Science.gov

Sample records for starch phosphorylase mutational

  1. A novel thymidine phosphorylase mutation in a Spanish MNGIE patient.

    PubMed

    Gamez, Josep; Lara, Maria Carmen; Mearin, Fermin; Oliveras-Ley, Carlos; Raguer, Nuria; Olive, Montse; Leist, Andres T; Perello, Antonia; Perona, Monica; Cervera, Carlos; Andreu, Antonio Luis; Martí, Ramon; Hirano, Michio

    2005-01-15

    A 29-year-old Spanish man presented with chronic intestinal pseudo-obstruction, progressive external ophthalmoplegia, peripheral neuropathy, and diffuse leukoencephalopathy. This combination of clinical features is characteristic of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Genetic analysis revealed a novel 18-base pair (bp) duplication (5044-5061 dup) in exon 8 of the thymidine phosphorylase (TP) gene. The mutation is predicted to produce a 6 amino acid insertion in the alpha-beta-domain of the protein. This 18-bp insertion in the thymidine phosphorylase gene is the first duplication mutation identified in MNGIE. PMID:15607208

  2. Synthesis of cellobiose from starch by the successive actions of two phosphorylases.

    PubMed

    Suzuki, Masayuki; Kaneda, Kyoko; Nakai, Yukiko; Kitaoka, Motomitsu; Taniguchi, Hajime

    2009-10-31

    Cellobiose was enzymatically synthesized from starch using two phosphorylases. Under the presence of 1 M Pi inorganic phosphate), glucan phosphorylase converted 40% of glucose residues in the starch molecule into G1P (glucose-1-phosphate). By electrodialysis fitted with an ion exchange membrane having molecular weight cutoff of 100, Pi was effectively dialyzed out and G1P was recovered with 80% yield. G1P and glucose were incubated with cellobiose phosphorylase in the presence of magnesium acetate at an alkaline condition. Inorganic phosphate coformed with cellobiose was immediately removed as insoluble magnesium ammonium phosphate and 85% of added G1P was converted into cellobiose. On the whole, cellobiose was produced with 60% yield from G1P and, at least, 23.7% yield from starch. PMID:19631300

  3. High phosphorylase activity is correlated with increased potato minituber formation and starch content during extended clinorotation

    NASA Astrophysics Data System (ADS)

    Nedukha, O. M.; Schnyukova, E. I.; Leach, J. E.

    2003-05-01

    The major purpose of these experiments were to investigate growth of potato storage organs and starch synthesis in minitubers at slow horizontal clinorotation (2 rpm), which partly mimics microgravity, and a secondary goal was to study the activity and localization of phosphorylase (EC 2.4.1.1) in storage parenchyma under these conditions. Miniplants of Solanum tuberosum L. (cv Adreta) were grown in culture for 30 days for both the vertical control and the horizontal clinorotation. During long-term clinorotation, an acceleration of minituber formation, and an increase of amyloplast number and size in storage parenchyma cells, as well as increased starch content, was observed in the minitubers. The differences among cytochemical reaction intensity, activity of phosphorylase, and carbohydrate content in storage parenchyma cells of minitubers grown in a horizontal clinostat were established by electron-cytochemical and biochemical methods. It is shown that high phosphorylase activity is correlated with increased starch content during extended clinorotation. The results demonstrate the increase in carbohydrate metabolism and possible accelerated growth of storage organs under the influence of microgravity, as mimicked by clinorotation; therefore, clinorotation can be used as a basis for future studies on mechanisms of starch synthesis under microgravity.

  4. Thymidine phosphorylase mutations cause instability of mitochondrial DNA.

    PubMed

    Hirano, Michio; Lagier-Tourenne, Clotilde; Valentino, Maria L; Martí, Ramon; Nishigaki, Yutaka

    2005-07-18

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by ptosis and progressive external ophthalmoplegia, peripheral neuropathy, severe gastrointestinal dysmotility, cachexia and leukoencephalopathy. Muscle biopsies of MNGIE patients have revealed morphologically abnormal mitochondria and defects of respiratory chain enzymes. In addition, patients harbor depletion, multiple deletions, and point mutations of mitochondrial DNA (mtDNA). This disorder is caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP) a cytosolic enzyme. In MNGIE patients, TP activity is very low or absent resulting in dramatically elevated levels of plasma thymidine and deoxyuridine. We have hypothesized that the increased levels of thymidine and deoxyuridine cause mitochondrial nucleotide pool imbalances that, in turn, generate mtDNA alterations. PMID:15975738

  5. Overexpression of the Starch Phosphorylase-Like Gene (PHO3) in Lotus japonicus has a Profound Effect on the Growth of Plants and Reduction of Transitory Starch Accumulation

    PubMed Central

    Qin, Shanshan; Tang, Yuehui; Chen, Yaping; Wu, Pingzhi; Li, Meiru; Wu, Guojiang; Jiang, Huawu

    2016-01-01

    Two isoforms of starch phosphorylase (PHO; EC 2.4.1.1), plastidic PHO1 and cytosolic PHO2, have been found in all plants studied to date. Another starch phosphorylase-like gene, PHO3, which is an ortholog of Chlamydomonas PHOB, has been detected in some plant lineages. In this study, we identified three PHO isoform (LjPHO) genes in the Lotus japonicus genome. Expression of the LjPHO3 gene was observed in all tissues tested in L. japonicus, and the LjPHO3 protein was located in the chloroplast. Overexpression of LjPHO3 in L. japonicus resulted in a drastic decline in starch granule sizes and starch content in leaves. The LjPHO3 overexpression transgenic seedlings were smaller, and showed decreased pollen fertility and seed set rate. Our results suggest that LjPHO3 may participate in transitory starch metabolism in L. japonicus leaves, but its catalytic properties remain to be studied.

  6. Polynucleotide phosphorylase plays an important role in the generation of spontaneous mutations in Escherichia coli.

    PubMed

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander; Miller, Jeffrey H

    2012-10-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rif(r) and the gyrB gene leading to Nal(r) and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  7. Polynucleotide Phosphorylase Plays an Important Role in the Generation of Spontaneous Mutations in Escherichia coli

    PubMed Central

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander

    2012-01-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rifr and the gyrB gene leading to Nalr and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  8. Mitochondrial neurogastrointestinal encephalomyopathy: novel pathogenic mutations in thymidine phosphorylase gene in two Italian brothers.

    PubMed

    Libernini, Laura; Lupis, Chiara; Mastrangelo, Mario; Carrozzo, Rosalba; Santorelli, Filippo Maria; Inghilleri, Maurizio; Leuzzi, Vincenzo

    2012-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE, MIM 603041) is an autosomal recessive multisystem disorder occurring due to mutations in a nuclear gene coding for the enzyme thymidine phosphorylase (TYMP). Clinical features of MNGIE include gastrointestinal dysmotility, cachexia, ptosis or ophthalmoparesis, peripheral neuropathy, diffuse leukoencephalopathy, and signs of mitochondrial dysfunction in tissues. We report the clinical and molecular findings in two brothers in whom novel TYMP gene mutations (c.215-13_215delinsGCGTGA; c.1159 + 2T > A) were associated with different clinical presentations and outcomes. PMID:22618301

  9. Identification of the Maize Amyloplast Stromal 112-kD Protein as a Plastidic Starch Phosphorylase12

    PubMed Central

    Yu, Ying; Mu, Helen He; Wasserman, Bruce P.; Carman, George M.

    2001-01-01

    Amyloplast is the site of starch synthesis in the storage tissue of maize (Zea mays). The amyloplast stroma contains an enriched group of proteins when compared with the whole endosperm. Proteins with molecular masses of 76 and 85 kD have been identified as starch synthase I and starch branching enzyme IIb, respectively. A 112-kD protein was isolated from the stromal fraction by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to tryptic digestion and amino acid sequence analysis. Three peptide sequences showed high identity to plastidic forms of starch phosphorylase (SP) from sweet potato, potato, and spinach. SP activity was identified in the amyloplast stromal fraction and was enriched 4-fold when compared with the activity in the whole endosperm fraction. Native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis analyses showed that SP activity was associated with the amyloplast stromal 112-kD protein. In addition, antibodies raised against the potato plastidic SP recognized the amyloplast stromal 112-kD protein. The amyloplast stromal 112-kD SP was expressed in whole endosperm isolated from maize harvested 9 to 24 d after pollination. Results of affinity electrophoresis and enzyme kinetic analyses showed that the amyloplast stromal 112-kD SP preferred amylopectin over glycogen as a substrate in the synthetic reaction. The maize shrunken-4 mutant had reduced SP activity due to a decrease of the amyloplast stromal 112-kD enzyme. PMID:11154342

  10. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency

    PubMed Central

    Nishigaki, Yutaka; Martí, Ramon; Copeland, William C.; Hirano, Michio

    2003-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP). This deficiency of TP leads to increased circulating levels of thymidine (deoxythymidine, dThd) and deoxyuridine (dUrd) and has been associated with multiple deletions and depletion of mitochondrial DNA (mtDNA). Here we describe 36 point mutations in mtDNA of tissues and cultured cells from MNGIE patients. Thirty-one mtDNA point mutations (86%) were T-to-C transitions, and of these, 25 were preceded by 5′-AA sequences. In addition, we identified a single base-pair mtDNA deletion and a TT-to-AA mutation. Next-nucleotide effects and dislocation mutagenesis may contribute to the formation of these mutations. These results provide the first demonstration that alterations of nucleoside metabolism can induce multiple sequence-specific point mutations in humans. We hypothesize that, in patients with TP deficiency, increased levels of dThd and dUrd cause mitochondrial nucleotide pool imbalances, which, in turn, lead to mtDNA abnormalities including site-specific point mutations. PMID:12813027

  11. Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency.

    PubMed

    Nishigaki, Yutaka; Martí, Ramon; Copeland, William C; Hirano, Michio

    2003-06-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by loss-of-function mutations in the gene encoding thymidine phosphorylase (TP). This deficiency of TP leads to increased circulating levels of thymidine (deoxythymidine, dThd) and deoxyuridine (dUrd) and has been associated with multiple deletions and depletion of mitochondrial DNA (mtDNA). Here we describe 36 point mutations in mtDNA of tissues and cultured cells from MNGIE patients. Thirty-one mtDNA point mutations (86%) were T-to-C transitions, and of these, 25 were preceded by 5'-AA sequences. In addition, we identified a single base-pair mtDNA deletion and a TT-to-AA mutation. Next-nucleotide effects and dislocation mutagenesis may contribute to the formation of these mutations. These results provide the first demonstration that alterations of nucleoside metabolism can induce multiple sequence-specific point mutations in humans. We hypothesize that, in patients with TP deficiency, increased levels of dThd and dUrd cause mitochondrial nucleotide pool imbalances, which, in turn, lead to mtDNA abnormalities including site-specific point mutations. PMID:12813027

  12. A mutation in the pnp gene encoding polynucleotide phosphorylase attenuates virulence of Salmonella enterica serovar typhimurium in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for ...

  13. Reduction of the plastidial phosphorylase in potato (Solanum tuberosum L.) reveals impact on storage starch structure during growth at low temperature.

    PubMed

    Orawetz, Tom; Malinova, Irina; Orzechowski, Slawomir; Fettke, Joerg

    2016-03-01

    Tubers of potato (Solanum tuberosum L.), one of the most important crops, are a prominent example for an efficient production of storage starch. Nevertheless, the synthesis of this storage starch is not completely understood. The plastidial phosphorylase (Pho1; EC 2.4.1.1) catalyzes the reversible transfer of glucosyl residues from glucose-1-phosphate to the non-reducing end of α-glucans with the release of orthophosphate. Thus, the enzyme is in principle able to act during starch synthesis. However, so far under normal growth conditions no alterations in tuber starch metabolism were observed. Based on analyses of other species and also from in vitro experiments with potato tuber slices it was supposed, that Pho1 has a stronger impact on starch metabolism, when plants grow under low temperature conditions. Therefore, we analyzed the starch content, granule size, as well as the internal structure of starch granules isolated from potato plants grown under low temperatures. Besides wild type, transgenic potato plants with a strong reduction in the Pho1 activity were analyzed. No significant alterations in starch content and granule size were detected. In contrast, when plants were cultivated at low temperatures the chain length distributions of the starch granules were altered. Thus, the granules contained more short glucan chains. That was not observed in the transgenic plants, revealing that Pho1 in wild type is involved in the formation of the short glucan chains, at least at low temperatures. PMID:26828405

  14. Thymidine phosphorylase gene mutations in patients with mitochondrial neurogastrointestinal encephalomyopathy syndrome.

    PubMed

    Slama, A; Lacroix, C; Plante-Bordeneuve, V; Lombès, A; Conti, M; Reimund, J M; Auxenfants, E; Crenn, P; Laforêt, P; Joannard, A; Seguy, D; Pillant, H; Joly, P; Haut, S; Messing, B; Said, G; Legrand, A; Guiochon-Mantel, A

    2005-04-01

    The mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) syndrome is characterized by the association of gastrointestinal and neurological symptoms. It is a rare autosomal recessive mitochondrial disorder with multiple mitochondrial DNA deletions and/or depletion. It is caused by thymidine phosphorylase (TP) gene mutations resulting in a complete abolition of TP activity. We tested 31 unrelated patients presenting either with a complete MNGIE syndrome (8 patients), a severe intestinal pseudo-obstruction (10 patients), and multiple deletions and/or depletion of mitochondrial DNA (13 patients). All the tested patients presenting with a complete MNGIE had increased thymidine levels in plasma and urine, and no TP activity. The group with pseudo-obstruction syndrome had normal or partial reduction of TP activity. We found pathogenic mutations on TP gene only in the MNGIE syndrome group: all the MNGIE patients were compound heterozygous or homozygous for mutations in the TP gene. Eight of these mutations are yet unreported, confirming the lack of genotype/phenotype correlation in this syndrome. Enzymatic activity and thymidine level are thus rapid diagnosis tests to detect MNGIE affected patients prior to genetic testing for patients with gastrointestinal symptoms. PMID:15781193

  15. Induced mutations in the starch branching enzyme II (SBEII) genes increase amylose and resistant starch content in durum wheat

    PubMed Central

    Hazard, Brittany; Zhang, Xiaoqin; Colasuonno, Pasqualina; Uauy, Cristobal; Beckles, Diane M.; Dubcovsky, Jorge

    2016-01-01

    Starch is the largest component of the wheat (Triticum aestivum L.) grain and consists of approximately 70-80% amylopectin and 20-30% amylose. Amylopectin is a highly-branched, readily digested polysaccharide, whereas amylose has few branches and forms complexes that resist digestion and mimic dietary fiber (resistant starch). Down-regulation of the starch branching enzyme II (SBEII) gene by RNA interference (RNAi) was previously shown to increase amylose content in both hexaploid and tetraploid wheat. We generated ethyl methane sulphonate (EMS) mutants for the SBEIIa-A and SBEIIa-B homoeologs in the tetraploid durum wheat variety Kronos (T. turgidum ssp. durum L.). Single-gene mutants showed non-significant increases in amylose and resistant starch content, but a double mutant combining a SBEIIa-A knock-out mutation with a SBEIIa-B splice-site mutation showed a 22% increase in amylose content (P<0.0001) and a 115% increase in resistant starch content (P<0.0001). In addition, we obtained mutants for the A and B genome copies of the paralogous SBEIIb gene, mapped them 1-2 cM from SBEIIa, and generated double SBEIIa-SBEIIb mutants to study the effect of the SBEIIb gene in the absence of SBEIIa. These mutants are available to those interested in increasing amylose content and resistant starch in durum wheat. PMID:26924849

  16. Use of advanced recombinant lines to study the impact and potential of mutations affecting starch synthesis in barley☆

    PubMed Central

    Howard, Thomas P.; Fahy, Brendan; Leigh, Fiona; Howell, Phil; Powell, Wayne; Greenland, Andy; Trafford, Kay; Smith, Alison M.

    2014-01-01

    The effects on barley starch and grain properties of four starch synthesis mutations were studied during the introgression of the mutations from diverse backgrounds into an elite variety. The lys5f (ADPglucose transporter), wax (granule-bound starch synthase), isa1 (debranching enzyme isoamylase 1) and sex6 (starch synthase IIa) mutations were introgressed into NFC Tipple to give mutant and wild-type BC2F4 families with different genomic contributions of the donor parent. Comparison of starch and grain properties between the donor parents, the BC2F4 families and NFC Tipple allowed the effects of the mutations to be distinguished from genetic background effects. The wax and sex6 mutations had marked effects on starch properties regardless of genetic background. The sex6 mutation conditioned low grain weight and starch content, but the wax mutation did not. The lys5 mutation conditioned low grain weight and starch content, but exceptionally high β-glucan contents. The isa1 mutation promotes synthesis of soluble α-glucan (phytoglycogen). Its introgression into NFC Tipple increased grain weight and total α-glucan content relative to the donor parent, but reduced the ratio of phytoglycogen to starch. This study shows that introgression of mutations into a common, commercial background provides new insights that could not be gained from the donor parent. PMID:24748716

  17. Effects of ethylene and 1-methylcyclopropene (1-MCP) on gene expression and activity profile of alpha-1,4-glucan-phosphorylase during banana ripening.

    PubMed

    Mainardi, Janaina Aparecida; Purgatto, Eduardo; Vieira, Adair; Bastos, Walter Arato; Cordenunsi, Beatriz Rosana; Oliveira do Nascimento, João Roberto; Lajolo, Franco Maria

    2006-09-20

    Starch phosphorylases are enzymes that can use starch as substrate, and they are supposed to act in both in starch synthesis and degradation. This paper reports the effects of ethylene and 1-methylcyclopropene (1-MCP) on the degradation of starch and phosphorylase activity and gene expression. The results indicate that phosphorylase activity is induced during ripening and that it is associated with the onset of starch degradation. The regulation of banana phosphorylase activity is mainly dependent on gene expression, and the absence of ethylene perception by 1-MCP had a positive effect. However, this effect can be precluded by increased levels of ethylene, both autocatalytic and exogenous. PMID:16968096

  18. Mutations in the gene encoding starch synthase II profoundly alter amylopectin structure in pea embryos.

    PubMed Central

    Craig, J; Lloyd, J R; Tomlinson, K; Barber, L; Edwards, A; Wang, T L; Martin, C; Hedley, C L; Smith, A M

    1998-01-01

    Mutations at the rug5 (rugosus5) locus have been used to elucidate the role of the major soluble isoform of starch synthase II (SSII) in amylopectin synthesis in the developing pea embryo. The SSII gene maps to the rug5 locus, and the gene in one of three rug5 mutant lines has been shown to carry a base pair substitution that introduces a stop codon into the open reading frame. All three mutant alleles cause a dramatic reduction or loss of the SSII protein. The mutations have pleiotropic effects on the activities of other isoforms of starch synthase but apparently not on those of other enzymes of starch synthesis. These mutations result in abnormal starch granule morphology and amylopectin structure. Amylopectin contains fewer chains of intermediate length (B2 and B3 chains) and more very short and very long chains than does amylopectin from wild-type embryos. The results suggest that SSII may play a specific role in the synthesis of B2 and B3 chains of amylopectin. The extent to which these findings can be extrapolated to other species is discussed. PMID:9501114

  19. Two Additional Phosphorylases in Developing Maize Seeds 12

    PubMed Central

    Tsai, C. Y.; Nelson, O. E.

    1969-01-01

    Two additional phosphorylases (III and IV) have been detected in developing seeds of maize. Phosphorylase IV is found only in the embryo (with scutellum). It is also present in the embryo of the germinating seed where its activity is 90-fold greater than the activity in the developing embryo 22 days after pollination. Phosphorylase IV is eluted from a DEAE-cellulose column in the same fraction as phosphorylase I of the endosperm, and the 2 enzymes are similar in many respects. Phosphorylase IV is distinguished from phosphorylase I by electrophoretic mobility, by pH optimum, and because its properties are not affected by the shrunken-4 mutation. Phosphorylase III is found both in the endosperms and embryos of developing seeds. Activity for this enzyme is not detected in crude homogenates nor eluates from a DEAE-cellulose column apparently because it complexes with a non-dialyzable, heat-labile inhibitor. High activity is found after protamine sulfate fractionation. Phosphorylase III is bound to protamine sulfate and is then removed by washing with 0.3 m phosphate buffer. Phosphorylase III activity in the endosperm is not detectable 8 days after pollination but is present 12 days after pollination. Phosphorylase III differs from phosphorylases I, II, and IV in several respects—pH optimum, pH-independent ATP inhibition, time of appearance in the endosperm, and because purine and pyrimidine nucleotides are equally inhibitory. In common with phosphorylase II, phosphorylase III apparently does not require a primer to initiate the synthesis of an amylose-like polymer. PMID:5774172

  20. SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)

    PubMed Central

    Schreiber, Lena; Nader-Nieto, Anna Camila; Schönhals, Elske Maria; Walkemeier, Birgit; Gebhardt, Christiane

    2014-01-01

    Starch accumulation and breakdown are vital processes in plant storage organs such as seeds, roots, and tubers. In tubers of potato (Solanum tuberosum L.) a small fraction of starch is converted into the reducing sugars glucose and fructose. Reducing sugars accumulate in response to cold temperatures. Even small quantities of reducing sugars affect negatively the quality of processed products such as chips and French fries. Tuber starch and sugar content are inversely correlated complex traits that are controlled by multiple genetic and environmental factors. Based on in silico annotation of the potato genome sequence, 123 loci are involved in starch-sugar interconversion, approximately half of which have been previously cloned and characterized. By means of candidate gene association mapping, we identified single-nucleotide polymorphisms (SNPs) in eight genes known to have key functions in starch-sugar interconversion, which were diagnostic for increased tuber starch and/or decreased sugar content and vice versa. Most positive or negative effects of SNPs on tuber-reducing sugar content were reproducible in two different collections of potato cultivars. The diagnostic SNP markers are useful for breeding applications. An allele of the plastidic starch phosphorylase PHO1a associated with increased tuber starch content was cloned as full-length cDNA and characterized. The PHO1a-HA allele has several amino acid changes, one of which is unique among all known starch/glycogen phosphorylases. This mutation might cause reduced enzyme activity due to impaired formation of the active dimers, thereby limiting starch breakdown. PMID:25081979

  1. SNPs in genes functional in starch-sugar interconversion associate with natural variation of tuber starch and sugar content of potato (Solanum tuberosum L.).

    PubMed

    Schreiber, Lena; Nader-Nieto, Anna Camila; Schönhals, Elske Maria; Walkemeier, Birgit; Gebhardt, Christiane

    2014-10-01

    Starch accumulation and breakdown are vital processes in plant storage organs such as seeds, roots, and tubers. In tubers of potato (Solanum tuberosum L.) a small fraction of starch is converted into the reducing sugars glucose and fructose. Reducing sugars accumulate in response to cold temperatures. Even small quantities of reducing sugars affect negatively the quality of processed products such as chips and French fries. Tuber starch and sugar content are inversely correlated complex traits that are controlled by multiple genetic and environmental factors. Based on in silico annotation of the potato genome sequence, 123 loci are involved in starch-sugar interconversion, approximately half of which have been previously cloned and characterized. By means of candidate gene association mapping, we identified single-nucleotide polymorphisms (SNPs) in eight genes known to have key functions in starch-sugar interconversion, which were diagnostic for increased tuber starch and/or decreased sugar content and vice versa. Most positive or negative effects of SNPs on tuber-reducing sugar content were reproducible in two different collections of potato cultivars. The diagnostic SNP markers are useful for breeding applications. An allele of the plastidic starch phosphorylase PHO1a associated with increased tuber starch content was cloned as full-length cDNA and characterized. The PHO1a-HA allele has several amino acid changes, one of which is unique among all known starch/glycogen phosphorylases. This mutation might cause reduced enzyme activity due to impaired formation of the active dimers, thereby limiting starch breakdown. PMID:25081979

  2. In situ mapping of the effect of additional mutations on starch granule structure in amylose-extender (ae) maize kernels.

    PubMed

    Liu, Dongli; Wellner, Nikolaus; Parker, Mary L; Morris, Victor J; Cheng, Fang

    2015-03-15

    Optical (KI/I2-staining, polarised) and FTIR microscopy has been used to monitor starch granule structure within wild-type (wt), GEMS-0067 and waxy-amylose-extender (wx-ae) maize mutant kernels. In the GEMS-0067 mutant containing the high amylose modifier (HAM) gene(s) plus the recessive ae gene, structural heterogeneity characteristic of the ae mutation was reduced markedly. However, enhanced variation in granule shape and size was observed distributed spatially within the kernel, which appears to be related to new heterogeneity in internal starch granule structure. In wx-ae starch mutants the ae gene led to heterogeneity of starch granule structure equivalent to that in single ae mutants, plus new structural heterogeneity coincident with novel induced variation in granule size and shape. PMID:25542125

  3. Mutation of the maize sbe1a and ae genes alters morphology and physical behavior of wx-type endosperm starch granules.

    PubMed

    Li, Ji-Hong; Guiltinan, Mark J; Thompson, Donald B

    2007-12-10

    In maize, three isoforms of starch-branching enzyme, SBEI, SBEIIa, and SBEIIb, are encoded by the Sbe1a, Sbe2a, and Amylose extender (Ae) genes, respectively. The objective of this research was to explore the effects of null mutations in the Sbe1a and Ae genes alone and in combination in wx background on kernel characteristics and on the morphology and physical behavior of endosperm starch granules. Differences in kernel morphology and weight, starch accumulation, starch granule size and size distribution, starch microstructure, and thermal properties were observed between the ae wx and sbe1a ae wx plants but not between the sbe1a wx mutants when compared to wx. Starch from sbe1a ae wx plants exhibited a larger granule size with a wider gelatinization temperature range and a lower endotherm enthalpy than ae wx. Microscopy shows weaker iodine staining in sbe1a ae wx starch granules. X-ray diffraction revealed A-type crystallinity in wx and sbe1a wx starches and B-type in sbe1a ae wx and ae wx. This study suggests that, while the SBEIIb isoform plays a dominant role in maize endosperm starch synthesis, SBEI also plays a role, which is only observable in the presence of the ae mutation. PMID:17765880

  4. Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

    PubMed

    Blazquez, A; Martín, M A; Lara, M C; Martí, R; Campos, Y; Cabello, A; Garesse, R; Bautista, J; Andreu, A L; Arenas, J

    2005-11-01

    We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP). PMID:16198108

  5. A single residue mutation abolishes attachment of the CBM26 starch-binding domain from Lactobacillus amylovorus alpha-amylase.

    PubMed

    Rodríguez-Sanoja, Romina; Oviedo, N; Escalante, L; Ruiz, B; Sánchez, S

    2009-03-01

    Starch is degraded by amylases that frequently have a modular structure composed of a catalytic domain and at least one non-catalytic domain that is involved in polysaccharide binding. The C-terminal domain from the Lactobacillus amylovorus alpha-amylase has an unusual architecture composed of five tandem starch-binding domains (SBDs). These domains belong to family 26 in the carbohydrate-binding modules (CBM) classification. It has been reported that members of this family have only one site for starch binding, where aromatic amino acids perform the binding function. In SBDs, fold similarities are better conserved than sequences; nevertheless, it is possible to identify in CBM26 members at least two aromatic residues highly conserved. We attempt to explain polysaccharide recognition for the L. amylovorus alpha-amylase SBD through site-directed mutagenesis of aromatic amino acids. Three amino acids were identified as essential for binding, two tyrosines and one tryptophan. Y18L and Y20L mutations were found to decrease the SBD binding capacity, but unexpectedly, the mutation at W32L led to a total loss of affinity, either with linear or ramified substrates. The critical role of Trp 32 in substrate binding confirms the presence of just one binding site in each alpha-amylase SBD. PMID:19052787

  6. A putative gene sbe3-rs for resistant starch mutated from SBE3 for starch branching enzyme in rice (Oryza sativa L.).

    PubMed

    Yang, Ruifang; Sun, Chunlong; Bai, Jianjiang; Luo, Zhixiang; Shi, Biao; Zhang, Jianming; Yan, Wengui; Piao, Zhongze

    2012-01-01

    Foods high in resistant starch (RS) are beneficial to prevent various diseases including diabetes, colon cancers, diarrhea and chronic renal or hepatic diseases. Elevated RS in rice is important for public health since rice is a staple food for half of the world population. A japonica mutant 'Jiangtangdao 1' (RS = 11.67%) was crossed with an indica cultivar 'Miyang 23' (RS = 0.41%). The mutant sbe3-rs that explained 60.4% of RS variation was mapped between RM6611 and RM13366 on chromosome 2 (LOD = 36) using 178 F(2) plants genotyped with 106 genome-wide polymorphic SSR markers. Using 656 plants from four F(3:4) families, sbe3-rs was fine mapped to a 573.3 Kb region between InDel 2 and InDel 6 using one STS, five SSRs and seven InDel markers. SBE3 which codes for starch branching enzyme was identified as a candidate gene within the putative region. Nine pairs of primers covering 22 exons were designed to sequence genomic DNA of the wild type for SBE3 and the mutant for sbe3-rs comparatively. Sequence analysis identified a missense mutation site where Leu-599 of the wild was changed to Pro-599 of the mutant in the SBE3 coding region. Because the point mutation resulted in the loss of a restriction enzyme site, sbe3-rs was not digested by a CAPS marker for SpeI site while SBE3 was. Co-segregation of the digestion pattern with RS content among 178 F(2) plants further supported sbe3-rs responsible for RS in rice. As a result, the CAPS marker could be used in marker-assisted breeding to develop rice cultivars with elevated RS which is otherwise difficult to accurately assess in crops. Transgenic technology should be employed for a definitive conclusion of the sbe3-rs. PMID:22937009

  7. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment

    PubMed Central

    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng

    2016-01-01

    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using starch as the sole carbon source. The enzyme production reached maximum at temperature of 30°C, pH 7, with 40 g/L starch in the medium inoculated with 1.4% v/v spore. When 0.3% w/v urea was added to the liquid medium as a nitrogen source, the amylase activity was elevated by 20%. Nine monosaccharides and derivatives were tested for α-amylase induction, glucose was the best inducer. Furthermore, the enzymology characterization of amylase was conducted. The molecular weight of amylase was determined to be 50 kD by SDS-PAGE. The amylase had maximum activity at 45°C and pH 7. The activity could be dramatically triggered by adding 1 mM Co2+, increased to 250%. The activity was inhibited by detergents SDS and Triton X-100. Six different brands of starch were tested for amylase activity, the results demonstrated that the more soluble of the starch, the higher hydrolyzability of the substrate by amylase. PMID:27335681

  8. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment.

    PubMed

    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng

    2016-01-01

    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using starch as the sole carbon source. The enzyme production reached maximum at temperature of 30°C, pH 7, with 40 g/L starch in the medium inoculated with 1.4% v/v spore. When 0.3% w/v urea was added to the liquid medium as a nitrogen source, the amylase activity was elevated by 20%. Nine monosaccharides and derivatives were tested for α-amylase induction, glucose was the best inducer. Furthermore, the enzymology characterization of amylase was conducted. The molecular weight of amylase was determined to be 50 kD by SDS-PAGE. The amylase had maximum activity at 45°C and pH 7. The activity could be dramatically triggered by adding 1 mM Co(2+), increased to 250%. The activity was inhibited by detergents SDS and Triton X-100. Six different brands of starch were tested for amylase activity, the results demonstrated that the more soluble of the starch, the higher hydrolyzability of the substrate by amylase. PMID:27335681

  9. The Crystal Structure of Streptococcus pyogenes Uridine Phosphorylase Reveals a Distinct Subfamily of Nucleoside Phosphorylases

    SciTech Connect

    Tran, Timothy H.; Christoffersen, S.; Allan, Paula W.; Parker, William B.; Piskur, Jure; Serra, I.; Terreni, M.; Ealick, Steven E.

    2011-09-20

    Uridine phosphorylase (UP), a key enzyme in the pyrimidine salvage pathway, catalyzes the reversible phosphorolysis of uridine or 2'-deoxyuridine to uracil and ribose 1-phosphate or 2'-deoxyribose 1-phosphate. This enzyme belongs to the nucleoside phosphorylase I superfamily whose members show diverse specificity for nucleoside substrates. Phylogenetic analysis shows Streptococcus pyogenes uridine phosphorylase (SpUP) is found in a distinct branch of the pyrimidine subfamily of nucleoside phosphorylases. To further characterize SpUP, we determined the crystal structure in complex with the products, ribose 1-phosphate and uracil, at 1.8 {angstrom} resolution. Like Escherichia coli UP (EcUP), the biological unit of SpUP is a hexamer with an ?/? monomeric fold. A novel feature of the active site is the presence of His169, which structurally aligns with Arg168 of the EcUP structure. A second active site residue, Lys162, is not present in previously determined UP structures and interacts with O2 of uracil. Biochemical studies of wild-type SpUP showed that its substrate specificity is similar to that of EcUP, while EcUP is {approx}7-fold more efficient than SpUP. Biochemical studies of SpUP mutants showed that mutations of His169 reduced activity, while mutation of Lys162 abolished all activity, suggesting that the negative charge in the transition state resides mostly on uracil O2. This is in contrast to EcUP for which transition state stabilization occurs mostly at O4.

  10. Allelic variants of the amylose extender mutation of maize demonstrate phenotypic variation in starch structure resulting from modified protein–protein interactions

    PubMed Central

    Liu, Fushan; Ahmed, Zaheer; Lee, Elizabeth A.; Donner, Elizabeth; Liu, Qiang; Ahmed, Regina; Morell, Matthew K.; Emes, Michael J.; Tetlow, Ian J.

    2012-01-01

    amylose extender (ae−) starches characteristically have modified starch granule morphology resulting from amylopectin with reduced branch frequency and longer glucan chains in clusters, caused by the loss of activity of the major starch branching enzyme (SBE), which in maize endosperm is SBEIIb. A recent study with ae− maize lacking the SBEIIb protein (termed ae1.1 herein) showed that novel protein–protein interactions between enzymes of starch biosynthesis in the amyloplast could explain the starch phenotype of the ae1.1 mutant. The present study examined an allelic variant of the ae− mutation, ae1.2, which expresses a catalytically inactive form of SBEIIb. The catalytically inactive SBEIIb in ae1.2 lacks a 28 amino acid peptide (Val272–Pro299) and is unable to bind to amylopectin. Analysis of starch from ae1.2 revealed altered granule morphology and physicochemical characteristics distinct from those of the ae1.1 mutant as well as the wild-type, including altered apparent amylose content and gelatinization properties. Starch from ae1.2 had fewer intermediate length glucan chains (degree of polymerization 16–20) than ae1.1. Biochemical analysis of ae1.2 showed that there were differences in the organization and assembly of protein complexes of starch biosynthetic enzymes in comparison with ae1.1 (and wild-type) amyloplasts, which were also reflected in the composition of starch granule-bound proteins. The formation of stromal protein complexes in the wild-type and ae1.2 was strongly enhanced by ATP, and broken by phosphatase treatment, indicating a role for protein phosphorylation in their assembly. Labelling experiments with [γ-32P]ATP showed that the inactive form of SBEIIb in ae1.2 was phosphorylated, both in the monomeric form and in association with starch synthase isoforms. Although the inactive SBEIIb was unable to bind starch directly, it was strongly associated with the starch granule, reinforcing the conclusion that its presence in the

  11. Evaluation of novel starch-deficient mutants of Chlorella sorokiniana for hyper-accumulation of lipids

    PubMed Central

    Vonlanthen, Sofie; Dauvillée, David; Purton, Saul

    2015-01-01

    When green algae are exposed to physiological stresses such as nutrient deprivation, growth is arrested and the cells channel fixed carbon instead into storage compounds, accumulating first starch granules and then lipid bodies containing triacylglycerides. In recent years there has been significant interest in the commercial exploitation of algal lipids as a sustainable source of biodiesel. Since starch and lipid biosynthesis involves the same C3 precursor pool, it has been proposed that mutations blocking starch accumulation should result in increased lipid yields, and indeed several studies have supported this. The fast-growing, thermotolerant alga Chlorella sorokiniana represents an attractive strain for industrial cultivation. We have therefore generated and characterized starch-deficient mutants of C. sorokiniana and determined whether lipid levels are increased in these strains under stress conditions. One mutant (ST68) is shown to lack isoamylase, whilst two others (ST3 and ST12) are defective in starch phosphorylase. However, we find no significant change in the accumulation or profile of fatty acids in these mutants compared to the wild-type, suggesting that a failure to accumulate starch per se is not sufficient for the hyper-accumulation of lipid, and that more subtle regulatory steps underlie the partitioning of carbon to the two storage products. PMID:26865991

  12. [Purine nucleoside phosphorylase].

    PubMed

    Pogosian, L G; Akopian, Zh I

    2013-01-01

    Purine nucleoside phosphorylase (PNP) is one of the most important enzymes of the purine metabolism, wich promotes the recycling of purine bases. Nowadays is the actual to search for effective inhibitors of this enzyme which is necessary for creation T-cell immunodeficient status of the organism in the organs and tissues transplantation, and chemotherapy of a number pathologies as well. For their successful practical application necessary to conduct in-depth and comprehensive study of the enzyme, namely a structure, functions, and an affinity of the reaction mechanism. In the review the contemporary achievements in the study of PNP from various biological objects are presented. New data describing the structure of PNP are summarised and analysed. The physiological role of the enzyme is discussed. The enzyme basic reaction mechanisms and actions are considered. The studies on enzyme physicochemical, kinetic, and catalytic research are presented. PMID:24479338

  13. Starch degradation in the cotyledons of germinating lentils.

    PubMed

    Tárrago, J F; Nicolás, G

    1976-11-01

    Starch, total amylolytic and phosphorylase activities were determined in lentil cotyledons during the first days of germination. Several independent criteria show that the amylolytic activity is due mainly to an amylase of the alpha type. Starch is degraded slowly in the first days; during this time, alpha- and beta-amylase activity are very low, while phosphorylase increases and reach a peak on the 3rd day. On the 4th day, there is a more rapid depletion of starch which coincides with an increase in alpha-amylase activity. By polyacrylamide gel electrophoresis of the crude starch-degrading enzyme, five bands were obtained: one phosphorylase, three alpha-amylases, and one beta-amylase. Based on their heat lability or heat stability, two sets of alpha-amylase seem to exist in lentil cotyledons. PMID:16659730

  14. Role of phosphorylase in the mechanism of potato minituber storage cell changes during clinorotation

    NASA Astrophysics Data System (ADS)

    Nedukha, O.; Shnyukova, E.

    The differences between the cytochemical reaction intensity and activity of phosphorylase (EC 2.4.1.1) and carbohydrate content in storage parenchyma cells of Solanum tuberosum L. (cv Adreta) minitubers grown for 30 days in the horizontal clinostate (2 rev/min) and in the control have been studied by electroncytochemical and biochemical methods. It is established an acceleration of minitubers formation and storage parenchyma cell differentiation at clinorotation. Electroncytochemical investigation of phosphorylase activity localization in the storage parenchyma cells of minitubers grown in control and at clinorotation showed the product of the reaction as electron-dense precipitate was marked plastids. Intensity and density of precipitate was increase in stroma of plastids and on starch grain surface during of intensive growth of starch in amyloplast (on 10- and 20-days of the minituber formation) of clinorotated minitubers in comparison with that in the control. The precipitate amount was decreased in the plastids on 30 day of growth in both variants. Using biochemical methods it is found that activity of phosphorylase and content of mono- and disaccharide and also starch content changed in minitubers formed during clinorotation and in the control. Data obtained are discussed regarding the possible mechanism of phosphorylase activity change and the role of mono- and disaccharide in acceleration of storage organ formation during clinorotation.

  15. Late-onset MNGIE without peripheral neuropathy due to incomplete loss of thymidine phosphorylase activity.

    PubMed

    Massa, Roberto; Tessa, Alessandra; Margollicci, Maria; Micheli, Vanna; Romigi, Andrea; Tozzi, Giulia; Terracciano, Chiara; Piemonte, Fiorella; Bernardi, Giorgio; Santorelli, Filippo M

    2009-12-01

    Mitochondrial NeuroGastroIntestinal Encephalomyopathy (MNGIE) is an autosomal recessive disorder characterized by severe gastrointestinal dysmotility, cachexia, peripheral neuropathy, ptosis, ophthalmoplegia, and leukoencephalopathy with early onset and severe prognosis. Mutations in the TYMP/ECGF1 gene cause a loss of thymidine phosphorylase catalytic activity, disrupting the homeostasis of intramitochondrial nucleotide pool. We report a woman with a very late onset of MNGIE, lacking peripheral neuropathy. Thymidine phosphorylase activity was markedly reduced in cultured fibroblasts, but only mildly reduced in buffy coat, where the defect is usually detected, and plasma thymidine was mildly increased compared to typical MNGIE patients. TYMP/ECGF1 analysis detected two heterozygous mutations, including a novel missense mutation. These findings indicate that a partial loss of thymidine phosphorylase activity may induce a late-onset and incomplete MNGIE phenotype. PMID:19853446

  16. A Putative Gene sbe3-rs for Resistant Starch Mutated from SBE3 for Starch Branching Enzyme in Rice (Oryza sativa L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Foods high in resistant starch (RS) are beneficial to prevent various diseases including diabetes, colon cancer, diarrhea and chronic renal or hepatic diseases. Elevated RS in rice is important for public health since rice is a staple food for half of the world’s population. A japonica mutant ‘Jiang...

  17. Polynucleotide phosphorylase from plant cells.

    PubMed

    Schumacher-Wittkopf, E; Richter, G; Schulze, S

    1984-06-01

    The isolation of polynucleotide phosphorylase (EC 2. 7. 7. 8) from suspension cultured plant cells of parsley (Petroselinum sativum) and from tomato seedlings (Lycopersicon esculentum) is described. The procedure includes an ultracentrifugation step, a glycerol density gradient centrifugation and preparative gel electrophoresis under nondenaturing conditions. Isoelectric focusing gives rise to a major component (pI ≈ 7.5) and to a minor one (pI ≈ 5). The enzyme contains five subunits with apparent Mr values of 160 000, 140 000, 70 000, 34 000 and 12 000, the 70 000-dalton one being a glycoprotein. PMID:24253429

  18. Enzymatic transformation of nonfood biomass to starch

    PubMed Central

    You, Chun; Chen, Hongge; Myung, Suwan; Sathitsuksanoh, Noppadon; Ma, Hui; Zhang, Xiao-Zhou; Li, Jianyong; Zhang, Y.-H. Percival

    2013-01-01

    The global demand for food could double in another 40 y owing to growth in the population and food consumption per capita. To meet the world’s future food and sustainability needs for biofuels and renewable materials, the production of starch-rich cereals and cellulose-rich bioenergy plants must grow substantially while minimizing agriculture’s environmental footprint and conserving biodiversity. Here we demonstrate one-pot enzymatic conversion of pretreated biomass to starch through a nonnatural synthetic enzymatic pathway composed of endoglucanase, cellobiohydrolyase, cellobiose phosphorylase, and alpha-glucan phosphorylase originating from bacterial, fungal, and plant sources. A special polypeptide cap in potato alpha-glucan phosphorylase was essential to push a partially hydrolyzed intermediate of cellulose forward to the synthesis of amylose. Up to 30% of the anhydroglucose units in cellulose were converted to starch; the remaining cellulose was hydrolyzed to glucose suitable for ethanol production by yeast in the same bioreactor. Next-generation biorefineries based on simultaneous enzymatic biotransformation and microbial fermentation could address the food, biofuels, and environment trilemma. PMID:23589840

  19. Starch poisoning

    MedlinePlus

    Cooking starch poisoning; Laundry starch poisoning ... Cooking and laundry starch are both made from vegetable products, most commonly: Corn Potatoes Rice Wheat Both are usually considered nonpoisonous (nontoxic), but ...

  20. Assessment of Thymidine Phosphorylase Function: Measurement of Plasma Thymidine (and Deoxyuridine) and Thymidine Phosphorylase Activity

    PubMed Central

    Martí, Ramon; López, Luis C.; Hirano, Michio

    2016-01-01

    We describe detailed methods to measure thymidine (dThd) and deoxyuridine (dUrd) concentrations and thymidine phosphorylase (TP) activity in biological samples. These protocols allow the detection of TP dysfunction in patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Since the identification of mutations in TϒMP, the gene encoding TP, as the cause of MNGIE (Nishino et al. Science 283:689–692, 1999), the assessment of TP dysfunction has become the best screening method to rule out or confirm MNGIE in patients. TϒMP sequencing, to find the causative mutations, is only needed when TP dysfunction is detected. dThd and dUrd are measured by resolving these compounds with high-performance liquid chromatography (HPLC) followed by the spectrophotometric monitoring of the eluate absorbance at 267 nm (HPLC-UV). TP activity can be measured by an endpoint determination of the thymine formed after 1 h incubation of the buffy coat homogenate in the presence of a large excess of its substrate dThd, either spectrophotometrically or by HPLC-UV. PMID:22215544

  1. Assessment of thymidine phosphorylase function: measurement of plasma thymidine (and deoxyuridine) and thymidine phosphorylase activity.

    PubMed

    Martí, Ramon; López, Luis C; Hirano, Michio

    2012-01-01

    We describe detailed methods to measure thymidine (dThd) and deoxyuridine (dUrd) concentrations and thymidine phosphorylase (TP) activity in biological samples. These protocols allow the detection of TP dysfunction in patients with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Since the identification of mutations in TYMP, the gene encoding TP, as the cause of MNGIE (Nishino et al. Science 283:689-692, 1999), the assessment of TP dysfunction has become the best screening method to rule out or confirm MNGIE in patients. TYMP sequencing, to find the causative mutations, is only needed when TP dysfunction is detected. dThd and dUrd are measured by resolving these compounds with high-performance liquid chromatography (HPLC) followed by the spectrophotometric monitoring of the eluate absorbance at 267 nm (HPLC-UV). TP activity can be measured by an endpoint determination of the thymine formed after 1 h incubation of the buffy coat homogenate in the presence of a large excess of its substrate dThd, either spectrophotometrically or by HPLC-UV. PMID:22215544

  2. Identification and subcellular localization of starch-metabolizing enzymes in the green alga Dunaliella marina.

    PubMed

    Kombrink, E; Wöber, G

    1980-07-01

    Enzymes of starch synthesis and degradation were identified in crude extracts of the unicellular green alga Dunaliella marina (Volvocales). By polyacrylamide gel electrophoresis and specific staining for enzyme activities, 4 multiple forms of starch synthase, 2 amylases, and at least 2 forms of α-glucan phosphorylase were visible. Using specific α-glucans incorporated into the gel before electrophoresis we have tentatively correlated α-amylase and β-amylase with both hydrolytic activities. The activities of α-glucan phosphorylase and amylase(s) were measured quantitatively in crude extracts, and the concomitant action of α-glucan phosphorylase and amylase(s) was found to account for the fastest rate of starch mobilization observed in vivo. Isolated chloroplasts retained both typical plastid marker enzymes and ADPglucose pyrophosphorylase, starch synthase, amylase(s), and α-glucan phosphorylase to a similar percentage. Gel electrophoretic analysis followed by staining for enzyme activity of a stromal fraction resulted in a pattern of multiple forms of starch-metabolizing enzymes analogous to that found in a crude extract. We interpret the combined data as indicating the exclusive location in vivo of starch-metabolizing enzymes in chloroplasts of D. marina. PMID:24306243

  3. Elevated plasma deoxyuridine in patients with thymidine phosphorylase deficiency.

    PubMed

    Martí, Ramon; Nishigaki, Yutaka; Hirano, Michio

    2003-03-28

    Mutations in the nuclear gene encoding thymidine phosphorylase (TP) cause mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), an autosomal recessive disease with mitochondrial dysfunction and mitochondrial DNA abnormalities. We have demonstrated alterations of thymidine (dThd) metabolism in MNGIE patients. Here, we report the accumulation of another substrate of TP, deoxyuridine (dUrd), whose circulating levels ranged from 5.5 to 24.4 microM (average 14.2) in MNGIE and were undetectable (<0.05 microM) in both TP mutation carriers and controls. The dramatic accumulation of dUrd may contribute to nucleotide pool imbalances and, together with the increased levels of dThd, is likely to contribute to the pathogenesis of MNGIE. PMID:12646159

  4. Thymidine phosphorylase deficiency causes MNGIE: an autosomal recessive mitochondrial disorder.

    PubMed

    Hirano, M; Martí, R; Spinazzola, A; Nishino, I; Nishigaki, Y

    2004-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the gene encoding thymidine phosphorylase (TP). The disease is characterized clinically by impaired eye movements, gastrointestinal dysmotility, cachexia, peripheral neuropathy, myopathy, and leukoencephalopathy. Molecular genetic studies of MNGIE patients' tissues have revealed multiple deletions, depletion, and site-specific point mutations of mitochondrial DNA. TP is a cytosolic enzyme required for nucleoside homeostasis. In MNGIE, TP activity is severely reduced and consequently levels of thymidine and deoxyuridine in plasma are dramatically elevated. We have hypothesized that the increased levels of intracellular thymidine and deoxyuridine cause imbalances of mitochondrial nucleotide pools that, in turn, lead to the mtDNA abnormalities. MNGIE was the first molecularly characterized genetic disorder caused by abnormal mitochondrial nucleoside/nucleotide metabolism. Future studies are likely to reveal further insight into this expanding group of diseases. PMID:15571233

  5. Soybean cotyledon starch metabolism is sensitive to altered gravity conditions

    NASA Technical Reports Server (NTRS)

    Brown, C. S.; Piastuch, W. C.; Knott, W. M.

    1994-01-01

    We have demonstrated that etiolated soybean seedlings grown under the altered gravity conditions of clinorotation (1 rpm) and centrifugation (5xg) exhibit changes in starch metabolism. Cotyledon starch concentration was lower (-28%) in clinorotated plants and higher (+24%) in centrifuged plants than in vertical control plants. The activity of ADP-glucose pyrophosphorylase in the cotyledons was affected in a similar way, i.e. lower (-37%) in the clinorotated plants and higher (+22%) in the centrifuged plants. Other starch metabolic enzyme activities, starch synthase, starch phosphorylase and total hydrolase were not affected by the altered gravity treatments. We conclude that the observed changes in starch concentrations were primarily due to gravity-mediated differences in ADP-glucose pyrophosphorylase activity.

  6. Glycal Formation in Crystals of Uridine Phosphorylase

    SciTech Connect

    Paul, Debamita; O’Leary, Sen E.; Rajashankar, Kanagalaghatta; Bu, Weiming; Toms, Angela; Settembre, Ethan C.; Sanders, Jennie M.; Begley, Tadhg P.; Ealick, Steven E.

    2010-06-22

    Uridine phosphorylase is a key enzyme in the pyrimidine salvage pathway. This enzyme catalyzes the reversible phosphorolysis of uridine to uracil and ribose 1-phosphate (or 2{prime}-deoxyuridine to 2{prime}-deoxyribose 1-phosphate). Here we report the structure of hexameric Escherichia coli uridine phosphorylase treated with 5-fluorouridine and sulfate and dimeric bovine uridine phosphorylase treated with 5-fluoro-2{prime}-deoxyuridine or uridine, plus sulfate. In each case the electron density shows three separate species corresponding to the pyrimidine base, sulfate, and a ribosyl species, which can be modeled as a glycal. In the structures of the glycal complexes, the fluorouracil O2 atom is appropriately positioned to act as the base required for glycal formation via deprotonation at C2{prime}. Crystals of bovine uridine phosphorylase treated with 2{prime}-deoxyuridine and sulfate show intact nucleoside. NMR time course studies demonstrate that uridine phosphorylase can catalyze the hydrolysis of the fluorinated nucleosides in the absence of phosphate or sulfate, without the release of intermediates or enzyme inactivation. These results add a previously unencountered mechanistic motif to the body of information on glycal formation by enzymes catalyzing the cleavage of glycosyl bonds.

  7. Isolation, identification and characterisation of starch-interacting proteins by 2-D affinity electrophoresis.

    PubMed

    Kosar-Hashemi, Behjat; Irwin, Jennifer A; Higgins, Jody; Rahman, Sadequr; Morell, Matthew K

    2006-05-01

    A 2-D affinity electrophoretic technique (2-DAE) has been used to isolate proteins that interact with various starch components from total barley endosperm extracts. In the first dimension, proteins are separated by native PAGE. The second-dimensional gel contains polysaccharides such as amylopectin and glycogen. The migration of starch-interacting proteins in this dimension is determined by their affinity towards a particular polysaccharide and these proteins are therefore spatially separated from the bulk of proteins in the crude extract. Four distinct proteins demonstrate significant affinity for amylopectin and have been identified as starch branching enzyme I (SBEI), starch branching enzyme IIa (SBEIIa), SBEIIb and starch phosphorylase using polyclonal antibodies and zymogram activity analysis. In the case of starch phosphorylase, a protein spot was excised from a 2-DAE polyacrylamide gel and analysed using Q-TOF MS/MS, resulting in the alignment of three internal peptide sequences with the known sequence of the wheat plastidic starch phosphorylase isoform. This assignment was confirmed by the determination of the enzyme's function using zymogram analysis. Dissociation constants (Kd) were calculated for the three enzymes at 4 degrees C and values of 0.20, 0.21 and 1.3 g/L were determined for SBEI, SBEIIa and starch phosphorylase, respectively. Starch synthase I could also be resolved from the other proteins in the presence of glycogen and its identity was confirmed using a polyclonal antibody and by activity analysis. The 2-DAE method described here is simple, though powerful, enabling protein separation from crude extracts on the basis of function. PMID:16645949

  8. Plantain and banana starches: granule structural characteristics explain the differences in their starch degradation patterns.

    PubMed

    Soares, Claudinéia Aparecida; Peroni-Okita, Fernanda Helena Gonçalves; Cardoso, Mateus Borba; Shitakubo, Renata; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2011-06-22

    Different banana cultivars were used to investigate the influences of starch granule structure and hydrolases on degradation. The highest degrees of starch degradation were observed in dessert bananas during ripening. Scanning electron microscopy images revealed smooth granule surface in the green stage in all cultivars, except for Mysore. The small and round granules were preferentially degraded in all of the cultivars. Terra demonstrated a higher degree of crystallinity and a short amylopectin chain length distribution, resulting in high starch content in the ripe stage. Amylose content and the crystallinity index were more strongly correlated than the distribution of amylopectin branch chain lengths in banana starches. α- and β-amylase activities were found in both forms, soluble in the pulp and associated with the starch granule. Starch-phosphorylase was not found in Mysore. On the basis of the profile of α-amylase in vitro digestion and the structural characteristics, it could be concluded that the starch of plantains has an arrangement of granules more resistant to enzymes than the starch of dessert bananas. PMID:21591784

  9. The crystal structure and activity of a putative trypanosomal nucleoside phosphorylase reveal it to be a homodimeric uridine phosphorylase

    PubMed Central

    Larson, Eric T.; Mudeppa, Devaraja G.; Gillespie, J. Robert; Mueller, Natascha; Napuli, Alberto J.; Arif, Jennifer A.; Ross, Jenni; Arakaki, Tracy L.; Lauricella, Angela; DeTitta, George; Luft, Joseph; Zucker, Frank; Verlinde, Christophe L. M. J.; Fan, Erkang; Van Voorhis, Wesley C.; Buckner, Frederick S.; Rathod, Pradipsinh K.; Hol, Wim G. J.; Merritt, Ethan A.

    2010-01-01

    Purine nucleoside phosphorylases and uridine phosphorylases are closely related enzymes involved in purine and pyrimidine salvage, respectively, which catalyze the removal of the ribosyl moiety from nucleosides so that the nucleotide base may be recycled. Parasitic protozoa generally are incapable of de novo purine biosynthesis so the purine salvage pathway is of potential therapeutic interest. Information about pyrimidine biosynthesis in these organisms is much more limited. Though all seem to carry at least a subset of enzymes from each pathway, the dependency on de novo pyrimidine synthesis versus salvage varies from organism to organism and even from one growth stage to another. We have structurally and biochemically characterized a putative nucleoside phosphorylase from the pathogenic protozoan Trypanosoma brucei and find that it is a homodimeric uridine phosphorylase. This is the first characterization of a uridine phosphorylase from a trypanosomal source despite this activity being observed decades ago. Although this gene was broadly annotated as a putative nucleoside phosphorylase, it was widely inferred to be a purine nucleoside phosphorylase. Our characterization of this trypanosomal enzyme shows that it is possible to distinguish between purine and uridine phosphorylase activity at the sequence level based on the absence or presence of a characteristic uridine phosphorylase-specificity insert. We suggest that this recognizable feature may aid in proper annotation of the substrate specificity of enzymes in the nucleoside phosphorylase family. PMID:20070944

  10. Regulation of locust fat-body phosphorylase

    PubMed Central

    Applebaum, S. W.; Schlesinger, H. M.

    1973-01-01

    1. Glycogen phosphorylase of locust fat-body was partially purified by differential centrifugation and dissociation from glycogen particles at two pH values. 2. Optimum activity was obtained at pH6.6–6.7. 3. The calculated apparent Km values for glycogen and glucose 1-phosphate were 0.08% and 10–13mm respectively. 4. 5′-AMP activated in the range 5μm–1mm. 5. Glucose 6-phosphate is a competitive inhibitor for the substrate glucose 1-phosphate (Ki=1.7mm). 5′-AMP abolishes this inhibition. Glucose weakly inhibits (Ki=25–30mm), but trehalose does not inhibit even at 100mm. 6. It is suggested that glucose 6-phosphate is a major regulator of glycogen phosphorylase activity in locust fat-body. PMID:4776873

  11. Myoglobinuria and Skeletal Muscle Phosphorylase Deficiency

    PubMed Central

    Nixon, J. C.; Hobbs, W. K.; Greenblatt, J.

    1966-01-01

    Investigation of a patient complaining of exercise-induced dark urine, pain, stiffness and tenderness of skeletal muscle revealed findings characteristic of McArdle's disease. The dark urine was attributable to the excretion of myoglobin, and an ischemic exercise test failed to demonstrate the usual rise and fall in blood lactate and pyruvate. Enzyme assays of skeletal muscle showed an absence of phosphorylase, a slight increase in phosphorylase b kinase and a slight decrease in phosphoglucomutase. Chemical and histochemical analyses demonstrated an increase in the skeletal muscle glycogen content and an enlargement of the muscle cells. No abnormality of liver glycogen metabolism was found. In the absence of specific therapy, an effective and practical form of treatment is reduction of exercise below the threshold of symptoms. ImagesFig. 1Fig. 2Fig. 6Fig. 7Fig. 8 PMID:4952390

  12. Phosphorylation of McArdle phosphorylase induces activity.

    PubMed Central

    Cerri, C G; Willner, J H

    1981-01-01

    In McArdle disease, myophosphorylase deficiency, enzyme activity is absent but the presence of an altered enzyme protein can frequently be demonstrated. We have found that phosphorylation of this protein in vitro can result in catalytic activity. We studied muscle of four patients; all lacked myophosphorylase activity, but myophosphorylase protein was demonstrated by immunodiffusion or gel electrophoresis. Incubation of muscle homogenate supernatants with cyclic AMP-dependent protein kinase and ATP resulted in phosphorylase activity. The activated enzyme comigrated with normal human myophosphorylase in gel electrophoresis. Incubation with [gamma-32P]ATP resulted in incorporatin of 32P into the band possessing phosphorylase activity. Activation of phosphorylase by cyclic AMP-dependent protein kinase was inhibited by antibodies to normal human myophosphorylase or by inhibitory protein to cyclic AMP-dependent protein kinase. Incubation of muscle homogenates with phosphorylase b kinase and ATP also resulted in phosphorylase activity. After the action of cyclic AMP-dependent protein kinase, the resulting activity was similar to that of phosphorylase b. However, incubation with phosphorylase kinase resulted in activity similar to that of phosphorylase a. For several reasons, it is not likely that McArdle disease is due to lack of normal phosphorylation, but restoration of activity to the mutant protein by phosphorylation may provide a clue to understanding the mechanism of this genetic defect. Images PMID:6265901

  13. Rational engineering of Lactobacillus acidophilus NCFM maltose phosphorylase into either trehalose or kojibiose dual specificity phosphorylase.

    PubMed

    Nakai, Hiroyuki; Petersen, Bent O; Westphal, Yvonne; Dilokpimol, Adiphol; Abou Hachem, Maher; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-10-01

    Lactobacillus acidophilus NCFM maltose phosphorylase (LaMP) of the (alpha/alpha)(6)-barrel glycoside hydrolase family 65 (GH65) catalyses both phosphorolysis of maltose and formation of maltose by reverse phosphorolysis with beta-glucose 1-phosphate and glucose as donor and acceptor, respectively. LaMP has about 35 and 26% amino acid sequence identity with GH65 trehalose phosphorylase (TP) and kojibiose phosphorylase (KP) from Thermoanaerobacter brockii ATCC35047. The structure of L. brevis MP and multiple sequence alignment identified (alpha/alpha)(6)-barrel loop 3 that forms the rim of the active site pocket as a target for specificity engineering since it contains distinct sequences for different GH65 disaccharide phosphorylases. Substitution of LaMP His413-Glu421, His413-Ile418 and His413-Glu415 from loop 3, that include His413 and Glu415 presumably recognising the alpha-anomeric O-1 group of the glucose moiety at subsite +1, by corresponding segments from Ser426-Ala431 in TP and Thr419-Phe427 in KP, thus conferred LaMP with phosphorolytic activity towards trehalose and kojibiose, respectively. Two different loop 3 LaMP variants catalysed the formation of trehalose and kojibiose in yields superior of maltose by reverse phosphorolysis with (alpha1, alpha1)- and alpha-(1,2)-regioselectivity, respectively, as analysed by nuclear magnetic resonance. The loop 3 in GH65 disaccharide phosphorylase is thus a key determinant for specificity both in phosphorolysis and in regiospecific reverse phosphorolysis. PMID:20713411

  14. Late-onset MNGIE due to partial loss of thymidine phosphorylase activity.

    PubMed

    Martí, Ramon; Verschuuren, Jan J G M; Buchman, Alan; Hirano, Ikuo; Tadesse, Saba; van Kuilenburg, André B P; van Gennip, Albert H; Poorthuis, Ben J H M; Hirano, Michio

    2005-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is caused by mutations in the gene encoding thymidine phosphorylase (TP). All MNGIE patients have had severe loss of TP function and prominent plasma accumulations of the TP substrates thymidine (dThd) and deoxyuridine (dUrd). Here, we report for the first time to our knowledge three MNGIE patients with later onset, milder phenotype, and less severe TP dysfunction, compared with typical MNGIE patients. This report demonstrates a direct relationship between the biochemical defects and clinical phenotypes in MNGIE and supports the notion that reduction of dThd and dUrd accumulation or TP replacement could be useful therapy for MNGIE. PMID:16178026

  15. [Starch aspiration].

    PubMed

    Volk, O; Neidhöfer, M; Schregel, W

    1999-06-01

    Starch is a white, neutral smelling, insoluble and harmless powder. The case of a 24-year old worker with a pronounced bronchospasm and arterial hypoxaemia after a collapse and aspiration during working in a silo filled with corn starch will be reported. Medication consisted mainly in mucolytics. Intensive airway clearing consisted of repeated bronchoscopies, bedding, tapotement and vibration massage. The patient has made a complete recovery in 3 days. PMID:10429779

  16. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    SciTech Connect

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E.

    2012-03-01

    Adenosine phosphorylase from B. cereus shows a strong preference for adenosine over other 6-oxopurine nucleosides. Mutation of Asp204 to asparagine reduces the efficiency of adenosine cleavage but does not affect inosine cleavage, effectively reversing the substrate specificity. The structures of D204N complexes explain these observations. Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2′-deoxy)nucleosides, generating the corresponding free base and (2′-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2–1.4 Å). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  17. Black leaf streak disease affects starch metabolism in banana fruit.

    PubMed

    Saraiva, Lorenzo de Amorim; Castelan, Florence Polegato; Shitakubo, Renata; Hassimotto, Neuza Mariko Aymoto; Purgatto, Eduardo; Chillet, Marc; Cordenunsi, Beatriz Rosana

    2013-06-12

    Black leaf streak disease (BLSD), also known as black sigatoka, represents the main foliar disease in Brazilian banana plantations. In addition to photosynthetic leaf area losses and yield losses, this disease causes an alteration in the pre- and postharvest behavior of the fruit. The aim of this work was to investigate the starch metabolism of fruits during fruit ripening from plants infected with BLSD by evaluating carbohydrate content (i.e., starch, soluble sugars, oligosaccharides, amylose), phenolic compound content, phytohormones, enzymatic activities (i.e., starch phosphorylases, α- and β-amylase), and starch granules. The results indicated that the starch metabolism in banana fruit ripening is affected by BLSD infection. Fruit from infested plots contained unusual amounts of soluble sugars in the green stage and smaller starch granules and showed a different pattern of superficial degradation. Enzymatic activities linked to starch degradation were also altered by the disease. Moreover, the levels of indole-acetic acid and phenolic compounds indicated an advanced fruit physiological age for fruits from infested plots. PMID:23692371

  18. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  19. Immobilized phosphorylase for synthesis of polysaccharides from glucose

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1972-01-01

    Continuous processes for enzymatic production of carbohydrates from glucose are discussed. Key reactant in process is identified as phosphorylase which catalyzes reversible formation or degradation of polysaccharide. Chemical compounds and reactions to synthesize polysaccharides are analyzed.

  20. Composition of clusters and building blocks in amylopectins from maize mutants deficient in starch synthase III.

    PubMed

    Zhu, Fan; Bertoft, Eric; Seetharaman, Koushik

    2013-12-18

    Branches in amylopectin are distributed along the backbone. Units of the branches are building blocks (smaller) and clusters (larger) based on the distance between branches. In this study, composition of clusters and building blocks of amylopectins from dull1 maize mutants deficient in starch synthase III (SSIII) with a common genetic background (W64A) were characterized and compared with the wild type. Clusters were produced from amylopectins by partial hydrolysis using α-amylase of Bacillus amyloliquefaciens and were subsequently treated with phosphorylase a and β-amylase to produce φ,β-limit dextrins. Clusters were further extensively hydrolyzed with the α-amylase to produce building blocks. Structures of clusters and building blocks were analyzed by diverse chromatographic techniques. The results showed that the dull1 mutation resulted in larger clusters with more singly branched building blocks. The average cluster contained ~5.4 blocks in dull1 mutants and ~4.2 blocks in the wild type. The results are compared with previous results from SSIII-deficient amo1 barley and suggest fundamental differences in the cluster structures. PMID:24229421

  1. Liver glycogen storage diseases due to phosphorylase system deficiencies: diagnosis thanks to non invasive blood enzymatic and molecular studies.

    PubMed

    Davit-Spraul, Anne; Piraud, Monique; Dobbelaere, Dries; Valayannopoulos, Vassili; Labrune, Philippe; Habes, Dalila; Bernard, Olivier; Jacquemin, Emmanuel; Baussan, Christiane

    2011-01-01

    Glycogen storage disease (GSD) due to a deficient hepatic phosphorylase system defines a genetically heterogeneous group of disorders that mainly manifests in children. We investigated 45 unrelated children in whom a liver GSD VI or IX was suspected on the basis of clinical symptoms including hepatomegaly, increased serum transaminases, postprandial lactatemia and/or mild fasting hypoglycemia. Liver phosphorylase and phosphorylase b kinase activities studied in peripheral blood cells allowed to suspect diagnosis in 37 cases but was uninformative in 5. Sequencing of liver phosphorylase genes was useful to establish an accurate diagnosis. Causative mutations were found either in the PYGL (11 patients), PHKA2 (26 patients), PHKG2 (three patients) or in the PHKB (three patients) genes. Eleven novel disease causative mutations, five missense (p.N188K, p.D228Y, p.P382L, p.R491H, p.L500R) and six truncating mutations (c.501_502ins361pb, c.528+2T>C, c.856-29_c.1518+614del, c.1620+1G>C, p.E703del and c.2313-1G>T) were identified in the PYGL gene. Seventeen novel disease causative mutations, ten missense (p.A42P, p.Q95R, p.G131D, p.G131V, p.Q134R, p.G187R, p.G300V, p.G300A, p.C326Y, p.W820G) and seven truncating (c.537+5G>A, p.G396DfsX28, p.Q404X, p.N653X, p.L855PfsX87, and two large deletions) were identified in the PHKA2 gene. Four novel truncating mutations (p.R168X, p.Q287X, p.I268PfsX12 and c.272-1G>C) were identified in the PHKG2 gene and three (c.573_577del, p.R364X, c.2427+3A>G) in the PHKB gene. Patients with PHKG2 mutations evolved towards cirrhosis. Molecular analysis of GSD VI or IX genes allows to confirm diagnosis suspected on the basis of enzymatic analysis and to establish diagnosis and avoid liver biopsy when enzymatic studies are not informative in blood cells. PMID:21646031

  2. Starch Degradation Metabolism towards Sucrose Synthesis in Germinating Araucaria araucana Seeds.

    PubMed

    Cardemil, L; Varner, J E

    1984-12-01

    As starch is the main seed reserve material in both species of Araucaria of South America, A. araucana and A. angustifolia, it is important to understand starch breakdown in both embryo and megagametophyte tissues of Araucaria seeds. Sugar analysis by thin layer chromatography indicates that sucrose is the main sugar produced in both tissues. Enzyme reactions coupled to benzidine oxidation indicate that sucrose is the main sugar moved from the megagametophyte to the growing regions of the embryo via the cotyledons.Phosphorylase was detected in both embryo and megagametophyte tissues by the formation of [(32)P]glucose-1-P and by formation of [(14)C] amylopectin from [(14)C]glucose-1-P. The enzyme activity increases 5-fold in both embryo and gametophyte to a peak 18 hours after the start of imbibition. Debranching enzyme, alpha-glucosidase, and hexokinase are also present in both embryonic and megagametophytic tissues.Branched glucan oligosaccharides accumulate during this time, reaching a maximum 40 hours after imbibition starts, and decline after germination occurs.The pattern of activity of the enzymes studied in this work suggests that starch degradation is initiated by alpha-amylase and phosphorylase in the embryo and by phosphorylase mainly in the megagametophyte. Sucrose-P synthase seems to be the enzyme responsible for sucrose synthesis in both tissues. PMID:16663947

  3. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    SciTech Connect

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E.

    2012-10-08

    Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2{prime}-deoxy)nucleosides, generating the corresponding free base and (2{prime}-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2-1.4 {angstrom}). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  4. Thymidine Phosphorylase in Cancer; Enemy or Friend?

    PubMed

    Elamin, Yasir Y; Rafee, Shereen; Osman, Nemer; O Byrne, Kenneth J; Gately, Kathy

    2016-04-01

    Thymidine phosphorylase (TP) is a nucleoside metabolism enzyme that plays an important role in the pyrimidine pathway.TP catalyzes the conversion of thymidine to thymine and 2-deoxy-α-D-ribose-1-phosphate (dRib-1-P). Although this reaction is reversible, the main metabolic function of TP is catabolic. TP is identical to the angiogenic factor platelet-derived endothelial-cell growth factor (PD-ECGF). TP is overexpressed in several human cancers in response to cellular stressful conditions like hypoxia, acidosis, chemotherapy and radiotherapy. TP has been shown to promote tumor angiogenesis, invasion, metastasis, evasion of the immune-response and resistance to apoptosis. Some of the biological effects of TP are dependent on its enzymatic activity, while others are mediated through cytokines like interleukin 10 (IL-10), basic fibroblast growth factor (bFGF) and tumour necrosis factor α (TNFα). Interestingly, TP also plays a role in cancer treatment through its role in the conversion of the oral fluoropyrimidine capecitabine into its active form 5-FU. TP is a predictive marker for fluoropyrimidine response. Given its various biological functions in cancer progression, TP is a promising target in cancer treatment. Further translational research is required in this area. PMID:26298314

  5. New Starch Phenotypes Produced by TILLING in Barley

    PubMed Central

    Sparla, Francesca; Falini, Giuseppe; Botticella, Ermelinda; Pirone, Claudia; Talamè, Valentina; Bovina, Riccardo; Salvi, Silvio; Tuberosa, Roberto; Sestili, Francesco; Trost, Paolo

    2014-01-01

    Barley grain starch is formed by amylose and amylopectin in a 1∶3 ratio, and is packed into granules of different dimensions. The distribution of granule dimension is bimodal, with a majority of small spherical B-granules and a smaller amount of large discoidal A-granules containing the majority of the starch. Starch granules are semi-crystalline structures with characteristic X-ray diffraction patterns. Distinct features of starch granules are controlled by different enzymes and are relevant for nutritional value or industrial applications. Here, the Targeting-Induced Local Lesions IN Genomes (TILLING) approach was applied on the barley TILLMore TILLING population to identify 29 new alleles in five genes related to starch metabolism known to be expressed in the endosperm during grain filling: BMY1 (Beta-amylase 1), GBSSI (Granule Bound Starch Synthase I), LDA1 (Limit Dextrinase 1), SSI (Starch Synthase I), SSIIa (Starch Synthase IIa). Reserve starch of nine M3 mutant lines carrying missense or nonsense mutations was analysed for granule size, crystallinity and amylose/amylopectin content. Seven mutant lines presented starches with different features in respect to the wild-type: (i) a mutant line with a missense mutation in GBSSI showed a 4-fold reduced amylose/amylopectin ratio; (ii) a missense mutations in SSI resulted in 2-fold increase in A:B granule ratio; (iii) a nonsense mutation in SSIIa was associated with shrunken seeds with a 2-fold increased amylose/amylopectin ratio and different type of crystal packing in the granule; (iv) the remaining four missense mutations suggested a role of LDA1 in granule initiation, and of SSIIa in determining the size of A-granules. We demonstrate the feasibility of the TILLING approach to identify new alleles in genes related to starch metabolism in barley. Based on their novel physicochemical properties, some of the identified new mutations may have nutritional and/or industrial applications. PMID:25271438

  6. Analysis of primer independent phosphorylase activity in potato plants: high levels of activity in sink organs and sucrose-dependent activity in cultured stem explants.

    PubMed

    Moreno, S; Tandecarz, J S

    1996-07-01

    One isoform of potato (Solanum tuberosum L., cv. Spunta), type L phosphorylase (EC 2.4.1.1), exhibiting primer independent activity appears to be tuber-specific. However, this activity can also be modulated by exogenous sucrose in storage as well as in non-storage organs. Primer independent phosphorylase (PIPh) activity in microtubers and shoots of in vitro plantlets was found to be much higher than in tubers and shoots of soil-grown plants. Detached leaves of soil-grown plants showed an increase in PIPh activity as well when incubated in sucrose-containing Murashige-Skoog (MS) medium. This increase was always accompanied by a rise in starch content. The presence of metabolizable carbohydrates in the growth or incubation medium are likely to be responsible for the observed rise in PIPh activity. In vitro microtubers and micropropagated plantlet organs (shoots and roots) exhibited a correlation between measurable PIPh activity and presence of enzyme protein, as judged by Western blot analysis using anti-potato tuber type L phosphorylase antibody. Therefore, in addition, to be developmentally regulated (tuber-specific accumulation), PIPh activity associated with the tuber type L isoform might be under a form of metabolic regulation. PMID:8832093

  7. Experiment 9: ASTROCULTURE: Growth and Starch Accumulation of Potato Tuber

    NASA Technical Reports Server (NTRS)

    Tibbitts, Theodore W.; Brown, Christopher S.; Croxdale, Judith G.; Wheeler, Raymond M.

    1998-01-01

    Potato explants (leaf, small stem section, and axillary bud) flown on STS-73 developed tubers of 1.5 cm diameter and 1.7 g mass during the 16-day period of space flight. The experiment was undertaken in the ASTROCULTURE(TM) experiment package under controlled temperature, humidity, lighting, and carbon dioxide concentrations. The tubers that formed in the explant system under microgravity had the same gross morphology, the same anatomical configuration of cells and tissues, and the same sizes, shapes, and surface character of starch granules as tubers formed in a 1 g environment. The total accumulation of starch and other energy containing compounds was similar in space flight and ground control tubers. Enzyme activity of starch synthase, starch phosphorylase, and total hydrolase was similar in space flight and ground controls, but activity of ADP-glucose pyrophosphorylase was reduced in the space flight tuber tissue. This experiment documented that potatoes will metabolize and accumulate starch as effectively in space flight as on the ground. Thus, this data provides the potential for effective utilization of potatoes in life support systems of space bases.

  8. Space Experiment on Tuber Development and Starch Accumulation for CELSS

    NASA Technical Reports Server (NTRS)

    Tibbitts,Theodore W.; Croxdale, Judith C.; Brown, Christopher S.

    1997-01-01

    Potato explants (leaf, small stem section, and axillary bud), flown on STS-73, developed tubers of 1.5 cm diameter and 1.7 g mass during the 16 day period of spaceflight. The experiment was undertaken in the ASTROCULTURE(Trademark) experiment package under controlled temperature, humidity, lighting, and carbon dioxide concentrations. The tubers formed in the explant system under microgravity had the same gross morphology, the same anatomical configuration of cells and tissues, and the same sizes, shapes, and surface character of starch granules as tubers formed in a 1 g environment. The total accumulation of starch and other energy containing compounds was singular in space flight and ground control tubers. Enzyme activity of starch synthase, starch phosphorylase, and total hydrolase was similar in spaceflight and ground controls but activity of ADP-glucose pyrophosphorylase was reduced in the spaceflight tuber tissue. This experiment documented that potatoes will metabolize and accumulate starch as effectively in spaceflight as on the ground and thus this data provides the potential for effective utilization of potatoes in life support systems of space bases.

  9. Starch synthase 4 is essential for coordination of starch granule formation with chloroplast division during Arabidopsis leaf expansion.

    PubMed

    Crumpton-Taylor, Matilda; Pike, Marilyn; Lu, Kuan-Jen; Hylton, Christopher M; Feil, Regina; Eicke, Simona; Lunn, John E; Zeeman, Samuel C; Smith, Alison M

    2013-12-01

    Arabidopsis thaliana mutants lacking the SS4 isoform of starch synthase have strongly reduced numbers of starch granules per chloroplast, suggesting that SS4 is necessary for the normal generation of starch granules. To establish whether it plays a direct role in this process, we investigated the circumstances in which granules are formed in ss4 mutants. Starch granule numbers and distribution and the accumulation of starch synthase substrates and products were investigated during ss4 leaf development, and in ss4 mutants carrying mutations or transgenes that affect starch turnover or chloroplast volume. We found that immature ss4 leaves have no starch granules, but accumulate high concentrations of the starch synthase substrate ADPglucose. Granule numbers are partially restored by elevating the capacity for glucan synthesis (via expression of bacterial glycogen synthase) or by increasing the volumes of individual chloroplasts (via introduction of arc mutations). However, these granules are abnormal in distribution, size and shape. SS4 is an essential component of a mechanism that coordinates granule formation with chloroplast division during leaf expansion and determines the abundance and the flattened, discoid shape of leaf starch granules. PMID:23952675

  10. Starch synthase 4 is essential for coordination of starch granule formation with chloroplast division during Arabidopsis leaf expansion

    PubMed Central

    Crumpton-Taylor, Matilda; Pike, Marilyn; Lu, Kuan-Jen; Hylton, Christopher M; Feil, Regina; Eicke, Simona; Lunn, John E; Zeeman, Samuel C; Smith, Alison M

    2013-01-01

    Arabidopsis thaliana mutants lacking the SS4 isoform of starch synthase have strongly reduced numbers of starch granules per chloroplast, suggesting that SS4 is necessary for the normal generation of starch granules. To establish whether it plays a direct role in this process, we investigated the circumstances in which granules are formed in ss4 mutants. Starch granule numbers and distribution and the accumulation of starch synthase substrates and products were investigated during ss4 leaf development, and in ss4 mutants carrying mutations or transgenes that affect starch turnover or chloroplast volume. We found that immature ss4 leaves have no starch granules, but accumulate high concentrations of the starch synthase substrate ADPglucose. Granule numbers are partially restored by elevating the capacity for glucan synthesis (via expression of bacterial glycogen synthase) or by increasing the volumes of individual chloroplasts (via introduction of arc mutations). However, these granules are abnormal in distribution, size and shape. SS4 is an essential component of a mechanism that coordinates granule formation with chloroplast division during leaf expansion and determines the abundance and the flattened, discoid shape of leaf starch granules. PMID:23952675

  11. Starch metabolism in leaves.

    PubMed

    Orzechowski, Sławomir

    2008-01-01

    Starch is the most abundant storage carbohydrate produced in plants. The initiation of transitory starch synthesis and degradation in plastids depends mainly on diurnal cycle, post-translational regulation of enzyme activity and starch phosphorylation. For the proper structure of starch granule the activities of all starch synthase isoenzymes, branching enzymes and debranching enzymes are needed. The intensity of starch biosynthesis depends mainly on the activity of AGPase (adenosine 5'-diphosphate glucose pyrophosphorylase). The key enzymes in starch degradation are beta-amylase, isoamylase 3 and disproportionating enzyme. However, it should be underlined that there are some crucial differences in starch metabolism between heterotrophic and autotrophic tissues, e.g. is the ability to build multiprotein complexes responsible for biosynthesis and degradation of starch granules in chloroplasts. The observed huge progress in understanding of starch metabolism was possible mainly due to analyses of the complete Arabidopsis and rice genomes and of numerous mutants with altered starch metabolism in leaves. The aim of this paper is to review current knowledge on transient starch metabolism in higher plants. PMID:18787712

  12. New inhibitors of glycogen phosphorylase as potential antidiabetic agents.

    PubMed

    Somsák, L; Czifrák, K; Tóth, M; Bokor, E; Chrysina, E D; Alexacou, K-M; Hayes, J M; Tiraidis, C; Lazoura, E; Leonidas, D D; Zographos, S E; Oikonomakos, N G

    2008-01-01

    The protein glycogen phosphorylase has been linked to type 2 diabetes, indicating the importance of this target to human health. Hence, the search for potent and selective inhibitors of this enzyme, which may lead to antihyperglycaemic drugs, has received particular attention. Glycogen phosphorylase is a typical allosteric protein with five different ligand binding sites, thus offering multiple opportunities for modulation of enzyme activity. The present survey is focused on recent new molecules, potential inhibitors of the enzyme. The biological activity can be modified by these molecules through direct binding, allosteric effects or other structural changes. Progress in our understanding of the mechanism of action of these inhibitors has been made by the determination of high-resolution enzyme inhibitor structures (both muscle and liver). The knowledge of the three-dimensional structures of protein-ligand complexes allows analysis of how the ligands interact with the target and has the potential to facilitate structure-based drug design. In this review, the synthesis, structure determination and computational studies of the most recent inhibitors of glycogen phosphorylase at the different binding sites are presented and analyzed. PMID:19075645

  13. Nucleoside Diphosphate Sugar-Starch Glucosyl Transferase Activity of wx Starch Granules 1

    PubMed Central

    Nelson, Oliver E.; Chourey, Prem S.; Chang, Ming Tu

    1978-01-01

    Starch granule preparations from the endosperm tissue of all waxy maize (Zea mays L.) mutants tested have low and approximately equal capability to incorporate glucose from adenosine diphosphate glucose into starch. As the substrate concentration is reduced, however, the activity of waxy preparations relative to nonmutant increases until, at the lowest substrate concentration utilized (0.1 μM), the activity of the waxy preparations is nearly equal to that of the nonmutant preparation. The apparent Km (adenosine diphosphate glucose) for starch granule preparations from wx-C/wx-C/wx-C endosperms was 7.1 × 10−5 M, which is compared to 3 × 10−3 M for preparations from nonwaxy endosperms. Starch granule preparations from three other waxy mutants of independent mutational origin have levels of enzymic activity approximately equal to wx-C at a given substrate concentration giving rise to similar apparent Km estimates. We conclude that there is in maize endosperm starch granules a second starch granule-bound glycosyl transferase, whose presence is revealed when mutation eliminates activity of the more active glucosyl transferase catalyzing the same reaction. PMID:16660522

  14. PROTEIN TARGETING TO STARCH Is Required for Localising GRANULE-BOUND STARCH SYNTHASE to Starch Granules and for Normal Amylose Synthesis in Arabidopsis

    PubMed Central

    Seung, David; Soyk, Sebastian; Coiro, Mario; Maier, Benjamin A.; Eicke, Simona; Zeeman, Samuel C.

    2015-01-01

    The domestication of starch crops underpinned the development of human civilisation, yet we still do not fully understand how plants make starch. Starch is composed of glucose polymers that are branched (amylopectin) or linear (amylose). The amount of amylose strongly influences the physico-chemical behaviour of starchy foods during cooking and of starch mixtures in non-food manufacturing processes. The GRANULE-BOUND STARCH SYNTHASE (GBSS) is the glucosyltransferase specifically responsible for elongating amylose polymers and was the only protein known to be required for its biosynthesis. Here, we demonstrate that PROTEIN TARGETING TO STARCH (PTST) is also specifically required for amylose synthesis in Arabidopsis. PTST is a plastidial protein possessing an N-terminal coiled coil domain and a C-terminal carbohydrate binding module (CBM). We discovered that Arabidopsis ptst mutants synthesise amylose-free starch and are phenotypically similar to mutants lacking GBSS. Analysis of granule-bound proteins showed a dramatic reduction of GBSS protein in ptst mutant starch granules. Pull-down assays with recombinant proteins in vitro, as well as immunoprecipitation assays in planta, revealed that GBSS physically interacts with PTST via a coiled coil. Furthermore, we show that the CBM domain of PTST, which mediates its interaction with starch granules, is also required for correct GBSS localisation. Fluorescently tagged Arabidopsis GBSS, expressed either in tobacco or Arabidopsis leaves, required the presence of Arabidopsis PTST to localise to starch granules. Mutation of the CBM of PTST caused GBSS to remain in the plastid stroma. PTST fulfils a previously unknown function in targeting GBSS to starch. This sheds new light on the importance of targeting biosynthetic enzymes to sub-cellular sites where their action is required. Importantly, PTST represents a promising new gene target for the biotechnological modification of starch composition, as it is exclusively involved

  15. Doubling Power Output of Starch Biobattery Treated by the Most Thermostable Isoamylase from an Archaeon Sulfolobus tokodaii

    PubMed Central

    Cheng, Kun; Zhang, Fei; Sun, Fangfang; Chen, Hongge; Percival Zhang, Y-H

    2015-01-01

    Biobattery, a kind of enzymatic fuel cells, can convert organic compounds (e.g., glucose, starch) to electricity in a closed system without moving parts. Inspired by natural starch metabolism catalyzed by starch phosphorylase, isoamylase is essential to debranch alpha-1,6-glycosidic bonds of starch, yielding linear amylodextrin – the best fuel for sugar-powered biobattery. However, there is no thermostable isoamylase stable enough for simultaneous starch gelatinization and enzymatic hydrolysis, different from the case of thermostable alpha-amylase. A putative isoamylase gene was mined from megagenomic database. The open reading frame ST0928 from a hyperthermophilic archaeron Sulfolobus tokodaii was cloned and expressed in E. coli. The recombinant protein was easily purified by heat precipitation at 80 oC for 30 min. This enzyme was characterized and required Mg2+ as an activator. This enzyme was the most stable isoamylase reported with a half lifetime of 200 min at 90 oC in the presence of 0.5 mM MgCl2, suitable for simultaneous starch gelatinization and isoamylase hydrolysis. The cuvett-based air-breathing biobattery powered by isoamylase-treated starch exhibited nearly doubled power outputs than that powered by the same concentration starch solution, suggesting more glucose 1-phosphate generated. PMID:26289411

  16. Diverse effects of two allosteric inhibitors on the phosphorylation state of glycogen phosphorylase in hepatocytes.

    PubMed Central

    Latsis, Theodore; Andersen, Birgitte; Agius, Loranne

    2002-01-01

    Two distinct allosteric inhibitors of glycogen phosphorylase, 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and CP-91149 (an indole-2-carboxamide), were investigated for their effects on the phosphorylation state of the enzyme in hepatocytes in vitro. CP-91149 induced inactivation (dephosphorylation) of phosphorylase in the absence of hormones and partially counteracted the phosphorylation caused by glucagon. Inhibition of glycogenolysis by CP-91149 can be explained by dephosphorylation of phosphorylase a. This was associated with activation of glycogen synthase and stimulation of glycogen synthesis. DAB, in contrast, induced a small degree of phosphorylation of phosphorylase. This was associated with inactivation of glycogen synthase and inhibition of glycogen synthesis. Despite causing phosphorylation (activation) of phosphorylase, DAB is a very potent inhibitor of glycogenolysis in both the absence and presence of glucagon. This is explained by allosteric inhibition of phosphorylase a, which overrides the increase in activation state. In conclusion, two potent phosphorylase inhibitors exert different effects on glycogen metabolism in intact hepatocytes as a result of opposite effects on the phosphorylation state of both phosphorylase and glycogen synthase. PMID:12186629

  17. Computer-generated Model of Purine Nucleoside Phosphorylase (PNP)

    NASA Technical Reports Server (NTRS)

    1987-01-01

    Purine Nucleoside Phosphorylase (PNP) is an important target enzyme for the design of anti-cancer and immunosuppressive drugs. Bacterial PNP, which is slightly different from the human enzyme, is used to synthesize chemotherapuautic agents. Knowledge of the three-dimensional structure of the bacterial PNP molecule is useful in efforts to engineer different types of PNP enzymes, that can be used to produce new chemotherapeutic agents. This picture shows a computer model of bacterial PNP, which looks a lot like a display of colorful ribbons. Principal Investigator was Charles Bugg.

  18. Compound heterozygous mutations of TYMP as underlying causes of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE).

    PubMed

    Suh, Bum Chun; Jeong, Ha-Neul; Yoon, Byung Suk; Park, Ji Hoon; Kim, Hye Jin; Park, Sun Wha; Hwang, Jung Hee; Choi, Byung-Ok; Chung, Ki Wha

    2013-07-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), an autosomal recessive multiorgan disease, frequently associated with mutations in the thymidine phosphorylase (TYMP) gene. TYMP encodes thymidine phosphorylase (TP), which has an essential role in the nucleotide salvage pathway for mitochondrial DNA (mtDNA) replication. This study reports an MNGIE patient with novel compound heterozygous missense mutations (Thr151Pro and Leu270Pro) in TYMP. Each mutation was inherited from one parent. Neither mutation was found in the controls and the mutation sites were well conserved between different species. Neither large deletion nor causative point mutations were found in the mtDNA. The patient presented with MNGIE symptoms, including gastrointestinal discomfort, external ophthalmoplegia, pigmentary retinopathy and demyelinating type diffuse sensory motor polyneuropathy. The patient demonstrated an early-onset but mild phenotype, with 9.6% TP activity; therefore, patients with these compound heterozygous mutations may exhibit a mild phenotype with a variable onset age according to TP activity level. PMID:23685548

  19. Starch nanoparticles: a review.

    PubMed

    Le Corre, Déborah; Bras, Julien; Dufresne, Alain

    2010-05-10

    Starch is a natural, renewable, and biodegradable polymer produced by many plants as a source of stored energy. It is the second most abundant biomass material in nature. The starch structure has been under research for years, and because of its complexity, an universally accepted model is still lacking (Buleon, A.; et al. Int. J. Biol. Macromol. 1998, 23, 85-112). However, the predominant model for starch is a concentric semicrystalline multiscale structure that allows the production of new nanoelements: (i) starch nanocrystals resulting from the disruption of amorphous domains from semicrystalline granules by acid hydrolysis and (ii) starch nanoparticles produced from gelatinized starch. This paper intends to give a clear overview of starch nanoparticle preparation, characterization, properties, and applications. Recent studies have shown that they could be used as fillers to improve mechanical and barrier properties of biocomposites. Their use for industrial packaging, continuously looking for innovative solutions for efficient and sustainable systems, is being investigated. Therefore, recently, starch nanoparticles have been the focus of an exponentially increasing number of works devoted to develop biocomposites by blending starch nanoparticles with different biopolymeric matrices. To our knowledge, this topic has never been reviewed, despite several published strategies and conclusions. PMID:20405913

  20. Structural bases for N-glycan processing by mannoside phosphorylase

    PubMed Central

    Ladevèze, Simon; Cioci, Gianluca; Roblin, Pierre; Mourey, Lionel; Tranier, Samuel; Potocki-Véronèse, Gabrielle

    2015-01-01

    The first crystal structure of Uhgb_MP, a β-1,4-mannopyranosyl-chitobiose phosphorylase belonging to the GH130 family which is involved in N-glycan degradation by human gut bacteria, was solved at 1.85 Å resolution in the apo form and in complex with mannose and N-acetylglucosamine. SAXS and crystal structure analysis revealed a hexameric structure, a specific feature of GH130 enzymes among other glycoside phosphorylases. Mapping of the −1 and +1 subsites in the presence of phosphate confirmed the conserved Asp104 as the general acid/base catalytic residue, which is in agreement with a single-step reaction mechanism involving Man O3 assistance for proton transfer. Analysis of this structure, the first to be solved for a member of the GH130_2 subfamily, revealed Met67, Phe203 and the Gly121–Pro125 loop as the main determinants of the specificity of Uhgb_MP and its homologues towards the N-glycan core oligosaccharides and mannan, and the molecular bases of the key role played by GH130 enzymes in the catabolism of dietary fibre and host glycans. PMID:26057673

  1. 1,2-β-Oligoglucan Phosphorylase from Listeria innocua

    PubMed Central

    Abe, Koichi; Nakai, Hiroyuki; Taguchi, Hayao; Kitaoka, Motomitsu

    2014-01-01

    We characterized recombinant Lin1839 protein (Lin1839r) belonging to glycoside hydrolase family 94 from Listeria innocua. Lin1839r catalyzed the synthesis of a series of 1,2-β-oligoglucans (Sopn: n denotes degree of polymerization) using sophorose (Sop2) as the acceptor and α-d-glucose 1-phosphate (Glc1P) as the donor. Lin1839r recognized glucose as a very weak acceptor substrate to form polymeric 1,2-β-glucan. The degree of polymerization of the 1,2-β-glucan gradually decreased with long-term incubation to generate a series of Sopns. Kinetic analysis of the phosphorolytic reaction towards sophorotriose revealed that Lin1839r followed a sequential Bi Bi mechanism. The kinetic parameters of the phosphorolysis of sophorotetraose and sophoropentaose were similar to those of sophorotriose, although the enzyme did not exhibit significant phosphorolytic activity on Sop2. These results indicate that the Lin1839 protein is a novel inverting phosphorylase that catalyzes reversible phosphorolysis of 1,2-β-glucan with a degree of polymerization of ≥3. We propose 1,2-β-oligoglucan: phosphate α-glucosyltransferase as the systematic name and 1,2-β-oligoglucan phosphorylase as the short name for this Lin1839 protein. PMID:24647662

  2. Cloning and orientation of the gene encoding polynucleotide phosphorylase in Escherichia coli.

    PubMed Central

    Crofton, S; Dennis, P P

    1983-01-01

    Mutations which affect the activity of polynucleotide phosphorylase (PNPase) map near 69 min on the bacterial chromosome. This region of the chromosome has been cloned by inserting the kanamycin-resistant transposon Tn5 near the argG and mtr loci at 68.5 min. Large SalI fragments of chromosomal DNA containing the Tn5 element were inserted into pBR322, and selection was made for kanamycin-resistant recombinant plasmids. Two of these plasmids were found to produce high levels of PNPase activity in both wild-type and host strains lacking PNPase activity. The pnp gene was further localized and subcloned on a 4.8 kilobase HindIII-EcoRI fragment. This fragment was shown to encode an 84,000-molecular weight protein which comigrated with purified PNPase during sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The orientation of the pnp gene was determined by insertion of Tn5 into the 4.8 kilobase fragment cloned in pBR322. Some of the insertions had lost the ability to elevate the level of PNPase activity in the host bacterium. Restriction mapping of the positions of the Tn5 insertions and analysis of plasmid-encoded polypeptides in UV-irradiated maxi-cells indicated that the pnp gene is oriented in the counterclockwise direction on the bacterial chromosome. Images PMID:6300041

  3. Docking and small angle X-ray scattering studies of purine nucleoside phosphorylase.

    PubMed

    Filgueira de Azevedo, Walter; dos Santos, Giovanni César; dos Santos, Denis Marangoni; Olivieri, Johnny Rizzieri; Canduri, Fernanda; Silva, Rafael Guimarães; Basso, Luiz Augusto; Renard, Gaby; da Fonseca, Isabel Osório; Mendes, Maria Anita; Palma, Mário Sérgio; Santos, Diógenes Santiago

    2003-10-01

    Docking simulations have been used to assess protein complexes with some success. Small angle X-ray scattering (SAXS) is a well-established technique to investigate protein spatial configuration. This work describes the integration of geometric docking with SAXS to investigate the quaternary structure of recombinant human purine nucleoside phosphorylase (PNP). This enzyme catalyzes the reversible phosphorolysis of N-ribosidic bonds of purine nucleosides and deoxynucleosides. A genetic deficiency due to mutations in the gene encoding for PNP causes gradual decrease in T-cell immunity. Inappropriate activation of T-cells has been implicated in several clinically relevant human conditions such as transplant rejection, rheumatoid arthritis, lupus, and T-cell lymphomas. PNP is therefore a target for inhibitor development aiming at T-cell immune response modulation and has been submitted to extensive structure-based drug design. The present analysis confirms the trimeric structure observed in the crystal. The potential application of the present procedure to other systems is discussed. PMID:13679062

  4. Starch Metabolism in Arabidopsis

    PubMed Central

    Streb, Sebastian; Zeeman, Samuel C.

    2012-01-01

    Starch is the major non-structural carbohydrate in plants. It serves as an important store of carbon that fuels plant metabolism and growth when they are unable to photosynthesise. This storage can be in leaves and other green tissues, where it is degraded during the night, or in heterotrophic tissues such as roots, seeds and tubers, where it is stored over longer time periods. Arabidopsis accumulates starch in many of its tissues, but mostly in its leaves during the day. It has proven to be a powerful genetic system for discovering how starch is synthesised and degraded, and new proteins and processes have been discovered. Such work has major significance for our starch crops, whose yield and quality could be improved by the application of this knowledge. Research into Arabidopsis starch metabolism has begun to reveal how its daily turnover is integrated into the rest of metabolism and adapted to the environmental conditions. Furthermore, Arabidopsis mutant lines deficient in starch metabolism have been employed as tools to study other biological processes ranging from sugar sensing to gravitropism and flowering time control. This review gives a detailed account of the use of Arabidopsis to study starch metabolism. It describes the major discoveries made and presents an overview of our understanding today, together with some as-yet unresolved questions. PMID:23393426

  5. Characterization of starch nanoparticles

    NASA Astrophysics Data System (ADS)

    Szymońska, J.; Targosz-Korecka, M.; Krok, F.

    2009-01-01

    Nanomaterials already attract great interest because of their potential applications in technology, food science and medicine. Biomaterials are biodegradable and quite abundant in nature, so they are favoured over synthetic polymer based materials. Starch as a nontoxic, cheap and renewable raw material is particularly suitable for preparation of nanoparticles. In the paper, the structure and some physicochemical properties of potato and cassava starch particles of the size between 50 to 100 nm, obtained by mechanical treatment of native starch, were presented. We demonstrated, with the aim of the Scanning Electron Microscopy (SEM) and the non-contact Atomic Force Microscopy (nc-AFM), that the shape and dimensions of the obtained nanoparticles both potato and cassava starch fit the blocklets - previously proposed as basic structural features of native starch granules. This observation was supported by aqueous solubility and swelling power of the particles as well as their iodine binding capacity similar to those for amylopectin-type short branched polysaccharide species. Obtained results indicated that glycosidic bonds of the branch linkage points in the granule amorphous lamellae might be broken during the applied mechanical treatment. Thus the released amylopectin clusters could escape out of the granules. The starch nanoparticles, for their properties qualitatively different from those of native starch granules, could be utilized in new applications.

  6. L+-lactic acid production from starch by a novel amylolytic Lactococcus lactis subsp. lactis B84.

    PubMed

    Petrov, Kaloyan; Urshev, Zoltan; Petrova, Penka

    2008-06-01

    A new Lactococcus lactis subsp. lactis B84, capable of utilizing starch as a sole carbon source and producing L(+)-lactate, was isolated from spontaneously fermented rye sourdough. Aiming at maximum lactic acid productivity, the components of the media and the cultivation conditions were varied. In MRS-starch medium (with absence of yeast and meat extracts), at 33 degrees C, agitation 200 rpm and pH 6.0 for 6 days complete starch hydrolysis occurred and 5.5 gl(-1) lactic acid were produced from 18 gl(-1) starch. The identification of strain B84 was based on genetic criteria. Amplified ribosomal DNA restriction analysis (ARDRA), PCR with species-specific primers and sequencing of the 16S rDNA proved its species affiliation. Four genes for enzymes, involved in starch degradation were detected in B84 genome: amyL, amyY, glgP and apu, coding cytoplasmic and extracellular alpha-amylases, glycogen phosphorylase and amylopullulanase, respectively. Reverse transcription PCR experiments showed that both genes, encoding alpha-amylases (amyL and amyY) were expressed into mRNAs, whereas apu and glgP were not. Amylase activity assay was performed at different pH and temperatures. The cell-bond amylase proved to be the key enzyme, involved in the starch hydrolysis with maximum activity at 45 degrees C and pH 5.4. PMID:18456109

  7. Computer Simulations Reveal Substrate Specificity of Glycosidic Bond Cleavage in Native and Mutant Human Purine Nucleoside Phosphorylase.

    PubMed

    Isaksen, Geir Villy; Hopmann, Kathrin Helen; Åqvist, Johan; Brandsdal, Bjørn Olav

    2016-04-12

    Purine nucleoside phosphorylase (PNP) catalyzes the reversible phosphorolysis of purine ribonucleosides and 2'-deoxyribonucleosides, yielding the purine base and (2'-deoxy)ribose 1-phosphate as products. While this enzyme has been extensively studied, several questions with respect to the catalytic mechanism have remained largely unanswered. The role of the phosphate and key amino acid residues in the catalytic reaction as well as the purine ring protonation state is elucidated using density functional theory calculations and extensive empirical valence bond (EVB) simulations. Free energy surfaces for adenosine, inosine, and guanosine are fitted to ab initio data and yield quantitative agreement with experimental data when the surfaces are used to model the corresponding enzymatic reactions. The cognate substrates 6-aminopurines (inosine and guanosine) interact with PNP through extensive hydrogen bonding, but the substrate specificity is found to be a direct result of the electrostatic preorganization energy along the reaction coordinate. Asn243 has previously been identified as a key residue providing substrate specificity. Mutation of Asn243 to Asp has dramatic effects on the substrate specificity, making 6-amino- and 6-oxopurines equally good as substrates. The principal effect of this particular mutation is the change in the electrostatic preorganization energy between the native enzyme and the Asn243Asp mutant, clearly favoring adenosine over inosine and guanosine. Thus, the EVB simulations show that this particular mutation affects the electrostatic preorganization of the active site, which in turn can explain the substrate specificity. PMID:26985580

  8. Biocatalytic production of novel glycolipids with cellodextrin phosphorylase.

    PubMed

    Tran, Hai Giang; Desmet, Tom; Saerens, Karen; Waegeman, Hendrik; Vandekerckhove, Stéphanie; D'hooghe, Matthias; Van Bogaert, Inge; Soetaert, Wim

    2012-07-01

    Glycolipids have gained increasing attention as natural surfactants with a beneficial environmental profile. They are typically produced by fermentation, which only gives access to a limited number of structures. Here we describe the biocatalytic production of novel glycolipids with the cellodextrin phosphorylase from Clostridium stercorarium. This enzyme was found to display a broad donor and acceptor specificity, allowing the synthesis of five different products. Indeed, using either α-glucose 1-phosphate or α-galactose 1-phosphate as glycosyl donor, sophorolipid as well as glucolipid could be efficiently glycosylated. The transfer of a glucosyl moiety afforded a mixture of products that precipitated from the solution, resulting in near quantitative yields. The transfer of a galactosyl moiety, in contrast, generated a single product that remained in solution at thermodynamic equilibrium. These glycolipids not only serve as a new class of biosurfactants, but could also have applications in the pharmaceutical and nanomaterials industries. PMID:22000964

  9. Thymidine Phosphorylase is Angiogenic and Promotes Tumor Growth

    NASA Astrophysics Data System (ADS)

    Moghaddam, Amir; Zhang, Hua-Tang; Fan, Tai-Ping D.; Hu, De-En; Lees, Vivien C.; Turley, Helen; Fox, Stephen B.; Gatter, Kevin C.; Harris, Adrian L.; Bicknell, Roy

    1995-02-01

    Platelet-derived endothelial cell growth factor was previously identified as the sole angiogenic activity present in platelets; it is now known to be thymidine phosphorylase (TP). The effect of TP on [methyl-^3H]thymidine uptake does not arise from de novo DNA synthesis and the molecule is not a growth factor. Despite this, TP is strongly angiogenic in a rat sponge and freeze-injured skin graft model. Neutralizing antibodies and site-directed mutagenesis confirmed that the enzyme activity of TP is a condition for its angiogenic activity. The level of TP was found to be elevated in human breast tumors compared to normal breast tissue (P < 0.001). Overexpression of TP in MCF-7 breast carcinoma cells had no effect on growth in vitro but markedly enhanced tumor growth in vivo. These data and the correlation of expression in tumors with malignancy identify TP as a target for antitumor strategies.

  10. The Starch Granule-Associated Protein EARLY STARVATION1 Is Required for the Control of Starch Degradation in Arabidopsis thaliana Leaves[OPEN

    PubMed Central

    Feike, Doreen; Seung, David; Graf, Alexander; Bischof, Sylvain; Ellick, Tamaryn; Coiro, Mario; Soyk, Sebastian; Eicke, Simona; Mettler-Altmann, Tabea; Lu, Kuan Jen; Trick, Martin; Zeeman, Samuel C.

    2016-01-01

    To uncover components of the mechanism that adjusts the rate of leaf starch degradation to the length of the night, we devised a screen for mutant Arabidopsis thaliana plants in which starch reserves are prematurely exhausted. The mutation in one such mutant, named early starvation1 (esv1), eliminates a previously uncharacterized protein. Starch in mutant leaves is degraded rapidly and in a nonlinear fashion, so that reserves are exhausted 2 h prior to dawn. The ESV1 protein and a similar uncharacterized Arabidopsis protein (named Like ESV1 [LESV]) are located in the chloroplast stroma and are also bound into starch granules. The region of highest similarity between the two proteins contains a series of near-repeated motifs rich in tryptophan. Both proteins are conserved throughout starch-synthesizing organisms, from angiosperms and monocots to green algae. Analysis of transgenic plants lacking or overexpressing ESV1 or LESV, and of double mutants lacking ESV1 and another protein necessary for starch degradation, leads us to propose that these proteins function in the organization of the starch granule matrix. We argue that their misexpression affects starch degradation indirectly, by altering matrix organization and, thus, accessibility of starch polymers to starch-degrading enzymes. PMID:27207856

  11. The Starch Granule-Associated Protein EARLY STARVATION1 Is Required for the Control of Starch Degradation in Arabidopsis thaliana Leaves.

    PubMed

    Feike, Doreen; Seung, David; Graf, Alexander; Bischof, Sylvain; Ellick, Tamaryn; Coiro, Mario; Soyk, Sebastian; Eicke, Simona; Mettler-Altmann, Tabea; Lu, Kuan Jen; Trick, Martin; Zeeman, Samuel C; Smith, Alison M

    2016-06-01

    To uncover components of the mechanism that adjusts the rate of leaf starch degradation to the length of the night, we devised a screen for mutant Arabidopsis thaliana plants in which starch reserves are prematurely exhausted. The mutation in one such mutant, named early starvation1 (esv1), eliminates a previously uncharacterized protein. Starch in mutant leaves is degraded rapidly and in a nonlinear fashion, so that reserves are exhausted 2 h prior to dawn. The ESV1 protein and a similar uncharacterized Arabidopsis protein (named Like ESV1 [LESV]) are located in the chloroplast stroma and are also bound into starch granules. The region of highest similarity between the two proteins contains a series of near-repeated motifs rich in tryptophan. Both proteins are conserved throughout starch-synthesizing organisms, from angiosperms and monocots to green algae. Analysis of transgenic plants lacking or overexpressing ESV1 or LESV, and of double mutants lacking ESV1 and another protein necessary for starch degradation, leads us to propose that these proteins function in the organization of the starch granule matrix. We argue that their misexpression affects starch degradation indirectly, by altering matrix organization and, thus, accessibility of starch polymers to starch-degrading enzymes. PMID:27207856

  12. Enzymatic acylation of starch.

    PubMed

    Alissandratos, Apostolos; Halling, Peter J

    2012-07-01

    Starch a cheap, abundant and renewable natural material has been chemically modified for many years. The popular modification acylation has been used to adjust rheological properties as well as deliver polymers with internal plasticizers and other potential uses. However the harsh reaction conditions required to produce these esters may limit their use, especially in sensitive applications (foods, pharmaceuticals, etc.). The use of enzymes to catalyse acylation may provide a suitable alternative due to high selectivities and mild reaction conditions. Traditional hydrolase-catalysed synthesis in non-aqueous apolar media is hard due to lack of polysaccharide solubility. However, acylated starch derivatives have recently been successfully produced in other non-conventional systems: (a) surfactant-solubilised subtilisin and suspended amylose in organic media; (b) starch nanoparticles dispersed in organic medium with immobilised lipase; (c) aqueous starch gels with lipase and dispersed fatty acids. We attempt a systematic review that draws parallels between the seemingly unrelated approaches described. PMID:22138593

  13. Resistant starches and health.

    PubMed

    Kendall, Cyril W C; Emam, Azadeh; Augustin, Livia S A; Jenkins, David J A

    2004-01-01

    It was initially hypothesized that resistant starches, i.e., starch that enters the colon, would have protective effects on chronic colonic diseases, including reduction of colon cancer risk and in the treatment of ulcerative colitis. Recent studies have confirmed the ability of resistant starch to increase fecal bulk, increase the molar ratio of butyrate in relation to other short-chain fatty acids, and dilute fecal bile acids. However the ability of resistant starch to reduce luminal concentrations of compounds that are damaging to the colonic mucosa, including fecal ammonia, phenols, and N-nitroso compounds, still requires clear demonstration. As such, the effectiveness of resistant starch in preventing or treating colonic diseases remains to be assessed. Nevertheless, there is a fraction of what has been termed resistant (RS1) starch, which enters the colon and acts as slowly digested or lente carbohydrate in the small intestine. Foods in this class are low glycemic index and have been shown to reduce the risk of chronic disease. They have been associated with systemic physiological effects such as reduced postprandial insulin levels and higher HDL cholesterol levels. Consumption of low glycemic index foods has been shown to be related to reductions in risk of coronary heart disease and Type 2 diabetes. Type 2 diabetes has in turn been related to a higher risk of colon cancer. If carbohydrates have a protective role in colon cancer prevention this may lie partly in the systemic effects of low glycemic index foods. The colonic advantages of different carbohydrates, varying in their glycemic index and resistant starch content, therefore, remain to be determined. However, as recent positive research findings continue to mount, there is reason for optimism over the possible health advantages of those resistant starches, which are slowly digested in the small intestine. PMID:15287678

  14. Crystal Structure and Substrate Recognition of Cellobionic Acid Phosphorylase, Which Plays a Key Role in Oxidative Cellulose Degradation by Microbes*

    PubMed Central

    Nam, Young-Woo; Nihira, Takanori; Arakawa, Takatoshi; Saito, Yuka; Kitaoka, Motomitsu; Nakai, Hiroyuki; Fushinobu, Shinya

    2015-01-01

    The microbial oxidative cellulose degradation system is attracting significant research attention after the recent discovery of lytic polysaccharide mono-oxygenases. A primary product of the oxidative and hydrolytic cellulose degradation system is cellobionic acid (CbA), the aldonic acid form of cellobiose. We previously demonstrated that the intracellular enzyme belonging to glycoside hydrolase family 94 from cellulolytic fungus and bacterium is cellobionic acid phosphorylase (CBAP), which catalyzes reversible phosphorolysis of CbA into glucose 1-phosphate and gluconic acid (GlcA). In this report, we describe the biochemical characterization and the three-dimensional structure of CBAP from the marine cellulolytic bacterium Saccharophagus degradans. Structures of ligand-free and complex forms with CbA, GlcA, and a synthetic disaccharide product from glucuronic acid were determined at resolutions of up to 1.6 Å. The active site is located near the dimer interface. At subsite +1, the carboxylate group of GlcA and CbA is recognized by Arg-609 and Lys-613. Additionally, one residue from the neighboring protomer (Gln-190) is involved in the carboxylate recognition of GlcA. A mutational analysis indicated that these residues are critical for the binding and catalysis of the aldonic and uronic acid acceptors GlcA and glucuronic acid. Structural and sequence comparisons with other glycoside hydrolase family 94 phosphorylases revealed that CBAPs have a unique subsite +1 with a distinct amino acid residue conservation pattern at this site. This study provides molecular insight into the energetically efficient metabolic pathway of oxidized sugars that links the oxidative cellulolytic pathway to the glycolytic and pentose phosphate pathways in cellulolytic microbes. PMID:26041776

  15. Centrifugally spun starch-based fibers from amylopectin rich starches.

    PubMed

    Li, Xianglong; Chen, Huanhuan; Yang, Bin

    2016-02-10

    Centrifugal spinning and electrospinning have proved to be effective techniques for fabricating micro-to-nanofibers. However, starches of amylopectin content above 65% cannot be fabricated to fiber by electrospinning. This paper is focus on the centrifugal spinnability of amylopectin rich starches. We investigated the amylopectin content of starches by Dual-wavelength colorimetry, studied the rheological properties of starch dopes to determine entanglement concentration (ce) by rotary rheometer. Results indicated that amylopectin rich native corn and potato starches, which with amylopectin content higher than 65%, were suitable for centrifugal spinning to micro-to-nanofibers. Additionally, starch-based fibers were successfully fabricated from the amylose rich corn starch as well. Rheological studies showed that the entanglement concentration (ce) of starch solution was crucial for successful centrifugal spinning. PMID:26686151

  16. The crystal structure of Escherichia coli maltodextrin phosphorylase provides an explanation for the activity without control in this basic archetype of a phosphorylase.

    PubMed Central

    Watson, K A; Schinzel, R; Palm, D; Johnson, L N

    1997-01-01

    In animals, glycogen phosphorylase (GP) exists in an inactive (T state) and an active (R state) equilibrium that can be altered by allosteric effectors or covalent modification. In Escherichia coli, the activity of maltodextrin phosphorylase (MalP) is controlled by induction at the level of gene expression, and the enzyme exhibits no regulatory properties. We report the crystal structure of E. coli maltodextrin phosphorylase refined to 2.4 A resolution. The molecule consists of a dimer with 796 amino acids per monomer, with 46% sequence identity to the mammalian enzyme. The overall structure of MalP shows a similar fold to GP and the catalytic sites are highly conserved. However, the relative orientation of the two subunits in E. coli MalP is different from both the T and R state GP structures, and there are significant changes at the subunit-subunit interfaces. The sequence changes result in loss of each of the control sites present in rabbit muscle GP. As a result of the changes at the subunit interface, the 280s loop, which in T state GP acts as a gate to control access to the catalytic site, is held in an open conformation in MalP. The open access to the conserved catalytic site provides an explanation for the activity without control in this basic archetype of a phosphorylase. PMID:9009262

  17. Neighboring Group Participation in the Transition State of Human Purine Nucleoside Phosphorylase

    SciTech Connect

    Murkin,A.; Birck, M.; Rinaldo-Matthis, A.; Shi, W.; Taylor, E.; Almo, S.; Schramm, V.

    2007-01-01

    The X-ray crystal structures of human purine nucleoside phosphorylase (PNP) with bound inosine or transition-state analogues show His{sup 257} within hydrogen bonding distance of the 5'-hydroxyl. The mutants His257Phe, His257Gly, and His257Asp exhibited greatly decreased affinity for Immucillin-H (ImmH), binding this mimic of an early transition state as much as 370-fold (K{sub m}/K{sub i}) less tightly than native PNP. In contrast, these mutants bound DADMe-ImmH, a mimic of a late transition state, nearly as well as the native enzyme. These results indicate that His{sup 257} serves an important role in the early stages of transition-state formation. Whereas mutation of His{sup 257} resulted in little variation in the PNP{center_dot}DADMe-ImmH{center_dot}SO{sub 4} structures, His257Phe{center_dot}ImmH{center_dot}PO{sub 4} showed distortion at the 5'-hydroxyl, indicating the importance of H-bonding in positioning this group during progression to the transition state. Binding isotope effect (BIE) and kinetic isotope effect (KIE) studies of the remote 5'-{sup 3}H for the arsenolysis of inosine with native PNP revealed a BIE of 1.5% and an unexpectedly large intrinsic KIE of 4.6%. This result is interpreted as a moderate electronic distortion toward the transition state in the Michaelis complex with continued development of a similar distortion at the transition state. The mutants His257Phe, His257Gly, and His257Asp altered the 5'-{sup 3}H intrinsic KIE to -3, -14, and 7%, respectively, while the BIEs contributed 2, 2, and -2%, respectively. These surprising results establish that forces in the Michaelis complex, reported by the BIEs, can be reversed or enhanced at the transition state.

  18. Liver as a source for thymidine phosphorylase replacement in mitochondrial neurogastrointestinal encephalomyopathy.

    PubMed

    Boschetti, Elisa; D'Alessandro, Roberto; Bianco, Francesca; Carelli, Valerio; Cenacchi, Giovanna; Pinna, Antonio D; Del Gaudio, Massimo; Rinaldi, Rita; Stanghellini, Vincenzo; Pironi, Loris; Rhoden, Kerry; Tugnoli, Vitaliano; Casali, Carlo; De Giorgio, Roberto

    2014-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive mitochondrial disease associated with mutations in the nuclear TYMP gene. As a result, the thymidine phosphorylase (TP) enzyme activity is markedly reduced leading to toxic accumulation of thymidine and therefore altered mitochondrial DNA. MNGIE is characterized by severe gastrointestinal dysmotility, neurological impairment, reduced life expectancy and poor quality of life. There are limited therapeutic options for MNGIE. In the attempt to restore TP activity, allogenic hematopoietic stem cell transplantation has been used as cellular source of TP. The results of this approach on ∼ 20 MNGIE patients showed gastrointestinal and neurological improvement, although the 5-year mortality rate is about 70%. In this study we tested whether the liver may serve as an alternative source of TP. We investigated 11 patients (7M; 35-55 years) who underwent hepatic resection for focal disorders. Margins of normal liver tissue were processed to identify, quantify and localize the TP protein by Western Blot, ELISA, and immunohistochemistry, and to evaluate TYMP mRNA expression by qPCR. Western Blot identified TP in liver with a TP/GAPDH ratio of 0.9 ± 0.5. ELISA estimated TP content as 0.5 ± 0.07 ng/μg of total protein. TP was identified in both nuclei and cytoplasm of hepatocytes and sinusoidal lining cells. Finally, TYMP mRNA was expressed in the liver. Overall, our study demonstrates that the liver is an important source of TP. Orthotopic liver transplantation may be considered as a therapeutic alternative for MNGIE patients. PMID:24802030

  19. Liver as a Source for Thymidine Phosphorylase Replacement in Mitochondrial Neurogastrointestinal Encephalomyopathy

    PubMed Central

    Boschetti, Elisa; D’Alessandro, Roberto; Bianco, Francesca; Carelli, Valerio; Cenacchi, Giovanna; Pinna, Antonio D.; Gaudio, Massimo Del; Rinaldi, Rita; Stanghellini, Vincenzo; Pironi, Loris; Rhoden, Kerry; Tugnoli, Vitaliano; Casali, Carlo; De Giorgio, Roberto

    2014-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive mitochondrial disease associated with mutations in the nuclear TYMP gene. As a result, the thymidine phosphorylase (TP) enzyme activity is markedly reduced leading to toxic accumulation of thymidine and therefore altered mitochondrial DNA. MNGIE is characterized by severe gastrointestinal dysmotility, neurological impairment, reduced life expectancy and poor quality of life. There are limited therapeutic options for MNGIE. In the attempt to restore TP activity, allogenic hematopoietic stem cell transplantation has been used as cellular source of TP. The results of this approach on ∼20 MNGIE patients showed gastrointestinal and neurological improvement, although the 5-year mortality rate is about 70%. In this study we tested whether the liver may serve as an alternative source of TP. We investigated 11 patients (7M; 35–55 years) who underwent hepatic resection for focal disorders. Margins of normal liver tissue were processed to identify, quantify and localize the TP protein by Western Blot, ELISA, and immunohistochemistry, and to evaluate TYMP mRNA expression by qPCR. Western Blot identified TP in liver with a TP/GAPDH ratio of 0.9±0.5. ELISA estimated TP content as 0.5±0.07 ng/μg of total protein. TP was identified in both nuclei and cytoplasm of hepatocytes and sinusoidal lining cells. Finally, TYMP mRNA was expressed in the liver. Overall, our study demonstrates that the liver is an important source of TP. Orthotopic liver transplantation may be considered as a therapeutic alternative for MNGIE patients. PMID:24802030

  20. Development of maize starch granules

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize kernels of self-pollinated inbred line B73 harvested on various days after pollination (DAP) were subjected for starch granule development studies. Starch in endosperms was first observed on 6 DAP. A small amount of starch granules (<2% of dry weight) was found in the endosperm on 12 DAP. S...

  1. Immunological detection of degradation intermediates of skeletal-muscle glycogen phosphorylase in vitro and in vivo.

    PubMed Central

    Cookson, E J; Flannery, A V; Cidlowski, J A; Beynon, R J

    1992-01-01

    Over 95% of the pyridoxal phosphate (PLP) in skeletal is bound to one protein, glycogen phosphorylase. This, and the fact that phosphorylase constitutes approx. 5% of the soluble protein in skeletal muscle, introduce the possibility that PLP might be used as a specific label to identify degradation intermediates of the enzyme. In this investigation, we have developed immunological methods, using a monoclonal antibody to PLP and polyclonal antibodies to phosphorylase, to detect degradation intermediates in vitro and in vivo. We have identified a family of degradation intermediates of glycogen phosphorylase in the high-speed-supernatant fraction of mouse skeletal muscle. These peptides react with both types of antibodies and are in the size and concentration range expected for degradation intermediates in a model in which the committed step is followed by rapid clearance of the products. Changes in amounts of degradation intermediates are examined in physiological or pathological conditions in which the rate of degradation of phosphorylase is altered. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:1445274

  2. Comparison of pasting and gel stabilities of waxy and normal starches from potato, maize, and rice with those of a novel waxy cassava starch under thermal, chemical, and mechanical stress.

    PubMed

    Sánchez, Teresa; Dufour, Dominique; Moreno, Isabel Ximena; Ceballos, Hernán

    2010-04-28

    Functional properties of normal and waxy starches from maize, rice, potato, and cassava as well as the modified waxy maize starch COLFLO 67 were compared. The main objective of this study is to position the recently discovered spontaneous mutation for amylose-free cassava starch in relation to the other starches with well-known characteristics. Paste clarity, wavelength of maximum absorption (lambda(max)), pasting properties, swelling power, solubility, and dispersed volume fraction measurements and gel stability (acid and alkaline resistance, shear, refrigeration, and freeze/thaw stability) were evaluated in the different types and sources of starch included in this study. lambda(max) in the waxy cassava starch was reduced considerably in comparison with that of normal cassava starch (535 vs 592 nm). RVA peak viscosity of waxy cassava starch was larger than in normal cassava starch (1119 vs 937 cP) and assumed a position intermediate between the waxy potato and maize starches. Acid, alkaline, and shear stability of waxy cassava starch were similar to normal cassava except for alkaline pH, at which it showed a low effect. Gels from normal root and tuber starches after refrigeration and freeze/thaw had lower syneresis than cereal starches. Gels from waxy starches (except for potato) did not present any syneresis after 5 weeks of storage at 4 degrees C. Waxy cassava starch was the only one not showing any syneresis after 5 weeks of storage at -20 degrees C. Natural waxy cassava starch is, therefore, a promising ingredient to formulate refrigerated or frozen food. PMID:20356303

  3. Vorinostat synergises with capecitabine through upregulation of thymidine phosphorylase

    PubMed Central

    Di Gennaro, E; Piro, G; Chianese, M I; Franco, R; Cintio, A Di; Moccia, T; Luciano, A; de Ruggiero, I; Bruzzese, F; Avallone, A; Arra, C; Budillon, A

    2010-01-01

    Background: Potentiation of anticancer activity of capecitabine is required to improve its therapeutic index. In colorectal cancer (CRC) cells, we evaluated whether the histone deacetylase-inhibitor vorinostat may induce synergistic antitumour effects in combination with capecitabine by modulating the expression of thymidine phosphorylase (TP), a key enzyme in the conversion of capecitabine to 5-florouracil (5-FU), and thymidylate synthase (TS), the target of 5-FU. Methods: Expression of TP and TS was measured by real-time PCR, western blotting and immunohistochemistry. Knockdown of TP was performed by specific small interfering RNA. Antitumour activity of vorinostat was assessed in vitro in combination with the capecitabine active metabolite deoxy-5-fluorouridine (5′-DFUR) according to the Chou and Talay method and by evaluating apoptosis as well as in xenografts-bearing nude mice in combination with capecitabine. Results: Vorinostat induced both in vitro and in vivo upregulation of TP as well as downregulation of TS in cancer cells, but not in ex vivo treated peripheral blood lymphocytes. Combined treatment with vorinostat and 5′-DFUR resulted in a synergistic antiproliferative effect and increased apoptotic cell death in vitro. This latter effect was impaired in cells where TP was knocked. In vivo, vorinostat plus capecitabine potently inhibited tumour growth, increased apoptosis and prolonged survival compared with control or single-agent treatments. Conclusions: Overall, this study suggests that the combination of vorinostat and capecitabine is an innovative antitumour strategy and warrants further clinical evaluation for the treatment of CRC. PMID:21045833

  4. Polynucleotide Phosphorylase Protects Escherichia coli against Oxidative Stress†

    PubMed Central

    Wu, Jinhua; Jiang, Zhe; Liu, Min; Gong, Xin; Wu, Shaohui; Burns, Christopher M.; Li, Zhongwei

    2009-01-01

    Escherichia coli polynucleotide phosphorylase (PNPase) primarily functions in RNA degradation. It is an exoribonuclease and integral component of the multienzyme RNA degradosome complex [Carpousis et al. (1994) Cell 76, 889]. PNPase was previously shown to specifically bind a synthetic RNA containing the oxidative lesion 8-hydroxyguanine (8-oxoG) [Hayakawa et al. (2001) Biochemistry 40, 9977], suggesting a possible role in removing oxidatively damaged RNA. Here we show that PNPase binds to RNA molecules of natural sequence that were oxidatively damaged by treatment with hydrogen peroxide (H2O2) postsynthetically. PNPase bound oxidized RNA with higher affinity than untreated RNA of the same sequence, raising the possibility that it may act against a wide variety of lesions. The importance of such a protective role is illustrated by the observation that, under conditions known to cause oxidative damage to cytoplasmic components, PNPase-deficient cells are less viable than wild-type cells. Further, when challenged with H2O2, PNPase-deficient cells accumulate 8-oxoG in cellular RNA to a greater extent than wild-type cells, suggesting that this RNase functions in minimizing oxidized RNA in vivo. Introducing the pnp gene encoding PNPase rescues defects in growth and RNA quality of the pnp mutant cells. Our results also suggest that protection against oxidative stress is an intrinsic function of PNPase because association with the RNA degradosome or with RNA helicase B (RhlB) is not required. PMID:19219992

  5. The essential role of methylthioadenosine phosphorylase in prostate cancer

    PubMed Central

    Foster, Barbara A.; Karasik, Ellen; Gillard, Bryan; Morrison, Carl; Mohler, James; Phillips, James G.; Smiraglia, Dominic J.

    2016-01-01

    Prostatic epithelial cells secrete high levels of acetylated polyamines into the prostatic lumen. This distinctive characteristic places added strain on the connected pathways, which are forced to increase metabolite production to maintain pools. The methionine salvage pathway recycles the one-carbon unit lost to polyamine biosynthesis back to the methionine cycle, allowing for replenishment of SAM pools providing a mechanism to help mitigate metabolic stress associated with high flux through these pathways. The rate-limiting enzyme involved in this process is methylthioadenosine phosphorylase (MTAP), which, although commonly deleted in many cancers, is protected in prostate cancer. We report near universal retention of MTAP expression in a panel of human prostate cancer cell lines as well as patient samples. Upon metabolic perturbation, prostate cancer cell lines upregulate MTAP and this correlates with recovery of SAM levels. Furthermore, in a mouse model of prostate cancer we find that both normal prostate and diseased prostate maintain higher SAM levels than other tissues, even under increased metabolic stress. Finally, we show that knockdown of MTAP, both genetically and pharmacologically, blocks androgen sensitive prostate cancer growth in vivo. Our findings strongly suggest that the methionine salvage pathway is a major player in homeostatic regulation of metabolite pools in prostate cancer due to their high level of flux through the polyamine biosynthetic pathway. Therefore, this pathway, and specifically the MTAP enzyme, is an attractive therapeutic target for prostate cancer. PMID:26910893

  6. Biological Implications in Cassava for the Production of Amylose-Free Starch: Impact on Root Yield and Related Traits

    PubMed Central

    Karlström, Amanda; Calle, Fernando; Salazar, Sandra; Morante, Nelson; Dufour, Dominique; Ceballos, Hernán

    2016-01-01

    Cassava (Manihot esculenta, Crantz) is an important food security crop, but it is becoming an important raw material for different industrial applications. Cassava is the second most important source of starch worldwide. Novel starch properties are of interest to the starch industry, and one them is the recently identified amylose-free (waxy) cassava starch. Waxy mutants have been found in different crops and have been often associated with a yield penalty. There are ongoing efforts to develop commercial cassava varieties with amylose-free starch. However, little information is available regarding the biological and agronomic implications of starch mutations in cassava, nor in other root and tuber crops. In this study, siblings from eight full-sib families, segregating for the waxy trait, were used to determine if the mutation has implications for yield, dry matter content (DMC) and harvest index in cassava. A total of 87 waxy and 87 wild-type starch genotypes from the eight families were used in the study. The only significant effect of starch type was on DMC (p < 0.01), with waxy clones having a 0.8% lower content than their wild type counterparts. There was no effect of starch type on fresh root yield (FRY), adjusted FRY and harvest index. It is not clear if lower DMC is a pleiotropic effect of the waxy starch mutation or else the result of linked genes introgressed along with the mutation. It is expected that commercial waxy cassava varieties will have competitive FRYs but special efforts will be required to attain adequate DMCs. This study contributes to the limited knowledge available of the impact of starch mutations on the agronomic performance of root and tuber crops. PMID:27242813

  7. Biological Implications in Cassava for the Production of Amylose-Free Starch: Impact on Root Yield and Related Traits.

    PubMed

    Karlström, Amanda; Calle, Fernando; Salazar, Sandra; Morante, Nelson; Dufour, Dominique; Ceballos, Hernán

    2016-01-01

    Cassava (Manihot esculenta, Crantz) is an important food security crop, but it is becoming an important raw material for different industrial applications. Cassava is the second most important source of starch worldwide. Novel starch properties are of interest to the starch industry, and one them is the recently identified amylose-free (waxy) cassava starch. Waxy mutants have been found in different crops and have been often associated with a yield penalty. There are ongoing efforts to develop commercial cassava varieties with amylose-free starch. However, little information is available regarding the biological and agronomic implications of starch mutations in cassava, nor in other root and tuber crops. In this study, siblings from eight full-sib families, segregating for the waxy trait, were used to determine if the mutation has implications for yield, dry matter content (DMC) and harvest index in cassava. A total of 87 waxy and 87 wild-type starch genotypes from the eight families were used in the study. The only significant effect of starch type was on DMC (p < 0.01), with waxy clones having a 0.8% lower content than their wild type counterparts. There was no effect of starch type on fresh root yield (FRY), adjusted FRY and harvest index. It is not clear if lower DMC is a pleiotropic effect of the waxy starch mutation or else the result of linked genes introgressed along with the mutation. It is expected that commercial waxy cassava varieties will have competitive FRYs but special efforts will be required to attain adequate DMCs. This study contributes to the limited knowledge available of the impact of starch mutations on the agronomic performance of root and tuber crops. PMID:27242813

  8. Structure of a mutant human purine nucleoside phosphorylase with the prodrug, 2-fluoro-2-deoxyadenosine and the cytotoxic drug, 2-fluoroadenine

    SciTech Connect

    Afshar, Sepideh; Sawaya, Michael R.; Morrison, Sherie L.

    2009-06-30

    A double mutant of human purine nucleoside phosphorylase (hDM) with the amino acid mutations Glu201Gln:Asn243Asp cleaves adenosine-based prodrugs to their corresponding cytotoxic drugs. When fused to an anti-tumor targeting component, hDM is targeted to tumor cells, where it effectively catalyzes phosphorolysis of the prodrug, 2-fluoro-2'-deoxyadenosine (F-dAdo) to the cytotoxic drug, 2-fluoroadenine (F-Ade). This cytotoxicity should be restricted only to the tumor microenvironment, because the endogenously expressed wild type enzyme cannot use adenosine-based prodrugs as substrates. To gain insight into the interaction of hDM with F-dAdo, we have determined the crystal structures of hDM with F-dAdo and F-Ade. The structures reveal that despite the two mutations, the overall fold of hDM is nearly identical to the wild type enzyme. Importantly, the residues Gln201 and Asp243 introduced by the mutation form hydrogen bond contacts with F-dAdo that result in its binding and catalysis. Comparison of substrate and product complexes suggest that the side chains of Gln201 and Asp243 as well as the purine base rotate during catalysis possibly facilitating cleavage of the glycosidic bond. The two structures suggest why hDM, unlike the wild-type enzyme, can utilize F-dAdo as substrate. More importantly, they provide a critical foundation for further optimization of cleavage of adenosine-based prodrugs, such as F-dAdo by mutants of human purine nucleoside phosphorylase.

  9. SURFACE PROPERTIES OF WATER SOLUBLE STARCH, STARCH ACETATES AND STARCH ACETATES/ALKENYLSUCCINATES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Surface and interfacial tensions with hexadecane were measured for starch and water soluble starch ester solutions in order to determine their potential as stabilizers or emulsifiers. The surface tension for an acid hydrolysed starch (maltodextrin) initially declined with concentration and then rea...

  10. The Characterization of Modified Starch Branching Enzymes: Toward the Control of Starch Chain-Length Distributions

    PubMed Central

    Li, Cheng; Wu, Alex Chi; Go, Rob Marc; Malouf, Jacob; Turner, Mark S.; Malde, Alpeshkumar K.; Mark, Alan E.; Gilbert, Robert G.

    2015-01-01

    Starch is a complex branched glucose polymer whose branch molecular weight distribution (the chain-length distribution, CLD) influences nutritionally important properties such as digestion rate. Chain-stopping in starch biosynthesis is by starch branching enzyme (SBE). Site-directed mutagenesis was used to modify SBEIIa from Zea mays (mSBEIIa) to produce mutants, each differing in a single conserved amino-acid residue. Products at different times from in vitro branching were debranched and the time evolution of the CLD measured by size-exclusion chromatography. The results confirm that Tyr352, Glu513, and Ser349 are important for mSBEIIa activity while Arg456 is important for determining the position at which the linear glucan is cut. The mutant mSBEIIa enzymes have different activities and suggest the length of the transferred chain can be varied by mutation. The work shows analysis of the molecular weight distribution can yield information regarding the enzyme branching sites useful for development of plants yielding starch with improved functionality. PMID:25874689

  11. Transition State Analogues of Purine Nucleoside Phosphorylase: the Work of Vernon L. Schramm

    PubMed Central

    Kresge, Nicole; Simoni, Robert D.; Hill, Robert L.

    2010-01-01

    Transition State Analogue Inhibitors of Purine Nucleoside Phosphorylase from Plasmodium falciparum (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Kim, K., and Schramm, V. L. (2002) J. Biol. Chem. 277, 3219–3225) Purine-less Death in Plasmodium falciparum Induced by Immucillin-H, a Transition State Analogue of Purine Nucleoside Phosphorylase (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Schramm, V. L., and Kim, K. (2002) J. Biol. Chem. 277, 3226–3231) Achieving the Ultimate Physiological Goal in Transition State Analogue Inhibitors for Purine Nucleoside Phosphorylase (Lewandowicz, A., Tyler, P. C., Evans, G. B., Furneaux, R. H., and Schramm, V. L. (2003) J. Biol. Chem. 278, 31465–31468)

  12. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    SciTech Connect

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A. Wilkinson, Anthony J.; Wilson, Keith S.

    2005-05-01

    The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis was solved by X-ray crystallography using molecular replacement and refined at a resolution of 2.24 Å. Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium.

  13. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    PubMed Central

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A.; Wilkinson, Anthony J.; Wilson, Keith S.

    2005-01-01

    Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium. PMID:16511068

  14. Application of crystallographic and modeling methods in the design of purine nucleoside phosphorylase inhibitors.

    PubMed Central

    Ealick, S E; Babu, Y S; Bugg, C E; Erion, M D; Guida, W C; Montgomery, J A; Secrist, J A

    1991-01-01

    Competitive inhibitors of the salvage pathway enzyme purine-nucleoside phosphorylase (purine-nucleoside:orthophosphate ribosyltransferase, EC 2.4.2.1) have been designed by using the three-dimensional structure of the enzyme as determined by x-ray crystallography. The process was an iterative one that utilized interactive computer graphics, Monte Carlo-based conformational searching, energy minimization, and x-ray crystallography. The proposed compounds were synthesized and tested by an in vitro assay. Among the compounds designed and synthesized are the most potent competitive inhibitors of purine nucleoside phosphorylase thus far reported. Images PMID:1763067

  15. One-Pot Biosynthesis of High-Concentration α-Glucose 1-Phosphate from Starch by Sequential Addition of Three Hyperthermophilic Enzymes.

    PubMed

    Zhou, Wei; You, Chun; Ma, Hongwu; Ma, Yanhe; Zhang, Y-H Percival

    2016-03-01

    α-Glucose 1-phosphate (G1P) is synthesized from 5% (w/v) corn starch and 1 M phosphate mediated by α-glucan phosphorylase (αGP) from the thermophilic bacterium Thermotoga maritima at pH 7.2 and 70 °C. To increase G1P yield from corn starch containing branched amylopectin, a hyper-thermostable isoamylase from Sulfolobus tokodaii was added for simultaneous starch gelatinization and starch-debranching hydrolysis at 85 °C and pH 5.5 before αGP use. The pretreatment of isoamylase increased G1P titer from 120 mM to 170 mM. To increase maltose and maltotriose utilization, the third thermostable enzyme, 4-glucanotransferase (4GT) from Thermococcus litoralis, was added during the late stage of G1P biotransformation, further increasing G1P titer to 200 mM. This titer is the highest G1P level obtained on starch or its derived products (maltodextrin and soluble starch). This study suggests that in vitro multienzyme biotransformation has an advantage of great engineering flexibility in terms of space and time compared with microbial fermentation. PMID:26832825

  16. Autogenous Regulation of Escherichia coli Polynucleotide Phosphorylase Expression Revisited▿ †

    PubMed Central

    Carzaniga, Thomas; Briani, Federica; Zangrossi, Sandro; Merlino, Giuseppe; Marchi, Paolo; Dehò, Gianni

    2009-01-01

    The Escherichia coli polynucleotide phosphorylase (PNPase; encoded by pnp), a phosphorolytic exoribonuclease, posttranscriptionally regulates its own expression at the level of mRNA stability and translation. Its primary transcript is very efficiently processed by RNase III, an endonuclease that makes a staggered double-strand cleavage about in the middle of a long stem-loop in the 5′-untranslated region. The processed pnp mRNA is then rapidly degraded in a PNPase-dependent manner. Two non-mutually exclusive models have been proposed to explain PNPase autogenous regulation. The earlier one suggested that PNPase impedes translation of the RNase III-processed pnp mRNA, thus exposing the transcript to degradative pathways. More recently, this has been replaced by the current model, which maintains that PNPase would simply degrade the promoter proximal small RNA generated by the RNase III endonucleolytic cleavage, thus destroying the double-stranded structure at the 5′ end that otherwise stabilizes the pnp mRNA. In our opinion, however, the first model was not completely ruled out. Moreover, the RNA decay pathway acting upon the pnp mRNA after disruption of the 5′ double-stranded structure remained to be determined. Here we provide additional support to the current model and show that the RNase III-processed pnp mRNA devoid of the double-stranded structure at its 5′ end is not translatable and is degraded by RNase E in a PNPase-independent manner. Thus, the role of PNPase in autoregulation is simply to remove, in concert with RNase III, the 5′ fragment of the cleaved structure that both allows translation and prevents the RNase E-mediated PNPase-independent degradation of the pnp transcript. PMID:19136586

  17. Thymidine Phosphorylase Participates in Platelet Signaling and Promotes Thrombosis

    PubMed Central

    Li, Wei; Gigante, Alba; Perez-Perez, Maria-Jesus; Yue, Hong; Hirano, Michio; McIntyre, Thomas; Silverstein, Roy L

    2014-01-01

    Rationale Platelets contain abundant thymidine phosphorylase (TYMP), which is highly expressed in diseases with high risk of thrombosis, such as atherosclerosis and type II diabetes. Objective Test the hypothesis that TYMP participates in platelet signaling and promotes thrombosis. Methods and Results By using a ferric chloride (FeCl3) induced carotid artery injury thrombosis model, we found time to blood flow cessation was significantly prolonged in Tymp−/− and Tymp+/− mice compared to wild type (WT) mice. Bone marrow transplantation and platelet transfusion studies demonstrated that platelet TYMP was responsible for the antithrombotic phenomenon in the TYMP deficient mice. Collagen-, collagen-related peptide (CRP)-, adenosine diphosphate-and/or thrombin-induced platelet aggregation were significantly attenuated in Tymp+/− and Tymp−/− platelets, and in WT or human platelets pretreated with TYMP inhibitor KIN59. Tymp deficiency also significantly decreased agonist-induced P-select in expression. TYMP contains an N-terminal SH3 domain binding proline-rich motif and forms a complex with the tyrosine kinases Lyn, Fyn and Yes in platelets. TYMP-associated Lyn was inactive in resting platelets, and TYMP trapped and diminished active Lyn after collagen stimulation. Tymp/Lyn double haploinsufficiency diminished the antithrombotic phenotype of Tymp+/− mice. TYMP deletion or inhibition of TYMP with KIN59 dramatically increased PECAM-1 tyrosine phosphorylation and diminished CRP or collagen induced AKT phosphorylation. In vivo administration of KIN59 significantly inhibited FeCl3 induced carotid artery thrombosis without affecting hemostasis. Conclusion TYMP participates in multiple platelet signaling pathways and regulates platelet activation and thrombosis. Targeting TYMP might be a novel anti-platelet and anti-thrombosis therapy. PMID:25287063

  18. An evaluation of indirubin analogues as phosphorylase kinase inhibitors.

    PubMed

    Begum, Jaida; Skamnaki, Vassiliki T; Moffatt, Colin; Bischler, Nicolas; Sarrou, Josephine; Skaltsounis, Alexios-Leandros; Leonidas, Demetres D; Oikonomakos, Nikos G; Hayes, Joseph M

    2015-09-01

    Phosphorylase kinase (PhK) has been linked with a number of conditions such as glycogen storage diseases, psoriasis, type 2 diabetes and more recently, cancer (Camus et al., 2012 [6]). However, with few reported structural studies on PhK inhibitors, this hinders a structure based drug design approach. In this study, the inhibitory potential of 38 indirubin analogues have been investigated. 11 of these ligands had IC50 values in the range 0.170-0.360μM, with indirubin-3'-acetoxime (1c) the most potent. 7-Bromoindirubin-3'-oxime (13b), an antitumor compound which induces caspase-independent cell-death (Ribas et al., 2006 [20]) is revealed as a specific inhibitor of PhK (IC50=1.8μM). Binding assay experiments performed using both PhK-holo and PhK-γtrnc confirmed the inhibitory effects to arise from binding at the kinase domain (γ subunit). High level computations using QM/MM-PBSA binding free energy calculations were in good agreement with experimental binding data, as determined using statistical analysis, and support binding at the ATP-binding site. The value of a QM description for the binding of halogenated ligands exhibiting σ-hole effects is highlighted. A new statistical metric, the 'sum of the modified logarithm of ranks' (SMLR), has been defined which measures performance of a model for both the "early recognition" (ranking earlier/higher) of active compounds and their relative ordering by potency. Through a detailed structure activity relationship analysis considering other kinases (CDK2, CDK5 and GSK-3α/β), 6'(Z) and 7(L) indirubin substitutions have been identified to achieve selective PhK inhibition. The key PhK binding site residues involved can also be targeted using other ligand scaffolds in future work. PMID:26364215

  19. Transition State Analysis of Thymidine Hydrolysis by Human Thymidine Phosphorylase*

    PubMed Central

    Schwartz, Phillip A.; Vetticatt, Mathew; Schramm, Vern L.

    2010-01-01

    Human thymidine phosphorylase (hTP) is responsible for thymidine (dT) homeostasis and its action promotes angiogenesis. In the absence of phosphate, hTP catalyzes a slow hydrolytic depyrimidination of dT yielding thymine and 2-deoxyribose (dRib). Its transition state was characterized using multiple kinetic isotope effect (KIE) measurements. Isotopically enriched thymidines were synthesized enzymatically from glucose or (deoxy)ribose and intrinsic KIEs were used to interpret the transition state structure. KIEs from [1′-14C]-, [1-15N]-, [1′-3H]-, [2′R-3H]-, [2′S-3H]-, [4′-3H]-, [5′-3H]dTs provided values of 1.033 ± 0.002, 1.004 ± 0.002, 1.325 ± 0.003, 1.101 ± 0.004, 1.087 ± 0.005, 1.040 ± 0.003, and 1.033 ± 0.003, respectively. Transition state analysis revealed a stepwise mechanism with a 2-deoxyribocation formed early and a higher energetic barrier for nucleophilic attack of a water molecule on the high energy intermediate. An equilibrium exists between the deoxyribocation and reactants prior to the irreversible nucleophilic attack by water. The results establish activation of the thymine leaving group without requirement for phosphate. A transition state constrained to match the intrinsic KIEs was found using density functional theory. An active site histidine (His116) is implicated as the catalytic base for activation of the water nucleophile at the rate-limiting transition state. The distance between the water nucleophile and the anomeric carbon (rC-O) is predicted to be 2.3 Å at the transition state. The transition state model predicts that deoxyribose adopts a mild 3′-endo confirmation during nucleophilic capture. These results differ from the concerted bimolecular mechanism reported for the arsenolytic reaction PMID:20804144

  20. Flavopiridol inhibits glycogen phosphorylase by binding at the inhibitor site.

    PubMed

    Oikonomakos, N G; Schnier, J B; Zographos, S E; Skamnaki, V T; Tsitsanou, K E; Johnson, L N

    2000-11-01

    Flavopiridol (L86-8275) ((-)-cis-5, 7-dihydroxy-2-(2-chlorophenyl)-8-[4-(3-hydroxy-1-methyl)-piperidinyl] -4H-benzopyran-4-one), a potential antitumor drug, currently in phase II trials, has been shown to be an inhibitor of muscle glycogen phosphorylase (GP) and to cause glycogen accumulation in A549 non-small cell lung carcinoma cells (Kaiser, A., Nishi, K., Gorin, F.A., Walsh, D.A., Bradbury, E. M., and Schnier, J. B., unpublished data). Kinetic experiments reported here show that flavopiridol inhibits GPb with an IC(50) = 15.5 microm. The inhibition is synergistic with glucose resulting in a reduction of IC(50) for flavopiridol to 2.3 microm and mimics the inhibition of caffeine. In order to elucidate the structural basis of inhibition, we determined the structures of GPb complexed with flavopiridol, GPb complexed with caffeine, and GPa complexed with both glucose and flavopiridol at 1.76-, 2.30-, and 2.23-A resolution, and refined to crystallographic R values of 0.216 (R(free) = 0.247), 0.189 (R(free) = 0.219), and 0.195 (R(free) = 0.252), respectively. The structures provide a rational for flavopiridol potency and synergism with glucose inhibitory action. Flavopiridol binds at the allosteric inhibitor site, situated at the entrance to the catalytic site, the site where caffeine binds. Flavopiridol intercalates between the two aromatic rings of Phe(285) and Tyr(613). Both flavopiridol and glucose promote the less active T-state through localization of the closed position of the 280s loop which blocks access to the catalytic site, thereby explaining their synergistic inhibition. The mode of interactions of flavopiridol with GP is different from that of des-chloro-flavopiridol with CDK2, illustrating how different functional parts of the inhibitor can be used to provide specific and potent binding to two different enzymes. PMID:10924512

  1. RHEOLOGY OF STARCH-LIPID COMPOSITES YOGURTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Yogurt is traditionally made by fermenting liquid milk. The ability of starches to thicken, gel, and hold water has been exploited in yogurt manufacture. The addition of starch increases the viscosity of yogurt, but some starches impart an undesirable taste and promote phase separation. Starch-li...

  2. Arabidopsis VTC2 Encodes a GDP-l-Galactose Phosphorylase, the Last Unknown Enzyme in the Smirnoff-Wheeler Pathway to Ascorbic Acid in Plants*

    PubMed Central

    Linster, Carole L.; Gomez, Tara A.; Christensen, Kathryn C.; Adler, Lital N.; Young, Brian D.; Brenner, Charles; Clarke, Steven G.

    2008-01-01

    The first committed step in the biosynthesis of l-ascorbate from d-glucose in plants requires conversion of GDP-l-galactose to l-galactose 1-phosphate by a previously unidentified enzyme. Here we show that the protein encoded by VTC2, a gene mutated in vitamin C-deficient Arabidopsis thaliana strains, is a member of the GalT/Apa1 branch of the histidine triad protein superfamily that catalyzes the conversion of GDP-l-galactose to l-galactose 1-phosphate in a reaction that consumes inorganic phosphate and produces GDP. In characterizing recombinant VTC2 from Arabidopsis thaliana as a specific GDP-l-galactose/GDP-d-glucose phosphorylase, we conclude that enzymes catalyzing each of the ten steps of the Smirnoff-Wheeler pathway from glucose to ascorbate have been identified. Finally, we identify VTC2 homologs in plants, invertebrates, and vertebrates, suggesting that a similar reaction is used widely in nature. PMID:17462988

  3. Re-Evaluation of the Role of Starch in Gravitropic Sensing

    NASA Technical Reports Server (NTRS)

    Sack, Fred D.

    1998-01-01

    Plant organs grow toward or away from gravity as a way to orient those organs for optimizing growth. Starch has long been thought to be important in sensing the direction of the g-vector in gravitropism, but that hypothesis has also evoked controversy. We have previously shown that starch-deficient mutants of Arabidopsis (TC7) and Nicotiana (NS458) are impaired in their gravitropism. While this suggests that starch is not necessary for reduced gravitropism, it also indicates that the mass of the starch contributes to sensing when present and thus is necessary for full gravitropic sensitivity. The research supported by this grant focused on three related projects, (1) the effect of light on hypocotyl gravitropism in NS458, (2) the effects of root phototropism on measurements of gravitropic sensitivity, and (3) the effects of starch overproduction on sedimentation and gravitropism. Collectively, our results provide additional strong support for the importance of starch in gravitropic sensing. First, by accounting for negative phototropism in roots of two starchless mutants of Arabidopsis we have established that these mutants are much less sensitive to gravity than previously thought. This work also demonstrates the importance of designing experimental protocols that remove the influence of root phototropism on measuring root gravitropism. Second, light apparently promotes gravitropism in starch-deficient Nicotiana hypocotyls by increasing the trace amounts of starch in the plastids, by inducing limited plastid sedimentation and thus by presumably increasing the signal provided by plastid mass. And finally, we show that excess starch in Arabidopsis seedlings has little effect on gravitropic sensitivity implying that the sensing system is already saturated. However, in light-grown stems where this mutation results in starch accumulation and where the wild-type practically lacks starch in the sensing cells, the mutant is much more sensitive than the wild-type again

  4. Thymidine phosphorylase activates NFκB and stimulates the expression of angiogenic and metastatic factors in human cancer cells.

    PubMed

    Tabata, Sho; Ikeda, Ryuji; Yamamoto, Masatatsu; Shimaoka, Shunji; Mukaida, Naofumi; Takeda, Yasuo; Yamada, Katsushi; Soga, Tomoyoshi; Furukawa, Tatsuhiko; Akiyama, Shin-ichi

    2014-11-15

    Thymidine phosphorylase (TP) promotes angiogenesis and metastasis, and confers resistance to anticancer agents in some cancer cell types. We previously reported that TP stimulates the expression of interleukin (IL)-8 in human KB cancer cells by an unknown mechanism. A mutation in the nuclear factor (NF)κB binding site of the IL-8 promoter suppressed promoter activity in KB/TP cells that overexpress TP. Specifically inhibiting NFκB by using BY11-7082 also suppressed TP-induced IL-8 promoter activity and IL-8 expression. Moreover, TP overexpression led to the activation of NFκB and an upregulation in the expression of its target genes, and increased phosphorylated IKKα/β protein levels, while promoting IκBα degradation as well as p65 phosphorylation and nuclear localization. The activation of NFκB in KB/TP cells was suppressed by the antioxidants N-acetylcysteine and EUK-8. In addition, in gastric cancer tissue samples, the expression of the NFκB-regulated genes, including IL-8, IL-6, and fibronectin-1 was positively correlated with TP expression. These findings indicate that reactive oxygen species mediated NFκB activation by TP increases the expression of genes that promote angiogenesis and metastasis in gastric cancer. PMID:25350954

  5. Hematopoietic gene therapy restores thymidine phosphorylase activity in a cell culture and a murine model of MNGIE.

    PubMed

    Torres-Torronteras, J; Gómez, A; Eixarch, H; Palenzuela, L; Pizzorno, G; Hirano, M; Andreu, A L; Barquinero, J; Martí, R

    2011-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disorder caused by mutations in the TYMP gene, which encodes thymidine phosphorylase (TP). TP dysfunction results in systemic thymidine (dThd) and deoxyuridine (dUrd) overload, which selectively impair mitochondrial DNA replication. Allogeneic hematopoietic transplantation has been used to treat MNGIE patients; however, this approach has serious adverse effects, including the toxicity of myeloablative conditioning, graft rejection and graft-versus-host disease. With the aim of testing the feasibility of gene therapy for MNGIE, we transduced TP-deficient B-lymphoblastoid cells from two MNGIE patients, with lentiviral vectors carrying a functional copy of the human TYMP DNA coding sequence. This restored TP activity in the cells, which reduced the excretion of dThd and dUrd and their concentrations when added in excess. Additionally, lentiviral-mediated hematopoietic gene therapy was used in partially myeloablated double Tymp/Upp1 knockout mice. In spite of the relatively low levels of molecular chimerism achieved, high levels of TP activity were observed in the peripheral blood of the transplanted mice, with a concomitant reduction of nucleoside concentrations. Our results suggest that hematopoietic gene therapy could be an alternative treatment for this devastating disorder in the future. PMID:21451581

  6. Molecular and supra-molecular structure of waxy starches developed from cassava (Manihot esculenta Crantz).

    PubMed

    Rolland-Sabaté, Agnès; Sanchez, Teresa; Buléon, Alain; Colonna, Paul; Ceballos, Hernan; Zhao, Shan-Shan; Zhang, Peng; Dufour, Dominique

    2013-02-15

    The aim of this work was to characterize the amylopectin of low amylose content cassava starches obtained from transgenesis comparatively with a natural waxy cassava starch (WXN) discovered recently in CIAT (International Center for Tropical Agriculture). Macromolecular features, starch granule morphology, crystallinity and thermal properties of these starches were determined. M¯(w) of amylopectin from the transgenic varieties are lower than WXN. Branched and debranched chain distributions analyses revealed slight differences in the branching degree and structure of these amylopectins, principally on DP 6-9 and DP>37. For the first time, a deep structural characterization of a series of transgenic lines of waxy cassava was carried out and the link between structural features and the mutated gene expression approached. The transgenesis allows to silenced partially or totally the GBSSI, without changing deeply the starch granule ultrastructure and allows to produce clones with similar amylopectin as parental cassava clone. PMID:23399176

  7. Polymer phosphorylases: clues to the emergence of non-replicative and replicative polymers.

    PubMed

    Freire, Miguel Angel

    2011-12-01

    Polymer formation is arguably one of the essential factors that allowed the emergence, stabilisation and spread of life on Earth. Consequently, studies concerning biopolymers could shed light on the origins of life itself. Of particular interest are RNA and polysaccharide polymers, the archetypes of the contrasting proposed evolutionary scenarios and their respective polymerases. Nucleic acid polymerases were hypothesised, before their discovery, to have a functional similarity with glycogen phosphorylase. Further identification and characterisation of nucleic acid polymerases; particularly of polynucleotide phosphorylase (PNPase), provided experimental evidence for the initial premise. Once discovered, frequent similarities were found between PNPase and glycogen phosphorylase, in terms of catalytic features and biochemical properties. As a result, PNPase was seen as a model of primitive polymerase and used in laboratory precellular systems. Paradoxically, however, these similarities were not sufficient as an argument in favour of an ancestral common polymerisation mechanism prior to polysaccharides and polyribonucleotides. Here we present an overview of the common features shared by polymer phosphorylases, with new proposals for the emergence of polysaccharide and RNA polymers. PMID:21785867

  8. 2-Arylquinazolin-4(3H)-ones: A novel class of thymidine phosphorylase inhibitors.

    PubMed

    Javaid, Sumaira; Saad, Syed Muhammad; Perveen, Shahnaz; Khan, Khalid Mohammed; Choudhary, M Iqbal

    2015-12-01

    Thymidine phosphorylase (TP) over expression plays an important role in several pathological conditions, such as rheumatoid arthritis, chronic inflammatory diseases, psoriasis, and tumor angiogenesis. In this regard, a series of twenty-five 2-arylquinazolin-4(3H)-one derivatives 1-25 were evaluated for thymidine phosphorylase inhibitory activity. Six compounds 5, 6, 20, 2, 23, and 3 were found to be active against thymidine phosphorylase enzyme with IC50 values in the range of 42.9-294.6μM. 7-Deazaxanthine (IC50=41.0±1.63μM) was used as a standard inhibitor. Compound 5 showed a significant activity (IC50=42.9±1.0μM), comparable to the standard. The enzyme kinetic studies on the most active compounds 5, 6, and 20 were performed for the determination of their modes of inhibition, and dissociation constants Ki. All active compounds were found to be largely non-cytotoxic against the mouse fibroblast 3T3 cell line. This study identifies a novel class of thymidine phosphorylase inhibitors which may be further investigated as leads to develop therapeutic agents. PMID:26547232

  9. Regulation of glycogen synthase and phosphorylase during recovery from high-intensity exercise in the rat.

    PubMed Central

    Bräu, L; Ferreira, L D; Nikolovski, S; Raja, G; Palmer, T N; Fournier, P A

    1997-01-01

    The aim of this study was to determine the role of the phosphorylation state of glycogen synthase and glycogen phosphorylase in the regulation of muscle glycogen repletion in fasted animals recovering from high-intensity exercise. Groups of rats were swum to exhaustion and allowed to recover for up to 120 min without access to food. Swimming to exhaustion caused substantial glycogen breakdown and lactate accumulation in the red, white and mixed gastrocnemius muscles, whereas the glycogen content in the soleus muscle remained stable. During the first 40 min of recovery, significant repletion of glycogen occurred in all muscles examined except the soleus muscle. At the onset of recovery, the activity ratios and fractional velocities of glycogen synthase in the red, white and mixed gastrocnemius muscles were higher than basal, but returned to pre-exercise levels within 20 min after exercise. In contrast, after exercise the activity ratios of glycogen phosphorylase in the same muscles were lower than basal, and increased to pre-exercise levels within 20 min. This pattern of changes in glycogen synthase and phosphorylase activities, never reported before, suggests that the integrated regulation of the phosphorylation state of both glycogen synthase and phosphorylase might be involved in the control of glycogen deposition after high-intensity exercise. PMID:9078277

  10. Effects of commonly used cryoprotectants on glycogen phosphorylase activity and structure.

    PubMed

    Tsitsanou, K E; Oikonomakos, N G; Zographos, S E; Skamnaki, V T; Gregoriou, M; Watson, K A; Johnson, L N; Fleet, G W

    1999-04-01

    The effects of a number of cryoprotectants on the kinetic and structural properties of glycogen phosphorylase b have been investigated. Kinetic studies showed that glycerol, one of the most commonly used cryoprotectants in X-ray crystallographic studies, is a competitive inhibitor with respect to substrate glucose-1-P with an apparent Ki value of 3.8% (v/v). Cryogenic experiments, with the enzyme, have shown that glycerol binds at the catalytic site and competes with glucose analogues that bind at the catalytic site, thus preventing the formation of complexes. This necessitated a change in the conditions for cryoprotection in crystallographic binding experiments with glycogen phosphorylase. It was found that 2-methyl-2,4-pentanediol (MPD), polyethylene glycols (PEGs) of various molecular weights, and dimethyl sulfoxide (DMSO) activated glycogen phosphorylase b to different extents, by stabilizing its most active conformation, while sucrose acted as a noncompetitive inhibitor and ethylene glycol as an uncompetitive inhibitor with respect to glucose-1-P. A parallel experimental investigation by X-ray crystallography showed that, at 100 K, both MPD and DMSO do not bind at the catalytic site, do not induce any significant conformational change on the enzyme molecule, and hence, are more suitable cryoprotectants than glycerol for binding studies with glycogen phosphorylase. PMID:10211820

  11. Effects of commonly used cryoprotectants on glycogen phosphorylase activity and structure.

    PubMed Central

    Tsitsanou, K. E.; Oikonomakos, N. G.; Zographos, S. E.; Skamnaki, V. T.; Gregoriou, M.; Watson, K. A.; Johnson, L. N.; Fleet, G. W.

    1999-01-01

    The effects of a number of cryoprotectants on the kinetic and structural properties of glycogen phosphorylase b have been investigated. Kinetic studies showed that glycerol, one of the most commonly used cryoprotectants in X-ray crystallographic studies, is a competitive inhibitor with respect to substrate glucose-1-P with an apparent Ki value of 3.8% (v/v). Cryogenic experiments, with the enzyme, have shown that glycerol binds at the catalytic site and competes with glucose analogues that bind at the catalytic site, thus preventing the formation of complexes. This necessitated a change in the conditions for cryoprotection in crystallographic binding experiments with glycogen phosphorylase. It was found that 2-methyl-2,4-pentanediol (MPD), polyethylene glycols (PEGs) of various molecular weights, and dimethyl sulfoxide (DMSO) activated glycogen phosphorylase b to different extents, by stabilizing its most active conformation, while sucrose acted as a noncompetitive inhibitor and ethylene glycol as an uncompetitive inhibitor with respect to glucose-1-P. A parallel experimental investigation by X-ray crystallography showed that, at 100 K, both MPD and DMSO do not bind at the catalytic site, do not induce any significant conformational change on the enzyme molecule, and hence, are more suitable cryoprotectants than glycerol for binding studies with glycogen phosphorylase. PMID:10211820

  12. A novel TYMP mutation in a French Canadian patient with mitochondrial neurogastrointestinal encephalomyopathy.

    PubMed

    Laforce, Robert; Valdmanis, Paul N; Dupré, Nicolas; Rouleau, Guy A; Turgeon, Alexis F; Savard, Martin

    2009-10-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive disorder characterized by gastrointestinal, extraocular muscle, peripheral nerve, and cerebral white matter involvement. Mutations in the nuclear gene TYMP encoding for thymidine phosphorylase (TP) cause loss of TP activity, systemic accumulation of its substrates in plasma and tissues, as well as alterations in mitochondrial DNA including deletions, depletion, and somatic point mutations. To date, more than 30 mutations have been reported in diverse ethnic populations. We present herein the clinical, neuroimaging, neuromuscular, and molecular findings of the first French Canadian patient with MNGIE caused by a novel homozygous invariant splicing site (IVS5 +1 G>A) mutation of the TYMP gene. PMID:19523753

  13. Starch Suspensions with Different Fluids

    NASA Astrophysics Data System (ADS)

    Lim, Melody; Melville, Audrey; Dijksman, Joshua; Behringer, Robert

    2014-03-01

    A suspension made of starch particles dispersed in water displays significant non-Newtonian behavior for high enough particulate concentration. This surprising behavior has recently inspired a series of experiments that have shed much light on the possible mechanism behind this phenomenon. In our studies we assess the role of the fluid phase in these suspensions. We find that using fluids other than water can significantly alter the behavior of starch suspensions. Through mechanical tests of various kinds, we assess the interaction between starch particles and different liquids, and how this interaction affects the non-Newtonian behavior of starch suspensions.

  14. Anopheles gambiae Purine Nucleoside Phosphorylase: Catalysis, Structure, and Inhibition

    SciTech Connect

    Taylor,E.; Rinaldo-Matthis, A.; Li, L.; Ghanem, M.; Hazleton, K.; Cassera, M.; Almo, S.; Schramm, V.

    2007-01-01

    The purine salvage pathway of Anopheles gambiae, a mosquito that transmits malaria, has been identified in genome searches on the basis of sequence homology with characterized enzymes. Purine nucleoside phosphorylase (PNP) is a target for the development of therapeutic agents in humans and purine auxotrophs, including malarial parasites. The PNP from Anopheles gambiae (AgPNP) was expressed in Escherichia coli and compared to the PNPs from Homo sapiens (HsPNP) and Plasmodium falciparum (PfPNP). AgPNP has kcat values of 54 and 41 s-1 for 2'-deoxyinosine and inosine, its preferred substrates, and 1.0 s-1 for guanosine. However, the chemical step is fast for AgPNP at 226 s-1 for guanosine in pre-steady-state studies. 5'-Deaza-1'-aza-2'-deoxy-1'-(9-methylene)-Immucillin-H (DADMe-ImmH) is a transition-state mimic for a 2'-deoxyinosine ribocation with a fully dissociated N-ribosidic bond and is a slow-onset, tight-binding inhibitor with a dissociation constant of 3.5 pM. This is the tightest-binding inhibitor known for any PNP, with a remarkable Km/Ki* of 5.4 x 107, and is consistent with enzymatic transition state predictions of enhanced transition-state analogue binding in enzymes with enhanced catalytic efficiency. Deoxyguanosine is a weaker substrate than deoxyinosine, and DADMe-Immucillin-G is less tightly bound than DADMe-ImmH, with a dissociation constant of 23 pM for AgPNP as compared to 7 pM for HsPNP. The crystal structure of AgPNP was determined in complex with DADMe-ImmH and phosphate to a resolution of 2.2 Angstroms to reveal the differences in substrate and inhibitor specificity. The distance from the N1' cation to the phosphate O4 anion is shorter in the AgPNP{center_dot}DADMe-ImmH{center_dot}PO4 complex than in HsPNP{center_dot}DADMe-ImmH{center_dot}SO4, offering one explanation for the stronger inhibitory effect of DADMe-ImmH for AgPNP.

  15. Purine nucleoside phosphorylase as a cytosolic arsenate reductase.

    PubMed

    Gregus, Zoltán; Németi, Balázs

    2002-11-01

    The findings of the accompanying paper (Németi and Gregus, Toxicol: Sci. 70, 4-12) indicate that the arsenate (AsV) reductase activity of rat liver cytosol is due to an SH enzyme that uses phosphate (or its analogue, arsenate, AsV) and a purine nucleoside (guanosine or inosine) as substrates. Purine nucleoside phosphorylase (PNP) is such an enzyme. It catalyzes the phosphorolytic cleavage of 6-oxopurine nucleosides according to the following scheme: guanosine (or inosine) + phosphate <--> guanine (or hypoxanthine) + ribose-1-phosphate. Therefore, we have tested the hypothesis that PNP is responsible for the thiol- and purine nucleoside-dependent reduction of AsV to AsIII by rat liver cytosol. AsIII formed from AsV was quantified by HPLC-hydride generation-atomic fluorescence spectrometry analysis of the deproteinized incubates. The following findings support the conclusion that PNP reduces AsV to AsIII, using AsV instead of phosphate in the reaction above: (1) Specific PNP inhibitors (CI-1000, BCX-1777) at a concentration of 1 microM completely inhibited cytosolic AsV reductase activity. (2) During anion-exchange chromatography of cytosolic proteins, PNP activity perfectly coeluted with the AsV reductase activity, suggesting that both activities belong to the same protein. (3) PNP purified from calf spleen catalyzed reduction of AsV to AsIII in the presence of dithiothreitol (DTT) and a 6-oxopurine nucleoside (guanosine or inosine). (4) AsV reductase activity of purified PNP, like the cytosolic AsV reductase activity, was inhibited by phosphate (a substrate of PNP alternative to AsV), guanine and hypoxanthine (products of PNP favoring the reverse reaction), mercurial thiol reagents (nonspecific inhibitors of PNP), as well as CI-1000 and BCX-1777 (specific PNP inhibitors). Thus, PNP appears to be responsible for the AsV reductase activity of rat liver cytosol in the presence of DTT. Further research should clarify the mechanism and the in vivo significance of PNP

  16. Metabolism of Oligosaccharides and Starch in Lactobacilli: A Review

    PubMed Central

    Gänzle, Michael G.; Follador, Rainer

    2012-01-01

    Oligosaccharides, compounds that are composed of 2–10 monosaccharide residues, are major carbohydrate sources in habitats populated by lactobacilli. Moreover, oligosaccharide metabolism is essential for ecological fitness of lactobacilli. Disaccharide metabolism by lactobacilli is well understood; however, few data on the metabolism of higher oligosaccharides are available. Research on the ecology of intestinal microbiota as well as the commercial application of prebiotics has shifted the interest from (digestible) disaccharides to (indigestible) higher oligosaccharides. This review provides an overview on oligosaccharide metabolism in lactobacilli. Emphasis is placed on maltodextrins, isomalto-oligosaccharides, fructo-oligosaccharides, galacto-oligosaccharides, and raffinose-family oligosaccharides. Starch is also considered. Metabolism is discussed on the basis of metabolic studies related to oligosaccharide metabolism, information on the cellular location and substrate specificity of carbohydrate transport systems, glycosyl hydrolases and phosphorylases, and the presence of metabolic genes in genomes of 38 strains of lactobacilli. Metabolic pathways for disaccharide metabolism often also enable the metabolism of tri- and tetrasaccharides. However, with the exception of amylase and levansucrase, metabolic enzymes for oligosaccharide conversion are intracellular and oligosaccharide metabolism is limited by transport. This general restriction to intracellular glycosyl hydrolases differentiates lactobacilli from other bacteria that adapted to intestinal habitats, particularly Bifidobacterium spp. PMID:23055996

  17. Cognitive dysfunction and hypogonadotrophic hypogonadism in a Brazilian patient with mitochondrial neurogastrointestinal encephalomyopathy and a novel ECGF1 mutation.

    PubMed

    Carod-Artal, F J; Herrero, M D; Lara, M C; López-Gallardo, E; Ruiz-Pesini, E; Martí, R; Montoya, J

    2007-05-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is caused by mutations in the thymidine phosphorylase gene (ECGF1). We present the first detailed report of a Brazilian MNGIE patient, harboring a novel ECGF1 homozygous mutation (C4202A, leading to a premature stop codon, S471X). Multiple deletions and the T5814C change were found in mitochondrial DNA. Together with gastrointestinal symptoms, endocrine involvement and memory dysfunction, not reported in MNGIE to date, were the most preeminent features. PMID:17437622

  18. Molecular Evolution and Functional Divergence of Soluble Starch Synthase Genes in Cassava (Manihot Esculenta Crantz)

    PubMed Central

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes. PMID:23888108

  19. Regulation of Maltodextrin Phosphorylase Synthesis in Escherichia coli by Cyclic Adenosine 3′, 5′-Monophosphate and Glucose1

    PubMed Central

    Chao, Julie; Weathersbee, Carolyn J.

    1974-01-01

    Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043

  20. Starch-filled polymer composites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes the development of degradable polymer composites that can be made at room temperature without special equipments. The developed composites are made from ethyl cyanoacrylate and starch. The polymer composites produced by this procedure contain 60 wt% of starch with compressive s...

  1. Starch Applications for Delivery Systems

    NASA Astrophysics Data System (ADS)

    Li, Jason

    2013-03-01

    Starch is one of the most abundant and economical renewable biopolymers in nature. Starch molecules are high molecular weight polymers of D-glucose linked by α-(1,4) and α-(1,6) glycosidic bonds, forming linear (amylose) and branched (amylopectin) structures. Octenyl succinic anhydride modified starches (OSA-starch) are designed by carefully choosing a proper starch source, path and degree of modification. This enables emulsion and micro-encapsulation delivery systems for oil based flavors, micronutrients, fragrance, and pharmaceutical actives. A large percentage of flavors are encapsulated by spray drying in today's industry due to its high throughput. However, spray drying encapsulation faces constant challenges with retention of volatile compounds, oxidation of sensitive compound, and manufacturing yield. Specialty OSA-starches were developed suitable for the complex dynamics in spray drying and to provide high encapsulation efficiency and high microcapsule quality. The OSA starch surface activity, low viscosity and film forming capability contribute to high volatile retention and low active oxidation. OSA starches exhibit superior performance, especially in high solids and high oil load encapsulations compared with other hydrocolloids. The submission is based on research and development of Ingredion

  2. Responsive starch-based materials

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch, a low-cost, annually renewable resource, is naturally hydrophilic and its properties change with relative humidity. Starch’s hygroscopic nature can be used to develop materials which change shape or volume in response to environmental changes (e.g. humidity). For example, starch-based graf...

  3. Starch-Lignin Baked Foams

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch-kraft lignin foams were prepared by a baking process. Replacing up to 20% of the starch with lignin has no effect on foam density or overall morphology. At 10% replacement, lignin marginally increases water resistance and modulus of elasticity but decreases strain at maximum stress. At 20% re...

  4. Brucite nanoplate reinforced starch bionanocomposites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this paper the mechanical reinforcement in a series of bionanocomposites films based on starch and nano-sized brucite, Mg(OH)2, was investigated. Brucite nanoplates with an aspect ratio of 9.25 were synthesized by wet precipitation and incorporated into starch matrices at different concentrations...

  5. Structural investigation of the thymidine phosphorylase from Salmonella typhimurium in the unliganded state and its complexes with thymidine and uridine.

    PubMed

    Balaev, Vladislav V; Lashkov, Alexander A; Gabdulkhakov, Azat G; Dontsova, Maria V; Seregina, Tatiana A; Mironov, Alexander S; Betzel, Christian; Mikhailov, Al'bert M

    2016-03-01

    Highly specific thymidine phosphorylases catalyze the phosphorolytic cleavage of thymidine, with the help of a phosphate ion, resulting in thymine and 2-deoxy-α-D-ribose 1-phosphate. Thymidine phosphorylases do not catalyze the phosphorolysis of uridine, in contrast to nonspecific pyrimidine nucleoside phosphorylases and uridine phosphorylases. Understanding the mechanism of substrate specificity on the basis of the nucleoside is essential to support rational drug-discovery investigations of new antitumour and anti-infective drugs which are metabolized by thymidine phosphorylases. For this reason, X-ray structures of the thymidine phosphorylase from Salmonella typhimurium were solved and refined: the unliganded structure at 2.05 Å resolution (PDB entry 4xr5), the structure of the complex with thymidine at 2.55 Å resolution (PDB entry 4yek) and that of the complex with uridine at 2.43 Å resolution (PDB entry 4yyy). The various structural features of the enzyme which might be responsible for the specificity for thymidine and not for uridine were identified. The presence of the 2'-hydroxyl group in uridine results in a different position of the uridine furanose moiety compared with that of thymidine. This feature may be the key element of the substrate specificity. The specificity might also be associated with the opening/closure mechanism of the two-domain subunit structure of the enzyme. PMID:26919527

  6. Starches, Sugars and Obesity

    PubMed Central

    Aller, Erik E. J. G.; Abete, Itziar; Astrup, Arne; Martinez, J. Alfredo; van Baak, Marleen A.

    2011-01-01

    The rising prevalence of obesity, not only in adults but also in children and adolescents, is one of the most important public health problems in developed and developing countries. As one possible way to tackle obesity, a great interest has been stimulated in understanding the relationship between different types of dietary carbohydrate and appetite regulation, body weight and body composition. The present article reviews the conclusions from recent reviews and meta-analyses on the effects of different starches and sugars on body weight management and metabolic disturbances, and provides an update of the most recent studies on this topic. From the literature reviewed in this paper, potential beneficial effects of intake of starchy foods, especially those containing slowly-digestible and resistant starches, and potential detrimental effects of high intakes of fructose become apparent. This supports the intake of whole grains, legumes and vegetables, which contain more appropriate sources of carbohydrates associated with reduced risk of cardiovascular and other chronic diseases, rather than foods rich in sugars, especially in the form of sugar-sweetened beverages. PMID:22254101

  7. Adenovirus-mediated delivery into myocytes of muscle glycogen phosphorylase, the enzyme deficient in patients with glycogen-storage disease type V.

    PubMed Central

    Baqué, S; Newgard, C B; Gerard, R D; Guinovart, J J; Gómez-Foix, A M

    1994-01-01

    The feasibility of using adenovirus as a vector for the introduction of glycogen phosphorylase activity into myocytes has been examined. We used the C2C12 myoblast cell line to assay the impact of phosphorylase gene transfer on myocyte glycogen metabolism and to reproduce in vitro the two strategies proposed for the treatment of muscle genetic diseases, myoblast transplantation and direct DNA delivery. In this study, a recombinant adenovirus containing the muscle glycogen phosphorylase cDNA transcribed from the cytomegalovirus promoter (AdCMV-MGP) was used to transduce both differentiating myoblasts and nondividing mature myotube cells. Muscle glycogen phosphorylase mRNA levels and total phosphorylase activity were increased in both cell types after viral treatment although more efficiently in the differentiated myotubes. The increase in phosphorylase activity was transient (15 days) in myoblasts whereas in myotubes higher levels of phosphorylase gene expression and activity were reached, which remained above control levels for the duration of the study (20 days). The introduction of muscle phosphorylase into myotubes enhanced their glycogenolytic capacity. AdCMV MGP-transduced myotubes had lower glycogen levels under basal conditions. In addition, these engineered cells showed more extensive glycogenolysis in response to both adrenaline, which stimulates glycogen phosphorylase phosphorylation, and carbonyl cyanide m-chlorophenylhydrazone, a metabolic uncoupler. In conclusion, transfer of the muscle glycogen phosphorylase cDNA into myotubes confers an enhanced and regulatable glycogenolytic capacity. Thus this system might be useful for delivery of muscle glycogen phosphorylase and restoration of glycogenolysis in muscle cells from patients with muscle phosphorylase deficiency (McArdle's disease). Images Figure 1 Figure 2 Figure 5 PMID:7818463

  8. Enzymatic synthesis of 2'-deoxyuridine by whole cell catalyst co-expressing uridine phosphorylase and thymidine phosphorylase through auto-induction system.

    PubMed

    Xiong, Shuli; Wang, Yingbin; Wang, Xi; Wang, Jie; Li, Jie; Zhang, Guiyou; Zhang, Rongqing; Xie, Liping; Wang, Hongzhong

    2014-12-01

    Genes encoding uridine phosphorylase (UP) and thymidine phosphorylase (TP) from Escherichia coli K12 were cloned and recombined respectively into plasmids pET-21a(+) and pET-28a(+). The recombinant plasmids BL21/pET21a-UP and BL21/pET28a-TP were co-transformed into E. coli BL21(DE3) to construct highly effective BTU strain (BL21/pET28a-TP, pET21a-UP) overexpressing both of UP and TP. BTU was cultivated in ZYM-Fe-5052 medium for 10 h and used as catalyst to synthesize 2'-deoxyuridine (dUR). It was found to increase the productivity of dUR by 8-9 fold when compared to wild E. coli K12 and E. coli BL21(DE3) strains. A series of experiments were carried out to find out the optimal conditions for synthesis of dUR. At 50°C, with 0.25‰ dry wt./v to catalyze the reaction of 2:1 β-thymidine: uracil (60 mM β-thymidine, 30 mM uracil), the conversion rate of dUR would reach 61.6% at 1 h, which was much higher than the rates obtained by BTU strain cultured in LB medium and induced by IPTG. This result proved co-expression and auto-induction were efficient methods in enhancing the expression quantity and activity of nucleoside phosphorylases, and they also had significant implications for large-scale industrial production of dUR and synthesis of other nucleoside derivatives. PMID:24910260

  9. Determination of expression and activity of genes involved in starch metabolism in Lactobacillus plantarum A6 during fermentation of a cereal-based gruel.

    PubMed

    Humblot, Christèle; Turpin, Williams; Chevalier, François; Picq, Christian; Rochette, Isabelle; Guyot, Jean-Pierre

    2014-08-18

    Traditional fermented gruels prepared from cereals are widely used for complementary feeding of young children in Africa and usually have a low energy density. The amylase activity of some lactic acid bacteria (LAB) helps increase the energy content of gruels through partial hydrolysis of starch, thus enabling the incorporation of more starchy material while conserving the desired semi-liquid consistency for young children. Even if this ability is mainly related to the production of alpha-amylase (E.C. 3.2.1.1), in a recent molecular screening, genes coding for enzymes involved in starch metabolism were detected in the efficient amylolytic LAB Lactobacillus plantarum A6: alpha-glucosidase (E.C. 3.2.1.20), neopullulanase (E.C. 3.2.1.135), amylopectin phosphorylase (E.C. 2.4.1.1) and maltose phosphorylase (E.C. 2.4.1.8). The objective of this study was to investigate the expression of these genes in a model of starchy fermented food made from pearl millet (Pennisetum glaucum). Transcriptional and enzymatic analyses were performed during the 18-h fermentation period. Liquefaction was mainly caused by an extracellular alpha amylase encoded by the amyA gene specific to the A6 strain among L. plantarum species and found in both Lactobacillus amylovorus and Lactobacillus manihotivorans. The second most active enzyme was neopullulanase. Other starch metabolizing enzymes were less often detected. The dynamic detection of transcripts of gene during starch fermentation in pearl millet porridge suggests that the set of genes we investigated was not expressed continuously but transiently. PMID:24950021

  10. Mixed biopolymer systems based on starch.

    PubMed

    Abd Elgadir, M; Akanda, Md Jahurul Haque; Ferdosh, Sahena; Mehrnoush, Amid; Karim, Alias A; Noda, Takahiro; Sarker, Md Zaidul Islam

    2012-01-01

    A binary mixture of starch-starch or starch with other biopolymers such as protein and non-starch polysaccharides could provide a new approach in producing starch-based food products. In the context of food processing, a specific adjustment in the rheological properties plays an important role in regulating production processing and optimizing the applicability, stability, and sensory of the final food products. This review examines various biopolymer mixtures based on starch and the influence of their interaction on physicochemical and rheological properties of the starch-based foods. It is evident that the physicochemical and rheological characteristics of the biopolymers mixture are highly dependent on the type of starch and other biopolymers that make them up mixing ratios, mixing procedure and presence of other food ingredients in the mixture. Understanding these properties will lead to improve the formulation of starch-based foods and minimize the need to resort to chemically modified starch. PMID:22231495

  11. Powder and compaction characteristics of pregelatinized starches.

    PubMed

    Rojas, J; Uribe, Y; Zuluaga, A

    2012-06-01

    Pregelatinized starch is widely used as a pharmaceutical aid, especially as a filler-binder. It is known that the tableting performance of excipients could be affected by their source. The aim of this study was to evaluate the powder and tableting properties of pregelatinized starches obtained from yucca, corn and rice and compare those properties with those of Starch 1500. This material had the lowest particle size, and porosity and largest density and best flow. However, yucca starch and corn starch showed an irregular granule morphology, better compactibility and compressibility than Starch 1500. Their onset of plastic deformation and their strain rate sensitivity was comparable to that of Starch 1500. These two materials showed compact disintegration slower that Starch 1500. Conversely, rice starch showed a high elasticity, and friability, low compactibility, which are undesirable for direct compression. This study demonstrated the potential use of pregelatinized starches, especially those obtained from yucca and corn as direct compression filler-binders. PMID:22822539

  12. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    SciTech Connect

    Abramchik, Yu. A. Timofeev, V. I. Zhukhlistova, N. E.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamer is the biological active form of E. coli. purine nucleoside phosphorylase.

  13. Unbalanced deoxynucleotide pools cause mitochondrial DNA instability in thymidine phosphorylase-deficient mice.

    PubMed

    López, Luis C; Akman, Hasan O; García-Cazorla, Angeles; Dorado, Beatriz; Martí, Ramón; Nishino, Ichizo; Tadesse, Saba; Pizzorno, Giuseppe; Shungu, Dikoma; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

    2009-02-15

    Replication and repair of DNA require equilibrated pools of deoxynucleoside triphosphate precursors. This concept has been proven by in vitro studies over many years, but in vivo models are required to demonstrate its relevance to multicellular organisms and to human diseases. Accordingly, we have generated thymidine phosphorylase (TP) and uridine phosphorylase (UP) double knockout (TP(-/-)UP(-/-)) mice, which show severe TP deficiency, increased thymidine and deoxyuridine in tissues and elevated mitochondrial deoxythymidine triphosphate. As consequences of the nucleotide pool imbalances, brains of mutant mice developed partial depletion of mtDNA, deficiencies of respiratory chain complexes and encephalopathy. These findings largely account for the pathogenesis of mitochondrial neurogastrointestinal encephalopathy (MNGIE), the first inherited human disorder of nucleoside metabolism associated with somatic DNA instability. PMID:19028666

  14. Characterization and crystal structure determination of β-1,2-mannobiose phosphorylase from Listeria innocua.

    PubMed

    Tsuda, Tomohiro; Nihira, Takanori; Chiku, Kazuhiro; Suzuki, Erika; Arakawa, Takatoshi; Nishimoto, Mamoru; Kitaoka, Motomitsu; Nakai, Hiroyuki; Fushinobu, Shinya

    2015-12-21

    Glycoside hydrolase family 130 consists of phosphorylases and hydrolases for β-mannosides. Here, we characterized β-1,2-mannobiose phosphorylase from Listeria innocua (Lin0857) and determined its crystal structures complexed with β-1,2-linked mannooligosaccharides. β-1,2-Mannotriose was bound in a U-shape, interacting with a phosphate analog at both ends. Lin0857 has a unique dimer structure connected by a loop, and a significant open-close loop displacement was observed for substrate entry. A long loop, which is exclusively present in Lin0857, covers the active site to limit the pocket size. A structural basis for substrate recognition and phosphorolysis was provided. PMID:26632508

  15. Three-dimensional structure of E. Coli purine nucleoside phosphorylase at 0.99 Å resolution

    NASA Astrophysics Data System (ADS)

    Timofeev, V. I.; Abramchik, Yu. A.; Zhukhlistova, N. E.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-03-01

    Purine nucleoside phosphorylases (PNPs) catalyze the reversible phosphorolysis of nucleosides and are key enzymes involved in nucleotide metabolism. They are essential for normal cell function and can catalyze the transglycosylation. Crystals of E. coli PNP were grown in microgravity by the capillary counterdiffusion method through a gel layer. The three-dimensional structure of the enzyme was determined by the molecular-replacement method at 0.99 Å resolution. The structural features are considered, and the structure of E. coli PNP is compared with the structures of the free enzyme and its complexes with purine base derivatives established earlier. A comparison of the environment of the purine base in the complex of PNP with formycin A and of the pyrimidine base in the complex of uridine phosphorylase with thymidine revealed the main structural features of the base-binding sites. Coordinates of the atomic model determined with high accuracy were deposited in the Protein Data Bank (PDB_ID: 4RJ2).

  16. Effect of 5-Fluorouracil on Thymidine Phosphorylase Activity in Model Experiment.

    PubMed

    Stashkevich, M A; Khomutov, E V; Dumanskii, Yu V; Matvienko, A G; Zinkovich, I I

    2016-03-01

    Variations in thymidine phosphorylase activity in rat liver were studied in 1, 3, 6, 12, and 24 h after intraperitoneal bolus injection of 5-fluorouracil. Enzyme activity was measured by HPLC. A 2-fold decrease in enzyme activity was observed 3 h after 5-fluorouracil administration and persisted for 12 h. This additional effect of the cytostatic should be taken into account in choosing chemotherapy protocol. PMID:27021101

  17. Effects of granule swelling on starch saccharification by granular starch hydrolyzing enzyme.

    PubMed

    Li, Zhaofeng; Cai, Liming; Gu, Zhengbiao; Shi, Yong-Cheng

    2014-08-13

    The effects of granule swelling on enzymatic saccharification of normal corn starch by granular starch hydrolyzing enzyme were investigated. After swelling, Km values for the saccharification of granular starch decreased compared with native granular starch, indicating that granule swelling caused granular starch hydrolyzing enzyme to have higher affinity for starch granules. The partial swelling of starch granules enhanced starch saccharification. Furthermore, the enhancement at an earlier stage of enzymatic reaction was much more significant than that at later stages. For granular starch pretreated at 67.5 °C for 30 min, conversions to glucose after incubation with the enzyme at 32 °C for 4 and 24 h were approximately 3-fold and 26% higher than for native granular starch, respectively. As a result, proper heat pretreatment of granular starch before simultaneous saccharification and fermentation has great potential to facilitate industrial production of ethanol by use of granular starch hydrolyzing enzyme. PMID:25039418

  18. A novel ECGF1 mutation in a Thai patient with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE).

    PubMed

    Kintarak, Jutatip; Liewluck, Teerin; Sangruchi, Tumtip; Hirano, Michio; Kulkantrakorn, Kongkiat; Muengtaweepongsa, Sombat

    2007-09-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive, multisystem disorder, which is clinically defined by ptosis, ophthalmoparesis, gastrointestinal dysmotility, cachexia, peripheral neuropathy, and leukoencephalopathy. MNGIE is caused by mutations in the nuclear gene, endothelial cell growth factor 1 (ECGF1), encoding thymidine phosphorylase (TP). ECGF1 mutations cause severe loss of TP activity, abnormal accumulations of thymidine and deoxyuridine in plasma, and alterations of mitochondrial DNA. Here, we report the first Thai patient with MNGIE confirmed genetically by the identification of a homozygous novel ECGF1 gene mutation, c.100insC, which causes a frameshift and premature truncation of TP protein. PMID:17544574

  19. Nonsense Mutations in the Maltose A Region of the Genetic Map of Escherichia coli

    PubMed Central

    Hatfield, Dolph; Hofnung, Maurice; Schwartz, Maxime

    1969-01-01

    The isolation of one amber mutation in malQ, one ochre mutation in malP, and seven amber mutations in malT is reported. A study of their phenotypic expressions in the presence of the amber suppressor suIII and the ochre suppressor suc suggests that (i) malQ is the structural gene for amylomaltase; (ii) malQ and the structural gene for maltodextrin phosphorylase, malP, belong to the same operon; (iii) the malT product, which promotes the expression of the malP-malQ operon, is a protein synthesized in limiting amounts by the wild-type strain. PMID:4902812

  20. Overcoming inefficient cellobiose fermentation by cellobiose phosphorylase in the presence of xylose

    PubMed Central

    2014-01-01

    Background Cellobiose and xylose co-fermentation holds promise for efficiently producing biofuels from plant biomass. Cellobiose phosphorylase (CBP), an intracellular enzyme generally found in anaerobic bacteria, cleaves cellobiose to glucose and glucose-1-phosphate, providing energetic advantages under the anaerobic conditions required for large-scale biofuel production. However, the efficiency of CBP to cleave cellobiose in the presence of xylose is unknown. This study investigated the effect of xylose on anaerobic CBP-mediated cellobiose fermentation by Saccharomyces cerevisiae. Results Yeast capable of fermenting cellobiose by the CBP pathway consumed cellobiose and produced ethanol at rates 61% and 42% slower, respectively, in the presence of xylose than in its absence. The system generated significant amounts of the byproduct 4-O-β-d-glucopyranosyl-d-xylose (GX), produced by CBP from glucose-1-phosphate and xylose. In vitro competition assays identified xylose as a mixed-inhibitor for cellobiose phosphorylase activity. The negative effects of xylose were effectively relieved by efficient cellobiose and xylose co-utilization. GX was also shown to be a substrate for cleavage by an intracellular β-glucosidase. Conclusions Xylose exerted negative impacts on CBP-mediated cellobiose fermentation by acting as a substrate for GX byproduct formation and a mixed-inhibitor for cellobiose phosphorylase activity. Future efforts will require efficient xylose utilization, GX cleavage by a β-glucosidase, and/or a CBP with improved substrate specificity to overcome the negative impacts of xylose on CBP in cellobiose and xylose co-fermentation. PMID:24944578

  1. FR258900, a potential anti-hyperglycemic drug, binds at the allosteric site of glycogen phosphorylase

    PubMed Central

    Tiraidis, Costas; Alexacou, Kyra-Melinda; Zographos, Spyros E.; Leonidas, Demetres D.; Gimisis, Thanasis; Oikonomakos, Nikos G.

    2007-01-01

    FR258900 has been discovered as a novel inhibitor of human liver glycogen phosphorylase a and proved to suppress hepatic glycogen breakdown and reduce plasma glucose concentrations in diabetic mice models. To elucidate the mechanism of inhibition, we have determined the crystal structure of the cocrystallized rabbit muscle glycogen phosphorylase b–FR258900 complex and refined it to 2.2 Å resolution. The structure demonstrates that the inhibitor binds at the allosteric activator site, where the physiological activator AMP binds. The contacts from FR258900 to glycogen phosphorylase are dominated by nonpolar van der Waals interactions with Gln71, Gln72, Phe196, and Val45′ (from the symmetry-related subunit), and also by ionic interactions from the carboxylate groups to the three arginine residues (Arg242, Arg309, and Arg310) that form the allosteric phosphate-recognition subsite. The binding of FR258900 to the protein promotes conformational changes that stabilize an inactive T-state quaternary conformation of the enzyme. The ligand-binding mode is different from those of the potent phenoxy-phthalate and acyl urea inhibitors, previously described, illustrating the broad specificity of the allosteric site. PMID:17600143

  2. FR258900, a potential anti-hyperglycemic drug, binds at the allosteric site of glycogen phosphorylase.

    PubMed

    Tiraidis, Costas; Alexacou, Kyra-Melinda; Zographos, Spyros E; Leonidas, Demetres D; Gimisis, Thanasis; Oikonomakos, Nikos G

    2007-08-01

    FR258900 has been discovered as a novel inhibitor of human liver glycogen phosphorylase a and proved to suppress hepatic glycogen breakdown and reduce plasma glucose concentrations in diabetic mice models. To elucidate the mechanism of inhibition, we have determined the crystal structure of the cocrystallized rabbit muscle glycogen phosphorylase b-FR258900 complex and refined it to 2.2 A resolution. The structure demonstrates that the inhibitor binds at the allosteric activator site, where the physiological activator AMP binds. The contacts from FR258900 to glycogen phosphorylase are dominated by nonpolar van der Waals interactions with Gln71, Gln72, Phe196, and Val45' (from the symmetry-related subunit), and also by ionic interactions from the carboxylate groups to the three arginine residues (Arg242, Arg309, and Arg310) that form the allosteric phosphate-recognition subsite. The binding of FR258900 to the protein promotes conformational changes that stabilize an inactive T-state quaternary conformation of the enzyme. The ligand-binding mode is different from those of the potent phenoxy-phthalate and acyl urea inhibitors, previously described, illustrating the broad specificity of the allosteric site. PMID:17600143

  3. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.

    PubMed

    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi

    2016-03-01

    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes. PMID:26689855

  4. Inhibition of rabbit muscle glycogen phosphorylase by D-gluconohydroximo-1,5-lactone-N-phenylurethane.

    PubMed

    Papageorgiou, A C; Oikonomakos, N G; Leonidas, D D

    1989-08-01

    The effect of the beta-glycosidase inhibitor D-gluconohydroximo-1,5-lactone-N-phenylurethane (PUG) on the kinetic and ultracentrifugation properties of glycogen phosphorylase has been studied. Recent crystallographic work at 2.4 A resolution [D. Barford et al. (1988) Biochemistry 27, 6733-6741] has shown that PUG binds in the catalytic site of phosphorylase b crystals with its gluconohydroximolactone moiety occupying a position similar to that observed for other glucosyl compounds and the N-phenylurethane side chain fitting into an adjacent cavity with little conformational change in the enzyme. In solution, PUG was shown to be a potent inhibitor of phosphorylase b, directly competitive with alpha-D-glucopyranose 1-phosphate (glucose-1-P) (Ki = 0.40 mM) and noncompetitive with respect to glycogen and AMP. When PUG was tested for synergistic inhibition in the presence of caffeine, the Dixon plots of reciprocal velocity versus PUG concentration at different fixed caffeine concentrations provided intersecting lines with interaction constant (alpha) values of 0.95-1.38, indicating that the binding of one inhibitor is not significantly affected by the binding of the other. For glycogen phosphorolysis, PUG was noncompetitive with respect to phosphate, suggesting that it can bind to the central enzyme-AMP-glycogen-phosphate complex. PUG was shown to inhibit phosphorylase alpha (without AMP) activity (Ki = 0.43 mM) in a manner similar to that of the b form. However, in the presence of AMP, PUG exhibited complex kinetics, acting as a noncompetitive inhibitor with respect to glucose-1-P, while a twofold decrease of PUG binding to the enzyme-AMP-glycogen complex was observed. Ultracentrifugation experiments demonstrated that PUG does not cause any significant dissociation of phosphorylase alpha tetramer. Furthermore the dimerization of phosphorylase alpha by glucose is completely prevented in the presence of PUG. These observations are consistent with PUG binding to both the

  5. Activator anion binding site in pyridoxal phosphorylase b: the binding of phosphite, phosphate, and fluorophosphate in the crystal.

    PubMed

    Oikonomakos, N G; Zographos, S E; Tsitsanou, K E; Johnson, L N; Acharya, K R

    1996-12-01

    It has been established that phosphate analogues can activate glycogen phosphorylase reconstituted with pyridoxal in place of the natural cofactor pyridoxal 5'-phosphate (Change YC. McCalmont T, Graves DJ. 1983. Biochemistry 22:4987-4993). Pyridoxal phosphorylase b has been studied by kinetic, ultracentrifugation, and X-ray crystallographic experiments. In solution, the catalytically active species of pyridoxal phosphorylase b adopts a conformation that is more R-state-like than that of native phosphorylase b, but an inactive dimeric species of the enzyme can be stabilized by activator phosphite in combination with the T-state inhibitor glucose. Co-crystals of pyridoxal phosphorylase b complexed with either phosphite, phosphate, or fluorophosphate, the inhibitor glucose, and the weak activator IMP were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the structures of the complexes have been refined to give crystallographic R factors of 18.5-19.2%, for data between 8 and 2.4 A resolution. The anions bind tightly at the catalytic site in a similar but not identical position to that occupied by the cofactor 5'-phosphate group in the native enzyme (phosphorus to phosphorus atoms distance = 1.2 A). The structural results show that the structures of the pyridoxal phosphorylase b-anion-glucose-IMP complexes are overall similar to the glucose complex of native T-state phosphorylase b. Structural comparisons suggest that the bound anions, in the position observed in the crystal, might have a structural role for effective catalysis. PMID:8976550

  6. Activator anion binding site in pyridoxal phosphorylase b: the binding of phosphite, phosphate, and fluorophosphate in the crystal.

    PubMed Central

    Oikonomakos, N. G.; Zographos, S. E.; Tsitsanou, K. E.; Johnson, L. N.; Acharya, K. R.

    1996-01-01

    It has been established that phosphate analogues can activate glycogen phosphorylase reconstituted with pyridoxal in place of the natural cofactor pyridoxal 5'-phosphate (Change YC. McCalmont T, Graves DJ. 1983. Biochemistry 22:4987-4993). Pyridoxal phosphorylase b has been studied by kinetic, ultracentrifugation, and X-ray crystallographic experiments. In solution, the catalytically active species of pyridoxal phosphorylase b adopts a conformation that is more R-state-like than that of native phosphorylase b, but an inactive dimeric species of the enzyme can be stabilized by activator phosphite in combination with the T-state inhibitor glucose. Co-crystals of pyridoxal phosphorylase b complexed with either phosphite, phosphate, or fluorophosphate, the inhibitor glucose, and the weak activator IMP were grown in space group P4(3)2(1)2, with native-like unit cell dimensions, and the structures of the complexes have been refined to give crystallographic R factors of 18.5-19.2%, for data between 8 and 2.4 A resolution. The anions bind tightly at the catalytic site in a similar but not identical position to that occupied by the cofactor 5'-phosphate group in the native enzyme (phosphorus to phosphorus atoms distance = 1.2 A). The structural results show that the structures of the pyridoxal phosphorylase b-anion-glucose-IMP complexes are overall similar to the glucose complex of native T-state phosphorylase b. Structural comparisons suggest that the bound anions, in the position observed in the crystal, might have a structural role for effective catalysis. PMID:8976550

  7. Novel POLG mutations in progressive external ophthalmoplegia mimicking mitochondrial neurogastrointestinal encephalomyopathy.

    PubMed

    Van Goethem, Gert; Schwartz, Marianne; Löfgren, Ann; Dermaut, Bart; Van Broeckhoven, Christine; Vissing, John

    2003-07-01

    Autosomal recessive progressive external ophthalmoplegia (PEO) is one clinical disorder associated with multiple mitochondrial DNA deletions and can be caused by missense mutations in POLG, the gene encoding the mitochondrial DNA polymerase gamma. Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is another autosomal recessive disorder associated with PEO and multiple deletions of mitochondrial DNA in skeletal muscle. In several patients this disorder is caused by loss of function mutations in the gene encoding thymidine phosphorylase (TP). We report a recessive family with features of MNGIE but no leukoencephalopathy in which two patients carry three missense mutations in POLG, of which two are novel mutations (N846S and P587L). The third mutation was previously reported as a recessive POLG mutation (T251I). This finding indicates the need for POLG sequencing in patients with features of MNGIE without TP mutations. PMID:12825077

  8. Deficiency of maize starch-branching enzyme i results in altered starch fine structure, decreased digestibility and reduced coleoptile growth during germination

    PubMed Central

    2011-01-01

    Background Two distinct starch branching enzyme (SBE) isoforms predate the divergence of monocots and dicots and have been conserved in plants since then. This strongly suggests that both SBEI and SBEII provide unique selective advantages to plants. However, no phenotype for the SBEI mutation, sbe1a, had been previously observed. To explore this incongruity the objective of the present work was to characterize functional and molecular phenotypes of both sbe1a and wild-type (Wt) in the W64A maize inbred line. Results Endosperm starch granules from the sbe1a mutant were more resistant to digestion by pancreatic α-amylase, and the sbe1a mutant starch had an altered branching pattern for amylopectin and amylose. When kernels were germinated, the sbe1a mutant was associated with shorter coleoptile length and higher residual starch content, suggesting that less efficient starch utilization may have impaired growth during germination. Conclusions The present report documents for the first time a molecular phenotype due to the absence of SBEI, and suggests strongly that it is associated with altered physiological function of the starch in vivo. We believe that these results provide a plausible rationale for the conservation of SBEI in plants in both monocots and dicots, as greater seedling vigor would provide an important survival advantage when resources are limited. PMID:21599988

  9. Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

    SciTech Connect

    Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.; Pavlyuk, Bogdan Ph.; Kachalova, Galina S.; Betzel, Christian

    2007-10-01

    S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding the catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.

  10. Starch-degrading polysaccharide monooxygenases.

    PubMed

    Vu, Van V; Marletta, Michael A

    2016-07-01

    Polysaccharide degradation by hydrolytic enzymes glycoside hydrolases (GHs) is well known. More recently, polysaccharide monooxygenases (PMOs, also known as lytic PMOs or LPMOs) were found to oxidatively degrade various polysaccharides via a copper-dependent hydroxylation. PMOs were previously thought to be either GHs or carbohydrate binding modules (CBMs), and have been re-classified in carbohydrate active enzymes (CAZY) database as auxiliary activity (AA) families. These enzymes include cellulose-active fungal PMOs (AA9, formerly GH61), chitin- and cellulose-active bacterial PMOs (AA10, formerly CBM33), and chitin-active fungal PMOs (AA11). These PMOs significantly boost the activity of GHs under industrially relevant conditions, and thus have great potential in the biomass-based biofuel industry. PMOs that act on starch are the latest PMOs discovered (AA13), which has expanded our perspectives in PMOs studies and starch degradation. Starch-active PMOs have many common structural features and biochemical properties of the PMO superfamily, yet differ from other PMO families in several important aspects. These differences likely correlate, at least in part, to the differences in primary and higher order structures of starch and cellulose, and chitin. In this review we will discuss the discovery, structural features, biochemical and biophysical properties, and possible biological functions of starch-active PMOs, as well as their potential application in the biofuel, food, and other starch-based industries. Important questions regarding various aspects of starch-active PMOs and possible economical driving force for their future studies will also be highlighted. PMID:27170366

  11. Impact of Waxy, Partial Waxy, and Wildtype Wheat Starch Fraction Properties on Hearth Bread Characteristics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thirteen different wheat (Triticum aestivum L.)cultivars were selected to represent GBSS mutations: three each of wildtype, axnull, and bxnull, and two each of 2xnull and waxy. Starch and A- and B-granules were purified from wheat flour. Hearth bread loaves were produced from the flours using a smal...

  12. Kernel Composition, Starch Structure, and Enzyme Digestibility of Opaque-2 Maize and Quality Protein Maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objectives of this study were to understand how opaque-2 (o2) mutation and quality protein maize (QPM) affect maize kernel composition and starch structure, property, and enzyme digestibility. Kernels of o2 maize contained less protein (9.6−12.5%) than those of the wild-type (WT) counterparts (12...

  13. Rheological properties of reactive extrusion modified waxy starch and waxy starch-polyacrylamide copolymer gels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rheological properties of modified waxy starch and waxy starch-polyacrylamide graft copolymers prepared by reactive extrusion were investigated. Both materials can absorb huge amount of water and form gels. The modified waxy starch and waxy starch-polyacrylamide graft copolymer gels all exhibite...

  14. Comparison of Cationic and Unmodified Starches in Reactive Extrusion of Starch-Polyacrylamide Graft Copolymers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Graft copolymers of starch and polyacrylamide (PAAm) were prepared using reactive extrusion in a corotating twin screw extruder. The effect of cationic starch modification was examined using unmodified and cationic dent starch (approximately 23% amylose) and waxy maize starch (approximately 2% amyl...

  15. Starch phosphorylation: insights and perspectives.

    PubMed

    Mahlow, Sebastian; Orzechowski, Sławomir; Fettke, Joerg

    2016-07-01

    During starch metabolism, the phosphorylation of glucosyl residues of starch, to be more precise of amylopectin, is a repeatedly observed process. This phosphorylation is mediated by dikinases, the glucan, water dikinase (GWD) and the phosphoglucan, water dikinase (PWD). The starch-related dikinases utilize ATP as dual phosphate donor transferring the terminal γ-phosphate group to water and the β-phosphate group selectively to either C6 position or C3 position of a glucosyl residue within amylopectin. By the collaborative action of both enzymes, the initiation of a transition of α-glucans from highly ordered, water-insoluble state to a less order state is realized and thus the initial process of starch degradation. Consequently, mutants lacking either GWD or PWD reveal a starch excess phenotype as well as growth retardation. In this review, we focus on the increased knowledge collected over the last years related to enzymatic properties, the precise definition of the substrates, the physiological implications, and discuss ongoing questions. PMID:27147464

  16. Quality of Spelt Wheat and its Starch

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flours from 5 spelt cultivars grown over 3 years were evaluated as to their bread baking quality and isolated starch properties. The starch properties included amylose contents, gelatinization temperatures (differential scanning calorimetry), granule size distributions and pasting properties. Mill...

  17. Production and Characteristics of Raw-Starch-Digesting α-Amylase from a Protease-Negative Aspergillus ficum Mutant

    PubMed Central

    Hayashida, Shinsaku; Teramoto, Yuji

    1986-01-01

    Mutational experiments were carried out to decrease the protease productivity of Aspergillus ficum IFO 4320 by using N-methyl-N′-nitro-N-nitrosoguanidine. A protease-negative mutant, M-33, exhibited higher α-amylaseactivity than the parent strain under submerged culture at 30°C for 24 h. About 70% of the total α-amylase activity in the M-33 culture filtrate was adsorbed onto starch granules. The electrophoretically homogeneous preparation of raw-starch-adsorbable α-amylase (molecular weight, 88,000), acid stable at pH 2, showed intensive raw-starch-digesting activity, dissolving corn starch granules completely. The preparation also exhibited a high synergistic effect with glucoamylase I. A mutant, M-72, with higher protease activity produced a raw cornstarch-unadsorbable α-amylase. The purified enzyme (molecular weight, 54,000), acid unstable, showed no digesting activity on raw corn starch and a lower synergistic effect with glucoamylase I in the hydrolysis of raw corn starch. The fungal α-amylase was therefore divided into two types, a novel type of raw-starch-digesting enzyme and a conventional type of raw-starch-nondigesting enzyme. Images PMID:16347204

  18. Insulin-independent glycogen supercompensation in isolated mouse skeletal muscle: role of phosphorylase inactivation.

    PubMed

    Sandström, Marie E; Abbate, Fabio; Andersson, Daniel C; Zhang, Shi-Jin; Westerblad, Håkan; Katz, Abram

    2004-08-01

    Glycogen supercompensation (increase in muscle glycogen content above basal) is an established phenomenon induced by unknown mechanisms. It consists of both insulin-dependent and -independent components. Here, we investigate insulin-independent glycogen supercompensation in isolated, intact extensor digitorum longus muscles from mice. Muscles were stimulated electrically, incubated in vitro with 5.5 mM glucose for up to 16 h and then analysed for glycogen, glucose uptake and enzyme activities. Basal glycogen was 84+/-6 micro mol glucosyl units/g dry muscle and was depleted by 80% after 10 min contraction. Glycogen increased after contraction, reaching a peak value of 113+/-9 micro mol glucosyl units/g dry muscle ( P<0.05 vs. basal) by 6 h, and returned to basal values by 16 h (84+/-8). Maximal activities of glycogen synthase, phosphorylase and alpha-glucosidase were not significantly altered by contraction or during the 6-h recovery period. Glycogen synthase fractional activity (0.17/7.2 mM glucose-6-P; inversely related to phosphorylation state of the enzyme) was increased about twofold early after contraction but then decreased and was slightly lower than baseline during the period of supercompensation (4-6 h). Phosphorylase fractional activity (+/-adenosine monophosphate; directly related to phosphorylation state of the enzyme) decreased to 60% of basal after contraction and decreased further during the initial 4 h of recovery to 40% of basal ( P<0.01 vs. basal). After 4 h recovery, glucose uptake was slightly (50%) higher in the stimulated than in the non-stimulated muscle ( P<0.01). Thus, insulin-independent glycogen supercompensation involves inactivation of phosphorylase and hence an inhibition of glycogen breakdown. PMID:15085341

  19. Studies of Amylose Content in Potato Starch

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Potato starch is typically low in amylose (~20-25%), but high amylose starch has superior nutritional qualities. The ratio between amylose and amylopectin is the most important property influencing the physical properties of starch. There is a strong case to be made for the development of food crops...

  20. Starch in the Wet-End

    NASA Astrophysics Data System (ADS)

    de Clerck, Peter

    Starch has been used in papermaking almost since the invention of paper. The global paper industry consumes almost 5 million tonnes of starch per year, making starch the third most important raw material in papermaking. Roughly 20% of this is used in the wet-end.

  1. Starch Granule Variability in Wild Solanum Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Because most of the dry matter of potato tubers is starch, an understanding of starch properties is important in potato improvement programs. Starch granule size is considered to influence tuber processing quality parameters such as gelatinization temperature, viscosity, and water holding capacity. ...

  2. TRIBOLOGICAL PROPERTIES OF CHEMICALLY MODIFIED STARCH

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch is one of the most abundantly available plant-based biopolymer. It is a major component of such high volume commodity crops as corn, potato, and rice. Starch is a highly crystalline, high molecular weight poly(glucose) biopolymer. Starch is insoluble in water in its native state. Various ...

  3. Esterification of Starch in Ionic Liquids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We shall discuss the use of various ionic liquids in the preparation of starch esters. Starch was reacted with vinyl acetate in different 1-butyl-3-methylimidazolium (bmim) salts as solvents in an effort to produce starches with different acetylation patterns. Overall degree of substitution (DS) w...

  4. Rice functionality, starch structure and the genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Through collaborative efforts among USDA scientists at Beaumont, Texas, we have gained in-depth knowledge of how rice functionality, i.e. the texture of the cooked rice, rice processing properties, and starch gelatinization temperature, are associated with starch-synthesis genes and starch structure...

  5. Structure of Porous Starch Microcellular Foam Particles

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A relatively new starch product with various novel applications is a porous microcellular foam. The foam product is made by dehydrating a starch hydrogel in a solvent such as ethanol and then removing the solvent to form a foam product. The process involves heating an aqueous slurry of starch (8% w/...

  6. Potassium ion-dependent trehalose phosphorylase from halophilic Bacillus selenitireducens MLS10.

    PubMed

    Nihira, Takanori; Saito, Yuka; Chiku, Kazuhiro; Kitaoka, Motomitsu; Ohtsubo, Ken'ichi; Nakai, Hiroyuki

    2013-11-01

    We discovered a potassium ion-dependent trehalose phosphorylase (Bsel_1207) belonging to glycoside hydrolase family 65 from halophilic Bacillus selenitireducens MLS10. Under high potassium ion concentrations, the recombinant Bsel_1207 produced in Escherichia coli existed as an active dimeric form that catalyzed the reversible phosphorolysis of trehalose in a typical sequential bi bi mechanism releasing β-D-glucose 1-phosphate and D-glucose. Decreasing potassium ion concentrations significantly reduced thermal and pH stabilities, leading to formation of inactive monomeric Bsel_1207. PMID:24021648

  7. Facile enzymatic synthesis of sugar 1-phosphates as substrates for phosphorylases using anomeric kinases.

    PubMed

    Liu, Yuan; Nishimoto, Mamoru; Kitaoka, Motomitsu

    2015-01-12

    Three sugar 1-phosphates that are donor substrates for phosphorylases were produced at the gram scale from phosphoenolpyruvic acid and the corresponding sugars by the combined action of pyruvate kinase and the corresponding anomeric kinases in good yields. These sugar 1-phosphates were purified through two electrodialysis steps. α-D-Galactose 1-phosphate was finally isolated as crystals of dipotassium salts. α-D-Mannose 1-phosphate and 2-acetamido-2-deoxy-α-D-glucose 1-phosphate were isolated as crystals of bis(cyclohexylammonium) salts. PMID:25464074

  8. Methylthioadenosine phosphorylase compositions and methods of use in the diagnosis and treatment of proliferative disorders

    DOEpatents

    Olopade, Olufunmilayo I.

    2005-03-22

    Disclosed are novel nucleic acid and peptide compositions comprising methythlioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and idenification tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

  9. Compositions and methods involving methyladenosine phosphorylase in the diagnosis and treatment of proliferative disorders

    DOEpatents

    Olopade, Olufunmilayo I.

    2007-03-20

    Disclosed are novel nucleic acid and peptide compositions comprising methylthioadenosine phosphorylase (MTAP) and methods of use for MTAP amino acid sequences and DNA segments comprising MTAP in the diagnosis of human cancers and development of MTAP-specific antibodies. Also disclosed are methods for the diagnosis and treatment of tumors and other proliferative cell disorders, and identification of tumor suppressor genes and gene products from the human 9p21-p22 chromosome region. Such methods are useful in the diagnosis of multiple tumor types such as bladder cancer, lung cancer, breast cancer, pancreatic cancer, brain tumors, lymphomas, gliomas, melanomas, and leukemias.

  10. Properties of retrograded and acetylated starch produced via starch extrusion or starch hydrolysis with pullulanase.

    PubMed

    Kapelko, M; Zięba, T; Gryszkin, A; Styczyńska, M; Wilczak, A

    2013-09-12

    The aim of the present study was to determine the impact of serial modifications of starch, including firstly starch extrusion or hydrolysis with pullulanase, followed by retrogradation (through freezing and defrosting of pastes) and acetylation (under industrial conditions), on its susceptibility to amylolysis. The method of production had a significant effect on properties of the resultant preparations, whilst the direction and extent of changes depended on the type of modification applied. In the produced starch esters, the degree of substitution, expressed by the per cent of acetylation, ranged from 3.1 to 4.4 g/100 g. The acetylation had a significant impact on contents of elements determined with the atomic emission spectrometry, as it contributed to an increased Na content and decreased contents of Ca and K. The DSC thermal characteristics enabled concluding that the modifications caused an increase in temperatures and a decrease in heat of transition (or its lack). The acetylation of retrograded starch preparations increased their solubility in water and water absorbability. The modifications were found to exert various effects on the rheological properties of pastes determined based on the Brabender's pasting characteristics and flow curves determined with the use of an oscillatory-rotating viscosimeter. All starch acetates produced were characterized by ca. 40% resistance to amylolysis. PMID:23911484

  11. Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) in two Mexican brothers harboring a novel mutation in the ECGF1 gene.

    PubMed

    Monroy, Nancy; Macías Kauffer, Luis R; Mutchinick, Osvaldo M

    2008-01-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare autosomal recessive disease caused by mutations in the thymidine phosphorylase gene located on chromosome 22q13.32-ter, causing defective functioning of the enzyme. At present 87 sporadic or familial cases have been reported and 52 different mutations identified. We present herein the clinical, neuromuscular and molecular findings of two affected brothers from an indigenous Mexican family living in a very small village not far from Mexico City, both brothers being homozygous for a novel mutation (Leu133Pro) in exon 3 of the ECGF1 gene. PMID:18280229

  12. Expression of the yeast glycogen phosphorylase gene is regulated by stress-response elements and by the HOG MAP kinase pathway.

    PubMed

    Sunnarborg, S W; Miller, S P; Unnikrishnan, I; LaPorte, D C

    2001-12-01

    Yeast glycogen metabolism responds to environmental stressors such as nutrient limitation and heat shock. This response is mediated, in part, by the regulation of the glycogen metabolic genes. Environmental stressors induce a number of glycogen metabolic genes, including GPH1, which encodes glycogen phosphorylase. Primer extension analysis detected two start sites for GPH1, one of which predominated. Sequences upstream of these sites included a possible TATA element. Mutation of this sequence reduced GPH1 expression by a factor of 10 but did not affect start site selection. This mutation also did not affect the relative induction of GPH1 upon entry into stationary phase. Three candidates for stress response elements (STREs) were found upstream of the TATA sequence. Mutation of the STREs showed that they were required for regulation of GPH1 expression in early stationary phase, and in response to osmotic shock and heat shock. These elements appeared to act synergistically, since the intact promoter exhibited 30-fold more expression in stationary phase than the sum of that observed for each element acting independently. HOG1, which encodes a MAP kinase, has been implicated in control mediated by STREs. For GPH1, induction by osmotic shock depended on a functional HOG1 allele. In contrast, induction upon entry into stationary phase was only partially dependent on HOG1. Furthermore, the heat shock response, which can also be mediated by STREs, was independent of HOG1. These observations suggest that the GPH1 STREs respond to more than one pathway, only one of which requires HOG1. PMID:11748727

  13. Pullulanase and Starch Synthase III Are Associated with Formation of Vitreous Endosperm in Quality Protein Maize

    PubMed Central

    Wu, Hao; Clay, Kasi; Thompson, Stephanie S.; Hennen-Bierwagen, Tracie A.; Andrews, Bethany J.; Zechmann, Bernd; Gibbon, Bryan C.

    2015-01-01

    The opaque-2 (o2) mutation of maize increases lysine content, but the low seed density and soft texture of this type of mutant are undesirable. Lines with modifiers of the soft kernel phenotype (mo2) called “Quality Protein Maize” (QPM) have high lysine and kernel phenotypes similar to normal maize. Prior research indicated that the formation of vitreous endosperm in QPM might involve changes in starch granule structure. In this study, we focused on analysis of two starch biosynthetic enzymes that may influence kernel vitreousness. Analysis of recombinant inbred lines derived from a cross of W64Ao2 and K0326Y revealed that pullulanase activity had significant positive correlation with kernel vitreousness. We also found that decreased Starch Synthase III abundance may decrease the pullulanase activity and average glucan chain length given the same Zpu1 genotype. Therefore, Starch Synthase III could indirectly influence the kernel vitreousness by affecting pullulanase activity and coordinating with pullulanase to alter the glucan chain length distribution of amylopectin, resulting in different starch structural properties. The glucan chain length distribution had strong positive correlation with the polydispersity index of glucan chains, which was positively associated with the kernel vitreousness based on nonlinear regression analysis. Therefore, we propose that pullulanase and Starch Synthase III are two important factors responsible for the formation of the vitreous phenotype of QPM endosperms. PMID:26115014

  14. Pullulanase and Starch Synthase III Are Associated with Formation of Vitreous Endosperm in Quality Protein Maize.

    PubMed

    Wu, Hao; Clay, Kasi; Thompson, Stephanie S; Hennen-Bierwagen, Tracie A; Andrews, Bethany J; Zechmann, Bernd; Gibbon, Bryan C

    2015-01-01

    The opaque-2 (o2) mutation of maize increases lysine content, but the low seed density and soft texture of this type of mutant are undesirable. Lines with modifiers of the soft kernel phenotype (mo2) called "Quality Protein Maize" (QPM) have high lysine and kernel phenotypes similar to normal maize. Prior research indicated that the formation of vitreous endosperm in QPM might involve changes in starch granule structure. In this study, we focused on analysis of two starch biosynthetic enzymes that may influence kernel vitreousness. Analysis of recombinant inbred lines derived from a cross of W64Ao2 and K0326Y revealed that pullulanase activity had significant positive correlation with kernel vitreousness. We also found that decreased Starch Synthase III abundance may decrease the pullulanase activity and average glucan chain length given the same Zpu1 genotype. Therefore, Starch Synthase III could indirectly influence the kernel vitreousness by affecting pullulanase activity and coordinating with pullulanase to alter the glucan chain length distribution of amylopectin, resulting in different starch structural properties. The glucan chain length distribution had strong positive correlation with the polydispersity index of glucan chains, which was positively associated with the kernel vitreousness based on nonlinear regression analysis. Therefore, we propose that pullulanase and Starch Synthase III are two important factors responsible for the formation of the vitreous phenotype of QPM endosperms. PMID:26115014

  15. Starch characteristics influencing resistant starch content of cooked buckwheat groats

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enzyme resistant starch (RS), owing to its health benefits such as colon cancer inhibition, reduced glycemic response, reduced cholesterol level, prevention of gall stone formation and obesity, has received an increasing attention from consumers and food manufacturers, whereas intrinsic and extrinsi...

  16. MNGIE with lack of skeletal muscle involvement and a novel TP splice site mutation.

    PubMed

    Szigeti, K; Wong, L-J C; Perng, C-L; Saifi, G M; Eldin, K; Adesina, A M; Cass, D L; Hirano, M; Lupski, J R; Scaglia, F

    2004-02-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive multisystem disorder caused by thymidine phosphorylase (TP) deficiency, resulting in severe gastrointestinal dysmotility and skeletal muscle abnormalities. A patient is reported with a classical MNGIE clinical presentation but without skeletal muscle involvement at morphological, enzymatic, or mitochondrial DNA level, though gastrointestinal myopathy was present. MNGIE was diagnosed by markedly raised plasma thymidine and reduced thymidine phosphorylase activity. Molecular genetic analysis showed a homozygous novel splice site mutation in TP. On immunohistochemical studies there was marked TP expression in the CNS, in contrast to what has been observed in rodents. It is important to examine the most significantly affected tissue and to measure TP activity and plasma thymidine in order to arrive at an accurate diagnosis in this condition. PMID:14757860

  17. Mechanical properties and solubility in water of corn starch-collagen composite films: Effect of starch type and concentrations.

    PubMed

    Wang, Kun; Wang, Wenhang; Ye, Ran; Liu, Anjun; Xiao, Jingdong; Liu, Yaowei; Zhao, Yana

    2017-02-01

    This study investigated the possibility of enhancing the properties of collagen with three different maize starches: waxy maize starch, normal starch, and high amylose starch. Scanning electron microscopy images revealed that starch-collagen films had a rougher surface compared to pure collagen films which became smoother upon heating. Amylose starch and normal starch increased the tensile strength of unheated collagen films in both dry and wet states, while all starches increased tensile strength of collagen film by heating. Depending upon the amylose content and starch concentrations, film solubility in water decreased with the addition of starch. DSC thermograms demonstrated that addition of all starches improved the thermal stability of the collagen film. Moreover, X-ray diffraction results indicated that except for high amylose starch, the crystallinity of both starch and collagen was significantly decreased when subject to heating. FTIR spectra indicated that intermolecular interactions between starch and collagen were enhanced upon heating. PMID:27596411

  18. Purification and characterization of purine nucleoside phosphorylase from developing embryos of Hyalomma dromedarii.

    PubMed

    Kamel, M Y; Fahmy, A S; Ghazy, A H; Mohamed, M A

    1991-04-01

    Purine nucleoside phosphorylase from Hyalomma dromedarii, the camel tick, was purified to apparent homogeneity. A molecular weight of 56,000 - 58,000 was estimated for both the native and denatured enzyme, suggesting that the enzyme is monomeric. Unlike purine nucleoside phosphorylase preparations from other tissues, the H. dromedarii enzyme was unstable in the presence of beta-mercaptoethanol. The enzyme had a sharp pH optimum at pH 6.5. It catalyzed the phosphorolysis and arsenolysis of ribo- and deoxyribo-nucleosides of hypoxanthine and guanine, but not of adenine or pyrimidine nucleosides. The Km values of the enzyme at the optimal pH for inosine, deoxyinosine, guanosine, and deoxyguanosine were 0.31, 0.67, 0.55, and 0.33 mM, respectively. Inactivation and kinetic studies suggested that histidine and cysteine residues were essential for activity. The pKa values determined for catalytic ionizable groups were 6-7 and 8-9. The enzyme was completely inactivated by thiol reagents and reactivated by excess beta-mercaptoethanol. The enzyme was also susceptible to pH-dependent photooxidation in the presence of methylene blue, implicating histidine. Initial velocity studies showed an intersecting pattern of double-reciprocal plots of the data, consistent with a sequential mechanism. PMID:1905141

  19. Structural basis for the mechanism of inhibition of uridine phosphorylase from Salmonella typhimurium

    SciTech Connect

    Lashkov, A. A.; Zhukhlistova, N. E.; Sotnichenko, S. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2010-01-15

    The three-dimensional structures of three complexes of Salmonella typhimurium uridine phosphorylase with the inhibitor 2,2'-anhydrouridine, the substrate PO{sub 4}, and with both the inhibitor 2,2'-anhydrouridine and the substrate PO{sub 4} (a binary complex) were studied in detail by X-ray diffraction. The structures of the complexes were refined at 2.38, 1.5, and 1.75 A resolution, respectively. Changes in the three-dimensional structure of the subunits in different crystal structures are considered depending on the presence or absence of the inhibitor molecule and (or) the phosphate ion in the active site of the enzyme. The presence of the phosphate ion in the phosphate-binding site was found to substantially change the orientations of the side chains of the amino-acid residues Arg30, Arg91, and Arg48 coordinated to this ion. A comparison showed that the highly flexible loop L9 is unstable. The atomic coordinates of the refined structures of the complexes and the corresponding structure factors were deposited in the Protein Data Bank (their PDB ID codes are 3DD0 and 3C74). The experimental data on the spatial reorganization of the active site caused by changes in its functional state from the unligated to the completely inhibited state suggest the structural basis for the mechanism of inhibition of Salmonella typhimurium uridine phosphorylase.

  20. C-Glucopyranosyl-1,2,4-triazol-5-ones: synthesis and inhibition of glycogen phosphorylase.

    PubMed

    Bokor, Éva; Széles, Zsolt; Docsa, Tibor; Gergely, Pál; Somsák, László

    2016-06-24

    Various C-glucopyranosyl-1,2,4-triazolones were designed as potential inhibitors of glycogen phosphorylase. Syntheses of these compounds were performed with O-perbenzoylated glucose derivatives as precursors. High temperature ring closure of N(1)-carbamoyl-C-β-D-glucopyranosyl formamidrazone gave 3-β-D-glucopyranosyl-1,2,4-triazol-5-one. Reaction of N(1)-tosyl-C-β-D-glucopyranosyl formamidrazone with ClCOOEt furnished 3-β-D-glucopyranosyl-1-tosyl-1,2,4-triazol-5-one. In situ prepared β-D-glucopyranosylcarbonyl isocyanate was transformed by PhNHNHBoc into 3-β-D-glucopyranosyl-1-phenyl-1,2,4-triazol-5-one, while the analogous 1-(2-naphthyl) derivative was obtained from the unsubstituted triazolone by naphthalene-2-boronic acid in a Cu(II) catalyzed N-arylation. Test compounds were prepared by Zemplén deacylation. The new glucose derivatives had weak or no inhibition of rabbit muscle glycogen phosphorylase b: the best inhibitor was 3-β-D-glucopyranosyl-1-(2-naphthyl)-1,2,4-triazol-5-one (Ki = 80 µM). PMID:26818133

  1. Identification of galacto-N-biose phosphorylase from Clostridium perfringens ATCC13124.

    PubMed

    Nakajima, Masahiro; Nihira, Takanori; Nishimoto, Mamoru; Kitaoka, Motomitsu

    2008-03-01

    Lacto-N-biose phosphorylase (LNBP) from bifidobacteria is involved in the metabolism of lacto-N-biose I (Galbeta1-->3GlcNAc, LNB) and galacto-N-biose (Galbeta1-->3GalNAc, GNB). A homologous gene of LNBP (CPF0553 protein) was identified in the genome of Clostridium perfringens ATCC13124, which is a gram-positive anaerobic intestinal bacterium. In the present study, we cloned the gene and compared the substrate specificity of the CPF0553 protein with LNBP from Bifidobacterium longum JCM1217 (LNBPBl). In the presence of alpha-galactose 1-phosphate (Gal 1-P) as a donor, the CPF0553 protein acted only on GlcNAc and GalNAc, and GalNAc was a more effective acceptor than GlcNAc. The reaction product from GlcNAc/GalNAc and Gal 1-P was identified as LNB or GNB. The CPF0553 protein also phosphorolyzed GNB much faster than LNB, which suggests that the protein should be named galacto-N-biose phosphorylase (GNBP). GNBP showed a kcat/Km value for GNB that was approximately 50 times higher than that for LNB, whereas LNBPBl showed similar kcat/Km values for both GNB and LNB. Because C. perfringens possesses a gene coding endo-alpha-N-acetylgalactosaminidase, GNBP may play a role in the intestinal residence by metabolizing GNB that is available as a mucin core sugar. PMID:18183385

  2. Calcineurin B-like domains in the large regulatory alpha/beta subunits of phosphorylase kinase.

    PubMed

    Carrière, Cathelène; Mornon, Jean-Paul; Venien-Bryan, Catherine; Boisset, Nicolas; Callebaut, Isabelle

    2008-06-01

    Phosphorylase kinase (PhK) is a large hexadecameric complex that catalyzes the phosphorylation and activation of glycogen phosphorylase (GP). It consists in four copies each of a catalytic subunit (gamma) and three regulatory subunits (alpha beta delta). Delta corresponds to endogenous calmodulin, whereas little is known on the molecular architecture of the large alpha and beta subunits, which probably arose from gene duplication. Here, using sensitive methods of sequence analysis, we show that the C-terminal domain (named domain D) of these alpha and beta subunits can be significantly related to calcineurin B-like (CBL) proteins. CBL are members of the EF-hand family that are involved in the regulation of plant-specific kinases of the CIPK/PKS family, and relieve autoinhibition of their target kinases by binding to their regulatory region. The relationship highlighted here suggests that PhK alpha and/or beta domain D may be involved in a similar regulation mechanism, a hypothesis which is supported by the experimental observation of a direct interaction between domain D of PhKalpha and the regulatory region of the Gamma subunit. This finding, together the identification of significant similarities of domain D with the preceding domain C, may help to understand the molecular mechanism by which PhK alpha and/or beta domain D might regulate PhK activity. PMID:18320589

  3. Structural determinants of the 5'-methylthioinosine specificity of Plasmodium purine nucleoside phosphorylase.

    PubMed

    Donaldson, Teraya M; Ting, Li-Min; Zhan, Chenyang; Shi, Wuxian; Zheng, Renjian; Almo, Steven C; Kim, Kami

    2014-01-01

    Plasmodium parasites rely upon purine salvage for survival. Plasmodium purine nucleoside phosphorylase is part of the streamlined Plasmodium purine salvage pathway that leads to the phosphorylysis of both purines and 5'-methylthiopurines, byproducts of polyamine synthesis. We have explored structural features in Plasmodium falciparum purine nucleoside phosphorylase (PfPNP) that affect efficiency of catalysis as well as those that make it suitable for dual specificity. We used site directed mutagenesis to identify residues critical for PfPNP catalytic activity as well as critical residues within a hydrophobic pocket required for accommodation of the 5'-methylthio group. Kinetic analysis data shows that several mutants had disrupted binding of the 5'-methylthio group while retaining activity for inosine. A triple PfPNP mutant that mimics Toxoplasma gondii PNP had significant loss of 5'-methylthio activity with retention of inosine activity. Crystallographic investigation of the triple mutant PfPNP with Tyr160Phe, Val66Ile, andVal73Ile in complex with the transition state inhibitor immucillin H reveals fewer hydrogen bond interactions for the inhibitor in the hydrophobic pocket. PMID:24416224

  4. Functions, structures, and applications of cellobiose 2-epimerase and glycoside hydrolase family 130 mannoside phosphorylases.

    PubMed

    Saburi, Wataru

    2016-07-01

    Carbohydrate isomerases/epimerases are essential in carbohydrate metabolism, and have great potential in industrial carbohydrate conversion. Cellobiose 2-epimerase (CE) reversibly epimerizes the reducing end d-glucose residue of β-(1→4)-linked disaccharides to d-mannose residue. CE shares catalytic machinery with monosaccharide isomerases and epimerases having an (α/α)6-barrel catalytic domain. Two histidine residues act as general acid and base catalysts in the proton abstraction and addition mechanism. β-Mannoside hydrolase and 4-O-β-d-mannosyl-d-glucose phosphorylase (MGP) were found as neighboring genes of CE, meaning that CE is involved in β-mannan metabolism, where it epimerizes β-d-mannopyranosyl-(1→4)-d-mannose to β-d-mannopyranosyl-(1→4)-d-glucose for further phosphorolysis. MGPs form glycoside hydrolase family 130 (GH130) together with other β-mannoside phosphorylases and hydrolases. Structural analysis of GH130 enzymes revealed an unusual catalytic mechanism involving a proton relay and the molecular basis for substrate and reaction specificities. Epilactose, efficiently produced from lactose using CE, has superior physiological functions as a prebiotic oligosaccharide. PMID:27031293

  5. Iminosugars as potential inhibitors of glycogenolysis: structural insights into the molecular basis of glycogen phosphorylase inhibition.

    PubMed

    Oikonomakos, Nikos G; Tiraidis, Costas; Leonidas, Demetres D; Zographos, Spyros E; Kristiansen, Marit; Jessen, Claus U; Nørskov-Lauritsen, Leif; Agius, Loranne

    2006-09-21

    Iminosugars DAB (5), isofagomine (9), and several N-substituted derivatives have been identified as potent inhibitors of liver glycogen phosphorylase a (IC(50) = 0.4-1.2 microM) and of basal and glucagon-stimulated glycogenolysis (IC(50) = 1-3 microM). The X-ray structures of 5, 9, and its N-3-phenylpropyl analogue 8 in complex with rabbit muscle glycogen phosphorylase (GPb) shows that iminosugars bind tightly at the catalytic site in the presence of the substrate phosphate and induce conformational changes that characterize the R-state conformation of the enzyme. Charged nitrogen N1 is within hydrogen-bonding distance with the carbonyl oxygen of His377 (5) and in ionic contact with the substrate phosphate oxygen (8 and 9). Our findings suggest that the inhibitors function as oxocarbenium ion transition-state analogues. The conformational change to the R state provides an explanation for previous findings that 5, unlike inhibitors that favor the T state, promotes phosphorylation of GPb in hepatocytes with sequential inactivation of glycogen synthase. PMID:16970395

  6. Properties of baked foams from citric acid modified cassava starch and native cassava starch blends.

    PubMed

    Pornsuksomboon, Kanlaya; Holló, Berta Barta; Szécsényi, Katalin Mészáros; Kaewtatip, Kaewta

    2016-01-20

    Starch foams from native cassava starch (NS) and citric acid modified cassava starch (CNS) were prepared using baking processes with blend ratios of 80/20, 60/40, 50/50, 40/60 and 20/80. The density, thickness, morphology, thermal stability and water absorption of the NS, CNS and blended starch foams were determined. The ratio of the two starch components had a significant influence on the density and thickness of the blended starch foams. All blended starch foams showed good water resistance. Moreover, the morphology of the blended starch foam with the NS/CNS ratio of 50/50 showed a more ordered distribution of cell sizes with thicker cell walls than for the NS and CNS foams. The thermal stability of the blended starch foams was somewhat lower than the stability of the NS foam but not to the extent that it affected any potential practical applications. PMID:26572335

  7. Annealing properties of rice starch.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thermal properties of starch can be modified by annealing, i.e., a pre-treatment in excessive amounts of water at temperatures below the gelatinization temperatures. This treatment is known to improve the crystalline properties, and is a useful tool to gain a better control of the functional proper...

  8. Starch composites with aconitic acid.

    PubMed

    Gilfillan, William Neil; Doherty, William O S

    2016-05-01

    The aim of this project is to examine the effectiveness of using aconitic acid (AcA), a tricarboxylic acid which contains a carbon/carbon double bond (CC), to enhance the properties of starch-based films. Starch/glycerol cast films were prepared with 0, 2, 5, 10 and 15wt% AcA (starch wt% basis) and the properties analysed. It was shown that AcA acted as both a cross-linking agent and also a strong plasticising agent. The 5wt% AcA derived starch films were the most effectively cross-linked having the lowest solubility (28wt%) and decreased swelling coefficient (35vol.%) by approximately 3 times and 2.4 times respectively compared to the control film submerged in water (23°C). There was also a significant increase in the film elongation at break by approximately 35 times (compared to the control) with the addition of 15wt% AcA, emphasising the plasticising effect of AcA. However, generally there was a reduced tensile strength, softening of the film, and reduced thermal stability with increased amounts of AcA. PMID:26876996

  9. Synthesis and characterization of 6-fluoro 5'-deoxypyridoxal. Study of phosphorylase reconstituted with 6-fluoro 5'-deoxypyridoxal and 5'-pyridoxal

    SciTech Connect

    Chang, Y.C.; Scott, R.D.; Graves, D.J.

    1986-05-01

    A new Vitamin B/sub 6/ analogue, 6-fluoro 5'-deoxypyridoxal (6FDPL), was synthesized and characterized. Phosphorylase reconstituted with this analogue show 1% of the activity of the native enzyme in the presence of phosphite. The kinetic pattern, pH optimum of activity, and the activity-temperature dependency of the 6-FDPL-enzyme were virtually identical to those of phosphorylase reconstituted 6-fluoropyridoxal (6-FPAL), except the Km of phosphite toward the former enzyme was 9-times higher than that with the latter enzyme and the 6-FDPL-enzyme showed a lower V/sub max/ value. F-19 NMR studies showed that the binding of glucose-1-P to a 6-FDPL-enzyme-AMP complex shifted the F-19 signal 0.6 ppm toward upfield, whereas a 2.1 ppm change was observed when the 6-FPAL-enzyme-AMP formed with glucose-1-P. Analysis of the activation parameters, of the glycogen breakdown reaction catalyzed by the native phosphorylase and phosphorylase containing 6-fluoropyridoxal 5'-phosphate (6-FPLD), 6-FPAL, 6-FDPL, pyridoxal or DPL showed that modifications of the coenzyme molecule only affected the activation entropy, not the activation enthalpy. These results suggest that the pyridine ring of the coenzyme may undergo a rotation during the course of catalysis; and the interaction between the coenzyme molecule with its neighboring amino acids are important to the efficiency of catalysis.

  10. Physicochemical and functional properties of ozone-oxidized starch.

    PubMed

    Chan, Hui T; Bhat, Rajeev; Karim, Alias A

    2009-07-01

    The effects of oxidation by ozone gas on some physicochemical and functional properties of starch (corn, sago, and tapioca) were investigated. Starch in dry powder form was exposed to ozone for 10 min at different ozone generation times (OGTs). Carboxyl and carbonyl contents increased markedly in all starches with increasing OGTs. Oxidation significantly decreased the swelling power of oxidized sago and tapioca starches but increased that of oxidized corn starch. The solubility of tapioca starch decreased and sago starch increased after oxidation. However, there was an insignificant changed in the solubility of oxidized corn starch. Intrinsic viscosity [eta] of all oxidized starches decreased significantly, except for tapioca starch oxidized at 5 min OGT. Pasting properties of the oxidized starches followed different trends as OGTs increased. These results show that under similar conditions of ozone treatment, the extent of starch oxidation varies among different types of starch. PMID:19489606

  11. Rheological and textural properties of pulse starch gels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The properties of starch gels from black beans, chickpeas, lentils and navy beans were investigated. Differences were shown between starch sources, and effect of starch concentration was studied. Navy bean starch had the highest peak and final viscosities in pasting tests, while black bean starch h...

  12. Physicochemical Properties of Starch Isolated from Bracken (Pteridium aquilinim) Rhizome.

    PubMed

    Yu, Xurun; Wang, Jin; Zhang, Jing; Wang, Leilei; Wang, Zhong; Xiong, Fei

    2015-12-01

    Bracken (Pteridium aquilinum) is an important wild plant starch resource worldwide. In this work, starch was separated from bracken rhizome, and the physicochemical properties of this starch were systematically investigated and compared with 2 other common starches, that is, starches from waxy maize and potato. There were significant differences in shape, birefringence patterns, size distribution, and amylose content between bracken and the 2 other starches. X-ray diffraction analysis revealed that bracken starch exhibited a typical C-type crystalline structure. Bracken starch presented, respectively, lower and higher relative degree of crystallinity than waxy maize and potato starches. Ordered structures in particle surface differed among these 3 starches. The swelling power tendency of bracken starch in different temperature intervals was very similar to that of potato starch. The viscosity parameters during gelatinization were the lowest in waxy maize, followed by bracken and potato starches. The contents of 3 nutritional components, that is, rapidly digestible, slowly digestible, and resistant starches in native, gelatinized, and retrograded starch from bracken rhizome presented more similarities with potato starch than waxy maize starch. These finding indicated that physicochemical properties of bracken starch showed more similarities with potato starch than waxy maize starch. PMID:26551243

  13. The Simultaneous Abolition of Three Starch Hydrolases Blocks Transient Starch Breakdown in Arabidopsis*

    PubMed Central

    Streb, Sebastian; Eicke, Simona; Zeeman, Samuel C.

    2012-01-01

    In this study, we investigated which enzymes are involved in debranching amylopectin during transient starch degradation. Previous studies identified two debranching enzymes, isoamylase 3 (ISA3) and limit dextrinase (LDA), involved in this process. However, plants lacking both enzymes still degrade substantial amounts of starch. Thus, other enzymes/mechanisms must contribute to starch breakdown. We show that the chloroplastic α-amylase 3 (AMY3) also participates in starch degradation and provide evidence that all three enzymes can act directly at the starch granule surface. The isa3 mutant has a starch excess phenotype, reflecting impaired starch breakdown. In contrast, removal of AMY3, LDA, or both enzymes together has no impact on starch degradation. However, removal of AMY3 or LDA in addition to ISA3 enhances the starch excess phenotype. In plants lacking all three enzymes, starch breakdown is effectively blocked, and starch accumulates to the highest levels observed so far. This provides indirect evidence that the heteromultimeric debranching enzyme ISA1-ISA2 is not involved in starch breakdown. However, we illustrate that ISA1-ISA2 can hydrolyze small soluble branched glucans that accumulate when ISA3 and LDA are missing, albeit at a slow rate. Starch accumulation in the mutants correlates inversely with plant growth. PMID:23019330

  14. Biosynthesis of starch in chloroplasts.

    PubMed

    Nomura, T; Nakayama, N; Murata, T; Akazawa, T

    1967-03-01

    The enzymic synthesis of ADP-glucose and UDP-glucose by chloroplastic pyrophosphorylase of bean and rice leaves has been demonstrated by paper chromatographic techniques. In both tissues, the activity of UDP-glucose-pyrophosphorylase was much higher than ADP-glucose-pyrophosphorylase. Glycerate-3-phosphate, phosphoenolpyruvate and fructose-1,6-diphosphate did not stimulate ADP-glucose formation by a pyrophosphorylation reaction. The major metabolic pathway for UDP-glucose utilization appears to be the synthesis of either sucrose or sucrose-P. On the other hand, a specific precursor role of ADP-glucose for synthesizing chloroplast starch by the ADP-glucose-starch transglucosylase reaction is supported by the coupled enzyme system of ADP-glucose-pyrophosphorylase and transglucosylase, isolated from chloroplasts. None of the glycolytic intermediates stimulated the glucose transfer in the enzyme sequence of reaction system employed. PMID:4292567

  15. Physicochemical properties of quinoa starch.

    PubMed

    Li, Guantian; Wang, Sunan; Zhu, Fan

    2016-02-10

    Physicochemical properties of quinoa starches isolated from 26 commercial samples from a wide range of collection were studied. Swelling power (SP), water solubility index (WSI), amylose leaching (AML), enzyme susceptibility, pasting, thermal and textural properties were analyzed. Apparent amylose contents (AAM) ranged from 7.7 to 25.7%. Great variations in the diverse physicochemical properties were observed. Correlation analysis showed that AAM was the most significant factor related to AML, WSI, and pasting parameters. Correlations among diverse physicochemical parameters were analyzed. Principal component analysis using twenty three variables were used to visualize the difference among samples. Six principal components were extracted which could explain 88.8% of the total difference. The wide variations in physicochemical properties could contribute to innovative utilization of quinoa starch for food and non-food applications. PMID:26686137

  16. Formation of nanoporous aerogels from wheat starch.

    PubMed

    Ubeyitogullari, Ali; Ciftci, Ozan N

    2016-08-20

    Biodegradable nanoporous aerogels were obtained from wheat starch using a simple and green method based on supercritical carbon dioxide (SC-CO2) drying. Effects of processing parameters (temperature, wheat starch concentration and mixing rate during gelatinization; temperature, pressure, and flow rate of CO2, during SC-CO2 drying) on the aerogel formation were investigated, and optimized for the highest surface area and smallest pore size of the aerogels. At the optimized conditions, wheat starch aerogels had surface areas between 52.6-59.7m(2)/g and densities ranging between 0.05-0.29g/cm(3). The average pore size of the starch aerogels was 20nm. Starch aerogels were stable up to 280°C. Due to high surface area and nanoporous structure, wheat starch aerogels are promising carrier systems for bioactives and drugs in food and pharmaceutical industries. PMID:27178916

  17. The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

    PubMed Central

    Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

    2015-01-01

    ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings

  18. Molecular evolution accompanying functional divergence of duplicated genes along the plant starch biosynthesis pathway

    PubMed Central

    2014-01-01

    Background Starch is the main source of carbon storage in the Archaeplastida. The starch biosynthesis pathway (sbp) emerged from cytosolic glycogen metabolism shortly after plastid endosymbiosis and was redirected to the plastid stroma during the green lineage divergence. The SBP is a complex network of genes, most of which are members of large multigene families. While some gene duplications occurred in the Archaeplastida ancestor, most were generated during the sbp redirection process, and the remaining few paralogs were generated through compartmentalization or tissue specialization during the evolution of the land plants. In the present study, we tested models of duplicated gene evolution in order to understand the evolutionary forces that have led to the development of SBP in angiosperms. We combined phylogenetic analyses and tests on the rates of evolution along branches emerging from major duplication events in six gene families encoding sbp enzymes. Results We found evidence of positive selection along branches following cytosolic or plastidial specialization in two starch phosphorylases and identified numerous residues that exhibited changes in volume, polarity or charge. Starch synthases, branching and debranching enzymes functional specializations were also accompanied by accelerated evolution. However, none of the sites targeted by selection corresponded to known functional domains, catalytic or regulatory. Interestingly, among the 13 duplications tested, 7 exhibited evidence of positive selection in both branches emerging from the duplication, 2 in only one branch, and 4 in none of the branches. Conclusions The majority of duplications were followed by accelerated evolution targeting specific residues along both branches. This pattern was consistent with the optimization of the two sub-functions originally fulfilled by the ancestral gene before duplication. Our results thereby provide strong support to the so-called “Escape from Adaptive Conflict

  19. The diurnal metabolism of leaf starch.

    PubMed

    Zeeman, Samuel C; Smith, Steven M; Smith, Alison M

    2007-01-01

    Starch is a primary product of photosynthesis in leaves. In most plants, a large fraction of the carbon assimilated during the day is stored transiently in the chloroplast as starch for use during the subsequent night. Photosynthetic partitioning into starch is finely regulated, and the amount of carbohydrate stored is dependent on the environmental conditions, particularly day length. This regulation is applied at several levels to control the flux of carbon from the Calvin cycle into starch biosynthesis. Starch is composed primarily of branched glucans with an architecture that allows the formation of a semi-crystalline insoluble granule. Biosynthesis has been most intensively studied in non-photosynthetic starch-storing organs, such as developing seeds and tubers. Biosynthesis in leaves has received less attention, but recent reverse-genetic studies of Arabidopsis (thale cress) have produced data generally consistent with what is known for storage tissues. The pathway involves starch synthases, which elongate the glucan chains, and branching enzymes. Remarkably, enzymes that partially debranch glucans are also required for normal amylopectin synthesis. In the last decade, our understanding of starch breakdown in leaves has advanced considerably. Starch is hydrolysed to maltose and glucose at night via a pathway that requires recently discovered proteins in addition to well-known enzymes. These sugars are exported from the plastid to support sucrose synthesis, respiration and growth. In the present review we provide an overview of starch biosynthesis, starch structure and starch degradation in the leaves of plants. We focus on recent advances in each area and highlight outstanding questions. PMID:17150041

  20. Structural and functional properties of C-type starches.

    PubMed

    Cai, Jinwen; Cai, Canhui; Man, Jianmin; Zhou, Weidong; Wei, Cunxu

    2014-01-30

    This study investigated the structural and functional properties of C-type starches from pea seeds, faba bean seeds, yam rhizomes and water chestnut corms. These starches were mostly oval in shape with significantly different sizes and contents of amylose, damaged starch and phosphorus. Pea, faba bean and water chestnut starches had central hila, and yam starch had eccentric hilum. Water chestnut and yam starches had higher amylopectin short and long chain, respectively. Water chestnut and faba bean starches showed CA-type crystallinities, and pea and yam starches had C-type crystallinities. Water chestnut starch had the highest swelling power, granule swelling and pasting viscosity, lowest gelatinization temperatures and enthalpy. Faba bean starch had the lowest pasting viscosity, whereas yam starch had the highest gelatinization temperatures. Water chestnut and yam starches possessed significantly higher and lower susceptibility to acid and enzyme hydrolysis, the highest and lowest RDS contents, and the lowest and highest RS contents, respectively. PMID:24299776

  1. Structure of cellobiose phosphorylase from Clostridium thermocellum in complex with phosphate

    PubMed Central

    Bianchetti, Christopher M.; Elsen, Nathaniel L.; Fox, Brian G.; Phillips, George N.

    2011-01-01

    Clostridium thermocellum is a cellulosome-producing bacterium that is able to efficiently degrade and utilize cellulose as a sole carbon source. Cellobiose phosphorylase (CBP) plays a critical role in cellulose degradation by catalyzing the reversible phosphate-dependent hydrolysis of cellobiose, the major product of cellulose degradation, into α-d-glucose 1-phosphate and d-glucose. CBP from C. thermocellum is a modular enzyme composed of four domains [N-­terminal domain, helical linker, (α/α)6-barrel domain and C-terminal domain] and is a member of glycoside hydrolase family 94. The 2.4 Å resolution X-ray crystal structure of C. thermocellum CBP reveals the residues involved in coordinating the catalytic phosphate as well as the residues that are likely to be involved in substrate binding and discrimination. PMID:22102229

  2. Structure of cellobiose phosphorylase from Clostridium thermocellum in complex with phosphate

    SciTech Connect

    Bianchetti, Christopher M.; Elsen, Nathaniel L.; Fox, Brian G.; Phillips, Jr., George N.

    2012-03-27

    Clostridium thermocellum is a cellulosome-producing bacterium that is able to efficiently degrade and utilize cellulose as a sole carbon source. Cellobiose phosphorylase (CBP) plays a critical role in cellulose degradation by catalyzing the reversible phosphate-dependent hydrolysis of cellobiose, the major product of cellulose degradation, into -D-glucose 1-phosphate and D-glucose. CBP from C. thermocellum is a modular enzyme composed of four domains [N-terminal domain, helical linker, (/)6-barrel domain and C-terminal domain] and is a member of glycoside hydrolase family 94. The 2.4 {angstrom} resolution X-ray crystal structure of C. thermocellum CBP reveals the residues involved in coordinating the catalytic phosphate as well as the residues that are likely to be involved in substrate binding and discrimination.

  3. Structural basis for selective inhibition of purine nucleoside phosphorylase from Schistosoma mansoni: kinetic and structural studies.

    PubMed

    Castilho, Marcelo S; Postigo, Matheus P; Pereira, Humberto M; Oliva, Glaucius; Andricopulo, Adriano D

    2010-02-15

    Selectivity plays a crucial role in the design of enzyme inhibitors as novel antiparasitic agents, particularly in cases where the target enzyme is also present in the human host. Purine nucleoside phosphorylase from Schistosoma mansoni (SmPNP) is an attractive target for the discovery of potential antischistosomal agents. In the present work, kinetic studies were carried out in order to determine the inhibitory potency, mode of action and enzyme selectivity of a series of inhibitors of SmPNP. In addition, crystallographic studies provided important structural insights for rational inhibitor design, revealing consistent structural differences in the binding mode of the inhibitors in the active sites of the SmPNP and human PNP (HsPNP) structures. The molecular information gathered in this work should be useful for future medicinal chemistry efforts in the design of new inhibitors of SmPNP having increased affinity and selectivity. PMID:20129792

  4. Preliminary crystallographic studies of purine nucleoside phosphorylase from the cariogenic pathogen Streptococcus mutans

    PubMed Central

    Hou, Qiao-Ming; Liu, Xiang; Brostromer, Erik; Li, Lan-Fen; Su, Xiao-Dong

    2009-01-01

    The punA gene of the cariogenic pathogen Streptococcus mutans encodes purine nucleoside phosphorylase (PNP), which is a pivotal enzyme in the nucleotide-salvage pathway, catalyzing the phosphorolysis of purine nucleosides to generate purine bases and α-ribose 1-phosphate. In the present work, the PNP protein was expressed in Escherichia coli strain BL21 (DE3) in a soluble form at a high level. After purification of the PNP enzyme, the protein was crystallized using the sitting-drop vapour-diffusion technique; the crystals diffracted to 1.6 Å resolution at best. The crystals belonged to space group H3, with unit-cell parameters a = b = 113.0, c = 60.1 Å. PMID:20054131

  5. Enzymatic Glycosylation of Phenolic Antioxidants: Phosphorylase-Mediated Synthesis and Characterization.

    PubMed

    De Winter, Karel; Dewitte, Griet; Dirks-Hofmeister, Mareike E; De Laet, Sylvie; Pelantová, Helena; Křen, Vladimír; Desmet, Tom

    2015-11-25

    Although numerous biologically active molecules exist as glycosides in nature, information on the activity, stability, and solubility of glycosylated antioxidants is rather limited to date. In this work, a wide variety of antioxidants were glycosylated using different phosphorylase enzymes. The resulting antioxidant library, containing α/β-glucosides, different regioisomers, cellobiosides, and cellotriosides, was then characterized. Glycosylation was found to significantly increase the solubility and stability of all evaluated compounds. Despite decreased radical-scavenging abilities, most glycosides were identified to be potent antioxidants, outperforming the commonly used 2,6-bis(1,1-dimethylethyl)-4-methylphenol (BHT). Moreover, the point of attachment, the anomeric configuration, and the glycosidic chain length were found to influence the properties of these phenolic glycosides. PMID:26540621

  6. Influence of structural and electronic properties of uranyl derivatives on the inhibition of thymidine phosphorylase

    SciTech Connect

    Dimoglo, A.S.; Bersuker, I.B.; Gorbachev, M.Yu.

    1986-07-01

    The inhibition of enzymes by definite compounds lies at the basis of the mechanism of the action of most drugs. Uracil and its derivatives are effective inhibitors of thymidine phosphorylase and other related enzymes. Cancer cells are especially sensitive to the absence of thymidine. The study of the inhibiting action of uracil derivatives has been conducted previously. In this article, the authors used the hydrophobicity constants of the substituents, directly bonded to the uracil framework in the 1- and 3-positions and the 6-position as well as the constants of ortho- and meta-substituents in benzene rings bonded to uracil in the investigated compounds for the derivation of correlation equations relating the inhibiting activity to the physicochemical parameters. A table is presented of the 142 uracil derivatives taken for logical-structural analysis.

  7. The ligand binding mechanism to purine nucleoside phosphorylase elucidated via molecular dynamics and machine learning

    PubMed Central

    Decherchi, Sergio; Berteotti, Anna; Bottegoni, Giovanni; Rocchia, Walter; Cavalli, Andrea

    2015-01-01

    The study of biomolecular interactions between a drug and its biological target is of paramount importance for the design of novel bioactive compounds. In this paper, we report on the use of molecular dynamics (MD) simulations and machine learning to study the binding mechanism of a transition state analogue (DADMe–immucillin-H) to the purine nucleoside phosphorylase (PNP) enzyme. Microsecond-long MD simulations allow us to observe several binding events, following different dynamical routes and reaching diverse binding configurations. These simulations are used to estimate kinetic and thermodynamic quantities, such as kon and binding free energy, obtaining a good agreement with available experimental data. In addition, we advance a hypothesis for the slow-onset inhibition mechanism of DADMe–immucillin-H against PNP. Combining extensive MD simulations with machine learning algorithms could therefore be a fruitful approach for capturing key aspects of drug–target recognition and binding. PMID:25625196

  8. Mass Modulation of Protein Dynamics Associated with Barrier Crossing in Purine Nucleoside Phosphorylase

    PubMed Central

    Antoniou, Dimitri; Ge, Xiaoxia; Schramm, Vern L.; Schwartz, Steven D.

    2012-01-01

    The role of protein dynamics on different time scales in enzyme catalysis remains an area of active debate. The connection between enzyme dynamics on the femtosecond time scale and transition state formation has been demonstrated in human purine nucleoside phosphorylase (PNP) through the study of a mass-altered enzyme. Isotopic substitution in human PNP (heavy PNP) decreased the rate of on-enzyme chemistry but did not alter either the transition state structure or steady-state kinetic parameters. Here we investigate the underlying atomic motions associated with altered barrier crossing probability for heavy PNP. Transition path sampling was employed to illuminate the molecular differences between barrier crossing in light and heavy enzymes. The mass effect is apparent in promoting vibrations that polarize the N-ribosidic bond, and that promote the stability of the purine leaving group. These motions facilitate barrier crossing. PMID:24496053

  9. Evaluation of capillary chromatographic supports for immobilized human purine nucleoside phosphorylase in frontal affinity chromatography studies.

    PubMed

    de Moraes, Marcela Cristina; Temporini, Caterina; Calleri, Enrica; Bruni, Giovanna; Ducati, Rodrigo Gay; Santos, Diógenes Santiago; Cardoso, Carmen Lucia; Cass, Quezia Bezerra; Massolini, Gabriella

    2014-04-18

    The aim of this work was to optimize the preparation of a capillary human purine nucleoside phosphorylase (HsPNP) immobilized enzyme reactor (IMER) for characterization and affinity screening studies of new inhibitors by frontal affinity chromatography coupled to mass spectrometry (FAC-MS). For this purpose two monolithic supports, a Chromolith Speed Rod (0.1mm I.D.×5cm) and a methacrylate-based monolithic epoxy polymeric capillary column (0.25mm I.D.×5cm) with epoxy reactive groups were considered and compared to an IMER previously developed using an open fused silica capillary. Each HsPNP-IMER was characterized in terms of catalytic activity using Inosine as standard substrate. Furthermore, they were also explored for affinity ranking experiments. Kd determination was carried out with the based fused silica HsPNP-IMER and the results are herein discussed. PMID:24630982

  10. Specificity and Efficiency of Thymidine Incorporation in Escherichia coli Lacking Thymidine Phosphorylase

    PubMed Central

    Fangman, Walton L.

    1969-01-01

    A mutant of Escherichia coli lacking the catabolic enzyme thymidine phosphorylase readily incorporates exogenous thymidine into deoxyribonucleic acid (DNA) even when provided at concentrations as low as 0.2 μg/ml. Incorporation by this prototrophic strain occurs specifically into DNA, since, with radioactively labeled thymidine, (i) more than 98% is incorporated into alkali-stable material, (ii) at least 90% is recovered as thymine after brief formic acid hydrolysis, and (iii) at least 90% is incorporated into material with the buoyant density of DNA. During growth in medium containing thymidine, the bacteria obtain approximately half of their DNA thymines from the exogenous thymidine and half from endogenous synthesis. The thymines and cytosines of DNA can be simultaneously and specifically labeled by thymidine-2-14C and uridine-5-3H, respectively. The mutant, which does not degrade thymidine, retains the ability to degrade the thymidine analogue 5-bromodeoxyuridine. PMID:4905532

  11. Enzymatic synthesis of dendritic amphoteric α-glucans by thermostable phosphorylase catalysis.

    PubMed

    Takata, Yusei; Shimohigoshi, Riko; Yamamoto, Kazuya; Kadokawa, Jun-Ichi

    2014-10-01

    This article reports the enzymatic synthesis of dendritic amphoteric α-glucans having both glucuronic acid and glucosamine residues at the non-reducing ends by thermostable phosphorylase-catalyzed successive glucuronylation and glucosaminylation of a glucan dendrimer having α-(1 → 4)-glucan non-reducing ends using α-D-glucuronic acid 1-phosphate and α-D-glucosamine 1-phosphate as glycosyl donors, respectively. The structure of the products is confirmed by the (1)H NMR analysis. The products exhibit inherent isoelectric points (pIs) determined by the ζ-potential measurement. These materials self-assemble in water at pH = pI to form large aggregates, but disassemble at pH shifted from pI. PMID:24978042

  12. Sucrose-to-Starch Metabolism in Tomato Fruit Undergoing Transient Starch Accumulation.

    PubMed Central

    Schaffer, A. A.; Petreikov, M.

    1997-01-01

    Immature green tomato (Lycopersicon esculentum) fruits undergo a period of transient starch accumulation characterized by developmental changes in the activities of key enzymes in the sucrose (Suc)-to-starch metabolic pathway. Activities of Suc synthase, fructokinase, ADP-glucose (Glc) pyrophosphorylase, and soluble and insoluble starch synthases decline dramatically in parallel to the decrease in starch levels in the developing fruit. Comparison of "maximal" in vitro activities of the enzymes in the Suc-to-starch pathway suggests that these same enzymes are limiting to the rate of starch accumulation. In contrast, activities of invertase, UDP-Glc pyrophosphorylase, nucleoside diphosphate kinase, phosphoglucoisomerase, and phosphoglucomutase do not exhibit dramatic decreases in activity and appear to be in excess of starch accumulation rates. Starch accumulation is spatially localized in the inner and radial pericarp and columella, whereas the outer pericarp and seed locule contain little starch. The seed locule is characterized by lower activities of Suc synthase, UDP-Glc pyrophosphorylase, phosphoglucomutase, ADP-Glc pyrophosphorylase, and soluble and insoluble starch synthases. The outer pericarp exhibits comparatively lower activities of ADP-Glc pyrophosphorylase and insoluble starch synthase only. These data are discussed in terms of the developmental and tissue-specific coordinated control of Suc-to-starch metabolism. PMID:12223639

  13. Inducing PLA/starch compatibility through butyl-etherification of waxy and high amylose starch.

    PubMed

    Wokadala, Obiro Cuthbert; Emmambux, Naushad Mohammad; Ray, Suprakas Sinha

    2014-11-01

    In this study, waxy and high amylose starches were modified through butyl-etherification to facilitate compatibility with polylactide (PLA). Fourier transform infrared spectroscopy, proton nuclear magnetic resonance spectroscopy and wettability tests showed that hydrophobic butyl-etherified waxy and high amylose starches were obtained with degree of substitution values of 2.0 and 2.1, respectively. Differential scanning calorimetry, tensile testing, and scanning electron microscopy (SEM) demonstrated improved PLA/starch compatibility for both waxy and high amylose starch after butyl-etherification. The PLA/butyl-etherified waxy and high amylose starch composite films had higher tensile strength and elongation at break compared to PLA/non-butyl-etherified composite films. The morphological study using SEM showed that PLA/butyl-etherified waxy starch composites had a more homogenous microstructure compared to PLA/butyl-etherified high amylose starch composites. Thermogravimetric analysis showed that PLA/starch composite thermal stability decreased with starch butyl-etherification for both waxy and high amylose starches. This study mainly demonstrates that PLA/starch compatibility can be improved through starch butyl-etherification. PMID:25129738

  14. Position of modifying groups on starch chains of octenylsuccinic anhydride-modified waxy maize starch.

    PubMed

    Bai, Yanjie; Kaufman, Rhett C; Wilson, Jeff D; Shi, Yong-Cheng

    2014-06-15

    Octenylsuccinic anhydride (OSA)-modified starches with a low (0.018) and high (0.092) degree of substitution (DS) were prepared from granular native waxy maize starch in aqueous slurry. The position of OS substituents along the starch chains was investigated by enzyme hydrolysis followed by chromatographic analysis. Native starch and two OS starches with a low and high DS had β-limit values of 55.9%, 52.8%, and 34.4%, respectively. The weight-average molecular weight of the β-limit dextrin from the OS starch with a low DS was close to that of the β-limit dextrin from native starch but lower than that of the β-limit dextrin from the OS starch with a high DS. Debranching of OS starches was incomplete compared with native starch. OS groups in the OS starch with a low DS were located on the repeat units near the branching points, whereas the OS substituents in the OS starch with a high DS occurred both near the branching points and the non-reducing ends. PMID:24491720

  15. Starch-Soybean Oil Composites with High Oil: Starch Ratios Prepared by Steam Jet Cooking

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aqueous mixtures of soybean oil and starch were jet cooked at oil:starch ratios ranging from 0.5:1 to 4:1 to yield dispersions of micron-sized oil droplets that were coated with a thin layer of starch at the oil-water interface. The jet cooked dispersions were then centrifuged at 2060 and 10,800 x ...

  16. Starch aerogel beads obtained from inclusion complexes prepared from high amylose starch and sodium palmitate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch aerogels are a class of low density highly porous renewable materials currently prepared from retrograded starch gels and are of interest for their good surface area, porosity, biocompatibility, and biodegradability. Recently, we have reported on starches containing amylose-fatty acid salt h...

  17. Issues of Starch in Sugarcane Processing and Prospects of Breeding for Low Starch Content in Sugarcane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch is a sugarcane impurity that adversely affects the quantity and quality of sugar processes and products. The increased production of combine and green harvested sugarcane has increased delivery of starch to sugarcane factories. Starch occurs as granules composed of amylose and amylopectin p...

  18. Microalgae--novel highly efficient starch producers.

    PubMed

    Brányiková, Irena; Maršálková, Barbora; Doucha, Jiří; Brányik, Tomáš; Bišová, Kateřina; Zachleder, Vilém; Vítová, Milada

    2011-04-01

    The freshwater alga Chlorella, a highly productive source of starch, might substitute for starch-rich terrestrial plants in bioethanol production. The cultivation conditions necessary for maximizing starch content in Chlorella biomass, generated in outdoor scale-up solar photobioreactors, are described. The most important factor that can affect the rate of starch synthesis, and its accumulation, is mean illumination resulting from a combination of biomass concentration and incident light intensity. While 8.5% DW of starch was attained at a mean light intensity of 215 µmol/(m2 s1), 40% of DW was synthesized at a mean light intensity 330 µmol/(m2 s1). Another important factor is the phase of the cell cycle. The content of starch was highest (45% of DW) prior to cell division, but during the course of division, its cellular level rapidly decreased to about 13% of DW in cells grown in light, or to about 4% in those kept in the dark during the division phase. To produce biomass with high starch content, it is necessary to suppress cell division events, but not to disturb synthesis of starch in the chloroplast. The addition of cycloheximide (1 mg/L), a specific inhibitor of cytoplasmic protein synthesis, and the effect of element limitation (nitrogen, sulfur, phosphorus) were tested. The majority of the experiments were carried out in laboratory-scale photobioreactors, where culture treatments increased starch content to up to about 60% of DW in the case of cycloheximide inhibition or sulfur limitation. When the cells were limited by phosphorus or nitrogen supply, the cellular starch content increased to 55% or 38% of DW, respectively, however, after about 20 h, growth of the cultures stopped producing starch, and the content of starch again decreased. Sulfur limited and cycloheximide-treated cells maintained a high content of starch (60% of DW) for up to 2 days. Sulfur limitation, the most appropriate treatment for scaled-up culture of starch-enriched biomass

  19. Improved method for detection of starch hydrolysis

    SciTech Connect

    Ohawale, M.R.; Wilson, J.J.; Khachatourians, G.G.; Ingledew, W.M.

    1982-09-01

    A new starch hydrolysis detection method which does not rely on iodine staining or the use of color-complexed starch is described. A linear relationship was obtained with agar-starch plates when net clearing zones around colonies of yeasts were plotted against enzyme levels (semilogarithm scale) produced by the same yeast strains in liquid medium. A similar relationship between starch clearing zones and alpha-amylase levels from three different sources was observed. These observations suggest that the method is useful in mutant isolations, strain improvement programs, and the prediction of alpha-amylase activities in culture filtrates or column effluents. (Refs. 18).

  20. Homology between O-linked GlcNAc transferases and proteins of the glycogen phosphorylase superfamily.

    PubMed

    Wrabl, J O; Grishin, N V

    2001-11-30

    The O-linked GlcNAc transferases (OGTs) are a recently characterized group of largely eukaryotic enzymes that add a single beta-N-acetylglucosamine moiety to specific serine or threonine hydroxyls. In humans, this process may be part of a sugar regulation mechanism or cellular signaling pathway that is involved in many important diseases, such as diabetes, cancer, and neurodegeneration. However, no structural information about the human OGT exists, except for the identification of tetratricopeptide repeats (TPR) at the N terminus. The locations of substrate binding sites are unknown and the structural basis for this enzyme's function is not clear. Here, remote homology is reported between the OGTs and a large group of diverse sugar processing enzymes, including proteins with known structure such as glycogen phosphorylase, UDP-GlcNAc 2-epimerase, and the glycosyl transferase MurG. This relationship, in conjunction with amino acid similarity spanning the entire length of the sequence, implies that the fold of the human OGT consists of two Rossmann-like domains C-terminal to the TPR region. A conserved motif in the second Rossmann domain points to the UDP-GlcNAc donor binding site. This conclusion is supported by a combination of statistically significant PSI-BLAST hits, consensus secondary structure predictions, and a fold recognition hit to MurG. Additionally, iterative PSI-BLAST database searches reveal that proteins homologous to the OGTs form a large and diverse superfamily that is termed GPGTF (glycogen phosphorylase/glycosyl transferase). Up to one-third of the 51 functional families in the CAZY database, a glycosyl transferase classification scheme based on catalytic residue and sequence homology considerations, can be unified through this common predicted fold. GPGTF homologs constitute a substantial fraction of known proteins: 0.4% of all non-redundant sequences and about 1% of proteins in the Escherichia coli genome are found to belong to the GPGTF

  1. Role of Glycoside Phosphorylases in Mannose Foraging by Human Gut Bacteria*

    PubMed Central

    Ladevèze, Simon; Tarquis, Laurence; Cecchini, Davide A.; Bercovici, Juliette; André, Isabelle; Topham, Christopher M.; Morel, Sandrine; Laville, Elisabeth; Monsan, Pierre; Lombard, Vincent; Henrissat, Bernard; Potocki-Véronèse, Gabrielle

    2013-01-01

    To metabolize both dietary fiber constituent carbohydrates and host glycans lining the intestinal epithelium, gut bacteria produce a wide range of carbohydrate-active enzymes, of which glycoside hydrolases are the main components. In this study, we describe the ability of phosphorylases to participate in the breakdown of human N-glycans, from an analysis of the substrate specificity of UhgbMP, a mannoside phosphorylase of the GH130 protein family discovered by functional metagenomics. UhgbMP is found to phosphorolyze β-d-Manp-1,4-β-d-GlcpNAc-1,4-d-GlcpNAc and is also a highly efficient enzyme to catalyze the synthesis of this precious N-glycan core oligosaccharide by reverse phosphorolysis. Analysis of sequence conservation within family GH130, mapped on a three-dimensional model of UhgbMP and supported by site-directed mutagenesis results, revealed two GH130 subfamilies and allowed the identification of key residues responsible for catalysis and substrate specificity. The analysis of the genomic context of 65 known GH130 sequences belonging to human gut bacteria indicates that the enzymes of the GH130_1 subfamily would be involved in mannan catabolism, whereas the enzymes belonging to the GH130_2 subfamily would rather work in synergy with glycoside hydrolases of the GH92 and GH18 families in the breakdown of N-glycans. The use of GH130 inhibitors as therapeutic agents or functional foods could thus be considered as an innovative strategy to inhibit N-glycan degradation, with the ultimate goal of protecting, or restoring, the epithelial barrier. PMID:24043624

  2. Nicotinamide riboside and nicotinic acid riboside salvage in fungi and mammals. Quantitative basis for Urh1 and purine nucleoside phosphorylase function in NAD+ metabolism.

    PubMed

    Belenky, Peter; Christensen, Kathryn C; Gazzaniga, Francesca; Pletnev, Alexandre A; Brenner, Charles

    2009-01-01

    NAD+ is a co-enzyme for hydride transfer enzymes and an essential substrate of ADP-ribose transfer enzymes and sirtuins, the type III protein lysine deacetylases related to yeast Sir2. Supplementation of yeast cells with nicotinamide riboside extends replicative lifespan and increases Sir2-dependent gene silencing by virtue of increasing net NAD+ synthesis. Nicotinamide riboside elevates NAD+ levels via the nicotinamide riboside kinase pathway and by a pathway initiated by splitting the nucleoside into a nicotinamide base followed by nicotinamide salvage. Genetic evidence has established that uridine hydrolase, purine nucleoside phosphorylase, and methylthioadenosine phosphorylase are required for Nrk-independent utilization of nicotinamide riboside in yeast. Here we show that mammalian purine nucleoside phosphorylase but not methylthioadenosine phosphorylase is responsible for mammalian nicotinamide riboside kinase-independent nicotinamide riboside utilization. We demonstrate that so-called uridine hydrolase is 100-fold more active as a nicotinamide riboside hydrolase than as a uridine hydrolase and that uridine hydrolase and mammalian purine nucleoside phosphorylase cleave nicotinic acid riboside, whereas the yeast phosphorylase has little activity on nicotinic acid riboside. Finally, we show that yeast nicotinic acid riboside utilization largely depends on uridine hydrolase and nicotinamide riboside kinase and that nicotinic acid riboside bioavailability is increased by ester modification. PMID:19001417

  3. Elevated thymidine phosphorylase activity in psoriatic lesions accounts for the apparent presence of an epidermal growth inhibitor, but is not in itself growth inhibitory

    SciTech Connect

    Hammerberg, C.; Fisher, G.J.; Voorhees, J.J.; Cooper, K.D. )

    1991-08-01

    An apparent tissue-specific growth inhibitor, or chalone, obtained from psoriatic lesions was tentatively identified in the 100-kDa fraction based upon inhibition of DNA synthesis, as measured by (3H)-thymidine uptake by a squamous cell carcinoma cell line, SCC 38. This fraction, however, failed to inhibit SCC 38 cell growth when assessed directly in a neutral red uptake assay. Characterization of the inhibitor of (3H)-thymidine uptake revealed it to have biochemical properties identical to thymidine phosphorylase: (1) molecular weight close to 100 kDa, (2) isoelectric point of 4.2, and (3) thymidine phosphorylase enzyme activity. Thus, the authors conclude that its ability to inhibit (3H)-thymidine uptake was due to thymidine catabolism rather than inhibition of DNA synthesis or growth inhibition. Examination of thymidine phosphorylase activity in keratome biopsies from psoriatic and normal skin demonstrated a twentyfold increase in activity in psoriatic lesions relative to non-lesional or normal skin. This increase in metabolism of thymidine was due to thymidine phosphorylase rather than uridine phosphorylase activity. The correlation between increased thymidine phosphorylase activity and increased keratinocyte proliferation in vitro (cultured) and in vivo (psoriasis), suggests that this enzyme may play a critical role in providing the thymidine necessary for keratinocyte proliferation.

  4. The binding of 2-deoxy-D-glucose 6-phosphate to glycogen phosphorylase b: kinetic and crystallographic studies.

    PubMed

    Oikonomakos, N G; Zographos, S E; Johnson, L N; Papageorgiou, A C; Acharya, K R

    1995-12-15

    Kinetic and crystallographic studies have characterized the effect of 2-deoxy-glucose 6-phosphate on the catalytic and structural properties of glycogen phosphorylase b. Previous work on the binding of glucose 6-phosphate, a potent physiological inhibitor of the enzyme, to T state phosphorylase b in the crystal showed that the inhibitor binds at the allosteric site and induces substantial conformational changes that affect the subunit-subunit interface. The hydrogen-bond from the O-2 hydroxyl of glucose 6-phosphate to the main-chain oxygen of Val40' represents the only hydrogen bond from the sugar to the other subunit, and this interaction appears important for promoting a more "tensed" structure than native T state phosphorylase b. 2-Deoxy-glucose 6-phosphate acts competitively with both the activator AMP and the substrate glucose 1-phosphate, with Ki values of 0.53 mM and 1.23 mM, respectively. The binding of 2-deoxy-glucose 6-phosphate to T state glycogen phosphorylase b in the crystal, has been investigated and the complex phosphorylase b: 2-deoxy-glucose 6-phosphate has been refined to give a crystallographic R factor of 17.3%, for data between 8 A and 2.3 A. 2-Deoxy-glucose 6-phosphate binds at the allosteric site as the a anomer and adopts a different conformation compared to glucose 6-phosphate. The two conformations differ by 160 degrees in the torsion angle about the C-5-C-6 bond. The contacts from the phosphate group are essentially identical to those made by the phosphate of glucose 6-phosphate but the 2-deoxy glucosyl moiety binds in a quite different orientation compared to the glucosyl of glucose 6-phosphate. 2-Deoxy-glucose 6-phosphate can be accommodated in the allosteric site with very little change in the protein, while structural comparisons show that the phosphorylase b: 2-deoxy-glucose 6-phosphate complex structure is overall more similar to a glucose-like complex than to the Glc-6-P complex structure. PMID:7500360

  5. Reduced gravitropism in hypocotyls of starch-deficient mutants of Arabidopsis

    NASA Technical Reports Server (NTRS)

    Kiss, J. Z.; Guisinger, M. M.; Miller, A. J.; Stackhouse, K. S.

    1997-01-01

    Gravitropism was examined in dark- and light-grown hypocotyls of wild-type (WT), two reduced starch mutants (ACG 20 and ACG 27), and a starchless mutant (ACG 21) of Arabidopsis. In addition, the starch content of these four strains was studied with light and electron microscopy. Based on time course of curvature and orientation studies, the graviresponse in hypocotyls is proportional to the amount of starch in a genotype. Furthermore, starch mutations seem to primarily affect gravitropism rather than differential growth since both phototropic curvature and growth rates among the four genotypes are approximately equal. Our results suggest that gravity perception may require a greater plastid mass in hypocotyls compared to roots. The kinetics of gravitropic curvature also was compared following reorientation at 45 degrees, 90 degrees, and 135 degrees. As has been reported for other plant species, the optimal angle of reorientation is 135 degrees for WT Arabidopsis and the two reduced starch mutants, but the magnitude of curvature of the starchless mutant appears to be independent of the initial angle of displacement. Taken together, the results of the present study and our previous experiments with roots of the same four genotypes [Kiss et al. (1996) Physiol. Plant. 97: 237] support a plastid-based hypothesis for gravity perception in plants.

  6. Structural and molecular basis of starch viscosity in hexaploid wheat.

    PubMed

    Ral, J-P; Cavanagh, C R; Larroque, O; Regina, A; Morell, M K

    2008-06-11

    Wheat starch is considered to have a low paste viscosity relative to other starches. Consequently, wheat starch is not preferred for many applications as compared to other high paste viscosity starches. Increasing the viscosity of wheat starch is expected to increase the functionality of a range of wheat flour-based products in which the texture is an important aspect of consumer acceptance (e.g., pasta, and instant and yellow alkaline noodles). To understand the molecular basis of starch viscosity, we have undertaken a comprehensive structural and rheological analysis of starches from a genetically diverse set of wheat genotypes, which revealed significant variation in starch traits including starch granule protein content, starch-associated lipid content and composition, phosphate content, and the structures of the amylose and amylopectin fractions. Statistical analysis highlighted the association between amylopectin chains of 18-25 glucose residues and starch pasting properties. Principal component analysis also identified an association between monoesterified phosphate and starch pasting properties in wheat despite the low starch-phosphate level in wheat as compared to tuber starches. We also found a strong negative correlation between the phosphate ester content and the starch content in flour. Previously observed associations between internal starch granule fatty acids and the swelling peak time and pasting temperature have been confirmed. This study has highlighted a range of parameters associated with increased starch viscosity that could be used in prebreeding/breeding programs to modify wheat starch pasting properties. PMID:18459791

  7. Mutations in Durum Wheat SBEII Genes affect Grain Yield Components, Quality, and Fermentation Responses in Rats

    PubMed Central

    Hazard, Brittany; Zhang, Xiaoqin; Naemeh, Mahmoudreza; Hamilton, M. Kristina; Rust, Bret; Raybould, Helen E.; Newman, John W.; Martin, Roy; Dubcovsky, Jorge

    2016-01-01

    Increased amylose in wheat (Triticum ssp.) starch is associated with increased resistant starch, a fermentable dietary fiber. Fermentation of resistant starch in the large intestine produces short-chain fatty acids that are associated with human health benefits. Since wheat foods are an important component of the human diet, increases in amylose and resistant starch in wheat grains have the potential to deliver health benefits to a large number of people. In three replicated field trials we found that mutations in starch branching enzyme II genes (SBEIIa and SBEIIb) in both A and B genomes (SBEIIa/b-AB) of durum wheat [T. turgidum L. subsp. durum (Desf.) Husn.] resulted in large increases of amylose and resistant starch content. The presence of these four mutations was also associated with an average 5% reduction in kernel weight (P = 0.0007) and 15% reduction in grain yield (P = 0.06) compared to the wild type. Complete milling and pasta quality analysis showed that the mutant lines have an acceptable quality with positive effects on pasta firmness and negative effects on semolina extraction and pasta color. Positive fermentation responses were detected in rats (Rattus spp.) fed with diets incorporating mutant wheat flour. This study quantifies benefits and limitations associated with the deployment of the SBEIIa/b-AB mutations in durum wheat and provides the information required to develop realistic strategies to deploy durum wheat varieties with increased levels of amylose and resistant starch. PMID:27134286

  8. Cell mediated immunity to corn starch in starch-induced granulomatous peritonitis.

    PubMed

    Goodacre, R L; Clancy, R L; Davidson, R A; Mullens, J E

    1976-03-01

    Two patients with histologically diagnosed starch induced granulomatous peritonitis (SGP) have been shown to have cell mediated immunity to corn starch using the techniques of macrophage migration inhibition and lymphocyte DNA synthesis. Control groups of normal subjects, patients with uncomplicated laparotomy, and patients with Crohn's disease were negative in both tests. Lymphocytes from two patients with band adhesions, one of whom had biopsy evidence of a granulomatous reaction to starch, were sensitized to starch. Cell mediated immunity to starch may contribute to the pathogenesis of SGP, and some band adhesions may be a chronic low grade manifestation of this disorder. PMID:1269987

  9. Characterization of a novel TYMP splice site mutation associated with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE).

    PubMed

    Taanman, Jan-Willem; Daras, Mariza; Albrecht, Juliane; Davie, Charles A; Mallam, Elizabeth A; Muddle, John R; Weatherall, Mark; Warner, Thomas T; Schapira, Anthony H V; Ginsberg, Lionel

    2009-02-01

    Mitochondrial neurogastrointestinal encephalomyopathy is an autosomal recessive disorder caused by loss-of-function mutations in the thymidine phosphorylase gene (TYMP). We report here a patient compound heterozygous for two TYMP mutations: a novel g.4009G>A transition affecting the consensus splice donor site of intron 9, and a previously reported g.675G>C splice site mutation. The novel mutation causes exon 9 skipping but leaves the reading frame intact; however, TYMP protein was not detected by immunoblot analysis, suggesting that neither mutant allele is expressed as protein. The patient's fibroblasts showed gradual loss of the mitochondrial DNA-encoded subunit I of cytochrome-c oxidase, suggesting a progressive mitochondrial DNA defect in culture. PMID:19056268

  10. Rheology and pressurised gyration of starch and starch-loaded poly(ethylene oxide).

    PubMed

    Mahalingam, S; Ren, G G; Edirisinghe, M J

    2014-12-19

    This work investigates the rheology and spinning of starch and starch-loaded poly(ethylene oxide) (PEO) by pressurised gyration in order to prepare nanofibres. The spinning dope's rheological properties played a crucial role in fibre formation. Newtonian behaviour is observed in 1-20 wt% starch suspensions and non-Newtonian behaviour is found in all the PEO-starch mixtures. Pressurised gyration of the starch suspensions produced beads only but PEO-starch mixtures generated fibres. The fibre diameter of the PEO-starch samples is shown to be a function of polymer concentration and rotating speed of the gyration system. Fibre formation can only be facilitated below a certain working pressure. The concentration of starch in the PEO-starch mixtures is crucial in defining whether beaded or continuous fibres were generated and this is related to the composition of the spinning dope. FT-IR, XRD and microscopy studies indicated very good miscibility of starch and PEO in the nanofibres. The storage modulus of the PEO-starch were also studied as a function of temperature (30-150°C) and showed interesting results but it was not possible to deduce general trends valid for the entire temperature range. PMID:25263892