Sample records for t-dna insertion line

  1. Generation and characterization of Arabidopsis T-DNA insertion mutants.

    PubMed

    Qu, Li-Jia; Qin, Genji

    2014-01-01

    Transfer DNA (T-DNA) insertion mutants are often used in forward and reverse genetics to reveal the molecular mechanisms of a particular biological process in plants. To generate T-DNA insertion mutants, T-DNA must be inserted randomly in the genome through transformation mediated by Agrobacterium tumefaciens. During generation of a T-DNA insertion mutant, Agrobacterium competent cells are first prepared and plasmids containing the T-DNA introduced into Agrobacterium cells. Agrobacterium containing T-DNA vectors are then used to transform T-DNA into Arabidopsis. After screening and identifying T-DNA insertion mutants with interesting phenotypes, genomic DNA is extracted from the mutants and used to isolate the T-DNA flanking sequences. To finally determine the mutated genes causing the specific phenotype in the T-DNA insertion mutants, cosegregation analysis and complementation or recapitulation analysis are needed. In this chapter, we describe detailed protocols for generation and characterization of T-DNA insertion mutants. PMID:24057370

  2. Implementing reverse genetics in Rosaceae: analysis of T-DNA flanking sequences of insertional mutant lines in the diploid strawberry, Fragaria vesca.

    PubMed

    Oosumi, Teruko; Ruiz-Rojas, Juan Jairo; Veilleux, Richard E; Dickerman, Allan; Shulaev, Vladimir

    2010-09-01

    Reverse genetics is used for functional genomics research in model plants. To establish a model system for the systematic reverse genetics research in the Rosaceae family, we analyzed genomic DNA flanking the T-DNA insertions in 191 transgenic plants of the diploid strawberry, Fragaria vesca. One hundred and seventy-six T-DNA flanking sequences were amplified from the right border (RB) and 37 from the left border (LB) by thermal asymmetric interlaced PCR. Analysis of the T-DNA nick positions revealed that T-DNA was most frequently nicked at the cleavage sites. Analysis of 11 T-DNA integration sites indicated that T-DNA was integrated into the F. vesca genome by illegitimate recombination, as reported in other model plants: Arabidopsis, rice and tobacco. First, deletion of DNA was found at T-DNA integration target sites in all transgenic plants tested. Second, microsimilarities of a few base pairs between the left and/or right ends of the T-DNA and genomic sites were found in all transgenic plants tested. Finally, filler DNA was identified in four break-points. Out of 191 transgenic plants, T-DNA flanking sequences of 79 plants (41%) showed significant similarity to genes, elements or proteins of other plant species and 67 (35%) of the sequences are still unknown strawberry gene fragments. T-DNA flanking sequences of 126 plants (66%) showed homology to plant ESTs. This is the first report of T-DNA integration in a sizeable population of a rosaceous species. We have shown in this paper that T-DNA integration in strawberry is not random but directed by sequence microsimilarities in the host genome. PMID:20444194

  3. SNP discovery and genetic mapping of T-DNA insertional mutants in Fragaria vesca L

    Microsoft Academic Search

    J. J. Ruiz-Rojas; D. J. Sargent; V. Shulaev; A. W. Dickerman; J. Pattison; S. H. Holt; A. Ciordia; Richard E. Veilleux

    2010-01-01

    As part of a program to develop forward and reverse genetics platforms in the diploid strawberry [Fragaria vesca L.; (2n = 2x = 14)] we have generated insertional mutant lines by T-DNA mutagenesis using pCAMBIA vectors. To characterize the T-DNA insertion\\u000a sites of a population of 108 unique single copy mutants, we utilized thermal asymmetric interlaced PCR (hiTAIL-PCR) to amplify\\u000a the flanking region surrounding

  4. SNP discovery and genetic mapping of T-DNA insertional mutants in Fragaria vesca L.

    PubMed

    Ruiz-Rojas, J J; Sargent, D J; Shulaev, V; Dickerman, A W; Pattison, J; Holt, S H; Ciordia, A; Veilleux, Richard E

    2010-08-01

    As part of a program to develop forward and reverse genetics platforms in the diploid strawberry [Fragaria vesca L.; (2n = 2x = 14)] we have generated insertional mutant lines by T-DNA mutagenesis using pCAMBIA vectors. To characterize the T-DNA insertion sites of a population of 108 unique single copy mutants, we utilized thermal asymmetric interlaced PCR (hiTAIL-PCR) to amplify the flanking region surrounding either the left or right border of the T-DNA. Bioinformatics analysis of flanking sequences revealed little preference for insertion site with regard to G/C content; left borders tended to retain more of the plasmid backbone than right borders. Primers were developed from F. vesca flanking sequences to attempt to amplify products from both parents of the reference F. vesca 815 x F. bucharica 601 mapping population. Polymorphism occurred as: presence/absence of an amplification product for 16 primer pairs and different size products for 12 primer pairs, For 46 mutants, where polymorphism was not found by PCR, the amplification products were sequenced to reveal SNP polymorphism. A cleaved amplified polymorphic sequence/derived cleaved amplified polymorphism sequence (CAPS/dCAPS) strategy was then applied to find restriction endonuclease recognition sites in one of the parental lines to map the SNP position of 74 of the T-DNA insertion lines. BLAST search of flanking regions against GenBank revealed that 46 of 108 flanking sequences were close to presumed strawberry genes related to annotated genes from other plants. PMID:20349033

  5. Bidirectional promoter trapping T-DNA for insertional mutagenesis in Verticillium dahliae.

    PubMed

    Deng, Sheng; Wang, Cai-yue; Zhang, Xin; Lin, Ling

    2014-07-01

    Transfer DNA (T-DNA)-based random insertional mutagenesis is a universal forward genetic approach for gene identification and cloning in many phytopathogenic fungi. In a large number of randomly selected transformants, screening for mutants with a specific phenotype is laborious, especially for pathogenicity-defective mutants. To accelerate mutant screening and gene identification, a bidirectional promoter-trapping Ti binary vector, 1300-bisGFP-hyg, was constructed and deployed in this study. More than 6000 Verticillium dahliae transformants were obtained by the mediation of Agrobacterium tumefaciens carrying the vector. One thousand randomly selected transformants were cultured on Czapek-Dox and on Czapek-Dox plus cotton root extract media plates. The cultured transformants with green fluorescent protein (GFP) expression or changes in phenotype were selected and used in virulence or promoter-trapping assays. Based on the virulence assay of 60 transformants, the pathogenicity of 17 of these mutants was compromised. Ten pathogenicity-defective mutants were found with GFP expression, and 6 with expression in Czapek-Dox plus cotton root extract media specifically. Using TAIL-PCR (thermal asymmetric interlaced polymerase chain reaction), the T-DNA insertion sites were identified in 8 GFP-expressing transformants, including 5 pathogenicity-defective mutants and 3 unaffected transformants. Promoters of 6 genes were successfully trapped using the T-DNA method in this study. The nonpathogenic transformant 24C9 was the subject of additional investigation. It displayed strong GFP expression on water agar medium supplemented with cotton root extracts and on cotton seedling stems. The results obtained by Southern blot and quantitative real-time PCR confirmed that the transcription level of VdUGPU (encoding UTP-glucose-1-phosphate uridylyltransferase) was significantly reduced owing to T-DNA insertion in the gene promoter region. These results indicate that the bidirectional promoter-trapping Ti vector, combined with induction medium that contains root exudates, can be useful for identification of pathogenicity-related and functional genes in V. dahliae. PMID:24993736

  6. T-DNA insertion, plasmid rescue and integration analysis in the model mycorrhizal fungus Laccaria bicolor.

    PubMed

    Kemppainen, Minna; Duplessis, Sebastien; Martin, Francis; Pardo, Alejandro G

    2008-05-01

    Ectomycorrhiza is a mutualistic symbiosis formed between fine roots of trees and the mycelium of soil fungi. This symbiosis plays a key role in forest ecosystems for the mineral nutrition of trees and the biology of the fungal communities associated. The characterization of genes involved in developmental and metabolic processes is important to understand the complex interactions that control the ectomycorrhizal symbiosis. Agrobacterium-mediated gene transfer (AMT) in fungi is currently opening a new era for fungal research. As whole genome sequences of several fungi are being released studies about T-DNA integration patterns are needed in order to understand the integration mechanisms involved and to evaluate the AMT as an insertional mutagenesis tool for different fungal species. The first genome sequence of a mycorrhizal fungus, the basidiomycete Laccaria bicolor, became public in July 2006. Release of Laccaria genome sequence and the availability of AMT makes this fungus an excellent model for functional genomic studies in ectomycorrhizal research. No data on the integration pattern in Laccaria genome were available, thus we optimized a plasmid rescue approach for this fungus. To this end the transformation vector (pHg/pBSk) was constructed allowing the rescue of the T-DNA right border (RB)-genomic DNA junctions in Escherichia coli. Fifty-one Agrobacterium-transformed fungal strains, picked up at random from a larger collection of T-DNA tagged strains (about 500), were analysed. Sixty-nine per cent were successfully rescued for the RB of which 87% were resolved for genomic integration sequences. Our results demonstrate that the plasmid rescue approach can be used for resolving T-DNA integration sites in Laccaria. The RB was well conserved during transformation of this fungus and the integration analysis showed no clear sequence homology between different genomic sites. Neither obvious sequence similarities were found between these sites and the T-DNA borders indicating non-homologous integration of the transgenes. Majority (75%) of the integrations were located in predicted genes. Agrobacterium-mediated gene transfer is a powerful tool that can be used for functional gene studies in Laccaria and will be helpful along with plasmid rescue in searching for relevant fungal genes involved in the symbiotic process. PMID:21261845

  7. Genetic and Phenotypic Analyses of a Papaver somniferum T-DNA Insertional Mutant with Altered Alkaloid Composition.

    PubMed

    Kawano, Noriaki; Kiuchi, Fumiyuki; Kawahara, Nobuo; Yoshimatsu, Kayo

    2012-01-01

    The in vitro shoot culture of a T-DNA insertional mutant of Papaver somniferum L. established by the infection of Agrobacterium rhizogenes MAFF03-01724 accumulated thebaine instead of morphine as a major opium alkaloid. To develop a non-narcotic opium poppy and to gain insight into its genetic background, we have transplanted this mutant to soil, and analyzed its alkaloid content along with the manner of inheritance of T-DNA insertion loci among its selfed progenies. In the transplanted T0 primary mutant, the opium (latex) was found to be rich in thebaine (16.3% of dried opium) by HPLC analysis. The analyses on T-DNA insertion loci by inverse PCR, adaptor-ligation PCR, and quantitative real-time PCR revealed that as many as 18 copies of T-DNAs were integrated into a poppy genome in a highly complicated manner. The number of copies of T-DNAs was decreased to seven in the selected T3 progenies, in which the average thebaine content was 2.4-fold that of the wild type plant. This may indicate that the high thebaine phenotype was increasingly stabilized as the number of T-DNA copies was decreased. In addition, by reverse transcription PCR analysis on selected morphine biosynthetic genes, the expression of codeine 6-O-demethylase was clearly shown to be diminished in the T0 in vitro shoot culture, which can be considered as one of the key factors of altered alkaloid composition. PMID:24288085

  8. Major Chromosomal Rearrangements Induced by T-DNA Transformation in Arabidopsis

    Microsoft Academic Search

    Philippe Nacry; Christine Camilleri; Beatrice Courtial; Michel Caboche; David Bouchez

    We show that major chromosomal rearrangements can occur upon T-DNA transformation of Arabidopsis thaliana. In the ACL4 line, two T-DNA insertion loci were found; one is a tandem T-DNA insert in a head- to-head orientation, and the other is a truncated insert with only the left part of the T-region. The four flanking DNA regions were isolated and located on

  9. Multifunctional T-DNA\\/ Ds tomato lines designed for gene cloning and molecular and physical dissection of the tomato genome

    Microsoft Academic Search

    D. Gidoni; E. Fuss; A. Burbidge; G. J. Speckmann; S. James; D. Nijkamp; A. Mett; J. Feiler; M. Smoker; M. J. de Vroomen; D. Leader; T. Liharska; J. Groenendijk; E. Coppoolse; J. J. M. Smit; I. Levin; M. de Both; W. Schuch; J. D. G. Jones; I. B. Taylor; K. Theres; M. J. J van Haaren

    2003-01-01

    In order to make the tomato genome more accessible for molecular analysis and gene cloning, we have produced 405 individual tomato (Lycopersicon esculentum) lines containing a characterized copy of pJasm13, a multifunctional T-DNA\\/modifiedDs transposon element construct. Both the T-DNA and the Ds element in pJasm13 harbor a set of selectable marker genes to monitor excision and reintegration of Ds and

  10. A candidate gene OsAPC6 of anaphase-promoting complex of rice identified through T-DNA insertion.

    PubMed

    Kumar, Mankesh; Basha, P Osman; Puri, Anju; Rajpurohit, Deepak; Randhawa, Gursharn Singh; Sharma, Tilak Raj; Dhaliwal, Harcharan Singh

    2010-08-01

    A dwarf mutant (Oryza sativa anaphase-promoting complex 6 (OsAPC6)) of rice cultivar Basmati 370 with 50% reduced plant height as compared to the wild type was isolated by Agrobacterium tumefaciens-mediated transformation using Hm(R) Ds cassette. This mutant was found to be insensitive to exogenous gibberellic acid (GA(3)) application. Homozygous mutant plants showed incomplete penetrance and variable expressivity for plant height and pleiotropic effects including gibberellic acid insensitivity, reduced seed size, panicle length, and female fertility. Single copy insertion of T-DNA and its association with OsAPC6 was confirmed by Southern hybridization, germination on hygromycin, and 3:1 segregation of HPT gene in F(2) from OsAPC6 x Basmati 370 cross. The T-DNA flanking region sequenced through thermal asymmetric interlaced polymerase chain reaction showed a single hit on chromosome 3 of japonica rice cultivar Nipponbare in the second exonic region of a gene which encodes for sixth subunit of anaphase-promoting complex/cyclosome. The candidate gene of 8.6-kb length encodes a 728-amino acid protein containing a conserved tetratricopeptide repeat (TPR) domain and has only a paralog, isopenicillin N-synthase family protein on the same chromosome without the TPR domain. There was no expression of the gene in the mutant while in Basmati 370, it was equal in both roots and shoots. The knockout mutant OsAPC6 interferes with the gibberellic acid signaling pathway leading to reduced height and cell size probably through ubiquitin-mediated proteolysis. Further functional validation of the gene through RNAi is in progress. PMID:20091079

  11. Generation and flanking sequence analysis of a rice T-DNA tagged population

    Microsoft Academic Search

    Y. Sha; S. Li; Z. Pei; L. Luo; Y. Tian; C. He

    2004-01-01

    Insertional mutagenesis provides a rapid way to clone a mutated gene. Transfer DNA (T-DNA) of Agrobacterium tumefaciens has been proven to be a successful tool for gene discovery in Arabidopsis and rice (Oryza sativa L. ssp. japonica). Here, we report the generation of 5,200 independent T-DNA tagged rice lines. The T-DNA insertion pattern in the rice genome was investigated, and

  12. A rice phenomics study—phenotype scoring and seed propagation of a T-DNA insertion-induced rice mutant population

    Microsoft Academic Search

    Chyr-Guan Chern; Ming-Jen Fan; Su-May Yu; Po-Chang Lu; Yao-Cheng Lin; Fu-Jin Wei; Sheng-Chung Huang; Shu Chen; Ming-Hsing Lai; Ching-Shan Tseng; Hsing-Mu Yen; Woei-Shyuan Jwo; Chen-Chia Wu; Tung-Lung Yang; Lung-Sheng Li; Yih-Cheng Kuo; Su-Mien Li; Charng-Pei Li; Chiu-Kai Wey; Arunee Trisiriroj; Hsing-Fang Lee; Yue-Ie C. Hsing

    2007-01-01

    With the completion of the rice genome sequencing project, the next major challenge is the large-scale determination of gene\\u000a function. As an important crop and a model organism, rice provides major insights into gene functions important for crop growth\\u000a or production. Phenomics with detailed information about tagged populations provides a good tool for functional genomics analysis.\\u000a By a T-DNA insertional

  13. Reduced tillering in Basmati rice T-DNA insertional mutant OsTEF1 associates with differential expression of stress related genes and transcription factors.

    PubMed

    Paul, Priyanka; Awasthi, Anjali; Rai, Amit Kumar; Gupta, Santosh Kumar; Prasad, R; Sharma, T R; Dhaliwal, H S

    2012-06-01

    A T-DNA insertional mutant OsTEF1 of rice gives 60-80% reduced tillering, retarded growth of seminal roots, and sensitivity to salt stress compared to wild type Basmati 370. The insertion occurred in a gene encoding a transcription elongation factor homologous to yeast elf1, on chromosome 2 of rice. Detailed transcriptomic profiling of OsTEF1 revealed that mutation in the transcription elongation factor differentially regulates the expression of more than 100 genes with known function and finely regulates tillering process in rice by inducing the expression of cytochrome P450. Along with different transcription factors, several stress associated genes were also affected due to a single insertion. In silico analysis of the TEF1 protein showed high conservation among different organisms. This transcription elongation factor predicted to interact with other proteins that directly or indirectly positively regulate tillering in rice. PMID:22367482

  14. Intronic T-DNA Insertion Renders Arabidopsis opr3 a Conditional Jasmonic Acid-Producing Mutant1[C][W][OA

    PubMed Central

    Chehab, E. Wassim; Kim, Se; Savchenko, Tatyana; Kliebenstein, Daniel; Dehesh, Katayoon; Braam, Janet

    2011-01-01

    Jasmonic acid and its derived metabolites (JAs) orchestrate plant defense against insects and fungi. 12-Oxo-phytodienoic acid (OPDA), a JA precursor, has also been implicated in plant defense. We sought to define JAs and OPDA functions through comparative defense susceptibility characteristics of three Arabidopsis (Arabidopsis thaliana) genotypes: aos, lacking JAs and OPDA; opda reductase3 (opr3), deficient in JA production but can accumulate OPDA; and transgenics that overexpress OPR3. opr3, like aos, is susceptible to cabbage loopers (Trichoplusia ni) but, relative to aos, opr3 has enhanced resistance to a necrotrophic fungus. Gas chromatography-mass spectrometry reveals that opr3 produces OPDA but no detectable JAs following wounding and looper infestation; unexpectedly, substantial levels of JAs accumulate in opr3 upon fungal infection. Full-length OPR3 transcripts accumulate in fungal-infected opr3, potentially through splicing of the T-DNA containing intron. Fungal resistance correlates with levels of JAs not OPDA; therefore, opr3 resistance to some pests is likely due to JA accumulation, and signaling activities ascribed to OPDA should be reassessed because opr3 can produce JAs. Together these data (1) reinforce the primary role JAs play in plant defense against insects and necrotrophic fungi, (2) argue for a reassessment of signaling activities ascribed to OPDA, and (3) provide evidence that mutants with intron insertions can retain gene function. PMID:21487047

  15. T-DNA Binary Vectors and Systems

    Microsoft Academic Search

    Lan-Ying Lee; Stanton B. Gelvin

    2008-01-01

    For more than two decades, scientists have used Agrobacterium-mediated genetic transformation to generate transgenic plants. Initial technologies to in- troduce genes of interest (goi) into Agrobacterium in- volved complex microbial genetic methodologies that inserted these goi into the transfer DNA (T-DNA) re- gion of large tumor-inducing plasmids (Ti-plasmids). However, scientists eventually learned that T-DNA transfer could still be effected if

  16. An intron sense suppression construct targeting soybean FAD2-1 requires a double-stranded RNA-producing inverted repeat T-DNA insert.

    PubMed

    Mroczka, Andrew; Roberts, Peter D; Fillatti, Joanne J; Wiggins, B Elizabeth; Ulmasov, Tim; Voelker, Toni

    2010-06-01

    We demonstrate that the transformation of soybean (Glycine max) with sense suppression constructs using intron sequences from the fatty acid oleyl Delta12 desaturase gene FAD2-1A leads to efficient and specific reduction of FAD2-1 transcripts in developing seeds, increased oleic acid, and decreased polyunsaturated fatty acids. The related FAD2-2 transcripts are only marginally affected. Despite screening a large number of independent transformants, no single-copy efficacious transformants could be found. Invariably, all the least complex transgenic loci have two T-DNA copies in an inverted repeat configuration, centered at the right borders. We show that this T-DNA configuration produces an inverted repeat transcript and that small interfering RNAs accumulate against the target sequence. PMID:20424004

  17. The WiscDsLox T-DNA collection: an arabidopsis community resource generated by using an improved high-throughput T-DNA sequencing pipeline.

    PubMed

    Woody, Scott T; Austin-Phillips, Sandra; Amasino, Richard M; Krysan, Patrick J

    2007-01-01

    We have developed a new community resource, called the WiscDsLox collection, for performing reverse-genetic analysis in arabidopsis. This resource is composed of 10,459 T-DNA lines generated using the Arabidopsis thaliana ecotype Columbia. The flanking sequence tag for each T-DNA insertion has been deposited in public databases, and seed for each line is currently available from the Arabidopsis Biological Resource Center. The pDsLox vector used to create this new population contains a Ds transposon and Cre/Lox recombination sites. Each WiscDsLox line therefore has the potential to serve as a launch-pad for performing local saturation mutagenesis by mobilization of the Ds element. In addition, Cre-Lox recombination between the T-DNA and a transposed Ds element should enable targeted deletion of specific genomic regions. We generated the WiscDsLox collection using an improved high-throughput pipeline that streamlines analysis of large numbers of independent Arabidopsis thaliana (L.) Hyenh. lines. In this paper we describe the details of this novel method and also provide potential users of WiscDsLox T-DNA lines with useful background information about this collection. Experiments to characterize the utility of the Ds transposon and Cre/Lox elements present in the WiscDsLox lines are in progress and will be reported in the future. PMID:17186119

  18. Dissociation ( Ds ) constructs, mapped Ds launch pads and a transiently-expressed transposase system suitable for localized insertional mutagenesis in rice

    Microsoft Academic Search

    Narayana M. Upadhyaya; Qian-Hao Zhu; Xue-Rong Zhou; Andrew L. Eamens; Mohammad S. Hoque; Kerrie Ramm; Ramannee Shivakkumar; Kathryn F. Smith; Shu-Ting Pan; Suzhi Li; Kefan Peng; Song J. Kim; Elizabeth S. Dennis

    2006-01-01

    We have developed a transiently-expressed transposase (TET)-mediated Dissociation (Ds) insertional mutagenesis system for generating stable insertion lines in rice which will allow localized mutagenesis of\\u000a a chromosomal region. In this system, a Ds containing T-DNA construct was used to produce Ds launch pad lines. Callus tissues, from single-copy Ds\\/T-DNA lines, were then transiently infected with Agrobacterium harbouring an immobile Ac

  19. Peripherally inserted central line catheter infections in burn patients.

    PubMed

    Barsun, Alura; Sen, Soman; Palmieri, Tina L; Greenhalgh, David G

    2014-01-01

    Peripherally inserted central line catheter (PICC) use has increased in burn patients. While the risks of central line associated blood stream infections (CLABSI) in burn patients have been well studied, the risks of PICC infections have yet to be fully elucidated. A retrospective chart review was performed of all burn patients with a PICC admitted to our regional burn center from 2006 to 2008. Information collected included: age, total body surface area (TBSA) burn injury, length of hospital stay, duration of PICC line insertion, hospital day of PICC line insertion, and development of infections. All mean values are presented as the mean ± standard error. A total of 56 patients received a PICC during this time period. Eight patients developed PICC infections with an overall rate of 11.7/1000 catheter days. Burn patient CLABSI for the same time period was 12.9/1000 catheter days. Duration of PICC did not differ between infected and noninfected patients (13.3 ± 6 vs. 12.1 ± 9.6 days). Patients with PICC infections had a higher percentage of TBSA (42.7 ± 3.2 vs. 20.6 ± 2.4*), longer length of admission (72.4 ± 6 vs. 35 ± 3.2*), and later hospital day of PICC insertion (48 ± 4.6 vs. 17.1 ± 2.5*). On linear regression analysis, PICC infection was significantly associated with TBSA (B = 22.1*), length of admission (B = 37.4*), and hospital day of PICC insertion (B = 30.3*). On multivariate analysis, TBSA (Odds ratio [OR] = 1.05*), length of admission (OR = 1.04*), and hospital day of PICC insertion (OR = 1.05*) all independently increased the risk of developing a PICC infection. Patients with severe burn injury, long hospital admissions, and later hospital day of PICC insertions are at higher risk of developing PICC infections. This data suggests that protocols should be developed about routine PICC changes in this high-risk burn population. PMID:25055005

  20. The impact of central line insertion bundle on central line-associated bloodstream infection

    PubMed Central

    2014-01-01

    Background Knowledge about the impact of each central line insertion bundle on central line-associated bloodstream infection (CLABSI) is limited. Methods A quality-improvement intervention, including education, central venous catheter (CVC) insertion bundle, process and outcome surveillance, have been introduced since March 2013. Outcome surveillances, including CLABSI per 1,000 catheter-days, CLABSI per 1,000 inpatient-days, and catheter utilization rates (days of catheter use divided by total inpatient-days), were measured. As a baseline measurement for a comparison, we retrospectively collected data from March 1, 2012 to December 31, 2012. Results During this 10-month period, there were a total of 687 CVC insertions, and 627 (91.2%) insertions were performed by intensivists. The rate of CLABSI significantly declined from 1.65 per 1000 catheter-day during the pre-intervention period to 0.65 per 1000 catheter-day post-intervention period (P?=?0.039). CLABSI more likely developed in subjects in which a maximal sterile barrier was not used compared with subjects in which it was used (P?=?0.03). Moreover, CVC inserted by non-intensivists were more likely to become infected than CVC inserted by intensivists (P?=?0.010). Conclusions This multidisciplinary infection control intervention, including a central line insertion care bundle, can effectively reduce the rate of CLABSI. The impact of different care bundle varies, and a maximal sterile barrier precaution during catheter insertion is an essential component of the care line insertion bundle. PMID:24985729

  1. Systematic Reverse Genetic Screening of T-DNA Tagged Genes in Rice for Fun...es as a Test Case --Lee et al. 44 (12): 1403 --Plant and Cell Physiology Frame contained PDF file, click here to view

    E-print Network

    Nei, Masatoshi

    a). Among these methods, random insertional mutagenesis by transposons or T-DNA have been most: Insertional mutagenesis -- MADS-box genes -- Pool screening -- Rice -- T-DNA. Because sequencing of the rice

  2. Prepackaged central line kits reduce procedural mistakes during central line insertion: a randomized controlled prospective trial

    PubMed Central

    2013-01-01

    Background Central line catheter insertion is a complex procedure with a high cognitive load for novices. Providing a prepackaged all-inclusive kit is a simple measure that may reduce the cognitive load. We assessed whether the use of prepackaged all-inclusive central line insertion kits reduces procedural mistakes during central line catheter insertion by novices. Methods Thirty final year medical students and recently qualified physicians were randomized into two equal groups. One group used a prepackaged all-inclusive kit and the other used a standard kit containing only the central vein catheter and all other separately packaged components provided in a materials cart. The procedure was videotaped and analyzed by two blinded raters using a checklist. Both groups performed central line catheter insertion on a manikin, assisted by nursing students. Results The prepackaged kit group outperformed the standard kit group in four of the five quality indicators: procedure duration (26:26?±?3:50 min vs. 31:27?±?5:57 min, p?=?.01); major technical mistakes (3.1?±?1.4 vs. 4.8?±?2.6, p?=?.03); minor technical mistakes (5.2?±?1.7 vs. 8.0?±?3.2, p?=?.01); and correct steps (83?±?5% vs. 75?±?11%, p?=?.02). The difference for breaches of aseptic technique (1.2?±?0.8 vs. 3.0?±?3.6, p?=?.06) was not statistically significant. Conclusions Prepackaged all-inclusive kits for novices improved the procedure quality and saved staff time resources in a controlled simulation environment. Future studies are needed to address whether central line kits also improve patient safety in hospital settings. PMID:23631396

  3. A landscape of hairy and twisted: hunting for new trichome mutants in the Saskatoon Arabidopsis T-DNA population.

    PubMed

    Taheri, A; Gao, P; Yu, M; Cui, D; Regan, S; Parkin, I; Gruber, M

    2015-03-01

    A total of 88 new Arabidopsis lines with trichome variation were recovered by screening 49,200 single-seed descent T3 lines from the SK activation-tagged population and from a new 20,000-line T-DNA insertion population (called pAG). Trichome variant lines were classified into 12 distinct phenotype categories. Single or multiple T-DNA insertion sites were identified for 89% of these mutant lines. Alleles of the well-known trichome genes TRY, GL2 and TTG1 were recovered with atypical phenotype variation not reported previously. Moreover, atypical gene expression profiles were documented for two additional mutants specifying TRY and GL2 disruptions. In remaining mutants, ten lines were disrupted in genes coding for proteins not implicated in trichome development, five were disrupted in hypothetical proteins and 11 were disrupted in proteins with unknown function. The collection represents new opportunities for the plant biology community to define trichome development more precisely and to refine the function of individual trichome genes. PMID:25348773

  4. Blood Cultures at Central Line Insertion in the Intensive Care Unit: Comparison with Peripheral Venipuncture?

    PubMed Central

    Stohl, Sheldon; Benenson, Shmuel; Sviri, Sigal; Avidan, Alexander; Block, Colin; Sprung, Charles L.; Levin, Phillip D.

    2011-01-01

    Blood cultures are a key diagnostic test for intensive care unit (ICU) patients; however, contaminants complicate interpretations and lead to unnecessary antibiotic administration and costs. Indications for blood cultures and central venous catheter (CVC) insertions often overlap for ICU patients. Obtaining blood cultures under the strict sterile precautions utilized for CVC insertion might be expected to decrease culture contamination. This retrospective study compared the results of blood cultures taken at CVC insertion, at arterial line insertion, and from peripheral venipuncture in order to validate the advantage of CVC insertion cultures. Cultures from indwelling lines were excluded. Results of 14,589 blood cultures, including 2,736 (19%) CVC, 1,513 (10%) arterial line, and 10,340 (71%) peripheral cultures taken over 5.5 years in two ICUs (general and medical) were analyzed. CVC cultures were contaminated more frequently than arterial line or peripheral cultures (225/2,736 [8%] CVC, 48/1,513 [3%] arterial line, and 378/10,340 (4%) peripheral cultures [P < 0.001 for CVC versus peripheral and CVC versus arterial line cultures]). True pathogens were found more frequently in CVC insertion cultures (334/2,736 [12%] CVC, 155/1,513 [10%] arterial line, and 795/10,340 [8%] peripheral cultures [P < 0.001 for CVC versus peripheral cultures; P = 0.055 for CVC versus arterial line cultures; P < 0.001 for peripheral versus arterial line cultures]). Contamination and true-positive rates were similar for culture sets from the two ICUs for each given culture source. Despite superior sterile precautions, cultures taken at the time of central line insertion had a higher contamination rate than did either peripheral or arterial line blood cultures. This may be related to the increased manipulations required for CVC insertion. PMID:21525219

  5. DEVELOPMENT OF A TOOL TO INSERT ABOMASAL INFUSION LINES INTO DAIRY COWS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A tool was developed to aid in ruminal insertion of abomasal infusion lines into dairy cows. The tool consisted of two pieces cut from polyvinyl chloride pipe. The first piece of pipe, the insertion tool, contained a groove that held the flexible plastic flange that was on the end of the infusion ...

  6. Dissociation (Ds) constructs, mapped Ds launch pads and a transiently-expressed transposase system suitable for localized insertional mutagenesis in rice.

    PubMed

    Upadhyaya, Narayana M; Zhu, Qian-Hao; Zhou, Xue-Rong; Eamens, Andrew L; Hoque, Mohammad S; Ramm, Kerrie; Shivakkumar, Ramannee; Smith, Kathryn F; Pan, Shu-Ting; Li, Suzhi; Peng, Kefan; Kim, Song J; Dennis, Elizabeth S

    2006-05-01

    We have developed a transiently-expressed transposase (TET)-mediated Dissociation (Ds) insertional mutagenesis system for generating stable insertion lines in rice which will allow localized mutagenesis of a chromosomal region. In this system, a Ds containing T-DNA construct was used to produce Ds launch pad lines. Callus tissues, from single-copy Ds/T-DNA lines, were then transiently infected with Agrobacterium harbouring an immobile Ac (iAc) construct, also containing a green fluorescent protein gene (sgfpS65T) as the visual marker. We have regenerated stable Ds insertion lines at a frequency of 9-13% using selection for Ds excision and GFP counter selection against iAc and nearly half of them were unique insertion lines. Double transformants (iAc/Ds) were also obtained and their progeny yielded approximately 10% stable insertion lines following excision and visual marker screening with 50% redundancy. In general, more than 50% of the Ds reinsertions were within 1 cM of the launch pad. We have produced a large number of single-copy Ds/T-DNA launch pads distributed over the rice chromosomes and have further refined the Ds/T-DNA construct to enrich for "clean" single-copy T-DNA insertions. The availability of single copy "clean" Ds/T-DNA launch pads will facilitate chromosomal region-directed insertion mutagenesis. This system provides an opportunity for distribution of gene tagging tasks among collaborating laboratories on the basis of chromosomal locations. PMID:16505997

  7. Integrated mechanism for the generation of the 5' junctions of LINE inserts.

    PubMed

    Yamaguchi, Katsumi; Kajikawa, Masaki; Okada, Norihiro

    2014-12-01

    To elucidate the molecular mechanism of the integration of long interspersed elements (LINEs), we characterized the 5' ends of more than 200 LINE de novo retrotransposition events into chicken DT40 or human HeLa cells. Human L1 inserts produced 15-bp target-site duplications (TSDs) and zebrafish ZfL2-1 inserts produced 5-bp TSDs in DT40 cells, suggesting that TSD length depends on the LINE species. Further analysis of 5' junctions revealed that the 5'-end-joining pathways of LINEs can be divided into two fundamental types-annealing or direct. We also found that the generation of 5' inversions depends on host and LINE species. These results led us to propose a new model for 5'-end joining, the type of which is determined by the extent of exposure of 3' overhangs generated after the second-strand cleavage and by the involvement of host factors. PMID:25378331

  8. Plenum window insertion loss in the presence of a line source--a scale model study.

    PubMed

    Tong, Y G; Tang, S K

    2013-03-01

    The acoustical insertion losses of plenum windows installed on a building facade in the presence of a non-parallel line source are studied by using a 1:4 scaled down model in a semi-anechoic chamber in the present investigation. Two types of insertion losses, weighted by the normalized traffic noise spectrum (from the 100 Hz to 5000 Hz one-third octave bands), are defined with different references. The first one is for the case where the orientation of the building facade relative to the line source is fixed. The reference case is the opened window having the same orientation angle as the plenum window. The maximum and minimum insertion losses under this condition across the orientations tested are found to be around 14 dB and 5 dB, respectively. The other is the opposite situation where such orientation is allowed to change because of practical purposes and the reference for this condition is the opened window with its width span parallel to the line source. The corresponding maximum and minimum insertion losses are found to be around 18 dB and 8 dB, respectively. There are evidences showing that the lower order plenum acoustic modes are responsible for the relatively high low frequency insertion loss. PMID:23464017

  9. Molecular analysis of Agrobacterium T-DNA integration in tomato reveals a role for left border sequence homology in most integration events.

    PubMed

    Thomas, Colwyn M; Jones, Jonathan D G

    2007-10-01

    Studies in several plants have shown that Agrobacterium tumefaciens T-DNA can integrate into plant chromosomal DNA by different mechanisms involving single-stranded (ss) or double-stranded (ds) forms. One mechanism requires sequence homology between plant target and ssT-DNA border sequences and another double-strand-break repair in which preexisting chromosomal DSBs "capture" dsT-DNAs. To learn more about T-DNA integration in Solanum lycopersicum we characterised 98 T-DNA/plant DNA junction sequences and show that T-DNA left border (LB) and right border transfer is much more variable than previously reported in Arabidopsis thaliana and Populus tremula. The analysis of seven plant target sequences showed that regions of homology between the T-DNA LB and plant chromosomal DNA plays an important role in T-DNA integration. One T-DNA insertion generated a target sequence duplication that resulted from nucleolytic processing of a LB/plant DNA heteroduplex that generated a DSB in plant chromosomal DNA. One broken end contained a captured T-DNA that served as a template for DNA repair synthesis. We propose that most T-DNA integrations in tomato require sequence homology between the ssT-DNA LB and plant target DNA which results in the generation of DSBs in plant chromosomal DNA. PMID:17574477

  10. T-DNA Organization in Tumor Cultures and Transgenic Plants of the Monocotyledon Asparagus officinalis

    Microsoft Academic Search

    Benny Bytebier; Francine Deboeck; Henri de Greve; Marc van Montagu; Jean-Pierre Hernalsteens

    1987-01-01

    Asparagus officinalis was the first monocotyledonous plant from which hormone-independent and opine-producing crown gall tissue could be isolated. We confirm by DNA hybridization that tumor lines obtained after infection of this plant by Agrobacterium strains harboring wild-type nopaline and octopine tumor-inducing (Ti) plasmids are stably transformed and contain transferred DNA (T-DNA) segments identical to the T-DNA found in dicotyledonous plants.

  11. Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

    PubMed

    Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

    2001-08-01

    Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions. PMID:11511928

  12. Highly efficient germ-line transmission of proviral insertions in zebrafish.

    PubMed Central

    Gaiano, N; Allende, M; Amsterdam, A; Kawakami, K; Hopkins, N

    1996-01-01

    An important technology in model organisms is the ability to make transgenic animals. In the past, transgenic technology in zebrafish has been limited by the relatively low efficiency with which transgenes could be generated using either DNA microinjection or retroviral infection. Previous efforts to generate transgenic zebrafish with retroviral vectors used a pseudotyped virus with a genome based on the Moloney murine leukemia virus and the envelope protein of the vesicular stomatitis virus. This virus was injected into blastula-stage zebrafish, and 16% of the injected embryos transmitted proviral insertions to their offspring, with most founders transmitting a single insertion to approximately 2% of their progeny. In an effort to improve this transgenic frequency, we have generated pseudotyped viral stocks of two new Moloney-based genomes. These viral stocks have titers up to two orders of magnitude higher than that used previously. Injection of these viruses resulted in a dramatic increase in transgenic efficiency; over three different experiments, 83% (110/133) of the injected embryos transmitted proviral insertions to 24% of their offspring. Furthermore, founders made with one of the viruses transmitted an average of 11 different insertions through their germ line. These results represent a 50- to 100-fold improvement in the efficiency of generating transgenic zebrafish, making it now feasible for a single lab to rapidly generate tens to hundreds of thousands of transgenes. Consequently, large-scale insertional mutagenesis strategies, previously limited to invertebrates, may now be possible in a vertebrate. Images Fig. 2 PMID:8755552

  13. Differential insertion loss and deterministic jitter for different types of differential transmission lines in high-speed serial backplane bus

    Microsoft Academic Search

    H. Osaka; Y. Uematsu; K. Yamamoto; H. Kanai; N. Chujo

    2007-01-01

    We measured the differential insertion loss and the deterministic jitter for three types of differential transmission lines on a motherboard in a serial backplane bus at 2 Gbps in order to prioritize the design specifications for transmission lines. We tested three line widths having different common impedances of the lines while keeping the differential impedance at about 100 Omega, moreover

  14. A new exon created by intronic insertion of a rearranged LINE1 element as the cause of chronic granulomatous disease

    Microsoft Academic Search

    Christof Meischl; Martin de Boer; Anders Åhlin; Dirk Roos

    2000-01-01

    Long interspersed nuclear element-1 (LINE-1) or L1 elements are DNA elements present in the genome in high copy number and capable of active retrotransposition. Here we present a patient with severe chronic granulomatous disease (CGD) caused by insertion of an L1 sequence into intron 5 of the X-lined gene CYBB. Due to internal rearrangements, the insert introduced new splice sites

  15. Rescuing Alu: Recovery of New Inserts Shows LINE-1 Preserves Alu Activity through A-Tail Expansion

    PubMed Central

    Wagstaff, Bradley J.; Hedges, Dale J.; Derbes, Rebecca S.; Campos Sanchez, Rebeca; Chiaromonte, Francesca; Makova, Kateryna D.; Roy-Engel, Astrid M.

    2012-01-01

    Alu elements are trans-mobilized by the autonomous non-LTR retroelement, LINE-1 (L1). Alu-induced insertion mutagenesis contributes to about 0.1% human genetic disease and is responsible for the majority of the documented instances of human retroelement insertion-induced disease. Here we introduce a SINE recovery method that provides a complementary approach for comprehensive analysis of the impact and biological mechanisms of Alu retrotransposition. Using this approach, we recovered 226 de novo tagged Alu inserts in HeLa cells. Our analysis reveals that in human cells marked Alu inserts driven by either exogenously supplied full length L1 or ORF2 protein are indistinguishable. Four percent of de novo Alu inserts were associated with genomic deletions and rearrangements and lacked the hallmarks of retrotransposition. In contrast to L1 inserts, 5? truncations of Alu inserts are rare, as most of the recovered inserts (96.5%) are full length. De novo Alus show a random pattern of insertion across chromosomes, but further characterization revealed an Alu insertion bias exists favoring insertion near other SINEs, highly conserved elements, with almost 60% landing within genes. De novo Alu inserts show no evidence of RNA editing. Priming for reverse transcription rarely occurred within the first 20 bp (most 5?) of the A-tail. The A-tails of recovered inserts show significant expansion, with many at least doubling in length. Sequence manipulation of the construct led to the demonstration that the A-tail expansion likely occurs during insertion due to slippage by the L1 ORF2 protein. We postulate that the A-tail expansion directly impacts Alu evolution by reintroducing new active source elements to counteract the natural loss of active Alus and minimizing Alu extinction. PMID:22912586

  16. Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress

    PubMed Central

    Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László

    2009-01-01

    Background Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Results Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26°C followed by a gradual decrease to 8°C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. Conclusion This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA line. Qualitative and quantitative GUS expression analyses of one tagged promoter in a commercial cultivar demonstrated a reproducible promoter activity pattern during in vitro culture. Thus, this promoter could be used during in vitro selection and generation of commercial transgenic plants. PMID:19552803

  17. Agrobacterium tumefaciens T-DNA integrates into multiple sites of the sunflower crown gall genome

    Microsoft Academic Search

    Doris Ursic; Jerry L. Slightom; John D. Kemp

    1983-01-01

    We analyzed the integration of a tumor inducing (Ti) plasmid into an octopine producing crown gall tumor of sunflower, line PSCG 15955. A continuous Ti plasmid segment (T-DNA) of about 19.5 kilo base pairs (kbp) is transferred and integrated into a small number of sites of the plant DNA.

  18. Transcription of Agrobacterium rhizogenes A4 T-DNA

    Microsoft Academic Search

    Brian H. Taylor; Frank F. White; Eugene W. Nester; Milton P. Gordon

    1985-01-01

    Two distinct segments of transferred DNA (T-DNA) were detected in tumor tissue incited by Agrobacterium rhizogenes strain A4 on Nicotiana glauca. RNA from these tumors was examined for the presence of T-DNA encoded transcripts. Six genetic loci involved in virulence and tumor morphology have been identified by transposon mutagenesis: rol A-D on the leftward T-DNA (TL-DNA) and tms1 and 2

  19. T-DNA transfer and T-DNA integration efficiencies upon Arabidopsis thaliana root explant cocultivation and floral dip transformation.

    PubMed

    Ghedira, Rim; De Buck, Sylvie; Van Ex, Frédéric; Angenon, Geert; Depicker, Ann

    2013-08-24

    T-DNA transfer and integration frequencies during Agrobacterium-mediated root explant cocultivation and floral dip transformations of Arabidopsis thaliana were analyzed with and without selection for transformation-competent cells. Based on the presence or absence of CRE recombinase activity without or with the CRE T-DNA being integrated, transient expression versus stable transformation was differentiated. During root explant cocultivation, continuous light enhanced the number of plant cells competent for interaction with Agrobacterium and thus the number of transient gene expression events. However, in transformation competent plant cells, continuous light did not further enhance cotransfer or cointegration frequencies. Upon selection for root transformants expressing a first T-DNA, 43-69 % of these transformants showed cotransfer of another non-selected T-DNA in two different light regimes. However, integration of the non-selected cotransferred T-DNA occurred only in 19-46 % of these transformants, indicating that T-DNA integration in regenerating root cells limits the transformation frequencies. After floral dip transformation, transient T-DNA expression without integration could not be detected, while stable T-DNA transformation occurred in 0.5-1.3 % of the T1 seedlings. Upon selection for floral dip transformants with a first T-DNA, 8-34 % of the transformants showed cotransfer of the other non-selected T-DNA and in 93-100 % of them, the T-DNA was also integrated. Therefore, a productive interaction between the agrobacteria and the female gametophyte, rather than the T-DNA integration process, restricts the floral dip transformation frequencies. PMID:23975012

  20. Pat Hock, RN, PICU Nurse Educator, Lucille Packard Children's Hospital CVP lines are frequently inserted in

    E-print Network

    Kay, Mark A.

    gloves and remove dressing. Remove sutures, if any. Prep exit site with Chloraprep, use crisscrossing Complications during insertion include inadvertent arterial puncture, hematoma, pneumothorax, hemothorax

  1. Analysis of junctions between T-DNA and plant genome in transgenic Arabidopsis thaliana

    Microsoft Academic Search

    Jeong Hoe Kim; Sangman Lee

    2007-01-01

    To understand the mechanism forAgrobacterium- mediated transformation of plants, we analyzed the junctions between T-DNA and plant genome, using 12 individual transgenic lines\\u000a transformed with 7 different plant expression constructs. After performing TAIL-PCR, we sequenced 42 PCR products for analysis.\\u000a All of the RBs were nicked by VirD1\\/VirD2 proteins whereas only 62% of the LBs were. Additional deletions of the

  2. Agrobacterium T-DNA integration: molecules and models.

    PubMed

    Tzfira, Tzvi; Li, Jianxiong; Lacroix, Benoît; Citovsky, Vitaly

    2004-08-01

    Genetic transformation mediated by Agrobacterium involves the transfer of a DNA molecule (T-DNA) from the bacterium to the eukaryotic host cell, and its integration into the host genome. Whereas extensive work has revealed the biological mechanisms governing the production, Agrobacterium-to-plant cell transport and nuclear import of the Agrobacterium T-DNA, the integration step remains largely unexplored, although several different T-DNA integration mechanisms have been suggested. Recent genetic and functional studies have revealed the importance of host proteins involved in DNA repair and maintenance for T-DNA integration. In this article, we review our understanding of the specific function of these proteins and propose a detailed model for integration. PMID:15262410

  3. SEARCHING FOR AGROBACTERIAL T-DNA FRAGMENTS IN PLANT GENOMES

    Microsoft Academic Search

    SUMMARY Motivation: The aim of this work was to search for the nucleotide sequences in plant genome data banks similar to agrobacterial T-DNA fragments, in order to evaluate the role of naturally associated soilborne agrobacteria in plant evolution. Results: Depending on the variant and length of the T-DNA right-border fragment, we found from 2 to 115 nucleotide sequences within different

  4. Identification of Lactobacillus species using tDNA-PCR.

    PubMed

    Baele, Margo; Vaneechoutte, Mario; Verhelst, Rita; Vancanneyt, Marc; Devriese, Luc A; Haesebrouck, Freddy

    2002-08-01

    tDNA intergenic spacer PCR (tDNA-PCR) using consensus primers complementary to the conserved edges of the tRNA genes can amplify the intergenic spacers. Separation of the PCR products with capillary electrophoresis enables discrimination between fragments differing only one basepair in length. This method was applied to a collection of 82 Lactobacillus strains belonging to 37 species in order to evaluate the discriminatory power of this technique within this genus. Twenty-one species could be distinguished to species level on the basis of a unique tDNA fingerprint pattern. The other species grouped by two (e.g. L. fermentum and L. cellobiosus) or three (L. acidophilus, L. gallinarum and L. helveticus). Inclusion of the resulting fingerprints in a numerical database containing fingerprints of numerous other Gram-positive and Gram-negative species makes the identification of unknown strains possible. PMID:12031576

  5. T-DNA from Agrobacterium Ti Plasmid is in the Nuclear DNA Fraction of Crown Gall Tumor Cells

    Microsoft Academic Search

    Mary-Dell Chilton; Randall K. Saiki; Narendra Yadav; Milton P. Gordon; Francis Quetier

    1980-01-01

    The crown gall teratoma tumor line BT37, incited by Agrobacterium tumefaciens strain T37, has been found to contain part of the tumor-inducing plasmid, pTi T37, of the inciting strain. This foreign DNA segment, called T-DNA, is maintained at several copies per diploid tumor cell. We have examined subcellular DNA fractions from this tumor line in an effort to determine whether

  6. Transcultural diabetes nutrition algorithm (tDNA): Venezuelan application.

    PubMed

    Nieto-Martínez, Ramfis; Hamdy, Osama; Marante, Daniel; Marulanda, María Inés; Marchetti, Albert; Hegazi, Refaat A; Mechanick, Jeffrey I

    2014-04-01

    Medical nutrition therapy (MNT) is a necessary component of comprehensive type 2 diabetes (T2D) management, but optimal outcomes require culturally-sensitive implementation. Accordingly, international experts created an evidence-based transcultural diabetes nutrition algorithm (tDNA) to improve understanding of MNT and to foster portability of current guidelines to various dysglycemic populations worldwide. This report details the development of tDNA-Venezuelan via analysis of region-specific cardiovascular disease (CVD) risk factors, lifestyles, anthropometrics, and resultant tDNA algorithmic modifications. Specific recommendations include: screening for prediabetes (for biochemical monitoring and lifestyle counseling); detecting obesity using Latin American cutoffs for waist circumference and Venezuelan cutoffs for BMI; prescribing MNT to people with prediabetes, T2D, or high CVD risk; specifying control goals in prediabetes and T2D; and describing regional differences in prevalence of CVD risk and lifestyle. Venezuelan deliberations involved evaluating typical food-based eating patterns, correcting improper dietary habits through adaptation of the Mediterranean diet with local foods, developing local recommendations for physical activity, avoiding stigmatizing obesity as a cosmetic problem, avoiding misuse of insulin and metformin, circumscribing bariatric surgery to appropriate indications, and using integrated health service networks to implement tDNA. Finally, further research, national surveys, and validation protocols focusing on CVD risk reduction in Venezuelan populations are necessary. PMID:24699193

  7. Transcultural Diabetes Nutrition Algorithm (tDNA): Venezuelan Application

    PubMed Central

    Nieto-Martínez, Ramfis; Hamdy, Osama; Marante, Daniel; Inés Marulanda, María; Marchetti, Albert; Hegazi, Refaat A.; Mechanick, Jeffrey I.

    2014-01-01

    Medical nutrition therapy (MNT) is a necessary component of comprehensive type 2 diabetes (T2D) management, but optimal outcomes require culturally-sensitive implementation. Accordingly, international experts created an evidence-based transcultural diabetes nutrition algorithm (tDNA) to improve understanding of MNT and to foster portability of current guidelines to various dysglycemic populations worldwide. This report details the development of tDNA-Venezuelan via analysis of region-specific cardiovascular disease (CVD) risk factors, lifestyles, anthropometrics, and resultant tDNA algorithmic modifications. Specific recommendations include: screening for prediabetes (for biochemical monitoring and lifestyle counseling); detecting obesity using Latin American cutoffs for waist circumference and Venezuelan cutoffs for BMI; prescribing MNT to people with prediabetes, T2D, or high CVD risk; specifying control goals in prediabetes and T2D; and describing regional differences in prevalence of CVD risk and lifestyle. Venezuelan deliberations involved evaluating typical food-based eating patterns, correcting improper dietary habits through adaptation of the Mediterranean diet with local foods, developing local recommendations for physical activity, avoiding stigmatizing obesity as a cosmetic problem, avoiding misuse of insulin and metformin, circumscribing bariatric surgery to appropriate indications, and using integrated health service networks to implement tDNA. Finally, further research, national surveys, and validation protocols focusing on CVD risk reduction in Venezuelan populations are necessary. PMID:24699193

  8. Ergonomic study on the manual component insertion lines for occupational health and safety improvements.

    PubMed

    Sen, Rabindra Nath; Yeow, Paul H P

    2003-01-01

    The study aimed at reducing the occupational health and safety problems faced by the manual component insertion operators. Subjective and objective assessments, and direct observations were made in the printed circuit assembly factory. Simple and low-cost ergonomic interventions were implemented, that is, repairing chairs, reducing high workloads, assigning operators to a maximum of 2 workstations, confining machines that emitted bad smell and much noise, and providing finger work aids. The results of the interventions were reductions in operators' work discomforts, that is, chair discomfort (by 90%), high work stress, and discomfort due to profound change in their workstations. Their health hazards were also eliminated, that is, inhalation of toxic fumes, exposure to too much noise, and pain due to pressing sharp components. PMID:12636892

  9. Characterization of a Chinese Hamster Ovary Cell Line Developed by Retroviral Insertional Mutagenesis That Is Resistant to Sindbis Virus Infection

    PubMed Central

    Jan, Jia-Tsrong; Byrnes, Andrew P.; Griffin, Diane E.

    1999-01-01

    The alphavirus Sindbis virus (SV) has a wide host range and infects many types of cultured cells in vitro. The outcome of infection is dependent on the strain of virus used for infection and the properties of the cells infected. To identify cellular determinants of susceptibility to SV infection we mutagenized Chinese hamster ovary (CHO) cells by retroviral insertion with a vector containing the neomycin resistance gene that allowed selection for integration into transcriptionally active genes. Cells were then selected for survival after infection with SV. The most resistant cell line (CHO-18.4m) exhibited delayed virus replication and virus-induced cell death, had a single retroviral insertion, and was defective in SV binding to the cell surface. Further analysis revealed that CHO-18.4m cells were deficient in the expression of the sulfated glycosaminoglycans heparan sulfate and chondroitin sulfate. This further confirms the importance of heparan sulfate as an attachment molecule for SV in vitro and demonstrates the usefulness of this technique for identifying cellular genes that are important for virus replication. PMID:10233953

  10. An insertional mutagenesis programme with an enhancer trap for the identification and tagging of genes involved in abiotic stress tolerance in the tomato wild-related species Solanum pennellii.

    PubMed

    Atarés, Alejandro; Moyano, Elena; Morales, Belén; Schleicher, Peter; García-Abellán, José Osvaldo; Antón, Teresa; García-Sogo, Begoña; Perez-Martin, Fernando; Lozano, Rafael; Flores, Francisco Borja; Moreno, Vicente; Bolarin, María del Carmen; Pineda, Benito

    2011-10-01

    Salinity and drought have a huge impact on agriculture since there are few areas free of these abiotic stresses and the problem continues to increase. In tomato, the most important horticultural crop worldwide, there are accessions of wild-related species with a high degree of tolerance to salinity and drought. Thus, the finding of insertional mutants with other tolerance levels could lead to the identification and tagging of key genes responsible for abiotic stress tolerance. To this end, we are performing an insertional mutagenesis programme with an enhancer trap in the tomato wild-related species Solanum pennellii. First, we developed an efficient transformation method which has allowed us to generate more than 2,000 T-DNA lines. Next, the collection of S. pennelli T(0) lines has been screened in saline or drought conditions and several presumptive mutants have been selected for their salt and drought sensitivity. Moreover, T-DNA lines with expression of the reporter uidA gene in specific organs, such as vascular bundles, trichomes and stomata, which may play key roles in processes related to abiotic stress tolerance, have been identified. Finally, the growth of T-DNA lines in control conditions allowed us the identification of different development mutants. Taking into account that progenies from the lines are being obtained and that the collection of T-DNA lines is going to enlarge progressively due to the high transformation efficiency achieved, there are great possibilities for identifying key genes involved in different tolerance mechanisms to salinity and drought. PMID:21647638

  11. T-DNA from Agrobacterium Ti plasmid is in the nuclear DNA fraction of crown gall tumor cells

    PubMed Central

    Chilton, Mary-Dell; Saiki, Randall K.; Yadav, Narendra; Gordon, Milton P.; Quetier, Francis

    1980-01-01

    The crown gall teratoma tumor line BT37, incited by Agrobacterium tumefaciens strain T37, has been found to contain part of the tumor-inducing plasmid, pTi T37, of the inciting strain. This foreign DNA segment, called T-DNA, is maintained at several copies per diploid tumor cell. We have examined subcellular DNA fractions from this tumor line in an effort to determine whether T-DNA is in chloroplasts, mitochondria, or nuclei. Tumor cell chloroplast DNA exhibited EcoRI and Bst I endonuclease cleavage patterns identical to those of normal tobacco chloroplast DNA. Tumor cell mitochondrial DNA exhibited a complex Bst I cleavage pattern that did not differ detectably from that of normal tobacco mitochondrial DNA. Southern blots of tumor chloroplast and mitochondrial cleavage products did not hybridize with labeled pTi T37 DNA, whereas blots of tumor cell nuclear DNA cleavage products hybridized strongly. We conclude that T-DNA is located not in chloroplasts or mitochondria but rather in the nuclear fraction of this tumor line. Images PMID:16592850

  12. The Aspergillus nidulans amdS gene as a marker for the identification of multicopy T-DNA integration events in Agrobacterium -mediated transformation of Aspergillus awamori

    Microsoft Academic Search

    C. B. Michielse; A. F. J. Ram; C. A. M. J. J. van den Hondel

    2004-01-01

    The Aspergillus nidulans amdS selection marker was used for the identification of multicopy T-DNA insertions in Agrobacterium-mediated transformation of Asp. awamori. The selection of transformants on agar plates containing acetamide as sole nitrogen source and hygromycin resulted in a six-fold decrease in the transformation frequency, compared with the transformation frequency obtained after hygromycin selection alone. However, it was found that

  13. Clones from a shooty tobacco crown gall tumor I: deletions, rearrangements and amplifications resulting in irregular T-DNA structures and organizations

    Microsoft Academic Search

    R. Peerbolte; K. Leenhouts; G. M. S. Hooykaas-van Slogteren; J. H. C. Hoge; G. J. Wullems; R. A. Schilperoort

    1986-01-01

    Transformed clones from a shooty tobacco crown gall tumor, induced byAgrobacterium tumefaciens strain LBA1501, having a Tn1831 insertion in the auxin locus, were investigated for their T-DNA structure and expression. In addition to clones with the expected phenotype, i.e. phytohormone autonomy, regeneration of non-rooting shoots and octopine synthesis (Aut+Reg+Ocs+ 'type I' clones), clones were obtained with an aberrant phenotype. Among

  14. Agrobacterium-Mediated Gene Transfer Results Mainly in Transgenic Plants Transmitting T-DNA as a Single Mendelian Factor

    PubMed Central

    Budar, F.; Thia-Toong, L.; Van Montagu, M.; Hernalsteens, J.-P.

    1986-01-01

    Forty-four independent transformed tobacco plants were obtained from a cocultivation experiment with Agrobacterium tumefaciens strains carrying modified Ti-plasmids. The transformed plants were either self-fertilized or crossed with nontransformed plants or with other transformed plants. The segregation of a phenotypic marker (kanamycin resistance) in the progenies of these plants was determined. In 40 cases out of 44, the segregation of the kanamycin resistance marker is consistent with Mendelian genetics. Among these 40 clones, 35 contain a single kanamycin resistance locus. The five others segregate two independent resistance loci. In two of the single insert clones, the segregation ratio after selfing indicates that the T-DNA insertion may have caused a recessive lethal mutation. PMID:17246346

  15. Agrobacterium rhizogenes inserts T-DNA into the genomes of the host plant root cells

    Microsoft Academic Search

    Mary-Dell Chilton; David A. Tepfer; Annik Petit; Chantal David; Francine Casse-Delbart; Jacques Tempé

    1982-01-01

    Agrobacterium rhizogenes, which induces hairy root disease of dicotyledonous plants1, is closely related to Agrobacterium tumefaciens, the causative agent of crown gall disease1-3. Virulence in both species is conferred by large plasmids4-7. Infected plant tissue synthesizes novel metabolites, opines8-11, that are not found in normal plant tissues. The pattern of opines synthesized is determined by the type of virulence plasmid

  16. Should nephrologists take a larger role in interventional nephrology, and should central line insertion remain a requirement of nephrology residency training? A debate.

    PubMed

    Mendelssohn, David C

    2015-01-01

    The Canadian Society of Nephrology must soon provide input concerning the future of procedural training in nephrology. While at one time, the ability to insert a central venous catheter (CVC) was an essential skill required by all nephrologists, in 2014, nephrology training and practice has changed in fundamental ways such that it would be both unreasonable, and impractical, to maintain this requirement. Indeed, survey evidence suggests that many current trainees are not achieving this competency. Amongst the reasons that this requirement should be withdrawn include: 1) Not all trainees have the procedural skills to safely learn to insert CVC's. 2) Most nephrologists in training and in practice are intellectually oriented, not procedurally oriented and are not seeking to perform lots of procedures. 3) In most practice settings, interventional radiologists and intensive care doctors perform dialysis line insertions using real time ultrasound guidance frequently, and offer timely, safer, and better service to patients. 4) Most trainees will not enter practice settings where CVC insertion ability is required. 5) Otherwise excellent future trainees may be denied a nephrology certificate of special competence only because they are unable to insert a CVC by the end of their fellowship. 6) Academic nephrology training programs that cannot provide adequate CVC insertion experience to fellows may lose their status as training centres. As a pragmatic way forward, Canadian nephrology training programs must encourage and offer only those nephrology trainees who have the ability and interest in procedural nephrology, a pathway through which they may be provided superb advanced training to become an expert. There is no longer a compelling reason to mandate this for all trainees. PMID:25922687

  17. The maternal chromosome set is the target of the T-DNA in the in planta transformation of Arabidopsis thaliana.

    PubMed Central

    Bechtold, N; Jaudeau, B; Jolivet, S; Maba, B; Vezon, D; Voisin, R; Pelletier, G

    2000-01-01

    In planta transformation methods are now commonly used to transform Arabidopsis thaliana by Agrobacterium tumefaciens. The origin of transformants obtained by these methods has been studied by inoculating different floral stages and examining gametophytic expression of an introduced beta-glucuronidase marker gene encoding GUS. We observed that transformation can still occur after treating flowers where embryo sacs have reached the stage of the third division. No GUS expression was observed in embryo sacs or pollen of plants infiltrated with an Agrobacterium strain bearing a GUS gene under the control of a gametophyte-specific promoter. To identify the genetic target we used an insertion mutant in which a gene essential for male gametophytic development has been disrupted by a T-DNA bearing a Basta resistance gene (B(R)). In this mutant the B(R) marker is transferred to the progeny only by the female gametes. This mutant was retransformed with a hygromycin resistance marker and doubly resistant plants were selected. The study of 193 progeny of these transformants revealed 25 plants in which the two resistance markers were linked in coupling and only one plant where they were linked in repulsion. These results point to the chromosome set of the female gametophyte as the main target for the T-DNA. PMID:10924482

  18. Activity of T-DNA borders in plant cell transformation by mini-T plasmids.

    PubMed Central

    Jen, G C; Chilton, M D

    1986-01-01

    By using a binary vector system, we examined the requirements for border sequences in T-DNA transformation of plant genomes. Mini-T plasmids consisting of small replicons with different extents of pTiT37 T-DNA were tested for plant tumor-inducing ability in Agrobacterium tumefaciens strain LBA4404 containing helper plasmid pAL4404 (which encodes virulence genes needed for T-DNA transfer). Assays of these bacteria on carrot disks, Kalanchoë leaves, and SR1 Nicotiana tabacum plantlets showed that mini-T plasmid containing full length T-DNA including left and right borders was highly virulent, as were mini-T plasmids containing all onc (oncogenicity) genes and only the right border. In contrast, mini-T plasmids containing all onc genes and only the left border induced tumors only rarely, and a mini-T plasmid containing all onc genes but no T-DNA borders was completely avirulent. Southern hybridization analyses of tumor DNA showed that T-DNA border sequences delimited the extent of the two-border mini-T plasmid transferred and integrated into the plant genome. When only one T-DNA border was present, it formed one end of the transferred DNA, and the other end mapped in the vector sequences. The implications of these results for the mechanism of T-DNA transfer and integration are discussed. Images PMID:3009403

  19. Inactivation of the Mouse HPRTLocus by a 203-bp Retroposon Insertion and a 55-kb Gene-Targeted Deletion: Establishment of New HPRT-Deficient Mouse Embryonic Stem Cell Lines

    Microsoft Academic Search

    Hirohisa Tsuda; Catherine E. Maynard-Currie; Laura H. Reid; Takayuki Yoshida; Koji Edamura; Nobuyo Maeda; Oliver Smithies; Aya Jakobovits

    1997-01-01

    To obtain useful hypoxanthine phosphoribosyltransferase (HPRT)-deficient mouse ES cell lines, two different methods were employed: (i) selection of spontaneous 6-TG-resistant mutants and (ii) gene targeting of theHPRTlocus. The first approach resulted in the establishment of E14.1TG3B1, a spontaneous HPRT-deficient cell line with an insertional mutation of 203 bp in the third exon of theHPRTgene. The insert is highly homologous to

  20. Insertional mutagenesis using Tnt1 retrotransposon in potato

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Potato is the third most important food crop in the world. However, genetics and genomics research of potato has lagged behind many major crop species due to its autotetraploidy and a highly heterogeneous genome. Insertional mutagenesis using T-DNA or transposable elements, which is available in sev...

  1. Analysis of crosstalk of coupled transmission lines by inserting additional traces grounded with vias on printed circuit boards

    Microsoft Academic Search

    Shulan Li; Yuan'an Liu; Zhanhai Song; Hefei Hu

    2003-01-01

    In analog and digital electronic systems, crosstalk between traces on the printed circuit boards (PCB) can degrade the performance of equipment operations. To reduce crosstalk between two parallel traces of which one is called aggressor trace and the other one is called victim trace, two additional traces grounded by vias are inserted and the aggressor trace is in between the

  2. Marker-Free Transgenic Chrysanthemum Obtained by Agrobacterium -Mediated Transformation with Twin T-DNA Binary Vectors

    Microsoft Academic Search

    Lei Sun; Lin Zhou; Miao Lu; Ming CAI; Xi-Wang Jiang; Qi-Xiang Zhang

    2009-01-01

    In this study, a superbinary vector was constructed to evaluate the potential of a twin T-DNA system for generating selectable\\u000a marker-free transgenic chrysanthemum plants. The first T-DNA of the pCAMBIA 1300 vector contained the hygromycin phosphotransferase\\u000a (hpt) selectable marker gene, while the second T-DNA carried the ?-glucuronidase gene (uidA) and featuring the gene of interest. The two T-DNA regions were

  3. Copper Heat Exchanger for the External Auxiliary Bus-Bars Routing Line in the LHC Insertion Regions

    Microsoft Academic Search

    C Garion; A Poncet; F Seyvet; M Sitko; B Skoczen; J P Tock

    2006-01-01

    The corrector magnets and the main quadrupoles of the LHC dispersion suppressors are powered by a special superconducting line (called auxiliary bus-bars line N), external to the cold mass and housed in a 50 mm diameter stainless steel tube fixed to the cold mass. As the line is periodically connected to the cold mass, the same gaseous and liquid helium

  4. A LINE-1 Insertion in DLX6 Is Responsible for Cleft Palate and Mandibular Abnormalities in a Canine Model of Pierre Robin Sequence

    PubMed Central

    Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.

    2014-01-01

    Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw?=?4.64×10?15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068

  5. Efficient and sensitive assay for T-DNA-dependent transient gene expression

    Microsoft Academic Search

    L. Rossi; J. Escudero; B. Hohn; B. Tinland

    1993-01-01

    We describe here a very sensitive and reproducible method to detect the efficiency ofAgrobacterium-mediated T-DNA transfer. This method is based on a quantitative assay of ?-glucuronidase activity produced in the plant cell\\u000a upon transfer of T-DNA carrying a specialuidA gene construct. Analysis of the transfer efficiency of a transfer-proficient bacterium compared with that of the same bacterium\\u000a diluted at different

  6. Copper Heat Exchanger for the External Auxiliary Bus-Bars Routing Line in the LHC Insertion Regions

    E-print Network

    Garion, C; Seyvet, F; Sitko, M; Skoczen, B; Tock, J P

    2006-01-01

    The corrector magnets and the main quadrupoles of the LHC dispersion suppressors are powered by a special superconducting line (called auxiliary bus-bars line N), external to the cold mass and housed in a 50 mm diameter stainless steel tube fixed to the cold mass. As the line is periodically connected to the cold mass, the same gaseous and liquid helium cools both the magnets and the line. The final sub-cooling process (from around 4.5 K down to 1.9 K) consists in the phase transformation from liquid to superfluid helium. Heat is extracted from the line through the magnets via their point of junction. In dispersion suppressor zones, approximately 40 m long, the sub-cooling of the line is slightly delayed with respect to the magnets. This might have an impact on the readiness of the accelerator for operation. In order to accelerate the process, a special heat exchanger has been designed. It is located in the middle of the dispersion suppressor portion of the line. Its main function consists in providing a loca...

  7. Gallery 31: mys inserted in chromosomes

    NSDL National Science Digital Library

    2009-12-26

    Repetitive DNA can have preferred insertion sites. In this example, yellow represents the distribution of mys (a type of LINE) over a mouse genome where chromosomes are orange. There are more mys inserted in the sex (X) chromosomes.

  8. Natural plant genetic engineer Agrobacterium rhizogenes: role of T-DNA in plant secondary metabolism.

    PubMed

    Chandra, Sheela

    2012-03-01

    Agrobacterium rhizogenes is a natural plant genetic engineer. It is a gram-negative soil bacterium that induces hairy root formation. Success has been obtained in exploring the molecular mechanisms of transferred DNA (T-DNA) transfer, interaction with host plant proteins, plant defense signaling and integration to plant genome for successful plant genetic transformation. T-DNA and corresponding expression of rol genes alter morphology and plant host secondary metabolism. During transformation, there is a differential loss of a few T-DNA genes. Loss of a few ORFs drastically affect the growth and morphological patterns of hairy roots, expression pattern of biosynthetic pathway genes and accumulation of specific secondary metabolites. PMID:22048847

  9. A resource of mapped dissociation launch pads for targeted insertional mutagenesis in the Arabidopsis genome.

    PubMed

    Muskett, Paul R; Clissold, Leah; Marocco, Adriano; Springer, Patricia S; Martienssen, Robert; Dean, Caroline

    2003-06-01

    We describe a new resource for targeted insertional mutagenesis in Arabidopsis using a maize (Zea mays) Activator/Dissociation (Ds) two-element system. The two components of the system, T-DNA vectors carrying a Ds launch pad and a stable Activator transposase source, were designed to simplify selection of transposition events and maximize their usefulness. Because Ds elements preferentially transpose to nearby genomic sites, they can be used in targeted mutagenesis of linked genes. To efficiently target all genes throughout the genome, we generated a large population of transgenic Arabidopsis plants containing the Ds launch pad construct, identified lines containing single Ds launch pad inserts, and mapped the positions of Ds launch pads in 89 lines. The integration sites of the Ds launch pads were relatively evenly distributed on all five chromosomes, except for a region of chromosomes 2 and 4 and the centromeric regions. This resource therefore provides access to the majority of the Arabidopsis genome for targeted tagging. PMID:12805583

  10. A Resource of Mapped Dissociation Launch Pads for Targeted Insertional Mutagenesis in the Arabidopsis Genome1

    PubMed Central

    Muskett, Paul R.; Clissold, Leah; Marocco, Adriano; Springer, Patricia S.; Martienssen, Robert; Dean, Caroline

    2003-01-01

    We describe a new resource for targeted insertional mutagenesis in Arabidopsis using a maize (Zea mays) Activator/Dissociation (Ds) two-element system. The two components of the system, T-DNA vectors carrying a Ds launch pad and a stable Activator transposase source, were designed to simplify selection of transposition events and maximize their usefulness. Because Ds elements preferentially transpose to nearby genomic sites, they can be used in targeted mutagenesis of linked genes. To efficiently target all genes throughout the genome, we generated a large population of transgenic Arabidopsis plants containing the Ds launch pad construct, identified lines containing single Ds launch pad inserts, and mapped the positions of Ds launch pads in 89 lines. The integration sites of the Ds launch pads were relatively evenly distributed on all five chromosomes, except for a region of chromosomes 2 and 4 and the centromeric regions. This resource therefore provides access to the majority of the Arabidopsis genome for targeted tagging. PMID:12805583

  11. Feeding tube insertion - gastrostomy

    MedlinePLUS

    ... tube insertion; G-tube insertion; PEG tube insertion; Stomach tube insertion; Percutaneous endoscopic gastrostomy tube insertion ... and down the esophagus, which leads to the stomach. After the endoscopy tube is inserted, the skin ...

  12. A Resource of Mapped Dissociation Launch Pads for Targeted Insertional Mutagenesis in the

    Microsoft Academic Search

    Arabidopsis Genome; Paul R. Muskett; Leah Clissold; Adriano Marocco; Patricia S. Springer; Robert Martienssen; Caroline Dean

    We describe a new resource for targeted insertional mutagenesis in Arabidopsis using a maize (Zea mays) Activator\\/ Dissociation (Ds) two-element system. The two components of the system, T-DNA vectors carrying a Ds launch pad and a stable Activator transposase source, were designed to simplify selection of transposition events and maximize their usefulness. Because Ds elements preferentially transpose to nearby genomic

  13. Germ-line transformation of Arabidopsis lasiocarpa.

    PubMed

    Tague, B W

    2001-06-01

    In planta transformation methods have opened up the possibility of transforming plant species for which no regeneration protocols currently exist. In this study, the suitability of the germ-line transformation method developed for Arabidopsis thaliana was examined for four taxa in the Brassicaceae that have not been previously transformed: Arabidopsis griffithiana, Arabidopsis lasiocarpa, Arabidopsis petraea and Capsella bursa-pastoris. Numerous transformants were obtained for A. lasiocarpa. Transformation of A. lasiocarpa was confirmed at the phenotypic and molecular levels for stably transformed lines and for backcrossed lines segregating the T-DNA insert. Parameters affecting transformation efficiency of A. lasiocarpa were also explored. As with A. thaliana, sucrose and surfactant in the inoculation medium are required for high levels of transformation, although the suitable concentrations of these are different for A. lasiocarpa. Other components present in earlier versions of the inoculation medium had little effect on transformation efficiency. Vacuum infiltration (rather than simple floral dipping) led to higher rates of transformation and did not seriously affect seed production in A. lasiocarpa. Identification of species susceptible to germ-line transformation will aid in determining the factors important for applying this technology to more recalcitrant species. PMID:11437282

  14. Two large-insert soybean genomic libraries constructed in a binary vector: applications in chromosome walking and genome wide physical mapping

    Microsoft Academic Search

    K. Meksem; K. Zobrist; E. Ruben; D. Hyten; T. Quanzhou; H. B. Zhang; D. A. Lightfoot

    2000-01-01

    Large DNA insert libraries in binary T-DNA vectors can assist in the isolation of the gene(s) underlying a quantitative trait\\u000a locus (QTL). Binary vectors facilitate the transfer of large-insert DNA fragments containing a QTL from E. coli to Agrobacterium sp. and then to plants. We constructed two soybean large-insert libraries from cv. Forrest in the pCLD04541 (V41) binary\\u000a vector after

  15. [Cotransformation of aspen and birch with three T-DNA regions from two different replicons in one Agrobacterium tumefaciens strain].

    PubMed

    Lebedev, V G; Shestibratov, K A; Shadrina, T E; Bulatova, I V; Abramochkin, D G; Miroshnikov, A I

    2010-11-01

    The cointegration rate into the aspen and birch genomes of foreign genes from a binary vector and a disarmed Ti plasmid pCBE21 carried by the same Agrobacterium tumefaciens strain was studied. The cotransformation rate for the genes within the Ti plasmid varied from 30 to 100%; while the transformation rate for the gene from T(L) region was twofold higher as compared with the T(R) region. On the average, the gene transfer from all three T-DNAs was recorded in 10.9% of the transgenic lines. For the vector pBI121, the cotransformation rates for the genes from both regions of pCBE21 T-DNA were higher as compared with the vector pGS. In addition, a concurrent transfer of the genes from the Ti plasmid T(L) and T(R) regions was recorded only after the transformation with the vector pBI121. These results can be used for constructing woody plants containing several genes. PMID:21261057

  16. Nucleotide sequence of the T-DNA region from the A grobacterium tumefaciens octopine Ti plasmid pTi15955

    Microsoft Academic Search

    R. F. Barker; K. B. Idler; D. V. Thompson; J. D. Kemp

    1983-01-01

    The complete nucleotide sequence of the transferred region (T-DNA) of an octopine tumor inducing (Ti) plasmid fromAgrobacterium tumefaciens (pTi15955) has been determined. A total of 24 595 nucleotides extending approximately 900 bases to either side of the outermost, T-DNA boundaries was sequenced. Computer analysis of the sequenced portion of the Ti plasmid revealed that recognition sites for 72 restriction endonucleases

  17. Identification of T-DNA in the root-inducing plasmid of the agropine type Agrobacterium rhizogenes 1855

    Microsoft Academic Search

    L. Spano; M. Pomponi; P. Costantino; G. M. S. Slogteren; J. Tempé

    1982-01-01

    The region of the virulence plasmid of the agropine type Agrobacterium rhizogenes 1855 (pRi-1855) which is transferred to plant cells upon infection (T-DNA) has been identified by means of Southern blot hybridizations with the T-DNA of the mannopine type A. rhizogenes 8196. The presence in the plant genome of the pRi-1855 sequences thus identified is demonstrated in carrot roots derived

  18. High Efficiency Transgene Segregation in Co-Transformed Maize Plants using an Agrobacterium Tumefaciens 2 T-DNA Binary System

    Microsoft Academic Search

    Michael Miller; Laura Tagliani; Ning Wang; Benjamin Berka; Dennis Bidney; Zuo-Yu Zhao

    2002-01-01

    For regulatory issues and research purposes it would be desirable to have the ability to segregate transgenes in co-transformed maize. We have developed a highly efficient system to segregate transgenes in maize that was co-transformed using an Agrobacterium tumefaciens 2 T-DNA binary system. Three vector treatments were compared in this study; (1) a 2 T-DNA vector, where the selectable marker

  19. The non-conserved region of cucumopine-type Agrobacterium rhizogenes T-DNA is responsible for hairy root induction

    Microsoft Academic Search

    M. C. Failla; F. Maimone; A. De Paolis; P. Costantino; M. Cardarelli

    1990-01-01

    The T-DNA regions of three strains of Ri plasmids 1855, 8196, 2659 (agropine, mannopine and cucumopine type respectively) share two highly conserved regions flanking a non-homologous central part [1,2]. We have cloned segments of the cucumopine Ri plasmid 2659 T-DNA in the binary vector system Bin 19 and infected carrot discs with recombinant Agrobacterium strains. We show here that the

  20. The use of the two T-DNA binary system to derive marker-free transgenic soybeans

    Microsoft Academic Search

    Aiqiu Xing; Zhangyuan Zhang; Shirley Sato; Paul Staswick; Tom Clemente

    2000-01-01

    Summary  A binary vector, pPTN133, was assembled that harbored two separate T-DNAs. T-DNA one contained a bar cassette, while T-DNA two carried a GUS cassette. The plasmid was mobilized into the Agrobacterium tumefaciens strain EHA101. Mature soybean cotyledonary node explants were inoculated and regenerated on medium amended with glufosinate.\\u000a Transgenic soybeans were grown to maturity in the greenhouse. Fifteen primary transformants

  1. T-DNA tagged knockout mutation of rice OsGSK1 , an orthologue of Arabidopsis BIN2 , with enhanced tolerance to various abiotic stresses

    Microsoft Academic Search

    Serry Koh; Sang-Choon Lee; Min-Kyung Kim; Jun Ho Koh; Sichul Lee; Gynheung An; Sunghwa Choe; Seong-Ryong Kim

    2007-01-01

    T-DNA-tagged rice plants were screened under cold- or salt-stress conditions to determine the genes involved in the molecular\\u000a mechanism for their abiotic-stress response. Line 0-165-65 was identified as a salt-responsive line. The gene responsible\\u000a for this GUS-positive phenotype was revealed by inverse PCR as OsGSK1 (O\\u000a ryza \\u000a s\\u000a ativa\\u000a g\\u000a lycogen \\u000a s\\u000a ynthase \\u000a k\\u000a inase3-like gene \\u000a 1), a member of

  2. Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis.

    PubMed

    Liu, Liping; Zhao, Dian; Zheng, Lu; Hsiang, Tom; Wei, Yangdou; Fu, Yanping; Huang, Junbin

    2013-11-01

    To investigate the molecular and genetic mechanisms underlying virulence of Colletotrichum higginsianum on Arabidopsis thaliana, a T-DNA insertion mutant library of C. higginsianum, the causal agent of crucifer anthracnose, was established using Agrobacterium tumefaciens-mediated transformation. Among 875 transformants tested for virulence on Arabidopsis, six mutants with altered virulence, including an appressorial melanin-deficient mutant T734, two mutants defective in penetration, T45 and B30, and three mutants, T679, T732 and T801, that cause hypersensitive reactions on host Arabidopsis, were obtained. Southern blot analysis indicated that the mutants T732 and T734 harbored single-site T-DNA integrations, while B30 harbored two T-DNA insertions. Border flanking sequences of T-DNAs from these mutants were recovered by inverse polymerase chain reaction (PCR) and thermal asymmetric interlaced PCR. Sequence analyses revealed that single T-DNA insertions in mutant T734 targeted the coding region of a gene with unknown function, and in mutant T732 targeted a gene encoding a copper amine oxidase. The two T-DNA insertion sites in mutant B30 were found in the coding region of a gene encoding an exosome component and in the upstream region of a DUF221-domain gene. None of these genes have previously been implicated in virulence of the phytopathogenic fungi. Among these avirulent mutants, T734 showed altered color in colony growth and produced melanin-deficient, albino appressoria. The T-DNA insert in T734 was detected in the coding region of a gene named C. higginsianum melanin-deficiency gene (Ch-MEL1), which is highly similar to a gene encoding a hypothetical protein in Colletotrichum gloeosporioides (GenBank ELA33048). To validate whether the Ch-MEL1 gene was associated with virulence of the mutant T734, a targeted gene disruption and complementation approach was used. The appressoria of ?Ch-mel1 null mutants were defective in melanization and failed to penetrate the host epidermal cells. When inoculated onto the wounded leaf tissues, the ?Ch-mel1 mutants grew on host tissues but failed to cause lesions beyond the wound site. In contrast, both the complement C?Ch-mel1-2 and the wild type produced melanized appressoria and caused necrosis on leaves of Arabidopsis. Ch-MEL1 is required for both appressorial melanin production in C. higginsianum and post-invasive growth in host tissues. Together with identification of other avirulent mutants and their associated genes, this study provides novel insights into molecular mechanisms underlying virulence of the hemibiotroph, C. higginsianum. PMID:23806215

  3. Insertion Sequences

    PubMed Central

    Mahillon, Jacques; Chandler, Michael

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

  4. Laparoscopic-assisted uterovaginal anastomosis for uterine cervix atresia with vaginal aplasia using a silicone stent lined with acellular porcine small intestinal submucosa graft inserted using a 16F Foley catheter.

    PubMed

    Zhou, Qiongjie; Chen, Xiaojun; Luo, Xuezhen; Ding, Jinxin; Zhang, Guofu; Ren, Yunyun; Liu, Zhi; Hua, Keqin

    2013-01-01

    Herein is reported a novel technique for cervical reconstruction of congenital cervicovaginal atresia. The patient was a 16-year-old girl with congenital atresia of the cervix and vagina, didelphic uterus, and right hematosalpinx. At laparoscopic-assisted creation of a neocervix, a silicone stent was inserted using a 16F Foley catheter and lined with an acellular porcine small intestinal submucosa graft under ultrasound guidance. At 3-month clinical follow-up after placement of the stent, the patient had regular menstrual flow. The neocervix was completely mucosalized on the inner surface at 4 months after surgery. There were no complications related to the silicone stent or the cervical stent. Cervical reconstruction using a vaginal mucosa-lined silicone stent is accessible and effective, and provides an alternative option to preserve reproductive potential in patients with cervicovaginal atresia. PMID:23680519

  5. Differences in susceptibility of Arabidopsis ecotypes to crown gall disease may result from a deficiency in T-DNA integration.

    PubMed Central

    Nam, J; Matthysse, A G; Gelvin, S B

    1997-01-01

    We show that among ecotypes of Arabidopsis, there is considerable variation in their susceptibility to crown gall disease. Differences in susceptibility are heritable and, in one ecotype, segregate as a single major contributing locus. In several ecotypes, recalcitrance to tumorigenesis results from decreased binding of Agrobacterium to inoculated root explants. The recalcitrance of another ecotype occurs at a late step in T-DNA transfer. Transient expression of a T-DNA-encoded beta-glucuronidase gusA gene is efficient, but the ecotype is deficient in crown gall tumorigenesis, transformation to kanamycin resistance, and stable GUS expression. This ecotype is also more sensitive to gamma radiation than is a susceptible ecotype. DNA gel blot analysis showed that after infection by Agrobacterium, less T-DNA was integrated into the genome of the recalcitrant ecotype than was integrated into the genome of a highly susceptible ecotype. PMID:9090878

  6. Insertional mutagenesis in transgenic mice.

    PubMed

    Rijkers, T; Peetz, A; Rüther, U

    1994-07-01

    Increasing numbers of transgenic mouse lines have resulted in several dozens of mutants created by insertional mutagenesis. The advantages of different vector systems and the problems associated with the analysis of mutations and the cloning of the affected genes are discussed in this review. PMID:7920737

  7. Agrobacterium tumefaciens -mediated transformation for random insertional mutagenesis in Colletotrichum lagenarium

    Microsoft Academic Search

    Gento Tsuji; Satoshi Fujii; Naoki Fujihara; Chika Hirose; Seiji Tsuge; Tomonori Shiraishi; Yasuyuki Kubo

    2003-01-01

    Random insertional mutagenesis using a marker DNA fragment is an effective method for identifying fungal genes relevant to morphogenesis, metabolism, and so on. Agrobacterium tumefaciens-mediated transformation (AtMT) has long been used as a tool for the genetic modification of a wide range of plant species. Recent study has indicated that A. tumefaciens could transfer T-DNA not only to plant cells

  8. Chest tube insertion

    MedlinePLUS

    Chest drainage tube insertion; Insertion of tube into chest; Tube thoracostomy ... When your chest tube is inserted, you will lie on your side or sit partly upright, with one arm over your head. The ...

  9. Dihalocarbene Insertion Experiment

    ERIC Educational Resources Information Center

    Goh, S. H.

    1975-01-01

    Describes the insertion reaction using the insertion of carbenes into carbon-hydrogen bonds as an example. Outlines an experiment that will illustrate dihalocarbene insertions into diisopropyl ether. (GS)

  10. Fractal Dimension Analysis in Self-Assembled Poly(dA)·poly(dT) DNA Network on Mica Surface

    NASA Astrophysics Data System (ADS)

    Kawano, Satoyuki

    Characteristics of the self-assembled poly(dA)·poly(dT) DNA network adhered on the mica substrate are experimentally investigated based on the AFM observations and the fractal dimension analysis. Artificial B-type double stranded DNA, which consists of 50 base pairs of adenine and thymine, is specially prepared for the experiment. The manufacturing process of DNA network is done in the aqueous solution of poly(dA)·poly(dT) DNA, and the systematical experimental runs are made for various concentration of the solution. It is found that the 2D fractal dimension strongly depends on the fabrication process of the DNA network.

  11. Pacemaker insertion

    PubMed Central

    Kotsakou, Maria; Kioumis, Ioannis; Lazaridis, George; Pitsiou, Georgia; Lampaki, Sofia; Papaiwannou, Antonis; Karavergou, Anastasia; Tsakiridis, Kosmas; Katsikogiannis, Nikolaos; Karapantzos, Ilias; Karapantzou, Chrysanthi; Baka, Sofia; Mpoukovinas, Ioannis; Karavasilis, Vasilis; Rapti, Aggeliki; Trakada, Georgia; Zissimopoulos, Athanasios; Zarogoulidis, Konstantinos

    2015-01-01

    A pacemaker (PM) (or artificial PM, so as not to be confused with the heart’s natural PM) is a medical device that uses electrical impulses, delivered by electrodes contracting the heart muscles, to regulate the beating of the heart. The primary purpose of this device is to maintain an adequate heart rate, either because the heart’s natural PM is not fast enough, or there is a block in the heart’s electrical conduction system. Modern PMs are externally programmable and allow the cardiologist to select the optimum pacing modes for individual patients. Some combine a PM and defibrillator in a single implantable device. PMs can be temporary or permanent. Temporary PMs are used to treat short-term heart problems, such as a slow heartbeat that’s caused by a heart attack, heart surgery, or an overdose of medicine. Permanent PMs are used to control long-term heart rhythm problems. A PM can relieve some arrhythmia symptoms, such as fatigue and fainting. A PM also can help a person who has abnormal HRs resume a more active lifestyle. In the current mini review we will focus on the insertion of a PM and the possible pneumothorax that can be caused. PMID:25815303

  12. Arabidopsis VIRE2 INTERACTING PROTEIN2 Is Required for Agrobacterium T-DNA Integration in Plants W

    E-print Network

    Citovsky, Vitaly

    transformation but not for transient trans- formation. Assays based upon a promoter-trap vectorArabidopsis VIRE2 INTERACTING PROTEIN2 Is Required for Agrobacterium T-DNA Integration in Plants W,a Vitaly Citovsky,b and Kirankumar S. Mysorea,1 a Plant Biology Division, Samuel Roberts Noble Foundation

  13. Central line infections - hospitals

    MedlinePLUS

    Central line-associated bloodstream infection; CLABSI; Peripherally inserted central catheter - infection; PICC - infection; Central venous catheter - infection; CVC - infection; Central venous device - infection

  14. Green fluorescent protein as a vital elimination marker to easily screen marker-free transgenic progeny derived from plants co-transformed with a double T-DNA binary vector system

    Microsoft Academic Search

    Songbiao Chen; Xugang Li; Xiang Liu; Hongling Xu; Kun Meng; Guifang Xiao; Xiaoli Wei; Feng Wang; Zhen Zhu

    2005-01-01

    We investigated the potential of a novel double T-DNA vector for generating marker-free transgenic plants. Co-transformation methods using a double T-DNA vector or using mixture of two Agrobacterium tumefaciens strains were compared, and showed that the double T-DNA vector method could produce marker-free transgenic tobacco ( Nicotiana tabacum L.) plants more efficiently. A dual marker double T-DNA vector was then

  15. T-DNA trapping of a cryptic promoter identifies an ortholog of highly conserved SNZ growth arrest response genes in

    Microsoft Academic Search

    Csaba Mathea; Eva Horvath; Jeff Schell; Csaba Koncz

    A T-DNA tagged Arabidopsis locus, A37, identified by a promoter-trap aph(3%)II reporter gene fusion expressed in calli and roots, encodes an ortholog of evolutionarily conserved SNZ growth arrest response proteins. Gene A37 is located on chromosome 3-35, lacks introns, and shares considerable sequence identity with HEVER1 from rubber tree, SLEXORFA-1 from Stellaria longipes, SNZ1 from yeast, and SNZ-homologs from bacteria

  16. Transient GFP expression in Nicotiana plumbaginifolia suspension cells: the role of gene silencing, cell death and T-DNA loss

    Microsoft Academic Search

    Richard Weld; Jack Heinemann; Colin Eady

    2001-01-01

    The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells fromAgrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP

  17. Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress

    Microsoft Academic Search

    Efrén Santos; Serge Remy; Els Thiry; Saskia Windelinckx; Rony Swennen; László Sági

    2009-01-01

    BACKGROUND: Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored

  18. In planta transformation method for T-DNA transfer in orchids

    NASA Astrophysics Data System (ADS)

    Semiarti, Endang; Purwantoro, Aziz; Mercuriani, Ixora S.; Anggriasari, Anida M.; Jang, Seonghoe; Suhandono, Sony; Machida, Yasunori; Machida, Chiyoko

    2014-03-01

    Transgenic plant technology is an efficient tool to study the function of gene(s) in plant. The most popular and widely used technique is Agrobacterium-mediated transformation in which cocultivation was done by immersing the plant tissues/organ in overnight bacterial cultured for about 30 minutes to one hour under in vitro condition. In this experiment, we developed more easier technique that omitted the in vitro step during cocultivation with Agrobacterium, namely in planta transformation method. Pollinaria (compact pollen mass of orchid) of Phalaenopsis amabilis and Spathoglottis plicata orchids were used as target explants that were immersed into bacterial culture for 30 minutes, then dried up the pollinaria, the transformed pollinaria was used to pollinate orchid flowers. The T-DNA used for this experiments were Ubipro?PaFT/A. tumefaciens GV3101 for P. amabilis and MeEF1?2 pro?GUS/ A. tumefaciens LBA 4404 for S.plicata. Seeds that were produced from pollinated flowers were grown onto 10 mg/l hygromicin containing NP (New Phalaenopsis) medium. The existance of transgene in putative transformant protocorm (developing orchid embryo) genome was confirmed using PCR with specific primers of either PaFT or GUS genes. Histochemical GUS assay was also performed to the putative transformants. The result showed that transformation frequencies were 2.1 % in P. amabilis, and 0,53% in S. plicata. These results indicates that in planta transformation method could be used for Agrobacterium-mediated genetic transformation, with advantage easier and more secure work from contaminants than that of the in vitro method.

  19. The orf13 T-DNA gene of Agrobacterium rhizogenes confers meristematic competence to differentiated cells.

    PubMed

    Stieger, Pia A; Meyer, Alain D; Kathmann, Petra; Fründt, Corinne; Niederhauser, Isabel; Barone, Mario; Kuhlemeier, Cris

    2004-07-01

    Plant infections by the soil bacterium Agrobacterium rhizogenes result in neoplastic disease with the formation of hairy roots at the site of infection. Expression of a set of oncogenes residing on the stably integrated T-DNA is responsible for the disease symptoms. Besides the rol (root locus) genes, which are essential for the formation of hairy roots, the open reading frame orf13 mediates cytokinin-like effects, suggesting an interaction with hormone signaling pathways. Here we show that ORF13 induced ectopic expression of KNOX (KNOTTED1-like homeobox) class transcription factors, as well as of several genes involved in cell cycle control in tomato (Lycopersicon esculentum). ORF13 has a retinoblastoma (RB)-binding motif and interacted with maize (Zea mays) RB in vitro, whereas ORF13, bearing a point mutation in the RB-binding motif (ORF13*), did not. Increased cell divisions in the vegetative shoot apical meristem and accelerated formation of leaf primordia were observed in plants expressing orf13, whereas the expression of orf13* had no influence on cell division rates in the shoot apical meristem, suggesting a role of RB in the regulation of the cell cycle in meristematic tissues. On the other hand, ectopic expression of LeT6 was not dependent on a functional RB-binding motif. Hormone homeostasis was only altered in explants of leaves, whereas in the root no effects were observed. We suggest that ORF13 confers meristematic competence to cells infected by A. rhizogenes by inducing the expression of KNOX genes and promotes the transition of infected cells from the G1 to the S phase by binding to RB. PMID:15247407

  20. Agrobacterium-Mediated Transformation of Fusarium oxysporum: An Efficient Tool for Insertional Mutagenesis and Gene Transfer.

    PubMed

    Mullins, E D; Chen, X; Romaine, P; Raina, R; Geiser, D M; Kang, S

    2001-02-01

    ABSTRACT Agrobacterium tumefaciens-mediated transformation (ATMT) has long been used to transfer genes to a wide variety of plants and has also served as an efficient tool for insertional mutagenesis. In this paper, we report the construction of four novel binary vectors for fungal transformation and the optimization of an ATMT protocol for insertional mutagenesis, which permits an efficient genetic manipulation of Fusarium oxysporum and other phytopathogenic fungi to be achieved. Employing the binary vectors, carrying the bacterial hygromycin B phosphotrans-ferase gene (hph) under the control of the Aspergillus nidulans trpC promoter as a selectable marker, led to the production of 300 to 500 hygromycin B resistant transformants per 1 x 10(6) conidia of F. oxysporum, which is at least an order of magnitude higher than that previously accomplished. Transformation efficiency correlated strongly with the duration of cocultivation of fungal spores with Agrobacterium tumefaciens cells and significantly with the number of Agrobacteruium tumefaciens cells present during the cocultivation period (r = 0.996; n = 3; P < 0.01). All transformants tested remained mitotically stable, maintaining their hygromycin B resistance. Growing Agrobacterium tumefaciens cells in the presence of acetosyringone (AS) prior to cocultivation shortened the time required for the formation of transformants but decreased to 53% the percentage of transformants containing a single T-DNA insert per genome. This increased to over 80% when Agrobacterium tumefaciens cells grown in the absence of AS were used. There was no correlation between the average copy number of T-DNA per genome and the colony diameter of the transformants, the period of cocultivation or the quantity of Agrobacterium tumefaciens cells present during cocultivation. To isolate the host sequences flanking the inserted T-DNA, we employed a modified thermal asymmetric interlaced PCR (TAIL-PCR) technique. Utilizing just one arbitrary primer resulted in the successful amplification of desired products in 90% of those transformants analyzed. The insertion event appeared to be a random process with truncation of the inserted T-DNA, ranging from 1 to 14 bp in size, occurring on both the right and left border sequences. Considering the size and design of the vectors described here, coupled with the efficiency and flexibility of this ATMT protocol, it is suggested that ATMT should be regarded as a highly efficient alternative to other DNA transfer procedures in characterizing those genes important for the pathogenicity of F. oxysporum and potentially those of other fungal pathogens. PMID:18944391

  1. Characteristic analysis of transformants in T-DNA mutation library of Monascus ruber

    Microsoft Academic Search

    Yanchun Shao; Yuedi Ding; Ying Zhao; Sha Yang; Bijun Xie; Fusheng Chen

    2009-01-01

    Monascus ruber, a red mold species, has been widely used in the fields of food and medicine. In this research, we transformed Monascus ruber spores using Agrobacterium tumefaciens as a tool for random insertional mutagenesis with the hygromycin phosphotransferase gene as the selected marker. Three types\\u000a of mutants including citrinin-producing mutants, mutants with abnormal aerial hyphae and pigment change mutants

  2. Agrobacterium rhizogenes pRi8196 T-DNA: Mapping and DNA Sequence of Functions Involved in Mannopine Synthesis and Hairy Root Differentiation

    Microsoft Academic Search

    Genevieve Hansen; Mireille Larribe; Daniele Vaubert; Jacques Tempe; Brenda J. Biermann; Alice L. Montoya; Mary-Dell Chilton; Jean Brevet

    1991-01-01

    This paper presents the map and DNA sequence analysis of pRi8196 transferred DNA (T-DNA) genes encoding root-inducing and mannopine synthesis functions. A canonical 24-base-pair border repeat as well as two \\

  3. Regulation of Oncogene Expression in T-DNA-Transformed Host Plant Cells

    PubMed Central

    Zhang, Yi; Lee, Chil-Woo; Wehner, Nora; Imdahl, Fabian; Svetlana, Veselova; Weiste, Christoph; Dröge-Laser, Wolfgang; Deeken, Rosalia

    2015-01-01

    Virulent Agrobacterium tumefaciens strains integrate their T-DNA into the plant genome where the encoded agrobacterial oncogenes are expressed and cause crown gall disease. Essential for crown gall development are IaaH (indole-3-acetamide hydrolase), IaaM (tryptophan monooxygenase) and Ipt (isopentenyl transferase), which encode enzymes for the biosynthesis of auxin (IaaH, IaaM) and cytokinin (Ipt). Although these oncogenes are well studied as the tumor-inducing principle, nothing is known about the regulation of oncogene expression in plant cells. Our studies show that the intergenic regions (IGRs) between the coding sequences (CDS) of the three oncogenes function as promoters in plant cells. These promoters possess a eukaryotic sequence organization and cis-regulatory elements for the binding of plant transcription factors. WRKY18, WRKY40, WRKY60 and ARF5 were identified as activators of the Ipt promoter whereas IaaH and IaaM is constitutively expressed and no transcription factor further activates their promoters. Consistent with these results, the wrky triple mutant plants in particular, develops smaller crown galls than wild-type and exhibits a reduced Ipt transcription, despite the presence of an intact ARF5 gene. WRKY40 and WRKY60 gene expression is induced by A. tumefaciens within a few hours whereas the ARF5 gene is transcribed later during crown gall development. The WRKY proteins interact with ARF5 in the plant nucleus, but only WRKY40 together with ARF5 synergistically boosts the activation of the Ipt promoter in an auxin-dependent manner. From our data, we propose that A. tumefaciens initially induces WRKY40 gene expression as a pathogen defense response of the host cell. The WRKY protein is recruited to induce Ipt expression, which initiates cytokinin-dependent host cell division. With increasing auxin levels triggered by ubiquitous expression of IaaH and IaaM, ARF5 is activated and interacts with WRKY40 to potentiate Ipt expression and balance cytokinin and auxin levels for further cell proliferation. PMID:25615824

  4. A Novel Two T-DNA Binary Vector Allows Efficient Generation of Marker-free Transgenic Plants in Three Elite Cultivars of Rice ( Oryza sativa L.)

    Microsoft Academic Search

    Jean-Christophe Breitler; Donaldo Meynard; Jos Van Boxtel; Monique Royer; François Bonnot; Laurence Cambillau; Emmanuel Guiderdoni

    2004-01-01

    A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free\\u000a progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities\\u000a to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the

  5. Position-Dependent Methylation and Transcriptional Silencing of Transgenes in Inverted T-DNA Repeats: Implications for Posttranscriptional Silencing of Homologous Host Genes in Plants

    Microsoft Academic Search

    MAIKE STAM; ADA VITERBO; JOSEPH N. M. MOL; JAN M. KOOTER

    1998-01-01

    Posttranscriptional silencing of chalcone synthase (Chs) genes in petunia transformants occurs by intro- ducing T-DNAs that contain a promoter-driven or promoterless Chs transgene. With the constructs we used, silencing occurs only by T-DNA loci which are composed of two or more T-DNA copies that are arranged as inverted repeats (IRs). Since we are interested in the mechanism by which these

  6. Cre\\/lox-mediated site-specific integration of Agrobacterium T-DNA in Arabidopsis thaliana by transient expression of cre

    Microsoft Academic Search

    Annette C. Vergunst; Paul J. J. Hooykaas

    1998-01-01

    The Cre\\/lox system was used to obtain targeted integration of an Agrobacterium T-DNA at a lox site in the genome of Arabidopsis thaliana. Site-specific recombinants, and not random events, were preferentially selected by activation of a silent lox-neomycin phosphotransferase (nptII) target gene. To analyse the effectiveness of Agrobacterium-mediated transfer we used T-DNA vectors harbouring a single lox sequence (this vector

  7. The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA.

    PubMed Central

    Hood, E E; Helmer, G L; Fraley, R T; Chilton, M D

    1986-01-01

    We used a binary-vector strategy to study the hypervirulence of Agrobacterium tumefaciens A281, an L,L-succinamopine strain. Strain A281 is hypervirulent on several solanaceous plants. We constructed plasmids (pCS65 and pCS277) carrying either the transferred DNA (T-DNA) or the remainder of the tumor-inducing (Ti) plasmid (pEHA101) from this strain and tested each of these constructs in trans with complementary regions from heterologous Ti plasmids. Hypervirulence on tobacco could be reconstructed in a bipartite strain with the L,L-succinamopine T-DNA and the vir region on separate plasmids. pEHA101 was able to complement octopine T-DNA to hypervirulence on tobacco and tomato plants. Nopaline T-DNA was complemented better on tomato plants by pEHA101 than it was by its own nopaline vir region, but not to hypervirulence. L,L-Succinamopine T-DNA could not be complemented to hypervirulence on tobacco and tomato plants with either heterologous vir region. From these results we suggest that the hypervirulence of strain A281 is due to non-T-DNA sequences on the Ti plasmid. Images PMID:3782037

  8. Mapped Ds \\/T-DNA launch pads for functional genomics in barley

    Microsoft Academic Search

    Tiehan Zhao; Margaret Palotta; Peter Langridge; Manoj Prasad; Andreas Graner; Paul Schulze-Lefert; Thomas Koprek

    2006-01-01

    Summary A system for targeted gene tagging and local saturation mutagenesis based on maize transposable elements (Ac\\/Ds) was developed in barley (Hordeum vulgare L.). We generated large numbers of transgenic barley lines carrying a single copy of the non-autonomous maize Ds element at defined positions in the genome. Independent Ds lines were either generated by activating Ds elements in existing

  9. Effects of P Element Insertions on Quantitative Traits in Drosophila Melanogaster

    PubMed Central

    Mackay, TFC.; Lyman, R. F.; Jackson, M. S.

    1992-01-01

    P element mutagenesis was used to construct 94 third chromosome lines of Drosophila melanogaster which contained on average 3.1 stable P element inserts, in an inbred host strain background previously free of P elements. The homozygous and heterozygous effects of the inserts on viability and abdominal and sternopleural bristle number were ascertained by comparing the chromosome lines with inserts to insert-free control lines of the inbred host strain. P elements reduced average homozygous viability by 12.2% per insert and average heterozygous viability by 5.5% per insert, and induced recessive lethal mutations at a rate of 3.8% per insert. Mutational variation for the bristle traits averaged over both sexes was 0.03V(e) per homozygous P insert and 0.003V(e) per heterozygous P insert, where V(e) is the environmental variance. Mutational variation was greater for the sexes considered separately because inserts had large pleiotropic effects on sex dimorphism of bristle characters. The distributions of homozygous effects of inserts on the bristle traits were asymmetrical, with the largest effects in the direction of reducing bristle number; and highly leptokurtic, with most of the increase in variance contributed by a few lines with large effects. The inserts had partially recessive effects on the bristle traits. Insert lines with extreme bristle effects had on average greatly reduced viability. PMID:1311697

  10. Identification of pathogenicity-related genes in the vascular wilt fungus verticillium dahliae by agrobacterium tumefaciens-mediated t-DNA insertional mutagenesis.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Verticillium dahliae is the causal agent of vascular wilt in many economically important crops worldwide. Identification of genes that underpin pathogenicity or virulence may suggest targets for alternative control methods for this fungus. In this study, Agrobacterium tumefaciens-mediated transform...

  11. Agrobacterium T-DNA integration into the plant genome can occur without the activity of key non-homologous end-joining proteins.

    PubMed

    Park, So-Yon; Vaghchhipawala, Zarir; Vasudevan, Balaji; Lee, Lan-Ying; Shen, Yunjia; Singer, Kamy; Waterworth, Wanda M; Zhang, Zhanyuan J; West, Christopher E; Mysore, Kirankumar S; Gelvin, Stanton B

    2015-03-01

    Non-homologous end joining (NHEJ) is the major model proposed for Agrobacterium T-DNA integration into the plant genome. In animal cells, several proteins, including KU70, KU80, ARTEMIS, DNA-PKcs, DNA ligase IV (LIG4), Ataxia telangiectasia mutated (ATM), and ATM- and Rad3-related (ATR), play an important role in 'classical' (c)NHEJ. Other proteins, including histone H1 (HON1), XRCC1, and PARP1, participate in a 'backup' (b)NHEJ process. We examined transient and stable transformation frequencies of Arabidopsis thaliana roots mutant for numerous NHEJ and other related genes. Mutants of KU70, KU80, and the plant-specific DNA Ligase VI (LIG6) showed increased stable transformation susceptibility. However, these mutants showed transient transformation susceptibility similar to that of wild-type plants, suggesting enhanced T-DNA integration in these mutants. These results were confirmed using a promoter-trap transformation vector that requires T-DNA integration into the plant genome to activate a promoterless gusA (uidA) gene, by virus-induced gene silencing (VIGS) of Nicotiana benthamiana NHEJ genes, and by biochemical assays for T-DNA integration. No alteration in transient or stable transformation frequencies was detected with atm, atr, lig4, xrcc1, or parp1 mutants. However, mutation of parp1 caused high levels of T-DNA integration and transgene methylation. A double mutant (ku80/parp1), knocking out components of both NHEJ pathways, did not show any decrease in stable transformation or T-DNA integration. Thus, T-DNA integration does not require known NHEJ proteins, suggesting an alternative route for integration. PMID:25641249

  12. A selectively terminable transgenic rice line expressing human lactoferrin.

    PubMed

    Lin, Chaoyang; Nie, Peng; Lu, Wei; Zhang, Qing; Li, Jing; Shen, Zhicheng

    2010-11-01

    Human lactoferrin (hLF) is a multifunctional milk protein which could be utilized for promoting human health. Transgenic rice has been used as a bioreactor for mass production of recombinant hLF. However, one major concern over such transgenic rice is the risk of its unintended spreading into environment and into our food supplies. Here we report the development of selectively terminable transgenic rice expressing human lactoferrin in seeds. These transgenic rice plants could be selectively terminated by bentazon, a common herbicide used for rice weed control. The hLF expression cassette was constructed into a T-DNA containing the RNA interference cassette suppressing the expression of the rice gene CYP81A6 which detoxifies herbicide bentazon, and the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) cassette which confers to glyphosate tolerance. A transgenic line, named as G281, was identified for its high sensitivity to bentazon, high tolerance to glyphosate, and high expression of hLF. Southern analysis suggested G281 is a single copy insertion event. Field tests demonstrated that G281 plants can be completely killed by a single spray of bentazon at 1000 mg/L, which is safe to regular rice and represents only half of the dose recommended by manufacturer for rice field weed control. Therefore, any G281 contaminations in regular rice could be selectively terminated to make sure it will not enter food or feed supplies. PMID:20433928

  13. Insight into the molecular requirements for pathogenicity of Fusarium oxysporum f. sp. lycopersici through large-scale insertional mutagenesis

    PubMed Central

    Michielse, Caroline B; van Wijk, Ringo; Reijnen, Linda; Cornelissen, Ben JC; Rep, Martijn

    2009-01-01

    Background Fusarium oxysporum f. sp. lycopersici is the causal agent of vascular wilt disease in tomato. In order to gain more insight into the molecular processes in F. oxysporum necessary for pathogenesis and to uncover the genes involved, we used Agrobacterium-mediated insertional mutagenesis to generate 10,290 transformants and screened the transformants for loss or reduction of pathogenicity. Results This led to the identification of 106 pathogenicity mutants. Southern analysis revealed that the average T-DNA insertion is 1.4 and that 66% of the mutants carry a single T-DNA. Using TAIL-PCR, chromosomal T-DNA flanking regions were isolated and 111 potential pathogenicity genes were identified. Conclusions Functional categorization of the potential pathogenicity genes indicates that certain cellular processes, such as amino acid and lipid metabolism, cell wall remodeling, protein translocation and protein degradation, seem to be important for full pathogenicity of F. oxysporum. Several known pathogenicity genes were identified, such as those encoding chitin synthase V, developmental regulator FlbA and phosphomannose isomerase. In addition, complementation and gene knock-out experiments confirmed that a glycosylphosphatidylinositol-anchored protein, thought to be involved in cell wall integrity, a transcriptional regulator, a protein with unknown function and peroxisome biogenesis are required for full pathogenicity of F. oxysporum. PMID:19134172

  14. Pearls Educator's Guide Insert

    NSDL National Science Digital Library

    This four-page PDF insert takes an informative look at pearls, oysters, and mollusks. Useful to both educators and students, it includes information and images from the Pearls exhibition at the American Museum of Natural History.

  15. Stimulation of Agrobacterium tumefaciens T-DNA transfer by overdrive depends on a flanking sequence but not on helical position with respect to the border repeat.

    PubMed Central

    Shurvinton, C E; Ream, W

    1991-01-01

    T-DNA transfer by Agrobacterium tumefaciens depends on the right border repeat of the T-DNA and is greatly stimulated by overdrive, an adjacent sequence. We report that the function of overdrive does not depend on helical position with respect to the border repeat. A synthetic 24-bp overdrive and a 12-bp region containing a fully conserved 8-bp core overdrive sequence stimulated virulence equally, but full function required additional bases to the left of the 24-bp sequence. Images PMID:1885533

  16. Induction and growth properties of carrot roots with different complements of Agrobacterium rhizogenes T-DNA.

    PubMed

    Capone, I; Spanò, L; Cardarelli, M; Bellincampi, D; Petit, A; Costantino, P

    1989-07-01

    Single and multiple infections of carrot discs were carried out with Agrobacterium strains harbouring different segments of pRi1855 TL-DNA cloned in the binary vector Bin 19 and with a strain carrying the TR-DNA from the same Ri plasmid. Roots induced by the various co-inoculations were cultured and their growth patterns were followed. Abundant roots could be induced by TL-DNA rol genes A, B and C as a single insert (rolA + B + C) and by rolB alone provided an extended segment beyond its 5' non-coding region was included in the construction. A depression of rooting capability was caused by the inclusion of rolC together with rolB (rolB + C). In all cases co-inoculation with the Agrobacterium carrying TR-DNA-borne auxin genes was necessary for root induction since none of the rol constructions was in itself capable of eliciting any response; an exceeding majority of these roots were however shown to contain rol genes but no TR-DNA. Rooting was also elicited if rol constructions were co-inoculated with a strain carrying TL-DNA genes 13 and 14 (ORF13 + 14) instead of the TR-DNA strain. These roots were shown to contain both rol genes and ORF13 + 14. Striking differences in growth properties were shown by roots containing different complements of TL-DNA genes. Typical hairy root traits, high growth rate, branching and, most noticeably, absence of geotropism, were shown by roots containing rolB alone, while roots with rolA + B + C were geotropic as normal carrot roots. Hairy root traits were conferred to rolA + B + C roots by the concomitant presence of ORF13 + 14 and by the addition of auxin to the culture medium. A model is presented which attempts to rationalize the growth patterns by assigning interplaying roles to the various TL-DNA genes involved. PMID:2562759

  17. Efforts to deregulate Rainbow papaya in Japan: Molecular Characterization of Transgene and Vector Inserts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...

  18. Agrobacterium tumefaciens-mediated transformation of Aspergillus aculeatus for insertional mutagenesis

    PubMed Central

    2011-01-01

    Agrobacterium tumefaciens-mediated transformation (AMT) was applied to Aspergillus aculeatus. Transformants carrying the T-DNA from a binary vector pBIG2RHPH2 were sufficiently mitotically stable to allow functional genomic analyses. The AMT technique was optimized by altering the concentration of acetosyringone, the ratio and concentration of A. tumefaciens and A. aculeatus cells, the duration of co-cultivation, and the status of A. aculeatus cells when using conidia, protoplasts, or germlings. On average, 30 transformants per 104 conidia or 217 transformants per 107 conidia were obtained under the optimized conditions when A. tumefaciens co-cultured with fungi using solid or liquid induction media (IM). Although the transformation frequency in liquid IM was 100-fold lower than that on solid IM, the AMT method using liquid IM is better suited for high-throughput insertional mutagenesis because the transformants can be isolated on fewer selection media plates by concentrating the transformed germlings. The production of two albino A. aculeatus mutants by AMT confirmed that the inserted T-DNA disrupted the polyketide synthase gene AapksP, which is involved in pigment production. Considering the efficiency of AMT and the correlation between the phenotypes and genotypes of the transformants, the established AMT technique offers a highly efficient means for characterizing the gene function in A. aculeatus. PMID:22166586

  19. T-DNA vector backbone sequences are frequently integrated into the genome of transgenic plants obtained by Agrobacterium-mediated transformation

    Microsoft Academic Search

    Sylvie De Buck; Chris De Wilde; Marc Van Montagu; Ann Depicker

    2000-01-01

    Transgenic Arabidopsis and tobacco plants (125) derived from seven Agrobacterium-mediated transformation experiments were screened by polymerase chain reaction and DNA gel blot analysis for the presence of vector `backbone' sequences. The percentage of plants with vector DNA not belonging to the T-DNA varied between 20% and 50%. Neither the plant species, the explant type used for transformation, the replicon type

  20. Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions involved in mannopine synthesis and hairy root differentiation.

    PubMed Central

    Hansen, G; Larribe, M; Vaubert, D; Tempé, J; Biermann, B J; Montoya, A L; Chilton, M D; Brevet, J

    1991-01-01

    This paper presents the map and DNA sequence analysis of pRi8196 transferred DNA (T-DNA) genes encoding root-inducing and mannopine synthesis functions. A canonical 24-base-pair border repeat as well as two "pseudoborders" are present at the functional right T-DNA border. To the left of this border are homologs of the mas1' and mas2' genes of TR pRiA4. Next to these are five open reading frames (ORFs) homologous to ORFs 10-14 of TL of pRiA4. ORFs 10-12 (rolA, rolB, and rolC) are less related to their pRiA4 homologs than are the other large ORFs analyzed here. In contrast to T-DNA genes of pRiA4, pRi8196 T-DNA ORFs 11 and 12 (rolB and rolC) are sufficient to induce hairy roots on carrot disks. Images PMID:1909028

  1. Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions involved in mannopine synthesis and hairy root differentiation.

    PubMed

    Hansen, G; Larribe, M; Vaubert, D; Tempé, J; Biermann, B J; Montoya, A L; Chilton, M D; Brevet, J

    1991-09-01

    This paper presents the map and DNA sequence analysis of pRi8196 transferred DNA (T-DNA) genes encoding root-inducing and mannopine synthesis functions. A canonical 24-base-pair border repeat as well as two "pseudoborders" are present at the functional right T-DNA border. To the left of this border are homologs of the mas1' and mas2' genes of TR pRiA4. Next to these are five open reading frames (ORFs) homologous to ORFs 10-14 of TL of pRiA4. ORFs 10-12 (rolA, rolB, and rolC) are less related to their pRiA4 homologs than are the other large ORFs analyzed here. In contrast to T-DNA genes of pRiA4, pRi8196 T-DNA ORFs 11 and 12 (rolB and rolC) are sufficient to induce hairy roots on carrot disks. PMID:1909028

  2. The T-DNA oncogene A4-orf8 from Agrobacterium rhizogenes A4 induces abnormal growth in tobacco.

    PubMed

    Umber, Marie; Clément, Bernadette; Otten, Léon

    2005-03-01

    The related orf8 and iaaM T-DNA genes from Agrobacterium are each composed of two distinct parts. The 5' parts (called Norf8 or NiaaM) encode a 200-amino-acid (aa) sequence with homology to various T-DNA oncoproteins such as RolB, RolC, and 6b. The 3' parts (Corf8 or CiaaM) encode a 550-aa sequence with homology to IaaM proteins from Pseudomonas and Pantoea spp. Whereas iaaM genes encode flavin adenine dinucleotide (FAD)-dependent tryptophan 2-monooxygenases that catalyze the synthesis of indole-3-acetamide (IAM), A4-orf8 from Agrobacterium rhizogenes A4 does not. Plants expressing a 2x35S-A4-Norf8 construct accumulate soluble sugars and starch. We now have regenerated plants that express the full-size 2x35S-A4-orf8 and the truncated 2x35S-A4-Corf8 gene. 2x35S-A4-Corf8 plants accumulate starch and show reduced growth like 2x35S-A4-Norf8 plants but, in addition, display a novel set of characteristic growth modifications. These consist of leaf hypertrophy and hyperplasia (blisters); thick, dark-green leaves; thick stems; and swollen midveins. Mutations in the putative FAD-binding site of A4-Orf8 did not affect the blister syndrome. Plants expressing 2x35S-A4-Corf8 had a normal phenotype but contained less starch and soluble sugars than did wild-type plants. When 2x35S-A4-Corf8 plants were crossed to starch-accumulating 2x35S-A4-Norf8 plants with reduced growth, A4-Corf8 partially restored growth and reduced starch accumulation. A4-Corf8xA4-Norf8 crosses did not lead to the blister syndrome, suggesting that this requires physical linkage of the A4-NOrf8 and A4-COrf8 sequences. PMID:15782634

  3. Insertion in Persian

    ERIC Educational Resources Information Center

    Kambuziya, Aliyeh Kord-e Zafaranlu; Dehghan, Masoud

    2011-01-01

    This paper investigates epenthesis process in Persian to catch some results in relating to vowel and consonant insertion in Persian lexicon. This survey has a close relationship to the description of epenthetic consonants and the conditions in which these consonants are used. Since no word in Persian may begin with a vowel, so that hiatus can't be…

  4. Sensitive detection for coralyne and mercury ions based on homo-A/T DNA by exonuclease signal amplification.

    PubMed

    Huang, Hailiang; Shi, Shuo; Zheng, Xuyue; Yao, Tianming

    2015-09-15

    Based on specific homo-A/T DNA binding properties, a strategy for coralyne and mercury ions detection was realised by exonuclease-aided signal amplification. Coralyne could specifically bind homo-A DNA and protect it from the hydrolysis of exonuclease I. The coralyne-protected DNA was subsequently used as a trigger strand to hydrolyze DNA2 in exonuclease-aided signal amplification process. Thiazole orange was used to quantify the remainder DNA2. Under the optimal condition, the fluorescence intensity was linearly proportional to the concentration of coralyne in the range of 0.2-100nM with a limit of detection (LOD) of 0.31nM, which presented the lowest LOD for coralyne among all reported. With homo-T and Hg(2+) taking the place of homo-A DNA and coralyne, respectively, the system could also be used for Hg(2+) detection. The experiments in real samples also showed good results. This method was label-free, low-cost, easy-operating and highly repeatable for the detection of coralyne and mercury ions. It could also be extended to detect various analytes, such as other metal ions, proteins and small molecules by using appropriate aptamers. PMID:25950941

  5. Effect of medium on charge transport properties of modified poly(dA)-poly(dT) DNA molecular wire

    NASA Astrophysics Data System (ADS)

    Suhendro, D. K.; Yudiarsah, E.; Saleh, R.

    2014-09-01

    By using tight binding Hamiltonian approach, the medium's effect on charge transport properties of modified poly(dA)-poly(dT) DNA molecular wire is studied. The DNA sequences used are modified poly(dA)-poly(dT) sequence by replacing 50 base pairs randomly with GC or CG base pairs. The DNA is contacted by metallic leads at both ends. The medium's effect on DNA is modeled as backbone onsite energy disorder. The DNA is taken to be at room temperature. The charge transport properties of the two sequences are studied by calculating the transmission probabilities of the charges using the scattering and transfer matrix methods simultaneously. Then the current-voltage (I-V) characteristics are calculated from the transmission probabilities using the Landauer-Büttiker Formalism. The theoretical differential conductance curve is then calculated from the I-V characteristic curve. The I-V results show that as the backbone disorder strength increases, the maximum current decreases for both sequences. However, the threshold voltage can increase or decrease with increasing backbone disorder depending on the sequence. The transmission results show that the position of transmission peaks changed with backbone disorder strength. Comparison with previous published results using poly(dG)-poly(dC) sequence shows that in contrast to that sequence, backbone disorder can decrease the threshold voltage in one of the sequences studied. This may point to a new understanding of the interplay between environmental and sequence disorder effect on charge transport in DNA.

  6. Insertion Order Virginia Tech Magazine

    E-print Network

    Buehrer, R. Michael

    Insertion Order Virginia Tech Magazine This Insertion Order constitutes an agreement between Virginia Polytechnic Institute and State University (Virginia Tech) and ___________________________ (Client) for advertising space in Virginia Tech Magazine, published by Virginia Tech. Edition(s): Summer 2014 Fall 2014

  7. Ear tube insertion - series (image)

    MedlinePLUS

    Ear tube insertion is recommended for: fluid in the middle ear (present for more than 12 weeks) recurrent ear ... the accumulated fluid is suctioned out. A small tube is inserted through the incised eardrum in order ...

  8. Remote Control Inserting the batteries

    E-print Network

    Kostic, Milivoje M.

    Top View Rear View Inserting the batteries 1 3Press in on the arrow mark and slide in the direction of the arrow to remove the battery cover. 2 Insert two AA size batteries, making sure their polarities match the and marks inside the battery compartment. Insert the side tabs of the battery cover into their slots

  9. High Speed Video Insertion

    NASA Astrophysics Data System (ADS)

    Janess, Don C.

    1984-11-01

    This paper describes a means of inserting alphanumeric characters and graphics into a high speed video signal and locking that signal to an IRIG B time code. A model V-91 IRIG processor, developed by Instrumentation Technology Systems under contract to Instrumentation Marketing Corporation has been designed to operate in conjunction with the NAC model FHS-200 High Speed Video Camera which operates at 200 fields per second. The system provides for synchronizing the vertical and horizontal drive signals such that the vertical sync precisely coincides with five millisecond transitions in the IRIG time code. Additionally, the unit allows for the insertion of an IRIG time message as well as other data and symbols.

  10. T-DNA trapping of a cryptic promoter identifies an ortholog of highly conserved SNZ growth arrest response genes in Arabidopsis

    Microsoft Academic Search

    László Ökrész; Csaba Máthé; Éva Horváth; Jeff Schell; Csaba Koncz; László Szabados

    1998-01-01

    A T-DNA tagged Arabidopsis locus, A37, identified by a promoter-trap aph(3?)II reporter gene fusion expressed in calli and roots, encodes an ortholog of evolutionarily conserved SNZ growth arrest response proteins. Gene A37 is located on chromosome 3–35, lacks introns, and shares considerable sequence identity with HEVER1 from rubber tree, SLEXORFA-1 from Stellaria longipes, SNZ1 from yeast, and SNZ-homologs from bacteria

  11. The T-DNA ORF8 of the cucumopine-type Agrobacterium rhizogenes Ri plasmid is involved in auxin response in transgenic tobacco

    Microsoft Academic Search

    Akila Ouartsi; Danielle Clérot; Alain D Meyer; Yves Dessaux; Jean Brevet; Mercè Bonfill

    2004-01-01

    In A. rhizogenes, various Ri plasmids are found that show some differences in terms of genetic organization as compared to the reference plasmid pRiA4. On this plasmid as well on the pRi2659 and pRi8196, the T-DNA genes rolA, rolB, and rolC (ORFs10, 11, and 12) appear to sufice to induce root formation in most assayed plant species. However, the most

  12. Detection of transformed cells in crown gall tumors using the GUS reporter gene and correlation of GUS stained cells with T-DNA gene activity

    SciTech Connect

    Black, R.C. (Pennsylvania State Univ., Media (USA)); Labriola, J.; Binns, A.N. (Univ. of Pennsylvania, Philadelphia (USA))

    1990-05-01

    Crown gall tumors are a mixture of transformed hormone producing cells and normal cells. Until now it has not been possible to directly visualize these cell types in situ. We have constructed strains of Agrobacterium tumefaciens that carry the 35S-{beta}-glucuronidase (GUS) reporter gene in either wild type or mutant Ti plasmids. Using histochemical staining for GUS activity, blue (GUS positive) sectors are observed in tumor sections. In order to demonstrate that the blue sectors actually represent cells expressing other T-DNA genes, we have looked for T-DNA gene encoded enzyme activity in the stained and unstained sectors. The blue sectors accumulate octopine (a product of the octopine synthase gene on the T-DNA) while the white (GUS negative) sectors do not. We conclude that the use of the GUS reporter gene provides a sensitive and reliable method for visualizing transformation events in plant tissues. A comparison of the proportion of transformed and nontransformed cells in wild type tumors vs. tumors deficient in auxin or cytokinin encoding genes will be discussed.

  13. A coumaroyl-ester-3-hydroxylase Insertion Mutant Reveals the Existence of Nonredundant meta-Hydroxylation Pathways and Essential Roles for Phenolic Precursors in Cell Expansion and Plant Growth1[W][OA

    PubMed Central

    Abdulrazzak, Nawroz; Pollet, Brigitte; Ehlting, Jürgen; Larsen, Kim; Asnaghi, Carole; Ronseau, Sebastien; Proux, Caroline; Erhardt, Mathieu; Seltzer, Virginie; Renou, Jean-Pierre; Ullmann, Pascaline; Pauly, Markus; Lapierre, Catherine; Werck-Reichhart, Danièle

    2006-01-01

    Cytochromes P450 monooxygenases from the CYP98 family catalyze the meta-hydroxylation step in the phenylpropanoid biosynthetic pathway. The ref8 Arabidopsis (Arabidopsis thaliana) mutant, with a point mutation in the CYP98A3 gene, was previously described to show developmental defects, changes in lignin composition, and lack of soluble sinapoyl esters. We isolated a T-DNA insertion mutant in CYP98A3 and show that this mutation leads to a more drastic inhibition of plant development and inhibition of cell growth. Similar to the ref8 mutant, the insertion mutant has reduced lignin content, with stem lignin essentially made of p-hydroxyphenyl units and trace amounts of guaiacyl and syringyl units. However, its roots display an ectopic lignification and a substantial proportion of guaiacyl and syringyl units, suggesting the occurrence of an alternative CYP98A3-independent meta-hydroxylation mechanism active mainly in the roots. Relative to the control, mutant plantlets produce very low amounts of sinapoyl esters, but accumulate flavonol glycosides. Reduced cell growth seems correlated with alterations in the abundance of cell wall polysaccharides, in particular decrease in crystalline cellulose, and profound modifications in gene expression and homeostasis reminiscent of a stress response. CYP98A3 thus constitutes a critical bottleneck in the phenylpropanoid pathway and in the synthesis of compounds controlling plant development. CYP98A3 cosuppressed lines show a gradation of developmental defects and changes in lignin content (40% reduction) and structure (prominent frequency of p-hydroxyphenyl units), but content in foliar sinapoyl esters is similar to the control. The purple coloration of their leaves is correlated to the accumulation of sinapoylated anthocyanins. PMID:16377748

  14. Electrically Isolating Transmission-Line Driver

    NASA Technical Reports Server (NTRS)

    Marchman, Robert H.

    1992-01-01

    Proposed optoelectronic coupling circuit used to insert signal in transmission line and to isolate transmission line from ground of circuit in which signal originates. Made from commercially available components, reduces susceptibility to interference along transmission path.

  15. A High-Throughput Arabidopsis Reverse Genetics System

    Microsoft Academic Search

    Allen Sessions; Ellen Burke; Gernot Presting; John McElver; David Patton; Bob Dietrich; Patrick Ho; Johana Bacwaden; Cynthia Ko; Joseph D. Clarke; David Cotton; David Bullis; Jennifer Snell; Trini Miguel; Theresa Mitzel; Fumiaki Katagiri; Jane Glazebrook; Marc Law; Stephen A. Goff

    2002-01-01

    A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of func- tional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ? 100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and

  16. Effect of Agrobacterium rhizogenes on phenolic content of Mentha pulegium elite clonal line for phytoremediation applications

    Microsoft Academic Search

    Sarah Strycharz; Kalidas Shetty

    2002-01-01

    Mentha pulegium elite clonal line MPH-4 is known to contain high levels of endogenous phenolic compounds. These compounds are secondary metabolites of the phenylpropanoid pathway that aid in several metabolic processes, including stress response and hormone production. Agrobacterium rhizogenes is a soil bacterium utilized for its ability to transfer its Rol genes via the Ri plasmid on t-DNA. A. rhizogenes

  17. Transgene expression variability (position effect) of CAT and GUS reporter genes driven by linked divergent T-DNA promoters

    Microsoft Academic Search

    Cindy Peach; Jeff Velten

    1991-01-01

    Forty-five individually transformed clonal tobacco callus lines were simultaneously assayed for both chloramphenicol acetyltransferase (CAT) and ß-glucuronidase (GUS) activity resulting from expression of introduced reporter genes driven by the adjacent and divergent mannopine (mas) promoters. Excluding lines in which one or both of the enzyme activities was essentially zero, the activities of the reporter genes varied by as much as

  18. Landscape of Insertion Polymorphisms in the Human Genome

    PubMed Central

    Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

    2015-01-01

    Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5?-TTTT/A-3? sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

  19. Live insertion method used for main renewal

    SciTech Connect

    Solkowitz, M. (Gas Supply Dept., Baltimore Gas and Electric Co., Baltimore, MD (US))

    1992-04-01

    Baltimore Gas and Electric's pilot project using the live insertion method to replace a cast iron main provided excellent results. Its use on Eastern Avenue, a major state highway, was cost effective, provided gas service to customers during the work, required relatively short construction time and resulted in only minor traffic disruptions. Gas service transfers to the new main were done at customer convenience and resulted in outages of only a few hours per customer. This paper reports that the project involved inserting a 6-in. plastic line inside an existing 10-in. cast iron main. Miller Pipeline Corp., Indianapolis, supplier of the Insertec {l angle}R{r angle} live insertion method was contracted for the job. Miller technicians assisted BG and E forces by providing a load analysis of the main, a pushing machine and related supplies, foaming equipment and pipe cutting tools. Company forces were responsible for all preparatory work, including opening all excavations, installing bypasses, and fusing and testing the plastic pipe. Service transfers and renewals were also completed by company employees.

  20. Functional Analysis of an Arabidopsis T-DNA “Knockout” of the High-Affinity NH4+ Transporter AtAMT1;11

    PubMed Central

    Kaiser, Brent N.; Rawat, Suman R.; Siddiqi, M. Yaeesh; Masle, Josette; Glass, Anthony D.M.

    2002-01-01

    NH4+ acquisition by plant roots is thought to involve members of the NH4+ transporter family (AMT) found in plants, yeast, bacteria, and mammals. In Arabidopsis, there are six AMT genes of which AtAMT1;1 demonstrates the highest affinity for NH4+. Ammonium influx into roots and AtAMT1;1 mRNA expression levels are highly correlated diurnally and when plant nitrogen (N) status is varied. To further investigate the involvement of AtAMT1;1 in high-affinity NH4+ influx, we identified a homozygous T-DNA mutant with disrupted AtAMT1;1 activity. Contrary to expectation, high-affinity 13NH4+ influx in the amt1;1:T-DNA mutant was similar to the wild type when grown with adequate N. Removal of N to increase AtAMT1;1 expression decreased high-affinity 13NH4+ influx in the mutant by 30% compared with wild-type plants, whereas low-affinity 13NH4+ influx (250 ?m–10 mm NH4+) exceeded that of wild-type plants. In these N-deprived plants, mRNA copy numbers of root AtAMT1;3 and AtAMT2;1 mRNA were significantly more increased in the mutant than in wild-type plants. Under most growth conditions, amt1;1:T-DNA plants were indistinguishable from the wild type, however, leaf morphology was altered. However, when grown with NH4+ and sucrose, the mutant grew poorly and died. Our results are the first in planta evidence that AtAMT1;1 is a root NH4+ transporter and that redundancies within the AMT family may allow compensation for the loss of AtAMT1;1. PMID:12427993

  1. Quantum Diffusion in Polaron Model of poly(dG)-poly(dC) and poly(dA)-poly(dT) DNA polymers

    E-print Network

    H. Yamada; E. B. Starikov; D. Hennig

    2007-05-18

    We numerically investigate quantum diffusion of an electron in a model of poly(dG)-poly(dC) and poly(dA)-poly(dT) DNA polymers with fluctuation of the parameters due to the impact of colored noise. The randomness is introduced by fluctuations of distance between two consecutive bases along the stacked base pairs. We demonstrate that in the model the decay time of the correlation can control the spread of the electronic wavepacket. Furthermore it is shown that in a motional narrowing regime the averaging over fluctuation causes ballistic propagation of the wavepacket, and in the adiabatic regime the electronic states are affected by localization.

  2. INSERTING SIMULATED TRACKS INTO SAR CCD IMAGERY Eric Turner

    E-print Network

    Zakhor, Avideh

    INSERTING SIMULATED TRACKS INTO SAR CCD IMAGERY Eric Turner University of California, Berkeley.phillips,chiang,miriam.cha}@ll.mit.edu Keywords: Synthetic aperture radar, line detection, SAR simulation, change detection Abstract Synthetic Aperture Radar Coherent Change Detection (SAR CCD) images are highly sensitive change maps produced

  3. Machine Learning manuscript No. (will be inserted by the editor)

    E-print Network

    Szepesvari, Csaba

    Machine Learning manuscript No. (will be inserted by the editor) Model Selection in Reinforcement Learning Amir massoud Farahmand1 , Csaba Szepesv´ari1 Department of Computing Science University of Alberta learning. More specifically, we consider the batch (off-line, non-interactive) reinforcement learning

  4. Oil-sealing valve guide insert and method of manufacture

    SciTech Connect

    Kammeraad, J.A.

    1988-09-06

    A valve guide insert is described for lining and relining of a valve guide of an internal combustion engine, the engine including a valve having a stem axially reciprocating within the valve guide, and a source of lubricating oil external of the valve guide, the valve guide insert comprising: a cylindrical sleeve having an outside surface adapted to be press-fitted within a valve guide and an inside surface adapted to receive a valve stem therethrough; means defining a plurality of annular groove segments on the inside surface spaced along the entire length of the insert; discontinuity means defining discontinuities between the groove segments at opposite ends thereof for preventing linear migration of engine oil between the groove segments each of the groove segments comprises one revolution around the inside surface; and transferring means for transferring oil laterally between groove segments, the transferring means comprising the groove segments being inclined with respect to the cross section of the insert such that the stem rotating within the insert will transfer oil across the inside surface between adjacent groove segments, the transferring means providing means for lubricating the stem by moving lubricating oil from the source axially along the insert.

  5. Ku80 plays a role in non-homologous recombination but is not required for T-DNA integration in Arabidopsis.

    PubMed

    Gallego, M E; Bleuyard, J-Y; Daoudal-Cotterell, S; Jallut, N; White, C I

    2003-09-01

    Chromosomal breaks are repaired by homologous recombination (HR) or non-homologous end joining (NHEJ) mechanisms. The Ku70/Ku80 heterodimer binds DNA ends and plays roles in NHEJ and telomere maintenance in organisms ranging from yeast to humans. We have previously identified a ku80 mutant of the model plant Arabidopsis thaliana and shown the role of Ku80 in telomere homeostasis in plant cells. We show here that this mutant is hypersensitive to the DNA-damaging agent methyl methane sulphonate and has a reduced capacity to carry out NHEJ recombination. To understand the interplay between HR and NHEJ in plants, we measured HR in the absence of Ku80. We find that the frequency of intrachromosomal HR is not affected by the absence of Ku80. Previous work has clearly implicated the Ku heterodimer in Agrobacterium-mediated T-DNA transformation of yeast. Surprisingly, ku80 mutant plants show no defect in the efficiency of T-DNA transformation of plants with Agrobacterium, showing that an alternative pathway must exist in plants. PMID:12940949

  6. SPONTANEOUS TRANSMEMBRANE HELIX INSERTION THERMODYNAMICALLY MIMICS TRANSLOCON-GUIDED INSERTION

    PubMed Central

    Ulmschneider, Martin B.; Ulmschneider, Jakob P.; Schiller, Nina; Wallace, B. A.; von Heijne, Gunnar; White, Stephen H.

    2014-01-01

    The favorable transfer free energy for a transmembrane (TM) ?-helix between the aqueous phase and lipid bilayer underlies the stability of membrane proteins. However, the connection between the energetics and process of membrane protein assembly by the Sec61/SecY translocon complex in vivo is not clear. Here, we directly determine the partitioning free energies of a family of designed peptides using three independent approaches: an experimental microsomal Sec61 translocon assay, a biophysical (spectroscopic) characterization of peptide insertion into hydrated planar lipid bilayer arrays, and an unbiased atomic-detail equilibrium folding-partitioning molecular dynamics simulation. Remarkably, the measured free energies of insertion are quantitatively similar for all three approaches. The molecular dynamics simulations show that TM helix insertion involves equilibrium with the membrane interface, suggesting that the interface may play a role in translocon-guided insertion. PMID:25204588

  7. Large-Scale Mapping of Transposable Element Insertion Sites Using Digital Encoding of Sample Identity

    PubMed Central

    Gohl, Daryl M.; Freifeld, Limor; Silies, Marion; Hwa, Jennifer J.; Horowitz, Mark; Clandinin, Thomas R.

    2014-01-01

    Determining the genomic locations of transposable elements is a common experimental goal. When mapping large collections of transposon insertions, individualized amplification and sequencing is both time consuming and costly. We describe an approach in which large numbers of insertion lines can be simultaneously mapped in a single DNA sequencing reaction by using digital error-correcting codes to encode line identity in a unique set of barcoded pools. PMID:24374352

  8. Retargeting Sleeping Beauty Transposon Insertions by Engineered Zinc Finger DNA-binding Domains

    PubMed Central

    Voigt, Katrin; Gogol-Döring, Andreas; Miskey, Csaba; Chen, Wei; Cathomen, Toni; Izsvák, Zsuzsanna; Ivics, Zoltán

    2012-01-01

    The Sleeping Beauty (SB) transposon is a nonviral, integrating vector system with proven efficacy in preclinical animal models, and thus holds promise for future clinical applications. However, SB has a close-to-random insertion profile that could lead to genotoxic effects, thereby presenting a potential safety issue. We evaluated zinc finger (ZF) DNA-binding domains (DBDs) for their abilities to introduce a bias into SB's insertion profile. E2C, that binds a unique site in the erbB-2 gene, mediated locus-specific transposon insertions at low frequencies. A novel ZF targeting LINE1 repeats, ZF-B, showed specific binding to an 18-bp site represented by ~12,000 copies in the human genome. We mapped SB insertions using linear-amplification (LAM)-PCR and Illumina sequencing. Targeted insertions with ZF-B peaked at approximately fourfold enrichment of transposition around ZF-B binding sites yielding ~45% overall frequency of insertion into LINE1. A decrease in the ZF-B dataset with respect to transposon insertions in genes was found, suggesting that LINE1 repeats act as a sponge that “soak up” a fraction of SB insertions and thereby redirect them away from genes. Improvements in ZF technology and a careful choice of targeted genomic regions may improve the safety profile of SB for future clinical applications. PMID:22776959

  9. DRUG NAME (INSERT DRUG NAME)

    Cancer.gov

    Supplies-(tools such as oral syringes, disposable spoon, cup, gloves, pad or paper towels, etc. needed to measure or prepare the drug.)List preparation instructionsInsert administration instruction (e.g., with or without food).

  10. Chest tube insertion - series (image)

    MedlinePLUS

    ... lung can collapse, preventing adequate air exchange. Chest tubes are used to treat conditions that can cause ... Chest tubes are inserted to drain blood, fluid, or air and allow full expansion of the lungs. The tube ...

  11. Placement of a peripherally inserted central catheter into the azygous vein

    PubMed Central

    Franklin, Iain; Gilmore, Christopher

    2015-01-01

    Peripherally inserted central catheters (PICC) are used for a variety of infusion therapies. They are indicated in patients requiring long-term venous access. Incorrect positioning of the insertion of a PICC line is one of the known complications when inserting the device in clinical practice. Radiographers once performing imaging will commonly check if the tip of a PICC has entered the superior vena cava. This case study will report on a lesser known incorrect placement of a PICC line into the azygous vein and how this can be detected on radiographic imaging. This outcome for the patient can be detrimental as it has an increased risk of perforation, thrombus, and fistula formation.

  12. Limitation of transmission line switching overvoltages

    Microsoft Academic Search

    Heresh Seyedi; Smko Golabi; Zaher Abam

    2010-01-01

    In this paper switching overvoltages of an actual transmission line are studied. Simulations are executed using Electro Magnetic Transients Program. A comprehensive switching transient study is performed for the Azerbaijan province network in Iran. The purpose of this study is to determine the unnecessary pre-insertion resistors in the UHV network, since the new policy is to use pre-insertion resistors only

  13. Transposon insertion mapping with PIMMS – Pragmatic Insertional Mutation Mapping System

    PubMed Central

    Blanchard, Adam M.; Leigh, James A.; Egan, Sharon A.; Emes, Richard D.

    2015-01-01

    The PIMMS (Pragmatic Insertional Mutation Mapping System) pipeline has been developed for simple conditionally essential genome discovery experiments in bacteria. Capable of using raw sequence data files alongside a FASTA sequence of the reference genome and GFF file, PIMMS will generate a tabulated output of each coding sequence with corresponding mapped insertions accompanied with normalized results enabling streamlined analysis. This allows for a quick assay of the genome to identify conditionally essential genes on a standard desktop computer prioritizing results for further investigation. Availability: The PIMMS script, manual and accompanying test data is freely available at https://github.com/ADAC-UoN/PIMMS PMID:25914720

  14. Pneumothorax as a complication of central venous catheter insertion

    PubMed Central

    Tsotsolis, Nikolaos; Tsirgogianni, Katerina; Kioumis, Ioannis; Pitsiou, Georgia; Baka, Sofia; Papaiwannou, Antonis; Karavergou, Anastasia; Rapti, Aggeliki; Trakada, Georgia; Katsikogiannis, Nikolaos; Tsakiridis, Kosmas; Karapantzos, Ilias; Karapantzou, Chrysanthi; Barbetakis, Nikos; Zissimopoulos, Athanasios; Kuhajda, Ivan; Andjelkovic, Dejan; Zarogoulidis, Konstantinos

    2015-01-01

    The central venous catheter (CVC) is a catheter placed into a large vein in the neck [internal jugular vein (IJV)], chest (subclavian vein or axillary vein) or groin (femoral vein). There are several situations that require the insertion of a CVC mainly to administer medications or fluids, obtain blood tests (specifically the “central venous oxygen saturation”), and measure central venous pressure. CVC usually remain in place for a longer period of time than other venous access devices. There are situations according to the drug administration or length of stay of the catheter that specific systems are indicated such as; a Hickman line, a peripherally inserted central catheter (PICC) line or a Port-a-Cath may be considered because of their smaller infection risk. Sterile technique is highly important here, as a line may serve as a port of entry for pathogenic organisms, and the line itself may become infected with organisms such as Staphylococcus aureus and coagulase-negative Staphylococci. In the current review we will present the complication of pneumothorax after CVC insertion. PMID:25815301

  15. Gene Insertion Patterns and Sites

    NASA Astrophysics Data System (ADS)

    Vain, Philippe; Thole, Vera

    During the past 25 years, the molecular analysis of transgene insertion patterns and sites in plants has greatly contributed to our understanding of the mechanisms underlying transgene integration, expression, and stability in the nuclear genome. Molecular characterization is also an essential step in the safety assessment of genetically modified crops. This chapter describes the standard experimental procedures used to analyze transgene insertion patterns and loci in cereals and grasses transformed using Agrobacterium tumefaciens or direct transfer of DNA. Methods and protocols enabling the determination of the number and configuration of transgenic loci via a combination of inheritance studies, polymerase chain reaction, and Southern analyses are presented. The complete characterization of transgenic inserts in plants is, however, a holistic process relying on a wide variety of experimental approaches. In this chapter, these additional approaches are not detailed but references to relevant bibliographic records are provided.

  16. Electromagnetically tracked placement of a peripherally inserted central catheter

    NASA Astrophysics Data System (ADS)

    Sacolick, Laura; Patel, Neilesh; Tang, Jonathan; Levy, Elliot; Cleary, Kevin R.

    2004-05-01

    This paper describes a computer program to utilize electromagnetic tracking guidance during insertion of peripherally inserted central catheters. Placement of a Peripherally Inserted Central Catheter (PICC) line is a relatively simple, routine procedure in which a catheter is inserted into the veins of the lower arm and threaded up the arm to the vena cava to sit just above the heart. However, the procedure requires x-ray verification of the catheter position and is usually done under continuous fluoroscopic guidance. The computer program is designed to replace fluoroscopic guidance in this procedure and make PICC line placement a bedside procedure. This would greatly reduce the time and resources dedicated to this procedure. The physician first goes through a quick registration procedure to register the patient space with the computer screen coordinates. Once registration is completed, the program provides a continuous, real-time display of the position of the catheter tip overlaid on an x-ray image of the patient on an adjacent computer screen. Both the position and orientation of the catheter tip is shown. The display is very similar to that shown when using fluoroscopy.

  17. Formation of nanofilms on cell surfaces to improve the insertion efficiency of a nanoneedle into cells

    SciTech Connect

    Amemiya, Yosuke [Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 4, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562 (Japan)] [Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 4, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562 (Japan); Kawano, Keiko [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-26 Naka-cho, Koganei, Tokyo 184-8588 (Japan)] [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-26 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Matsusaki, Michiya; Akashi, Mitsuru [Department of Applied Chemistry, Graduate School of Engineering Science, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan)] [Department of Applied Chemistry, Graduate School of Engineering Science, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Nakamura, Noriyuki [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-26 Naka-cho, Koganei, Tokyo 184-8588 (Japan)] [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-26 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Nakamura, Chikashi, E-mail: chikashi-nakamura@aist.go.jp [Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 4, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562 (Japan) [Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 4, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562 (Japan); Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-26 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We examined the insertion efficiency of nanoneedles into fibroblast and neural cells. Black-Right-Pointing-Pointer Nanofilms formed on cell surfaces improved the insertion efficiency of nanoneedles. Black-Right-Pointing-Pointer Nanofilms improved the insertion efficiency even in Y27632-treated cells. -- Abstract: A nanoneedle, an atomic force microscope (AFM) tip etched to 200 nm in diameter and 10 {mu}m in length, can be inserted into cells with the aid of an AFM and has been used to introduce functional molecules into cells and to analyze intracellular information with minimal cell damage. However, some cell lines have shown low insertion efficiency of the nanoneedle. Improvement in the insertion efficiency of a nanoneedle into such cells is a significant issue for nanoneedle-based cell manipulation and analysis. Here, we have formed nanofilms composed of extracellular matrix molecules on cell surfaces and found that the formation of the nanofilms improved insertion efficiency of a nanoneedle into fibroblast and neural cells. The nanofilms were shown to improve insertion efficiency even in cells in which the formation of actin stress fibers was inhibited by the ROCK inhibitor Y27632, suggesting that the nanofilms with the mesh structure directly contributed to the improved insertion efficiency of a nanoneedle.

  18. Insertion and crossing region design

    Microsoft Academic Search

    U. Wienands; P. Beloshitsky

    2001-01-01

    This article is the summary of the 5-afternoon tutorial on insertions for circular machines. Roughly half the course (Part 1) was spent discussing interaction regions, We start by recapitulating basic beam optics including building blocks. This provides the tools to analyze the basic structure of interaction regions and explore the parameter space. This simple example is then successively refined and

  19. LATEST DEVELOPMENTS ON INSERTION DEVICES

    Microsoft Academic Search

    J. Chavanne; P. Elleaume

    A review is made of the latest developments of Insertion Devices. The construction of a number of sychrotron sources with energy around 3 GeV and with the goal of producing brilliant radiation around 1 angstroem is driving the development of short period small gap undulators. At this time in-vacuum permanent magnet undulators using the hybrid magnet structure represent the most

  20. Coated carbide cutting tool insert

    SciTech Connect

    Yohe, W. C.

    1985-10-22

    Cobalt cemented carbide cutting inserts are prepared for coating with a hard, wear-resistant coating by providing a cobalt enriched zone on a surface to be coated. Cobalt enrichment is effectuated by means of nitrogen gas contact with the carbide followed by a period of vacuum sintering during its sintering process of manufacture.

  1. Focus on peripherally inserted central catheters in critically ill patients

    PubMed Central

    Cotogni, Paolo; Pittiruti, Mauro

    2014-01-01

    Venous access devices are of pivotal importance for an increasing number of critically ill patients in a variety of disease states and in a variety of clinical settings (emergency, intensive care, surgery) and for different purposes (fluids or drugs infusions, parenteral nutrition, antibiotic therapy, hemodynamic monitoring, procedures of dialysis/apheresis). However, healthcare professionals are commonly worried about the possible consequences that may result using a central venous access device (CVAD) (mainly, bloodstream infections and thrombosis), both peripherally inserted central catheters (PICCs) and centrally inserted central catheters (CICCs). This review aims to discuss indications, insertion techniques, and care of PICCs in critically ill patients. PICCs have many advantages over standard CICCs. First of all, their insertion is easy and safe -due to their placement into peripheral veins of the arm- and the advantage of a central location of catheter tip suitable for all osmolarity and pH solutions. Using the ultrasound-guidance for the PICC insertion, the risk of hemothorax and pneumothorax can be avoided, as well as the possibility of primary malposition is very low. PICC placement is also appropriate to avoid post-procedural hemorrhage in patients with an abnormal coagulative state who need a CVAD. Some limits previously ascribed to PICCs (i.e., low flow rates, difficult central venous pressure monitoring, lack of safety for radio-diagnostic procedures, single-lumen) have delayed their start up in the intensive care units as common practice. Though, the recent development of power-injectable PICCs overcomes these technical limitations and PICCs have started to spread in critical care settings. Two important take-home messages may be drawn from this review. First, the incidence of complications varies depending on venous accesses and healthcare professionals should be aware of the different clinical performance as well as of the different risks associated with each type of CVAD (CICCs or PICCs). Second, an inappropriate CVAD choice and, particularly, an inadequate insertion technique are relevant-and often not recognized-potential risk factors for complications in critically ill patients. We strongly believe that all healthcare professionals involved in the choice, insertion or management of CVADs in critically ill patients should know all potential risk factors of complications. This knowledge may minimize complications and guarantee longevity to the CVAD optimizing the risk/benefit ratio of CVAD insertion and use. Proper management of CVADs in critical care saves lines and lives. Much evidence from the medical literature and from the clinical practice supports our belief that, compared to CICCs, the so-called power-injectable peripherally inserted central catheters are a good alternative choice in critical care. PMID:25374804

  2. Insert sleeve prevents tube soldering contamination

    NASA Technical Reports Server (NTRS)

    Stein, J.

    1966-01-01

    Teflon sleeve insert prevents contamination of internal tube surfaces by solder compound during soldering operations that connect and seal the tube ends. The sleeve insert is pressed into the mating tube ends with a slight interference fit.

  3. Lipid-insertion enables targeting functionalization of erythrocyte membrane-cloaked nanoparticles

    NASA Astrophysics Data System (ADS)

    Fang, Ronnie H.; Hu, Che-Ming J.; Chen, Kevin N. H.; Luk, Brian T.; Carpenter, Cody W.; Gao, Weiwei; Li, Shulin; Zhang, Dong-Er; Lu, Weiyue; Zhang, Liangfang

    2013-09-01

    RBC membrane-cloaked polymeric nanoparticles represent an emerging nanocarrier platform with extended circulation in vivo. A lipid-insertion method is employed to functionalize these nanoparticles without the need for direct chemical conjugation. Insertion of both folate and the nucleolin-targeting aptamer AS1411 shows receptor-specific targeting against model cancer cell lines.RBC membrane-cloaked polymeric nanoparticles represent an emerging nanocarrier platform with extended circulation in vivo. A lipid-insertion method is employed to functionalize these nanoparticles without the need for direct chemical conjugation. Insertion of both folate and the nucleolin-targeting aptamer AS1411 shows receptor-specific targeting against model cancer cell lines. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr03064d

  4. Needle insertion into soft tissue: A survey

    Microsoft Academic Search

    Niki Abolhassani; Rajni Patel; Mehrdad Moallem

    2007-01-01

    Needle insertion in soft tissue has attracted considerable attention in recent years due to its application in minimally invasive percutaneous procedures such as biopsies and brachytherapy. This paper presents a survey of the current state of research on needle insertion in soft tissue. It examines the topic from several aspects, e.g. modeling needle insertion forces, modeling tissue deformation and needle

  5. JT/LJT connector insert material evaluation

    SciTech Connect

    Baca, J.R.F.

    1991-10-01

    Different insert (insulator) materials are undergoing evaluation to replace the Fiberite E-3938 BE96 material currently used. Also being evaluated is the reconfiguration of the insert and metal shell-edge geometries for the purpose of reducing the alleged interference principally responsible for insert damage.

  6. Insertion device calculations with mathematica

    SciTech Connect

    Carr, R. [Stanford Synchrotron Radiation Lab., CA (United States); Lidia, S. [Univ. of California, Davis, CA (United States)

    1995-02-01

    The design of accelerator insertion devices such as wigglers and undulators has usually been aided by numerical modeling on digital computers, using code in high level languages like Fortran. In the present era, there are higher level programming environments like IDL{reg_sign}, MatLab{reg_sign}, and Mathematica{reg_sign} in which these calculations may be performed by writing much less code, and in which standard mathematical techniques are very easily used. The authors present a suite of standard insertion device modeling routines in Mathematica to illustrate the new techniques. These routines include a simple way to generate magnetic fields using blocks of CSEM materials, trajectory solutions from the Lorentz force equations for given magnetic fields, Bessel function calculations of radiation for wigglers and undulators and general radiation calculations for undulators.

  7. Insertion and crossing region design

    NASA Astrophysics Data System (ADS)

    Wienands, U.; Beloshitsky, P.

    2001-10-01

    This article is the summary of the 5-afternoon tutorial on insertions for circular machines. Roughly half the course (Part 1) was spent discussing interaction regions, We start by recapitulating basic beam optics including building blocks. This provides the tools to analyze the basic structure of interaction regions and explore the parameter space. This simple example is then successively refined and made more realistic. Examples of realized interaction regions for both hadron and electron machines are shown and their salient features and differences explained. A brief discussion of solenoid-decoupling brings Part 1 to a close. In Part 2 we discussed various utility sections. Dispersion suppressors are presented in detail discussing the principles as well as the practical implementation of flexible suppressors using LEP as an example. Injection schemes, both single-turn and multi-turn stacking, are presented in depth. The matching of wiggler and undulator insertions and a discussion of the impact of these devices on beam parameters closes out Part 2.

  8. Nozzle insert for mixed mode fuel injector

    DOEpatents

    Lawrence, Keith E. (Peoria, IL)

    2006-11-21

    A fuel injector includes a homogenous charge nozzle outlet set and a conventional nozzle outlet set controlled respectively, by first and second needle valve members. The homogeneous charged nozzle outlet set is defined by a nozzle insert that is attached to an injector body, which defines the conventional nozzle outlet set. The nozzle insert is a one piece metallic component with a large diameter segment separated from a small diameter segment by an annular engagement surface. One of the needle valve members is guided on an outer surface of the nozzle insert, and the nozzle insert has an interference fit attachment to the injector body.

  9. Agrobacterium-mediated transformation and insertional mutagenesis in Colletotrichum acutatum for investigating varied pathogenicity lifestyles.

    PubMed

    Talhinhas, Pedro; Muthumeenakshi, S; Neves-Martins, João; Oliveira, Helena; Sreenivasaprasad, S

    2008-05-01

    Colletotrichum acutatum is a cosmopolitan pathogen causing economically important diseases known as anthracnose on a wide range of hosts. This fungus exhibits varied pathogenicity lifestyles and the tools essential to understand the molecular mechanisms are still being developed. The transformation methods currently available for this species for gene discovery and functional analysis involve protoplast transformation and are laborious and inefficient. We have developed a protocol for efficient Agrobacterium tumefaciens-mediated transformation (ATMT) of C. acutatum. Using this protocol we were able to transform C. acutatum isolates belonging to different genetic groups and originating from different hosts. The transformation efficiency was up to 156 transformants per 10(4) conidia, with >70% transformants showing single location/single copy integration of T-DNA. Binary vector pBHt2-GFP was constructed, enabling green fluorescence protein tagging of C. acutatum strains, which will be a useful tool for epidemiology and histopathology studies. The ATMT protocol developed was used to identify putative pathogenicity mutants, suggesting the applicability of this technique for rapid generation of a large panel of insertional mutants of C. acutatum leading to the identification of the genes associated with the varied lifestyles. PMID:18183501

  10. Insertion slanting strabismus surgical procedures.

    PubMed

    Kushner, Burton J

    2011-12-01

    Insertion slanting recessions or biased resections have been reported to be useful for treating A- and V-pattern strabismus, convergence insufficiency, and convergence excess esotropia. Paradoxically, good results have been reported with methods that are opposite in nature. For example, some researchers would recess the medial rectus muscles and slant the superior pole of each muscle back farther than the inferior pole (Simonsz/von Graefe method) for a V-pattern esotropia, and others would slant the inferior poles back farther (Bietti method). The Simonsz/von Graefe method seems to be based on sound concepts of oculomotor mechanics. The Bietti method has been justified based on a misquoting and misinterpretation of previous work by Alan Scott, MD. Probably neither method contributes substantially to the outcome of strabismus surgery because sarcomere remodeling should rapidly negate the effect of the slanting. Most likely it is the recession or resection itself that affects the outcome. PMID:22159685

  11. O-ring insertion tool

    NASA Astrophysics Data System (ADS)

    Zannini, Frank

    1991-09-01

    A tool for installing an O-ring in an inwardly facing O-ring groove in an electrical connection includes a guide shaft and a contact member slidably and rotatably received in the guide shaft. The guide shaft includes an elongated cylindrical shaft portion and a flared end portion on the shaft portion. The contact member includes an attachment portion for slidably and rotatably securing the contact member on the shaft portion and a contact finger on the attachment portion which extends in a direction toward the flared end portion of the guide shaft. The tool is operable by assembling an O-ring on the shaft portion between the flared end portion and the contact finger, inserting the flared end portion into a connection and then manipulating the contact member to advance the O-ring into an O-ring groove in the connector with the contact finger.

  12. 1. EI LDPC Erasure Insertion LDPC

    E-print Network

    Song, Hong-Yeop

    1. EI LDPC BFSK . Erasure Insertion LDPC Non-Coherent BFSK-Check) Non-coherent FSK Erasure Insertion(EI) . AWGN(Additive White Gaussian Noise) (Partial-Band Jamming) . AWGNPBJ EI . . (Frequency-Hopping Spread-Spectrum: FHSS) [1]. FHSS

  13. Insert presenter logo here on slide master.

    E-print Network

    Gutmann, Peter

    University of Auckland PKI: Lemon Markets and Lemonade Session ID: STAR-304 Session Classification: Intermediate Insert presenter logo here on slide master. See hidden slide 2 for directions Agenda 2 Lemon master. See hidden slide 2 for directions3 Lemon Markets / PKI Markets Insert presenter logo here

  14. Quantitative Analysis of Human Cruciate Ligament Insertions

    Microsoft Academic Search

    Christopher D. Harner; Goo Hyun Baek; Tracy M. Vogrin; Gregory J. Carlin; Shinji Kashiwaguchi; Savio L. Y. Woo

    1999-01-01

    Summary: The objective of this study was to provide quantitative data on the insertion sites of the cruciate ligaments. In the first part of the study, we determined the shapes and sizes of the insertions of the anterior and posterior cruciate ligaments (ACL and PCL), and further compared these data with the midsubstance cross-sectional areas of the ligaments. The cross-sectional

  15. Simultaneous Shield and Repeater Insertion Renatas Jakushokas

    E-print Network

    Friedman, Eby G.

    Simultaneous Shield and Repeater Insertion Renatas Jakushokas jakushok@ece.rochester.edu Eby G- cuits is presented. The methodology is applied to simultaneous shield and repeater insertion, resulting in minimum coupling noise under power, delay, and area constraints. Design expressions ex- hibiting parabolic

  16. Inserting a Flash Animation Into Powerpoint

    E-print Network

    Illinois at Urbana-Champaign, University of

    Inserting a Flash Animation Into Powerpoint Jo Wozniak, Research Programmer, Imaging Technology 61801 techreports@itg.uiuc.edu http://www.itg.uiuc.edu #12;Inserting a Flash animation into Power the presentation a flash animation is considered an active X object in powerpoint know the location of your

  17. Upper extremity deep vein thrombosis: a complication of an indwelling peripherally inserted central venous catheter

    PubMed Central

    Carr, Peter J; Rippey, James C R

    2015-01-01

    Key Clinical Message We report a case of peripherally inserted central venous catheter (PICC)-associated deep vein thrombosis (DVT). Ultrasound images and video of subclavian thrombus are presented. PICC line-associated DVT, particularly in cancer patients is not uncommon. Point-of-care Emergency Department ultrasound can readily diagnose this complication and device removal is not always necessary. PMID:25838907

  18. of Shield Insertion on Reducing Crosstalk Noise between Coupled Interconnects Junmou Zhang and Eby G. Friedman

    E-print Network

    Friedman, Eby G.

    Effect of Shield Insertion on Reducing Crosstalk Noise between Coupled Interconnects Junmou Zhang the lines, the coupling noise can produce a peak noise of 15% of¡ ¢ ¢ in a 0.18 ¥ m CMOS technology. A ¦ § © - ! model is used to develop an analytic estimate of the peak noise for shielded interconnects. The peak

  19. The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

    Microsoft Academic Search

    Hugo J. Bellen; Robert W. Levis; Guochun Liao; Yuchun He; Joseph W. Carlson; Garson Tsang; Martha Evans-Holm; P. Robin Hiesinger; Karen L. Schulze; Gerald M. Rubin; Roger A. Hoskins; Allan C. Spradling

    2004-01-01

    The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for

  20. The Journal on Software and Systems Modeling manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    manage- ment) and also increases the complexity of traditional software engineering activitiesThe Journal on Software and Systems Modeling manuscript No. (will be inserted by the editor) A Model-Driven Traceability Framework for Software Product Lines Nicolas Anquetil1 , Uir´a Kulesza2 , Ralf

  1. Astronomy & Astrophysics manuscript no. infpap February 12, 2004 (DOI: will be inserted by hand later)

    E-print Network

    Ziegler, Bodo Leonhardt

    Astronomy & Astrophysics manuscript no. infpap February 12, 2004 (DOI: will be inserted by hand of Durham, South Road, Durham DH1 3LE, UK 3 Department of Astronomy and Astrophysics, University of Toronto measurements of the emission lines H # and [O II]#3727 are used to assess the star formation activity

  2. Astronomy & Astrophysics manuscript no. aa0261-04 (DOI: will be inserted by hand later)

    E-print Network

    Balogh, Michael L.

    Astronomy & Astrophysics manuscript no. aa0261-04 (DOI: will be inserted by hand later) Star DH1 3LE, UK 3 Department of Astronomy and Astrophysics, University of Toronto, 60 St. George Street strength measurements of the emission lines H and [O II]3727 are used to assess the star formation activity

  3. Sequential cooling insert for turbine stator vane

    DOEpatents

    Jones, Russell B; Krueger, Judson J; Plank, William L

    2014-04-01

    A sequential impingement cooling insert for a turbine stator vane that forms a double impingement for the pressure and suction sides of the vane or a triple impingement. The insert is formed from a sheet metal formed in a zigzag shape that forms a series of alternating impingement cooling channels with return air channels, where pressure side and suction side impingement cooling plates are secured over the zigzag shaped main piece. Another embodiment includes the insert formed from one or two blocks of material in which the impingement channels and return air channels are machined into each block.

  4. FOA Lecture 16: Insertion Loss Testing

    NSDL National Science Digital Library

    This is Lecture 16 in the FOA series on fiber optics. This lecture is about insertion loss testing. Insertion loss testing tests an installed cable plant with a light source and power meter in a method that is similar to how a communications system transmits data over the cable plant. Insertion loss testing is used to test the cable plant and compare it to the loss budget calculated in the design phase to ensure the planned communications systems will work over the cable plant. Running time for the lecture is 15:50. Flash is required to view the video.

  5. Elliptically polarizing adjustable phase insertion device

    DOEpatents

    Carr, Roger (Redwood City, CA)

    1995-01-01

    An insertion device for extracting polarized electromagnetic energy from a beam of particles is disclosed. The insertion device includes four linear arrays of magnets which are aligned with the particle beam. The magnetic field strength to which the particles are subjected is adjusted by altering the relative alignment of the arrays in a direction parallel to that of the particle beam. Both the energy and polarization of the extracted energy may be varied by moving the relevant arrays parallel to the beam direction. The present invention requires a substantially simpler and more economical superstructure than insertion devices in which the magnetic field strength is altered by changing the gap between arrays of magnets.

  6. Insertion Sequence Diversity in Archaea

    PubMed Central

    Filée, J.; Siguier, P.; Chandler, M.

    2007-01-01

    Insertion sequences (ISs) can constitute an important component of prokaryotic (bacterial and archaeal) genomes. Over 1,500 individual ISs are included at present in the ISfinder database (www-is.biotoul.fr), and these represent only a small portion of those in the available prokaryotic genome sequences and those that are being discovered in ongoing sequencing projects. In spite of this diversity, the transposition mechanisms of only a few of these ubiquitous mobile genetic elements are known, and these are all restricted to those present in bacteria. This review presents an overview of ISs within the archaeal kingdom. We first provide a general historical summary of the known properties and behaviors of archaeal ISs. We then consider how transposition might be regulated in some cases by small antisense RNAs and by termination codon readthrough. This is followed by an extensive analysis of the IS content in the sequenced archaeal genomes present in the public databases as of June 2006, which provides an overview of their distribution among the major archaeal classes and species. We show that the diversity of archaeal ISs is very great and comparable to that of bacteria. We compare archaeal ISs to known bacterial ISs and find that most are clearly members of families first described for bacteria. Several cases of lateral gene transfer between bacteria and archaea are clearly documented, notably for methanogenic archaea. However, several archaeal ISs do not have bacterial equivalents but can be grouped into Archaea-specific groups or families. In addition to ISs, we identify and list nonautonomous IS-derived elements, such as miniature inverted-repeat transposable elements. Finally, we present a possible scenario for the evolutionary history of ISs in the Archaea. PMID:17347521

  7. Insertion of lithium into vanadium molybdenum oxides

    NASA Astrophysics Data System (ADS)

    Muranushi, Yoshihisa; Miura, Takashi; Kishi, Tomiya; Nagai, Takashi

    Chemical insertion of lithium into V 2O 5, Mo 0.1V 1.8O 4.8 and MoV 2O 8 by LiI has been investigated. The limiting lithium content in all oxides is Li/V = 0.5, suggesting that only the V component is responsible for the lithium insertion. For V 2O 5, two potential plateaux correspond exactly to two-phase coexistent crystal structures with different van der Waals gap distances; the interaction energy between inserted lithium is attractive. By contrast, as the ratio of V substitution in Mo increases, the two-phase behaviour decreases, and the interaction between Li + cations becomes repulsive. These insertion characteristics have been analyzed in relation to structural changes in VO 5 polyhedra.

  8. High-Pressure Trocar Insertion Technique

    PubMed Central

    Reich, Harry; Conti Ribeiro, Sergio; Rasmussen, Carsten; Rosenberg, Jay

    1999-01-01

    Background: The majority of laparoscopic complications occur at the time of Veress needle and trocar insertion. Although not very frequent, they increase the morbidity and mortality of both diagnostic and operative laparoscopic procedures. Alternative techniques of trocar insertion have been described but have not completely eliminated the risk of injury. Technique: After Veress needle insertion and establishment of pneumoperitoneum to 25 to 30 mm Hg, insertion of a short trocar is performed in the deepest part of the umbilicus without elevation of the anterior abdominal wall. The result is a parietal peritoneal puncture directly beneath the umbilicus. The high-pressure setting used during initial insertion of the trocar is lowered as soon as safe abdominal entry is documented. Experience: The trocar insertion technique described above was performed in 3041 procedures. No vascular injury occurred. There were two bowel perforations. No complications related to the increased intra-abdominal pressure were observed. Conclusion: The high-pressure abdominal entry technique has the advantage of reducing intra-abdominal trocar-related injuries without requiring additional instrumentation or additional training. PMID:10323169

  9. Determining common insertion sites based on retroviral insertion distribution across tumors.

    PubMed

    Chen, Feng; Li, Zhoufang; Chen, Yi-Ping Phoebe

    2014-08-01

    A CIS (common insertion site) indicates a genome region that is hit more frequently by retroviral insertions than expected by chance. Such a region is strongly related to cancer gene loci, which leads to the detection of cancer genes. An algorithm for detecting CISs should satisfy the following: (1) it does not require any prior knowledge of underlying insertion distribution; (2) it can resolve the insertion biases caused by hotspots; (3) it can detect CISs of any biological width; (4) it can identify noises resulting from statistic mistakes and non-CIS insertions; and (5) it can identify the widths of CISs as accurately as possible. We develop a method to resolve these difficulties. We verify a region's significance from two perspectives: distribution width and distribution depth. The former indicates how many insertions in a region while the latter evaluates the insertion distribution across the tumors in a region. We compare our method with kernel density estimation and sliding window on the simulated data, showing that our method not only identifies cancer-related insertions effectively, but also filters noises correctly. The experiments on the real data show that taking insertion distribution into account can highlight significant CISs. We detect 53 novel CISs, some of which have been proven correct by the biological literature. PMID:24675070

  10. Central Solenoid Insert Technical Specification

    SciTech Connect

    Martovetsky, Nicolai N [ORNL; Smirnov, Alexandre [ORNL

    2011-09-01

    The US ITER Project Office (USIPO) is responsible for the ITER central solenoid (CS) contribution to the ITER project. The Central Solenoid Insert (CSI) project will allow ITER validation the appropriate lengths of the conductors to be used in the full-scale CS coils under relevant conditions. The ITER Program plans to build and test a CSI to verify the performance of the CS conductor. The CSI is a one-layer solenoid with an inner diameter of 1.48 m and a height of 4.45 m between electric terminal ends. The coil weight with the terminals is approximately 820 kg without insulation. The major goal of the CSI is to measure the temperature margin of the CS under the ITER direct current (DC) operating conditions, including determining sensitivity to load cycles. Performance of the joints, ramp rate sensitivity, and stability against thermal or electromagnetic disturbances, electrical insulation, losses, and instrumentation are addressed separately and therefore are not major goals in this project. However, losses and joint performance will be tested during the CSI testing campaign. The USIPO will build the CSI that will be tested at the Central Solenoid Model Coil (CSMC) Test Facility at the Japan Atomic Energy Agency (JAEA), Naka, Japan. The industrial vendors (the Suppliers) will report to the USIPO (the Company). All approvals to proceed will be issued by the Company, which in some cases, as specified in this document, will also require the approval of the ITER Organization. Responsibilities and obligations will be covered by respective contracts between the USIPO, called Company interchangeably, and the industrial Prime Contractors, called Suppliers. Different stages of work may be performed by more than one Prime Contractor, as described in this specification. Technical requirements of the contract between the Company and the Prime Contractor will be covered by the Fabrication Specifications developed by the Prime Contractor based on this document and approved by the Company and ITER. The Fabrication Specifications may reflect some national requirements and regulations that are not fully provided here. This document presents the ITER CSI specifications.

  11. Central line sepsis.

    PubMed

    Peterson, Kimberly K

    2003-01-01

    Since 1980, the placement of central venous access devices has become routine, and these catheters have been of great benefit in the treatment of patients with cancer. Unfortunately, central venous catheters have not been without complications. Central line sepsis has been reported to be one of the most frequently occurring complications, and although it is extremely costly to treat, more importantly, this condition is potentially life threatening to patients. Developing strategies that would prevent central line catheter infections has been a continual challenge for healthcare providers. Studies have been conducted on the use of catheters with antiseptic coatings, antimicrobial coatings, impregnated antimicrobial cuffs, prophylactic antibiotic therapy, antibiotic locks, use of antithrombolytics, different exit site dressings, and the use of various disinfectants for cleansing catheter exit sites. Healthcare providers, including oncology nurses, need to be knowledgeable concerning potential sources of infection and factors that may lead to central line sepsis (Chaiyakunapruk, Veenstra, Lipsky, & Saint, 2002; Darouiche et al., 1999; Little & Palmer, 1998; Veenstra, Saint, Saha, Lumley, & Sullivan, 1999). They need to advocate for the use of sterile technique during catheter insertion and aseptic technique when routine maintenance is provided and be aware of the standard treatments for and potential outcomes of central line catheter infections. In addition, oncology nurses should be encouraged to support and participate in controlled, randomized studies that may provide scientific-based practices that decrease the number of catheter-related infections in the future. PMID:12696220

  12. The Elettra beam line control system

    Microsoft Academic Search

    M. Mignacco; A. Abrami; Z. Dequal

    1994-01-01

    Elettra is a third generation Synchrotron Light Source located in Trieste (Italy). It consists of a full energy linac injector and a storage ring with beam energies between 1.5 and 2 GeV. The facility is scheduled to be operational by end 1993. For the whole project 22 beam lines from insertion devices are foreseen, each of them is composed of

  13. Insertions and the emergence of novel protein structure: a structure-based phylogenetic study of insertions

    Microsoft Academic Search

    Haiyan Jiang; Christian Blouin

    2007-01-01

    BACKGROUND: In protein evolution, the mechanism of the emergence of novel protein domain is still an open question. The incremental growth of protein variable regions, which was produced by stochastic insertions, has the potential to generate large and complex sub-structures. In this study, a deterministic methodology is proposed to reconstruct phylogenies from protein structures, and to infer insertion events in

  14. Peptide partitioning properties from direct insertion studies

    SciTech Connect

    Ulmschneider, Martin [University of Oxford; Smith, Jeremy C [ORNL; Ulmschneider, Jakob [University of Heidelberg

    2010-06-01

    Partitioning properties of polypeptides are at the heart of biological membrane phenomena and their precise quantification is vital for ab-initio structure prediction and the accurate simulation of membrane protein folding and function. Recently the cellular translocon machinery has been employed to determine membrane insertion propensities and transfer energetics for a series of polyleucine segments embedded in a carrier sequence. We show here that the insertion propensity, pathway, and transfer energetics into synthetic POPC bilayers can be fully described by direct atomistic peptide partitioning simulations. The insertion probability as a function of peptide length follows two-state Boltzmann statistics, in agreement with the experiments. The simulations expose a systematic offset between translocon-mediated and direct insertion free energies. Compared to the experiment the insertion threshold is shifted toward shorter peptides by 2 leucine residues. The simulations reveal many hitherto unknown atomic-resolution details about the partitioning process and promise to provide a powerful tool for urgently needed calibration of lipid parameters to match experimentally observed peptide transfer energies.

  15. Toolbox for Mobile-Element Insertion Detection on Cancer Genomes

    PubMed Central

    Lee, Wan-Ping; Wu, Jiantao; Marth, Gabor T

    2014-01-01

    Mobile elements constitute greater than 45% of the human genome as a result of repeated insertion events during human genome evolution. Although most of mobile elements are fixed within the human population, some elements (including ALU, long interspersed elements (LINE) 1 (L1), and SVA) are still actively duplicating and may result in life-threatening human diseases such as cancer, motivating the need for accurate mobile-element insertion (MEI) detection tools. We developed a software package, TANGRAM, for MEI detection in next-generation sequencing data, currently serving as the primary MEI detection tool in the 1000 Genomes Project. TANGRAM takes advantage of valuable mapping information provided by our own MOSAIK mapper, and until recently required MOSAIK mappings as its input. In this study, we report a new feature that enables TANGRAM to be used on alignments generated by any mainstream short-read mapper, making it accessible for many genomic users. To demonstrate its utility for cancer genome analysis, we have applied TANGRAM to the TCGA (The Cancer Genome Atlas) mutation calling benchmark 4 dataset. TANGRAM is fast, accurate, easy to use, and open source on https://github.com/jiantao/Tangram. PMID:25452688

  16. Rack Insertion End Effector (RIEE) automation

    NASA Technical Reports Server (NTRS)

    Malladi, Narasimha

    1993-01-01

    NASA is developing a mechanism to manipulate and insert Racks into the Space Station Logistic modules. The mechanism consists of the following: a base with three motorized degrees of freedom, a 3 section motorized boom that goes from 15 to 44 feet in length, and a Rack Insertion End Effector (RIEE) with 5 hand wheels for precise alignment. The robotics section was tasked with the automation of the RIEE unit. In this report, for the automation of the RIEE unit, application of the Perceptics Vision System was conceptually developed to determine the position and orientation of the RIEE relative to the logistic module, and a MathCad program is written to display the needed displacements for precise alignment and final insertion of the Rack. The uniqueness of this report is that the whole report is in fact a MathCad program including text, derivations, and executable equations with example inputs and outputs.

  17. Membrane Protein Insertion at the Endoplasmic Reticulum

    PubMed Central

    Shao, Sichen; Hegde, Ramanujan S.

    2014-01-01

    Integral membrane proteins of the cell surface and most intracellular compartments of eukaryotic cells are assembled at the endoplasmic reticulum. Two highly conserved and parallel pathways mediate membrane protein targeting to and insertion into this organelle. The classical cotranslational pathway, utilized by most membrane proteins, involves targeting by the signal recognition particle followed by insertion via the Sec61 translocon. A more specialized posttranslational pathway, employed by many tail-anchored membrane proteins, is composed of entirely different factors centered around a cytosolic ATPase termed TRC40 or Get3. Both of these pathways overcome the same biophysical challenges of ferrying hydrophobic cargo through an aqueous milieu, selectively delivering it to one among several intracellular membranes and asymmetrically integrating its transmembrane domain(s) into the lipid bilayer. Here, we review the conceptual and mechanistic themes underlying these core membrane protein insertion pathways, the complexities that challenge our understanding, and future directions to over-come these obstacles. PMID:21801011

  18. Elliptically polarizing adjustable phase insertion device

    DOEpatents

    Carr, R.

    1995-01-17

    An insertion device for extracting polarized electromagnetic energy from a beam of particles is disclosed. The insertion device includes four linear arrays of magnets which are aligned with the particle beam. The magnetic field strength to which the particles are subjected is adjusted by altering the relative alignment of the arrays in a direction parallel to that of the particle beam. Both the energy and polarization of the extracted energy may be varied by moving the relevant arrays parallel to the beam direction. The present invention requires a substantially simpler and more economical superstructure than insertion devices in which the magnetic field strength is altered by changing the gap between arrays of magnets. 3 figures.

  19. Electrochemistry of ion inserted vanadium oxide nanosheets

    NASA Astrophysics Data System (ADS)

    Pomeroy, Marc; Ren, Shaola; Yuan, Qifan; Soghomonian, Victoria

    2013-03-01

    Electrochemical energy storage is becoming increasingly important for its high specific power and quick charge and discharge rates. We investigate the electrical properties of hydrothermally synthesized vanadium oxide nanosheets as potential anode component of an electrochemical capacitor. The room temperature resistivity of the as-synthesized and pristine vanadium oxide nanosheets is around 10?7 ohm-cm, and variable temperature measurements indicate the semiconducting behavior of the material. Electrodes are fabricated from the nanosheets, and inserted into appropriate chloride solutions of Li, Na and ammonium. Room temperature voltammetry in the solutions are recorded and provide a measure of stored energy relative to each cation. Scanning electron micrographs obtained before and after various cyclic voltammograms provides a visual measure of nanosheet stability and a correlation to its electrochemical activity. Micrographs show that the material is robust towards Li insertion, but after several cycles of ammonium insertion, degradation occurs. Degradation upon Na insertion is minimal. These comparative studies shed light on the interactions between ions and metal oxide nanosheets. Electrochemical energy storage is becoming increasingly important for its high specific power and quick charge and discharge rates. We investigate the electrical properties of hydrothermally synthesized vanadium oxide nanosheets as potential anode component of an electrochemical capacitor. The room temperature resistivity of the as-synthesized and pristine vanadium oxide nanosheets is around 10?7 ohm-cm, and variable temperature measurements indicate the semiconducting behavior of the material. Electrodes are fabricated from the nanosheets, and inserted into appropriate chloride solutions of Li, Na and ammonium. Room temperature voltammetry in the solutions are recorded and provide a measure of stored energy relative to each cation. Scanning electron micrographs obtained before and after various cyclic voltammograms provides a visual measure of nanosheet stability and a correlation to its electrochemical activity. Micrographs show that the material is robust towards Li insertion, but after several cycles of ammonium insertion, degradation occurs. Degradation upon Na insertion is minimal. These comparative studies shed light on the interactions between ions and metal oxide nanosheets. We acknowledge support from NSF DMR 0943971 and 1206338.

  20. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S. (Santa Fe, NM); Cabantous, Stephanie (Los Alamos, NM)

    2008-06-24

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  1. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S. (Santa Fe, NM); Cabantous, Stephanie (Los Alamos, NM)

    2011-06-14

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  2. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2013-04-16

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  3. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S; Cabantous, Stephanie

    2013-02-12

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  4. ALS insertion device block measurement and inspection

    SciTech Connect

    Marks, S.; Carrieri, J.; Cook, C.; Hassenzahl, W.V.; Hoyer, E.; Plate, D.

    1991-05-01

    The performance specifications for ALS insertion devices require detailed knowledge and strict control of the Nd-Fe-B permanent magnet blocks incorporated in these devices. This paper describes the measurement and inspection apparatus and the procedures designed to qualify and characterize these blocks. A detailed description of a new, automated Helmholtz coil facility for measurement of the three components of magnetic moment is included. Physical block inspection and magnetic moment measurement procedures are described. Together they provide a basis for qualifying blocks and for specifying placement of blocks within an insertion devices' magnetic structures. 1 ref., 4 figs.

  5. Hollow polymer microneedles array resistance and insertion tests.

    PubMed

    Lhernould, Marion Sausse; Deleers, Michel; Delchambre, Alain

    2015-03-01

    Microneedles are developed in order to become the transdermal administration method of the future. They however still face numerous challenges. This paper addresses the challenge to effectively insert the microneedle arrays into membranes. A recently proposed model membrane and test method for microneedles insertion, published in International Journal of Pharmaceutics, is used in this aim. A moulded 4 by 4 hollow polymer microneedle array developed at the Université Libre de Bruxelles is tested for insertion using this model. Results show that the array is extremely resistant to insertion, it can withstand very high forces and even multiple insertions without blunting. Different insertion tests were performed on a folded in eight Parafilm® film because it exhibits excellent similarity to porcine skin. The insertion force, the insertion speed and the holding time of the array against membranes must be optimised in order to get efficient reliable insertions at, at least, 500?m depth. PMID:25595569

  6. Neutron absorber inserts for 55-gal drums

    SciTech Connect

    Wilson, R.E.; Kim, Y.S.; Toffer, H.

    2000-07-01

    Transport and temporary storage of more than 200 g of fissile material in 55-gal drums at the Rocky Flats Environmental Technology Site (RFETS) have received significant attention during the cleanup mission. This paper discusses successful applications and results of extensive computer studies. Interim storage and movement of fissile material in excess of standard drum limits (200 g) in a safe configuration have been accomplished using special drum inserts. Such inserts have constrained the contents of a drum to two 4-{ell} bottles. The content of the bottles was limited to 600 g Pu or U in solution or a total of 1200 g for the entire drum. The inserts were a simple design constructed of stainless steel, forming a vertical cylindrical pipe into which two bottles, one on top of the other, could be centered in the drum. The remaining drum volume was configured to preclude any additional bottle placement external to the vertical cylinder. Such inserts in drums were successfully used in moving high-concentration solution from one building to another for chemical processing. Concern about the knowledge of fissile material concentration in bottles prompted another study for drum inserts. The past practice had been to load up to fourteen 4-{ell} bottles into 55-gal drums, provided the fissile material concentration was <6 g fissile/{ell}, and the total drum contents of 200 g fissile was not exceeded. Only one determination of the solution concentration was needed. An extensive safety analysis concluded that a single measurement of bottle content could not ensure compliance with double-contingency-criterion requirements. A second determination of the bottle contents was required before bottles could be placed in a 55-gal drum. Al alternative to a dual-measurement protocol, which is for bolstering administrative control, was to develop an engineered safety feature that would eliminate expensive tests and administrative decisions. A drum insert design was evaluated that would ensure subcriticality in a drum even if the concentration of fissile material solution exceeded 6 g/{ell}. The challenge posed to the study was to maximize the number of bottles with a concentration up to 150 g/{ell} that could be safely placed into a drum. A concentration of 150 g of fissile material per liter is the maximum expected solution concentration in bottles at RFETS. A series of computer analyses were undertaken to design special drum inserts. A design was completed for a 55-gal drum insert to hold up to ten bottles containing 600 g fissile material in solution per bottle or 6 kg per drum. This insert would protect against accidental criticality caused by misloading high-concentration-solution bottles into a drum designated for low-concentration-bottle transport. The drum with the inserts could be used for transport or temporary storage of high-concentration solutions in 4-{ell} bottles. Conceptually, the drum with its inserts could also be employed for interim storage and transport of fissile material in forms other than solutions in 4-{ell} bottles.

  7. A High-Throughput Arabidopsis Reverse Genetics System

    PubMed Central

    Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

    2002-01-01

    A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ?100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

  8. Measure Lines

    ERIC Educational Resources Information Center

    Crissman, Sally

    2011-01-01

    One tool for enhancing students' work with data in the science classroom is the measure line. As a coteacher and curriculum developer for The Inquiry Project, the author has seen how measure lines--a number line in which the numbers refer to units of measure--help students not only represent data but also analyze it in ways that generate…

  9. A new mouse insertional mutation that causes sensorineural deafness and vestibular defects.

    PubMed Central

    Alagramam, K N; Kwon, H Y; Cacheiro, N L; Stubbs, L; Wright, C G; Erway, L C; Woychik, R P

    1999-01-01

    This article describes a new recessive insertional mutation in the transgenic line TgN2742Rpw that causes deafness and circling behavior in mice. Histologic analysis revealed virtually complete loss of the cochlear neuroepithelium (the organ of Corti) in adult mutant mice. In association with the neuroepithelial changes, there is a dramatic reduction of the cochlear nerve supply. Adult mutants also show morphological defects of the vestibular apparatus, including degeneration of the saccular neuroepithelium and occasional malformation of utricular otoconia. Audiometric evaluations demonstrated that the mice displaying the circling phenotype are completely deaf. Molecular analysis of this mutant line revealed that the transgenic insertion occurred without creating a large deletion of the host DNA sequences. The mutant locus was mapped to a region on mouse chromosome 10, where other spontaneous, recessive mutations causing deafness in mice have been mapped. PMID:10430593

  10. Online Advertising Insertion Order Form Company name

    E-print Network

    Butler, Laurie J.

    Online Advertising Insertion Order Form Advertiser Company name: Address: City: State: Zip: Contact: Billing Instructions Gross Amount : $ Net Amount: $ Please refer to 2014 Advertising Rate Sheet Less 15% agency discount or other applicable discount (please specify below): Send invoices to: Advertiser

  11. Inserting new technology into small missions

    NASA Technical Reports Server (NTRS)

    Deutsch, L. J.

    2001-01-01

    Part of what makes small missions small is that they have less money. Executing missions at low cost implies extensive use of cost sharing with other missions or use of existing solutions. Luckily, there are methods for creating new technology and inserting it into faster-better-cheaper missions.

  12. Parameter estimation during automated screw insertions

    Microsoft Academic Search

    Mongkom Klingajay; Lakmal D. Seneviratne; Kaspar Althoefer

    2002-01-01

    Threaded fastenings are a common assembly method, accounting for over a quarter of all assembly operations. Threaded fastenings are popular because they permit easy disassembly for maintenance, repair, relocation and recycling. Screw insertions are typically carried out manually and are a difficult problem to automate. As a result there is very little published research on automating threaded fastenings, and most

  13. Frequency, Gradience, and Variation in Consonant Insertion

    ERIC Educational Resources Information Center

    An, Young-ran

    2010-01-01

    This dissertation addresses the extent to which linguistic behavior can be described in terms of the projection of patterns from existing lexical items, through an investigation of Korean reduplication. Korean has a productive pattern of reduplication in which a consonant is inserted in a vowel-initial base, illustrated by forms such as "alok"--"t…

  14. Thermal Performance of the XRS Helium Insert

    NASA Technical Reports Server (NTRS)

    Breon, Susan R.; DiPirro, Michael J.; Tuttle, James G.; Shirron, Peter J.; Warner, Brent A.; Boyle, Robert F.; Canavan, Edgar R.

    1999-01-01

    The X-Ray Spectrometer (XRS) is an instrument on the Japanese Astro-E satellite, scheduled for launch early in the year 2000. The XRS Helium Insert comprises a superfluid helium cryostat, an Adiabatic Demagnetization Refrigerator (ADR), and the XRS calorimeters with their cold electronics. The calorimeters are capable of detecting X-rays over the energy range 0.1 to 10 keV with a resolution of 12 eV. The Helium Insert completed its performance and verification testing at Goddard in January 1999. It was shipped to Japan, where it has been integrated with the neon dewar built by Sumitomo Heavy Industries. The Helium Insert was given a challenging lifetime requirement of 2.0 years with a goal of 2.5 years. Based on the results of the thermal performance tests, the predicted on-orbit lifetime is 2.6 years with a margin of 30%. This is the result of both higher efficiency in the ADR cycle and the low temperature top-off, more than compensating for an increase in the parasitic heat load. This paper presents a summary of the key design features and the results of the thermal testing of the XRS Helium Insert.

  15. Minimizing noise via shield and repeater insertion

    Microsoft Academic Search

    Renatas Jakushokas; Eby G. Friedman

    2009-01-01

    Two techniques, shield and repeater insertion, are simultaneously investigated. Based on resource optimization, the relationship among noise, power, and delay is investigated. Coupling noise as a function of power dissipation is shown to behave parabolically. Due to this parabolic behavior, the minimum noise can be established. The resulting design expressions are compared with SPICE simulations, exhibiting good agreement. A design

  16. Hall of Ocean Life Educator's Guide Insert

    NSDL National Science Digital Library

    The museum's Milstein Family Hall of Ocean Life explores the diverse, complex web of life supported by the ocean and the vital inter-relationships between human and aquatic systems. This insert to the hall guide is designed to help you maximize your trip to the museum.

  17. Lymphatic Leak Complicating Central Venous Catheter Insertion

    Microsoft Academic Search

    Alex M. Barnacle; Tricia M. Kleidon

    2005-01-01

    Many of the risks associated with central venous access are well recognized. We report a case of inadvertent lymphatic disruption during the insertion of a tunneled central venous catheter in a patient with raised left and right atrial pressures and severe pulmonary hypertension, which led to significant hemodynamic instability. To our knowledge, this rare complication is previously unreported.

  18. Mapping Ds insertions in barley using a sequence-based approach

    Microsoft Academic Search

    L. D. Cooper; L. Marquez-Cedillo; J. Singh; A. K. Sturbaum; S. Zhang; V. Edwards; K. Johnson; A. Kleinhofs; S. Rangel; V. Carollo; P. Bregitzer; P. G. Lemaux; P. M. Hayes

    2004-01-01

    A transposon tagging system, based upon maize Ac\\/Ds elements, was developed in barley (Hordeum vulgare subsp. vulgare). The long-term objective of this project is to identify a set of lines with Ds insertions dispersed throughout the genome as a comprehensive tool for gene discovery and reverse genetics. AcTPase and Ds-bar elements were introduced into immature embryos of Golden Promise by

  19. A large-scale collection of phenotypic data describing an insertional mutant population to facilitate functional analysis of rice genes

    PubMed Central

    Iwasaki, Yukimoto; Kitano, Hidemi; Itoh, Jun-Ichi; Maekawa, Masahiko; Murata, Kazumasa; Yatou, Osamu; Nagato, Yasuo; Hirochika, Hirohiko

    2006-01-01

    In order to facilitate the functional analysis of rice genes, we produced about 50,000 insertion lines with the endogenous retrotransposon Tos17. Phenotypes of these lines in the M2 generation were observed in the field and characterized based on 53 phenotype descriptors. Nearly half of the lines showed more than one mutant phenotype. The most frequently observed phenotype was low fertility, followed by dwarfism. Phenotype data with photographs of each line are stored in the Tos17 mutant panel web-based database with a dataset of sequences flanking Tos17 insertion points in the rice genome (http://tos.nias.affrc.go.jp/). This combination of phenotypic and flanking sequence data will stimulate the functional analysis of rice genes. PMID:17180734

  20. Radiographic assessment of the femoral insertion of the posterior cruciate ligament

    PubMed Central

    Gali, Julio Cesar; Soares, André Schmidt; de Lima, Bruno Spagnuolo; Vianna, Filippo Santos Zozoloto; da Silva, Phelipe Augusto Cintra; Caetano, Edie Benedito

    2013-01-01

    Objective To establish the radiographic images of the femoral insertion of the posterior cruciate ligament (PCL), in order to assist the creation of anatomical femoral tunnels during surgeries, and to be used as parameters in postoperative evaluation of the location of these tunnels. Methods Thirty adult cadaver knees were used. The PCL anterolateral (AL) and posteromedial (PM) bundles' center was marked with a metallic marker. Radiographs were taken and a grid system was established to locate the position of bundles insertion. The percentile in which the projection of each bundle's center was in relation to the Blumensaat line was also determined. Results In the anteroposterior view, AL and PM bundles' centers were on average, on the 42.5% and 38.18% percentiles of Blumensaat's line, respectively. In lateral views, the AL and PM bundles' centers corresponded to the 72.94% and 55.56% percentiles of the line, respectively. In 73.33% of the knees the AL bundle center was on the 3D quadrant and in 70% of samples the PM bundle center was in quadrant 2D. Conclusions We established an X-ray pattern of femoral insertion of PCL that may be of interest for intraoperative control, before tunnel drilling, and also for post-operative evaluation of tunnel location. Controlled Laboratory Study. PMID:24453690

  1. Repeater Insertion in Tree Structured Inductive Interconnect Yehea I. Ismail, Eby G. Friedman, and Jose L. Neves1

    E-print Network

    Ismail, Yehea

    , subdividing the line into shorter sections by inserting repeaters is an effective strategy to reduce the total is to decouble a large capacitance from the critical path in order to minimize the overall delay of the critical. Furthermore, performance requirements are pushing the introduction of new materials for low resistance

  2. A Collection of Ds Insertional Mutants Associated With Defects in Male Gametophyte Development and Function in Arabidopsis thaliana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Functional analyses of the Arabidopsis genome require analysis of the gametophytic generation, since 10% of the genes are expressed in the male gametophyte and 9% in the female gametophyte. Here we describe the genetic and molecular characterization of 67 Ds insertion lines that show reduced transmi...

  3. Effects of insertion conditions on tissue strain and vascular damage during neuroprosthetic device insertion

    Microsoft Academic Search

    C. S. Bjornsson; S. J. Oh; Y. A. Al-Kofahi; Y. J. Lim; K. L. Smith; J. N. Turner; S. De; B. Roysam; W. Shain; S. J. Kim

    2006-01-01

    Long-term integration of neuroprosthetic devices is challenged by reactive responses that compromise the brain-device interface. The contribution of physical insertion parameters to immediate damage is not well described. We have developed an ex vivo preparation to capture real-time images of tissue deformation during device insertion using thick tissue slices from rat brains prepared with fluorescently labeled vasculature. Qualitative and quantitative

  4. A MANUAL INSERTION MECHANISM FOR PERCUTANEOUS COCHLEAR IMPLANTATION

    E-print Network

    Webster III, Robert James

    A MANUAL INSERTION MECHANISM FOR PERCUTANEOUS COCHLEAR IMPLANTATION Daniel Schurzig Vanderbilt. Webster III Vanderbilt University Nashville, TN, USA ABSTRACT Percutaneous Cochlear Implantation (PCI point. This precludes standard cochlear implant deployment techniques, and necessitates a new insertion

  5. Estimation of insertion depth angle based on cochlea diameter and linear insertion depth: a prediction tool for the CI422.

    PubMed

    Franke-Trieger, Annett; Mürbe, Dirk

    2014-11-01

    Beside the cochlear size, the linear insertion depth (LID) influences the insertion depth angle of cochlear implant electrode arrays. For the specific implant CI422 the recommended LID is not fixed but can vary continuously between 20 and 25 mm. In the current study, the influence of cochlea size and LID on the final insertion depth angle was investigated to develop a prediction tool for the insertion depth angle by means of cochlea diameter and LID. Preoperative estimation of insertion depth angles might help surgeons avoid exceeding an intended insertion depth, especially with respect to low-frequency residual hearing preservation. Postoperative, high-resolution 3D-radiographs provided by Flat Panel Computed Volume Tomography (FPCT) were used to investigate the insertion depth angle in 37 CI422 recipients. Furthermore, the FPCT images were used to measure linear insertion depth and diameter of the basal turn of the cochlea. A considerable variation of measured insertion depth angles ranging from 306° to 579° was identified. The measured linear insertion depth ranged from -18.6 to 26.2 mm and correlated positively with the insertion depth angle. The cochlea diameter ranged from 8.11 to 10.42 mm and correlated negatively with the insertion depth angle. The results suggest that preoperatively measured cochlea diameter combined with the option of different array positions by means of LID may act as predictors for the final insertion depth angle. PMID:25361895

  6. Trajectory generation for robotic needle insertion in soft tissue

    Microsoft Academic Search

    Niki Abolhassani; Rajni Patel; Mehrdad Moallem

    2004-01-01

    Accurate needle insertion in soft, inhomogeneous tissue has been a major concern in several recent studies involving robot-assisted percutaneous therapies. In procedures that involve multiple needle insertions such as transrectal ultrasound guided prostate brachytherapy, it is important to reduce tissue deformation before puncture and during insertion. In order to reduce this deformation, we have studied the effect of different trajectories

  7. Asymptotically Good Codes Correcting Insertions, Deletions, and Transpositions

    E-print Network

    Schulman, Leonard

    exponential error probability in a stochastic model of insertion­deletion. Keywords: error correcting codesAsymptotically Good Codes Correcting Insertions, Deletions, and Transpositions Leonard J. Schulman are asymptotically good for channels allowing insertions, deletions and transpositions. As a corollary, they achieve

  8. Insertion of group II intron retroelements after intrinsic transcriptional terminators

    E-print Network

    Zimmerly, Steven

    , for example, R2 elements insert site-specifically into defined se- quences within rDNA arrays while leavingInsertion of group II intron retroelements after intrinsic transcriptional terminators Aaron R by inserting directly after transcriptional terminator mo- tifs in bacterial genomes (stem-loops followed by Ts

  9. SFH/NC-BFSK Erasure insertion RS-BCH

    E-print Network

    Song, Hong-Yeop

    /NC-BFSK . erasure insertion BCH . BCH , RS BCH . SNR(Signal to noise ratio) SJR 2014 SFH/NC-BFSK Erasure insertion RS-BCH , , , , *, *, ** , *, ** {carisis, yangpw-Jamming Scheme Using RS-BCH Concatenation Code and Erasure Insertion in the SFH/BFSK System under Partial Band

  10. Power Optimal MTCMOS Repeater Insertion for Global Buses

    E-print Network

    Pedram, Massoud

    in the presence of crosstalk noise. MTCMOS technique by inserting high-Vth sleep transistors to reduce the leakagePower Optimal MTCMOS Repeater Insertion for Global Buses Hanif Fatemi Department of EE@ceng.usc.edu ABSTRACT This paper addresses the problem of power-optimal repeater insertion for global buses

  11. T-tube insertion for sclerotic subglottic stenosis.

    PubMed

    Goto, Taichiro; Kato, Ryoichi

    2014-02-01

    T-tube insertion is effective treatment for subglottic stenosis, but it is generally difficult due to bending of the T-tube. In a 52-year-old woman with relapsing polychondritis, a T-tube was inserted after predilatation using Hegar dilators. We describe the details of our T-tube insertion methods for sclerotic subglottic stenosis. PMID:24585799

  12. Insertion loss of sound waves through composite acoustic window materials

    Microsoft Academic Search

    Ji-Hye Lee; Byoung-Nam Kim; Ku-Kyun Shin; Suk Wang Yoon

    2010-01-01

    This study evaluated the insertion loss of sound waves through composite acoustic window materials for sonar dome applications, and examined the influence of dome shape on the sonar performance. The insertion loss of sound waves through acoustic window materials was experimentally measured as a function of frequency at normal incidence. The insertion loss was also theoretically estimated with three- and

  13. Simultaneous Shield Insertion and Net Ordering for Capacitive and Inductive

    E-print Network

    He, Lei

    Simultaneous Shield Insertion and Net Ordering for Capacitive and Inductive Coupling Minimization of inductive noise, and shield insertion is needed to minimize inductive noise. Using a Keff model as the figure of merit for inductive coupling, we then formulate two simultaneous shield insertion and net

  14. Stress-inducible OsP5CS2 gene is essential for salt and cold tolerance in rice

    Microsoft Academic Search

    Junghe Hur; Ki-Hong Jung; Choon-Hwan Lee; Gynheung An

    2004-01-01

    We isolated a rice T-DNA tagging line, in which T-DNA was inserted into the sixth intron of OsP5CS2. This gene encodes for a protein that is highly homologous to ?1-pyrroline-5-carboxylate synthetase (P5CS), a proline biosynthesis enzyme. The T-DNA contained the promoterless gus gene, allowing generation of a gene fusion between OsP5CS2 and gus. Therefore, the expression pattern of OsP5CS2 could

  15. Stress-inducible OsP5CS2gene is essential for salt and cold tolerance in rice

    Microsoft Academic Search

    Junghe Hur; Ki-Hong Jung; Choon-Hwan Leeb; Gynheung Ana

    We isolated a rice T-DNA tagging line, in which T-DNA was inserted into the sixth intron of OsP5CS2. This gene encodes for a protein that is highly homologous to ? 1-pyrroline-5-carboxylate synthetase (P5CS), a proline biosynthesis enzyme. The T-DNA contained the promoterless gus gene, allowing generation of a gene fusion between OsP5CS2 and gus. Therefore, the expression pattern of OsP5CS2

  16. Mouse genetic corneal disease resulting from transgenic insertional mutagenesis

    PubMed Central

    Ramalho, J S; Gregory-Evans, K; Huxley, C; Seabra, M C

    2004-01-01

    Background/aims: To report the generation of a new mouse model for a genetically determined corneal abnormality that occurred in transgenesis experiments. Methods: Transgenic mice expressing mutant forms of Rab27a, a GTPase that has been implicated in the pathogenesis of choroideremia, were generated. Results: Only one transgenic line (T27aT15) exhibited an unexpected eye phenotype. T27aT15 mice developed corneal opacities, usually unilateral, and cataracts, resulting in some cases in phthisical eyes. Histologically, the corneal stroma was thickened and vacuolated, and both epithelium and endothelium were thinned. The posterior segment of the eye was also affected with abnormal pigmentation, vessel narrowing, and abnormal leakage of dye upon angiography but was histologically normal. Conclusion: Eye abnormality in T27aT15 mice results from random insertional mutagenesis of the transgene as it was only observed in one line. The corneal lesion observed in T27aT15 mice most closely resembles posterior polymorphous corneal dystrophy and might result from the disruption of the equivalent mouse locus. PMID:14977782

  17. A retroelement modifies pre-mRNA splicing: the murine Glrb(spa) allele is a splicing signal polymorphism amplified by long interspersed nuclear element insertion.

    PubMed

    Becker, Kristina; Braune, Marlen; Benderska, Natalya; Buratti, Emanuele; Baralle, Francisco; Villmann, Carmen; Stamm, Stefan; Eulenburg, Volker; Becker, Cord-Michael

    2012-09-01

    The glycine receptor-deficient mutant mouse spastic carries a full-length long interspersed nuclear element (LINE1) retrotransposon in intron 6 of the glycine receptor ? subunit gene, Glrb(spa). The mutation arose in the C57BL/6J strain and is associated with skipping of exon 6 or a combination of the exons 5 and 6, thus resulting in a translational frameshift within the coding regions of the GlyR ? subunit. The effect of the Glrb(spa) LINE1 insertion on pre-mRNA splicing was studied using a minigene approach. Sequence comparison as well as motif prediction and mutational analysis revealed that in addition to the LINE1 insertion the inactivation of an exonic splicing enhancer (ESE) within exon 6 is required for skipping of exon 6. Reconstitution of the ESE by substitution of a single residue was sufficient to prevent exon skipping. In addition to the ESE, two regions within the 5' and 3' UTR of the LINE1 were shown to be critical determinants for exon skipping, indicating that LINE1 acts as efficient modifier of subtle endogenous splicing phenotypes. Thus, the spastic allele of the murine glycine receptor ? subunit gene is a two-hit mutation, where the hypomorphic alteration in an ESE is amplified by the insertion of a LINE1 element in the adjacent intron. Conversely, the LINE1 effect on splicing may be modulated by individual polymorphisms, depending on the insertional environment within the host genome. PMID:22782896

  18. Electrochemical insertion of sodium into carbon

    NASA Astrophysics Data System (ADS)

    Doeff, Marca M.; Ma, Yanping; Visco, Steven J.; Dejonghe, Lutgard C.

    1993-12-01

    Electrochemical insertion of sodium ions into carbon using solid polymer electrolytes or organic liquid electrolytes is described. Cells with the configuration Na P(EO)(sub *)NaCF3SO3 CP(EO) = polyethylene oxide or Na/liquid electrolyte/C were galvanostatically discharged, charged, and cycled. The extent of insertion into C (i.e., x in Na(+)C(sub x -)) was found to be a strong function of the type and particle size of the carbon used, and the reversibility of the process was highly dependent upon the type of electrolyte used. The possibility of designing sodium ion rocking chair cells is discussed, and a first-generation example, using a petroleum coke anode, polymer electrolyte, and sodium cobalt bronze cathode is described.

  19. Inserting new technology into small missions

    NASA Technical Reports Server (NTRS)

    Deutsch, L. J.

    2001-01-01

    Part of what makes small missions small is that they have less money. Executing missions at low cost implies extensive use of cost sharing with other missions or use of existing solutions. However, in order to create many small missions, new technology must be developed, applied, and assimilated. Luckily, there are methods for creating new technology and inserting it into faster-better-cheaper (FBC) missions.

  20. Aspergillus arachnoiditis post intrathecal baclofen pump insertion.

    PubMed

    Vivek, V; Kavar, B; Hogg, M; Eisen, D P; Butzkueven, H

    2013-08-01

    This report describes an unusual fungal infection of an intrathecal baclofen pump which, to our knowledge, has not been reported previously. We describe a 39-year-old man with severe lower limb spasticity due to secondary progressive multiple sclerosis that was managed with insertion of an intrathecal baclofen pump. He subsequently presented with distinct neurological decline secondary to an intrathecal baclofen pump infection with Aspergillus terreus. PMID:23685108

  1. Targeted gene insertion for molecular medicine

    Microsoft Academic Search

    Katrin Voigt; Zsuzsanna Izsvák; Zoltán Ivics

    2008-01-01

    Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term\\u000a therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist.\\u000a Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted\\u000a site, such as primary DNA sequence and

  2. Magnetic measurements on insertion devices at NSLS

    SciTech Connect

    Decker, G.; Galayda, J.; Kitamura, M.; Solomon, L.

    1988-01-01

    Magnetic measurements on three insertion devices for use in the NSLS x-ray ring are described. Hall probes were used for field mapping, and rotating long coils were used to determine integrated multipole coefficients. Results are presented for an iron pole-REC hybrid undulator, a vanadium permendur pole-REC wiggler and a 5 Tesla superconducting wiggler. 6 refs., 8 figs., 2 tabs.

  3. Thermally Activated Retainers For Insertion In Gaps

    NASA Technical Reports Server (NTRS)

    Grimaldi, Margaret E.; Hartz, Leslie S.

    1992-01-01

    Mechanical retainers of new type for use with gap filler easy to install and to attach themselves securely. Concept based on shape-memory properties of metal alloy Nitinol, alloy of nickel and titanium. Retainers conceived for use with Space Shuttle insulating tiles but used on other assemblies of blocks or tiles configured similarly. Tabs bent outward made flush by cooling below memory transition temperature. After insertion in gap and reheating, tabs spring outward.

  4. Probe insertion apparatus with inflatable seal

    NASA Technical Reports Server (NTRS)

    Trimarchi, Paul A. (inventor)

    1990-01-01

    A sealing apparatus is disclosed for inserting a probe into a pressure vessel having an elongated opening includes a pair of resiliently deformable seals opposingly disposed in sealing engagement with each other. A retainer is connected to the pressure vessel around the elongated opening and holds the pair of seals rigidly to the pressure vessel. A wedge is engageable with the pair of seals and carries the probe, for longitudinally translating the probe in pressure vessel.

  5. Diamond coated inserts, drills, and end mills

    SciTech Connect

    Suzuki, T.; Hattori, T.; Endo, A. [Toshiba Tungaloy Co., Ltd., Kawasaki (Japan)] [and others

    1995-12-31

    Current status of chemical vapor deposition (CVD) diamond for the application to cutting tools was briefly summarized, focused on microstructures, adhesion strength and cutting performance. Diamond-coated cemented carbide inserts, drills and end mills were tested against Al-Si alloys and problems for expanding tool market were also discussed. Further, the potential use of thick diamond films for replacing with PCD was described.

  6. Zip Line

    NSDL National Science Digital Library

    WGBH

    2010-01-01

    In this design challenge activity, learners build a device to carry a Ping-Pong ball from the top of a zip line to the bottom in four seconds (or less!). Learners follow the design process to build the carrier that slides quickly down a zip line string, figure out how to keep something balanced, and identify ways to reduce friction.

  7. One-piece rocker arm with insert

    SciTech Connect

    Patel, R.L.; Wherry, J.L.

    1988-04-19

    A one-piece, cold-formed rocker arm of the cam-follower type is described comprising a one-piece metal body having a rounded recess in a first end portion thereof to receive an end of a lifter post on which the rocker arm can pivot. The end portion thereof has an opening extending therethrough communicating with the rounded recess and the opening being flared outwardly in a direction away from the recess to form an oil reservoir. The body has an additional recess of rectangular transverse cross-sectional shape at a second end portion thereof to receive an end of a valve stem. The body has an intermediate generally convex portion facing away from the recesses. The convex portion has a shallow rectangular recess therein defined by four peripheral side walls. The body has a shallow projection of rectangular shape in longitudinal cross section on the side directly opposite the shallow recess, a long-wearing metal insert in the shallow recess to be engaged by a cam, the metal insert being prevented from sideways movement by the side walls of the body, and means affixing the metal insert in the shallow recess.

  8. Assembly and Insertion of a Self-Fitting Hearing Aid

    PubMed Central

    Hickson, Louise; Meyer, Carly

    2011-01-01

    A self-fitting hearing aid has been proposed as a viable option to meet the need for rehabilitation in areas where audiology services are unreliable. A successful outcome with a self-fitting hearing aid pivots in part on the clarity of the instructions accompanying the device. The aims of this article are (a) to review the literature to determine features that should be incorporated into written health-care materials and factors to consider in the design process when developing written instructions for a target audience of older adults and (b) to apply this information to the development of a set of written instructions as the first step in self-fitting of a hearing aid, assembling four parts and inserting the aid into the ear. The method involved a literature review of published peer reviewed research. The literature revealed four steps in the development of written health-care materials: planning, design, assessment of suitability, and pilot testing. Best practice design principles for each step were applied in the development of instructions for how to assemble and insert a hearing aid. Separate booklets were developed for the left and right aids and the content of each consisted of simple line drawings accompanied by captions. The reading level was Grade 3.5 equivalent and the Flesch Reading Ease Score was 91.1 indicating that the materials were “very easy” to read. It is essential to follow best practice design principles when developing written health-care materials to motivate the reader, maximize comprehension, and increase the likelihood of successful application of the content. PMID:22389434

  9. Insertion of coherence requests for debugging a multiprocessor

    DOEpatents

    Blumrich, Matthias A. (Ridgefield, CT); Salapura, Valentina (Chappaqua, NY)

    2010-02-23

    A method and system are disclosed to insert coherence events in a multiprocessor computer system, and to present those coherence events to the processors of the multiprocessor computer system for analysis and debugging purposes. The coherence events are inserted in the computer system by adding one or more special insert registers. By writing into the insert registers, coherence events are inserted in the multiprocessor system as if they were generated by the normal coherence protocol. Once these coherence events are processed, the processing of coherence events can continue in the normal operation mode.

  10. A piezoelectric vibration-based syringe for reducing insertion force

    NASA Astrophysics Data System (ADS)

    Huang, Y. C.; Tsai, M. C.; Lin, C. H.

    2012-12-01

    Puncturing of the human skin with a needle is perhaps the most common invasive medical procedure. Clinical studies have revealed that tissue deformation and needle deflection are the primary problem for needle misplacement in percutaneous procedures. To avoid this, various techniques for reducing insertion forces during needle insertion have been considered. This paper presents a piezoelectric vibration-based syringe to reduce insertion force. AC power was applied to the piezoelectric elements to vibrate the needle with high frequency and thereby reduce the friction and cutting forces between the needle and tissue. Vibration mode shapes of the needle were observed by finite element analysis and verified by experimental results. Effects of reducing insertion force via the vibrating needle were also confirmed by inserting the needle into the porcine tissues. The proposed syringe, which minimizes the insertion force and overcomes limitations of needle materials, can be widely utilized in robot-assisted needle insertion systems.

  11. Quench Module Insert (QMI) and the Diffusion Module Insert (DMI) Furnace Development

    NASA Technical Reports Server (NTRS)

    Crouch, Myscha R.; Carswell, William E.; Farmer, Jeff; Rose, Fred; Tidwell, Paul H., II

    2000-01-01

    The Quench Module Insert (QMI) and the Diffusion Module Insert (DMI) are microgravity furnaces under development at Marshall Space Flight Center. The furnaces are being developed for the first Materials Science Research Rack (MSRR-1) of the Materials Science Research Facility (MSRF), one of the first International Space Station (ISS) scientific payloads. QMI is a Bridgman furnace with quench capability for studying interface behavior during directional solidification of metallic and alloy materials. DMI will be a Bridgman-Stockbarger furnace to study diffusion processes in semiconductors. The design for each insert, both QMI and DMI, is driven by specific science, operations and safety requirements, as well as by constraints arising from resource limitations, such as volume, mass and power. Preliminary QMI analysis and testing indicates that the design meets these requirements.

  12. Number Line

    NSDL National Science Digital Library

    Clarity Innovations, Inc.

    2013-11-22

    This iOS app helps students to visualize number sentences and create models for addition, subtractions, multiplication, and division. The number line can be adjusted to represent multiples of numbers from one to one hundred.

  13. Analytic closed orbit analysis for RHIC insertion

    SciTech Connect

    Lee, S.Y. (Indiana Univ., Bloomington, IN (USA). Dept. of Physics); Tepikian, S. (Brookhaven National Lab., Upton, NY (USA))

    1991-01-01

    Analytic closed orbit analysis is performed to evaluate the tolerance of quadrupole misalignment and dipole errors (b{sub 0},a{sub 0}) in the RHIC insertion. Sensitivity coefficients of these errors are tabulated for different {beta}{sup 0} values. Using these sensitivity tables, we found that the power supplies ripple of 10{sup {minus}4} can cause closed orbit motion of 0.05 mm at the IP in comparison with the rms beam size of 0.3 mm. It is desirable to have the power supply ripple less than 10{sup {minus}5}. 2 refs., 1 fig., 2 tabs.

  14. Reactivity Insertion Accident Analysis with Coupled RETRAN

    SciTech Connect

    Kim, Yo-Han; Yang, Chang-Keun; Sung, Chang-Kyung; Lee, Chang-Sup [Korea Electric Power Research Institute, 103-16 Munji-dong Yusung-ku, Taejon (Korea, Republic of)

    2004-07-01

    Because of analysis field to be wider and complicated is required, it faces up hardships due to the narrow analysis scopes and limited functions of current vendor code systems. To overcome it KEPRI develop the in-house safety analysis methodology based on the available exquisite codes. For the development, the RETRAN code was modified and coupled to compensate for the lack of capabilities. To estimate the feasibility of the methodology and code system, some reactivity insertion accidents were analyzed and compared with the results mentioned in final safety analysis report of the plant. (authors)

  15. Insertional mutagenesis of Drosophila heterochromatin with single P elements.

    PubMed

    Zhang, P; Spradling, A C

    1994-04-26

    Insertional mutagenesis with transposable P elements has greatly facilitated the identification and analysis of genes located throughout the 70% of the Drosophila melanogaster genome classified as euchromatin. In contrast, genetically marked P elements have only rarely been shown to transpose into heterochromatin. By carrying out single P element insertional mutagenesis under conditions where position-effect variegation was suppressed, we efficiently generated strains containing insertions at diverse sites within centromeric and Y-chromosome heterochromatin. The tendency of P elements to transpose locally was shown to operate within heterochromatin, and it further enhanced the recovery of heterochromatic insertions. Three of the insertions disrupted vital genes known to be present at low density in heterochromatin. Strains containing single P element insertions will greatly facilitate the structural and functional analysis of this poorly understood genomic component. PMID:8170943

  16. Phoenix Conductivity Probe Inserted in Martian Soil

    NASA Technical Reports Server (NTRS)

    2008-01-01

    This series of six images from the Robotic Arm Camera on NASA's Phoenix Mars Lander records the first time that the four spikes of the lander's thermal and electrical conductivity probe were inserted into Martian soil.

    The images were taken on July 8, 2008, during the Phoenix mission's 43rd Martian day, or sol, since landing. The insertion visible from the shadows cast on the ground on that sol was a validation test of the procedure. The spikes on the probe are about 1.5 centimeters or half an inch long.

    The science team will use the probe tool to assess how easily heat and electricity move through the soil from one spike to another. Such measurements can provide information about frozen or unfrozen water in the soil. The probe is mounted on the 'knuckle' of Phoenix's Robotic Arm. It has already been used for assessing water vapor in the atmosphere when it is held above the ground.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is led by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  17. A transgenic insertion causing cryptorchidism in mice.

    PubMed

    Overbeek, P A; Gorlov, I P; Sutherland, R W; Houston, J B; Harrison, W R; Boettger-Tong, H L; Bishop, C E; Agoulnik, A I

    2001-05-01

    A distinctive feature of gonadal maturation in mammals is the movement to an extraabdominal location. Testicular descent is a complex, multistage process whereby the embryonic gonads migrate from their initial abdominal position to the scrotum. Failure in this process results in cryptorchidism, a frequent congenital birth defect in humans. We report here a new mouse transgenic insertional mutation, cryptorchidism with white spotting (crsp). Males homozygous for crsp exhibit a high intraabdominal position of the testes, associated with complete sterility. Heterozygous males have a wild-type phenotype, and homozygous females are fertile. Surgically descended testes in crsp/crsp males show normal spermatogenesis. Using FISH and genetic analyses, the transgenic insert causing the crsp mutation has been mapped to the distal part of mouse chromosome 5. Transgene integration resulted in a 550-kb deletion located upstream of the Brca2 gene. A candidate gene encoding a novel G protein-coupled receptor (Great) with an expression pattern suggesting involvement in testicular descent has been identified. PMID:11353515

  18. Radiological Insertion and Management of Peritoneovenous Shunt

    SciTech Connect

    Bratby, M. J. [St George's Hospital, Radiology Department (United Kingdom); Hussain, F. F., E-mail: fhussain@doctors.org.uk; Lopez, A. J. [Royal Surrey County Hospital and St. Luke's Cancer Centre, Radiology Department (United Kingdom)

    2007-06-15

    The purpose of the study was to report our experience of the management of complications following the insertion of a peritoneovenous shunt for intractable malignant ascites. From June 1999 to January 2006, 26 patients underwent insertion of a peritoneovenous shunt for ascites by interventional radiologists. We have used ultrasound and shuntography to assist in the diagnosis of the cause of shunt blockage. Successful techniques for the restoration of the shunt function include port- pumping, stripping of any fibrin sheath, and revision of either the venous or peritoneal catheter. The procedure was initially successful in all patients with continued patency until death in 17. A further four patients are still alive with a functioning shunt. There was one rapid postprocedure death resulting from pulmonary edema. Two patients developed pneumothorax, managed successfully with either a chest drain or aspiration. Shunt dysfunction occurred eight times in seven patients. There were five successful revisions in four patients. Overall, shunt patency has been maintained in 80.1% of patients. Shunt dysfunction is seen in a significant number of patients, but successful revision of the shunt can be achieved in the majority.

  19. Mammalian NUMT insertion is non-random

    PubMed Central

    Tsuji, Junko; Frith, Martin C.; Tomii, Kentaro; Horton, Paul

    2012-01-01

    It is well known that remnants of partial or whole copies of mitochondrial DNA, known as Nuclear MiTochondrial sequences (NUMTs), are found in nuclear genomes. Since whole genome sequences have become available, many bioinformatics studies have identified putative NUMTs and from those attempted to infer the factors involved in NUMT creation. These studies conclude that NUMTs represent randomly chosen regions of the mitochondrial genome. There is less consensus regarding the nuclear insertion sites of NUMTs — previous studies have discussed the possible role of retrotransposons, but some recent ones have reported no correlation or even anti-correlation between NUMT sites and retrotransposons. These studies have generally defined NUMT sites using BLAST with default parameters. We analyze a redefined set of human NUMTs, computed with a carefully considered protocol. We discover that the inferred insertion points of NUMTs have a strong tendency to have high-predicted DNA curvature, occur in experimentally defined open chromatin regions and often occur immediately adjacent to A?+?T oligomers. We also show clear evidence that their flanking regions are indeed rich in retrotransposons. Finally we show that parts of the mitochondrial genome D-loop are under-represented as a source of NUMTs in primate evolution. PMID:22761406

  20. Proposed mini beta insertion for spear

    SciTech Connect

    Wille, K.

    1984-03-01

    A significant gain in luminosity has been achieved by use of mini beta insertions implemented in several electron-positron storage rings (CESR, DORIS II, PEP, PETRA) during the last year. This concept consists of strong vertical focusing quadrupoles mounted as close as possible to the interaction point. Such an arrangement avoids the acceptance and chromaticity problems caused by an extreme focusing with the normal magnet structure, but they interfere with the particle detectors and if the detector has a magnetic field one has to protect the quadrupole from this field. In this paper a mini beta insertion for SPEAR is suggested which is rather similar to that developed for DORIS II. The essential element is a conventional iron magnet with moderate design values up to an energy of E = 4 GeV. The resulting optics allow vertical amplitude functions down to ..beta../sub y/* = 3 cm at the interaction points. Compared to the present SPEAR optics, the mini beta optics is only different in the interaction regions but unchanged in the whole arcs. This is of great importance to the injection system which does not need any modification. The resulting gain in luminosity is calculated to be approximately a factor of four. 8 references, 13 figures, 5 tables.

  1. Insertions of a Novel Class of Transposable Elements with a Strong Target Site Preference at the R Locus of Maize

    PubMed Central

    Walker, E. L.; Eggleston, W. B.; Demopulos, D.; Kermicle, J.; Dellaporta, S. L.

    1997-01-01

    The r locus of maize regulates anthocyanin synthesis in various tissues of maize through the production of helix-loop-helix DNA binding proteins capable of inducing expression of structural genes in the anthocyanin biosynthetic pathway. The complex r variant, R-r:standard (R-r), undergoes frequent mutation through a variety of mechanisms including displaced synapsis and crossing over, and intrachromosomal recombination. Here we report a new mechanism for mutation at the R-r complex: insertion of a novel family of transposable elements. Because the elements were first identified in the R-p gene of the R-r complex, they have been named P Instability Factor (PIF). Two different PIF elements were cloned and found to have identical sequences at their termini but divergent internal sequences. In addition, the PIF elements showed a marked specificity of insertion sites. Six out of seven PIF-containing derivatives examined had an element inserted at an identical location. Two different members of the PIF element family were identified at this position. The seventh PIF-containing derivative examined had the element inserted at a distinct position within r. Even at this location, however, the element inserted into a conserved target sequence. The timing of PIF excision is unusual. Germinal excision rates can range up to several percent of progeny. Yet somatic sectors are rare, even in lines exhibiting high germinal reversion rates. PMID:9178016

  2. Accelerating vs Constant Rate of Insertion in Wood Dowel Welding

    Microsoft Academic Search

    S. Auchet; C. Segovia; H. R. Mansouri; P.-J. Meausoone; A. Pizzi; P. Omrani

    2010-01-01

    Dowel insertion rates whether accelerating or constant are determining parameters for the tensile strength of welded dowel joints. Dowel insertion at acceleration up to 4–7 m\\/s appears to yield the best results at the lower dowel insertion speed, characteristic of welding by manual drills. Strength results for dowel welded joints of 24 mm depths of up to 2700 N\\/mm have

  3. Interleaving buffer insertion and transistor sizing into a single optimization

    Microsoft Academic Search

    Yanbin Jiang; Sachin S. Sapatnekar; Cyrus Bamji; Juho Kim

    1998-01-01

    This work presents strategies to insert buffers in a circuit, combined with gate sizing, to achieve better power- delay and area-delay tradeoffs. The purpose of this work is to examine how combining a sizing algorithm with buffer insertion will help us achieve better area-delay or power-delay tradeoffs, and to determine where and when to insert buffers in a circuit. The

  4. Technology assessment for CVD-diamond-coated cutting tool inserts

    Microsoft Academic Search

    K. R. Walton; J. P. Dismukes; R. A. Krueger; F. R. Field; J. P. Clark

    1989-01-01

    This study assesses the potential for manufacturing diamond-coated, cutting tool inserts by plasma-enhanced chemical vapor deposition (PA-CVD), an emerging technology expected to compete with the static, high-pressure sintering method presently used for the commercial production of polycrystalline diamond composite (PDC) coatings on tool inserts. Using a 4-step manufacturing model based upon microwave PA-CVD for diamond growth, insert manufacturing costs were

  5. Computing 3D Magnetic Fields from Insertion Devices

    NASA Astrophysics Data System (ADS)

    Elleaume, Pascal; Chubar, Oleg; Chavanne, Joel

    1997-05-01

    A 3D magnetostatics computer code optimized for Undulators and Wigglers is described. The code uses a boundary integral method and makes extensive use of analytical expressions for the field and especially field integrals along a straight line. Magnetic field boundary conditions are treated by the mirror approach. The code outperforms currently available finite element packages in the area of simple data input, cpu time of the solver and accuracy reached for the estimation of field integrals. It is written in C++ and takes advantage of object-oriented programming. The code is interfaced to Mathematica (Mathematica is a registered trademark of WolframResearch, Inc.). Pre- and post-processing of the field data is done in the Mathematica Language. These features make the code an effective tool for the development of permanent-magnet, hybrid and electro-magnet undulators and wigglers for use in synchrotron radiation sources and free-electron lasers, as well as for solving other relevant problems of magnetostatics. The code has been extensively benchmarked with respect to a commercial finite element code. All ESRF Insertion Devices built during the last 4 years have been designed using this code or an older version.

  6. Pi Line

    NSDL National Science Digital Library

    2011-01-19

    This lesson from Illuminations asks students to measure the diameter and circumference of various circular objects, plot the measurements on a graph, and relate the slope of the line to Ï?, the ratio of circumference to diameter. A student activity sheet is included. The material is appropriate for grades 9-12 and should require 1 class period to complete.

  7. Mode conversion at GCPW-to-microstrip-line transitions

    Microsoft Academic Search

    J.-P. Raskin; G. Gauthier; L. P. Katehi; G. M. Rebeiz

    2000-01-01

    Mode conversion at the transition between grounded coplanar waveguide (GCPW) and microstrip line is demonstrated. Experimental results show the effect of overmoding in a conductor-backed coplanar waveguide on the transition behavior. A simple micromachining solution is used to cancel the parasitic modes triggered by the transition in the GCPW feed line. This results in an insertion loss of 0.3 dB

  8. A novel global interconnect method using nonlinear transmission lines

    Microsoft Academic Search

    Jinsook Kim; Weiping Ni; Edwin C. Kan

    2005-01-01

    We propose the nonlinear transmission line (NLTL) as an effective global interconnect method that offers capabilities of rise\\/fall edge sharpening, signal shaping\\/amplification, and impedance matching. Interconnect line characteristics of NLTLs implemented with the MIT Lincoln Lab 0.18?m FDSOI (fully-depleted silicon-on-insulator) CMOS process are investigated up to 35GHz using S-parameters. The excellent return and insertion loss properties in a broadband illustrate

  9. Stabilization of insertion electrodes for lithium batteries.

    SciTech Connect

    Thackeray, M. M.

    1998-09-03

    This paper discusses the techniques that are being employed to stabilize LiMn{sub 2}O{sub 4} spinel and composite Li{sub x}MnO{sub 2} positive electrodes. The critical role that spinel domains play in stabilizing these electrodes for operation at both 4 V and 3 V is highlighted. The concept of using an intermetallic electrode MM{prime} where M is an active alloying element and M{prime} is an inactive element (or elements) is proposed as an alternative negative electrode (to carbon) for lithium-ion cells. An analogy to metal oxide insertion electrodes, such as MnO{sub 2}, in which Mn is the electrochemically active ion and O is the inactive ion, is made. Performance data are given for the copper-tin electrode system, which includes the intermetallic phases eta-Cu{sub 6}Sn{sub 5} and Li{sub 2}CuSn.

  10. Coldmass for LHC Dipole Insertion Magnets

    SciTech Connect

    Gupta, R.; Alforque, R.; Anerella, M.; Kelly, E.; Plate, S.; Rufer, C.; Wanderer, P.; Willen, E.; Wu, K.C.

    1997-10-18

    Brookhaven National Laboratory (BNL) is building a number of magnets for the insertion regions of the Large Hadron Collider (LHC). This paper presents the magnetic design and the expected field quality in 2-in-1 dipole magnets. A unique feature of this cold mass design is the use of an oblate-shaped yoke. This concept permits a variety of BNL-built magnets to have a similar overall design and allows the LHC main dipole cryostat, post, etc., to be used in these magnets. The proposed oblate-shaped yoke also offers a way to reduce the overall cryostat size in future magnets. The dipoles will use the same 80 mm aperture coils as used in the Relativistic Heavy Ion Collider (RHIC) dipole magnets, but will use stainless steel collars. The design presented here is still evolving and the magnets may be built differently than described here.

  11. COLDMASS FOR LHC DIPOLE INSERTION MAGNETS.

    SciTech Connect

    GUPTA,R.; ALFORQUE,R.; ANERELLA,M.; KELLY,E.; PLATE,S.; RUFER,C.; WANDERER,P.; WILLEN,E.; WU,K.C.

    1997-10-20

    Brookhaven National Laboratory (BNL) is building a number of magnets for the insertion regions of the Large Hadron Collider (LHC). This paper presents the magnetic design and the expected field quality in 2-in-1 dipole magnets. A unique feature of this coldmass design is the use of an oblate-shaped yoke. This concept permits a variety of BNL-built magnets to have a similar overall design and allows the LHC main dipole cryostat, post, etc., to be used in these magnets. The proposed oblate-shaped yoke also offers a way to reduce the overall cryostat size in future magnets. The dipoles will use the same 80 mm aperture coils as used in the Relativistic Heavy Ion Collider (RHIC) dipole magnets, but will use stainless steel collars. The design presented here is still evolving and the magnets may be built differently than described here.

  12. INSERTION DEVICE UPGRADE PLANS AT THE NSLS.

    SciTech Connect

    TANABE, T.; BLEDNYKH, A.; HARDER, D.; LEHECKA, M.; RAKOWSKY, G.; SKARITKA, J.

    2005-05-16

    This paper describes plans to upgrade insertion devices (IDs) at the National Synchrotron Light Source (NSLS), Brookhaven National Laboratory, U.S.A. The aging wiggler (W120) at X25 is being replaced by a 1 m long in-vacuum mini-gap undulator (MGU-X25) optimized for a dedicated macromolecular crystallography program. A new, 1/3 m long, undulator (MGU or SCU-X9), will be installed between a pair of RF cavities at X9, and will serve a new beamline dedicated for small angle x-ray scattering (SAXS). Both IDs will have provision for cryocooling the NdFeB hybrid arrays to 150K to raise the field and K-value and to obtain better spectral coverage. Design issues of the devices and other considerations, especially magnetic measurement at low temperature, will be discussed.

  13. Low Insertion-Loss, and Wideband Dual-Mode Bandpass Filters with Dual Perturbation Elements

    NASA Astrophysics Data System (ADS)

    Jhong, Shih-Bin; Weng, Min-Hang; Wu, Sean; Hung, Cheng-Yuan; Lee, Maw-Shung

    A novel low insertion-loss and wideband microstrip band-pass filter has been designed and tested. The basic configuration of this novel dual-mode filter is a square ring resonator with direct-connected orthogonal feed lines, and dual-perturbation elements are introduced within the resonator at symmetrical location. The effects of the size of the perturbation element are studied. A new filter having wider bandwidth and transmission zeros are presented. The proposed filter responses are in good agreement with the simulations and experiments.

  14. Line Defaults Modify Line/Shipping/Accounting

    E-print Network

    Shull, Kenneth R.

    Line Defaults and Modify Line/Shipping/Accounting NUFinancials Supply Chain FMS815 03/31/2010 --rkw, vlr Line Defaults & Modify Line/Shipping/Accounting © 2010 Northwestern University FMS815­ Job Aid Page 1 of 5 This job aid describes how and when to use Line Defaults and Modify Line/Shipping/Accounting

  15. Genomewide insertional mutagenesis in Streptomyces coelicolor reveals additional genes involved in

    E-print Network

    Beverley, Stephen M.

    Genomewide insertional mutagenesis in Streptomyces coelicolor reveals additional genes involved. The insertionally mutated library was introduced into S. coelicolor, and transposon insertions were recovered to the transposon insertion. As a fresh approach to the challenge of generating insertional mutants in Streptomyces

  16. Construction of finite element model and stress analysis of anterior cruciate ligament tibial insertion

    PubMed Central

    Dai, Can; Yang, Liu; Guo, Lin; Wang, Fuyou; Gou, Jingyue; Deng, Zhilong

    2015-01-01

    Objective: The aim of the present study was to develop a more realistic finite element (FE) model of the human anterior cruciate ligament (ACL) tibial insertion and to analyze the stress distribution in the ACL internal fibers under load. Methods: The ACL tibial insertions were processed histologically. With Photoshop software, digital images taken from the histological slides were collaged, contour lines were drawn, and different gray values were filled based on the structure. The data were exported to Amira software and saved as “.hmascii” file. This document was imported into HyperMesh software. The solid mesh model generated using HyperMesh software was imported into Abaqus software. The material properties were introduced, boundary conditions were set, and load was added to carry out the FE analysis. Results: The stress distribution of the ACL internal fibers was uneven. The lowest stress could be observed in the ACL lateral fibers under tensile and shear load. Conclusion: The establishment of ACL tibial insertion FE model and mechanical analysis could reveal the stress distribution in the ACL internal fibers under load. There was greater load carrying capacity in the ACL lateral fibers which could sustain greater tensile and shear forces.

  17. A Microscopic View of Phospholipid Insertion into Biological Membranes

    PubMed Central

    Vermaas, Josh V.; Tajkhorshid, Emad

    2014-01-01

    Understanding the process of membrane insertion is an essential step in developing a detailed mechanism, e.g., for peripheral membrane protein association and membrane fusion. The Highly Mobile Membrane Mimetic (HMMM) has been used to accelerate the membrane association and binding of peripheral membrane proteins in simulations by increasing the lateral diffusion of phospholipid headgroups while retaining an atomistic description of the interface. Through a comparative study, we assess the difference in insertion rate of a free phospholipid into an HMMM as well as into a conventional phospholipid bilayer, and develop a detailed mechanistic model of free phospholipid insertion into biological membranes. The mechanistic insertion model shows that successful, irreversible association of the free phospholipid to the membrane interface, which results in its insertion, is the rate limiting step. Association is followed by independent, sequential insertion of the acyl tails of the free phospholipid into the membrane, with splayed acyl tail intermediates. Use of the HMMM is found to replicate the same intermediate insertion states as in the full phospholipid bilayer, however it accelerates overall insertion by approximately a factor of three, with the probability of successful association of phospholipid to the membrane being significantly enhanced. PMID:24313792

  18. DNA Insertions and Deletions in the Human Genome

    E-print Network

    Spang, Rainer

    T C C A A T AA C A Mutation rate µ Random Insertion A T TAA length l AA TCGAAA G A rate l + SegmentalDNA Insertions and Deletions in the Human Genome Philipp W. Messer #12;Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG |||||||:||||| ||||||||:|||| CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic

  19. A Novel Manipulator for Percutaneous Needle Insertion: Design and Experimentation

    Microsoft Academic Search

    Harmanpreet S. Bassan; Rajni V. Patel; Mehrdad Moallem

    2009-01-01

    In this paper, we present the design of a novel 5-DOF manipulator for percutaneous needle insertion. The requirements of the manipulator have been instigated by a relatively common medical procedure: low-dose rate brachytherapy of the prostate. The manipulator can perform orientation, insertion, and rotation of the needle and linear motion of the stylet to drop radioactive seeds contained in a

  20. Magnetically Inserted Neural Electrodes: Tissue Response and Functional Lifetime.

    PubMed

    Dryg, Ian D; Ward, Matthew P; Qing, Kurt Y; Mei, Henry; Schaffer, Jeremy E; Irazoqui, Pedro P

    2015-07-01

    Neural recording and stimulation have great clinical potential. Long-term neural recording remains a challenge, however, as implantable electrodes eventually fail due to the adverse effects of the host tissue response to the indwelling implant. Astrocytes and microglia attempt to engulf the electrode, increasing the electrical impedance between the electrode and neurons, and possibly pushing neurons away from the recording site. Faster insertion speed, finer tip geometry, smaller size, and lower material stiffness all seem to decrease damage caused by insertion and reduce the intensity of the tissue response. However, electrodes that are too small result in buckling, making insertion impossible. In this paper, we assess the viability of high-speed (27.8 m/s) deployment of 25 ?m, ferromagnetic microelectrodes into rat brain. To characterize functionality of magnetically inserted electrodes, 4 Long-Evans rats were implanted for 31 days with impedance measurements and neural recordings taken daily. Performance was compared to 150 ?m diameter PlasticsOne electrodes since 25 ?m electrodes buckled during "slow speed" insertion. Platinum-iron magnetically inserted electrodes resolved single unit activity throughout the duration of the study in one rat, and saw no significant change (p=0.970) in impedance (4.54% increase) from day 0 (Z0 ? 144 k?,Z31 ? 150 k?). These findings provide a proof-of-concept for magnetic insertion as a viable insertion method that enables nonbuckling implantation of small (25 ?m) microelectrodes, with potential for neural recording applications. PMID:25706720

  1. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Toronto, University of

    the date of receipt and acceptance should be inserted later Abstract Models based on stochasticNoname manuscript No. (will be inserted by the editor) Adaptive time-stepping for the strong numerical solution of stochastic differential equations Silvana Ilie · Kenneth R. Jackson · Wayne H. Enright

  2. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    Noname manuscript No. (will be inserted by the editor) Energy-preserving integrators for stochastic Poisson systems D. Cohen and G. Dujardin the date of receipt and acceptance should be inserted later Abstract A new class of energy-preservingnumerical schemes for stochastic Hamil- tonian systems with non

  3. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    should be inserted later Abstract We observe a stochastic process where a convolution productNoname manuscript No. (will be inserted by the editor) On adaptive wavelet estimation of an unknown function and a known function is corrupted by Gaussian noise. We wish to estimate the squared L2

  4. Insertable biplanar gradient coils for magnetic resonance imaging

    Microsoft Academic Search

    M. A. Martens; L. S. Petropoulos; R. W. Brown; J. H. Andrews; M. A. Morich; J. L. Patrick

    1991-01-01

    Insertable planar gradient coils offer the potential for significant performance increases in magnetic resonance imaging through higher gradient strength and shorter rise times. Using variational methods to minimize inductance, and thereby to optimize switching speeds, we have analyzed and constructed a biplanar y-gradient coil for insertion into a solenoidal magnet system where z is the magnet axis. We have also

  5. Mechanisms of insertional mutagenesis in human genes causing genetic disease

    Microsoft Academic Search

    David N. Cooper; Michael Krawczak

    1991-01-01

    Examples of the insertion of < 10 bp of DNA sequence into human gene-coding regions causing genetic disease were collated in order to study the underlying causative mechanisms. The nature of these insertions was found to be consistent with several mechanisms of mutagenesis including: (1) slipped mispairing mediated by direct repeats or runs of identical bases and (2) the templated

  6. Insertional Mutagenesis of Drosophila Heterochromatin with Single P Elements

    Microsoft Academic Search

    Ping Zhang; Allan C. Spradling

    1994-01-01

    Insertional mutagenesis with transposable P elements has greatly facilitated the identification and analysis of genes located throughout the 70% of the Drosophila melanogaster genome classified as euchromatin. In contrast, genetically marked P elements have only rarely been shown to transpose into heterochromatin. By carrying out single P element insertional mutagenesis under conditions where position-effect variegation was suppressed, we efficiently generated

  7. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    E-print Network

    Cui, Yi

    Lithium Insertion In Silicon Nanowires: An ab Initio Study Qianfan Zhang, Wenxing Zhang, Wenhui Wan, and § School of Physics, Peking University, Beijing 100871, China ABSTRACT The ultrahigh specific lithium ion opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains

  8. Simultaneous Shield Insertion and Net Ordering for Capacitive and

    E-print Network

    He, Lei

    Simultaneous Shield Insertion and Net Ordering for Capacitive and Inductive Coupling Minimization Outline 1. Previous net ordering and shielding work 2. SINO problem formulations 3. SINO problem. Lepak, University of Wisconsin n Noise avoidance techniques: n Net ordering n Shield insertion

  9. Interactive needle insertions in 3D nonlinear material

    E-print Network

    Utrecht, Universiteit

    refinement scheme. This approach can also be applied to both the 3D situation and nonlinear material modelsInteractive needle insertions in 3D nonlinear material Han-Wen Nienhuys A. Frank van der Stappen.cs.uu.nl #12;Interactive needle insertions in 3D nonlinear material Han-Wen Nienhuys and A. Frank van der

  10. Master Thesis: Simulation of plastic deformation in cemented carbide inserts

    E-print Network

    Haviland, David

    Master Thesis: Simulation of plastic deformation in cemented carbide inserts Background Sandvik in cemented carbide, high-speed steel and other hard materials such as diamond, cubic boron nitride in cemented carbide inserts will be performed using the FEM software Ansys and AdvantEdge. The work

  11. Gas turbine nozzle vane insert and methods of installation

    DOEpatents

    Miller, William John (Simpsonville, SC); Predmore, Daniel Ross (Clifton Park, NY); Placko, James Michael (West Chester, OH)

    2002-01-01

    A pair of hollow elongated insert bodies are disposed in one or more of the nozzle vane cavities of a nozzle stage of a gas turbine. Each insert body has an outer wall portion with apertures for impingement-cooling of nozzle wall portions in registration with the outer wall portion. The insert bodies are installed into the cavity separately and spreaders flex the bodies toward and to engage standoffs against wall portions of the nozzle whereby the designed impingement gap between the outer wall portions of the insert bodies and the nozzle wall portions is achieved. The spreaders are secured to the inner wall portions of the insert bodies and the bodies are secured to one another and to the nozzle vane by welding or brazing.

  12. Method for improving the durability of ion insertion materials

    DOEpatents

    Lee, Se-Hee (Lakewood, CO); Tracy, C. Edwin (Golden, CO); Cheong, Hyeonsik M. (Seoul, KR)

    2002-01-01

    The invention provides a method of protecting an ion insertion material from the degradative effects of a liquid or gel-type electrolyte material by disposing a protective, solid ion conducting, electrically insulating, layer between the ion insertion layer and the liquid or gel-type electrolyte material. The invention further provides liquid or gel-type electrochemical cells having improved durability having a pair of electrodes, a pair of ion insertion layers sandwiched between the pair of electrodes, a pair of solid ion conducting layers sandwiched between the ion insertion layers, and a liquid or gel-type electrolyte material disposed between the solid ion conducting layers, where the solid ion conducting layer minimizes or prevents degradation of the faces of the ion insertion materials facing the liquid or gel-type electrolyte material. Electrochemical cells of this invention having increased durability include secondary lithium batteries and electrochromic devices.

  13. ccsd-00005367,version1-26Jan2006 Astronomy & Astrophysics manuscript no. hhveljun05.hyper19907 January 26, 2006 (DOI: will be inserted by hand later)

    E-print Network

    Paris-Sud XI, Université de

    in the inner layers of the Horsehead nebula. The data reveal a non­self-gravitating (m/mvir 0.3) filament ­ individual objects (Horsehead nebula) ­ Stars: Formation ­ Radio lines: ISM 1. Introduction Dense molecular January 26, 2006 (DOI: will be inserted by hand later) Velocity field and star formation in the Horsehead

  14. Design of Revolute Joints for In-Mold Assembly Using Insert Molding.

    PubMed

    Ananthanarayanan, Arvind; Ehrlich, Leicester; Desai, Jaydev P; Gupta, Satyandra K

    2011-12-01

    Creating highly articulated miniature structures requires assembling a large number of small parts. This is a very challenging task and increases cost of mechanical assemblies. Insert molding presents the possibility of creating a highly articulated structure in a single molding step. This can be accomplished by placing multiple metallic bearings in the mold and injecting plastic on top of them. In theory, this idea can generate a multi degree of freedom structures in just one processing step without requiring any post molding assembly operations. However, the polymer material has a tendency to shrink on top of the metal bearings and hence jam the joints. Hence, until now insert molding has not been used to create articulated structures. This paper presents a theoretical model for estimating the extent of joint jamming that occurs due to the shrinkage of the polymer on top of the metal bearings. The level of joint jamming is seen as the effective torque needed to overcome the friction in the revolute joints formed by insert molding. We then use this model to select the optimum design parameters which can be used to fabricate functional, highly articulating assemblies while meeting manufacturing constraints. Our analysis shows that the strength of weld-lines formed during the in-mold assembly process play a significant role in determining the minimum joint dimensions necessary for fabricating functional revolute joints. We have used the models and methods described in this paper to successfully fabricate the structure for a minimally invasive medical robot prototype with potential applications in neurosurgery. To the best of our knowledge, this is the first demonstration of building an articulated structure with multiple degrees of freedom using insert molding. PMID:23904746

  15. Force of cochlear implant electrode insertion performed by a robotic insertion tool: comparison of traditional versus Advance

    E-print Network

    Simaan, Nabil

    Force of cochlear implant electrode insertion performed by a robotic insertion tool: comparison Medical Center, Nashville, TN, robert.labadie@vanderbilt.edu Abstract Objective--Robotic cochlear implant design--Prospective. Setting--Tertiary referral center. Intervention(s)--A robotic cochlear implant

  16. High-voltage subnanosecond pulse transformer composed of parallel-strip transmission lines

    Microsoft Academic Search

    Akira Homma

    1999-01-01

    A subnanosecond pulse isolation transformer composed of a parallel-strip transmission line was designed, constructed, and tested. The insertion loss and effective time constant of the transformer were calculated with transmission line analysis. To facilitate the analysis, the reflection diagram method was applied. The experiments indicate that the transformer can transmit subnanosecond rise time pulses across a potential difference of 100

  17. Design of compact LTCC bandpass filter with high process tolerance using meander line coupled inductor

    Microsoft Academic Search

    Shuwei Yang; Yali Qin; Zhefu Wu; Suming Zhuang

    2010-01-01

    A compact second-order bandpass filter using low temperature co-fired ceramic (LTCC) technology is proposed. To get more stable and smaller dimension bandpass filter with high process tolerate at insertion loss of passband and bandwidth for better yield, the traditional straight line coupled inductor instead by meander line coupled inductor. The EM simulation show that the performance of the filter using

  18. Complete association between a retroviral insertion in the tyrosinase gene and the recessive white mutation in chickens

    PubMed Central

    Chang, Chung-Ming; Coville, Jean-Luc; Coquerelle, Gérard; Gourichon, David; Oulmouden, Ahmad; Tixier-Boichard, Michèle

    2006-01-01

    Background In chickens, three mutant alleles have been reported at the C locus, including the albino mutation, and the recessive white mutation, which is characterized by white plumage and pigmented eyes. The albino mutation was found to be a 6 bp deletion in the tyrosinase (TYR) gene. The present work describes an approach to identify the structural rearrangement in the TYR gene associated with the recessive white mutation. Results Molecular analysis of the chicken TYR gene has revealed a major structural difference (Restriction Fragment Length Polymorphism, RFLP) in the genomic DNA of the recessive white chicken. A major size difference of 7.7 kb was found in intron 4 of the TYR gene by long-range PCR. Molecular cloning and sequencing results showed the insertion of a complete avian retroviral sequence of the Avian Leukosis Virus (ALV) family. Several aberrant transcripts of the tyrosinase gene were found in 10 week old recessive white chickens but not in the homozygous wild type colored chicken. We established a rapid genotyping diagnostic test based on the discovery of this retroviral insertion. It shows that all homozygous carriers of this insertion had a white plumage in various chicken strains. Furthermore, it was possible to distinguish heterozygous carriers from homozygous normal chickens in a segregating line. Conclusion In this study, we conclude that the insertion of a complete avian retroviral sequence in intron 4 of the tyrosinase gene is diagnostic of the recessive white mutation in chickens. This insertion causes aberrant transcripts lacking exon 5, and we propose that this insertion is the causal mutation for the recessive white allele in the chicken. PMID:16457736

  19. Line Scanners Basic line-scanner principle

    E-print Network

    Giger, Christine

    to the ground coordinate system · NB: satellite line scanners · line scanners are especially popularLine Scanners #12;Principle · Basic line-scanner principle #12;Principle · Sensor · single CCD line oriented perpendicular to the scanning (=flight) direction, often called "pushbroom scanner" · Scanning

  20. Gene Transfer and Genome-Wide Insertional Mutagenesis by Retroviral Transduction in Fish Stem Cells

    PubMed Central

    Liu, Qizhi; Wang, Yunzhi; Lin, Fan; Zhang, Lei; Li, Yan; Ge, Ruowen; Hong, Yunhan

    2015-01-01

    Retrovirus (RV) is efficient for gene transfer and integration in dividing cells of diverse organisms. RV provides a powerful tool for insertional mutagenesis (IM) to identify and functionally analyze genes essential for normal and pathological processes. Here we report RV-mediated gene transfer and genome-wide IM in fish stem cells from medaka and zebrafish. Three RVs were produced for fish cell transduction: rvLegfp and rvLcherry produce green fluorescent protein (GFP) and mCherry fluorescent protein respectively under control of human cytomegalovirus immediate early promoter upon any chromosomal integration, whereas rvGTgfp contains a splicing acceptor and expresses GFP only upon gene trapping (GT) via intronic in-frame integration and spliced to endogenous active genes. We show that rvLegfp and rvLcherry produce a transduction efficiency of 11~23% in medaka and zebrafish stem cell lines, which is as 30~67% efficient as the positive control in NIH/3T3. Upon co-infection with rvGTgfp and rvLcherry, GFP-positive cells were much fewer than Cherry-positive cells, consistent with rareness of productive gene trapping events versus random integration. Importantly, rvGTgfp infection in the medaka haploid embryonic stem (ES) cell line HX1 generated GTgfp insertion on all 24 chromosomes of the haploid genome. Similar to the mammalian haploid cells, these insertion events were presented predominantly in intergenic regions and introns but rarely in exons. RV-transduced HX1 retained the ES cell properties such as stable growth, embryoid body formation and pluripotency gene expression. Therefore, RV is proficient for gene transfer and IM in fish stem cells. Our results open new avenue for genome-wide IM in medaka haploid ES cells in culture. PMID:26029933

  1. Structural basis for outer membrane lipopolysaccharide insertion.

    PubMed

    Dong, Haohao; Xiang, Quanju; Gu, Yinghong; Wang, Zhongshan; Paterson, Neil G; Stansfeld, Phillip J; He, Chuan; Zhang, Yizheng; Wang, Wenjian; Dong, Changjiang

    2014-07-01

    Lipopolysaccharide (LPS) is essential for most Gram-negative bacteria and has crucial roles in protection of the bacteria from harsh environments and toxic compounds, including antibiotics. Seven LPS transport proteins (that is, LptA-LptG) form a trans-envelope protein complex responsible for the transport of LPS from the inner membrane to the outer membrane, the mechanism for which is poorly understood. Here we report the first crystal structure of the unique integral membrane LPS translocon LptD-LptE complex. LptD forms a novel 26-stranded ?-barrel, which is to our knowledge the largest ?-barrel reported so far. LptE adopts a roll-like structure located inside the barrel of LptD to form an unprecedented two-protein 'barrel and plug' architecture. The structure, molecular dynamics simulations and functional assays suggest that the hydrophilic O-antigen and the core oligosaccharide of the LPS may pass through the barrel and the lipid A of the LPS may be inserted into the outer leaflet of the outer membrane through a lateral opening between strands ?1 and ?26 of LptD. These findings not only help us to understand important aspects of bacterial outer membrane biogenesis, but also have significant potential for the development of novel drugs against multi-drug resistant pathogenic bacteria. PMID:24990744

  2. Phoenix Conductivity Probe Inserted into Martian Soil

    NASA Technical Reports Server (NTRS)

    2008-01-01

    NASA's Phoenix Mars Lander inserted the four needles of its thermal and conductivity probe into Martian soil during the 98th Martian day, or sol, of the mission and left it in place until Sol 99 (Sept. 4, 2008).

    The Robotic Arm Camera on Phoenix took this image on the morning of Sol 99 while the probe's needles were in the ground. The science team informally named this soil target 'Gandalf.'

    The thermal and conductivity probe measures how fast heat and electricity move from one needle to an adjacent one through the soil or air between the needles. Conductivity readings can be indicators about water vapor, water ice and liquid water.

    The probe is part of Phoenix's Microscopy, Electrochemistry and Conductivity suite of instruments.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  3. Construction of a new universal vector for insertional mutagenesis by homologous recombination.

    PubMed

    Chauhan, S S; Gottesman, M M

    1992-10-21

    We describe here the construction of a vector (pSSC-9) which can be used for the insertional mutagenesis of any gene for which genomic sequences have been cloned. This vector contains a neomycin-resistance-encoding gene (neoR) which is driven by a modified thymidine kinase (tk) promoter for positive selection. Flanking neoR are two tk genes driven by their own promoters for negative selection of nonhomologous insertions. The neoR and tk cassettes are separated by four unique cloning sites on the right-hand side of the neoR cassette and three unique sites on the left-hand side. The vector also includes two SfiI sites, one on each side of the tk cassettes, for the excision of the cloned genomic DNA fragments along with the selectable markers. Electroporation of pSSC-9 into mouse embryonic stem (ES) cells and cultured diploid mouse adrenal Y-1 cells conferred resistance to G418 and sensitivity to ganciclovir in both cell lines. These results illustrate the expression of the positive and negative selectable markers in two different cell lines and thus suggest that the vector could be used in ES cells, as well as in cultured somatic cells. PMID:1327975

  4. Viral insertion in Evi12 causes expression of aberrant Grp94 mRNAs containing the viral gag myristylation motif

    SciTech Connect

    Akker, Eric van den; Aarts, Lambertus H.J. [Department of Hematology, Erasmus University Medical Center, Dr. Molewaterplein 50, 3015 GE Rotterdam (Netherlands); Delwel, Ruud [Department of Hematology, Erasmus University Medical Center, Dr. Molewaterplein 50, 3015 GE Rotterdam (Netherlands)], E-mail: h.delwel@erasmusmc.nl

    2007-09-30

    Ecotropic Virus Integration site 12 (Evi12) is a common virus insertion site (cVIS) in retrovirally induced murine models of leukemia and lymphoma, suggesting an important role for this locus in these hematopoietic disorders. Evi12 is located near the promoter of the ER chaperone protein and Hsp90 family member Grp94. Here we show that viral insertion in Evi12 results in the expression of aberrant Grp94 transcripts in Cas-Br-MuLV as well as in AKXD induced hematopoietic tumors, demonstrating that Grp94 is a common viral target gene. While most transcripts encode for truncated forms of Grp94, transcripts containing viral gag sequences were detected in the leukemia cell line NFS107. Interestingly, these fusion transcripts encode for myristylated viral-Grp94 fusion proteins that localize to the plasma membrane. Combined with recent evidence that myristylated forms of Hsp90 transform cells, our data suggest that myristylation of target genes may be an important mechanism in retrovirally mediated oncogenesis. Since retroviral insertion in Evi12 also affects the expression of a recently identified novel gene Grp94 neighboring nucleotidase (Gnn), located at the other side of Evi12, it appears that proviral insertion can lead to deregulation of two genes present in the same locus.

  5. Experimental Analysis of Reduced-Sized Coplanar Waveguide Transmission Lines

    NASA Technical Reports Server (NTRS)

    Ponchak, George E.

    2002-01-01

    An experimental investigation of the use of capacitive loading of coplanar waveguides to reduce their line length and, thus the size, of monolithic microwave integrated circuits is presented. The reduced sized coplanar waveguides are compared to unloaded transmission lines and to lumped element transmission line segments. The phase bandwidth, defined by 2 percent error in S(sub 21), and the return loss bandwidth, defined by a return loss greater than 15 dB, of coplanar waveguides reduced from 0 to 90 percent are compared, and the insertion loss as a function of the size reduction is presented.

  6. Error compensation in insertion-region magnets

    SciTech Connect

    Wei, Jie

    1995-12-31

    In heavy ion storage rings, intra-beam scattering (IBS) between high charge state ions results in a large beam emittance during storage. The ultimate machine performance depends on achieving the highest possible magnetic field quality and alignment accuracy in the insertion-region (IR) triplet magnets during low-{beta} operation when the beam size is the largest in the triplets. Therefore, effective compensation of magnet construction errors and misalignments is crucial. Heavy-ion beams (Au{sup 79+} will be accelerated and stored for 10 hours in the Relativistic Heavy Ion Collider (RHIC) at the energy of 100 GeV/u in two separated rings consisting of superconducting magnets. Due to strong IBS, the transverse beam emittance grows from 10{pi} mm-mr at injection to more than 40{pi} mm-mr at storage. Dipoles and riplets of quadrupoles of large bore are placed on both sides of the six interaction points (IP). In order to maximize the luminosity at two IPs with proposed experiments, the nearby triplets are designed to enable the collision {beta}-function to be reduced to {beta} = 1 m. Consequently, the rms transverse beam size becomes large at the triplets ({beta}{sub max} = 1400 m), increasing from {sigma} = 2.3 mm to 4.7 mm during the period of storage. At the end of storage, the 5{sigma} beam size becomes about 71% of the coil radius (65 mm). The goal if IR triplet error compensation is to ensure satisfactory magnetic field quality and beam long-term stability up to this 5{sigma} radius.

  7. Insertion Paddlewheel Flowmeters: An Evaluation After Two Years of Use 

    E-print Network

    Robinson, J.; Bryant, J.; Turner, W. D.

    1993-01-01

    Insertion paddlewheel flowmeters were removed from field installations after 12 to 24 months of service for inspection and calibration. The tests were designed to identify meter degradation because of scale and debris on the paddlewheel and...

  8. Analysis of Early-Insertion Standard Coalesced Hashing

    E-print Network

    Chen, Wen-Chin; Vitter, Jeffrey Scott

    1983-01-01

    This paper analyzes the early-insertion standard coalesced hashing method (EISCH), which is a variant of the standard coalesced hashing algorithm (SCH) described in [Knu73], [Vit80] and [Vit82b]. The analysis answers the ...

  9. RSK Insertion for Set Partitions and Diagram Algebras

    E-print Network

    Halverson, Tom

    RSK Insertion for Set Partitions and Diagram Algebras Tom Halverson and Tim Lewandowski Department of Mathematics and Computer Science Macalester College, Saint Paul, MN 55105 USA halverson@macalester.edu tim

  10. Multimedia Systems Manuscript Nr. (will be inserted by hand later)

    E-print Network

    Eleftheriadis, Alexandros

    Multimedia Systems Manuscript Nr. (will be inserted by hand later) Silence detection for multimedia algorithms are required in order to maintain QoS. As an example, the large delay variation (jitter) that may

  11. Insertion device magnet measurements for the Advanced Light Source

    SciTech Connect

    Marks, S.; Cork, C.; Hoyer, E.; Humphries, D.; Kincaid, B.; Plate, D.; Robb, A.; Schlueter, R.; Wang, C. [Lawrence Berkeley Lab., CA (United States); Hassenzahl, W. [Lawrence Livermore National Lab., CA (United States)

    1993-05-01

    Allowable magnetic field errors for the 4.6 m long insertion devices for the Advanced Light Source (ALS) are extremely small and are driven by electron beam and radiation requirements. Detailed measurements and adjustments of each insertion device are performed to qualify them for installation in the ALS. To accomplish this, a high speed, precision magnetic measurement facility has been designed and built. Hall probe mapping equipment, capable of completing a 2500 sample, 6 m scan with precision axial position monitoring using a laser interferometer in under one minute, is used to obtain both local and integrated field information. A 5.5 m long, 1 cm wide coil is used to measure the field integral through an entire insertion device. This paper describes magnetic measurement equipment, and results of measurements on IDA, the first of the ALS insertion devices.

  12. Pressure molding of powdered materials improved by rubber mold insert

    NASA Technical Reports Server (NTRS)

    1964-01-01

    Pressure molding tungsten microspheres is accomplished by applying hydraulic pressure to a silicone rubber mold insert with several barrel shaped chambers which is placed in a steel die cavity. This technique eliminates castings containing shear fractures.

  13. PET Performance Evaluation of an MR-Compatible PET Insert

    Microsoft Academic Search

    Yibao Wu; Ciprian Catana; Richard Farrell; Purushottam A. Dokhale; Kanai S. Shah; Jinyi Qi; Simon R. Cherry

    2009-01-01

    A magnetic resonance (MR) compatible positron emission tomography (PET) insert has been developed in our laboratory for simultaneous small animal PET\\/MR imaging. This system is based on lutetium oxyorthosilicate (LSO) scintillator arrays with position-sensitive avalanche photodiode (PSAPD) photodetectors. The PET performance of this insert has been measured. The average reconstructed image spatial resolution was 1.51 mm. The sensitivity at the

  14. Production Recesses for Replaceable Cutting Inserts of Milling Tools

    NASA Astrophysics Data System (ADS)

    Kousal, Lukáš; Sadílek, Marek

    2014-12-01

    This article describes the production of recesses for replaceable cutting inserts of milling tools. The recess manufacture is exemplified on a D20 shanktype milling cutter with three replaceable cutting inserts. A new production technology and its operating cycle are demonstrated. A com-parison of the old and the new technologies shows the percentage saving of change cycles and used tools, including overall evaluation of the tech-nology.

  15. Deep electrode insertion and sound coding in cochlear implants.

    PubMed

    Hochmair, Ingeborg; Hochmair, Erwin; Nopp, Peter; Waller, Melissa; Jolly, Claude

    2015-04-01

    Present-day cochlear implants demonstrate remarkable speech understanding performance despite the use of non-optimized coding strategies concerning the transmission of tonal information. Most systems rely on place pitch information despite possibly large deviations from correct tonotopic placement of stimulation sites. Low frequency information is limited as well because of the constant pulse rate stimulation generally used and, being even more restrictive, of the limited insertion depth of the electrodes. This results in a compromised perception of music and tonal languages. Newly available flexible long straight electrodes permit deep insertion reaching the apical region with little or no insertion trauma. This article discusses the potential benefits of deep insertion which are obtained using pitch-locked temporal stimulation patterns. Besides the access to low frequency information, further advantages of deeply inserted long electrodes are the possibility to better approximate the correct tonotopic location of contacts, the coverage of a wider range of cochlear locations, and the somewhat reduced channel interaction due to the wider contact separation for a given number of channels. A newly developed set of strategies has been shown to improve speech understanding in noise and to enhance sound quality by providing a more "natural" impression, which especially becomes obvious when listening to music. The benefits of deep insertion should not, however, be compromised by structural damage during insertion. The small cross section and the high flexibility of the new electrodes can help to ensure less traumatic insertions as demonstrated by patients' hearing preservation rate. This article is part of a Special Issue entitled . PMID:25456089

  16. Lithium isotope effect accompanying electrochemical insertion of lithium into gallium

    Microsoft Academic Search

    Keita Zenzai; Satoshi Yanase; Yong-Hong Zhang; Takao Oi

    2008-01-01

    Lithium has been electrochemically inserted from a 1:2 (v\\/v) mixed solution of ethylene carbonate (EC) and methylethyl carbonate (MEC) containing 1M LiClO4 or from dimethyl sulfoxide (DMSO) containing 1M LiCl into gallium, and the lithium isotope fractionation accompanying the insertion has been observed. The lighter isotope was preferentially fractionated into gallium, which was in accordance with the theory of the

  17. Tool Insert Wear Classification Using Statistical Descriptors and Neuronal Networks

    Microsoft Academic Search

    Enrique Alegre; Rocío Aláiz; Joaquín Barreiro; M. Viñuela

    2005-01-01

    \\u000a The goal of this work is to automatically determine the level of tool insert wear based on images acquired using a vision\\u000a system. Experimental wear was carried out by machining AISI SAE 1045 and 4140 steel bars in a precision CNC lathe and using\\u000a Sandvik inserts of tungsten carbide. A Pulnix PE2015 B\\/W with an optic composed by an industrial

  18. Helix insertion into bilayers and the evolution of membrane proteins

    Microsoft Academic Search

    Robert Renthal

    2010-01-01

    Polytopic ?-helical membrane proteins cannot spontaneously insert into lipid bilayers without assistance from polytopic ?-helical\\u000a membrane proteins that already reside in the membrane. This raises the question of how these proteins evolved. Our current\\u000a knowledge of the insertion of ?-helices into natural and model membranes is reviewed with the goal of gaining insight into\\u000a the evolution of membrane proteins. Topics

  19. Micro injection molding for mass production using LIGA mold inserts

    Microsoft Academic Search

    Takanori Katoh; Ryuichi Tokuno; Yanping Zhang; Masahiro Abe; Katsumi Akita; Masaharu Akamatsu

    2008-01-01

    Micro molding is one of key technologies for mass production of polymer micro parts and structures with high aspect ratios.\\u000a The authors developed a commercially available micro injection molding technology for high aspect ratio microstructures (HARMs)\\u000a with LIGA-made mold inserts and pressurized CO2 gasses. The test inserts made of nickel with the smallest surface details of 5 ?m with structural height

  20. Review of valve seat insert material properties required for success

    SciTech Connect

    Strong, G.; Liang, X. [Winsert, Inc., Marinette, WI (United States)

    1997-12-31

    Valve seat inserts require unique properties to provide satisfactory wear resistance in the harsh thermal and chemical environment of the engine combustion chamber. An introductory review is given of the mechanical forces, the environment involved and the wear mechanisms associated with insert wear. The material properties required to succeed in this environment include hot hardness, corrosion resistance, adhesion and abrasion resistance. The physical properties of several common insert iron, nickel, and cobalt base materials are reviewed along with the means of measuring their capabilities. Much of the success of the material depends on the type, distribution and volume percentage of carbides or laves phase in the material. MC type carbides provide the greatest thermal stability, followed by various levels of carbide types. The base material must provide hot strength, resistance to bonding, and toughness to resist microfracturing. The surface film formed must be strong and provide some lubricity to reduce wear between the sliding valve and insert surfaces. Valve seat inserts are designed to provide wear resistance in an environment subject to corrosion at moderate to high temperatures of approximately 204 to 538{degrees}C (400 to 1000{degrees}F). They must also have a thermal expansion rate similar to the engine head counterbore to minimize retention problems and be produced at a reasonable cost. The inserts must also be compatible with the valves that they are coupled with so that the two components will exceed the warranty service requirement of the engine.

  1. Antibiotics Before Removal of Percutaneously Inserted Central Venous Catheters Reduces Clinical Sepsis in Premature Infants

    PubMed Central

    Reynolds, Gail E.; Tierney, Sarah B.

    2015-01-01

    OBJECTIVES: Evaluate the incidence of postcatheter removal clinical sepsis when antibiotics were infused prior to the removal of percutaneously inserted central venous catheters (PICCs). METHODS: A retrospective chart review of premature neonates (n = 196) weighing ?1250 g at birth with 218 PICC line removals in the presence or absence of antibiotics at a tertiary level neonatal intensive care unit (NICU) between January 1, 2010, and May 31, 2012. Charts were reviewed looking for the presence of clinical sepsis defined as a sepsis workup including white blood cell count, differential, C-reactive protein, blood and/or cerebral spinal fluid (CSF), and urine cultures along with at least 48 hours of antibiotic therapy given within 72 hours after removal of a PICC line. Antibiotics were considered present at line removal if given within 12 hours before catheter removal either electively or at completion of a planned course. RESULTS: When antibiotics were given within 12 hours before PICC line removal, only 2% of the line removal episodes (1/48) resulted in a neonate developing clinical sepsis versus 13% (21/165) when no antibiotics were given prior to removal (p = 0.03, Fisher's exact test). Despite the increased use of elective antibiotics with line removal, there was no increase in total antibiotic usage due to the overall decrease in episodes of clinical sepsis or changes in antibiogram susceptibility patterns. CONCLUSIONS: There was an 11% absolute decrease and a 6-fold relative decrease in postcatheter removal clinical sepsis events in premature neonates who received antibiotics prior to PICC line removal.

  2. Polar Lines

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Context image for PIA03597 Polar Lines

    This linear features near the South Polar Cap appeared during the height of southern summer.

    Image information: VIS instrument. Latitude 79.7S, Longitude 249.1E. 17 meter/pixel resolution.

    Note: this THEMIS visual image has not been radiometrically nor geometrically calibrated for this preliminary release. An empirical correction has been performed to remove instrumental effects. A linear shift has been applied in the cross-track and down-track direction to approximate spacecraft and planetary motion. Fully calibrated and geometrically projected images will be released through the Planetary Data System in accordance with Project policies at a later time.

    NASA's Jet Propulsion Laboratory manages the 2001 Mars Odyssey mission for NASA's Office of Space Science, Washington, D.C. The Thermal Emission Imaging System (THEMIS) was developed by Arizona State University, Tempe, in collaboration with Raytheon Santa Barbara Remote Sensing. The THEMIS investigation is led by Dr. Philip Christensen at Arizona State University. Lockheed Martin Astronautics, Denver, is the prime contractor for the Odyssey project, and developed and built the orbiter. Mission operations are conducted jointly from Lockheed Martin and from JPL, a division of the California Institute of Technology in Pasadena.

  3. Compact planar 3-way power divider using left handed transmission lines

    Microsoft Academic Search

    K. W. Eccleston

    2005-01-01

    In this paper, we propose a three-way planar fork power divider that has its ports located on a straight line. To achieve equal phase output ports, transmission lines are inserted between the fork divider and two of the output ports. To reduce circuit size without the need for meandering, left-handed transmission lines are also used. Simulations of a 3-way microstripline

  4. Iatrogenic pseudoaneurysm of the brachiocephalic artery: a rare complication of Hickman line insertion

    Microsoft Academic Search

    Glykeria Petrocheilou; Constantinos Kokkinis; Sotiria Stathopoulou; Loukia Fragopoulou; Petros Mihos; Paraskevi J. Papadaki; Marianna Vlychou

    2008-01-01

    Central venous catheterization is widely used for hemodialysis for patients with renal failure. A number of short and long-term\\u000a complications have been reported in literature. We describe a rare case of a lethal iatrogenic injury of the brachiocephalic\\u000a artery (BA) in a 65-year-old woman following subclavian venous catheterization with a Hickman catheter. Contrast-enhanced\\u000a CT-scan and reconstruction images demonstrated a pseudoaneurysm

  5. Molecular characterization of grapevine plants transformed with GFLV resistance genes: I.

    PubMed

    Gambino, Giorgio; Gribaudo, Ivana; Leopold, Stephan; Schartl, Angelica; Laimer, Margit

    2005-12-01

    The Grapevine FanLeaf Virus-Coat Protein (GFLV CP) gene was inserted through Agrobacterium-mediated transformation in Vitis vinifera "Nebbiolo", "Lumassina" and "Blaufränkisch". Two plasmids were used: pGA-CP+ (full-length GFLV CP gene with an introduced start codon) and pGA-AS (same gene in antisense orientation). Forty-three transgenic lines were regenerated. As several lines in Southern blots share same hybridization patterns, eight independent line groups resulted for "Nebbiolo", one for "Lumassina", and two for "Blaufränkisch". Inserted T-DNA copies ranged from one to three; one line probably contains an incomplete copy of T-DNA. Except for one "Nebbiolo" line, no evidence for methylation of the transgene at cytosine residues was found by Southern analyses. Specific mRNA was present at variable expression levels; some lines accumulated the coat protein while in others the protein was not detectable by ELISA. PMID:16240119

  6. Effects of sample probe insertion on plasma conditions in direct sample insertion-inductively coupled plasma-atomic emission spectrometry

    Microsoft Academic Search

    George C.-Y Chan; Mau-Nam Fan; Wing-Tat Chan

    2001-01-01

    The effects of sample probe insertion on plasma excitation conditions in direct sample insertion-inductively coupled plasma-atomic emission spectrometry (DSI-ICP-AES) were investigated. Graphite sample probes in the form of a cup and a rod (with or without undercut) were used. Molybdenum rods were also used for comparison. A dark central channel is created in the plasma when a sample probe is

  7. Definition of Metrics to Evaluate Cochlear Array Insertion Forces Performed with Forceps, Insertion Tool, or Motorized Tool in Temporal Bone Specimens

    PubMed Central

    Ferrary, Evelyne; Sterkers, Olivier

    2014-01-01

    Introduction. In order to achieve a minimal trauma to the inner ear structures during array insertion, it would be suitable to control insertion forces. The aim of this work was to compare the insertion forces of an array insertion into anatomical specimens with three different insertion techniques: with forceps, with a commercial tool, and with a motorized tool. Materials and Methods. Temporal bones have been mounted on a 6-axis force sensor to record insertion forces. Each temporal bone has been inserted, with a lateral wall electrode array, in random order, with each of the 3 techniques. Results. Forceps manual and commercial tool insertions generated multiple jerks during whole length insertion related to fits and starts. On the contrary, insertion force with the motorized tool only rose at the end of the insertion. Overall force momentum was 1.16 ± 0.505?N (mean ± SD, n = 10), 1.337 ± 0.408?N (n = 8), and 1.573 ± 0.764?N (n = 8) for manual insertion with forceps and commercial and motorized tools, respectively. Conclusion. Considering force momentum, no difference between the three techniques was observed. Nevertheless, a more predictable force profile could be observed with the motorized tool with a smoother rise of insertion forces. PMID:25126565

  8. The Smooth Muscle Myosin Seven Amino Acid Heavy Chain Insert's Kinetic Role in the Crossbridge Cycle for Mouse Bladder

    PubMed Central

    Karagiannis, Peter; Babu, Gopal J; Periasamy, Muthu; Brozovich, Frank V

    2003-01-01

    The seven amino acid insert in the smooth muscle myosin heavy chain is thought to regulate the kinetics of contraction, contributing to the differences between fast and slow smooth muscle. The effects of this insert on force and stiffness were determined in bladder tissue of a transgenic mouse line expressing the insert SMB at one of three levels: an SMB wild type (+/+), an SMA homozygous type (?/?) and a heterozygous type (+/?). For skinned muscle, an increase in MgADP or inorganic phosphate (Pi) should shift the distribution of crossbridges in the actomyosin ATPase (AMATPase) to increase the relative population of the crossbridge state prior to ADP release and Pi release, respectively. Exogenous ADP increased force and stiffness in a manner consistent with increasing the Ca2+ concentration in both the +/+ and +/? mouse types. However, the ?/? type showed a significantly greater increase in force than in stiffness suggesting that immediately prior to ADP release, the AMATPase either has an additional force producing isomerization state or a slower ADP dissociation rate for the ?/? type compared to the +/+ or +/? types. Exogenous Pi led to a significantly greater decrease in stiffness than in force for all three mouse types suggesting that there is a force producing state prior to Pi release. In addition, the increase in Pi showed similar changes in the +/+ and ?/? types whereas in the +/? type the decreases in both force and stiffness were greater than the other two mouse types indicating that the insert can affect the cooperativity between myosin heads. In conclusion, the seven amino acid insert modulates the kinetics and/or states of the AMATPase, which could lead to differences in the kinetics of contraction between fast and slow smooth muscle. PMID:12562924

  9. Palladium- and Nickel-Catalyzed Carbon–Carbon Bond Insertion Reactions with Alkylidenesilacyclopropanes

    PubMed Central

    Buchner, Kay M.; Woerpel, K. A.

    2010-01-01

    Palladium and nickel catalysts promoted highly selective carbon–carbon bond insertion reactions with di-tert-butyl-alkylidenesilacyclopropanes. Pd(PPh3)4 was demonstrated to be the optimal catalyst, allowing for a variety of carbon–carbon ?-bond insertion reactions. Depending on the nature of the carbon–carbon ? bond, the insertion reaction proceeded with either direct insertion into the carbon(sp2)–silicon bond or with allylic transposition. Ring-substituted alkylidenesilacyclopropanes required a nickel catalyst to afford insertion products. Using Ni(cod)2 as the carbon–carbon bond insertion catalyst, new double alkyne insertion products and alkene isomerization products were observed. PMID:20419110

  10. Enhanced EPR sensitivity from a ferroelectric cavity insert.

    PubMed

    Nesmelov, Y E; Surek, J T; Thomas, D D

    2001-11-01

    We report the development of a simple ferroelectric cavity insert that increases the electron paramagnetic resonance (EPR) sensitivity by an order of magnitude when a sample is placed within it. The insert is a hollow cylinder (length 4.8 mm, outside diameter 1.7 mm, inside diameter 0.6 mm) made from a single crystal of KTaO(3), which has a dielectric constant of 230 at X-band (9.5 GHz). Its outside dimensions were chosen to produce a resonant frequency in the X-band range, based on electromagnetic field modeling calculations. The insert increases the microwave magnetic field (H(1)) at the center of the insert by a factor of 7.4 when placed in an X-band TM(110) cavity. This increases the EPR signal for a small (volume 0.13 microL) unsaturated nitroxide spin label sample by a factor of 64 at constant microwave power, and by a factor of 9.8 at constant H(1). The insert does not significantly affect the cavity quality factor Q, indicating that this device simply redistributes the microwave fields within the cavity, focusing H(1) onto the sample inside the insert, thus increasing the filling factor. A similar signal enhancement is obtained in the TM(110) and TE(102) cavities, and when the insert is oriented either vertically (parallel to the microwave field) or horizontally (parallel to the DC magnetic field) in the TM(110) cavity. This order-of-magnitude sensitivity enhancement allows EPR spectroscopy to be performed in conventional high-Q cavities on small EPR samples previously only measurable in loop-gap or dielectric resonators. This is of particular importance for small samples of spin-labeled biomolecules. PMID:11700076

  11. Molecular characterization of grapevine plants transformed with GFLV resistance genes: II.

    PubMed

    Maghuly, Fatemeh; Leopold, Stephan; da Câmara Machado, Artur; Borroto Fernandez, Eduviges; Ali Khan, Mahmood; Gambino, Giorgio; Gribaudo, Ivana; Schartl, Angelika; Laimer, Margit

    2006-06-01

    A collection of 127 putatively transgenic individuals of Vitis vinifera cv. Russalka was characterized by PCR and Southern hybridization. Six different constructs containing the neomycin phosphotransferase (nptII) marker gene and sequences of the Grapevine Fanleaf Virus Coat Protein (GFLV CP) gene including non-translatable and truncated forms were transferred via Agrobacterium-mediated transformation. Detection of transgenic sequences by PCR was positive in all lines. Southern blot analysis revealed that the number of inserted T-DNA copies ranged from 1 to 6. More than 46% of the tested transgenic lines contain one copy of the inserted T-DNA, qualifying them as interesting candidates for further breeding programs. Southern data of one line indicate the presence of an incomplete copy of the T-DNA, thus confirming previous PCR results. Since many putative transgenic lines shared identical hybridization patterns, they were clustered into 39 lines and considered as having originated from independent transformation events. The detection of the tetracycline (TET) resistance genes in 15% of the lines shows that an integration of plasmid backbone sequences beyond the T-DNA borders occurred. Enzyme-linked immunosorbent assay (ELISA) performed on leaf tissue did not show any accumulation of the GFLV CP in the 39 transgenic lines analyzed. Reverse transcription polymerase chain reaction (RT-PCR) and Northern blot were carried out; RT-PCR analyses showed that the GFLV CP mRNA was expressed at variable levels. PMID:16408176

  12. Stable Transcription Activities Dependent on an Orientation of Tam3 Transposon Insertions into Antirrhinum and Yeast Promoters Occur Only within Chromatin1[W

    PubMed Central

    Uchiyama, Takako; Fujino, Kaien; Ogawa, Takashi; Wakatsuki, Akihito; Kishima, Yuji; Mikami, Tetsuo; Sano, Yoshio

    2009-01-01

    Transposon insertions occasionally occur in the promoter regions of plant genes, many of which are still capable of being transcribed. However, it remains unclear how transcription of such promoters is able to occur. Insertion of the Tam3 transposon into various genes of Antirrhinum majus can confer leaky phenotypes without its excision. These genes, named Tam3-permissible alleles, often contain Tam3 in their promoter regions. Two alleles at different anthocyanin biosynthesis loci, nivearecurrens?Tam3 (nivrec) and pallidarecurrens?Tam3 (palrec), both contain Tam3 at a similar position immediately upstream of the promoter TATA-box; however, these insertions had different phenotypic consequences. Under conditions where the inserted Tam3 is immobilized, the nivrec line produces pale red petals, whereas the palrec line produces no pigment. These pigmentation patterns are correlated with the level of transcripts from the nivrec or palrec alleles, and these transcriptional activities are independent of DNA methylation in their promoter regions. In nivrec, Tam3 is inserted in an orientation that results in the 3? end of Tam3 adjacent to the 5? region of the gene coding sequence. In contrast, the palrec allele contains a Tam3 insertion in the opposite orientation. Four of five different nonrelated genes that are also Tam3-permissible alleles and contain Tam3 within the promoter region share the same Tam3 orientation as nivrec. The different transcriptional activities dependent on Tam3 orientation in the Antirrhinum promoters were consistent with expression of luciferase reporter constructs introduced into yeast chromosomes but not with transient expression of these constructs in Antirrhinum cells. These results suggest that for Tam3 to sustain stable transcriptional activity in various promoters it must be embedded in chromatin. PMID:19759347

  13. Insertion of Totally Implantable Central Venous Access Devices by Surgeons

    PubMed Central

    An, Hyeonjun; Ryu, Chun-Geun; Jung, Eun-Joo; Kang, Hyun Jong; Paik, Jin Hee; Yang, Jung-Hyun

    2015-01-01

    Purpose The aim of this study is to evaluate the results for the insertion of totally implantable central venous access devices (TICVADs) by surgeons. Methods Total 397 patients, in whom TICVADs had been inserted for intravenous chemotherapy between September 2008 and June 2014, were pooled. This procedure was performed under local anesthesia in an operation room. The insertion site for the TICVAD was mainly in the right-side subclavian vein. In the case of breast cancer patients, the subclavian vein opposite the surgical site was used for insertion. Results The 397 patients included 73 males and 324 females. Primary malignant tumors were mainly colorectal and breast cancer. The mean operation time was 54 minutes (18-276 minutes). Operation-related complications occurred in 33 cases (8.3%). Early complications developed in 15 cases with catheter malposition and puncture failure. Late complications, which developed after 24 hours, included inflammation in 6 cases, skin necrosis in 6 cases, hematoma in 3 cases, port malfunction in 1 case, port migration in 1 case, and intractable pain at the port site in 1 case. Conclusion Insertion of a TICVAD under local anesthesia by a surgeon is a relatively safe procedure. Meticulous undermining of the skin and carefully managing the TICVAD could minimize complications. PMID:25960974

  14. Insertion site mapping for repeated elements in Mycobacterium tuberculosis.

    PubMed

    Moganeradj, Kartyk; Abubakar, Ibrahim; McHugh, Timothy D; Sonnenberg, Pam; Arnold, Catherine

    2013-02-15

    Insertion elements not only act as genetic markers for differentiation of bacteria but their movement in bacterial genomes likely plays an essential role in changing the physical and biochemical traits of the organisms when adapting to new environments. Genomic Insertion Site mapping of transposable elements could shed light on the putative altered function of adjacent genes. In the era of whole genome sequencing where repeat elements are difficult to sequence with short read technologies and in the absence of high throughput technologies especially in poorer resource settings, an alternative approach to their characterisation is needed. A rapid and simple method of insertion site mapping that uses Insertion Sequence 6110 (IS6110) fluorescent amplified fragment length polymorphism (FAFLP) PCR as a foundation and then uses additional selective bases to reduce the number of fragments generated was developed. This was applied to Mycobacterium tuberculosis H37Rv sequenced strain to compare the experimental data with the in silico results. This was successfully achieved for all but two of the sixteen fragments generated by FAFLP and demonstrated that, by using this technique, insertion sites can be mapped onto the genomes of M. tuberculosis. PMID:23262032

  15. Wobble decoding by the Escherichia coli selenocysteine insertion machinery

    PubMed Central

    Xu, Jianqiang; Croitoru, Victor; Rutishauser, Dorothea; Cheng, Qing; Arnér, Elias S.J.

    2013-01-01

    Selenoprotein expression in Escherichia coli redefines specific single UGA codons from translational termination to selenocysteine (Sec) insertion. This process requires the presence of a Sec Insertion Sequence (SECIS) in the mRNA, which forms a secondary structure that binds a unique Sec-specific elongation factor that catalyzes Sec insertion at the predefined UGA instead of release factor 2-mediated termination. During overproduction of recombinant selenoproteins, this process nonetheless typically results in expression of UGA-truncated products together with the production of recombinant selenoproteins. Here, we found that premature termination can be fully avoided through a SECIS-dependent Sec-mediated suppression of UGG, thereby yielding either tryptophan or Sec insertion without detectable premature truncation. The yield of recombinant selenoprotein produced with this method approached that obtained with a classical UGA codon for Sec insertion. Sec-mediated suppression of UGG thus provides a novel method for selenoprotein production, as here demonstrated with rat thioredoxin reductase. The results also reveal that the E. coli selenoprotein synthesis machinery has the inherent capability to promote wobble decoding. PMID:23982514

  16. LMA Supreme insertion by novices in manikins and patients.

    PubMed

    Howes, B W; Wharton, N M; Gibbison, B; Cook, T M

    2010-04-01

    The LMA Supreme has been suggested for use in emergency situations by medical personnel with no experience in endotracheal intubation. We evaluated the LMA Supreme when inserted by non-anaesthetists, firstly in a manikin and then in patients. Fifty airway novices inserted a LMA Supreme in a manikin without any complications so we proceeded to the patient phase. Fifty airway novices inserted the LMA Supreme in anaesthetised patients undergoing elective surgery. First time insertion success rate was 86% and overall insertion success rate was 100%. Mechanical ventilation was successful in all cases. Median (IQR [range]) time to establish an airway was 34 s (26-40 [18-145] s). Median (IQR [range]) pharyngeal seal pressure was 23 cmH(2)O (19-28 [13-40] cmH(2)O). There were no important complications. Results are consistent with previous studies of use of the LMA Supreme by airway experts. We conclude that the LMA supreme is suitable for use by airway novices. Further research is needed before it may be recommended for cardiopulmonary resuscitation and emergency airway use. PMID:20180796

  17. The endogenous ecotropic murine retroviruses Emv-16 and Emv-17 are both capable of producing new proviral insertions in the mouse genome.

    PubMed

    Szabo, C; Kim, Y K; Mark, W H

    1993-09-01

    New germ line proviral insertions are acquired at a high frequency by the progeny of SWR/J-RF/J hybrid female mice that carry the endogenous ecotropic murine leukemia proviruses Emv-16 and Emv-17. The tight linkage of these RF/J strain proviral loci has prevented genetic segregation of the retroviral genomes. Hence, it is not known whether both of these proviruses are capable of giving rise to new proviral insertions. We have molecularly cloned Emv-16 and Emv-17 and have characterized them in vitro and in vivo. Restriction enzyme analysis of the recombinant clones revealed that the proviral genomes are very similar to each other and closely resemble the wild-type AKR virus. A comparison of the flanking cellular DNA suggests that the Emv-16 and Emv-17 loci did not arise by simple duplication of a viral insertion site within the RF/J genome but most likely are independent integration events. Both proviruses produce infectious virus when transfected into NIH 3T3 cells, indicating that they are nondefective retroviruses. Exogenous infection of SWR/J mice with either Emv-16 or Emv-17 leads to viremia in the host animals, and in both cases, progeny of viremic females acquire new proviral insertions. The ability of these retroviruses to generate novel retroviral integration sites in the mouse genome provides a simple method for inducing insertional mutations in mice. PMID:8394469

  18. Solid 7Li-NMR and in situ XRD studies of the insertion reaction of lithium with tin oxide and tin-based amorphous composite oxide

    NASA Astrophysics Data System (ADS)

    Furuya, Kazuhiko; Ogawa, Keizou; Mineo, Yasushi; Matsufuji, Akihiro; Okuda, Jun; Erata, Tomoki

    2001-04-01

    The lithium insertion reactions with tin (II) oxide (SnO) and tin-based composite oxide (abbreviated as TBCO) are studied by solid 7Li-NMR Knight shift, T1 and T1? relaxation rate, TEM and in situ XRD methods. By the insertion reaction for SnO, the lithium oxide and ?-tin are produced first at Li/Sn = 2; at Li/Sn = 3 to 6 the products are not simple and a mixture of LiSn2, LiSn, Li5Sn2 and Li7Sn2 alloys is detected during the insertion. For the TBCO, which is revealed as amorphous, mainly constituted by randomly distributed very short-range (order of 10-9 m) regions by TEM observation, it is found that electrochemically inserted lithium forms Li2O and produces metallic tin (Sn) in the first step (Li/Sn <2), then the highly ionic lithium-tin alloys, Li7Sn2 (and Li7Si2), are produced in the second step (Li/Sn >2). During the second step, the Li/Sn ratio of formed lithium-tin alloy is kept at almost 4. By the analyses of 7Li NMR Knight shifts, line shape and in situ XRD, the lithium-inserted TBCOs are characterized as almost amorphous and mixtures of highly ionic components.

  19. Ka-band full-360° analog phase shifter with low insertion loss

    NASA Astrophysics Data System (ADS)

    Mengyi, Cao; Yang, Lu; Jiaxing, Wei; Jiaxin, Zheng; Xiaohua, Ma; Yue, Hao

    2014-10-01

    A new reflection-type wideband 360° monolithic-microwave integrated-circuit (MMIC) analog phase shifter at the Ka-band is proposed. The phase shifter is designed based on the principle of vector synthesis. Three Lange couplers are employed in the phase shifter, which is fabricated by the standard 0.25-?m GaAs process. We use four 4 × 40 ?m GaAs HEMTs as the reflection loads. A microstrip line in parallel with the device is used as an inductance to counteract the parasitic capacitance of the device so that the reflection load performs like a pure resistance and the insertion loss can be decreased. In this phase shifter, a folded Lange coupler is utilized to reduce the size of the chip. The size of the proposed MMIC phase shifter is only 2.0 × 1.2 mm2. The measurement results show that the insertion loss is 5.0 ± 0.8 dB and a 360° continuously tunable range across 27–32 GHz is obtained with miniscule DC power consumption.

  20. Nanohybrid systems of non-ionic surfactant inserting liposomes loading paclitaxel for reversal of multidrug resistance.

    PubMed

    Ji, Xiufeng; Gao, Yu; Chen, Lingli; Zhang, Zhiwen; Deng, Yihui; Li, Yaping

    2012-01-17

    Three new nanohybrid systems of non-ionic surfactant inserting liposomes loading paclitaxel (PTX) (NLPs) were prepared to overcome multidrug resistance (MDR) in PTX-resistance human lung cancer cell line. Three non-ionic surfactants, Solutol HS 15 (HS-15), pluronic F68 (PF-68) and cremophor EL (CrEL) were inserted into liposomes by film hydration method to form NLPs with an average size of around 110, 180 and 110 nm, respectively. There was an obvious increase of rhodamin 123 (Rh123) accumulation in A549/T cells after treated with nanohybrid systems loading Rh123 (NLRs) when compared with free Rh123 or liposomes loading Rh123 without surfactants (LRs), which indicated the significant inhibition effects of NLRs on drug efflux. The P-gp detection and ATP determination demonstrated that BNLs could not only interfere P-gp expression on the membrane of drug resistant cells, but also decrease ATP level in the cells. The cytotoxicity of NLPs against A549/T cells was higher than PTX loaded liposomes without surfactants (LPs), and the best result was achieved after treated with NLPs2. The apoptotic assay and the cell cycle analysis showed that NLPs could induce more apoptotic cells in drug resistant cells when compared with LPs. These results suggested that NLPs could overcome MDR by combination of drug delivery, P-gp inhibition and ATP depletion, and showed potential for treatment of MDR. PMID:22001531

  1. Feasibility of a free-standing insertable heat source

    NASA Astrophysics Data System (ADS)

    Munger, A. C.; Mohler, J. H.; Kelly, M. D.

    The feasibility of a free-standing insertable heat source to replace an existing heat powder charge has been demonstrated. Successful development of this design eliminates the need for three laser weld joints, a high pressure interface and various manufacturing processes in the next assembly. Previous work yielded a component consisting of a stainless steel tube loaded with Fe/KC104 heat powder and a pyrotechnic ignitor. Although this design is adequate for the function, the advantages of an insertable heat source prompted the present development. The initial concept was to load a heat powder into a thin-walled container that could be inserted later. Varying air gaps prevented proper heat transmission. A freestanding thermite compact pressed to the inside contour of the stainless steel tube was then developed. This compact was attached to an ignitor which could then be threaded into the next assembly. Various thermite materials were evaluated.

  2. Insertion of liquid crystal molecules into hydrocarbon monolayers

    NASA Astrophysics Data System (ADS)

    Popov, Piotr; Lacks, Daniel J.; Jákli, Antal; Mann, Elizabeth K.

    2014-08-01

    Atomistic molecular dynamics simulations were carried out to investigate the molecular mechanisms of vertical surface alignment of liquid crystals. We study the insertion of nCB (4-Cyano-4'-n-biphenyl) molecules with n = 0,…,6 into a bent-core liquid crystal monolayer that was recently found to provide good vertical alignment for liquid crystals. The results suggest a complex-free energy landscape for the liquid crystal within the layer. The preferred insertion direction of the nCB molecules (core or tail first) varies with n, which can be explained by entropic considerations. The role of the dipole moments was found to be negligible. As vertical alignment is the leading form of present day liquid crystal displays (LCD), these results will help guide improvement of the LCD technology, as well as lend insight into the more general problem of insertion of biological and other molecules into lipid and surfactant layers.

  3. Synchronized monochromator and insertion device energy scans at SLS

    SciTech Connect

    Krempasky, J.; Flechsig, U.; Korhonen, T.; Zimoch, D.; Quitmann, Ch.; Nolting, F. [Paul Scherrer Institut, Villigen, Swiss Light Source, 5235 Villigen PSI (Switzerland)

    2010-06-23

    Synchronous monochromator and insertion device energy scans were implemented at the Surfaces/Interfaces:Microscopy (SIM) beamline in order to provide the users fast X-ray magnetic dichroism studies (XMCD). A simple software control scheme is proposed based on a fast monochromator run-time energy readback which quickly updates the insertion device requested energy during an on-the-fly X-ray absorption scan (XAS). In this scheme the Plain Grating Monochromator (PGM) motion control, being much slower compared with the insertion device (APPLE-II type undulator), acts as a 'master' controlling the undulator 'slave' energy position. This master-slave software implementation exploits EPICS distributed device control over computer network and allows for a quasi-synchronous motion control combined with data acquisition needed for the XAS or XMCD experiment.

  4. The Elettra beam line control system

    NASA Astrophysics Data System (ADS)

    Mignacco, M.; Abrami, A.; Dequal, Z.

    1994-12-01

    Elettra is a third generation Synchrotron Light Source located in Trieste (Italy). It consists of a full energy linac injector and a storage ring with beam energies between 1.5 and 2 GeV. The facility is scheduled to be operational by end 1993. For the whole project 22 beam lines from insertion devices are foreseen, each of them is composed of a large number of measurement and controls instruments, most of them embedded in intelligent devices; in addition each beam line can be considered unique compared to the others, having been designed to provide a different kind of synchrotron radiation. This results in a large not homogenous environment where more than 200,000 physical points have to be controlled. A joint team composed of Softeco Sismat and Digital Equipment has developed a fully automated beam line control system able to give full remote controls, with different kind of access rights, to beam line users and beam line specialists as well as a full integration with experiment control systems.

  5. Characterisation of protein stability in rod-insert vaginal rings.

    PubMed

    Pattani, Aditya; Lowry, Deborah; Curran, Rhonda M; McGrath, Stephanie; Kett, Vicky L; Andrews, Gavin P; Malcolm, R Karl

    2012-07-01

    A major goal in vaccine development is elimination of the 'cold chain', the transport and storage system for maintenance and distribution of the vaccine product. This is particularly pertinent to liquid formulation of vaccines. We have previously described the rod-insert vaginal ring (RiR) device, comprising an elastomeric body into which are inserted lyophilised, rod-shaped, solid drug dosage forms, and having potential for sustained mucosal delivery of biomacromolecules, such as HIV envelope protein-based vaccine candidates. Given the solid, lyophilised nature of these insert dosage forms, we hypothesised that antigen stability may be significantly increased compared with more conventional solubilised vaginal gel format. In this study, we prepared and tested vaginal ring devices fitted with lyophilised rod inserts containing the model antigen bovine serum albumin (BSA). Both the RiRs and the gels that were freeze-dried to prepare the inserts were evaluated for BSA stability using PAGE, turbidimetry, microbial load, MALDI-TOF and qualitative precipitate solubility measurements. When stored at 4 °C, but not when stored at 40 °C/75% RH, the RiR formulation offered protection against structural and conformational changes to BSA. The insert also retained matrix integrity and release characteristics. The results demonstrate that lypophilised gels can provide relative protection against degradation at lower temperatures compared to semi-solid gels. The major mechanism of degradation at 40 °C/75% RH was shown to be protein aggregation. Finally, in a preliminary study, we found that addition of trehalose to the formulation significantly reduces the rate of BSA degradation compared to the original formulation when stored at 40 °C/75% RH. Establishing the mechanism of degradation, and finding that degradation is decelerated in the presence of trehalose, will help inform further development of RiRs specifically and polymer based freeze-dried systems in general. PMID:22486955

  6. Sequence and insertion sites of murine melanoma-associated retrovirus.

    PubMed

    Li, M; Huang, X; Zhu, Z; Gorelik, E

    1999-11-01

    We previously showed that B16 melanoma cells produce ecotropic melanoma-associated retrovirus (MelARV) which encodes a melanoma-associated antigen recognized by MM2-9B6 monoclonal antibody. The biological significance of MelARV in melanoma formation remains unknown. We found that infection of normal melanocytes with MelARV resulted in malignant transformation. It is likely that MelARV emerged from the defective Emv-2 provirus, a single copy of ecotropic provirus existing in the genome of C57BL/6 mice. In the present study, we cloned and sequenced the full-length MelARV genome and its insertion sites and we completed sequencing of the Emv-2 provirus. Our data show that MelARV has a typical full-length retroviral genome with high homology (98.54%) to Emv-2, indicating a close relationship between both viruses. MelARV probably emerged as a result of recombination between Emv-2 and an endogenous nonecotropic provirus. Some observed differences in the gag and pol regions of MelARV might account for the restoration of productivity and infectivity of a novel retrovirus that somatically emerged during melanoma formation. MelARV does not contain any oncogene and therefore might induce transformation by insertional mutagenesis. We sequenced two insertion sites of MelARV. The first insertion site represents the 3' coding region of the c-maf proto-oncogene at 67.0 centimorgans (cM) on chromosome 8. The c-maf proto-oncogene encodes a basic leucine zipper protein homologous to c-fos and c-jun. Insertion of MelARV in BL6 melanoma cells resulted in the up-regulation of c-maf. It is noteworthy that the Emv-2 provirus is also inserted into a noncoding region at 61.0 cM on the same chromosome 8. The second insertion site is the 3' noncoding region of the DNA polymerase gamma (PolG) gene on chromosome 7. The expression of PolG was not affected by the MelARV insertion. Further investigation of the biological significance of MelARV in melanoma formation is being undertaken. PMID:10516025

  7. 20 TeV collider lattices with low-. beta. insertions

    SciTech Connect

    Garren, A.A.

    1983-08-01

    A lattice containing insertions designed for collisions of 20 TeV proton beams at crossing points having beta values of two meters or less is presented. The machine would use high-field double bore superconducting magnets, with opposite focusing action on the two beams passing through each quadrupole. Hence the focusing pattern in the insertions is antisymmetric about the crossings. The beams, separated by 16 cms in the arcs are made colinear by dipoles common to both beams and then focused to the low-..beta.. collision points by quadrupole triplets. A similar machine design for pp collisions is also included.

  8. Method of modifying a volume mesh using sheet insertion

    DOEpatents

    Borden, Michael J. (Albuquerque, NM); Shepherd, Jason F. (Albuquerque, NM)

    2006-08-29

    A method and machine-readable medium provide a technique to modify a hexahedral finite element volume mesh using dual generation and sheet insertion. After generating a dual of a volume stack (mesh), a predetermined algorithm may be followed to modify (refine) the volume mesh of hexahedral elements. The predetermined algorithm may include the steps of locating a sheet of hexahedral mesh elements, determining a plurality of hexahedral elements within the sheet to refine, shrinking the plurality of elements, and inserting a new sheet of hexahedral elements adjacently to modify the volume mesh. Additionally, another predetermined algorithm using mesh cutting may be followed to modify a volume mesh.

  9. Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries

    PubMed Central

    Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.

    2015-01-01

    PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706

  10. Personal Time Line

    NSDL National Science Digital Library

    Eric Muller

    2003-01-01

    In this activity, learners work in groups to create a time line representing significant moments in their lives. Learners use scientific suffixes and prefixes to label their time lines, modeling the Geologic Time Line (i.e. Mesozoic, Paleozoic).

  11. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Lu, Jianguo

    Noname manuscript No. (will be inserted by the editor) Estimating Deep Web Data Source Size the size of a deep web data source that is accessible by queries only. Since most deep web data sources. The results show that our method has small bias and standard deviation. Keywords Deep web, estimators, capture

  12. Acceptance of Advertising A written insertion order is

    E-print Network

    Mateo, Jill M.

    Acceptance of Advertising A written insertion order is required for all advertisements. All advertisements are subject to approval. The University of Chicago Press reserves the right to reject advertising for any reason. The advertiser and/or its advertising agency are entirely responsible for the lawfulness

  13. Sphenoidal electrode insertion under local analgesia in children

    Microsoft Academic Search

    Lucia Septien; Pierre Gras; Maurice Giroud; Raymond Dumas

    1992-01-01

    The indications for method and the results of sphenoidal electrode insertion under local analgesia are evaluated in children. This technique makes it possible to study the hippocampal area, which cannot be studied by other extracranial electrodes. It also localizes in a temporal lobe some complex seizures without electrical events on surface recordings, complex sezures with bilateral temporal spikes or a

  14. Solar Physics manuscript No. (will be inserted by the editor)

    E-print Network

    Ulrich, Roger K.

    Solar Physics manuscript No. (will be inserted by the editor) Roger K. Ulrich ¢ John E. Boyden. For any observation of a feature or physical quantity on the apparent solar disk, standard methods CARRINGTON COORDINATES AND SOLAR MAPS December 27, 2005 Abstract Solar synoptic charts are normally displayed

  15. On the Application of Insertion Techniques for Job Shop Problems

    E-print Network

    Magdeburg, Universität

    On the Application of Insertion Techniques for Job Shop Problems with Setup Times 1 Yuri N. Sotskov Constructive heuristics for shop scheduling problems are often based on priority (or dis­ patching) rules various job shop scheduling problems with batch setup times. For each job a specific technological route

  16. Type Policy Title Here Effective Date: [Insert Date

    E-print Network

    Salzman, Daniel

    Should Know This Policy [List persons affected by the Policy] Exclusions & Special Situations [Type allType Policy Title Here Effective Date: [Insert Date] Policy Statement [Type Statement Text Here] Reason(s) for the Policy [Type Reason Text Here] Primary Guidance to Which This Policy Responds [Type

  17. Insertion of short transmembrane helices by the Sec61 translocon

    PubMed Central

    Jaud, Simon; Fernández-Vidal, Mónica; Nilsson, IngMarie; Meindl-Beinker, Nadja M.; Hübner, Nadja C.; Tobias, Douglas J.; von Heijne, Gunnar; White, Stephen H.

    2009-01-01

    The insertion efficiency of transmembrane (TM) helices by the Sec61 translocon depends on helix amino acid composition, the positions of the amino acids within the helix, and helix length. We have used an in vitro expression system to examine systematically the insertion efficiency of short polyleucine segments (Ln, n = 4 … 12) flanked at either end by 4-residue sequences of the form XXPX-Ln-XPXX with X = G, N, D, or K. Except for X = K, insertion efficiency (p) is <10% for n < 8, but rises steeply to 100% for n = 12. For X = K, p is already close to 100% for n = 10. A similar pattern is observed for synthetic peptides incorporated into oriented phospholipid bilayer arrays, consistent with the idea that recognition of TM segments by the translocon critically involves physical partitioning of nascent peptide chains into the lipid bilayer. Molecular dynamics simulations suggest that insertion efficiency is determined primarily by the energetic cost of distorting the bilayer in the vicinity of the TM helix. Very short lysine-flanked leucine segments can reduce the energetic cost by extensive hydrogen bonding with water and lipid phosphate groups (snorkeling) and by partial unfolding. PMID:19581593

  18. Autonomous Robots manuscript No. (will be inserted by the editor)

    E-print Network

    Indiana University

    Autonomous Robots manuscript No. (will be inserted by the editor) Recognition, Prediction: The approach of inferring user's intended task and optimizing low-level robot motions has promise for mak- ing robot teleoperation interfaces more intuitive and respon- sive. But most existing methods assume

  19. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    EPJ manuscript No. (will be inserted by the editor) A novel simplified two-dimensional magneto. Metal-coated retro-reflecting prisms replace mirrors and quarter-wave plates so the optical power and techniques ­ 39.25.+k Atom manipulation (scanning probe microscopy, laser cooling, etc.) 1 Introduction Slow

  20. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Gatica-Perez, Daniel

    the prob- lem of large sequence mining from big data. The particu- lar problem of interest is the effective mining of long se- quences from large-scale location data to be practical for Re- ality MiningNoname manuscript No. (will be inserted by the editor) A Probabilistic Approach to Mining Mobile

  1. Palliation of proximal malignant biliary obstruction by endoscopic endoprosthesis insertion

    Microsoft Academic Search

    A A Polydorou; S R Cairns; J F Dowsett; A R Hatfield; P R Salmon; P B Cotton; R C Russell

    1991-01-01

    For four years up to December 1987, 190 patients (median age 73 years) with proximal malignant biliary obstruction were treated by endoscopic endoprosthesis insertion. Altogether 101 had cholangiocarcinoma, 21 gall bladder carcinoma, 20 local spread of pancreatic carcinoma, and 48 metastatic malignancy. Fifty eight patients had type I, 54 type II, and 78 type III proximal biliary strictures (Bismuth classification).

  2. Autonomous Robots manuscript No. (will be inserted by the editor)

    E-print Network

    Stachniss, Cyrill

    dispersal. We formulate this task as a regression problem. To deal with the specific properties of gas surface and the molecules to be analyzed. This makes gas sensing different to perceiving the environmentAutonomous Robots manuscript No. (will be inserted by the editor) Learning Gas Distribution Models

  3. A dilution refrigerator insert for standard ILL cryostats K. Neumaier

    E-print Network

    Paris-Sud XI, Université de

    773 A dilution refrigerator insert for standard ILL cryostats K. Neumaier WMI Garching, F.R.G. A la gamme de température des cryostats standards ILL (300-1,2 K) on a remplacé le porte- échantillon 03BCW à 0,1 K. Abstract. 2014 In order to extend the temperature range of Standard ILL cryostats (300

  4. Basis of Identities of the Algebra of Simplified Insertions

    E-print Network

    for words of length ,k k . 1. Introduction Given a free associative algebra [ ]Ass X on a set of generators in [ ]Ass X , and if s sb u= , where s F and su are monomials in [ ]Ass X , then ( )s sb a u (see [2, 3]). Let's call the new algebra [ ], ,Ass X + the algebra of simplified insertions on the set

  5. Cassini observations of Saturn's inner plasmasphere: Saturn orbit insertion results

    Microsoft Academic Search

    E SITTLERJR; M. Thomsen; R. E. Johnson; R. E. Hartle; M. Burger; D. Chornay; M. D. Shappirio; D. Simpson; H. T. Smith; A. J. Coates; A. M. Rymer; D. J. McComas; D. T. Young; D. Reisenfeld; M. Dougherty; N. Andre

    2006-01-01

    We present new and definitive results of Cassini plasma spectrometer (CAPS) data acquired during passage through Saturn's inner plasmasphere by the Cassini spacecraft during the approach phase of the Saturn orbit insertion period. This analysis extends the original analysis of Sittler et al. [2005. Preliminary results on Saturn's inner plasmasphere as observed by Cassini: comparison with Voyager. Geophys. Res. Lett.

  6. MICA: A Probabilistic Dependency Parser Based on Tree Insertion Grammars

    E-print Network

    Boyer, Edmond

    MICA: A Probabilistic Dependency Parser Based on Tree Insertion Grammars Application Note Srinivas.nasr@lif.univ-mrs.fr rambow@ccls.columbia.edu benoit.sagot@inria.fr Abstract MICA is a dependency parser which returns deep This application note presents a freely avail- able parser, MICA (Marseille-INRIA-Columbia- AT&T).1 MICA has

  7. JMIV manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    JMIV manuscript No. (will be inserted by the editor) The topological gradient method for semi-linear problems and application to edge detection and noise removal. Audric Drogoul · Gilles Aubert Received: date degraded by diverse noises and blurs. This method is based on the notion of topological gradient. First

  8. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    EPJ manuscript No. (will be inserted by the editor) Statistics of power injection in a plate set Fluctuation phenomena, random process, noise and Brownian motion ­ 62.30.+d Mechan- ical and elastic waves. In the stochastic version [10,14], / is the temperature of the stochastic Langevin bath with which the system

  9. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Majda, Andrew J.

    Noname manuscript No. (will be inserted by the editor) Stochastic and Deterministic Multicloud of the coherent features of the model with re- spect to the amount of stochastic noise. The simulations with the new closure and a higher amount of stochastic noise result in a Walker type circulation with realistic

  10. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    EPJ manuscript No. (will be inserted by the editor) On causal stochastic equations for log reformulate various versions of infinitely divisible cascades proposed in the literature using stochastic when the infinitely divisible noise at the heart of such model is stable: an independently scattered

  11. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Noname manuscript No. (will be inserted by the editor) A note on adaptive wavelet estimation curves Y1(t), . . . , Yn(t) defined by the stochastic equation: dYm(t) = f(t - m)dt + dWm(t), t [0, 1 pattern from a set of similar curves in the presence of random translations and additive noise. It fits

  12. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    EPJ manuscript No. (will be inserted by the editor) Soliton and rogue wave statistics-Comt´e, Route de Gray, Besan¸con, France. Abstract. Stochastic numerical simulations are used to study by femtosecond pulses, the underlying spectral broadening mechanisms and noise properties are generally well

  13. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Noname manuscript No. (will be inserted by the editor) Adaptive wavelet estimator for a function an indirect convolution model where m blurred and noise-perturbed functions f1, . . . , fm are randomly. 2000 Mathematics Subject Classification 62G07, 62G20. 1 Motivations We observe n stochastic processes Y

  14. Cassini observations of Saturn's inner plasmasphere: Saturn orbit insertion results

    Microsoft Academic Search

    E. C. Sittler Jr; M. Thomsenb; R. E. Hartlea; M. Burgera; D. Chornaya; M. D. Shappirioa; D. Simpsona; A. J. Coatesd; A. M. Rymere; D. J. McComasf; D. Reisenfeldg; M. Doughertyh; N. Andred

    We present new and definitive results of Cassini plasma spectrometer (CAPS) data acquired during passage through Saturn's inner plasmasphere by the Cassini spacecraft during the approach phase of the Saturn orbit insertion period. This analysis extends the original analysis of Sittler et al. (2005. Preliminary results on Saturn's inner plasmasphere as observed by Cassini: comparison with Voyager. Geophys. Res. Lett.

  15. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    Noname manuscript No. (will be inserted by the editor) Adaptive wavelet estimator for a function an indirect convolution model where m blurred and noise-perturbed functions f1, . . . , fm are randomly Classification 62G07, 62G20. 1 Motivations We observe n stochastic processes Y1(t), . . . , Yn(t), t [0, 1

  16. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Larsson, Stig

    . Keywords Inf-sup theory · Stochastic linear heat equation · Additive noise · Linear multiplicative noiseNoname manuscript No. (will be inserted by the editor) A weak space-time formulation for the linear stochastic heat equation Stig Larsson · Matteo Molteni Received: date / Accepted: date Abstract We apply

  17. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Vasconcelos, Nuno M.

    Noname manuscript No. (will be inserted by the editor) Generalized Stauffer­Grimson Background version: date Abstract We propose an adaptive model for backgrounds containing significant stochastic the state, the Gaussian mixture assumes that the variability derives from noise, not the structured mo­ tion

  18. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Martinez, Aleix M.

    of orthogonal rows, thus employing a weak-perspective model. 1.1 Stochastic view of noise-free SfM In generalNoname manuscript No. (will be inserted by the editor) Rigid Structure from Motion from a Blind only second-order statistics in models of shape or noise. A further advantage of viewing SfM as a blind

  19. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Benda, Jan

    synchrony · neural coding · stochastic integrate-and-fire neuron · noise PACS 05.40.-a · 87.16.Nn · 05.40.FbNoname manuscript No. (will be inserted by the editor) Information filtering by synchronous spikes of uncoupled but noisy neu- rons (each subject to some intrinsic noise) that are driven by a common broadband

  20. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Larsson, Stig

    method with truncated noise for semilinear parabolic stochastic equations with additive noise Mih´aly KovNoname manuscript No. (will be inserted by the editor) Strong convergence of the finite element parabolic PDE driven by additive noise. The equation is discretized in space by a standard piecewise linear

  1. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Noname manuscript No. (will be inserted by the editor) Wavelet estimation of the derivatives of an unknown function from a convolution model Christophe Chesneau Received: Abstract We observe a stochastic by Gaussian noise. We wish to estimate the d-th derivatives of f from the observations. To reach this goal, we

  2. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Belykh, Igor

    literature [1­25]. Stochasticity can be brought into a system by driving noise and is capable of inducingEPJ manuscript No. (will be inserted by the editor) Multistable randomly switching oscillators these probabilities, the switching frequency, and the cho- sen initial conditions. 1 Introduction Stochastically

  3. Machine Learning manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Machine Learning manuscript No. (will be inserted by the editor) PAutomaC: a PFA/HMM Learning involve using finite state machines as models and attempt- ing to learn these; these machines can either the problems dealing with learning grammars and finite state machines and the relevant litera- ture. This paper

  4. Machine Learning manuscript No. (will be inserted by the editor)

    E-print Network

    Szepesvari, Csaba

    Machine Learning manuscript No. (will be inserted by the editor) Training Parsers by Inverse Reinforcement Learning Gergely Neu1,2 , Csaba Szepesv´ari3,2 1 Department of Computing Science, Budapest learning (IRL) where one is given an environment and a set of trajectories and the problem is to find

  5. Machine Learning manuscript No. (will be inserted by the editor)

    E-print Network

    Powell, Warren B.

    Machine Learning manuscript No. (will be inserted by the editor) Learning near-optimal policies Recherche en Informatique et en Automatique Sequential Learning (SequeL) project, INRIA Lille, France e theoretical result for off-policy control learning over continuous state-spaces using a single trajectory. Key

  6. Machine Learning manuscript No. (will be inserted by the editor)

    E-print Network

    Hüllermeier, Eyke

    Machine Learning manuscript No. (will be inserted by the editor) Preference-Based Reinforcement This paper makes a first step toward the integration of two subfields of machine learning, namely preference Learning: A Formal Framework and a Policy Iteration Algorithm Johannes F¨urnkranz, Eyke H

  7. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Luding, Stefan

    Noname manuscript No. (will be inserted by the editor) Modelling particulate self-healing materials is observed. Keywords self-healing materials · granular materials · particle simulation · contact force, The Netherlands, #12;2 1 Introduction Self-healing materials encompass a wide range of materials capable

  8. Preparation of the ITER poloidal field conductor insert (PFCI) test

    Microsoft Academic Search

    R. Zanino; S. Egorov; K. Kim; N. Martovetsky; Y. Nunoya; K. Okuno; E. Salpietro; C. Sborchia; Y. Takahashi; P. Weng; M. Bagnasco; L. Savoldi Richard; M. Polak; A. Formisano; E. Zapretilina; A. Shikov; G. Vedernikov; D. Ciazynski; L. Zani; L. Muzzi; M. Ricci; A. della Corte; M. Sugimoto; K. Hamada; A. Portone; F. Hurd; N. Mitchell; A. Nijhuis; Yu. Ilyin

    2005-01-01

    The Poloidal Field Conductor Insert (PFCI) of the International Thermonuclear Experimental Reactor (ITER) has been designed in the EU and is being manufactured at Tesla Engineering, UK, in the frame of a Task Agreement with the ITER International Team. Completion of the PFCI is expected at the beginning of 2005. Then, the coil shall be shipped to JAERI Naka, Japan,

  9. Autonomous Robots manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    -based autopilot performs well and allows a mini rotorcraft UAV to F. Kendoul · K. Nonami Robotics and Control LabAutonomous Robots manuscript No. (will be inserted by the editor) An Adaptive Vision-based Autopilot for Mini Flying Machines Guidance, Navigation and Control Farid Kendoul · Kenzo Nonami · Isabelle

  10. Rapid cellular removal of a membrane-inserted foreign polypeptide.

    PubMed Central

    Moskaug, J O; Prydz, K; Olsnes, S

    1993-01-01

    We have developed a system that makes it possible to study the fate of a foreign polypeptide that is inserted in the plasma membrane. Diphtheria toxin is a bacterial protein toxin that, upon acidification, has the ability to insert into the plasma membrane from the outside of eukaryotic cells. We present results that indicate endocytic uptake and degradation of the diphtheria toxin B-fragment after insertion into the membrane of Vero cells. The degradation rate of the fragment was found to be very high (t1/2 = 6 min) and dependent on cleavage of the extracellular part of the polypeptide with protease. Degradation was strongly inhibited in ATP-depleted cells, as well as at temperatures below 18 degrees C, and it was partially inhibited when the cytosol was acidified to block endocytosis from clathrin-coated pits. Degradation was also reduced in the presence of NH4Cl. The results indicate that the inserted and cleaved B-fragment is degraded by a process requiring endocytosis and transport to late endosomes or to lysosomes. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:8484728

  11. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Soskova, Mariya I.

    Noname manuscript No. (will be inserted by the editor) The Limitations of Cupping in the Local later Abstract We prove that a sequence of sets containing representatives of cup- ping partners of the 0 2 enumeration degrees containing the nonzero 3-c.e. enumeration degrees can be cupped to 0e

  12. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Huang, Huaxiong

    EPJ manuscript No. (will be inserted by the editor) Cortical Spreading Depression: An Enigma Robert Institute of Technology, Newark, New Jersey 07102 USA 2 Department of Mathematics and Statistics, York spreading depression (CSD for short) was discovered over 60 years ago by A.A.P. Le~ao, a Brazilian

  13. Supraventricular tachycardia following insertion of a central venous catheter.

    PubMed

    Yavascan, Onder; Mir, Sevgi; Tekguc, Hakan

    2009-11-01

    Placement of central venous catheters (CVCs) in patients is associated with several risks including endocardial injury and dysrhythmias. In addition, CVC extending into intracardiac chambers can provoke premature atrial and ventricular complexes, which have been reported to initiate supraventricular tachycardia (SVT). A 15-year-old boy with end-stage renal failure developed SVT after insertion of a CVC. PMID:19861871

  14. Effects of lithium insertion on thermal conductivity of silicon nanowires

    NASA Astrophysics Data System (ADS)

    Xu, Wen; Zhang, Gang; Li, Baowen

    2015-04-01

    Recently, silicon nanowires (SiNWs) have been applied as high-performance Li battery anodes, since they can overcome the pulverization and mechanical fracture during lithiation. Although thermal stability is one of the most important parameters that determine safety of Li batteries, thermal conductivity of SiNWs with Li insertion remains unclear. In this letter, using molecular dynamics simulations, we study room temperature thermal conductivity of SiNWs with Li insertion. It is found that compared with the pristine SiNW, there is as much as 60% reduction in thermal conductivity with 10% concentration of inserted Li atoms, while under the same impurity concentration the reduction in thermal conductivity of the mass-disordered SiNW is only 30%. With lattice dynamics calculations and normal mode decomposition, it is revealed that the phonon lifetimes in SiNWs decrease greatly due to strong scattering of phonons by vibrational modes of Li atoms, especially for those high frequency phonons. The observed strong phonon scattering phenomenon in Li-inserted SiNWs is similar to the phonon rattling effect. Our study serves as an exploration of thermal properties of SiNWs as Li battery anodes or weakly coupled with impurity atoms.

  15. Climatic Change manuscript No. (will be inserted by the editor)

    E-print Network

    Wing, Ian Sue

    Climatic Change manuscript No. (will be inserted by the editor) Coal's Medium-Run Future Under greenhouse gas (GHG) con- centrations adds further influences to the mix. Climate change mitigation measures / Accepted: date Abstract We assess the future of coal under alternative climate stabilization regimes

  16. Program insertion in real-time IP multicasts

    Microsoft Academic Search

    Jack Brassil; Sukesh Garg; Henning Schulzrinne

    1999-01-01

    We describe the design, implementation and operation of a prototype system which seamlessly mixes real-time audio and video streams originating from multiple, physically separated sources. Mixing is entirely decentralized, relying on new protocols to coordinate transfer of session control between IP multicast sources. The system is motivated by the desire to perform dynamic insertion of advertisements in active, real-time multimedia

  17. Constraints manuscript No. (will be inserted by the editor)

    E-print Network

    Stuckey, Peter J.

    . In this paper we examine how to integrate the circuit constraint, and its variants, into a lazy clauseConstraints manuscript No. (will be inserted by the editor) Explaining Circuit Propagation Kathryn Francis · Peter J. Stuckey Received: date / Accepted: date Abstract The circuit constraint is used

  18. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    North Carolina at Chapel Hill, University of

    procedures are liver and lung biopsies to detect tumors [1,2]. Therapeutic applications of needle inser- tion and therapeutic purposes such as biopsy and brachytherapy, re- spectively. Examples of diagnostic needle insertion may result in misdiagnosis and unsuccessful treatment during biopsy and brachytherapy, respectively

  19. In search of polymorphic Alu insertions with restricted geographic distributions

    PubMed Central

    Cordaux, Richard; Srikanta, Deepa; Lee, Jungnam; Stoneking, Mark; Batzer, Mark A.

    2007-01-01

    Summary Alu elements are transposable elements that have reached over one million copies in the human genome. Some Alu elements inserted in the genome so recently that they are still polymorphic for insertion presence or absence in human populations. Recently, there has been an increasing interest in using Alu variation for studies of human population genetic structure and inference of individual geographic origin. Currently, this requires a high number of Alu loci. Here, we used a linker-mediated PCR method to preferentially identify low frequency Alu elements in various human DNA samples with different geographic origins. The candidate Alu loci were subsequently genotyped in 18 worldwide human populations (~370 individuals), resulting in the identification of two new Alu insertions restricted to populations of African ancestry. Our results suggest that it may ultimately become possible to correctly infer the geographic affiliation of unknown samples with high levels of confidence without having to genotype as many as 100 Alu loci. This is desirable if Alu insertion polymorphisms are to be used for human evolution studies or forensic applications. PMID:17498924

  20. Virtual Reality manuscript No. (will be inserted by the editor)

    E-print Network

    Beckhaus, Steffi

    Virtual Reality manuscript No. (will be inserted by the editor) The Design Space of Dynamic Environments have become a key component of many fields and the critical component of Virtual Reality, Steffi Beckhaus 1 Introduction Statements like "in Virtual Reality anything is possible" and "the

  1. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Politècnica de Catalunya, Universitat

    Noname manuscript No. (will be inserted by the editor) LISP-MN Mobile Networking through LISP and locate hosts. The Locator/Identifier Separation Protocol (LISP) decouples them by considering two types as routing locators. LISP, with such separation in place, can also offer native mobility. LISP

  2. EPJ Applied Physics proofs (will be inserted by the editor)

    E-print Network

    Guerra, Vasco

    EPJ Applied Physics proofs (will be inserted by the editor) Kinetic modeling of low description of the overall behavior of nitrogen plasmas requires a deep understanding of the coupling between journal devoted to gas dis- charges or plasma science published in 2004. Why is that so? On one hand

  3. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    of receipt and acceptance should be inserted later Abstract Particle swarm optimization (PSO) techniques made an impact in mainstream sta- tistical applications hitherto. PSO methods are popular because requiring any assumption on the objective function to be optimized. We modify PSO techniques to find optimal

  4. Mathematical Programming manuscript No. (will be inserted by the editor)

    E-print Network

    Srebro, Nathan

    -Shwartz School of Computer Science and Engineering, The Hebrew University of Jerusalem, Israel E-mail: shais@cs.huji.ac.il Yoram Singer Google E-mail: singer@google.com Nathan Srebro Toyota Technological Institute at Chicago EMathematical Programming manuscript No. (will be inserted by the editor) Pegasos: Primal Estimated

  5. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    to the fourth category. Mesh generation from a given CAD object is one of the most time-consuming stepNoname manuscript No. (will be inserted by the editor) High-quality construction of analysis Rabczuk Received: date / Accepted: date Abstract High-quality volumetric parameterization of computational

  6. Simultaneous PTL Buffer Insertion and Sizing for Minimizing Elmore Delay

    E-print Network

    Zhou, Hai

    characteristics to static CMOS. One problem with PTL circuits is that the delay through serially connectedSimultaneous PTL Buffer Insertion and Sizing for Minimizing Elmore Delay I­Min Liu y Tai­Hung Liu y in pass transistor logic (PTL) has been shown to be superior in terms of area, timing, and power

  7. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Chawla, Nitesh V.

    in real world applications, resulting in the "concept drift" or "non-stationary learning" problem which number of previous hypotheses. Given this definition, learning from such data streams requiresNoname manuscript No. (will be inserted by the editor) Learning from Streaming Data with Concept

  8. J Supercomput manuscript No. (will be inserted by the editor)

    E-print Network

    Touriño, Juan

    communication middleware ibvdev increases Java appli- cations performance on clusters of multi-core processors of communications intensive Java HPC applications. Keywords Message-Passing in Java (MPJ) · InfiniBand · Multi-coreJ Supercomput manuscript No. (will be inserted by the editor) Design of scalable Java message

  9. Hearing Aid Evaluation: Predicting Speech Gain from Insertion Gain.

    ERIC Educational Resources Information Center

    Dillon, Harvey

    1993-01-01

    This study, involving 11 older males with mild or moderate sensorineural loss, tested whether speech gain that results from a hearing aid fitting is predictable on the basis of unaided performance intensity curve, unaided narrow-band sound field thresholds, hearing aid insertion gain as a function of frequency, ambient noise, and internal hearing…

  10. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Politi, Antonio

    ) L in the limit of small noise and large system size L. By comparing the numerical results be effectively controlled. For low noise amplitudes, the values are close to 1/3 for asymmetric potentialsEPJ manuscript No. (will be inserted by the editor) Anomalous transport and relaxation in classical

  11. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Adler, Andy

    Noname manuscript No. (will be inserted by the editor) Tao Dai · Manuchehr Soleimani · Andy Adler frames independently, although data are actually highly correlated espe- cially in high speed EIT systems reconstruction is posed in terms of an augmented image and Tao Dai System and Computer Engineering, Carleton

  12. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Keyser, John

    Noname manuscript No. (will be inserted by the editor) Automated Sampling and Control of Gaseous a method that au- tomates the sampling and control of gaseous fluid sim- ulations. Several recent to represent what is virtually perceived and no more. Thus, by applying control based on the sampled data, we

  13. The CERN SPS Low Beta Insertion Control System

    Microsoft Academic Search

    H. K. Kuhn; A. Hilaire

    1983-01-01

    Within the context of the CERN SPS ppbar colliding beam experiments there are 2 X 15 power supplies which have to provide the currents necessary to produce the two low-beta insertions. Their control system is described for both the hardware and the software parts. The references use a combination of an 18 bit DAC and an integrator to produce a

  14. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Ling, Haibin

    Noname manuscript No. (will be inserted by the editor) Discriminative Vessel Segmentation appearance and profiles, as well as im- age noises. To address these challenges, we propose a so- lution-mail: yingzhu97@gmail.com Yi Wu School of Information and Control Engineering, Nanjing University of Information

  15. Telecommunication Systems manuscript No. (will be inserted by the editor)

    E-print Network

    Bouras, Christos

    Telecommunication Systems manuscript No. (will be inserted by the editor) Mobility-aware Power Control in MBSFN Konstantinos Asimakis · Christos Bouras · Vasileios Kokkinos · Andreas Papazois Received Network (MBSFN) within LTE systems is a feature that allows synchronous broadcasting of common data among

  16. JRTIP manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    JRTIP manuscript No. (will be inserted by the editor) Pavel Karas · Vincent Morard · Jan Bartovský Centre of Mathematical Morphology, Department Mathematics and Systems, Mines ParisTech, 35, rue St.g., blood cell classification [8], (2) automated document analysis [9], or (3) industrial control [10

  17. Embedded Micromirror Inserts for Optical Printed Circuit Boards

    Microsoft Academic Search

    Nina Hendrickx; JÜrgen Van Erps; Erwin Bosman; Christof Debaes; Hugo Thienpont; Peter Van Daele

    2008-01-01

    We present the use of an embedded 45deg micromirror, which is patterned in polymer photoresist using deep proton writing. The micromirror is metallized and inserted in a laser ablated cavity in the optical layer and in a next step covered with cladding material. Surface roughness measurements confirm the excellent quality of the mirror facet. Loss measurements have been carried out

  18. Insertional Mutagenesis of the Drosophila Genome with Single P Elements

    Microsoft Academic Search

    Lynn Cooley; Richard Kelley; Allan Spradling

    1988-01-01

    A versatile genetic method for identifying and cloning Drosophila melanogaster genes affecting any recognizable phenotype is described. Strains are constructed in which the insertion of a single P transposable element has caused a new mutation, greatly simplifying the genetic and molecular analysis of the affected gene. Mutagenesis is initiated by crossing two strains, each of which contains a specially designed

  19. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Nordlund, Kai

    . However, atom- istic simulations of gold-thiol systems have so far been restricted by the lackEPJ manuscript No. (will be inserted by the editor) Development of a ReaxFF description for gold T, 2008 Abstract Atomistic simulations of the chemistry of thiol-gold-systems have been restricted

  20. Solving Witten's SFT by insertion of operators on projectors

    Microsoft Academic Search

    Haitang Yang

    2004-01-01

    Following Okawa, we insert operators at the boundary of regulated star algebra projectors to construct the leading order tachyon vacuum solution of open string field theory. We also calculate the energy density of the solution and the ratio between the kinetic and the cubic terms. A universal relationship between these two quantities is found. We show that for any twist

  1. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Noname manuscript No. (will be inserted by the editor) Validation of a Hybrid Doppler Ultrasound Doppler ultrasound (US) images acquired on the dura for the correction of brain-shift and registration · Brain-shift · Doppler ultrasound · Digital Phantom · Validation 1 Introduction Modern neurosurgery

  2. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Demaine, Erik

    patterns---repeated concentric shapes, alternating mountain and valley---yet automatically foldNoname manuscript No. (will be inserted by the editor) (Non)existence of Pleated Folds: How Paper Folds Between Creases Erik D. Demaine · Martin L. Demaine · Vi Hart · Gregory N. Price · Tomohiro Tachi

  3. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Demaine, Erik

    patterns--repeated concentric shapes, alternating mountain and valley--yet automatically foldNoname manuscript No. (will be inserted by the editor) (Non)existence of Pleated Folds: How Paper Folds Between Creases Erik D. Demaine · Martin L. Demaine · Vi Hart · Gregory N. Price · Tomohiro Tachi

  4. Distributed Computing manuscript No. (will be inserted by the editor)

    E-print Network

    for high clock speeds and low power consumption dramatically increases the adverse effects of upsets due,s}@ecs.tuwien.ac.at The date of receipt and acceptance will be inserted by the editor A note for reviewers: Parts of this paper

  5. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Varela, Carlos

    -world transport systems, a natu- ral question appears as to how such flows can be designed in order to optimizeEPJ manuscript No. (will be inserted by the editor) Distributed flow optimization and cascading. We investigate the effect of a specific edge weighting scheme (kikj ) on distributed flow efficiency

  6. 31. Photocopy of map. Insert from Master Plan Notes Prepared ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. Photocopy of map. Insert from Master Plan Notes Prepared by Environmental Planning and Design, Pittsburgh, Pa. Original at Missouri Botanical Garden. 1972 MASTER PLAN 32. 'THE TREE,' SCULPTURE BY ALEXANDER CALDER, 1966 - Missouri Botanical Garden, 2345 Tower Grove Avenue, Saint Louis, Independent City, MO

  7. National Aeronautics and Space Administration MAVEN Orbit Insertion

    E-print Network

    Waliser, Duane E.

    National Aeronautics and Space Administration NASAfacts MAVEN Orbit Insertion Mars Atmosphere. MAVEN: Exploring Mars' climate history #12;National Aeronautics and Space Administration Goddard Space and ionosphere of Mars, characterizing their current states and determining the rates of loss of gas to space

  8. Department of Industrial Engineering Spring 2010 Bit Insertion Mechanism

    E-print Network

    Demirel, Melik C.

    CNC machines and the bit feeder mechanism was rapid prototyped. A program for the PLC controllerPENNSTATE Department of Industrial Engineering Spring 2010 Bit Insertion Mechanism Overview Stanley automatically. The team will also be required to submit drawings and/or CAD models of the mechanism. Other

  9. Molecular archeology of L1 insertions in the human genome

    Microsoft Academic Search

    Suzanne T Szak; Oxana K Pickeral; Wojciech Makalowski; Mark S Boguski; David Landsman; Jef D Boeke

    2002-01-01

    BACKGROUND: As the rough draft of the human genome sequence nears a finished product and other genome-sequencing projects accumulate sequence data exponentially, bioinformatics is emerging as an important tool for studies of transposon biology. In particular, L1 elements exhibit a variety of sequence structures after insertion into the human genome that are amenable to computational analysis. We carried out a

  10. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Krasnogor, Natalio

    Noname manuscript No. (will be inserted by the editor) A Computational Study of Liposome Logic-up" liposome logic, also called vesicle computing. Liposome logic makes use of supra-molecular chemistry the scalability of the techniques presented when the liposome logic complexity increases from relatively simple

  11. Mathematical Programming manuscript No. (will be inserted by the editor)

    E-print Network

    Wright, Steve

    Mathematical Programming manuscript No. (will be inserted by the editor) Stephen J. Wright the code to solve it. Stephen J. Wright: Mathematics and Computer Science Division, Argonne National Labora­ tory, 9700 South Cass Avenue, Argonne, Illinois 60439; wright@mcs.anl.gov ? Research supported

  12. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    aspects of the cardiac behavior, whether in physiological or patho- logical conditions, see e.g. recent have been recognized as cru- cial in cardiac physiology for decades, most notably with the soNoname manuscript No. (will be inserted by the editor) Dimensional reductions of a cardiac model

  13. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    EPJ manuscript No. (will be inserted by the editor) Effect of structural distortions version: date Abstract. The chemical selectivity and great sensitivity of the Extended X-ray Absorption and rose new ques- tions. The structure of CuGeO3 can be described as a stack- ing of CuO6 octahedra and GeO

  14. On noise insertion strategies for wireless network secrecy

    Microsoft Academic Search

    Etienne Perron; Suhas Diggavi; Emre Telatar

    2009-01-01

    We provide lower and upper bounds on the optimal rate for reliable and secret transmission of a message from one node to another in an arbitrary wireless network with deterministic signal interaction. Certain relay nodes are allowed to insert noise into the transmission, i.e., to use a source of independent, random noise in their encoding functions. The secrecy is with

  15. Machine Learning manuscript No. (will be inserted by the editor)

    E-print Network

    Scheffer, Tobias

    Machine Learning manuscript No. (will be inserted by the editor) Active Evaluation of Ranking for ranking performance. In analogy to active learning, they select spe- cific queries from a pool · Niels Landwehr Received: date / Accepted: date Abstract Evaluating the quality of ranking functions

  16. Magnesium oxide inserts for the LECO Carbon Analyzer

    SciTech Connect

    Bagaasen, L.M.; Jensen, C.M.

    1991-01-16

    LECO carbon analysis of plutonium metal and plutonium oxide at the Rocky Flats Plant generates several hundred kilograms of high silica residues each year. The plutonium in these residues is difficult and expensive to recover using production dissolution processes. A magnesium oxide (MgO) insert has been developed that significantly lowers the plutonium recovery costs without adversely affecting accuracy of the carbon analysis.

  17. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    EPJ manuscript No. (will be inserted by the editor) Proposal for a Raman X-ray Free Electron Laser-ray free electron laser is proposed, based on a Raman process occurring during the interaction between- and gamma-ray laser ­ 41.60.Cr Free-electron lasers ­ 42.65.Dr Stimulated Raman Scattering 1 Introduction

  18. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Nocedal, Jorge

    · interior point · feasibility restoration Mathematics Subject Classification (2000) 90C30 · 90C51 1 Introduction This paper describes the design and implementation of interior point methods for nonlinear proNoname manuscript No. (will be inserted by the editor) An Interior Point Method for Nonlinear

  19. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    . In the Earth-Moon system, we first compute numerically a family of such orbits, based on Linsdtedt PoincarNoname manuscript No. (will be inserted by the editor) Eight Lissajous orbits in the Earth-Moon of Eight Lissajous orbits can be used to visit almost all the Moon surface in the Earth-Moon system

  20. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Noname manuscript No. (will be inserted by the editor) Constructing hyper-bent functions from: date / Accepted: date Abstract Hyper-bent functions as a subclass of bent functions attract much interest and it is elusive to completely characterize hyper-bent functions. Most of known hyper-bent

  1. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Noname manuscript No. (will be inserted by the editor) Non Abelian Bent Functions Laurent Poinsot Abelian groups. Thus we extend the concept of bent functions to the framework of non Abelian groups. Keywords Bent functions · perfect nonlinearity · finite non Abelian groups · Fourier transform. Mathematics

  2. Statistical quantum studies on insertion atom-diatom reactions

    Microsoft Academic Search

    Tomás González-Lezana

    2007-01-01

    The study of insertion atom-diatom reactions is usually complicated by the existence of deep potential wells between reactants and products. The large number of bound and resonance states to be properly described makes exact quantum mechanical calculations extremely demanding in terms of numerical effort. In this type of collision, the process proceeds via the formation of an intermediate complex of

  3. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    EPJ manuscript No. (will be inserted by the editor) Elastic response and wrinkling onset of curved such as cell motility [1,2], wound healing [3], electronic surface protection [4] and fabrication involved in such tests, wrinkling is often observed when the (compressive) stress exceeds a certain

  4. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Bystroff, Chris

    the date of receipt and acceptance should be inserted later Abstract Pathological examination of a biopsy) a normal bone tissue (b) a fractured tissue (c) a cancerous tissue Fig. 1 Microscopic images of tissue. Pathological examination of a biopsy is the most reliable and widely used technique to diagnose bone cancer

  5. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Torres-Verdín, Carlos

    . The second one produces automatically optimal 3D grids yielded by a 3D self-adaptive goal-oriented algorithmNoname manuscript No. (will be inserted by the editor) Simulations of 3D DC Borehole Resistivity Measurements with a Goal-Oriented hp Finite-Element Method. Part II: Through-Casing Resistivity Instruments D

  6. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Algorithm, Maximal Independent Set, Maximal Matching, Dominating Set, Connected Dominating Set, Coloring, Symmetry Breaking 1 Introduction Minimum dominating sets (MDS) and connected dominating sets (CDS) are wellNoname manuscript No. (will be inserted by the editor) An Optimal Maximal Independent Set Algorithm

  7. Biological Cybernetics manuscript No. (will be inserted by the editor)

    E-print Network

    Webb, Barbara

    Biological Cybernetics manuscript No. (will be inserted by the editor) Michael Mangan · Barbara 2003; Collett M. Mangan Informatics Forum, 10 Crichton Street, Edinburgh, EH8 9AB, Scotland, UK Tel.: +44 131 650 2690 Fax: +44 131 651 1426 E-mail: m.mangan@sms.ed.ac.uk and Collett 2002). Additionally

  8. EPJ manuscript No. (will be inserted by the editor)

    E-print Network

    Boyer, Edmond

    EPJ manuscript No. (will be inserted by the editor) A new control strategy for shape memory alloys-mail: Sylvain.Calloch@ensieta.fr http://www.ensieta.fr/fr/lbms Abstract. Shape memory alloys (SMA) are more the efficiency of this new control strategy despite thermal per- turbations. 1 Introduction Shape memory alloys

  9. Granular Matter manuscript No. (will be inserted by the editor)

    E-print Network

    Paris-Sud XI, Université de

    Granular Matter manuscript No. (will be inserted by the editor) A. Karrech · D. Duhamel · G. Bonnet · F. Chevoir · J.-N. Roux · J. Canou · J.-C. Dupla · A discrete element study of settlement-mail: duhamel@lami.enpc.fr Prof G. Bonnet: Universit Paris-Est, Laboratoire de Modlisation et Simulation Multi

  10. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Grothey, Andreas

    Noname manuscript No. (will be inserted by the editor) Solving Security Constrained Optimal Power the lin- earized (n-1) security constrained optimal power flow (SCOPF) problem by a struc- ture exploiting of Edinburgh, UK EH9 3JZ Tel.: +44-131-6505083 Fax: +44-131-6506553 E-mail: N.Chiang-2@sms.ed.ac.uk Andreas

  11. INSERT YOUR BUILDING NAME HERE: BUILDING EMERGENCY PLAN

    E-print Network

    INSERT YOUR BUILDING NAME HERE: BUILDING EMERGENCY PLAN Date Adopted: 6/4/13 Date Revised: 6/4/13 Prepared By: Tracey Simmerman #12;PURDUE UNIVERSITY BUILDING EMERGENCY PLAN VERSION 3 2 Table of Contents Suspension or Campus Closure SECTION 3: BUILDING INFORMATION 3.1 Building Deputy/Alternate Building Deputy

  12. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    #12;Noname manuscript No. (will be inserted by the editor) Diversity Emerging: From Competitive the emergence of diversity [12,13]. It is well-known that cultures inoculated with an isogenic strain of bac batch cultures [21]. Periodic selection is closely associated with competitive exclu- sion and thus

  13. Noname manuscript No. (will be inserted by the editor)

    E-print Network

    Keinan, Alon

    Noname manuscript No. (will be inserted by the editor) Learned-Loss Boosting Giles Hooker, James O. Ramsay Department of Psychology McGill University Montreal, QC, H2X 2G3 Canada giles.hooker into practical problems. Keywords: boosting, density estimation, functional data analysis #12;2 Giles Hooker

  14. Swarm Intelligence manuscript No. (will be inserted by the editor)

    E-print Network

    Ducatelle, Frederick

    framework in which most swarm intelligence routing algorithms can be placed. After that, we give­37] and Particle Swarm Optimization (PSO) [59­61]. ACO takes inspiration from the pheromone-mediated ability of antSwarm Intelligence manuscript No. (will be inserted by the editor) Principles and applications

  15. External Tank (ET) Bipod Fitting Bolted Attachment Locking Insert Performance

    NASA Technical Reports Server (NTRS)

    Larsen, Curtis E.; Wilson, Tim R.; Elliott, Kenny B.; Raju, Ivatury S.; McManamen, John

    2008-01-01

    Following STS-107, the External Tank (ET) Project implemented corrective actions and configuration changes at the ET bipod fitting. Among the corrective actions, the existing bolt lock wire which provided resistance to potential bolt rotation was removed. The lock wire removal was because of concerns with creating voids during foam application and potential for lock wire to become debris. The bolts had been previously lubricated to facilitate assembly but, because of elimination of the lock wire, the ET Project wanted to enable the locking feature of the insert. Thus, the lubrication was removed from bolt threads and instead applied to the washer under the bolt head. Lubrication is necessary to maximize joint pre-load while remaining within the bolt torque specification. The locking feature is implemented by thread crimping in at four places in the insert. As the bolt is torqued into the insert the bolt threads its way past the crimped parts of the insert. This provides the locking of the bolt, as torque is required to loosen the joint after clamping.

  16. Computer Modeling of Protocellular Functions: Peptide Insertion in Membranes

    NASA Technical Reports Server (NTRS)

    Rodriquez-Gomez, D.; Darve, E.; Pohorille, A.

    2006-01-01

    Lipid vesicles became the precursors to protocells by acquiring the capabilities needed to survive and reproduce. These include transport of ions, nutrients and waste products across cell walls and capture of energy and its conversion into a chemically usable form. In modem organisms these functions are carried out by membrane-bound proteins (about 30% of the genome codes for this kind of proteins). A number of properties of alpha-helical peptides suggest that their associations are excellent candidates for protobiological precursors of proteins. In particular, some simple a-helical peptides can aggregate spontaneously and form functional channels. This process can be described conceptually by a three-step thermodynamic cycle: 1 - folding of helices at the water-membrane interface, 2 - helix insertion into the lipid bilayer and 3 - specific interactions of these helices that result in functional tertiary structures. Although a crucial step, helix insertion has not been adequately studied because of the insolubility and aggregation of hydrophobic peptides. In this work, we use computer simulation methods (Molecular Dynamics) to characterize the energetics of helix insertion and we discuss its importance in an evolutionary context. Specifically, helices could self-assemble only if their interactions were sufficiently strong to compensate the unfavorable Free Energy of insertion of individual helices into membranes, providing a selection mechanism for protobiological evolution.

  17. Generation of Wheat Transcription Factor FOX Rice Lines and Systematic Screening for Salt and Osmotic Stress Tolerance

    PubMed Central

    Zhang, Qian; Liu, Yayun; Zhu, Butuo; Cao, Jian; Li, Zhanpeng; Han, Longzhi; Jia, Jizeng; Zhao, Guangyao; Sun, Xuehui

    2015-01-01

    Transcription factors (TFs) play important roles in plant growth, development, and responses to environmental stress. In this study, we collected 1,455 full-length (FL) cDNAs of TFs, representing 45 families, from wheat and its relatives Triticum urartu, Aegilops speltoides, Aegilops tauschii, Triticum carthlicum, and Triticum aestivum. More than 15,000 T0 TF FOX (Full-length cDNA Over-eXpressing) rice lines were generated; of these, 10,496 lines set seeds. About 14.88% of the T0 plants showed obvious phenotypic changes. T1 lines (5,232 lines) were screened for salt and osmotic stress tolerance using 150 mM NaCl and 20% (v/v) PEG-4000, respectively. Among them, five lines (591, 746, 1647, 1812, and J4065) showed enhanced salt stress tolerance, five lines (591, 746, 898, 1078, and 1647) showed enhanced osmotic stress tolerance, and three lines (591, 746, and 1647) showed both salt and osmotic stress tolerance. Further analysis of the T-DNA flanking sequences showed that line 746 over-expressed TaEREB1, line 898 over-expressed TabZIPD, and lines 1812 and J4065 over-expressed TaOBF1a and TaOBF1b, respectively. The enhanced salt and osmotic stress tolerance of lines 898 and 1812 was confirmed by retransformation of the respective genes. Our results demonstrate that a heterologous FOX system may be used as an alternative genetic resource for the systematic functional analysis of the wheat genome. PMID:26176782

  18. Selection of Early-Occurring Mutations Dictates Hormone-Independent Progression in Mouse Mammary Tumor Lines?

    PubMed Central

    Gattelli, Albana; Zimberlin, María N.; Meiss, Roberto P.; Castilla, Lucio H.; Kordon, Edith C.

    2006-01-01

    Mice harboring three mouse mammary tumor virus (MMTV) variants develop pregnancy-dependent (PD) tumors that progress to pregnancy-independent (PI) behavior through successive passages. Herein, we identified 10 predominant insertions in PI transplants from 8 independent tumor lines. These mutations were also detected in small cell populations in the early PD passages. In addition, we identified a new viral insertion upstream of the gene Rspo3, which is overexpressed in three of the eight independent tumor lines and codes for a protein very similar to the recently described protein encoded by Int7. This study suggests that during progression towards hormone independence, clonal expansion of cells with specific mutations might be more relevant than the occurrence of new MMTV insertions. PMID:16971449

  19. Underground power line fault locating system

    SciTech Connect

    Fox, L.D.; Flath, R.K.

    1993-08-24

    A method is described of locating a fault in a polyphase power distribution system power distributing power from a bulk power source to power consumers, the power distribution system having a substation feeding a fused switch gear unit, a first vault, and at least one subsequent vault receiving power from the first vault, the first vault distributing power from the fused switch gear unit among plural outgoing underground power lines, each underground outgoing power line supplying power to at least one power consumer, the method comprising the steps of: checking fusing within the fused switch gear unit to determine in which phase the fault has occurred; checking the continuity of a power line interconnecting the fused switch gear unit and the first vault; identifying the fused switch gear unit and the first vault which normally supply power to a line having the fault; installing a fault indicator on each underground outgoing power line of the faulted phase in the first vault and in each subsequent vault; inserting a current limiting fuse in series with and between the fused switch gear unit and the first vault; reenergizing the first vault plural outgoing underground power lines through the current limiting fuse and causing the current limiting fuse to blow; and reading each fault indicator after the reenergizing step to determine the location of the fault. A method according to claim 7 for an underground power distribution system wherein at least one underground outgoing power line delivers power to at least one distribution transformer, wherein the step of installing the fault indicators further comprises installing a fault indicator on each distribution transformer.

  20. Long acting betaxolol ocular inserts based on polymer composite.

    PubMed

    Gevariya, Hitesh B; Patel, Jayvadan K

    2013-08-01

    Poor bioavailability and therapeutic response of conventional therapy due to many pre-corneal constraints necessitate the development of novel controlled and sustained ocular drug delivery to become a standard one in modern pharmaceutical era. This investigation aimed to study the drug release kinetics of betaxolol hydrochloride from a hydrophobic matrix system of PMMA cast with incorporating different proportions of polyethylene oxide (PEO) and evaluate its ability to improve ocular bioavailability and duration of action for the drug. Matrix type ocular inserts were prepared by the film casting technique and characterized in vitro by drug release studies using a flow through apparatus that simulated the eye conditions. All the formulations were subjected to physicochemical evaluation. Rabbit model with steroid induced glaucoma was used to establish in vivo efficacy of inserts. Polymer composition and concentration significantly affected the drug release based on change in diffusional path length and formation of gelaneous pores by polymer erosion. Formulations released the drug by non-fickian diffusion including anomalous transport (0.51). It was also observed that increasing the proportion of PEO in to PMMA does not affect the blend miscibility. IVIVC suggested no significant difference (P< 0.001) between in vitro and in vivo release of drug from inserts. In vivo IOP lowering activity was better for optimized insert F8 (for 24 h) as compared to eye drops (10 h). This ocular insert could be a promising once-a-day sustained release formulation for treating glaucoma. PMID:23909665

  1. Lithium insertion in carbonaceous materials containing silicon

    NASA Astrophysics Data System (ADS)

    Wilson, Alfred Macdonald

    Three different series of silicon-containing carbonaceous materials were synthesized for use as anodes in lithium ion cells. Disordered (or pregraphitic) carbons containing nanodispersed silicon were prepared by the chemical vapour deposition (CVD) of various chlorosilanes (SiClsb4, (CHsb3)sb2Clsb2Si, and (CHsb3)sb3ClSi) with benzene in two different apparatuses. Silicon oxycarbide glasses were synthesized by the pyrolysis of over 50 silicon-containing polymers at various temperatures, although the principal materials in the study were prepared at 1000sp°C. Finally, materials which we believe to be similar to disordered carbons containing nanodispersed silicon were prepared by the pyrolysis of various blends of pitches with polysilanes. Powder X-ray diffraction was used to learn about the structure of all the materials made. Thermal gravimetric analysis was used to determine the silicon content in the CVD materials and, when coupled to a residual gas analyzer, to study the decomposition process of the polymers. Near edge X-ray absorption spectroscopy measurements of the silicon L- and K-edges of CVD materials and the silicon K-edges of silicon oxycarbides were used to learn about local chemical environments of the silicon atoms. Lithium metal electrochemical test cells of the silicon-containing CVD materials showed larger capacities (up to 500 mAh/g) than pure carbons prepared in the same way (˜300 mAh/g). The additional capacity was observed to be centered near 0.4 V on charge, the average voltage observed for the removal of lithium from a silicon-lithium alloy. Chemical analysis showed that the stoichiometries of materials made by polymer pyrolysis were distributed over a well-defined region in the Si-O-C Gibbs phase diagram. An interesting series of materials is found near the line in the Si-O-C Gibbs triangle connecting carbon to SiOsb{1.3}. Lithium metal electrochemical test cells made using all the silicon oxycarbides synthesized showed that a stoichiometry of about Sisb{.25}Csb{.45}Osb{.30} gave the maximum reversible capacity (about 900 mAh/g). However, materials near this stoichiometry exhibit large irreversible capacities (>350 mAh/g) and significant hysteresis (the voltage difference between charge and discharge) in the voltage profile (˜0.8 V). In an attempt to reduce the oxygen content in one of the silicon oxycarbide glasses, a sample was washed in a dilute solution of hydrofluoric acid (HF) for times ranging from 2 minutes to 24 hours. The material lost, at most, 40 percent of its initial mass, although there was only a small change in its stoichiometry. In addition to the techniques mentioned above, small angle X-ray scattering and BET surface area measurements were used to study the microscopic pore network that was created by the HF washing. Lithium metal electrochemical test cells made using the product of pyrolysing pitch-polysilane blends showed that the capacity increased with silicon content from 340 mAh/g for pure carbon to a maximum of 600 mAh/g for samples with about 15 atomic % silicon (Sisb{.14}Osb{.09}Csb{.77}). The capacity then decreased to near zero as the composition approached SiC. These materials contain oxygen which is correlated to irreversible capacity loss. (Abstract shortened by UMI.)

  2. Some observations on the pathogenicity of a molecular clone of a very virulent strain of Marek’s disease virus containing an insert of long terminal repeat of reticuloendotheliosis virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We recently artificially inserted REV LTR into a bacterial artificial chromosome (BAC) clone of a very virulent strain of Marek’s disease (MD) virus (MDV), Md5; the virus was designated rMd5-RM1-LTR (Kim et al., 2011). In the present study, susceptible chickens of ADOL line 15I5 X 71 with and witho...

  3. The Language of Lines.

    ERIC Educational Resources Information Center

    Breig-Allen, Cheryl; Hill, Janet; Geismar-Ryan, Lori; Cadwell, Louise Boyd

    1998-01-01

    Describes a project about lines in the environment used with 2- and 3-year olds and based on the Reggio Emilia approach. Activities included making tracks with riding toys, drawing lines on papers, seeing cloud lines, and making lines with yarn and Cuisenaire rods. Shows how young children's observations and ongoing discoveries can uncover their…

  4. Abstract Line Designs

    ERIC Educational Resources Information Center

    Nevinskas, Nancy

    2011-01-01

    In this article, the author describes a unit on the exploration of line. The unit was composed of two individual line lessons. In the first lesson, students were introduced to line as an element of design. They were asked to describe different types of lines, and look for them in art reproductions. The second lesson in the unit involved painting…

  5. Functional characterization of a mutated chicken ?7 nicotinic acetylcholine receptor subunit with a leucine residue inserted in transmembrane domain 2

    PubMed Central

    Buckingham, Steven D; Adcock, Charlotte; Sansom, Mark S P; Sattelle, David B; Baylis, Howard A

    1998-01-01

    Site-directed mutagenesis was used to create an altered form of the chicken ?7 nicotinic acetylcholine (ACh) receptor subunit (?7x61) in which a leucine residue was inserted between residues Leu9? and Ser10? in transmembrane domain 2. The properties of ?7x61 receptors are distinct from those of the wild-type receptor.Oocytes expressing wild-type ?7 receptors responded to 10??M nicotine with rapid inward currents that desensitized with a time-constant of 710±409?ms (mean±s.e.mean, n=5). However in ?7x61 receptors 10??M nicotine resulted in slower onset inward currents that desensitized with a time-constant of 5684±3403?ms (mean±s.e.mean, n=4). No significant difference in the apparent affinity of nicotine or acetylcholine between mutant and wild-type receptors was observed. Dihydro-?-erythroidine (DH?E) acted as an antagonist on both receptors.Molecular modelling of the ?7x61 receptor channel pore formed by a bundle of M2 ?-helices suggested that three of the channel lining residues would be altered by the leucine insertion i.e.; Ser10? would be replaced by the leucine insertion, Val13? and Phe14? would be replaced, by Thr and Val, respectively.When present in the LEV-1 nicotinic ACh receptor subunit from Caenorhabditis elegans the same alteration conferred resistance to levamisole anthelmintic drug. Levamisole blocked responses to nicotine of wild-type and ?7x61 receptors. However, block was more dependent on membrane potential for the ?7x61 receptors.We conclude that the leucine insertion in transmembrane domain 2 has the unusual effect of slowing desensitization without altering apparent agonist affinity. PMID:9690867

  6. The Zebrafish Insertion Collection (ZInC): a web based, searchable collection of zebrafish mutations generated by DNA insertion

    PubMed Central

    Varshney, Gaurav K.; Huang, Haigen; Zhang, Suiyuan; Lu, Jing; Gildea, Derek E.; Yang, Zhongan; Wolfsberg, Tyra G.; Lin, Shuo; Burgess, Shawn M.

    2013-01-01

    ZInC (Zebrafish Insertional Collection, http://research.nhgri.nih.gov/ZInC/) is a web-searchable interface of insertional mutants in zebrafish. Over the last two decades, the zebrafish has become a popular model organism for studying vertebrate development as well as for modeling human diseases. To facilitate such studies, we are generating a genome-wide knockout resource that targets every zebrafish protein-coding gene. All mutant fish are freely available to the scientific community through the Zebrafish International Resource Center (ZIRC). To assist researchers in finding mutant and insertion information, we developed a comprehensive database with a web front-end, the ZInC. It can be queried using multiple types of input such as ZFIN (Zebrafish Information Network) IDs, UniGene accession numbers and gene symbols from zebrafish, human and mouse. In the future, ZInC may include data from other insertional mutation projects as well. ZInC cross-references all integration data with the ZFIN (http://zfin.org/). PMID:23180778

  7. Miniaturized overlapped LC phase delay line

    NASA Astrophysics Data System (ADS)

    Guo, Xin; Li, Ling; Zhao, Chenxu; Liu, Zewen

    2014-03-01

    A novel miniaturized ultra-wide bandwidth (DC-35 GHz) LC phase delay line (PDL) based on overlapped meander inductors and air-bridge capacitors is proposed and fabricated. Two 45° and 90° PDLs were designed using a semi-lumped model, and the parameters were calculated and optimized based on transmission line theory and 3D simulations. The lengths of the 45° and 90° delay lines are 110 ?m and 286 ?m, respectively, which represent respective length reductions of 50% and 75% when compared with the corresponding conventional transmission lines. Over the entire operating band, the phase error is less than 0.6° for the 45° PDL and 2.5° for the 90° PDL. The return loss (S11) for both PDLs is better than 15.5 dB, while the insertion loss (S21) is less than 0.62 dB for both devices. Measured results show perfect consistency with the simulation results for these PDLs, and demonstrate the validity of the corresponding model.

  8. Forty five nanoseconds superconducting delay lines

    NASA Astrophysics Data System (ADS)

    Hohenwarter, G. K. G.; Track, E. K.; Drake, R. E.; Patt, R.

    1993-03-01

    The authors report on the design, simulation, fabrication, and measurement of very long superconducting coplanar waveguide delay lines on 3-in-diameter LaAlO3 substrates. Variations of the design involving the addition of a ground plane on the backside of the substrate and/or the use of gold wire-bond bridges to electrically connect the in-plane ground planes were investigated. A delay of 45 ns was measured for a line length of 4.3 m. The best response was obtained with wire-bond connections and no backside ground plane. A resonance-free insertion loss of less than 0.01 dB/ns was obtained with a 1.7-GHz bandwidth for NbN at 4.2 K. This is to be compared with a loss of 0.1 dB/ns for a 50-ns 0.141-in O.D. (outer diameter) copper coaxial delay line that weighs 1.5 lb and 0.02 dB/ns for a 60-ns 1-in O.D. copper coaxial delay line that weighs 45 lb.

  9. Functional Genomics of Eukaryotic Photosynthesis Using Insertional Mutagenesis of Chlamydomonas reinhardtii1

    E-print Network

    Functional Genomics of Eukaryotic Photosynthesis Using Insertional Mutagenesis of Chlamydomonas photosynthesis in eukaryotes. Here we describe the development of a resource for functional genomics of photosynthesis using insertional mutagenesis of the Chlamydomonas nuclear genome. Chlamydomonas cells were

  10. 49 CFR Appendix E to Part 227 - Use of Insert Earphones for Audiometric Testing

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...DEPARTMENT OF TRANSPORTATION OCCUPATIONAL NOISE EXPOSURE Pt. 227, App. E Appendix...prevents achievement of an acceptable insertion depth (fit). C. Insert earphones...the audiometer. IV. Background Noise Levels Testing shall be...

  11. 49 CFR Appendix E to Part 227 - Use of Insert Earphones for Audiometric Testing

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...DEPARTMENT OF TRANSPORTATION OCCUPATIONAL NOISE EXPOSURE Pt. 227, App. E Appendix...prevents achievement of an acceptable insertion depth (fit). C. Insert earphones...the audiometer. IV. Background Noise Levels Testing shall be...

  12. 49 CFR Appendix E to Part 227 - Use of Insert Earphones for Audiometric Testing

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...DEPARTMENT OF TRANSPORTATION OCCUPATIONAL NOISE EXPOSURE Pt. 227, App. E Appendix...prevents achievement of an acceptable insertion depth (fit). C. Insert earphones...the audiometer. IV. Background Noise Levels Testing shall be...

  13. Minimum Decoupling Capacitor Insertion in VLSI Power/Ground Supply Networks by Semidefinite

    E-print Network

    Liu, Bao

    power/ground supply voltage reduces transistor noise margin, degrades transistor and system performance1 Minimum Decoupling Capacitor Insertion in VLSI Power/Ground Supply Networks by Semidefinite decoupling capacitor insertion techniques are based on sensitivity analysis and greedy optimization

  14. Buffer insertion in large circuits using look-ahead and back-off techniques 

    E-print Network

    Waghmode, Mandar

    2007-04-25

    Buffer insertion is an essential technique for reducing interconnect delay in submicron circuits. Though it is a well researched area, there is a need for robust and effective algorithms to perform buffer insertion at the ...

  15. Increasing intrauterine contraception use by reducing barriers to post-abortal and interval insertion

    Microsoft Academic Search

    Suzan Goodman; Sarah K. Hendlish; Courtney Benedict; Matthew F. Reeves; Madeline Pera-Floyd; Anne Foster-Rosales

    2008-01-01

    BackgroundWe hypothesize that barriers to IUD insertion are central to low utilization in the USA. This study evaluates methods to minimize barriers, including post-abortal insertion, staff training and simplified screening.

  16. Flexible microfluidic devices supported by biodegradable insertion scaffolds for convection-enhanced neural

    E-print Network

    Schaffer, Chris B.

    Flexible microfluidic devices supported by biodegradable insertion scaffolds for convection compared with diffusion mediated delivery. We have fabricated and characterized an implantable microfluidic-C microfluidic channel that is supported during its insertion into tissue by a biodegrad- able poly

  17. Genome sequence comparison of Col and Ler lines reveals the dynamic nature of Arabidopsis chromosomes

    Microsoft Academic Search

    Piotr A. Ziolkowski; Grzegorz Koczyk; Lukasz Galganski; Jan Sadowski

    2009-01-01

    Large differences in plant genome sizes are mainly due to numerous events of insertions or deletions (indels). The balance between these events deter- mines the evolutionary direction of genome changes. To address the question of what phenom- ena trigger these alterations, we compared the genomic sequences of two Arabidopsis thaliana lines, Columbia (Col) and Landsberg erecta (Ler). Based on the

  18. Natural Language Processing for Lines and Devices in Portable Chest X-Rays

    E-print Network

    Rubin, Daniel L.

    /improving patient safety and reducing medical errors #12;Natural Language Processing for Lines and Devices the frequency of infections to the presence or length of time medical devices are present in patients. We a variety of medical devices inserted as part of their course of clinical care. These patients frequently

  19. Clock Line Considerations for an SFQ Large Scale Reconfigurable Data Paths Processor

    Microsoft Academic Search

    Irina Kataeva; Hiroyuki Akaike; Akira Fujimaki; Nobuyuki Yoshikawa; Shuichi Nagasawa; Naofumi Takagi

    2011-01-01

    We have estimated jitter accumulated in data and clock lines of an SFQ Reconfigurable Data Paths processor and its impact on the operating frequency and identified critical components. In order to prevent performance degradation, we have proposed to divide the processor in several parts clocked separately by an external jitter-free system clock. FIFO buffers and clock controllers inserted between the

  20. A broadband series power divider using zero-degree metamaterial phase-shifting lines

    Microsoft Academic Search

    Marco A. Antoniades; George V. Eleftheriades

    2005-01-01

    A metamaterial 1:4 series power divider that provides equal power split to all four output ports over a large bandwidth is presented, which can be extended to an arbitrary number of output ports. The divider comprises four nonradiating metamaterial lines in series, incurring a zero insertion phase over a large bandwidth, while simultaneously maintaining a compact length of ?0\\/8. Compared

  1. Homologous illegitimate random integration of foreign DNA into the X chromosome of a transgenic mouse line

    Microsoft Academic Search

    Bowen Yan; Defa Li; Kemian Gou

    2010-01-01

    BACKGROUND: It is not clear how foreign DNA molecules insert into the host genome. Recently, we have produced transgenic mice to investigate the role of the fad2 gene in the conversion of oleic acid to linoleic acid. Here we describe an integration mechanism of fad2 transgene by homologous illegitimate random integration. RESULTS: We confirmed that one fad2 line had a

  2. An optimal algorithm for the on-line dosest pair problem

    E-print Network

    , the points attive one after another. After a point arrives, we have to update the current closest pair [11]. To update the closest pair when a point is inserted, that algorithm makes some queries. See Preparata and Shamos [6]. In this paper, we consider the on-line closest pair problem. Here

  3. A Finite Element Model to Predict Sound Attenuation in Lined and Parallel-Baffle Rectangular Ducts

    Microsoft Academic Search

    Davide Borelli; Corrado Schenone

    2012-01-01

    The present paper describes a FEM model for the analysis of sound attenuation in lined and parallel-baffle rectangular ducts. By means of the numerical model it was possible to predict insertion losses in a frequency range up to 8000 Hz. The model was validated by comparing numerical results with experimental data obtained in accordance to EN ISO 11691 and EN

  4. 2010Copyright @ Otology & Neurotology, Inc. Unauthorized reproduction of this article is prohibited. Force of Cochlear Implant Electrode Insertion

    E-print Network

    Webster III, Robert James

    . Force of Cochlear Implant Electrode Insertion Performed by a Robotic Insertion Tool: Comparison cochlear implant electrode array insertion offers substantial potential advantages, namely repeatability:1207Y1210, 2010. Recent cochlear implant electrode designs have been aimed at decreasing intracochlear

  5. Assessment and optimal passive-loop mitigation of power lines’ magnetic fields

    Microsoft Academic Search

    Mohamed M. Saied

    2008-01-01

    This paper addresses the issue of the power frequency magnetic field in the vicinity of high voltage lines. Expressions are derived for the intrinsic power-frequency magnetic field. The mitigating effect of passive conductor loops installed below or above the active line conductors, is demonstrated. A further optimizable reduction in the magnetic field can be achieved by inserting properly-selected capacitors and\\/or

  6. Single radium insertion for treatment of early carcinoma of the cervix: rationale and results.

    PubMed

    Bond, W H; Mould, J

    1986-11-01

    Treatment of 1429 Stage 1B, 2A and 2B carcinomas of the cervix by a single radium insertion technique proved this to be a simple and effective method for the management of early carcinoma. The success of a single insertion at the lower of the two levels of dosage used, questions the value of multiple insertions. PMID:3791856

  7. Increasing the dielectric strength of interelectrode inserts in an MHD generator channel by air injection

    Microsoft Academic Search

    E. T. Bazeev; N. I. Mazur; A. A. Miroshnichenko; G. M. Schogolev

    1982-01-01

    Interelectrode insulating inserts have been tested in the plasma dynamic channel of an MHD generator with and without air injection. It is found that the dielectric strength of inserts thermally protected by air injection is higher than that of inserts without air injection, with only a slight resistance drop (no more than 1% for commercial MHD channels).

  8. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants

    E-print Network

    Ausubel, Frederick M.

    experimental conditions. A public, internet-accessible database (the PA14 Transposon Insertion Mu- tantAn ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Ausubel, December 22, 2005 Random transposon insertion libraries have proven invaluable in studying

  9. The use of ray-tracing method for the prediction of the insertion loss of enclosures

    E-print Network

    Paris-Sud XI, Université de

    noise control techniques, enclosures are widely used. Predicting their insertion loss is thereforeThe use of ray-tracing method for the prediction of the insertion loss of enclosures N. Trompette. The model allows calculation of both the insertion loss and the sound pressure outside the enclosure

  10. Simultaneous Shield Insertion and Net Ordering for Capacitive and Inductive Coupling Minimization

    E-print Network

    He, Lei

    are no longer valid with presence of inductive noise, and shield insertion is needed to minimize inductive noise there are no shielding wires (in short, shields), the noise in the quiet victims is 0.71V. As we insert one shield simultaneous shield insertion and net ordering (SINO). # of Shields Noise (% of Vdd) Ki of victims 0 0.71V (55

  11. Experimental study of whistle noise generated by insert edge and oil separator model of refrigeration cycle

    Microsoft Academic Search

    Jiang Du; Hua Ouyang

    2010-01-01

    The compressed air experiments are conducted to investigate the whistle noise radiated from the oil separator component of refrigerant cycle system. Two types of insert edge and a height-adjustable oil separator model are adopted. The acoustic characteristic of flow through plain top insert edge is more likely to be broadband. Flow through ramp top insert edge would induce whistle peaks

  12. Path Based Buffer Insertion C. N. Sze, Charles J. Alpert, Jiang Hu and Weiping Shi

    E-print Network

    Hu, Jiang

    . The noise avoidance issue is addressed in buffer insertion in [3]. Higher order delay models are adoptedPath Based Buffer Insertion C. N. Sze, Charles J. Alpert, Jiang Hu and Weiping Shi EE Dept., Texas insertion plays an increasingly critical role on affecting circuit design and perfor- mance. Traditional

  13. Simultaneous Shield and Buffer Insertion for Crosstalk Noise Reduction in Global Routing

    E-print Network

    Sapatnekar, Sachin

    Simultaneous Shield and Buffer Insertion for Crosstalk Noise Reduction in Global Routing Tianpei the noise requirements due to the contention. This motivates our simultaneous buffer and shield insertion with the func- tional noise as defined above, the insertion of supply shields with stable voltage levels between

  14. Safety and acceptability of post-abortal IUD insertion and the importance of counseling

    Microsoft Academic Search

    Ahmed El-Tagy; Ezzat Sakr; David C. Sokal; Adel Hakim Issa

    2003-01-01

    This nonrandomized observational clinical study evaluated the safety and acceptability of intrauterine device insertion either immediately or 2 weeks after abortion, according to the patient’s preference. Participants were 300 women with first-trimester abortions who agreed to immediate or delayed insertion. End points were bleeding patterns, pregnancy, expulsion, perforation, infection and device removal at 2, 6 and 10 weeks after insertion,

  15. CLOSED FORM SOLUTION TO SIMULTANEOUS BUFFER INSERTION/SIZING AND WIRE SIZING

    E-print Network

    Chu, Chris C.-N.

    m RD L b l2 CL # of buffers? Segment lengths? Segment widths? Where to insert? Buffer sizes? OUTPUTCLOSED FORM SOLUTION TO SIMULTANEOUS BUFFER INSERTION/SIZING AND WIRE SIZING Chris C. N. Chu and D insert bu ers between any two adjacent segments. The sizes of bu ers and the lengths and widths

  16. Membrane insertion profiles of peptides probed by molecular dynamics simulations In-Chul Yeh,*

    E-print Network

    Membrane insertion profiles of peptides probed by molecular dynamics simulations In-Chul Yeh,* Mark@bioanalysis.org Abstract Membrane insertion of small peptides plays important roles in antimicrobial defense, toxin actions synthetic peptides. Molecular dynamics simulation techniques are useful tools to study membrane insertion

  17. Design and implementation of the medium-beta insert of the Fermilab recycler ring

    SciTech Connect

    Weishi Wan et al.

    2001-08-15

    The design of the newly installed medium-{beta} insert of the Fermilab Recycler Ring is presented. The design philosophy is outlined. The stringent optical and physical constraints, as well as their influence on the design, are discussed. The impact of the medium-{beta} insert on the Recycler Ring is shown. Engineering design and installation of the new insert is presented.

  18. Design and implementation of the medium-beta insert of the Fermilab Recycler Ring

    Microsoft Academic Search

    Weishi Wan; C. Gattuso; D. E. Johnson; C. S. Mishra; J. A. Volk

    2001-01-01

    The design of the newly installed medium-? insert of the Fermilab Recycler Ring is presented. The design philosophy is outlined. The stringent optical and physical constraints, as well as their influence on the design, are discussed. The impact of the medium-? insert on the Recycler Ring is shown. The engineering design and installation of the new insert is presented

  19. Nanostructured Li Ion Insertion Electrodes. 1. Discussion on Fast Transport and Short Path for Ion Diffusion

    Microsoft Academic Search

    P. R. Bueno; E. R. Leite

    2003-01-01

    This paper describes the mechanisms of ion and electron transport in nanostructured insertion electrode materials such as metal oxide electrochromics and\\/or Li ion batteries. A general description is given of cases of insertion into a short path region predicted by the geometric disposition of insertion materials in nanostructural electrodes, designed mainly by connected spherical-like particles and nanofibers, both protruding from

  20. SAMPLE Q?RIUS TEACHER-PARENTAL CONSENT FORM I, __________________________________[insert parent or legal guardian name], hereby give

    E-print Network

    Mathis, Wayne N.

    SAMPLE Q?RIUS TEACHER-PARENTAL CONSENT FORM], hereby give permission to my child's teacher ______________________[insert teacher's name] at _____________________________ [insert school name] for the school