

    Yu Nakayama; Tomoki Ohtsuki

    2014-08-11

    In view of its physical importance in predicting the order of chiral phase transitions in QCD and frustrated spin systems, we perform the conformal bootstrap program of $O(n)\\times O(2)$-symmetric conformal field theories in $d=3$ dimensions with a special focus on $n=3$ and $4$. The existence of renormalization group fixed points with these symmetries has been controversial over years, but our conformal bootstrap program provides the non-perturbative evidence. In both $n=3$ and $4$ cases, we find singular behaviors in the bounds of scaling dimensions of operators in two different sectors, which we claim correspond to chiral and collinear fixed points, respectively. In contrast to the cases with larger values of $n$, we find no evidence for the anti-chiral fixed point. Our results indicate the possibility that the chiral phase transitions in QCD and frustrated spin systems are continuous with the critical exponents that we predict from the conformal bootstrap program.

  17. Conformal mapping techniques in string field theory. January 1986-April 1989 (Citations from the INSPEC: Information Services for the Physics and Engineering Communities data base). Report for January 1986-April 1989

    SciTech Connect

    Not Available

    1989-04-01

    This bibliography contains citations concerning recent developments of conformal-mapping techniques in string theories and superstring theories for elementary particle physics and unified fields. Conformal field theories for bosonic strings, fermionic strings, and heterotic strings are presented. Topics include construction of vertex operators for the development of string theories, conformal invariance and string dynamics, conformal gauge theory of strings, closed string and open string transitions, string propagation in background fields, conformal string compactification, string quantization on Riemann surfaces, supergravity, and superconformal algebras. (Contains 98 citations fully indexed and including a title list.)

  18. Conformational landscapes of DNA polymerase I and mutator derivatives establish fidelity checkpoints for nucleotide insertion

    PubMed Central

    Hohlbein, Johannes; Aigrain, Louise; Craggs, Timothy D.; Bermek, Oya; Potapova, Olga; Shoolizadeh, Pouya; Grindley, Nigel D. F.; Joyce, Catherine M.; Kapanidis, Achillefs N.

    2013-01-01

    The fidelity of DNA polymerases depends on conformational changes that promote the rejection of incorrect nucleotides before phosphoryl transfer. Here, we combine single-molecule FRET with the use of DNA polymerase I and various fidelity mutants to highlight mechanisms by which active-site side chains influence the conformational transitions and free-energy landscape that underlie fidelity decisions in DNA synthesis. Ternary complexes of high fidelity derivatives with complementary dNTPs adopt mainly a fully closed conformation, whereas a conformation with a FRET value between those of open and closed is sparsely populated. This intermediate-FRET state, which we attribute to a partially closed conformation, is also predominant in ternary complexes with incorrect nucleotides and, strikingly, in most ternary complexes of low-fidelity derivatives for both correct and incorrect nucleotides. The mutator phenotype of the low-fidelity derivatives correlates well with reduced affinity for complementary dNTPs and highlights the partially closed conformation as a primary checkpoint for nucleotide selection. PMID:23831915

  19. Enhanced conformational sampling of carbohydrates by Hamiltonian replica-exchange simulation.

    PubMed

    Mishra, Sushil Kumar; Kara, Mahmut; Zacharias, Martin; Koca, Jaroslav

    2014-01-01

    Knowledge of the structure and conformational flexibility of carbohydrates in an aqueous solvent is important to improving our understanding of how carbohydrates function in biological systems. In this study, we extend a variant of the Hamiltonian replica-exchange molecular dynamics (MD) simulation to improve the conformational sampling of saccharides in an explicit solvent. During the simulations, a biasing potential along the glycosidic-dihedral linkage between the saccharide monomer units in an oligomer is applied at various levels along the replica runs to enable effective transitions between various conformations. One reference replica runs under the control of the original force field. The method was tested on disaccharide structures and further validated on biologically relevant blood group B, Lewis X and Lewis A trisaccharides. The biasing potential-based replica-exchange molecular dynamics (BP-REMD) method provided a significantly improved sampling of relevant conformational states compared with standard continuous MD simulations, with modest computational costs. Thus, the proposed BP-REMD approach adds a new dimension to existing carbohydrate conformational sampling approaches by enhancing conformational sampling in the presence of solvent molecules explicitly at relatively low computational cost. PMID:24134878

  20. Lipid Regulated Conformational Dynamics of the Longin SNARE Protein Ykt6 Revealed by Molecular Dynamics Simulations.

    PubMed

    Weng, Jingwei; Yang, Yanhong; Wang, Wenning

    2015-03-01

    The conformation and subcellular localization of R-SNARE protein Ykt6 are regulated by the lipidation state of its C-terminal CCAIM motif. Biochemical and crystallography studies showed that lipid molecules binding at a hydrophobic pocket at the interface between the longin domain and the SNARE core can lock Ykt6 at a closed conformation and mimic the farnesylated state of Ykt6. In this study, we performed in silico farnesylation of Ykt6 and explored the conformational dynamics of Ykt6 using conventional and steered MD simulations. We found that the farnesylated Ykt6 model structure is stable during the 2 ?s simulation and the farnesyl group adopts conformations similar to those of the DPC molecule bound to Ykt6. Both DPC binding and farnesylation were found to reduce the conformational flexibility of Ykt6 and hinder the dissociation of SNARE core from the longin domain. The dissociation of the ?F-?G segment is the rate-limiting step during the putative closed-to-open conformational transition of Ykt6, and the key residues involved in this process are consistent with the experimental mutagenesis study. PMID:25268560

  1. Unimodular conformal and projective relativity

    NASA Astrophysics Data System (ADS)

    Bradonjic, Kaca

    Existing approaches to quantum gravity fail to fully reconcile the background independence of general relativity and the role of the quantum of action in quantum-mechanical theories. They disagree as to which classical space-time quantities (or observables) should be quantized, and use quantization techniques without taking into consideration the role of measurability analysis in assuring consistency between the definability of these observables and their individual measurability and joint co-measurability by some idealized process. This thesis outlines the framework of a new approach, called Unimodular Conformal and Projective Relativity (UCPR), discusses the classical measurability of all of its basic observables, and examines the problem of extending this analysis to a physically motivated theory of quantum gravity. We consider the unimodular group of transformations (i.e., those with the unit determinant), rather than the full diffeomorphism group, as the basic symmetry group of the theory. This reduction leads to a natural decomposition of the linear affine connection into a projective connection and an affine one-form, and of the Riemannian pseudo-metric into a conformal metric and a volume-element. The geometric representation of all four structures is motivated by their physical interpretation. The projective connection and affine one-form are motivated by the law of inertia; the first determines the paths traversed by massive particles moving only under the combined influence of inertia and gravitation, while the second assures that these particles move at constant speed. The conformal metric determines constant-phase wave-fronts of zero rest-mass fields, while the volume-element permits the averaging of physical fields independently of other space-time structures. Using the UCPR framework, we decompose the usual general-relativistic Lagrangian, and derive the homogenous and inhomogenous field equations and compatibility conditions for the four fundamental fields. The application of this formalism to systems including only zero rest-mass fields is presented. Finally, we outline some approaches to classical measurability analysis of all the relevant structures, and their possible extension to phenomena in which the quantum of action plays a significant role.

  2. Conformal Field Theories Coupled to 2-D Gravity in the Conformal Gauge

    Microsoft Academic Search

    F. David

    1988-01-01

    The coupling of conformal field theories to 2-d gravity may be studied in the conformal gauge. As an application, the results of Knizhnik, Polyakov and Zamolodchikov for the scaling dimensions of conformal fields are derived in a simple way. Their conjecture for the susceptibility exponent gamma of strings is proven and extended to arbitrary genus surfaces. The result agrees with

  3. NONCOMMUTATIVE GEOMETRY AND CONFORMAL GEOMETRY. I. LOCAL INDEX FORMULA AND CONFORMAL INVARIANTS

    E-print Network

    Ponge, Raphaël

    NONCOMMUTATIVE GEOMETRY AND CONFORMAL GEOMETRY. I. LOCAL INDEX FORMULA AND CONFORMAL INVARIANTS geometry and con- formal geometry. In this paper, elaborating on ideas of Connes and Moscovici, we establish a local index formula in conformal-diffeomorphism invariant geometry. The existence

  4. Conformational dynamics of single HIV-1 envelope trimers on the surface of native virions.

    PubMed

    Munro, James B; Gorman, Jason; Ma, Xiaochu; Zhou, Zhou; Arthos, James; Burton, Dennis R; Koff, Wayne C; Courter, Joel R; Smith, Amos B; Kwong, Peter D; Blanchard, Scott C; Mothes, Walther

    2014-11-01

    The HIV-1 envelope (Env) mediates viral entry into host cells. To enable the direct imaging of conformational dynamics within Env, we introduced fluorophores into variable regions of the glycoprotein gp120 subunit and measured single-molecule fluorescence resonance energy transfer within the context of native trimers on the surface of HIV-1 virions. Our observations revealed unliganded HIV-1 Env to be intrinsically dynamic, transitioning between three distinct prefusion conformations, whose relative occupancies were remodeled by receptor CD4 and antibody binding. The distinct properties of neutralization-sensitive and neutralization-resistant HIV-1 isolates support a dynamics-based mechanism of immune evasion and ligand recognition. PMID:25298114

  5. A search for the lowest-energy conformer of interstellar glycine

    NASA Technical Reports Server (NTRS)

    Hollis, J. M.; Snyder, L. E.; Suenram, R. D.; Lovas, F. J.

    1980-01-01

    The first search for the lowest-energy conformation of interstellar glycine has been carried out. An emission line has been detected in Sgr B2 which is coincident in frequency with the J(K-K+) = 14(1, 14)-13(1, 13) transition of conformer I glycine; while the carrier of the observed line is uncertain, no other frequency-coincident species are known, and hence glycine cannot be ruled out. Several previously unidentified lines have been identified as methyl formate. Evidence for the existence of the elusive interstellar ethylene oxide, the only reported interstellar ring-structure molecule, is discussed.

  6. Near-infrared laser induced conformational change and UV laser photolysis of glycine in low-temperature matrices: Observation of a short-lived conformer

    NASA Astrophysics Data System (ADS)

    Bazsó, Gábor; Magyarfalvi, Gábor; Tarczay, György

    2012-10-01

    The near-infrared spectrum (NIR) of glycine was measured in Ar and Kr matrices. Matrix-isolated glycine was irradiated with NIR laser light at the first OH or NH stretching overtone bands of the three main glycine (ttt/Ip, ccc/IIn, tct/IIIp) conformers. The main conversion paths and their efficiencies are described qualitatively, and it is shown that there are significant differences in the conversion paths in Ar and Kr. In the detailed analysis of these experiments many new, formerly unobserved low-intensity transitions of the three main conformers were identified, and in addition a short-lived (tunneling half-life is 5 ± 2 s) higher energy conformer (ttc/VIp) was observed during the irradiation at the first OH stretching overtone of ttt/Ip. The UV spectrum of glycine was also measured in Ar matrix, and the first two absorption bands of conformers ttt/Ip and ccc/IIn were identified. UV laser irradiation at longer (240 nm) wavelengths promotes rotamerization, while at shorter wavelengths (235 and 213.5 nm) it results in depletion of the different conformers with different rates. Analysis of spectra recorded after UV irradiation showed that the two main photodecomposition processes are decarboxylation and H2O loss, forming methylamine and NH2CHCO, respectively.

  7. Conformational study of cis-1,4-di-tert-butylcyclohexane by dynamic NMR spectroscopy and computational methods. Observation of chair and twist-boat conformations.

    PubMed

    Gill, Gurvinder; Pawar, Diwakar M; Noe, Eric A

    2005-12-23

    [reaction: see text] Low-temperature 13C NMR spectra of cis-1,4-di-tert-butylcyclohexane (1) showed signals for the twist-boat (1a) and chair (1b) conformations. 13C NMR signals were assigned to specific carbons based on the different populations, different symmetries (time-averaged C(2v) for 1a and time-averaged C(s) for 1b), and calculated chemical shifts (GIAO, HF/6-311+G*). In addition to slow ring inversion and interconversion of the chair and twist-boat conformations, slow rotation of the tert-butyl groups was found. Most of the expected 13C peaks were observed. Free-energy barriers of 6.83 and 6.35 kcal/mol were found for interconversion of 1a (major) and 1b (minor) at -148.1 degrees C. Conformational space was searched with Allinger's MM3 and MM4 programs, and free energies were obtained for several low-energy conformations 1a-c. Calculations were repeated with ab initio methods up to the HF/6-311+G* level. Molecular symmetries, relative free energies, relative enthalpies and entropies, frequencies, and NMR chemical shifts were obtained. A boat conformation (1d; C(2v) symmetry) was generated and optimized as a transition state by ab initio, MM3, and MM4 calculations. PMID:16355992

  8. Solvent Microenvironments and Copper Binding Alters the Conformation and Toxicity of a Prion Fragment

    PubMed Central

    Malkovskiy, Andrey V.; Carre, Antoine L.; Sivanesan, Senthilkumar; Hardesty, Jasper O.; Rajadas, Jayakumar

    2013-01-01

    The secondary structures of amyloidogenic proteins are largely influenced by various intra and extra cellular microenvironments and metal ions that govern cytotoxicity. The secondary structure of a prion fragment, PrP(111-126), was determined using circular dichroism (CD) spectroscopy in various microenvironments. The conformational preferences of the prion peptide fragment were examined by changing solvent conditions and pH, and by introducing external stress (sonication). These physical and chemical environments simulate various cellular components at the water-membrane interface, namely differing aqueous environments and metal chelating ions. The results show that PrP(111-126) adopts different conformations in assembled and non-assembled forms. Aging studies on the PrP(111-126) peptide fragment in aqueous buffer demonstrated a structural transition from random coil to a stable ?-sheet structure. A similar, but significantly accelerated structural transition was observed upon sonication in aqueous environment. With increasing TFE concentrations, the helical content of PrP(111-126) increased persistently during the structural transition process from random coil. In aqueous SDS solution, PrP(111-126) exhibited ?-sheet conformation with greater ?-helical content. No significant conformational changes were observed under various pH conditions. Addition of Cu2+ ions inhibited the structural transition and fibril formation of the peptide in a cell free in vitro system. The fact that Cu2+ supplementation attenuates the fibrillar assemblies and cytotoxicity of PrP(111-126) was witnessed through structural morphology studies using AFM as well as cytotoxicity using MTT measurements. We observed negligible effects during both physical and chemical stimulation on conformation of the prion fragment in the presence of Cu2+ ions. The toxicity of PrP(111-126) to cultured astrocytes was reduced following the addition of Cu2+ ions, owing to binding affinity of copper towards histidine moiety present in the peptide. PMID:24386462

  9. Wheeler-DeWitt Equation in Two-dimensional Quantum Gravity with $c=1$ Conformal Matter Field

    E-print Network

    Atushi Ishikawa

    1993-12-27

    In the context of two-dimensional quantum cosmology, we consider the path-integral of a string on annulus which contains the Liouville field and conformal matter fields. We show that, in the transition amplitude of the string universe, the non-zero modes of the fields are all cancelled out only when we take the $c=1$ conformal matter field and impose the Neumann boundary condition on the system. The transition amplitude obtained obeys the minisuperspace Wheeler-DeWitt equation. In our treatment, the modular parameter on annulus plays the role of time variable to integrate out.

  10. Electromagnetic characterization of conformal antennas

    NASA Technical Reports Server (NTRS)

    Volakis, John L.; Kempel, Leo C.; Alexanian, Angelos; Jin, J. M.; Yu, C. L.; Woo, Alex C.

    1992-01-01

    The ultimate objective of this project is to develop a new technique which permits an accurate simulation of microstrip patch antennas or arrays with various feed, superstrate and/or substrate configurations residing in a recessed cavity whose aperture is planar, cylindrical or otherwise conformed to the substructure. The technique combines the finite element and boundary integral methods to formulate a system suitable for solution via the conjugate gradient method in conjunction with the fast Fourier transform. The final code is intended to compute both scattering and radiation patterns of the structure with an affordable memory demand. With upgraded capabilities, the four included papers examined the radar cross section (RCS), input impedance, gain, and resonant frequency of several rectangular configurations using different loading and substrate/superstrate configurations.

  11. Charged gravastars admitting conformal motion

    E-print Network

    A A Usmani; Farook Rahaman; Saibal Ray; K K Nandi; Peter K. F. Kuhfittig; Sk. A Rakib; Z Hasan

    2011-06-03

    We propose a new model of a {\\it gravastar} admitting conformal motion. While retaining the framework of the Mazur-Mottola model, the gravastar is assumed to be internally charged, with an exterior defined by a Reissner-Nordstr{\\"o}m rather than a Schwarzschild line element. The solutions obtained involve (i) the interior region, (ii) the shell, and (iii) the exterior region of the sphere. Of these three cases the first case is of primary interest since the total gravitational mass vanishes for vanishing charge and turns the total gravitational mass into an {\\it electromagnetic mass} under certain conditions. This suggests that the interior de Sitter vacuum of a charged gravastar is essentially an electromagnetic mass model that must generate the gravitational mass. We have also analyzed various other aspects such as the stress energy tensor in the thin shell and the entropy of the system.

  12. Conformal Frame Dependence of Inflation

    E-print Network

    Domènech, Guillem

    2015-01-01

    Physical equivalence between different conformal frames in scalar-tensor theory of gravity is a known fact. However, assuming that matter minimally couples to the metric of a particular frame, which we call the matter Jordan frame, the matter point of view of the universe may vary from frame to frame. Thus, there is a clear distinction between gravitational sector (curvature and scalar field) and matter sector. In this paper, focusing on a simple power-law inflation model in the Einstein frame, two examples are considered; a super-inflationary and a bouncing universe Jordan frames. Then we consider a spectator curvaton minimally coupled to a Jordan frame, and compute its contribution to the curvature perturbation power spectrum. In these specific examples, we find a blue tilt at short scales for the super-inflationary case, and a blue tilt at large scales for the bouncing case.

  13. Approaching Conformality with Ten Flavors

    SciTech Connect

    Appelquist, Thomas; Brower, Richard C.; Buchoff, Michael I.; Cheng, Michael; Cohen, Saul D.; Fleming, George T.; Kiskis, Joe; Lin, Meifeng; Na, Heechang; Neil, Ethan T.; Osborn, James C.

    2012-04-01

    We present first results for lattice simulations, on a single volume, of the low-lying spectrum of an SU(3) Yang-Mills gauge theory with N{sub f} = 10 light fermions in the fundamental representation. Fits to the fermion mass dependence of various observables are found to be globally consistent with the hypothesis that this theory is within or just outside the strongly-coupled edge of the conformal window, with mass anomalous dimension {gamma}* {approx} 1 over the range of scales simulated. We stress that we cannot rule out the possibility of spontaneous chiral-symmetry breaking at scales well below our infrared cutoff. We discuss important systematic effects, including finite-volume corrections, and consider directions for future improvement.

  14. Conformal frame dependence of inflation

    NASA Astrophysics Data System (ADS)

    Domènech, Guillem; Sasaki, Misao

    2015-04-01

    Physical equivalence between different conformal frames in scalar-tensor theory of gravity is a known fact. However, assuming that matter minimally couples to the metric of a particular frame, which we call the matter Jordan frame, the matter point of view of the universe may vary from frame to frame. Thus, there is a clear distinction between gravitational sector (curvature and scalar field) and matter sector. In this paper, focusing on a simple power-law inflation model in the Einstein frame, two examples are considered; a super-inflationary and a bouncing universe Jordan frames. Then we consider a spectator curvaton minimally coupled to a Jordan frame, and compute its contribution to the curvature perturbation power spectrum. In these specific examples, we find a blue tilt at short scales for the super-inflationary case, and a blue tilt at large scales for the bouncing case.

  15. Perceived Symbols of Authority and Their Influence on Conformity.

    ERIC Educational Resources Information Center

    Bushman, Brad J.

    Although there are many variables that influence conformity, Bickman (1974) found that the apparel of the person making a request had a significant influence on conformity. To evaluate other factorswhicn may influence conformity (gender, age, status of the conforming subject, and altruism in conforming), 150 adult pedestrians (45% female, 71%…

  16. Transition metals

    PubMed Central

    Rodrigo-Moreno, Ana; Poschenrieder, Charlotte; Shabala, Sergey

    2013-01-01

    Transition metals such as Iron (Fe) and Copper (Cu) are essential for plant cell development. At the same time, due their capability to generate hydroxyl radicals they can be potentially toxic to plant metabolism. Recent works on hydroxyl-radical activation of ion transporters suggest that hydroxyl radicals generated by transition metals could play an important role in plant growth and adaptation to imbalanced environments. In this mini-review, the relation between transition metals uptake and utilization and oxidative stress-activated ion transport in plant cells is analyzed, and a new model depicting both apoplastic and cytosolic mode of ROS signaling to plasma membrane transporters is suggested. PMID:23333964

  17. Conformal coordinates of a constant density star

    E-print Network

    Karthik Shankar; Bernard. F. Whiting

    2007-06-28

    It is well known that the interior of a constant density spherical star is conformally flat. In this paper we obtain the coordinate system in which the conformal flatness of the metric manifests itself. In a similar way, we also construct such coordinates for Robertson Walker metric.

  18. Review article Protein conformation and disease

    E-print Network

    Paris-Sud XI, Université de

    Review article Protein conformation and disease PK Nandi Pathologie infectieuse et immunologie; In a number of neurodegenerative diseases, a change in the conformation of specific pro- teins occurs which is considered to be related to the development of the disease process. In general, a change in the protein

  19. Conformally related null Einstein-Maxwell fields

    NASA Astrophysics Data System (ADS)

    Hruška, J.; Žofka, M.

    2013-01-01

    We present a class of pairs of non-trivially conformally related solutions of Einstein-Maxwell equations that are not pp-waves. To our knowledge, this is the first such case and thus an extension of theorems by Brinkmann, Daftardar-Gejji and Van den Bergh concerning conformal transformations of solutions with null electromagnetic fields.

  20. Conformal field theory and elliptic cohomology

    Microsoft Academic Search

    P. HU; I. KRIZ

    2004-01-01

    In this paper, we use conformal field theory to construct a generalized cohomology theory which has some properties of elliptic cohomology theory which was some properties of elliptic cohomology. A part of our presentation is a rigorous definition of conformal field theory following Segal's axioms, and some examples, such as lattice theories associated with a unimodular even lattice. We also

  1. Fusion Rules in Conformal Field Theory

    Microsoft Academic Search

    Jürgen Fuchs

    1994-01-01

    Several aspects of fusion rings and fusion rule algebras, and of their manifestations in twodimensional (conformal) field theory, are described: diagonalization and the connection with modular invariance; the presentation in terms of quotients of polynomial rings; fusion graphs; various strategies that allow for a partial classification; and the role of the fusion rules in the conformal bootstrap programme.

  2. Operator algebras and conformal field theory

    Microsoft Academic Search

    Fabrizio Gabbiani; Jürg Fröhlich

    1993-01-01

    We define and study two-dimensional, chiral conformal field theory by the methods of algebraic field theory. We start by characterizing the vacuum sectors of such theories and show that, under very general hypotheses, their algebras of local observables are isomorphic to the unique hyperfinite type III1 factor. The conformal net determined by the algebras of local observables is proven to

  3. The conformal field theory of orbifolds

    Microsoft Academic Search

    Lance Dixon; Daniel Friedan; Emil Martinec; Stephen Shenker

    1987-01-01

    A prescription for the calculation of any correlation function in orbifold conformal field theory is given. The method is applied to the scattering of four twisted string states, which allows the extraction of operator product coefficients of conformal twist fields. We derive Yukawa couplings in the effective field theory for fermionic strings on orbifolds. Supported in part by DOE grant

  4. Conformal Field Theory and Geometry of Strings

    Microsoft Academic Search

    Jurg Frohlich; Krzysztof Gawedzki

    1993-01-01

    What is quantum geometry? This question is becoming a popular leitmotiv in theoretical physics and in mathematics. Conformal field theory may catch a glimpse of the right answer. We review global aspects of the geometry of conformal fields, such as duality and mirror symmetry, and interpret them within Connes' non-commutative geometry. Extended version of lectures given by the 2nd author

  5. osp(1|2) conformal field theory

    SciTech Connect

    Ennes, I. P.; Ramallo, A. V.; Sanchez de Santos, J. M. [Departamento de Fisica de Particulas, Universidad de Santiago, E-15706 Santiago de Compostela (Spain)

    1998-01-10

    We review some results recently obtained for the conformal field theories based on the affine Lie superalgebra osp(1|2). In particular, we study the representation theory of the osp(1|2) current algebras and their character formulas. By means of a free field representation of the conformal blocks, we obtain the structure constants and the fusion rules of the model.

  6. Conformational readout of RNA by small ligands

    PubMed Central

    Kligun, Efrat; Mandel-Gutfreund, Yael

    2013-01-01

    RNA molecules have highly versatile structures that can fold into myriad conformations, providing many potential pockets for binding small molecules. The increasing number of available RNA structures, in complex with proteins, small ligands and in free form, enables the design of new therapeutically useful RNA-binding ligands. Here we studied RNA ligand complexes from 10 RNA groups extracted from the protein data bank (PDB), including adaptive and non-adaptive complexes. We analyzed the chemical, physical, structural and conformational properties of binding pockets around the ligand. Comparing the properties of ligand-binding pockets to the properties of computed pockets extracted from all available RNA structures and RNA-protein interfaces, revealed that ligand-binding pockets, mainly the adaptive pockets, are characterized by unique properties, specifically enriched in rare conformations of the nucleobase and the sugar pucker. Further, we demonstrate that nucleotides possessing the rare conformations are preferentially involved in direct interactions with the ligand. Overall, based on our comprehensive analysis of RNA-ligand complexes, we suggest that the unique conformations adopted by RNA nucleotides play an important role in RNA recognition by small ligands. We term the recognition of a binding site by a ligand via the unique RNA conformations “RNA conformational readout.” We propose that “conformational readout” is a general way by which RNA binding pockets are recognized and selected from an ensemble of different RNA states. PMID:23618839

  7. Conformal smectics and their many metrics

    NASA Astrophysics Data System (ADS)

    Alexander, Gareth P.; Kamien, Randall D.; Mosna, Ricardo A.

    2012-05-01

    We establish that equally spaced smectic configurations enjoy an infinite-dimensional conformal symmetry and show that there is a natural map between them and null hypersurfaces in maximally symmetric spacetimes. By choosing the appropriate conformal factor it is possible to restore additional symmetries of focal structures only found before for smectics on flat substrates.

  8. A tale of two conformally invariant metrics

    Microsoft Academic Search

    H. S. Bear; Wayne Smith

    2006-01-01

    The Harnack metric is a conformally invariant metric defined in quite general domains that coincides with the hyperbolic metric in the disk. We prove that the Harnack distance is never greater than the hyperbolic distance and if the two distances agree for one pair of distinct points, then either the domain is simply connected or it is conformally equivalent to

  9. Conformal invariance, supersymmetry and string theory

    Microsoft Academic Search

    Daniel Friedan; Emil Martinec; Stephen Shenker

    1986-01-01

    Covariant quantization of string theories is developed in the context of conformal field theory and the BRST quantization procedure. The BRST method is used to covariantly quantize superstrings, and in particular to construct the vertex operators for string emission as well as the supersymmetry charge. The calculation of string loop diagrams is sketched. We discuss how conformal methods can be

  10. Regulatory Conformance Checking: Logic and Logical Form

    ERIC Educational Resources Information Center

    Dinesh, Nikhil

    2010-01-01

    We consider the problem of checking whether an organization conforms to a body of regulation. Conformance is studied in a runtime verification setting. The regulation is translated to a logic, from which we synthesize monitors. The monitors are evaluated as the state of an organization evolves over time, raising an alarm if a violation is…

  11. Conformational influence of the ribose 2'-hydroxyl group: crystal structures of DNA-RNA chimeric duplexes

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Rich, A.

    1993-01-01

    We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.

  12. 47 CFR 18.123 - Transition provisions for compliance with the rules.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... § 18.123 Transition provisions for compliance with the rules. Consumer ISM devices, induction cooking ranges and ultrasonic equipment that are authorized under the certification, verification or declaration of conformity procedures on or...

  13. PH-gated porosity and reversible swelling transitions in polyelectrolyte multilayers

    E-print Network

    Hiller, Jeri' Ann, 1976-

    2003-01-01

    This thesis explores the design of novel pH-responsive polyelectrolyte multilayer (PEM) films. The discoveries of discontinuous pH-induced swelling transitions and concomitant conformational memory effects as well as ...

  14. Observing the unfolding transition of [beta]-hairpin peptides with nonlinear infrared spectroscopy

    E-print Network

    Smith, Adam Wilcox, 1977-

    2008-01-01

    The biological function of a protein is in large measure determined by its three-dimensional structure. To date, however, the transition of the protein between the native and non-native conformations is not well-understood. ...

  15. Vertex operator algebras and conformal field theory

    SciTech Connect

    Huang, Y.Z. (School of Mathematics, Inst. for Advanced Study, Princeton, NJ (US))

    1992-04-20

    This paper discusses conformal field theory, an important physical theory, describing both two-dimensional critical phenomena in condensed matter physics and classical motions of strings in string theory. The study of conformal field theory will deepen the understanding of these theories and will help to understand string theory conceptually. Besides its importance in physics, the beautiful and rich mathematical structure of conformal field theory has interested many mathematicians. New relations between different branches of mathematics, such as representations of infinite-dimensional Lie algebras and Lie groups, Riemann surfaces and algebraic curves, the Monster sporadic group, modular functions and modular forms, elliptic genera and elliptic cohomology, Calabi-Yau manifolds, tensor categories, and knot theory, are revealed in the study of conformal field theory. It is therefore believed that the study of the mathematics involved in conformal field theory will ultimately lead to new mathematical structures which would be important to both mathematics and physics.

  16. Measuring chromosome conformation with degenerate labels

    NASA Astrophysics Data System (ADS)

    Ross, Brian C.; Wiggins, Paul A.

    2012-07-01

    Although DNA conformation plays an integral role in all genetic processes from transcription to chromosome segregation, there is as yet no tractable method for capturing the in vivo conformation of a chromosome at high resolution. Labeling and fluorescently imaging thousands of loci along the chromosome would readily yield a conformation if each locus could be uniquely distinguished in the image, but this would unrealistically require thousands of distinguishable labels and a tedious experimental process. Here we present a computational method for extracting conformations when the total number of labels far exceeds the number of distinguishable labels. We evaluate our technique using simulated conformations with lengths ranging from 10 to 100 kilobases, and discuss the prospects for an experiment.

  17. Classifying leukemia types with chromatin conformation data

    PubMed Central

    2014-01-01

    Background Although genetic or epigenetic alterations have been shown to affect the three-dimensional organization of genomes, the utility of chromatin conformation in the classification of human disease has never been addressed. Results Here, we explore whether chromatin conformation can be used to classify human leukemia. We map the conformation of the HOXA gene cluster in a panel of cell lines with 5C chromosome conformation capture technology, and use the data to train and test a support vector machine classifier named 3D-SP. We show that 3D-SP is able to accurately distinguish leukemias expressing MLL-fusion proteins from those expressing only wild-type MLL, and that it can also classify leukemia subtypes according to MLL fusion partner, based solely on 5C data. Conclusions Our study provides the first proof-of-principle demonstration that chromatin conformation contains the information value necessary for classification of leukemia subtypes. PMID:24995990

  18. Performance of Conformable Ablators in Aerothermal Environments

    NASA Technical Reports Server (NTRS)

    Thornton, J.; Fan, W.; Skokova, K.; Stackpoole, M.; Beck, R.; Chavez-Garcia, J.

    2012-01-01

    Conformable Phenolic Impregnated Carbon Ablator, a cousin of Phenolic Impregnated Carbon Ablator (PICA), was developed at NASA Ames Research Center as a lightweight thermal protection system under the Fundamental Aeronautics Program. PICA is made using a brittle carbon substrate, which has a very low strain to failure. Conformable PICA is made using a flexible carbon substrate, a felt in this case. The flexible felt significantly increases the strain to failure of the ablator. PICA is limited by its thermal mechanical properties. Future NASA missions will require heatshields that are more fracture resistant than PICA and, as a result, NASA Ames is working to improve PICAs performance by developing conformable PICA to meet these needs. Research efforts include tailoring the chemistry of conformable PICA with varying amounts of additives to enhance mechanical properties and testing them in aerothermal environments. This poster shows the performance of conformable PICA variants in arc jets tests. Some mechanical and thermal properties will also be presented.

  19. Transit Math

    NSDL National Science Digital Library

    This is a collection of mathematical problems about transits in the solar system. Learners can work problems created to be authentic glimpses of modern science and engineering issues, often involving actual research data.

  20. Representation of target-bound drugs by computed conformers: implications for conformational libraries

    PubMed Central

    Günther, Stefan; Senger, Christian; Michalsky, Elke; Goede, Andrean; Preissner, Robert

    2006-01-01

    Background The increasing number of known protein structures provides valuable information about pharmaceutical targets. Drug binding sites are identifiable and suitable lead compounds can be proposed. The flexibility of ligands is a critical point for the selection of potential drugs. Since computed 3D structures of millions of compounds are available, the knowledge of their binding conformations would be a great benefit for the development of efficient screening methods. Results Integration of two public databases allowed superposition of conformers for 193 approved drugs with 5507 crystallised target-bound counterparts. The generation of 9600 drug conformers using an atomic force field was carried out to obtain an optimal coverage of the conformational space. Bioactive conformations are best described by a conformational ensemble: half of all drugs exhibit multiple active states, distributed over the entire range of the reachable energy and conformational space. A number of up to 100 conformers per drug enabled us to reproduce the bound states within a similarity threshold of 1.0 Å in 70% of all cases. This fraction rises to about 90% for smaller or average sized drugs. Conclusion Single drugs adopt multiple bioactive conformations if they interact with different target proteins. Due to the structural diversity of binding sites they adopt conformations that are distributed over a broad conformational space and wide energy range. Since the majority of drugs is well represented by a predefined low number of conformers (up to 100) this procedure is a valuable method to compare compounds by three-dimensional features or for fast similarity searches starting with pharmacophores. The underlying 9600 generated drug conformers are downloadable from the Super Drug Web site [1]. All superpositions are visualised at the same source. Additional conformers (110,000) of 2400 classified WHO-drugs are also available. PMID:16764718

  1. Structural Basis and Kinetics of Force-Induced Conformational Changes of an ?A Domain-Containing Integrin

    PubMed Central

    Li, Tian; Chen, Wei; Lou, Jizhong; Zhu, Cheng

    2011-01-01

    Background Integrin ?L?2 (lymphocyte function-associated antigen, LFA-1) bears force upon binding to its ligand intercellular adhesion molecule 1 (ICAM-1) when a leukocyte adheres to vascular endothelium or an antigen presenting cell (APC) during immune responses. The ligand binding propensity of LFA-1 is related to its conformations, which can be regulated by force. Three conformations of the LFA-1 ?A domain, determined by the position of its ?7-helix, have been suggested to correspond to three different affinity states for ligand binding. Methodology/Principal Findings The kinetics of the force-driven transitions between these conformations has not been defined and dynamically coupled to the force-dependent dissociation from ligand. Here we show, by steered molecular dynamics (SMD) simulations, that the ?A domain was successively transitioned through three distinct conformations upon pulling the C-terminus of its ?7-helix. Based on these sequential transitions, we have constructed a mathematical model to describe the coupling between the ?A domain conformational changes of LFA-1 and its dissociation from ICAM-1 under force. Using this model to analyze the published data on the force-induced dissociation of single LFA-1/ICAM-1 bonds, we estimated the force-dependent kinetic rates of interstate transition from the short-lived to intermediate-lived and from intermediate-lived to long-lived states. Interestingly, force increased these transition rates; hence activation of LFA-1 was accelerated by pulling it via an engaged ICAM-1. Conclusions/Significance Our study defines the structural basis for mechanical regulation of the kinetics of LFA-1 ?A domain conformational changes and relates these simulation results to experimental data of force-induced dissociation of single LFA-1/ICAM-1 bonds by a new mathematical model, thus provided detailed structural and kinetic characterizations for force-stabilization of LFA-1/ICAM-1 interaction. PMID:22140490

  2. 47 CFR 2.906 - Declaration of Conformity.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 2010-10-01 false Declaration of Conformity. 2.906 Section 2.906 Telecommunication...General Provisions § 2.906 Declaration of Conformity. (a) A Declaration of Conformity is a procedure where the...

  3. 40 CFR 51.857 - Frequency of conformity determinations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 false Frequency of conformity determinations. 51.857 Section...OF IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State...Implementation Plans § 51.857 Frequency of conformity determinations. Link to an...

  4. 47 CFR 2.1072 - Limitation on Declaration of Conformity.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... false Limitation on Declaration of Conformity. 2.1072 Section 2.1072 Telecommunication...Authorization Procedures Declaration of Conformity § 2.1072 Limitation on Declaration of Conformity. (a) The Declaration...

  5. 40 CFR 89.121 - Certificate of conformity effective dates.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 false Certificate of conformity effective dates. 89.121 Section...Provisions § 89.121 Certificate of conformity effective dates. The certificate of conformity is valid from the date of issuance...

  6. 20 CFR 604.6 - Conformity and substantial compliance.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...2010-04-01 2010-04-01 false Conformity and substantial compliance. 604...UNEMPLOYMENT COMPENSATION § 604.6 Conformity and substantial compliance. (a...program. (b) Resolving Issues of Conformity and Substantial Compliance. For...

  7. 47 CFR 68.320 - Supplier's Declaration of Conformity.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ...2010-10-01 2010-10-01 false Supplier's Declaration of Conformity. 68.320...Terminal Equipment Approval § 68.320 Supplier's Declaration of Conformity. (a) Supplier's Declaration of Conformity is a...

  8. 47 CFR 68.324 - Supplier's Declaration of Conformity requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ...2010-10-01 2010-10-01 false Supplier's Declaration of Conformity requirements...Terminal Equipment Approval § 68.324 Supplier's Declaration of Conformity requirements...responsible party shall include in the Supplier's Declaration of Conformity, the...

  9. Author's personal copy Ligand Binding Reduces Conformational Flexibility

    E-print Network

    Wood, Thomas K.

    Author's personal copy Ligand Binding Reduces Conformational Flexibility in the Active Site loop is disordered and the general acid loop adopts an open conformation, placing the catalytic site experience motions on multiple timescales, consistent with a combination of conformational

  10. 21 CFR 26.69 - Monitoring of conformity assessment bodies.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...Monitoring of conformity assessment bodies. 26.69 Section 26.69...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL...Monitoring of conformity assessment bodies. The following shall apply...monitoring of conformity assessment bodies (CAB's) listed in...

  11. 21 CFR 26.70 - Conformity assessment bodies.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...false Conformity assessment bodies. 26.70 Section 26.70...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL...70 Conformity assessment bodies. Each party recognizes that the conformity assessment bodies (CAB's) listed in...

  12. 21 CFR 26.70 - Conformity assessment bodies.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...false Conformity assessment bodies. 26.70 Section 26.70...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL...70 Conformity assessment bodies. Each party recognizes that the conformity assessment bodies (CAB's) listed in...

  13. 21 CFR 26.69 - Monitoring of conformity assessment bodies.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...Monitoring of conformity assessment bodies. 26.69 Section 26.69...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL...Monitoring of conformity assessment bodies. The following shall apply...monitoring of conformity assessment bodies (CAB's) listed in...

  14. 21 CFR 26.70 - Conformity assessment bodies.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...false Conformity assessment bodies. 26.70 Section 26.70...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL...70 Conformity assessment bodies. Each party recognizes that the conformity assessment bodies (CAB's) listed in...

  15. 21 CFR 26.69 - Monitoring of conformity assessment bodies.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...Monitoring of conformity assessment bodies. 26.69 Section 26.69...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL MUTUAL...Monitoring of conformity assessment bodies. The following shall apply...monitoring of conformity assessment bodies (CAB's) listed in...

  16. The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.

    PubMed Central

    Lane, A N

    1991-01-01

    The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove. PMID:1998537

  17. The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.

    PubMed

    Lane, A N

    1991-01-15

    The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove. PMID:1998537

  18. Technidilaton at the conformal edge

    SciTech Connect

    Hashimoto, Michio; Yamawaki, Koichi [Maskawa Institute for Science and Culture, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-Ku, Kyoto 603-8555 (Japan); Kobayashi-Maskawa Institute for the Origin of Particles and the Universe (KMI), Nagoya University, Nagoya 464-8602 (Japan)

    2011-01-01

    Technidilaton (TD) was proposed long ago in the technicolor near criticality/conformality. To reveal the critical behavior of TD, we explicitly compute the nonperturbative contributions to the scale anomaly <{theta}{sub {mu}}{sup {mu}>} and to the technigluon condensate <{alpha}G{sub {mu}{nu}}{sup 2}>, which are generated by the dynamical mass m of the technifermions. Our computation is based on the (improved) ladder Schwinger-Dyson equation, with the gauge coupling {alpha} replaced by the two-loop running coupling {alpha}({mu}) having the Caswell-Banks-Zaks infrared fixed point {alpha}{sub *}: {alpha}({mu}){approx_equal}{alpha}={alpha}{sub *} for the infrared region m<{mu}<{Lambda}{sub TC}, where {Lambda}{sub TC} is the intrinsic scale (analogue of {Lambda}{sub QCD} of QCD) relevant to the perturbative scale anomaly. We find that -<{theta}{sub {mu}}{sup {mu}}>/m{sup 4}{yields}const{ne}0 and <{alpha}G{sub {mu}}{nu}{sup 2}>/m{sup 4}{yields}({alpha}/{alpha}{sub cr}-1){sup -3/2}{yields}{infinity} in the criticality limit m/{Lambda}{sub TC}{approx}exp(-{pi}/({alpha}/{alpha}{sub cr}-1){sup 1/2}){yields}0 ({alpha}={alpha}{sub *}=>{alpha}{sub cr}, or N{sub f} approaches N{sub f}{sup cr}) ('conformal edge'). Our result precisely reproduces the formal identity <{theta}{sub {mu}}{sup {mu}>}=({beta}({alpha})/4{alpha}{sup 2})<{alpha}G{sub {mu}{nu}}{sup 2}>, where {beta}({alpha})={Lambda}{sub TC}({partial_derivative}{alpha}/{partial_derivative}{Lambda}{sub TC})=-(2{alpha}{sub cr}/{pi}){center_dot}({alpha}/{alpha}{sub cr}-1){sup 3/2} is the nonperturbative beta function corresponding to the above essential singularity scaling of m/{Lambda}{sub TC}. Accordingly, the partially conserved dilatation current implies (M{sub TD}/m){sup 2}(F{sub TD}/m){sup 2}=-4<{theta}{sub {mu}}{sup {mu}}>/m{sup 4}{yields}const{ne}0 at criticality limit, where M{sub TD} is the mass of TD and F{sub TD} the decay constant of TD. We thus conclude that at criticality limit the TD could become a ''true (massless) Nambu-Goldstone boson'' M{sub TD}/m{yields}0, only when m/F{sub TD}{yields}0, namely, getting decoupled, as was the case of ''holographic technidilaton'' of Haba-Matsuzaki-Yamawaki. The decoupled TD can be a candidate of dark matter.

  19. Solution conformation and properties of the galactoglucan from Rhizobium meliloti strain YE-2(S1).

    PubMed

    Cesàro, A; Tomasi, G; Gamini, A; Vidotto, S; Navarini, L

    1992-07-01

    The physicochemical solution properties of the galactoglucan excreted by Rhizobium meliloti strain YE-2(S1) have been investigated by capillary viscometry, potentiometric titration, isothermal mixing microcalorimetry, and circular dichroism. Potentiometric and chiro-optical data, as a function of the degree of ionisation, indicate the absence of a co-operative conformational transition. Solution properties, as a function of ionic strength and temperature, suggest that the galactoglucan adopts a disordered conformation characterised by moderate flexibility. Polyelectrolyte theory is used to fit the enthalpy of dilution data with a suitable linear charge-density parameter. Conformational calculations and chain modelling, using molecular mechanics, give an unperturbed characteristic ratio, (C infinity) of 20, which was smaller than that estimated from intrinsic-viscosity and molecular-weight data for an expanded-coil chain model. PMID:1394308

  20. Autophosphorylation Activity of a Soluble Hexameric Histidine Kinase Correlates with the Shift in Protein Conformational Equilibrium

    PubMed Central

    Wojnowska, Marta; Yan, Jun; Sivalingam, Ganesh N.; Cryar, Adam; Gor, Jayesh; Thalassinos, Konstantinos; Djordjevic, Snezana

    2013-01-01

    Summary In a commonly accepted model, in response to stimuli, bacterial histidine kinases undergo a conformational transition between an active and inactive form. Structural information on histidine kinases is limited. By using ion mobility-mass spectrometry (IM-MS), we demonstrate an exchange between two conformational populations of histidine kinase ExsG that are linked to different levels of kinase activity. ExsG is an atypical signaling protein that incorporates an uncommon histidine kinase catalytic core at the C terminus preceded by an N-terminal “receiver domain” that is normally associated with the response regulator proteins in two-component signal transduction systems. IM-MS analysis and enzymatic assays indicate that phosphorylation of the ExsG receiver domain stabilizes the “compact” form of the protein and inhibits kinase core activity; in contrast, nucleotide binding required for kinase activity is associated with the more open conformation of ExsG. PMID:24210218

  1. Surface Quasi-Conformal Mapping by Solving Beltrami Equations

    E-print Network

    ,Luo,Yau,Gu Quasi-Conformal Mapping #12;Theoretic Background Definition (Conformal Atlas) suppose S is a surface, then the atlas A is a conformal atlas. U U S (U) (U) Zeng,Luo,Yau,Gu Quasi-Conformal Mapping #12;Theoretic-conformal map, with Beltrami coefficient µ(z), w ¯z = µ(z) w z . Then we construct another conformal atlas ~A1

  2. TRANSITION DE MOTT METAL-INSULATOR TRANSITIONS

    E-print Network

    Paris-Sud XI, Université de

    TRANSITION DE MOTT METAL-INSULATOR TRANSITIONS IN TRANSITION METAL OXIDES by D. B. McWHAN, A. MENTH oxydes de metaux de transition on observe une transition d'isolant a metal puis de metal a isolant de type Mott lorsque l'on augmentelenombre d'electrons d. Danslesysthe(V1-~Cr~)203une transition de Mott

  3. Conformational flexibility in biochemical regulation

    SciTech Connect

    Trewhella, J.

    1993-09-01

    Small-angle X-ray and neutron scattering have proven extremely useful for studying the evolutionarily related dumbbell-shaped Ca {sup 2+} -binding proteins calmodulin and troponin C and their interactions with the target proteins whose activity they regulate. Calmodulin contracts about target enzyme binding domains with the common characteristic of having a high propensity for forming a basic, amphipathic a-helix. The contraction is achieved via flexibility in the interconnecting helix region of the molecule that links its two globular domains. This flexibility allows calmodulin to optimize its binding to different arrangements of hydrophobic and charged residues important in forming these complexes. In contrast calmodulin remains extended in its interaction with the catalytic subunit of phosphorylase kinase. There are structural and functional similarities between this interaction and that of troponin C and troponin I. Our most recent neutron scattering experiments confirm our prediction that troponin C also remains extended in this complex. The ability of the dumbbell-shaped Ca {sup 2+} -binding proteins to modulate their conformations via flexibility in the interconnecting helix region in order to accommodate different target binding domains is a remarkable example nature building functional diversity as well as specificity into a compact and unusual shape.

  4. Conformations of an adenine bulge in a DNA octamer and its influence on DNA structure from molecular dynamics simulations.

    PubMed Central

    Feig, M; Zacharias, M; Pettitt, B M

    2001-01-01

    Molecular dynamics simulations have been applied to the DNA octamer d(GCGCA-GAAC). d(GTTCGCGC), which has an adenine bulge at the center to determine the pathway for interconversion between the stacked and extended forms. These forms are known to be important in the molecular recognition of bulges. From a total of ~35 ns of simulation time with the most recent CHARMM27 force field a variety of distinct conformations and subconformations are found. Stacked and fully looped-out forms are in excellent agreement with experimental data from NMR and x-ray crystallography. Furthermore, in a number of conformations the bulge base associates with the minor groove to varying degrees. Transitions between many of the conformations are observed in the simulations and used to propose a complete transition pathway between the stacked and fully extended conformations. The effect on the surrounding DNA sequence is investigated and biological implications of the accessible conformational space and the suggested transition pathway are discussed, in particular for the interaction of the MS2 replicase operator RNA with its coat protein. PMID:11423420

  5. Conformational changes in dopamine transporter intracellular regions upon cocaine binding and dopamine translocation.

    PubMed

    Dehnes, Yvette; Shan, Jufang; Beuming, Thijs; Shi, Lei; Weinstein, Harel; Javitch, Jonathan A

    2014-07-01

    The dopamine transporter (DAT), a member of the neurotransmitter:sodium symporter family, mediates the reuptake of dopamine at the synaptic cleft. DAT is the primary target for psychostimulants such as cocaine and amphetamine. We previously demonstrated that cocaine binding and dopamine transport alter the accessibility of Cys342 in the third intracellular loop (IL3). To study the conformational changes associated with the functional mechanism of the transporter, we made cysteine substitution mutants, one at a time, from Phe332 to Ser351 in IL3 of the background DAT construct, X7C, in which 7 endogenous cysteines were mutated. The accessibility of the 20 engineered cysteines to polar charged sulfhydryl reagents was studied in the absence and presence of cocaine or dopamine. Of the 11 positions that reacted with methanethiosulfonate ethyl ammonium, as evidenced by inhibition of ligand binding, 5 were protected against this inhibition by cocaine and dopamine (S333C, S334C, N336C, M342C and T349C), indicating that reagent accessibility is affected by conformational changes associated with inhibitor and substrate binding. In some of the cysteine mutants, transport activity is disrupted, but can be rescued by the presence of zinc, most likely because the distribution between inward- and outward-facing conformations is restored by zinc binding. The experimental data were interpreted in the context of molecular models of DAT in both the inward- and outward-facing conformations. Differences in the solvent accessible surface area for individual IL3 residues calculated for these states correlate well with the experimental accessibility data, and suggest that protection by ligand binding results from the stabilization of the outward-facing configuration. Changes in the residue interaction networks observed from the molecular dynamics simulations also revealed the critical roles of several positions during the conformational transitions. We conclude that the IL3 region of DAT undergoes significant conformational changes in transitions necessary for both cocaine binding and substrate transport. PMID:24576496

  6. [Self-conciousness and conformity: moderating effects of conformity motives and task-interest].

    PubMed

    Oshimi, T

    2000-10-01

    This study investigated the relationship between self-consciousness and conforming behavior, with conformity motives and task-interest as their moderator variables. One hundred fifty-six (156) participants were asked to imagine themselves in a hypothetical conforming situation, and estimate the probability of their conforming behavior and various conformity motives behind it, as well as their interest in the task. They also completed Self-Consciousness Scale. Among low task-interest participants, those high on private self-consciousness conformed more than the low if either motive for avoidance of isolation or motive for fairness was high, while those high on public self-consciousness conformed more than the low if motive for avoidance of isolation was high. Among high task-interest participants, those high on private self-consciousness conformed less than the low, while those high on public self-consciousness conformed more than the low if motive for fairness was high. The relationship between conformity motives and standards of behavior was discussed. PMID:11140255

  7. Modeling the solid-liquid phase transition in saturated triglycerides

    NASA Astrophysics Data System (ADS)

    Pink, David A.; Hanna, Charles B.; Sandt, Christophe; MacDonald, Adam J.; MacEachern, Ronald; Corkery, Robert; Rousseau, Dérick

    2010-02-01

    We investigated theoretically two competing published scenarios for the melting transition of the triglyceride trilaurin (TL): those of (1) Corkery et al. [Langmuir 23, 7241 (2007)], in which the average state of each TL molecule in the liquid phase is a discotic "Y" conformer whose three chains are dynamically twisted, with an average angle of ˜120° between them, and those of (2) Cebula et al. [J. Am. Oil Chem. Soc. 69, 130 (1992)], in which the liquid-state conformation of the TL molecule in the liquid phase is a nematic h?-conformer whose three chains are in a modified "chair" conformation. We developed two competing models for the two scenarios, in which TL molecules are in a nematic compact-chair (or "h") conformation, with extended, possibly all-trans, chains at low-temperatures, and in either a Y conformation or an h? conformation in the liquid state at temperatures higher than the phase-transition temperature, T?=319 K. We defined an h-Y model as a realization of the proposal of Corkery et al. [Langmuir 23, 7241 (2007)], and explored its predictions by mapping it onto an Ising model in a temperature-dependent field, performing a mean-field approximation, and calculating the transition enthalpy ?H. We found that the most plausible realization of the h-Y model, as applied to the solid-liquid phase transition in TL, and likely to all saturated triglycerides, gave a value of ?H in reasonable agreement with the experiment. We then defined an alternative h-h? model as a realization of the proposal of Cebula et al. [J. Am. Oil Chem. Soc. 69, 130 (1992)], in which the liquid phase exhibits an average symmetry breaking similar to an h conformation, but with twisted chains, to see whether it could describe the TL phase transition. The h-h? model gave a value of ?H that was too small by a factor of ˜3-4. We also predicted the temperature dependence of the 1132 cm-1 Raman band for both models, and performed measurements of the ratios of three TL Raman bands in the temperature range of -20 °C?T ?90 °C. The experimental results were in accord with the predictions of the h-Y model and support the proposal of Corkery et al. [Langmuir 23, 7241 (2007)] that the liquid state is made up of molecules that are each, on average, in a Y conformation. Finally, we carried out computer simulations of minimal-model TLs in the liquid phase, and concluded that although the individual TL molecules are, on average, Y conformers, long-range discotic order is unlikely to exist.

  8. On Conformal Conic Mappings of Spherical Domains

    PubMed Central

    Bourchtein, Ludmila

    2014-01-01

    The problem of the generation of homogeneous grids for spherical domains is considered in the class of conformal conic mappings. The equivalence between secant and tangent projections is shown and splitting the set of conformal conic mappings into equivalence classes is presented. The problem of minimization of the mapping factor variation is solved in the class of conformal conic mappings. Obtained results can be used in applied sciences, such as geophysical fluid dynamics and cartography, where the flattening of the Earth surface is required. PMID:24558337

  9. Conformational and Vibrational Studies of Triclosan

    NASA Astrophysics Data System (ADS)

    Özi?ik, Haci; Bayari, S. Haman; Sa?lam, Semran

    2010-01-01

    The conformational equilibrium of triclosan (5-chloro-2-(2, 4-dichlorophenoxy) phenol) have been calculated using density functional theory (DFTe/B3LYP/6-311++G(d, p)) method. Four different geometries were found to correspond to energy minimum conformations. The IR spectrum of triclosan was measured in the 4000-400 cm-1 region. We calculated the harmonic frequencies and intensities of the most stable conformers in order to assist in the assignment of the vibrational bands in the experimental spectrum. The fundamental vibrational modes were characterized depending on their total energy distribution (TED%) using scaled quantum mechanical (SQM) force field method.

  10. More Holography from Conformal Field Theory

    E-print Network

    Idse Heemskerk; James Sully

    2010-06-04

    We extend the work of [4] to support the conjecture that any conformal field theory with a large N expansion and a large gap in the spectrum of anomalous dimensions has a local bulk dual. We count to O(1/N^2) the solutions to the crossing constraints in conformal field theory for a completely general scalar four-point function and show that, to this order, the counting matches the number of independent interactions in a general scalar theory on Anti-de Sitter space. We introduce parity odd conformal blocks for this purpose.

  11. Conformal field theory on the plane

    E-print Network

    Sylvain Ribault

    2014-09-19

    We provide an introduction to conformal field theory on the plane in the conformal bootstrap approach. We introduce the main ideas of the bootstrap approach to quantum field theory, and how they apply to two-dimensional theories with local conformal symmetry. We describe the mathematical structures which appear in such theories, from the Virasoro algebra and its representations, to the BPZ equations and their solutions. As examples, we study a number of models: Liouville theory, (generalized) minimal models, free bosonic theories, the $H_3^+$ model, and the $SU_2$ and $\\widetilde{SL}_2(\\mathbb{R})$ WZW models.

  12. Conformation sensitive charge transport in conjugated polymers

    SciTech Connect

    Mattias Andersson, L., E-mail: matan@ifm.liu.se [Department of Physics, Chemistry and Biology (IFM), Linköping University, Linköping SE-581 83 (Sweden); Hedström, Svante; Persson, Petter [Division of Theoretical Chemistry, Lund University, P.O. Box 124, SE-221 00 Lund (Sweden)] [Division of Theoretical Chemistry, Lund University, P.O. Box 124, SE-221 00 Lund (Sweden)

    2013-11-18

    Temperature dependent charge carrier mobility measurements using field effect transistors and density functional theory calculations are combined to show how the conformation dependent frontier orbital delocalization influences the hole- and electron mobilities in a donor-acceptor based polymer. A conformationally sensitive lowest unoccupied molecular orbital results in an electron mobility that decreases with increasing temperature above room temperature, while a conformationally stable highest occupied molecular orbital is consistent with a conventional hole mobility behavior and also proposed to be one of the reasons for why the material works well as a hole transporter in amorphous bulk heterojunction solar cells.

  13. Conformity and Dissonance in Generalized Voter Models

    NASA Astrophysics Data System (ADS)

    Page, Scott E.; Sander, Leonard M.; Schneider-Mizell, Casey M.

    2007-09-01

    We generalize the voter model to include social forces that produce conformity among voters and avoidance of cognitive dissonance of opinions within a voter. The time for both conformity and consistency (which we call the exit time) is, in general, much longer than for either process alone. We show that our generalized model can be applied quite widely: it is a form of Wright's island model of population genetics, and is related to problems in the physical sciences. We give scaling arguments, numerical simulations, and analytic estimates for the exit time for a range of relative strengths in the tendency to conform and to avoid dissonance.

  14. Novel Approach to Conformal FINFET Extension Doping

    SciTech Connect

    Zschaetzsch, G.; Vandervorst, W. [imec Kapeldreef 75, B-3001 Leuven (Belgium); Hoffmann, T. Y.; Horiguchi, N. [Instituut voor Kern- en Stralingsfysica, K.U. Leuven, B-3001 Leuven (Belgium); Hautala, J.; Shao, Y. [TEL Epion Inc., 37 Manning Road, Billerica, MA, 01821 (United States)

    2011-01-07

    This paper presents a novel strategy to achieve conformal FINFET extension doping with low tilt-angle beam-line ion implantation. The process relies on the self-aligned cap layer formation exclusively on top of the FIN to tune doping levels in this particular area by partial dopant trapping. The conformality itself is evaluated for n- and p-type dopants by a novel extraction method applied to FIN resistor test structures. Furthermore, the process was integrated into a full NMOS device flow and compared to a highly tilted and more conformal As implant condition.

  15. Conformance testing of timed protocols

    E-print Network

    Arunkumar, Uma

    1992-01-01

    for concatenation of transitions in a FSM are proposed to generate a timed test sequence with consistent time labels. This thesis presents a characterization of a new set of UIO sequences, namely TUIO sequences. These sequences can be used in testing each partial... Sequences 52 XIV TTSS Concatenations Using Timed Bridge Sequences 53 XV Additional Edges in G+ 58 XVI XVII Edges in G A Minimal Timed Test Sequence (without labels) 58 XVIII XX A Minimal Timed Test Sequence (with labels) Input/Output and Time...

  16. Transition Resources

    NSDL National Science Digital Library

    Transition

    2011-11-23

    This is a site for teachers that work with students with disabilities at the secondary level. This site is broken down into categories to help you with the transition aspect of the IEP. The categories are as follows: Employment/Training, For Students - Career Exploration and Profiles, Independent Living, Learning Styles & Trainings, Level 1 Assessments, Self-Determination, and Transition Resources. All of the resources included in this site are free! TRANSITION RESOURCES: 1.) Adult Career and Continuing Education Services (ACCES-VR) This website takes you directly to the ACCES-VR website, where you can find information about vocational rehabilitation and the referral process. 2,) Guide to Quality Individualized Education Program (IEP) Development and Implementation Created by the New York State Special Education Department to help answer questions regarding the New IEP. Great resource! Gives examples!! 3.) Indicator 13 Checklist Use this ...

  17. Non-conforming hybrid meshes for efficient 2-D wave propagation using the Discontinuous Galerkin Method

    NASA Astrophysics Data System (ADS)

    Hermann, Verena; Käser, Martin; Castro, Cristóbal E.

    2011-02-01

    We present a Discontinuous Galerkin finite element method using a high-order time integration technique for seismic wave propagation modelling on non-conforming hybrid meshes in two space dimensions. The scheme can be formulated to achieve the same approximation order in space and time and avoids numerical artefacts due to non-conforming mesh transitions or the change of the element type. A point-wise Gaussian integration along partially overlapping edges of adjacent elements is used to preserve the schemes accuracy while providing a higher flexibility in the problem-adapted mesh generation process. We describe the domain decomposition strategy of the parallel implementation and validate the performance of the new scheme by numerical convergence test and experiments with comparisons to independent reference solutions. The advantage of non-conforming hybrid meshes is the possibility to choose the mesh spacing proportional to the seismic velocity structure, which allows for simple refinement or coarsening methods even for regular quadrilateral meshes. For particular problems of strong material contrasts and geometrically thin structures, the scheme reduces the computational cost in the sense of memory and run-time requirements. The presented results promise to achieve a similar behaviour for an extension to three space dimensions where the coupling of tetrahedral and hexahedral elements necessitates non-conforming mesh transitions to avoid linking elements in form of pyramids.

  18. On the effects of conformal degrees of freedom inside a neutron star

    E-print Network

    F. Canfora; A. Giacomini; S. Willison

    2007-12-14

    In this paper a neutron star with an inner core which undergoes a phase transition, which is characterized by conformal degrees of freedom on the phase boundary, is considered. Typical cases of such a phase transition are e.g. quantum Hall effect, superconductivity and superfluidity. Assuming the mechanical stability of this system the effects induced by the conformal degrees of freedom on the phase boundary will be analyzed. We will see that the inclusion of conformal degrees of freedom is not always consistent with the staticity of the phase boundary. Indeed also in the case of mechanical equilibrium there may be the tendency of one phase to swallow the other. Such a shift of the phase boundary would not imply any compression or decompression of the core. By solving the Israel junction conditions for the conformal matter, we have found the range of physical parameters which can guarantee a stable equilibrium of the phase boundary of the neutron star. The relevant parameters turn out to be not only the density difference but also the difference of the slope of the density profiles of the two phases. The values of the parameters which guarantee the stability turn out to be in a phenomenologically reasonable range. For the parameter values where the the phase boundary tends to move, a possible astrophysical consequence related to sudden small changes of the moment of inertia of the star is briefly discussed.

  19. Metric transition

    NASA Astrophysics Data System (ADS)

    1992-06-01

    This report describes NASA's metric transition in terms of seven major program elements. Six are technical areas involving research, technology development, and operations; they are managed by specific Program Offices at NASA Headquarters. The final program element, Institutional Management, covers both NASA-wide functional management under control of NASA Headquarters and metric capability development at the individual NASA Field Installations. This area addresses issues common to all NASA program elements, including: Federal, state, and local coordination; standards; private industry initiatives; public-awareness initiatives; and employee training. The concluding section identifies current barriers and impediments to metric transition; NASA has no specific recommendations for consideration by the Congress.

  20. Venus Transit

    NSDL National Science Digital Library

    This is an activity about the Venus Transit and how it helped astronomers determine the scale of the solar system. Learners will use measurement, ratios, and graphing to construct a model of the solar system and determine the relationship of each planet to the Sun. They will explore the scales needed to represent the size of the planets and the distances to the Sun. This activity corresponds to the NASA CONNECT video, titled Venus Transit, and has supplemental questions to support the video viewing.