Sample records for targeted gene knockdown

  1. A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets

    PubMed Central

    Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

    2014-01-01

    Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways. PMID:25475013

  2. A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets.

    PubMed

    Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

    2014-12-05

    Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways.

  3. Mitochondria-Targeted Antioxidant Prevents Cardiac Dysfunction Induced by Tafazzin Gene Knockdown in Cardiac Myocytes

    PubMed Central

    He, Quan; Harris, Nicole; Ren, Jun; Han, Xianlin

    2014-01-01

    Tafazzin, a mitochondrial acyltransferase, plays an important role in cardiolipin side chain remodeling. Previous studies have shown that dysfunction of tafazzin reduces cardiolipin content, impairs mitochondrial function, and causes dilated cardiomyopathy in Barth syndrome. Reactive oxygen species (ROS) have been implicated in the development of cardiomyopathy and are also the obligated byproducts of mitochondria. We hypothesized that tafazzin knockdown increases ROS production from mitochondria, and a mitochondria-targeted antioxidant prevents tafazzin knockdown induced mitochondrial and cardiac dysfunction. We employed cardiac myocytes transduced with an adenovirus containing tafazzin shRNA as a model to investigate the effects of the mitochondrial antioxidant, mito-Tempo. Knocking down tafazzin decreased steady state levels of cardiolipin and increased mitochondrial ROS. Treatment of cardiac myocytes with mito-Tempo normalized tafazzin knockdown enhanced mitochondrial ROS production and cellular ATP decline. Mito-Tempo also significantly abrogated tafazzin knockdown induced cardiac hypertrophy, contractile dysfunction, and cell death. We conclude that mitochondria-targeted antioxidant prevents cardiac dysfunction induced by tafazzin gene knockdown in cardiac myocytes and suggest mito-Tempo as a potential therapeutic for Barth syndrome and other dilated cardiomyopathies resulting from mitochondrial oxidative stress. PMID:25247053

  4. Quantification of Functionalised Gold Nanoparticle-Targeted Knockdown of Gene Expression in HeLa Cells

    PubMed Central

    Jiwaji, Meesbah; Sandison, Mairi E.; Reboud, Julien; Stevenson, Ross; Daly, Rónán; Barkess, Gráinne; Faulds, Karen; Kolch, Walter; Graham, Duncan; Girolami, Mark A.; Cooper, Jonathan M.; Pitt, Andrew R.

    2014-01-01

    Introduction Gene therapy continues to grow as an important area of research, primarily because of its potential in the treatment of disease. One significant area where there is a need for better understanding is in improving the efficiency of oligonucleotide delivery to the cell and indeed, following delivery, the characterization of the effects on the cell. Methods In this report, we compare different transfection reagents as delivery vehicles for gold nanoparticles functionalized with DNA oligonucleotides, and quantify their relative transfection efficiencies. The inhibitory properties of small interfering RNA (siRNA), single-stranded RNA (ssRNA) and single-stranded DNA (ssDNA) sequences targeted to human metallothionein hMT-IIa are also quantified in HeLa cells. Techniques used in this study include fluorescence and confocal microscopy, qPCR and Western analysis. Findings We show that the use of transfection reagents does significantly increase nanoparticle transfection efficiencies. Furthermore, siRNA, ssRNA and ssDNA sequences all have comparable inhibitory properties to ssDNA sequences immobilized onto gold nanoparticles. We also show that functionalized gold nanoparticles can co-localize with autophagosomes and illustrate other factors that can affect data collection and interpretation when performing studies with functionalized nanoparticles. Conclusions The desired outcome for biological knockdown studies is the efficient reduction of a specific target; which we demonstrate by using ssDNA inhibitory sequences targeted to human metallothionein IIa gene transcripts that result in the knockdown of both the mRNA transcript and the target protein. PMID:24926959

  5. Brain gene expression changes elicited by peripheral vitellogenin knockdown in the honey bee.

    PubMed

    Wheeler, M M; Ament, S A; Rodriguez-Zas, S L; Robinson, G E

    2013-10-01

    Vitellogenin (Vg) is best known as a yolk protein precursor. Vg also functions to regulate behavioural maturation in adult honey bee workers, but the underlying molecular mechanisms by which it exerts this novel effect are largely unknown. We used abdominal vitellogenin (vg) knockdown with RNA interference (RNAi) and brain transcriptomic profiling to gain insights into how Vg influences honey bee behavioural maturation. We found that vg knockdown caused extensive gene expression changes in the bee brain, with much of this transcriptional response involving changes in central biological functions such as energy metabolism. vg knockdown targeted many of the same genes that show natural, maturation-related differences, but the direction of change for the genes in these two contrasts was not correlated. By contrast, vg knockdown targeted many of the same genes that are regulated by juvenile hormone (JH) and there was a significant correlation for the direction of change for the genes in these two contrasts. These results indicate that the tight coregulatory relationship that exists between JH and Vg in the regulation of honey bee behavioural maturation is manifest at the genomic level and suggest that these two physiological factors act through common pathways to regulate brain gene expression and behaviour. © 2013 Royal Entomological Society.

  6. Gene Therapy by Targeted Adenovirus-mediated Knockdown of Pulmonary Endothelial Tph1 Attenuates Hypoxia-induced Pulmonary Hypertension

    PubMed Central

    Morecroft, Ian; White, Katie; Caruso, Paola; Nilsen, Margaret; Loughlin, Lynn; Alba, Raul; Reynolds, Paul N; Danilov, Sergei M; Baker, Andrew H; MacLean, Margaret R

    2012-01-01

    Serotonin is produced by pulmonary arterial endothelial cells (PAEC) via tryptophan hydroxylase-1 (Tph1). Pathologically, serotonin acts on underlying pulmonary arterial cells, contributing to vascular remodeling associated with pulmonary arterial hypertension (PAH). The effects of hypoxia on PAEC-Tph1 activity are unknown. We investigated the potential of a gene therapy approach to PAH using selective inhibition of PAEC-Tph1 in vivo in a hypoxic model of PAH. We exposed cultured bovine pulmonary arterial smooth muscle cells (bPASMCs) to conditioned media from human PAECs (hPAECs) before and after hypoxic exposure. Serotonin levels were increased in hypoxic PAEC media. Conditioned media evoked bPASMC proliferation, which was greater with hypoxic PAEC media, via a serotonin-dependent mechanism. In vivo, adenoviral vectors targeted to PAECs (utilizing bispecific antibody to angiotensin-converting enzyme (ACE) as the selective targeting system) were used to deliver small hairpin Tph1 RNA sequences in rats. Hypoxic rats developed PAH and increased lung Tph1. PAEC-Tph1 expression and development of PAH were attenuated by our PAEC-Tph1 gene knockdown strategy. These results demonstrate that hypoxia induces Tph1 activity and selective knockdown of PAEC-Tph1 attenuates hypoxia-induced PAH in rats. Further investigation of pulmonary endothelial-specific Tph1 inhibition via gene interventions is warranted. PMID:22525513

  7. Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.

    Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less

  8. Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana

    DOE PAGES

    Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.; ...

    2016-02-17

    Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less

  9. Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

    PubMed

    Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

    2017-02-01

    RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

  10. Salt Sensitive Tet-Off-Like Systems to Knockdown Primordial Germ Cell Genes for Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus.

    PubMed

    Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A

    2017-05-31

    Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus . Two primordial germ cell (PGC) marker genes, nanos and dead end , were targeted for knockdown, and an off-target gene, vasa , was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos , full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P₁ fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P₁ fish, most F₁ individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F₂ or F₃ are needed for evaluation.

  11. Salt Sensitive Tet-Off-Like Systems to Knockdown Primordial Germ Cell Genes for Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus

    PubMed Central

    Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A.; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A.

    2017-01-01

    Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown, and an off-target gene, vasa, was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5′ end (N1) or 3′ end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P1 fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P1 fish, most F1 individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F2 or F3 are needed for evaluation. PMID:28561774

  12. Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts

    PubMed Central

    Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek

    2015-01-01

    Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398

  13. Establishment of conditional vectors for hairpin siRNA knockdowns

    PubMed Central

    Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

    2003-01-01

    Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

  14. In Situ Gene Therapy via AAV-CRISPR-Cas9-Mediated Targeted Gene Regulation.

    PubMed

    Moreno, Ana M; Fu, Xin; Zhu, Jie; Katrekar, Dhruva; Shih, Yu-Ru V; Marlett, John; Cabotaje, Jessica; Tat, Jasmine; Naughton, John; Lisowski, Leszek; Varghese, Shyni; Zhang, Kang; Mali, Prashant

    2018-04-25

    Development of efficacious in vivo delivery platforms for CRISPR-Cas9-based epigenome engineering will be critical to enable the ability to target human diseases without permanent modification of the genome. Toward this, we utilized split-Cas9 systems to develop a modular adeno-associated viral (AAV) vector platform for CRISPR-Cas9 delivery to enable the full spectrum of targeted in situ gene regulation functionalities, demonstrating robust transcriptional repression (up to 80%) and activation (up to 6-fold) of target genes in cell culture and mice. We also applied our platform for targeted in vivo gene-repression-mediated gene therapy for retinitis pigmentosa. Specifically, we engineered targeted repression of Nrl, a master regulator of rod photoreceptor determination, and demonstrated Nrl knockdown mediates in situ reprogramming of rod cells into cone-like cells that are resistant to retinitis pigmentosa-specific mutations, with concomitant prevention of secondary cone loss. Furthermore, we benchmarked our results from Nrl knockdown with those from in vivo Nrl knockout via gene editing. Taken together, our AAV-CRISPR-Cas9 platform for in vivo epigenome engineering enables a robust approach to target disease in a genomically scarless and potentially reversible manner. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  15. Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

    PubMed

    Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

    2017-01-01

    Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

  16. Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus, by Knockdown of Primordial Germ Cell Genes with Copper-Sensitive Constructs.

    PubMed

    Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Elaswad, Ahmed; Alsaqufi, Ahmed; Perera, Dayan A; Qin, Zhenkui; Odin, Ramji; Vo, Khoi; Drescher, David; Robinson, Dalton; Dong, Sheng; Zhang, Dan; Shang, Mei; Abass, Nermeen; Das, Sanjay K; Bangs, Max; Dunham, Rex A

    2018-06-01

    Repressible knockdown approaches were investigated to manipulate for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown and an off-target gene, vasa, was monitored. Two potentially copper-sensitive repressible promoters, yeast ctr3 (M) and ctr3-reduced (Mctr), were coupled with four knockdown strategies separately including: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA), and ds-sh RNA-targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with copper sulfate as the repressor compound. Spawning rates of full-sibling P 1 fish exposed or not exposed to the constructs as treated and untreated embryos were 85 and 54%, respectively, indicating potential sterilization of fish and repression of the constructs. In F 1 fish, mRNA expressions of PGC marker genes for most constructs were downregulated in the untreated group and the knockdown was repressed in the treated group. Gonad development in transgenic, untreated F 1 channel catfish was reduced compared to non-transgenic fish for MctrN2, MN1, MN2, and MDND. For 3-year-old adults, gonad size in the transgenic untreated group was 93.4% smaller than the non-transgenic group for females and 92.3% for males. However, mean body weight of transgenic females (781.8 g) and males (883.8 g) was smaller than of non-transgenic counterparts (984.2 and 1254.3 g) at 3 years of age, a 25.8 and 41.9% difference for females and males, respectively. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but negative pleiotropic effects can result.

  17. Novel liposomal combination treatments using dual genes knockdown in oral cancer treatment

    NASA Astrophysics Data System (ADS)

    Wu, Jyun-Sian; Yeh, Chia-Hsien; Huang, Leaf; Hsu, Yih-Chih

    2018-02-01

    Small interfering RNA (siRNA) can be used to treat tumor because it can effectively knockdown target oncoprotein expression and it leads to cancer cell death and apoptosis. Hypoxia-inducible factors-1 (HIF-1) is a transcription factor gene. Its high expression of tumor hypoxia cells, activation of transcription factor HIF-1α and angiogenesis found in most cancerous tissues. HIF-1α protein in cancer cells are critical to cell survival, tumor growth and proliferation. Epidermal growth factor receptor (EGFR) gene is another common head and neck oncogene. The dual self-designed siRNA sequences were encapsulated in the lipid-calcium-phosphate (LCP) and targeted to sigma receptors on the surface of cancer cells via binding to amino ethyl anisamide (AEAA). We used human oral cancer cells to establish the xenograft animal model to study the combination therapy for therapeutic results.

  18. Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.

    PubMed

    Pauli, Andrea; Montague, Tessa G; Lennox, Kim A; Behlke, Mark A; Schier, Alexander F

    2015-01-01

    Antisense oligonucleotides (ASOs) are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO)-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA) MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.

  19. RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells.

    PubMed

    Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S

    2011-11-01

    Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular

  20. RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells

    PubMed Central

    Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen

    2011-01-01

    Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury

  1. Gene expression profiling of selenophosphate synthetase 2 knockdown in Drosophila melanogaster.

    PubMed

    Li, Gaopeng; Liu, Liying; Li, Ping; Chen, Luonan; Song, Haiyun; Zhang, Yan

    2016-03-01

    Selenium (Se) is an important trace element for many organisms and is incorporated into selenoproteins as selenocysteine (Sec). In eukaryotes, selenophosphate synthetase SPS2 is essential for Sec biosynthesis. In recent years, genetic disruptions of both Sec biosynthesis genes and selenoprotein genes have been investigated in different animal models, which provide important clues for understanding the Se metabolism and function in these organisms. However, a systematic study on the knockdown of SPS2 has not been performed in vivo. Herein, we conducted microarray experiments to study the transcriptome of fruit flies with knockdown of SPS2 in larval and adult stages. Several hundred differentially expressed genes were identified in each stage. In spite that the expression levels of other Sec biosynthesis genes and selenoprotein genes were not significantly changed, it is possible that selenoprotein translation might be reduced without impacting the mRNA level. Functional enrichment and network-based analyses revealed that although different sets of differentially expressed genes were obtained in each stage, they were both significantly enriched in the carbohydrate metabolism and redox processes. Furthermore, protein-protein interaction (PPI)-based network clustering analysis implied that several hub genes detected in the top modules, such as Nimrod C1 and regucalcin, could be considered as key regulators that are responsible for the complex responses caused by SPS2 knockdown. Overall, our data provide new insights into the relationship between Se utilization and several fundamental cellular processes as well as diseases.

  2. A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

    PubMed Central

    Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

    2013-01-01

    The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

  3. Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

    PubMed

    Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

    2018-05-18

    Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

  4. Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

    PubMed

    Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

    2016-03-20

    RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

  5. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

    PubMed Central

    Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E.; Seidman, Jonathan G.; Pu, William T.; Wang, Da-Zhi

    2016-01-01

    Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimalimmunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations. PMID:28060283

  6. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.

    PubMed

    Ding, Jian; Lin, Zhi-Qiang; Jiang, Jian-Ming; Seidman, Christine E; Seidman, Jonathan G; Pu, William T; Wang, Da-Zhi

    2016-12-17

    Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

  7. [Effect of NOR1 gene knockdown on the biological behavior of HeLa cells].

    PubMed

    Tan, Yixin; Li, Wenjuan; Yi, Mei; Wang, Wei; Zheng, Pan; Zhang, Haijing; Xiang, Bo; Li, Guiyuan

    2014-08-01

    To explore the effect of the oxidored nitro domain containing protein 1 (NOR1) gene knockdown on the biological behavior of HeLa cells in cervical carcinoma. The recombinant plasmids pSUPER-shNOR1-1, pSUPER-shNOR1-2 and pSUPERscramble, which targeted to NOR1 gene, were constructed by pSUPER.neo+GFP vector, transfected into HeLa cells respectively using Lipofectamine 2000 reagent, and followed by G418 selection. The expression level of NOR1 mRNA and protein were determined by RT-PCR and Western blotting, respectively. Methyl thiazolyl tetrazolium (MTT) assay was performed to determine the growth curve of cell viability. The stable transfectants were treated with H₂O₂ and cell apoptosis was determined by Hoechst 33258 staining and terminal deoxynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) assay. The expression levels of Bcl-2, cleaved caspase 9 and poly ADP-ribose polymerase (PARP) were measured by Western blot. NOR1- knockdown HeLa cells were successfully constructed by transfection of pSUPER-shNOR1-1 or pSUPER-shNOR1-2 plasmids into HeLa cells. MTT assay showed that the silence of endogenous NOR1 in HeLa cells could lead to the increase in cell viability and proliferation, and the inhibition of H₂O₂-induced apoptosis compared with the negative control. Western blot showed that the expression level of active caspase 9 and cleaved PARP was inhibited in NOR1-knockdown cells when they were treated with H₂O₂ while the expression level of Bcl-2 protein increased. Silence of endogenous NOR1 facilitates the cell viability and growth of HeLa cells, and attenuates HeLa cells apoptosis induced by H₂O₂, which might be mediated by up-regulation of Bcl-2 level and down-regulation of the cleaved caspase 9 cascade.

  8. shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

    PubMed

    Basit, Abdul; Tang, Wenwen; Wu, Dianqing

    2016-01-01

    To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.

  9. Neuron-specific knockdown of Drosophila PDHB induces reduction of lifespan, deficient locomotive ability, abnormal morphology of motor neuron terminals and photoreceptor axon targeting.

    PubMed

    Dung, Vuu My; Suong, Dang Ngoc Anh; Okamaoto, Yuji; Hiramatsu, Yu; Thao, Dang Thi Phuong; Yoshida, Hideki; Takashima, Hiroshi; Yamaguchi, Masamitsu

    2018-05-15

    Pyruvate dehydrogenase complex deficiency (PDCD) is a common primary cause of defects in mitochondrial function and also can lead to peripheral neuropathy. Pyruvate dehydrogenase E1 component subunit beta (PDHB) is a subunit of pyruvate dehydrogenase E1, which is a well-known component of PDC. In Drosophila melanogaster, the CG11876 (dPDHB) gene is a homolog of human PDHB. In this study, we established a Drosophila model with neuron-specific knockdown of dPDHB to investigate its role in neuropathy pathogenesis. Knockdown of dPDHB in pan-neurons induced locomotor defects in both larval and adult stages, which were consistent with abnormal morphology of the motor neuron terminals at neuromuscular junctions and mitochondrial fragmentation in brains. Moreover, neuron-specific knockdown of dPDHB also shortened the lifespan of adult flies. In addition, flies with knockdown of dPDHB manifested a rough eye phenotype and aberrant photoreceptor axon targeting. These results with the Drosophila model suggest the involvement of PDHB in peripheral neuropathy. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Brain-Targeted (Pro)Renin Receptor Knockdown attenuates Angiotensin II-Dependent Hypertension

    PubMed Central

    Li, Wencheng; Peng, Hua; Cao, Theresa; Sato, Ryosuke; McDaniels, Sarah. J.; Kobori, Hiroyuki; Navar, L. Gabriel; Feng, Yumei

    2012-01-01

    The (pro)renin receptor is a newly discovered member of the brain renin-angiotensin system. To investigate the role of brain (pro)renin receptor in hypertension, adeno-associated virus-mediated (pro)renin receptor shRNA was used to knockdown (pro)renin receptor expression in the brain of non-transgenic normotensive and human renin-angiotensinogen double transgenic hypertensive mice. Blood pressure was monitored using implanted telemetric probes in conscious animals. Real-time PCR and immunostaining were performed to determine (pro)renin receptor, angiotensin II type 1 receptor and vasopressin mRNA levels. Plasma vasopressin levels were determined by Enzyme-Linked Immuno Sorbent Assay. Double transgenic mice exhibited higher blood pressure, elevated cardiac and vascular sympathetic tone, and impaired spontaneous baroreflex sensitivity. Intracerebroventricular delivery of (pro)renin receptor shRNA significantly reduced blood pressure, cardiac and vasomotor sympathetic tone, and improved baroreflex sensitivity compared to the control virus treatment in double transgenic mice. (Pro)renin receptor knockdown significantly reduced angiotensin II type 1 receptor and vasopressin levels in double transgenic mice. These data indicate that (pro)renin receptor knockdown in the brain attenuates angiotensin II-dependent hypertension and is associated with a decrease insympathetic tone and an improvement of the baroreflex sensitivity. In addition, brain-targeted (pro)renin receptor knockdown is associated with down-regulation of angiotensin II type 1 receptor and vasopressin levels. We conclude that central (pro)renin receptor contributes to the pathogenesis of hypertension in human renin-angiotensinogen transgenic mice. PMID:22526255

  11. Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

    PubMed

    Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

    2015-01-01

    We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

  12. miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

    PubMed Central

    Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

    2015-01-01

    RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

  13. Knockdown of the schizophrenia susceptibility gene TCF4 alters gene expression and proliferation of progenitor cells from the developing human neocortex.

    PubMed

    Hill, Matthew J; Killick, Richard; Navarrete, Katherinne; Maruszak, Aleksandra; McLaughlin, Gemma M; Williams, Brenda P; Bray, Nicholas J

    2017-05-01

    Common variants in the TCF4 gene are among the most robustly supported genetic risk factors for schizophrenia. Rare TCF4 deletions and loss-of-function point mutations cause Pitt-Hopkins syndrome, a developmental disorder associated with severe intellectual disability. To explore molecular and cellular mechanisms by which TCF4 perturbation could interfere with human cortical development, we experimentally reduced the endogenous expression of TCF4 in a neural progenitor cell line derived from the developing human cerebral cortex using RNA interference. Effects on genome-wide gene expression were assessed by microarray, followed by Gene Ontology and pathway analysis of differentially expressed genes. We tested for genetic association between the set of differentially expressed genes and schizophrenia using genome-wide association study data from the Psychiatric Genomics Consortium and competitive gene set analysis (MAGMA). Effects on cell proliferation were assessed using high content imaging. Genes that were differentially expressed following TCF4 knockdown were highly enriched for involvement in the cell cycle. There was a nonsignificant trend for genetic association between the differentially expressed gene set and schizophrenia. Consistent with the gene expression data, TCF4 knockdown was associated with reduced proliferation of cortical progenitor cells in vitro. A detailed mechanistic explanation of how TCF4 knockdown alters human neural progenitor cell proliferation is not provided by this study. Our data indicate effects of TCF4 perturbation on human cortical progenitor cell proliferation, a process that could contribute to cognitive deficits in individuals with Pitt-Hopkins syndrome and risk for schizophrenia.

  14. A Simple Retroelement Based Knock-Down System in Dictyostelium: Further Insights into RNA Interference Mechanisms.

    PubMed

    Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang

    2015-01-01

    We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.

  15. Knockdown of astrocyte elevated gene-1 inhibits tumor growth and modifies microRNAs expression profiles in human colorectal cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Sujun; Southern Medical University, Guangzhou, Guangdong 510515; Wu, Binwen, E-mail: wubinwengd@aliyun.com

    2014-02-14

    Highlights: • AEG-1 expression in CRC cell lines and down-regulation or upregulation of AEG-1 in vitro. • Knockdown of AEG-1 inhibits cell proliferation, colony formation and invasion. • Upregulation of AEG-1 enhances proliferation, invasion and colony formation. • Knockdown of AEG-1 accumulates G0/G1-phase cells and promotes apoptosis in CRC cells. • AEG-1 knockdown increases 5-FU cytotoxicity. - Abstract: Astrocyte elevated gene-1 (AEG-1), upregulated in various types of malignancies including colorectal cancer (CRC), has been reported to be associated with the carcinogenesis. MicroRNAs (miRNAs) are widely involved in the initiation and progression of cancer. However, the functional significance of AEG-1 andmore » the relationship between AEG-1 and microRNAs in human CRC remains unclear. The aim of this study was to investigate whether AEG-1 could serve as a potential therapeutic target of human CRC and its possible mechanism. We adopted a strategy of ectopic overexpression or RNA interference to upregulate or downregulate expression of AEG-1 in CRC models. Their phenotypic changes were analyzed by Western blot, MTT and transwell matrix penetration assays. MicroRNAs expression profiles were performed using microarray analysis followed by validation using qRT-PCR. Knockdown of AEG-1 could significantly inhibit colon cancer cell proliferation, colony formation, invasion and promotes apoptosis. Conversely, upregulation of AEG-1 could significantly enhance cell proliferation, invasion and reduced apoptisis. AEG-1 directly contributes to resistance to chemotherapeutic drug. Targeted downregulation of AEG-1 might improve the expression of miR-181a-2{sup ∗}, -193b and -193a, and inversely inhibit miR-31 and -9{sup ∗}. Targeted inhibition of AEG-1 can lead to modification of key elemental characteristics, such as miRNAs, which may become a potential effective therapeutic strategy for CRC.« less

  16. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  17. Phenotypic effects induced by knock-down of the period clock gene in Bombyx mori.

    PubMed

    Sandrelli, Federica; Cappellozza, Silvia; Benna, Clara; Saviane, Alessio; Mastella, Antonio; Mazzotta, Gabriella M; Moreau, Stephane; Pegoraro, Mirko; Piccin, Alberto; Zordan, Mauro A; Cappellozza, Luciano; Kyriacou, Charalambos P; Costa, Rodolfo

    2007-04-01

    The lepidopteran Bombyx mori is an insect of considerable scientific and economic importance. Recently, the B. mori circadian clock gene period has been molecularly characterized. We have transformed a B. mori strain with a construct encoding a period double-strand RNA in order to knock-down period gene expression. We observe that this post-transcriptional silencing produces a small but detectable disruption in the egg-hatching rhythm, as well as a reduction in egg-to-adult developmental time, without altering silk production parameters. Thus we show that both circadian and non-circadian phenotypes can be altered by changing per expression, and, at a practical level, these results suggest that per knock-down may provide a suitable strategy for improving the efficiency of rearing, without affecting silk productivity.

  18. Neuron-specific knockdown of the Drosophila fat induces reduction of life span, deficient locomotive ability, shortening of motoneuron terminal branches and defects in axonal targeting.

    PubMed

    Nakamura, Aya; Tanaka, Ryo; Morishita, Kazushige; Yoshida, Hideki; Higuchi, Yujiro; Takashima, Hiroshi; Yamaguchi, Masamitsu

    2017-07-01

    Mutations in FAT4 gene, one of the human FAT family genes, have been identified in Van Maldergem syndrome (VMS) and Hennekam lymphangiectasia-lymphedema syndrome (HS). The FAT4 gene encodes a large protein with extracellular cadherin repeats, EGF-like domains and Laminin G-like domains. FAT4 plays a role in tumor suppression and planar cell polarity. Drosophila contains a human FAT4 homologue, fat. Drosophila fat has been mainly studied with Drosophila eye and wing systems. Here, we specially knocked down Drosophila fat in nerve system. Neuron-specific knockdown of fat shortened the life span and induced the defect in locomotive abilities of adult flies. In consistent with these phenotypes, defects in synapse structure at neuromuscular junction were observed in neuron-specific fat-knockdown flies. In addition, aberrations in axonal targeting of photoreceptor neuron in third-instar larvae were also observed, suggesting that fat involves in axonal targeting. Taken together, the results indicate that Drosophila fat plays an essential role in formation and/or maintenance of neuron. Both VMS and HS show mental retardation and neuronal defects. We therefore consider that these two rare human diseases could possibly be caused by the defect in FAT4 function in neuronal cells. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  19. Gene-knockdown in the honey bee mite Varroa destructor by a non-invasive approach: studies on a glutathione S-transferase

    PubMed Central

    2010-01-01

    Background The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi). Results Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment. Conclusions Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks

  20. Sustained conditional knockdown reveals intracellular bone sialoprotein as essential for breast cancer skeletal metastasis.

    PubMed

    Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M; Berger, Martin R

    2014-07-30

    Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-reg-ulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic le-sions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant de-creases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions.

  1. Sustained conditional knockdown reveals intracellular bone sialoprotein as essential for breast cancer skeletal metastasis

    PubMed Central

    Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M.; Berger, Martin R.

    2014-01-01

    Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-regulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic lesions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant decreases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions. PMID:24980816

  2. Dmpk gene deletion or antisense knockdown does not compromise cardiac or skeletal muscle function in mice

    PubMed Central

    Carrell, Samuel T.; Carrell, Ellie M.; Auerbach, David; Pandey, Sanjay K.; Bennett, C. Frank; Dirksen, Robert T.; Thornton, Charles A.

    2016-01-01

    Myotonic dystrophy type 1 (DM1) is a genetic disorder in which dominant-active DM protein kinase (DMPK) transcripts accumulate in nuclear foci, leading to abnormal regulation of RNA processing. A leading approach to treat DM1 uses DMPK-targeting antisense oligonucleotides (ASOs) to reduce levels of toxic RNA. However, basal levels of DMPK protein are reduced by half in DM1 patients. This raises concern that intolerance for further DMPK loss may limit ASO therapy, especially since mice with Dmpk gene deletion reportedly show cardiac defects and skeletal myopathy. We re-examined cardiac and muscle function in mice with Dmpk gene deletion, and studied post-maturity knockdown using Dmpk-targeting ASOs in mice with heterozygous deletion. Contrary to previous reports, we found no effect of Dmpk gene deletion on cardiac or muscle function, when studied on two genetic backgrounds. In heterozygous knockouts, the administration of ASOs reduced Dmpk expression in cardiac and skeletal muscle by > 90%, yet survival, electrocardiogram intervals, cardiac ejection fraction and muscle strength remained normal. The imposition of cardiac stress by pressure overload, or muscle stress by myotonia, did not unmask a requirement for DMPK. Our results support the feasibility and safety of using ASOs for post-transcriptional silencing of DMPK in muscle and heart. PMID:27522499

  3. Dual knockdown of N-ras and epiregulin synergistically suppressed the growth of human hepatoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Meng; He, Hong-wei; Sun, Huan-xing

    2009-09-18

    Hepatocellular carcinoma (HCC) is a major challenge because of its resistance to conventional cytotoxic chemotherapy and radiotherapy. Multi-targeted therapy might be a new option for HCC treatment. Our previous study showed that N-ras gene was activated in HCC and was inhibited by RNA interference. In the present study, we investigated the alternation of gene expression by microarray in N-Ras-siRNA-treated HepG2 cells. The results revealed that the EREG gene, encoding epiregulin, was dramatically up-regulated in response to silence of N-ras. We speculated that the up-regulation of epiregulin was involved in the compensatory mechanism of N-ras knockdown for cell growth. Therefore, wemore » evaluated whether dual silence of N-ras and epiregulin display a greater suppression of cell growth. The results confirmed that dual knockdown of N-ras and epiregulin synergistically inhibited cell growth. Our results also showed that dual knockdown of N-ras and epiregulin significantly induced cell arrest at G0/G1 phase. Furthermore, Western blot assay showed that dual knockdown of N-ras and epiregulin markedly reduced the phosphorylations of ERK1/2, Akt and Rb, and inhibited the expression of cyclin D1. Our findings imply that multi-targeted silence of oncogenes might be an effective treatment for HCC.« less

  4. Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

    PubMed Central

    Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

    2011-01-01

    Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

  5. Gene therapy knockdown of VEGFR2 in retinal endothelial cells to treat retinopathy.

    PubMed

    Simmons, Aaron B; Bretz, Colin A; Wang, Haibo; Kunz, Eric; Hajj, Kassem; Kennedy, Carson; Yang, Zhihong; Suwanmanee, Thipparat; Kafri, Tal; Hartnett, M Elizabeth

    2018-05-05

    Inhibition of vascular endothelial growth factor (VEGF) in retinopathy of prematurity (ROP) raises concerns for premature infants because VEGF is essential for retinovascular development as well as neuronal and glial health. This study tested the hypothesis that endothelial cell-specific knockdown of VEGF receptor 2 (VEGFR2), or downstream STAT3, would inhibit VEGF-induced retinopathy without delaying physiologic retinal vascular development. We developed an endothelial cell-specific lentiviral vector that delivered shRNAs to VEGFR2 or STAT3 and a green fluorescent protein reporter under control of the VE-cadherin promoter. The specificity and efficacy of the lentiviral vector-driven shRNAs were validated in vitro and in vivo. In the rat oxygen-induced retinopathy model highly representative of human ROP, the effects of endothelial cell knockdown of VEGFR2 or STAT3 were determined on intravitreal neovascularization (IVNV), physiologic retinal vascular development [assessed as area of peripheral avascular/total retina (AVA)], retinal structure, and retinal function. Targeted knockdown of VEGFR2 or STAT3 specifically in retinal endothelial cells by subretinal injection of lentiviral vectors into postnatal day 8 rat pup eyes efficiently inhibited IVNV, and knockdown of VEGFR2 also reduced AVA and increased retinal thickness without altering retinal function. Taken together, our results support specific knockdown of VEGFR2 in retinal endothelial cells as a novel therapeutic method to treat retinopathy.

  6. Knockdown of the placental growth factor gene inhibits laser induced choroidal neovascularization in a murine model.

    PubMed

    Nourinia, Ramin; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Akrami, Hassan; Rezaei Kanavi, Mozhgan; Samiei, Shahram

    2013-01-01

    To evaluate the effect of placental growth factor (PlGF) gene knockdown in a murine model of laser-induced choroidal neovascularization. Choroidal neovascularization was induced in the left eyes of 11 mice by infrared laser. Small interfering RNA (siRNA, 20 picomoles/10 μl) corresponding to PlGF mRNA was administered intravitreally by Hamilton syringe in all subjects. One month later, fluorescein angiography and histolologic examination were performed. No leakage was apparent in the 11 eyes treated with siRNA cognate to PlGF. The results of histological evaluation were consistent with angiographic findings showing absence of choroidal neovascularization. Knockdown of the PlGF gene can inhibit the growth of laser-induced choroidal neovascularization in mice.

  7. Knockdown of Oncogenic KRAS in Non-Small Cell Lung Cancers Suppresses Tumor Growth and Sensitizes Tumor Cells to Targeted Therapy

    PubMed Central

    Sunaga, Noriaki; Shames, David S.; Girard, Luc; Peyton, Michael; Larsen, Jill E.; Imai, Hisao; Soh, Junichi; Sato, Mitsuo; Yanagitani, Noriko; Kaira, Kyoichi; Xie, Yang; Gazdar, Adi F.; Mori, Masatomo; Minna, John D.

    2011-01-01

    Oncogenic KRAS is found in >25% of lung adenocarcinomas, the major histologic subtype of non-small cell lung cancer (NSCLC), and is an important target for drug development. To this end, we generated four NSCLC lines with stable knockdown selective for oncogenic KRAS. As expected, stable knockdown of oncogenic KRAS led to inhibition of in vitro and in vivo tumor growth in the KRAS mutant NSCLC cells, but not in NSCLC cells that have wild-type KRAS (but mutant NRAS). Surprisingly, we did not see large-scale induction of cell death and the growth inhibitory effect was not complete. To further understand the ability of NSCLCs to grow despite selective removal of mutant KRAS expression, we performed microarray expression profiling of NSCLC cell lines with or without mutant KRAS knockdown and isogenic human bronchial epithelial cell lines (HBECs) with and without oncogenic KRAS. We found that while the MAPK pathway is significantly down-regulated after mutant KRAS knockdown, these NSCLCs showed increased levels of phospho-STAT3 and phospho-EGFR, and variable changes in phospho-Akt. In addition, mutant KRAS knockdown sensitized the NSCLCs to p38 and EGFR inhibitors. Our findings suggest that targeting oncogenic KRAS by itself will not be sufficient treatment but may offer possibilities of combining anti-KRAS strategies with other targeted drugs. PMID:21306997

  8. Knockdown of the Placental Growth Factor Gene Inhibits Laser Induced Choroidal Neovascularization in a Murine Model

    PubMed Central

    Nourinia, Ramin; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Akrami, Hassan; Rezaei Kanavi, Mozhgan; Samiei, Shahram

    2013-01-01

    Purpose To evaluate the effect of placental growth factor (PlGF) gene knockdown in a murine model of laser-induced choroidal neovascularization. Methods Choroidal neovascularization was induced in the left eyes of 11 mice by infrared laser. Small interfering RNA (siRNA, 20 picomoles/10 μl) corresponding to PlGF mRNA was administered intravitreally by Hamilton syringe in all subjects. One month later, fluorescein angiography and histolologic examination were performed. Results No leakage was apparent in the 11 eyes treated with siRNA cognate to PlGF. The results of histological evaluation were consistent with angiographic findings showing absence of choroidal neovascularization. Conclusion Knockdown of the PlGF gene can inhibit the growth of laser-induced choroidal neovascularization in mice. PMID:23825706

  9. Knockdown of miR-210 decreases hypoxic glioma stem cells stemness and radioresistance.

    PubMed

    Yang, Wei; Wei, Jing; Guo, Tiantian; Shen, Yueming; Liu, Fenju

    2014-08-01

    Glioma contains abundant hypoxic regions which provide niches to promote the maintenance and expansion of glioma stem cells (GSCs), which are resistant to conventional therapies and responsible for recurrence. Given the fact that miR-210 plays a vital role in cellular adaption to hypoxia and in stem cell survival and stemness maintenance, strategies correcting the aberrantly expressed miR-210 might open up a new therapeutic avenue to hypoxia GSCs. In the present study, to explore the possibility of miR-210 as an effective therapeutic target to hypoxic GSCs, we employed a lentiviral-mediated anti-sense miR-210 gene transfer technique to knockdown miR-210 expression and analyze phenotypic changes in hypoxic U87s and SHG44s cells. We found that hypoxia led to an increased HIF-2α mRNA expression and miR-210 expression in GSCs. Knockdown of miR-210 decreased neurosphere formation capacity, stem cell marker expression and cell viability, and induced differentiation and G0/G1 arrest in hypoxic GSCs by partially rescued Myc antagonist (MNT) protein expression. Knockdown of MNT could reverse the gene expression changes and the growth inhibition resulting from knockdown of miR-210 in hypoxic GSCs. Moreover, knockdown of miR-210 led to increased apoptotic rate and Caspase-3/7 activity and decreased invasive capacity, reactive oxygen species (ROS) and lactate production and radioresistance in hypoxic GSCs. These findings suggest that miR-210 might be a potential therapeutic target to eliminate GSCs located in hypoxic niches. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. A splice junction-targeted CRISPR approach (spJCRISPR) reveals human FOXO3B to be a protein-coding gene.

    PubMed

    Santo, Evan E; Paik, Jihye

    2018-06-17

    The rapid development of CRISPR technology is revolutionizing molecular approaches to the dissection of complex biological phenomena. Here we describe an alternative generally applicable implementation of the CRISPR-Cas9 system that allows for selective knockdown of extremely homologous genes. This strategy employs the lentiviral delivery of paired sgRNAs and nickase Cas9 (Cas9D10A) to achieve targeted deletion of splice junctions. This general strategy offers several advantages over standard single-guide exon-targeting CRISPR-Cas9 such as greatly reduced off-target effects, more restricted genomic editing, routine disruption of target gene mRNA expression and the ability to differentiate between closely related genes. Here we demonstrate the utility of this strategy by achieving selective knockdown of the highly homologous human genes FOXO3A and suspected pseudogene FOXO3B. We find the spJCRISPR strategy to efficiently and selectively disrupt FOXO3A and FOXO3B mRNA and protein expression; thus revealing that the human FOXO3B locus encodes a bona fide human gene. Unlike FOXO3A, we find the FOXO3B protein to be cytosolically localized in both the presence and absence of active Akt. The ability to selectively target and efficiently disrupt the expression of the closely-related FOXO3A and FOXO3B genes demonstrates the efficacy of the spJCRISPR approach. Copyright © 2018. Published by Elsevier B.V.

  11. Response of Two Heat Shock Genes to Selection for Knockdown Heat Resistance in Drosophila Melanogaster

    PubMed Central

    McColl, G.; Hoffmann, A. A.; McKechnie, S. W.

    1996-01-01

    To identify genes involved in stress resistance and heat hardening, replicate lines of Drosophila melanogaster were selected for increased resistance to knockdown by a 39° heat stress. Two selective regimes were used, one with and one without prior hardening. Mean knockdown times were increased from ~5 min to >20 min after 18 generations. Initial realized heritabilities were as high as 10% for lines selected without hardening, and crosses between lines indicated simple additive gene effects for the selected phenotypes. To survey allelic variation and correlated selection responses in two candidate stress genes, hsr-omega and hsp68, we applied denaturing gradient gel electrophoresis to amplified DNA sequences from small regions of these genes. After eight generations of selection, allele frequencies at both loci showed correlated responses for selection following hardening, but not without hardening. The hardening process itself was associated with a hsp68 frequency change in the opposite direction to that associated with selection that followed hardening. These stress loci are closely linked on chromosome III, and the hardening selection established a disequilibrium, suggesting an epistatic effect on resistance. The data indicate that molecular variation in both hsr-omega and hsp68 contribute to natural heritable variation for hardened heat resistance. PMID:8844150

  12. RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum.

    PubMed

    Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G

    2016-07-14

    The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.

  13. ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells.

    PubMed

    Bao, Lingjie; Wu, Jianfa; Dodson, Matthew; Rojo de la Vega, Elisa Montserrat; Ning, Yan; Zhang, Zhenbo; Yao, Ming; Zhang, Donna D; Xu, Congjian; Yi, Xiaofang

    2017-06-01

    Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer cells, respectively. These two pairs of stable cell lines were then subjected to microarray analysis, where we identified 18 putative NRF2 target genes. Among these genes, ABCF2, a cytosolic member of the ABC superfamily of transporters, has previously been reported to contribute to chemoresistance in clear cell ovarian cancer. A detailed analysis on ABCF2 revealed a functional antioxidant response element (ARE) in its promoter region, establishing ABCF2 as an NRF2 target gene. Next, we investigated the contribution of ABCF2 in NRF2-mediated cisplatin resistance using our stable ovarian cancer cell lines. The NRF2-overexpressing cell line, containing high levels of ABCF2, was more resistant to cisplatin-induced apoptosis compared to its control cell line; whereas the NRF2 knockdown cell line with low levels of ABCF2, was more sensitive to cisplatin treatment than its control cell line. Furthermore, transient overexpression of ABCF2 in the parental cells decreased apoptosis and increased cell viability following cisplatin treatment. Conversely, knockdown of ABCF2 using specific siRNA notably increased apoptosis and decreased cell viability in cisplatin-resistant cells treated with cisplatin. This data indicate that the novel NRF2 target gene, ABCF2, plays a critical role in cisplatin resistance in ovarian cancer, and that targeting ABCF2 may be a new strategy to improve chemotherapeutic efficiency. © 2017 Wiley Periodicals, Inc.

  14. RNAi-Mediated Knockdown of IKK1 in Transgenic Mice Using a Transgenic Construct Containing the Human H1 Promoter

    PubMed Central

    Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos

    2014-01-01

    Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631

  15. [Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

    PubMed

    Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

    2018-01-01

    Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

  16. Egr1 gene knockdown affects embryonic ocular development in zebrafish.

    PubMed

    Hu, Chao-Yu; Yang, Chang-Hao; Chen, Wei-Yu; Huang, Chiu-Ju; Huang, Hsing-Yen; Chen, Muh-Shy; Tsai, Huai-Jen

    2006-10-26

    To identify the changes in zebrafish embryonic ocular development after early growth response factor 1 (Egr1) gene knockdown by Egr1-specific translation inhibitor, morpholino oligonucleotides (MO). Two kinds of Egr1-MO were microinjected separately with various dosages into one to four celled zebrafish embryos to find an optimal dose generating an acceptable mortality rate and high frequency of specific phenotype. Chordin-MO served as the positive control; a 5 mismatch MO of Egr1-MO1 and a nonspecific MO served as negative controls. We graded the Egr1 morphants according to their gross abnormalities, and measured their ocular dimensions accordingly. Western blot analysis and synthetic Egr1 mRNA rescue experiments confirmed whether the deformities were caused by Egr1 gene knockdown. Histological examination and three kinds of immunohistochemical staining were applied to identify glutamate receptor one expression in retinal ganglion cells and amacrine cells, to recognize acetylated alpha-tubulin expression which indicated axonogenesis, and to label photoreceptor cells with zpr-1 antibody. After microinjection of 8 ng Egr1-MO1 or 2 ng Egr1-MO2, 81.8% and 97.3% of larvae at 72 h postfertilization had specific defects, respectively. The gross phenotype included string-like heart, flat head, and deformed tail. The more severely deformed larvae had smaller eyes and pupils. Co-injection of 8 ng Egr1-MO1 and supplementary 12 pg synthetic Egr1 mRNA reduced the gross abnormality rate from 84.4% to 29.7%, and decreased the severity of deformities. Egr1 protein appeared in the wildtype and rescued morphants, but was lacking in the Egr1 morphants with specific deformities. Lenses of Egr1 morphants were smaller and had some residual nucleated lens fiber cells. Morphants' retinal cells arranged disorderly and compactly with thin plexiform layers. Immunohistochemical studies showed that morphants had a markedly decreased number of mature retinal ganglion cells, amacrine cells, and

  17. Stable SREBP-1a knockdown decreases the cell proliferation rate in human preadipocyte cells without inducing senescence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alvarez, María Soledad; Fernandez-Alvarez, Ana; Cucarella, Carme

    2014-04-25

    Highlights: • SGBS cells mostly expressed SREBP-1a variant. • SREBP-1a knockdown decreased the proliferation of SGBS cells without inducing senescence. • We have identified RBBP8 and CDKN3 genes as potential SREBP-1a targets. - Abstract: Sterol regulatory element binding proteins (SREBP), encoded by the Srebf1 and Srebf2 genes, are important regulators of genes involved in cholesterol and fatty acid metabolism. Whereas SREBP-2 controls the cholesterol synthesis, SREBP-1 proteins (-1a and -1c) function as the central hubs in lipid metabolism. Despite the key function of these transcription factors to promote adipocyte differentiation, the roles of SREBP-1 proteins during the preadipocyte state remainmore » unknown. Here, we evaluate the role of SREBP-1 in preadipocyte proliferation using RNA interference technology. Knockdown of the SREBP-1a gene decreased the proliferation rate in human SGBS preadipocyte cell strain without inducing senescence. Furthermore, our data identified retinoblastoma binding protein 8 and cyclin-dependent kinase inhibitor 3 genes as new potential SREBP-1 targets, in addition to cyclin-dependent kinase inhibitor 1A which had already been described as a gene regulated by SREBP-1a. These data suggested a new role of SREBP-1 in adipogenesis via regulation of preadipocyte proliferation.« less

  18. Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

    PubMed

    Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

    2013-01-01

    The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited "half-ecdysis". In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control.

  19. Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua

    PubMed Central

    Zhang, Zan; Xing, Yanru; Li, Fei

    2013-01-01

    The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1st to 5th instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4th instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20–94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited “half-ecdysis”. In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control. PMID

  20. Catalytic in vivo protein knockdown by small-molecule PROTACs

    PubMed Central

    Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M

    2015-01-01

    The current predominant theapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target’s ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522

  1. Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

    PubMed

    Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

    2013-01-01

    Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

  2. The drug target genes show higher evolutionary conservation than non-target genes.

    PubMed

    Lv, Wenhua; Xu, Yongdeng; Guo, Yiying; Yu, Ziqi; Feng, Guanglong; Liu, Panpan; Luan, Meiwei; Zhu, Hongjie; Liu, Guiyou; Zhang, Mingming; Lv, Hongchao; Duan, Lian; Shang, Zhenwei; Li, Jin; Jiang, Yongshuai; Zhang, Ruijie

    2016-01-26

    Although evidence indicates that drug target genes share some common evolutionary features, there have been few studies analyzing evolutionary features of drug targets from an overall level. Therefore, we conducted an analysis which aimed to investigate the evolutionary characteristics of drug target genes. We compared the evolutionary conservation between human drug target genes and non-target genes by combining both the evolutionary features and network topological properties in human protein-protein interaction network. The evolution rate, conservation score and the percentage of orthologous genes of 21 species were included in our study. Meanwhile, four topological features including the average shortest path length, betweenness centrality, clustering coefficient and degree were considered for comparison analysis. Then we got four results as following: compared with non-drug target genes, 1) drug target genes had lower evolutionary rates; 2) drug target genes had higher conservation scores; 3) drug target genes had higher percentages of orthologous genes and 4) drug target genes had a tighter network structure including higher degrees, betweenness centrality, clustering coefficients and lower average shortest path lengths. These results demonstrate that drug target genes are more evolutionarily conserved than non-drug target genes. We hope that our study will provide valuable information for other researchers who are interested in evolutionary conservation of drug targets.

  3. Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors

    PubMed Central

    Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

    2012-01-01

    Purpose The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer (PCa) tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in PCa cells. The junction of theTMPRSS2 and ERG derived portions of the fusion mRNA constitutes a cancer specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low toxicity treatment for PCa. Experimental Design We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (Type III or Type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of PCa cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. Results The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Conclusions Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with PCa. PMID:23052253

  4. Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors.

    PubMed

    Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

    2012-12-15

    The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in prostate cancer cells. The junction of theTMPRSS2- and ERG-derived portions of the fusion mRNA constitutes a cancer-specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low-toxicity treatment for prostate cancer. We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (type III or type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of prostate cancer cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with prostate cancer. ©2012 AACR.

  5. Microinjection-based RNA interference knockdown of ecdysteroid biosynthetic genes in a non-model hemipteran pest, Lygus hesperus (western tarnished plant bug)

    USDA-ARS?s Scientific Manuscript database

    RNAi-mediated knockdown of target transcripts offers great potential, both in terms of insect functional genomics and the development of novel insect pest management strategies. Frequently, dsRNAs targeting transcripts of interest are introduced orally to the target organism via feeding. This delive...

  6. [Effect of Golgi α-mannosidase 2 (GM2) gene knockdown on adhesion abilities of human gastric carcinoma cell line BGC-823 and its mechanism].

    PubMed

    Zeng, Bo; Zeng, Zhen; Liu, Chang; Yang, Yaying

    2017-06-01

    Objective To investigate the effect of Golgi α-mannosidase II (GM2) gene knockdown on adhesion abilities of BGC-823 human gastric carcinoma cells. Methods Three plasmid vectors expressing GM2 shRNAs and a negative control plasmid vector were designed, constructed and then transfected into BGC-823 cells by Lipofectamine TM 2000. After transfection, the mRNA and protein levels of GM2 in BGC-823 cells were detected by real-time quantitative PCR (qRT-PCR) and Western blotting to evaluate the transfection efficacy. The best plasmid for GM2 gene knockdown was selected and stably transfected into BGC-823 cells. Adhesion abilities of BGC-823 cells after GM2 gene silencing were observed by cell-cell, cell-matrix and cell-endothelial cell adhesion assays. At the same time, the expressions of E-cadherin, P-selectin, CD44v6 and intercellular adhesion molecule-1 (ICAM-1) proteins were detected by Western blotting after GM2 gene knockdown. Results The expression of GM2 was effectively knockdown in GM2-shRNA-2-transfected BGC-823 cells. Compared with the blank control group and the negative control group, the intercellular adhesion ability of the GM2-shRNA-2-transfected cells increased significantly, while their cell-matrix and cell-endothelium adhesion abilities markedly decreased. In GM2-shRNA-2 transfection group, E-cadherin expression was significantly elevated and the P-selectin expression was significantly reduced, while the expression levels of CD44v6 and ICAM-1 were not obviously changed. Conclusion After GM2 gene knockdown, the intercellular adhesion ability of gastric carcinoma BGC-823 cells is enhanced, while the adhesion abilities with the extracellular matrix and endothelial cells are weakened. The changes might be related to the up-regulated expression of E-cadherin and the down-regulation of P-selectin.

  7. Geometric morphometrics reveals shifts in flower shape symmetry and size following gene knockdown of CYCLOIDEA and ANTHOCYANIDIN SYNTHASE.

    PubMed

    Berger, Brent A; Ricigliano, Vincent A; Savriama, Yoland; Lim, Aedric; Thompson, Veronica; Howarth, Dianella G

    2017-11-17

    While floral symmetry has traditionally been assessed qualitatively, recent advances in geometric morphometrics have opened up new avenues to specifically quantify flower shape and size using robust multivariate statistical methods. In this study, we examine, for the first time, the ability of geometric morphometrics to detect morphological differences in floral dorsoventral asymmetry following virus-induced gene silencing (VIGS). Using Fedia graciliflora Fisch. & Meyer (Valerianaceae) as a model, corolla shape of untreated flowers was compared using canonical variate analysis to knockdown phenotypes of CYCLOIDEA2A (FgCYC2A), ANTHOCYANIDIN SYNTHASE (FgANS), and empty vector controls. Untreated flowers and all VIGS treatments were morphologically distinct from each other, suggesting that VIGS may cause subtle shifts in floral shape. Knockdowns of FgCYC2A were the most dramatic, affecting the position of dorsal petals in relation to lateral petals, thereby resulting in more actinomorphic-like flowers. Additionally, FgANS knockdowns developed larger flowers with wider corolla tube openings. These results provide a method to quantify the role that specific genes play in the developmental pathway affecting the dorsoventral axis of symmetry in zygomorphic flowers. Additionally, they suggest that ANS may have an unintended effect on floral size and shape.

  8. A Pre- and Co-Knockdown of RNAseT Enzyme, Eri-1, Enhances the Efficiency of RNAi Induced Gene Silencing in Caenorhabditis elegans

    PubMed Central

    Jadiya, Pooja; Nazir, Aamir

    2014-01-01

    Background The approach of RNAi mediated gene knockdown, employing exogenous dsRNA, is being beneficially exploited in various fields of functional genomics. The immense utility of the approach came to fore from studies with model system C. elegans, but quickly became applicable with varied research models ranging from in vitro to various in vivo systems. Previously, there have been reports on the refractoriness of the neuronal cells to RNAi mediated gene silencing following which several modulators like eri-1 and lin-15 were described in C. elegans which, when present, would negatively impact the gene knockdown. Methodology/Principal Findings Taking a clue from these findings, we went on to screen hypothesis-driven- methodologies towards exploring the efficiency in the process of RNAi under various experimental conditions, wherein these genes would be knocked down preceding to, or concurrently with, the knocking down of a gene of interest. For determining the efficiency of gene knockdown, we chose to study visually stark phenotypes of uncoordinated movement, dumpy body morphology and blistered cuticle obtained by knocking down of genes unc-73, dpy-9 and bli-3 respectively, employing the RNAi-by-feeding protocol in model system C. elegans. Conclusions/Significance Our studies led to a very interesting outcome as the results reveal that amongst various methods tested, pre-incubation with eri-1 dsRNA synthesizing bacteria followed by co-incubation with eri-1 and gene-of-interest dsRNA synthesizing bacteria leads to the most efficient gene silencing as observed by the analysis of marker phenotypes. This provides an approach for effectively employing RNAi induced gene silencing while working with different genetic backgrounds including transgenic and mutant strains. PMID:24475317

  9. The BTB and CNC homology 1 (BACH1) target genes are involved in the oxidative stress response and in control of the cell cycle.

    PubMed

    Warnatz, Hans-Jörg; Schmidt, Dominic; Manke, Thomas; Piccini, Ilaria; Sultan, Marc; Borodina, Tatiana; Balzereit, Daniela; Wruck, Wasco; Soldatov, Alexey; Vingron, Martin; Lehrach, Hans; Yaspo, Marie-Laure

    2011-07-01

    The regulation of gene expression in response to environmental signals and metabolic imbalances is a key step in maintaining cellular homeostasis. BTB and CNC homology 1 (BACH1) is a heme-binding transcription factor repressing the transcription from a subset of MAF recognition elements at low intracellular heme levels. Upon heme binding, BACH1 is released from the MAF recognition elements, resulting in increased expression of antioxidant response genes. To systematically address the gene regulatory networks involving BACH1, we combined chromatin immunoprecipitation sequencing analysis of BACH1 target genes in HEK 293 cells with knockdown of BACH1 using three independent types of small interfering RNAs followed by transcriptome profiling using microarrays. The 59 BACH1 target genes identified by chromatin immunoprecipitation sequencing were found highly enriched in genes showing expression changes after BACH1 knockdown, demonstrating the impact of BACH1 repression on transcription. In addition to known and new BACH1 targets involved in heme degradation (HMOX1, FTL, FTH1, ME1, and SLC48A1) and redox regulation (GCLC, GCLM, and SLC7A11), we also discovered BACH1 target genes affecting cell cycle and apoptosis pathways (ITPR2, CALM1, SQSTM1, TFE3, EWSR1, CDK6, BCL2L11, and MAFG) as well as subcellular transport processes (CLSTN1, PSAP, MAPT, and vault RNA). The newly identified impact of BACH1 on genes involved in neurodegenerative processes and proliferation provides an interesting basis for future dissection of BACH1-mediated gene repression in neurodegeneration and virus-induced cancerogenesis.

  10. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    PubMed

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Gene Knockdown of Venezuelan Equine Encephalitis Virus E2 Glycoprotein Using DNA-Directed RNA Interference

    DTIC Science & Technology

    2006-12-01

    Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE r/sYDEFENSE Gene Knockdown of Venezuelan Equine...Further research is required to develop an antiviral against VEE that is both safe and effective. One antiviral strategy that has shown considerable...Novagen, Madison, WI)) on a MJ Research PTC-200 DNA engine (Bio-Rad, formerly MJ Research , Mississauga, ON). Amplification products (5 pL) were

  12. RNCR3 knockdown inhibits diabetes mellitus-induced retinal reactive gliosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Chang; Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai; The Fourth School of Clinical Medicine, Nanjing Medical University, Nanjing

    Retinal reactive gliosis is an important pathological feature of diabetic retinopathy. Identifying the underlying mechanisms causing reactive gliosis will be important for developing new therapeutic strategies for treating diabetic retinopathy. Herein, we show that long noncoding RNA-RNCR3 knockdown significantly inhibits retinal reactive gliosis. RNCR3 knockdown leads to a marked reduction in the release of several cytokines. RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration, as shown by less apoptotic retinal cells and ameliorative visual function. RNCR3 knockdown could also decrease Müller glial cell viability and proliferation, and reduce the expression of glial reactivity-related genes including GFAP and vimentin in vitro. Collectively, thismore » study shows that RNCR3 knockdown may be a promising strategy for the prevention of diabetes mellitus-induced retinal neurodegeneration. - Highlights: • RNCR3 knockdown inhibits retinal reactive gliosis. • RNCR3 knockdown causes a significant change in cytokine profile. • RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration. • RNCR3 knockdown affects Müller glial cell function in vitro.« less

  13. GABAA receptor γ2 subunit knockdown mice have enhanced anxiety-like behavior but unaltered hypnotic response to benzodiazepines

    PubMed Central

    Chandra, Dev; Korpi, Esa R; Miralles, Celia P; De Blas, Angel L; Homanics, Gregg E

    2005-01-01

    Background Gamma-aminobutyric acid type A receptors (GABAA-Rs) are the major inhibitory receptors in the mammalian brain and are modulated by a number of sedative/hypnotic drugs including benzodiazepines and anesthetics. The significance of specific GABAA-Rs subunits with respect to behavior and in vivo drug responses is incompletely understood. The γ2 subunit is highly expressed throughout the brain. Global γ2 knockout mice are insensitive to the hypnotic effects of diazepam and die perinatally. Heterozygous γ2 global knockout mice are viable and have increased anxiety-like behaviors. To further investigate the role of the γ2 subunit in behavior and whole animal drug action, we used gene targeting to create a novel mouse line with attenuated γ2 expression, i.e., γ2 knockdown mice. Results Knockdown mice were created by inserting a neomycin resistance cassette into intron 8 of the γ2 gene. Knockdown mice, on average, showed a 65% reduction of γ2 subunit mRNA compared to controls; however γ2 gene expression was highly variable in these mice, ranging from 10–95% of normal. Immunohistochemical studies demonstrated that γ2 protein levels were also variably reduced. Pharmacological studies using autoradiography on frozen brain sections demonstrated that binding of the benzodiazepine site ligand Ro15-4513 was decreased in mutant mice compared to controls. Behaviorally, knockdown mice displayed enhanced anxiety-like behaviors on the elevated plus maze and forced novelty exploration tests. Surprisingly, mutant mice had an unaltered response to hypnotic doses of the benzodiazepine site ligands diazepam, midazolam and zolpidem as well as ethanol and pentobarbital. Lastly, we demonstrated that the γ2 knockdown mouse line can be used to create γ2 global knockout mice by crossing to a general deleter cre-expressing mouse line. Conclusion We conclude that: 1) insertion of a neomycin resistance gene into intron 8 of the γ2 gene variably reduced the amount of γ2

  14. A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

    DOE PAGES

    Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E.; ...

    2015-03-31

    Here, we document a collection of ~7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstratemore » reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates.« less

  15. deGradFP: A System to Knockdown GFP-Tagged Proteins.

    PubMed

    Caussinus, Emmanuel; Affolter, Markus

    2016-01-01

    Protein depletion by genetic means, in a very general sense including the use of RNA interference [1, 2] or CRISPR/Cas9-based methods, represents a central paradigm of modern biology to study protein functions in vivo. However, acting upstream the proteic level is a limiting factor if the turnover of the target protein is slow or the existing pool of the target protein is important (for instance, in insect embryos, as a consequence of a strong maternal contribution). In order to circumvent these problems, we developed deGradFP [3, 4]. deGradFP harnesses the ubiquitin-proteasome pathway to achieve direct depletion of GFP-tagged proteins. deGradFP is in essence a universal method because it relies on an evolutionarily conserved machinery for protein catabolism in eukaryotic cells; see refs. 5, 6 for review. deGradFP is particularly convenient in Drosophila melanogaster where it is implemented by a genetically encoded effector expressed under the control of the Gal4 system. deGradFP is a ready-to-use solution to perform knockdowns at the protein level if a fly line carrying a functional GFP-tagged version of the gene of interest is available. Many such lines have already been generated by the Drosophila community through different technologies allowing to make genomic rescue constructs or direct GFP knockins: protein-trap stock collections [7, 8] ( http://cooley.medicine.yale.edu/flytrap/ , http://www.flyprot.org/ ), P[acman] system [9], MiMIC lines [10, 11], and CRISPR/Cas9-driven homologous recombination.Two essential controls of a protein knockdown experiment are easily achieved using deGradFP. First, the removal of the target protein can be assessed by monitoring the disappearance of the GFP tag by fluorescence microscopy in parallel to the documentation of the phenotype of the protein knockdown (see Note 1 ). Second, the potential nonspecific effects of deGradFP can be assessed in control fly lacking a GFP-tagged target protein. So far, no nonspecific effects of

  16. Knockdown of PLC-gamma-2 and calmodulin 1 genes sensitizes human cervical adenocarcinoma cells to doxorubicin and paclitaxel.

    PubMed

    Stanislaus, Anthony; Bakhtiar, Athirah; Salleh, Diyana; Tiash, Snigdha; Fatemian, Tahereh; Hossain, Sharif; Akaike, Toshihiro; Chowdhury, Ezharul Hoque

    2012-06-18

    RNA interference (RNAi) is a powerful approach in functional genomics to selectively silence messenger mRNA (mRNA) expression and can be employed to rapidly develop potential novel drugs against a complex disease like cancer. However, naked siRNA being anionic is unable to cross the anionic cell membrane through passive diffusion and therefore, delivery of siRNA remains a major hurdle to overcome before the potential of siRNA technology can fully be exploited in cancer. pH-sensitive carbonate apatite has recently been developed as an efficient tool to deliver siRNA into the mammalian cells by virtue of its high affinity interaction with the siRNA and the desirable size distribution of the resulting siRNA-apatite complex for effective cellular endocytosis. Moreover, internalized siRNA was found to escape from the endosomes in a time-dependent manner and efficiently silence gene expression. Here we show that carbonate apatite-mediated delivery of siRNA against PLC-gamma-2 (PLCG2) and calmodulin 1 (CALM1) genes has led to the sensitization of a human cervical cancer cell line to doxorubicin- and paclitaxel depending on the dosage of the individual drug whereas no such enhancement in cell death was observed with cisplatin irrespective of the dosage following intracellular delivery of the siRNAs. Thus, PLCG2 and CALM1 genes are two potential targets for gene knockdown in doxorubicin and paclitaxel-based chemotherapy of cervical cancer.

  17. The functional genetic link of NLGN4X knockdown and neurodevelopment in neural stem cells

    PubMed Central

    Shi, Lingling; Chang, Xiao; Zhang, Peilin; Coba, Marcelo P.; Lu, Wange; Wang, Kai

    2013-01-01

    Genetic mutations in NLGN4X (neuroligin 4), including point mutations and copy number variants (CNVs), have been associated with susceptibility to autism spectrum disorders (ASDs). However, it is unclear how mutations in NLGN4X result in neurodevelopmental defects. Here, we used neural stem cells (NSCs) as in vitro models to explore the impacts of NLGN4X knockdown on neurodevelopment. Using two shRNAmir-based vectors targeting NLGN4X and one control shRNAmir vector, we modulated NLGN4X expression and differentiated these NSCs into mature neurons. We monitored the neurodevelopmental process at Weeks 0, 0.5, 1, 2, 4 and 6, based on morphological analysis and whole-genome gene expression profiling. At the cellular level, in NSCs with NLGN4X knockdown, we observed increasingly delayed neuronal development and compromised neurite formation, starting from Week 2 through Week 6 post differentiation. At the molecular level, we identified multiple pathways, such as neurogenesis, neuron differentiation and muscle development, which are increasingly disturbed in cells with NLGN4X knockdown. Notably, several postsynaptic genes, including DLG4, NLGN1 and NLGN3, also have decreased expression. Based on in vitro models, NLGN4X knockdown directly impacts neurodevelopmental process during the formation of neurons and their connections. Our functional genomics study highlights the utility of NSCs models in understanding the functional roles of CNVs in affecting neurodevelopment and conferring susceptibility to neurodevelopmental diseases. PMID:23710042

  18. The functional genetic link of NLGN4X knockdown and neurodevelopment in neural stem cells.

    PubMed

    Shi, Lingling; Chang, Xiao; Zhang, Peilin; Coba, Marcelo P; Lu, Wange; Wang, Kai

    2013-09-15

    Genetic mutations in NLGN4X (neuroligin 4), including point mutations and copy number variants (CNVs), have been associated with susceptibility to autism spectrum disorders (ASDs). However, it is unclear how mutations in NLGN4X result in neurodevelopmental defects. Here, we used neural stem cells (NSCs) as in vitro models to explore the impacts of NLGN4X knockdown on neurodevelopment. Using two shRNAmir-based vectors targeting NLGN4X and one control shRNAmir vector, we modulated NLGN4X expression and differentiated these NSCs into mature neurons. We monitored the neurodevelopmental process at Weeks 0, 0.5, 1, 2, 4 and 6, based on morphological analysis and whole-genome gene expression profiling. At the cellular level, in NSCs with NLGN4X knockdown, we observed increasingly delayed neuronal development and compromised neurite formation, starting from Week 2 through Week 6 post differentiation. At the molecular level, we identified multiple pathways, such as neurogenesis, neuron differentiation and muscle development, which are increasingly disturbed in cells with NLGN4X knockdown. Notably, several postsynaptic genes, including DLG4, NLGN1 and NLGN3, also have decreased expression. Based on in vitro models, NLGN4X knockdown directly impacts neurodevelopmental process during the formation of neurons and their connections. Our functional genomics study highlights the utility of NSCs models in understanding the functional roles of CNVs in affecting neurodevelopment and conferring susceptibility to neurodevelopmental diseases.

  19. The LIM-homeodomain transcription factor LMX1B regulates expression of NF-kappa B target genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rascle, Anne; Neumann, Tanja; Raschta, Anne-Sarah

    2009-01-01

    LMX1B is a LIM-homeodomain transcription factor essential for development. Putative LMX1B target genes have been identified through mouse gene targeting studies, but their identity as direct LMX1B targets remains hypothetical. We describe here the first molecular characterization of LMX1B target gene regulation. Microarray analysis using a tetracycline-inducible LMX1B expression system in HeLa cells revealed that a subset of NF-{kappa}B target genes, including IL-6 and IL-8, are upregulated in LMX1B-expressing cells. Inhibition of NF-{kappa}B activity by short interfering RNA-mediated knock-down of p65 impairs, while activation of NF-{kappa}B activity by TNF-{alpha} synergizes induction of NF-{kappa}B target genes by LMX1B. Chromatin immunoprecipitation demonstratedmore » that LMX1B binds to the proximal promoter of IL-6 and IL-8 in vivo, in the vicinity of the characterized {kappa}B site, and that LMX1B recruitment correlates with increased NF-{kappa}B DNA association. IL-6 promoter-reporter assays showed that the {kappa}B site and an adjacent putative LMX1B binding motif are both involved in LMX1B-mediated transcription. Expression of NF-{kappa}B target genes is affected in the kidney of Lmx1b{sup -/-} knock-out mice, thus supporting the biological relevance of our findings. Together, these data demonstrate for the first time that LMX1B directly regulates transcription of a subset of NF-{kappa}B target genes in cooperation with nuclear p50/p65 NF-{kappa}B.« less

  20. Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior

    PubMed Central

    Hermanstyne, Tracey O.; Mellor, Rebecca L.

    2017-01-01

    Abstract Rapidly activating and inactivating A-type K+ currents (IA) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly (p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). IA was also significantly (p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and IA was larger at night. In addition, Kv4.1-targeted shRNA expression significantly (p < 0.001) increased mean ± SEM nighttime input resistance (Rin; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly (p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded IA channels in regulating circadian rhythms in neuronal excitability and behavior. PMID:28560311

  1. Acute Knockdown of Kv4.1 Regulates Repetitive Firing Rates and Clock Gene Expression in the Suprachiasmatic Nucleus and Daily Rhythms in Locomotor Behavior.

    PubMed

    Hermanstyne, Tracey O; Granados-Fuentes, Daniel; Mellor, Rebecca L; Herzog, Erik D; Nerbonne, Jeanne M

    2017-01-01

    Rapidly activating and inactivating A-type K + currents (I A ) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly ( p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). I A was also significantly ( p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and I A was larger at night. In addition, Kv4.1-targeted shRNA expression significantly ( p < 0.001) increased mean ± SEM nighttime input resistance (R in ; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly ( p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded I A channels in regulating circadian rhythms in neuronal excitability and behavior.

  2. Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

    PubMed Central

    De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

    2006-01-01

    RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

  3. Knockdown of cullin 4A inhibits growth and increases chemosensitivity in lung cancer cells.

    PubMed

    Hung, Ming-Szu; Chen, I-Chuan; You, Liang; Jablons, David M; Li, Ya-Chin; Mao, Jian-Hua; Xu, Zhidong; Lung, Jr-Hau; Yang, Cheng-Ta; Liu, Shih-Tung

    2016-07-01

    Cullin 4A (Cul4A) has been observed to be overexpressed in various cancers. In this study, the role of Cul4A in the growth and chemosensitivity in lung cancer cells were studied. We showed that Cul4A is overexpressed in lung cancer cells and tissues. Knockdown of the Cul4A expression by shRNA in lung cancer cells resulted in decreased cellular proliferation and growth in lung cancer cells. Increased sensitivity to gemcitabine, a chemotherapy drug, was also noted in those Cul4A knockdown lung cancer cells. Moreover, increased expression of p21, transforming growth factor (TGF)-β inducible early gene-1 (TIEG1) and TGF beta-induced (TGFBI) was observed in lung cancer cells after Cul4A knockdown, which may be partially related to increased chemosensitivity to gemcitabine. G0/G1 cell cycle arrest was also noted after Cul4A knockdown. Notably, decreased tumour growth and increased chemosensitivity to gemcitabine were also noted after Cul4A knockdown in lung cancer xenograft nude mice models. In summary, our study showed that targeting Cul4A with RNAi or other techniques may provide a possible insight to the development of lung cancer therapy in the future. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  4. A library of MiMICs allows tagging of genes and reversible, spatial and temporal knockdown of proteins in Drosophila

    PubMed Central

    Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E; Chen, Kuchuan; Anguiano-Zarate, Stephanie; Cantu Gutierrez, Manuel; Busby, Theodore; Lin, Wen-Wen; He, Yuchun; Schulze, Karen L; Booth, Benjamin W; Evans-Holm, Martha; Venken, Koen JT; Levis, Robert W; Spradling, Allan C; Hoskins, Roger A; Bellen, Hugo J

    2015-01-01

    Here, we document a collection of ∼7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstrate reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates. DOI: http://dx.doi.org/10.7554/eLife.05338.001 PMID:25824290

  5. A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages

    PubMed Central

    Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

    2016-01-01

    Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in RAW264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of RAW264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the RAW264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

  6. RNA interference: learning gene knock-down from cell physiology

    PubMed Central

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  7. Signal Transducer and Activator of Transcription 1 (STAT1) Knock-down Induces Apoptosis in Malignant Pleural Mesothelioma.

    PubMed

    Arzt, Lisa; Halbwedl, Iris; Gogg-Kamerer, Margit; Popper, Helmut H

    2017-07-01

    Malignant pleural mesothelioma (MPM) is the most common primary tumor of the pleura. Its incidence is still increasing in Europe and the prognosis remains poor. We investigated the oncogenic function of signal transducer and activator of transcription 1 (STAT1) in MPM in more detail. A miRNA profiling was performed on 52 MPM tissue samples. Upregulated miRNAs (targeting SOCS1/3) were knocked-down using miRNA inhibitors. mRNA expression levels of STAT1/3, SOCS1/3 were detected in MPM cell lines. STAT1 has been knocked-down using siRNA and qPCR was used to detect mRNA expression levels of all JAK/STAT family members and genes that regulate them. An immunohistochemical staining was performed to detect the expression of caspases. STAT1 was upregulated and STAT3 was downregulated, SOCS1/3 protein was not detected but it was possible to detect SOCS1/3 mRNA in MPM cell lines. The upregulated miRNAs were successfully knocked-down, however the expected effect on SOCS1 expression was not detected. STAT1 knock-down had different effects on STAT3/5 expression. Caspase 3a and 8 expression was found to be increased after STAT1 knock-down. The physiologic regulation of STAT1 via SOCS1 is completely lost in MPM and it does not seem that the miRNAs identified by now, do inhibit the expression of SOCS1. MPM cell lines compensate STAT1 knock-down by increasing the expression of STAT3 or STAT5a, two genes which are generally considered to be oncogenes. And much more important, STAT1 knock-down induces apoptosis in MPM cell lines and STAT1 might therefore be a target for therapeutic intervention.

  8. RNAi targeting GPR4 influences HMEC-1 gene expression by microarray analysis

    PubMed Central

    Ren, Juan; Zhang, Yuelang; Cai, Hui; Ma, Hongbing; Zhao, Dongli; Zhang, Xiaozhi; Li, Zongfang; Wang, Shufeng; Wang, Jiangsheng; Liu, Rui; Li, Yi; Qian, Jiansheng; Wei, Hongxia; Niu, Liying; Liu, Yan; Xiao, Lisha; Ding, Muyang; Jiang, Shiwen

    2014-01-01

    G-protein coupled receptor 4 (GPR4) belongs to a protein family comprised of 3 closely related G protein-coupled receptors. Recent studies have shown that GPR4 plays important roles in angiogenesis, proton sensing, and regulating tumor cells as an oncogenic gene. How GPR4 conducts its functions? Rare has been known. In order to detect the genes related to GPR4, microarray technology was employed. GPR4 is highly expressed in human vascular endothelial cell HMEC-1. Small interfering RNA against GPR4 was used to knockdown GPR4 expression in HMEC-1. Then RNA from the GPR4 knockdown cells and control cells were analyzed through genome microarray. Microarray results shown that among the whole genes and expressed sequence tags, 447 differentially expressed genes were identified, containing 318 up-regulated genes and 129 down-regulated genes. These genes whose expression dramatically changed may be involved in the GPR4 functions. These genes were related to cell apoptosis, cytoskeleton and signal transduction, cell proliferation, differentiation and cell-cycle regulation, gene transcription and translation and cell material and energy metabolism. PMID:24753754

  9. Gene knockdown by morpholino-modified oligonucleotides in the zebrafish model: applications for developmental toxicology

    PubMed Central

    Timme-Laragy, Alicia R.; Karchner, Sibel I.; Hahn, Mark E.

    2014-01-01

    Summary The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knock-down via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level, while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e. phenotypic anchoring). In this chapter we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use. PMID:22669659

  10. PlGF gene knockdown in human retinal pigment epithelial cells.

    PubMed

    Akrami, Hassan; Soheili, Zahra-Soheila; Sadeghizadeh, Majid; Ahmadieh, Hamid; Rezaeikanavi, Mozhgan; Samiei, Shahram; Khalooghi, Keynoush

    2011-04-01

    To evaluate the knockdown of placental growth factor (PlGF) gene expression in human retinal pigment epithelium (RPE) cells and its effect on cell proliferation, apoptosis and angiogenic potential of RPE cells. Human RPE cells were isolated by dispase I solution and cultured in DMEM/F12 supplemented with 10% fetal calf serum (FCS). A small interfering RNA (siRNA) corresponding to PlGF mRNA and a scrambled siRNA (scRNA) were introduced into the cells. Cell proliferation and cell death were examined by ELISA. PlGF mRNA and protein were quantified by real-time polymerase chain reaction (PCR) and western blot. The levels of gene expression for human retinal pigment epithelium-specific protein 65 kDa (RPE65), cellular retinaldehyde-binding protein (CRALBP) and tyrosinase were examined by real-time PCR. The angiogenic activity of RPE cell-derived conditioned media was assayed by a tube formation assay using human umbilical vein endothelial cells (HUVECs). At a final siRNA concentration of 20 pmol/ml, the transfection efficiency was about 80%. The amount of PlGF transcripts was reduced to 10% after 36 h of incubation, and the amount of PlGF protein in culture supernatant was significantly decreased. Suppression of PlGF gene had no effect on RPE cell proliferation and survival, and there were no notable changes in the transcript levels of RPE65, CRALBP or tyrosinase for the cultures treated by siRNA cognate to PlGF. Vascular tube formation was efficiently reduced in HUVECs. Our findings present PlGF as a key modulator of angiogenic potential in RPE cells of the human retina.

  11. Syndecan-1 knockdown inhibits glioma cell proliferation and invasion by deregulating a c-src/FAK-associated signaling pathway.

    PubMed

    Shi, Shuang; Zhong, Dong; Xiao, Yao; Wang, Bing; Wang, Wentao; Zhang, Fu'an; Huang, Haoyang

    2017-06-20

    Recent studies have shown that increased syndecan-1 (SDC1) expression in human glioma is associated with higher tumor grades and poor prognoses, but its oncogenic functions and the underlying molecular mechanisms remain unknown. Here, we examined SDC1 expression in datasets from The Cancer Genome Atlas and the National Center for Biotechnology Information Gene Expression Omnibus. Elevated SDC1 expression in glioma was closely associated with increases in tumor progression and shorter survival. We also examined SDC1 expression and evaluated the effects of stable SDC1 knockdown in glioma cell lines. SDC1 knockdown attenuated proliferation and invasion by glioma cells and markedly decreased PCNA and MMP-9 mRNA and protein expression. In a xenograft model, SDC1 knockdown suppressed the tumorigenic effects of U87 cells in vivo. SDC1 knockdown decreased phosphorylation of the c-src/FAK complex and its downstream signaling molecules, Erk, Akt and p38 MAPK. These results suggest that SDC1 may be a novel therapeutic target in the treatment of glioma.

  12. Periaqueductal gray knockdown of V2, not V1a and V1b receptor influences nociception in the rat. yj6676@yahoo.com.

    PubMed

    Yang, Jun; Yang, Yu; Chen, Jian-Min; Wang, Gen; Xu, Hong-Tao; Liu, Wen-Yan; Lin, Bao-Cheng

    2007-01-01

    Our pervious study has proved that arginine vasopressin (AVP) in periaqueductal gray (PAG) plays a role in antinociception. After establishing a model of local special gene knockdown, the nociceptive effect of vasopressin receptor subunit in PAG was investigated in the rat. Microinjection of short-interfering RNA (siRNA) into PAG, which targeted vasopressin receptor subtypes (V(1a), V(1b) and V(2)), locally weakened the associated mRNA expression and depressed the related receptor synthesis in a dose-dependent manner, in which the significant inhibitive effect occurred on from 7th day to 14th day following 1microg or 2microg siRNA administration. PAG knockdown of V(2) receptor gene markedly decreased pain threshold in from 6th day to 13th day after siRNA administration, whereas local knockdown of either V(1a) or V(1b) receptor gene could not influence pain threshold. The data suggest that V(2) rather than V(1a) and V(1b) receptor in PAG involves in nociception.

  13. Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth

    PubMed Central

    2011-01-01

    Introduction MicroRNAs (miRNAs) are a class of small non-coding RNAs (20 to 24 nucleotides) that post-transcriptionally modulate gene expression. A key oncomir in carcinogenesis is miR-21, which is consistently up-regulated in a wide range of cancers. However, few functional studies are available for miR-21, and few targets have been identified. In this study, we explored the role of miR-21 in human breast cancer cells and tissues, and searched for miR-21 targets. Methods We used in vitro and in vivo assays to explore the role of miR-21 in the malignant progression of human breast cancer, using miR-21 knockdown. Using LNA silencing combined to microarray technology and target prediction, we screened for potential targets of miR-21 and validated direct targets by using luciferase reporter assay and Western blot. Two candidate target genes (EIF4A2 and ANKRD46) were selected for analysis of correlation with clinicopathological characteristics and prognosis using immunohistochemistry on cancer tissue microrrays. Results Anti-miR-21 inhibited growth and migration of MCF-7 and MDA-MB-231 cells in vitro, and tumor growth in nude mice. Knockdown of miR-21 significantly increased the expression of ANKRD46 at both mRNA and protein levels. Luciferase assays using a reporter carrying a putative target site in the 3' untranslated region of ANKRD46 revealed that miR-21 directly targeted ANKRD46. miR-21 and EIF4A2 protein were inversely expressed in breast cancers (rs = -0.283, P = 0.005, Spearman's correlation analysis). Conclusions Knockdown of miR-21 in MCF-7 and MDA-MB-231 cells inhibits in vitro and in vivo growth as well as in vitro migration. ANKRD46 is newly identified as a direct target of miR-21 in BC. These results suggest that inhibitory strategies against miR-21 using peptide nucleic acids (PNAs)-antimiR-21 may provide potential therapeutic applications in breast cancer treatment. PMID:21219636

  14. Knockdown of miR-21 in human breast cancer cell lines inhibits proliferation, in vitro migration and in vivo tumor growth.

    PubMed

    Yan, Li Xu; Wu, Qi Nian; Zhang, Yan; Li, Yang Yang; Liao, Ding Zhun; Hou, Jing Hui; Fu, Jia; Zeng, Mu Sheng; Yun, Jing Ping; Wu, Qiu Liang; Zeng, Yi Xin; Shao, Jian Yong

    2011-01-10

    MicroRNAs (miRNAs) are a class of small non-coding RNAs (20 to 24 nucleotides) that post-transcriptionally modulate gene expression. A key oncomir in carcinogenesis is miR-21, which is consistently up-regulated in a wide range of cancers. However, few functional studies are available for miR-21, and few targets have been identified. In this study, we explored the role of miR-21 in human breast cancer cells and tissues, and searched for miR-21 targets. We used in vitro and in vivo assays to explore the role of miR-21 in the malignant progression of human breast cancer, using miR-21 knockdown. Using LNA silencing combined to microarray technology and target prediction, we screened for potential targets of miR-21 and validated direct targets by using luciferase reporter assay and Western blot. Two candidate target genes (EIF4A2 and ANKRD46) were selected for analysis of correlation with clinicopathological characteristics and prognosis using immunohistochemistry on cancer tissue microrrays. Anti-miR-21 inhibited growth and migration of MCF-7 and MDA-MB-231 cells in vitro, and tumor growth in nude mice. Knockdown of miR-21 significantly increased the expression of ANKRD46 at both mRNA and protein levels. Luciferase assays using a reporter carrying a putative target site in the 3' untranslated region of ANKRD46 revealed that miR-21 directly targeted ANKRD46. miR-21 and EIF4A2 protein were inversely expressed in breast cancers (rs = -0.283, P = 0.005, Spearman's correlation analysis). Knockdown of miR-21 in MCF-7 and MDA-MB-231 cells inhibits in vitro and in vivo growth as well as in vitro migration. ANKRD46 is newly identified as a direct target of miR-21 in BC. These results suggest that inhibitory strategies against miR-21 using peptide nucleic acids (PNAs)-antimiR-21 may provide potential therapeutic applications in breast cancer treatment.

  15. Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hayakawa, Kazuo; Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto; Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya

    2013-03-22

    Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggestmore » its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were

  16. miR-137 inhibits the invasion of melanoma cells through downregulation of multiple oncogenic target genes.

    PubMed

    Luo, Chonglin; Tetteh, Paul W; Merz, Patrick R; Dickes, Elke; Abukiwan, Alia; Hotz-Wagenblatt, Agnes; Holland-Cunz, Stefan; Sinnberg, Tobias; Schittek, Birgit; Schadendorf, Dirk; Diederichs, Sven; Eichmüller, Stefan B

    2013-03-01

    MicroRNAs are small noncoding RNAs that regulate gene expression and have important roles in various types of cancer. Previously, miR-137 was reported to act as a tumor suppressor in different cancers, including malignant melanoma. In this study, we show that low miR-137 expression is correlated with poor survival in stage IV melanoma patients. We identified and validated two genes (c-Met and YB1) as direct targets of miR-137 and confirmed two previously known targets, namely enhancer of zeste homolog 2 (EZH2) and microphthalmia-associated transcription factor (MITF). Functional studies showed that miR-137 suppressed melanoma cell invasion through the downregulation of multiple target genes. The decreased invasion caused by miR-137 overexpression could be phenocopied by small interfering RNA knockdown of EZH2, c-Met, or Y box-binding protein 1 (YB1). Furthermore, miR-137 inhibited melanoma cell migration and proliferation. Finally, miR-137 induced apoptosis in melanoma cell lines and decreased BCL2 levels. In summary, our study confirms that miR-137 acts as a tumor suppressor in malignant melanoma and reveals that miR-137 regulates multiple targets including c-Met, YB1, EZH2, and MITF.

  17. Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

    PubMed

    Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

    2015-12-01

    The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Knockdown of the coenzyme Q synthesis gene Smed-dlp1 affects planarian regeneration and tissue homeostasis

    PubMed Central

    Shiobara, Yumiko; Harada, Chiaki; Shiota, Takeshi; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tanaka, Saeko; Tabata, Kenta; Sekie, Kiyoteru; Yamamoto, Yorihiro; Sugiyama, Tomoyasu

    2015-01-01

    The freshwater planarian is a model organism used to study tissue regeneration that occupies an important position among multicellular organisms. Planarian genomic databases have led to the identification of genes that are required for regeneration, with implications for their roles in its underlying mechanism. Coenzyme Q (CoQ) is a fundamental lipophilic molecule that is synthesized and expressed in every cell of every organism. Furthermore, CoQ levels affect development, life span, disease and aging in nematodes and mice. Because CoQ can be ingested in food, it has been used in preventive nutrition. In this study, we investigated the role of CoQ in planarian regeneration. Planarians synthesize both CoQ9 and rhodoquinone 9 (RQ9). Knockdown of Smed-dlp1, a trans-prenyltransferase gene that encodes an enzyme that synthesizes the CoQ side chain, led to a decrease in CoQ9 and RQ9 levels. However, ATP levels did not consistently decrease in these animals. Knockdown animals exhibited tissue regression and curling. The number of mitotic cells decreased in Smed-dlp1 (RNAi) animals. These results suggested a failure in physiological cell turnover and stem cell function. Accordingly, regenerating planarians died from lysis or exhibited delayed regeneration. Interestingly, the observed phenotypes were partially rescued by ingesting food supplemented with α-tocopherol. Taken together, our results suggest that oxidative stress induced by reduced CoQ9 levels affects planarian regeneration and tissue homeostasis. PMID:26516985

  19. Conditional knockdown of BCL2A1 reveals rate-limiting roles in BCR-dependent B-cell survival

    PubMed Central

    Sochalska, M; Ottina, E; Tuzlak, S; Herzog, S; Herold, M; Villunger, A

    2016-01-01

    Bcl2 family proteins control mitochondrial apoptosis and its members exert critical cell type and differentiation stage-specific functions, acting as barriers against autoimmunity or transformation. Anti-apoptotic Bcl2a1/Bfl1/A1 is frequently deregulated in different types of blood cancers in humans but its physiological role is poorly understood as quadruplication of the Bcl2a1 gene locus in mice hampers conventional gene targeting strategies. Transgenic overexpression of A1, deletion of the A1-a paralogue or constitutive knockdown in the hematopoietic compartment of mice by RNAi suggested rate-limiting roles in lymphocyte development, granulopoiesis and mast cell activation. Here we report on the consequences of conditional knockdown of A1 protein expression using a reverse transactivator (rtTA)-driven approach that highlights a critical role for this Bcl2 family member in the maintenance of mature B-cell homeostasis. Furthermore, we define the A1/Bim (Bcl-2 interacting mediator of cell death) axis as a target of key kinases mediating B-cell receptor (BCR)-dependent survival signals, such as, spleen tyrosine kinase (Syk) and Brutons tyrosine kinase (Btk). As such, A1 represents a putative target for the treatment of B-cell-related pathologies depending on hyperactivation of BCR-emanating survival signals and loss of A1 expression accounts, in part, for the pro-apoptotic effects of Syk- or Btk inhibitors that rely on the ‘BH3-only' protein Bim for cell killing. PMID:26450454

  20. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

    PubMed

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  1. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  2. CDKL5 is a brain MeCP2 target gene regulated by DNA methylation.

    PubMed

    Carouge, Delphine; Host, Lionel; Aunis, Dominique; Zwiller, Jean; Anglard, Patrick

    2010-06-01

    Rett syndrome and its "early-onset seizure" variant are severe neurodevelopmental disorders associated with mutations within the MECP2 and the CDKL5 genes. Antidepressants and drugs of abuse induce the expression of the epigenetic factor MeCP2, thereby influencing chromatin remodeling. We show that increased MeCP2 levels resulted in the repression of Cdkl5 in rat brain structures in response to cocaine, as well as in cells exposed to serotonin, or overexpressing MeCP2. In contrast, Cdkl5 was induced by siRNA-mediated knockdown of Mecp2 and by DNA-methyltransferase inhibitors, demonstrating its regulation by MeCP2 and by DNA methylation. Cdkl5 gene methylation and its methylation-dependent binding to MeCP2 were increased in the striatum of cocaine-treated rats. Our data demonstrate that Cdkl5 is a MeCP2-repressed target gene providing a link between genes the mutation of which generates overlapping symptoms. They highlight DNA methylation changes as a potential mechanism participating in the long-term plasticity triggered by pharmacological agents.

  3. Knockdown of TNF-α by DNAzyme Gold Nanoparticles as an Anti-inflammatory Therapy for Myocardial Infarction

    PubMed Central

    Somasuntharam, Inthirai; Yehl, Kevin; Carroll, Sheridan L.; Maxwell, Joshua T.; Martinez, Mario D.; Che, Pao-Lin; Brown, Milton E.; Salaita, Khalid; Davis, Michael E.

    2017-01-01

    In this study, we used deoxyribozyme (DNAzyme) functionalized gold nanoparticles (AuNPs) to catalytically silence tumor necrosis factor-α (TNF-α) in vivo as a potential therapeutic for myocardial infarction (MI). Using primary macrophages as a model, we demonstrated 50% knockdown of TNF-α, which was not attainable using Lipofectamine-based approaches. Local injection of DNAzyme conjugated to gold particles (AuNPs) in the rat myocardium yielded TNF-α knockdown efficiencies of 50%, which resulted in significant anti-inflammatory effects and improvement in acute cardiac function following MI. Our results represent the first example showing the use of DNAzyme AuNP conjugates in vivo for viable delivery and gene regulation. This is significant as TNF-α is a multibillion dollar drug target implicated in many inflammatory-mediated disorders, thus underscoring the potential impact of DNAzyme-conjugated AuNPs. PMID:26773660

  4. Knockdown of the coenzyme Q synthesis gene Smed-dlp1 affects planarian regeneration and tissue homeostasis.

    PubMed

    Shiobara, Yumiko; Harada, Chiaki; Shiota, Takeshi; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tanaka, Saeko; Tabata, Kenta; Sekie, Kiyoteru; Yamamoto, Yorihiro; Sugiyama, Tomoyasu

    2015-12-01

    The freshwater planarian is a model organism used to study tissue regeneration that occupies an important position among multicellular organisms. Planarian genomic databases have led to the identification of genes that are required for regeneration, with implications for their roles in its underlying mechanism. Coenzyme Q (CoQ) is a fundamental lipophilic molecule that is synthesized and expressed in every cell of every organism. Furthermore, CoQ levels affect development, life span, disease and aging in nematodes and mice. Because CoQ can be ingested in food, it has been used in preventive nutrition. In this study, we investigated the role of CoQ in planarian regeneration. Planarians synthesize both CoQ9 and rhodoquinone 9 (RQ9). Knockdown of Smed-dlp1, a trans-prenyltransferase gene that encodes an enzyme that synthesizes the CoQ side chain, led to a decrease in CoQ9 and RQ9 levels. However, ATP levels did not consistently decrease in these animals. Knockdown animals exhibited tissue regression and curling. The number of mitotic cells decreased in Smed-dlp1 (RNAi) animals. These results suggested a failure in physiological cell turnover and stem cell function. Accordingly, regenerating planarians died from lysis or exhibited delayed regeneration. Interestingly, the observed phenotypes were partially rescued by ingesting food supplemented with α-tocopherol. Taken together, our results suggest that oxidative stress induced by reduced CoQ9 levels affects planarian regeneration and tissue homeostasis. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Dual-targeting siRNAs

    PubMed Central

    Tiemann, Katrin; Höhn, Britta; Ehsani, Ali; Forman, Stephen J.; Rossi, John J.; Sætrom, Pål

    2010-01-01

    We have developed an algorithm for the prediction of dual-targeting short interfering RNAs (siRNAs) in which both strands are deliberately designed to separately target different mRNA transcripts with complete complementarity. An advantage of this approach versus the use of two separate duplexes is that only two strands, as opposed to four, are competing for entry into the RNA-induced silencing complex. We chose to design our dual-targeting siRNAs as Dicer substrate 25/27mer siRNAs, since design features resembling pre-microRNAs (miRNAs) can be introduced for Dicer processing. Seven different dual-targeting siRNAs targeting genes that are potential targets in cancer therapy have been developed including Bcl2, Stat3, CCND1, BIRC5, and MYC. The dual-targeting siRNAs have been characterized for dual target knockdown in three different cell lines (HEK293, HCT116, and PC3), where they were as effective as their corresponding single-targeting siRNAs in target knockdown. The algorithm developed in this study should prove to be useful for predicting dual-targeting siRNAs in a variety of different targets and is available from http://demo1.interagon.com/DualTargeting/. PMID:20410240

  6. Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: applications for developmental toxicology.

    PubMed

    Timme-Laragy, Alicia R; Karchner, Sibel I; Hahn, Mark E

    2012-01-01

    The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knockdown via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e., phenotypic anchoring). In this chapter, we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use.

  7. RNAi-mediated knockdown of the Halloween gene spookiest (CYP307B1) impedes adult eclosion in the western tarnished plant bug, Lygus hesperus

    USDA-ARS?s Scientific Manuscript database

    Ecdysteroids play a critical role in coordinating insect growth, development, and reproduction. A suite of cytochrome P450 monooxygenases coded by what are collectively termed Halloween genes mediate ecdysteroid biosynthesis. In this study, we describe cloning and RNAi-mediated knockdown of the CYP3...

  8. PAI-1, a target gene of miR-143, regulates invasion and metastasis by upregulating MMP-13 expression of human osteosarcoma.

    PubMed

    Hirahata, Mio; Osaki, Mitsuhiko; Kanda, Yusuke; Sugimoto, Yui; Yoshioka, Yusuke; Kosaka, Nobuyoshi; Takeshita, Fumitaka; Fujiwara, Tomohiro; Kawai, Akira; Ito, Hisao; Ochiya, Takahiro; Okada, Futoshi

    2016-05-01

    Despite recent improvements in the therapy for osteosarcoma, 30-40% of osteosarcoma patients die of this disease, mainly due to its lung metastasis. We have previously reported that intravenous injection of miR-143 significantly suppresses lung metastasis of human osteosarcoma cells (143B) in a mouse model. In this study, we examined the biological role and mechanism of miR-143 in the metastasis of human osteosarcoma cells. We identified plasminogen activator inhibitor-1 (PAI-1) as a direct target gene of miR-143. To determine the role of PAI-1 in human osteosarcoma cells, siRNA was transfected into 143B cells for knockdown of PAI-1 expression. An in vitro study showed that downregulation of PAI-1 suppressed cell invasion activity, but not proliferation. Moreover, injection of PAI-1 siRNA into a primary lesion in the osteosarcoma mouse model inhibited lung metastasis compared to control siRNA-injected mice, without influencing the proliferative activity of the tumor cells. Subsequent examination using 143B cells revealed that knockdown of PAI-1 expression resulted in downregulation of the expression and secretion of matrix metalloproteinase-13 (MMP-13), which is also a target gene of miR-143 and a proteolytic enzyme that regulates tumor-induced osteolysis. Immunohistochemical analysis using clinical samples showed that higher miR-143 expressing cases showed poor expression of PAI-1 in the primary tumor cells. All such cases belonged to the lung metastasis-negative group. Moreover, the frequency of lung metastasis-positive cases was significantly higher in PAI-1 and MMP-13 double-positive cases than in PAI-1 or MMP-13 single-positive or double-negative cases (P < 0.05). These results indicated that PAI-1, a target gene of miR-143, regulates invasion and lung metastasis via enhancement of MMP-13 expression and secretion in human osteosarcoma cells, suggesting that these molecules could be potential therapeutic target genes for preventing lung metastasis in

  9. Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

    PubMed

    Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

    2017-01-01

    Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can

  10. Sterilization of sterlet Acipenser ruthenus by using knockdown agent, antisense morpholino oligonucleotide, against dead end gene.

    PubMed

    Linhartová, Zuzana; Saito, Taiju; Kašpar, Vojtěch; Rodina, Marek; Prášková, Eva; Hagihara, Seishi; Pšenička, Martin

    2015-10-15

    Sturgeons (chondrostean, acipenseridae) are ancient fish species, widely known for their caviar. Nowadays, most of them are critically endangered. The sterlet (Acipenser ruthenus) is a common Eurasian sturgeon species with a small body size and the fastest reproductive cycle among sturgeons. Such species can be used as a host for surrogate production; application is of value for recovery of critically endangered and huge sturgeon species with an extremely long reproductive cycle. One prerequisite for production of the donor's gametes only is to have a sterile host. Commonly used sterilization techniques in fishes such as triploidization or hybridization do not guarantee sterility in sturgeon. Alternatively, sterilization can be achieved by using a temporary germ cell exclusion-specific gene by a knockdown agent, the antisense morpholino oligonucleotide (MO). The targeted gene for the MO is the dead end gene (dnd) which is a vertebrate-specific gene encoding a RNA-binding protein which is crucial for migration and survival of primordial germ cells (PGCs). For this purpose, a dnd homologue of Russian sturgeon (Agdnd), resulting in the same sequence in the start codon region with isolated fragments of sterlet dnd (Ardnd), was used. Reverse transcription polymerase chain reaction confirmed tissue-specific expression of Ardnd only in the gonads of both sexes. Dnd-MO for depletion of PGCs together with fluorescein isothiocyanate (FITC)-biotin-dextran for PGCs labeling was injected into the vegetal region of one- to four-cell-stage sterlet embryos. In the control groups, only FITC was injected to validate the injection method and labeling of PGCs. After optimization of MO concentration together with volume injection, 250-μM MO was applied for sterilization of sturgeon embryos. Primordial germ cells were detected under a fluorescent stereomicroscope in the genital ridge of the FITC-labeled control group only, whereas no PGCs were present in the body cavities of morphants

  11. PhotoMorphs™: A Novel Light-Activated Reagent for Controlling Gene Expression in Zebrafish

    PubMed Central

    Tomasini, Amber J.; Schuler, Aaron D.; Zebala, John A.; Mayer, Alan N.

    2009-01-01

    Manipulating gene expression in zebrafish is critical for exploiting the full potential of this vertebrate model organism. Morpholino oligos are the most commonly employed antisense technology for knocking down gene expression. However, morpholinos suffer from a lack of control over the timing and location of knockdown. In this report, we describe a novel light-activatable knockdown reagent called PhotoMorph™. PhotoMorphs can be generated from existing morpholinos by hybridization with a complementary caging strand containing a photocleavable linkage. The caging strand neutralizes the morpholino activity until irradiation of the PhotoMorph with UV light releases the morpholino. We generated PhotoMorphs to target genes encoding enhanced green fluorescent protein (EGFP), No tail, and E-cadherin to illustrate the utility of this approach. Temporal control of gene expression with PhotoMorphs permitted us to circumvent the early lethal phenotype of E-cadherin knockdown. A splice-blocking PhotoMorph directed to the rheb gene showed light-dependent gene knockdown up to 72 hpf. PhotoMorphs thus offer a new class of laboratory reagents suitable for the spatiotemporal control of gene expression in the zebrafish. PMID:19644983

  12. Protein Knockdown Technology: Application of Ubiquitin Ligase to Cancer Therapy.

    PubMed

    Ohoka, Nobumichi; Shibata, Norihito; Hattori, Takayuki; Naito, Mikihiko

    2016-01-01

    Selective degradation of pathogenic proteins by small molecules in cells is a novel approach for development of therapeutic agents against various diseases, including cancer. We and others have developed a protein knockdown technology with a series of hybrid small compounds, called SNIPERs (Specific and Nongenetic IAP-dependent Protein ERasers); and peptidic chimeric molecules, called PROTACs (proteolysis-targeting chimeric molecules), which induce selective degradation of target proteins via the ubiquitin-proteasome pathway. These compounds include two different ligands connected by a linker; one is a ligand for a ubiquitin ligase and the other is a ligand for the target protein, which are expected to crosslink these proteins in cells. Theoretically, any cytosolic protein can be targeted for degradation by this technology. To date, several SNIPERs and PROTACs against various oncogenic proteins have been developed, which specifically induce polyubiquitylation and proteasomal degradation of the oncogenic proteins, resulting in cell death, growth arrest, or impaired migration of cancer cells. Thus, this protein knockdown technology has a great potential for cancer therapy.

  13. RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

    PubMed Central

    Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

    2006-01-01

    Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

  14. About miRNAs, miRNA seeds, target genes and target pathways.

    PubMed

    Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas

    2017-12-05

    miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).

  15. ALK is a MYCN target gene and regulates cell migration and invasion in neuroblastoma

    PubMed Central

    Hasan, Md. Kamrul; Nafady, Asmaa; Takatori, Atsushi; Kishida, Satoshi; Ohira, Miki; Suenaga, Yusuke; Hossain, Shamim; Akter, Jesmin; Ogura, Atsushi; Nakamura, Yohko; Kadomatsu, Kenji; Nakagawara, Akira

    2013-01-01

    Human anaplastic lymphoma kinase (ALK) has been identified as an oncogene that is mutated or amplified in NBLs. To obtain a better understanding of the molecular events associated with ALK in the pathogenesis of NBL, it is necessary to clarify how ALK gene contributes to NBL progression. In the present study, we found that ALK expression was significantly high in NBL clinical samples with amplified MYCN (n = 126, P < 0.01) and in developing tumors of MYCN-transgenic mice. Indeed, promoter analysis revealed that ALK is a direct transcriptional target of MYCN. Overexpression and knockdown of ALK demonstrated its function in cell proliferation, migration and invasion. Moreover, treatment with an ALK inhibitor, TAE-684, efficiently suppressed such biological effects in MYCN amplified cells and tumor growth of the xenograft in mice. Our present findings explore the fundamental understanding of ALK in order to develop novel therapeutic tools by targeting ALK for aggressive NBL treatment. PMID:24356251

  16. Knockdown of ferroportin accelerates erastin-induced ferroptosis in neuroblastoma cells.

    PubMed

    Geng, N; Shi, B-J; Li, S-L; Zhong, Z-Y; Li, Y-C; Xua, W-L; Zhou, H; Cai, J-H

    2018-06-01

    Ferroptosis is a new-found iron-dependent form of non-apoptotic regulated cell death (RCD), which is activated on therapy with several antitumor agents, but the potential mechanism remains unclear. Erastin, exhibiting selectivity for RAS-mutated cancer cells, induces ferroptosis by increasing iron and lipid reactive oxygen species (ROS) levels in cell. Ferroportin (Fpn), the sole iron export protein, participates in the regulation of intracellular iron concentration. In this study, we investigated the role of Fpn on ferroptosis induced by erastin in SH-SY5Y cells. The cell viability was determined by CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay kit. The activity of caspase-3 was measured by ELISA kit. qRT-PCR was performed to examine the mRNA expression of Fpn. Western blot assay was conducted to examine the expression level of marker proteins. Specific commercial kits were used to examine the levels of MDA, ROS and iron in cells, respectively. Ferroptosis was evaluated by intracellular lipid ROS level and iron concentration. Hepcidin could prevent erastin-induced ferroptosis by degrading Fpn. Erastin (5 μg/mL) was observed to induce ferroptosis in neuroblastoma cells at 6 hours, which was promoted by knockdown of Fpn. The expression of Fpn gene and protein was decreased in SH-SY5Y cells treated with erastin. After treatment with erastin, Fpn siRNA transfection in SH-SY5Y cells was able to accelerate ferroptosis-associated phenotypic changes. Fpn acted as a negative regulator of ferroptosis by reducing intracellular iron concentration. Knockdown of Fpn enhanced anticancer activity of erastin. These results suggested that knockdown of Fpn accelerated erastin-induced ferroptosis by increasing iron-dependent lipid ROS accumulation, highlighting Fpn as a potential therapeutic target site for neuroblastoma. Thus, Fpn inhibitors may provide new access for chemosensitization of neuroblastoma.

  17. EphA2 knockdown attenuates atherosclerotic lesion development in ApoE(-/-) mice.

    PubMed

    Jiang, Hong; Li, Xinyun; Zhang, Xiaoli; Liu, Yan; Huang, Shanying; Wang, Xiaowei

    2014-01-01

    The inflammatory response of vascular endothelial cells plays important roles in the initiation and progression of atherosclerotic lesions. EphA2 receptor activation promotes the endothelial cell inflammatory response, and its expression is increased in the endothelial cell layer of atherosclerotic plaques. However, the association between EphA2 and atherosclerosis has not been determined. Eight-week-old male ApoE(-/-) mice were systemically infected with adenoassociated virus serotype 9 carrying a small hairpin RNA specifically targeting the EphA2 gene to knock down EphA2 expression in aortic endothelial cells. These mice were then fed a high-cholesterol diet for 12 weeks. Blood was collected for the measurement of plasma lipids. The aortas were harvested to evaluate the atherosclerotic lesion size, macrophage components, and expression of proinflammatory genes using Oil Red O staining, immunofluorescence staining, and molecular biology analysis. The lesions formed in the entire aorta and aortic sinus of the ApoE(-/-) mice with EphA2 knockdown were significantly smaller than those in the control mice (10.7%±3.1% versus 25.1%±4.2%; 0.51±0.02mm(2) versus 0.85±0.03mm(2); n=10; P<.05). Furthermore, the lesions in the ApoE(-/-) mice with EphA2 knockdown displayed reduced inflammation compared with the control mice, as reflected by the decreased macrophage infiltration (8.2%±2.9% versus 22.7%±4%; n=10; P<.05); decreased nuclear factor-κβ activation; and diminished expression of vascular cell adhesion molecule-1, E-selectin, and monocyte chemotactic protein-1 (all P<.05). Our data demonstrate that the EphA2 receptor silencing attenuates the extent and inflammation of atherosclerotic lesions in ApoE(-/-) mice. Thus, EphA2 knockdown in endothelial cells represents a novel therapeutic strategy for patients with atherosclerosis. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Liu, E-mail: lyang@u.washington.edu; Medical Research Service, VA Puget Sound Health Care System, Seattle, WA 98108; Hu, Hsien-Ming

    2010-11-05

    Research highlights: {yields} Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. {yields} The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. {yields} While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. {yields} This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusionmore » protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.« less

  19. High-Throughput Analysis of Promoter Occupancy Reveals New Targets for Arx, a Gene Mutated in Mental Retardation and Interneuronopathies

    PubMed Central

    Quillé, Marie-Lise; Hirchaud, Edouard; Baron, Daniel; Benech, Caroline; Guihot, Jeanne; Placet, Morgane; Mignen, Olivier; Férec, Claude; Houlgatte, Rémi; Friocourt, Gaëlle

    2011-01-01

    Genetic investigations of X-linked intellectual disabilities have implicated the ARX (Aristaless-related homeobox) gene in a wide spectrum of disorders extending from phenotypes characterised by severe neuronal migration defects such as lissencephaly, to mild or moderate forms of mental retardation without apparent brain abnormalities but with associated features of dystonia and epilepsy. Analysis of Arx spatio-temporal localisation profile in mouse revealed expression in telencephalic structures, mainly restricted to populations of GABAergic neurons at all stages of development. Furthermore, studies of the effects of ARX loss of function in humans and animal models revealed varying defects, suggesting multiple roles of this gene during brain development. However, to date, little is known about how ARX functions as a transcription factor and the nature of its targets. To better understand its role, we combined chromatin immunoprecipitation and mRNA expression with microarray analysis and identified a total of 1006 gene promoters bound by Arx in transfected neuroblastoma (N2a) cells and in mouse embryonic brain. Approximately 24% of Arx-bound genes were found to show expression changes following Arx overexpression or knock-down. Several of the Arx target genes we identified are known to be important for a variety of functions in brain development and some of them suggest new functions for Arx. Overall, these results identified multiple new candidate targets for Arx and should help to better understand the pathophysiological mechanisms of intellectual disability and epilepsy associated with ARX mutations. PMID:21966449

  20. Knockdown of Uba2 inhibits colorectal cancer cell invasion and migration through downregulation of the Wnt/β-catenin signaling pathway.

    PubMed

    Cheng, Hongjing; Sun, Xun; Li, Ji; He, Ping; Liu, Wanqi; Meng, Xiangwei

    2018-05-10

    Colorectal cancer is a serious threat to human health, and has a high mortality rate. There is currently no effective therapy for end-stage colorectal cancer. In recent years, molecular targeted therapy has received increasing attention for cancer treatment. In particular, the role of Uba2, a vital component of SUMO-activating enzyme, has been highlighted, which plays important roles in the progression of certain cancers; however, its role in colorectal cancer remains unclear. Accordingly, the aim of this study was to evaluate the relationship between Uba2 and colorectal cancer. Uba2 expression was knocked down in two colorectal cancer cell lines, and gene microarray analysis was conducted, followed by proliferation, migration, and invasion assays. Uba2 knockdown influenced the expression of several genes, and significantly inhibited the proliferation, migration, and invasion of cancer cells. To determine the underlying mechanism, the expression of related signaling pathways and molecules was evaluated in the knockdown cell lines. Overall, the results suggest that Uba2 participates in the progression, invasion, and metastasis of colorectal cancer, and the possible mechanism is via regulating the Wnt signaling pathway and enhancing epithelial-mesenchymal transition behaviors of colorectal cancer cells. Therefore, Uba2 is expected to be an important oncoprotein and potential therapeutic target in colorectal cancer. © 2018 Wiley Periodicals, Inc.

  1. Enhanced Antitumorigenic Effects in Glioblastoma on Double Targeting of Pleiotrophin and Its Receptor ALK1

    PubMed Central

    Grzelinski, Marius; Steinberg, Florian; Martens, Tobias; Czubayko, Frank; Lamszus, Katrin; Aigner, Achim

    2009-01-01

    In adults, glioblastomas are the most lethal and most frequent malignant brain tumors, and the poor prognosis despite aggressive treatment indicates the need to establish novel targets for molecular intervention. The secreted growth factor pleiotrophin (PTN, HB-GAM, HBNF, OSF-1) shows mitogenic, chemotactic, and transforming activity. Whereas PTN expression is tightly regulated during embryogenesis and is very limited in normal adult tissues, a marked PTN up-regulation is seen in tumors including glioblastomas. Likewise, the PTN receptor anaplastic lymphoma kinase (ALK) has been shown previously to be upregulated and functionally relevant in glioblastoma. In this study, we explore the antitumorigenic effects of the simultaneous ribozyme-mediated knockdown of both receptor and ligand. Various glioblastoma cell lines are analyzed for PTN and ALK expression. Beyond the individual efficacies of several specific ribozymes against PTN or ALK, respectively, antiproliferative and proapoptotic effects of a single gene targeting approach are strongly enhanced on double knockdown of both genes in vitro. More importantly, this results in the abolishment of tumor growth in an in vivo subcutaneous tumor xenograft model. Finally, the analysis of various downstream signaling pathways by antibody arrays reveals a distinct pattern of changes in the activation of signal transduction molecules on PTN/ALK double knockdown. Beyond the already known ones, it identifies additional pathways relevant for PTN/ALK signaling. We conclude that double targeting of PTN and ALK leads to enhanced antitumorigenic effects over single knockdown approaches, which offers novel therapeutic options owing to increased efficacy also after prolonged knockdown. PMID:19177199

  2. Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

    PubMed Central

    Krishnamurthy, Sateesh; Behlke, Mark A; Ramachandran, Shyam; Salem, Aliasger K; McCray Jr, Paul B; Davidson, Beverly L

    2012-01-01

    The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA) delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE) or human airway epithelia (HAE) grown at the air–liquid interface (ALI), the delivery of a Dicer-substrate small-interfering RNA (DsiRNA) duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT) with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding) exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF), a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap) database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi) responses. PMID

  3. Abhydrolase domain containing 2, an androgen target gene, promotes prostate cancer cell proliferation and migration.

    PubMed

    Obinata, Daisuke; Takada, Shogo; Takayama, Ken-ichi; Urano, Tomohiko; Ito, Akiko; Ashikari, Daisaku; Fujiwara, Kyoko; Yamada, Yuta; Murata, Taro; Kumagai, Jinpei; Fujimura, Tetsuya; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Homma, Yukio; Takahashi, Satoru; Inoue, Satoshi

    2016-04-01

    The androgen receptor (AR) plays a key role in the development of prostate cancer. AR signalling mediates the expression of androgen-responsive genes, which are involved in prostate cancer development and progression. Our previous chromatin immunoprecipitation study showed that the region of abhydrolase domain containing 2 (ABHD2) includes a functional androgen receptor binding site. In this study, we demonstrated that ABHD2 is a novel androgen-responsive gene that is overexpressed in human prostate cancer tissues. The expression levels of ABHD2 in androgen-sensitive cells were evaluated by quantitative reverse transcription polymerase chain reaction and western-blot analyses. LNCaP and VCaP cells with ABHD2 overexpression or short interfering RNA (siRNA) knockdown were used for functional analyses. ABHD2 expression was examined in clinical samples of prostate cancer by immunohistochemistry. We showed that ABHD2 expression is increased by androgen in LNCaP and VCaP cells. This androgen-induced ABHD2 expression was diminished by bicalutamide. While stable expression of ABHD2 affected the enhancement of LNCaP cell proliferation and migration, siRNA-mediated ABHD2 knockdown suppressed cell proliferation and migration. In addition, the siRNA treatment significantly repressed the tumour growth derived from LNCaP cells in athymic mice. Immunohistochemical analysis of ABHD2 expression in tumour specimens showed a positive correlation of ABHD2 immunoreactivity with high Gleason score and pathological N stage. Moreover, patients with high immunoreactivity of ABHD2 showed low cancer-specific survival rates and a resistance to docetaxel-based chemotherapy. ABHD2 is a novel androgen-regulated gene that can promote prostate cancer growth and resistance to chemotherapy, and is a novel target for diagnosis and treatment of prostate cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Citrullination/Methylation Crosstalk on Histone H3 Regulates ER-Target Gene Transcription.

    PubMed

    Clancy, Kathleen W; Russell, Anna-Maria; Subramanian, Venkataraman; Nguyen, Hannah; Qian, Yuewei; Campbell, Robert M; Thompson, Paul R

    2017-06-16

    Posttranslational modifications of histone tails are a key contributor to epigenetic regulation. Histone H3 Arg26 and Lys27 are both modified by multiple enzymes, and their modifications have profound effects on gene expression. Citrullination of H3R26 by PAD2 and methylation of H3K27 by PRC2 have opposing downstream impacts on gene regulation; H3R26 citrullination activates gene expression, and H3K27 methylation represses gene expression. Both of these modifications are drivers of a variety of cancers, and their writer enzymes, PAD2 and EZH2, are the targets of drug therapies. After biochemical and cell-based analysis of these modifications, a negative crosstalk interaction is observed. Methylation of H3K27 slows citrullination of H3R26 30-fold, whereas citrullination of H3R26 slows methylation 30,000-fold. Examination of the mechanism of this crosstalk interaction uncovered a change in structure of the histone tail upon citrullination which prevents methylation by the PRC2 complex. This mechanism of crosstalk is reiterated in cell lines using knockdowns and inhibitors of both enzymes. Based our data, we propose a model in which, after H3 Cit26 formation, H3K27 demethylases are recruited to the chromatin to activate transcription. In total, our studies support the existence of crosstalk between citrullination of H3R26 and methylation of H3K27.

  5. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    PubMed

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional

  6. Knockdown of Rice microRNA166 by Short Tandem Target Mimic (STTM).

    PubMed

    Teotia, Sachin; Zhang, Dabing; Tang, Guiliang

    2017-01-01

    Small RNAs, including microRNAs (miRNAs), are abundant in plants and play key roles in controlling plant development and physiology. miRNAs regulate the expression of the target genes involved in key plant processes. Due to functional redundancy among miRNA family members in plants, an ideal approach to silence the expression of all members simultaneously, for their functional characterization, is desirable. Target mimic (TM) was the first approach to achieve this goal. Short tandem target mimic (STTM) is a potent approach complementing TM for silencing miRNAs in plants. STTMs have been successfully used in dicots to block miRNA functions. Here, we describe in detail the protocol for designing STTM construct to block miRNA functions in rice. Such approach can be applied to silence miRNAs in other monocots as well.

  7. Knockdown of human serine/threonine kinase 33 suppresses human small cell lung carcinoma by blocking RPS6/BAD signaling transduction.

    PubMed

    Sun, E L; Liu, C X; Ma, Z X; Mou, X Y; Mu, X A; Ni, Y H; Li, X L; Zhang, D; Ju, Y R

    2017-01-01

    Small cell lung cancer (SCLC) is characterized by rapid growth rate and a tendency to metastasize to distinct sites of patients' bodies. The human serine/threonine kinase 33 (STK33) gene has shown its potency as a therapeutic target for prevention of lung carcinomas including non-small cell lung cancer (NSCLC), but its function in the oncogenesis and development of SCLC remains unrevealed. In the current study, it was hypothesized that STK33 played a key role in the proliferation, survival, and invasion of SCLC cells. The expression of STK33 in human SCLC cell lines NCI-H466 and DMS153 was inhibited by specific shRNA. The cell proliferation, cell apoptosis, and cell invasion of the cells were assessed with a series of in vitro assays. To explore the mechanism through which STK33 gene exerted its function in the carcinogenesis of SCLC cells, the effect of STK33 knockdown on the activity of S6K1/RPS6/BAD signaling was detected. Then the results were further confirmed with STK33 inhibitor ML281 and in vivo assays. The results demonstrated that inhibition of STK33 in SCLC cells suppressed the cell proliferation and invasion while induced cell apoptosis. Associated with the change in the phenotypic features, knockdown of STK33 also decreased the phosphorylation of RPS6 and BAD while increased the expression of cleaved caspase 9, indicating that apoptosis induced by STK33 suppression was mediated via mitochondrial pathway. Similar to the results of STK33 knockdown, incubating NCI-H466 cells with STK33 inhibitor also reduced the cell viability by suppressing RPS6/BAD pathways. Additionally, STK33 knockdown also inhibited tumor growth and RPS6/BAD activity in mice models. Findings outlined in our study were different from that in NSCLC to some extent: knockdown of STK33 in SCLC cells induced the apoptosis through mitochondrial pathway but independent of S6K1 function, inferring that the function of STK33 might be cancer type specific.

  8. Targeted gene insertion for molecular medicine.

    PubMed

    Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

    2008-11-01

    Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

  9. RNA interference knockdown of DNA methyl-transferase 3 affects gene alternative splicing in the honey bee

    PubMed Central

    Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.

    2013-01-01

    Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726

  10. Differential Effects of Histone Acetyltransferase GCN5 or PCAF Knockdown on Urothelial Carcinoma Cells

    PubMed Central

    Koutsogiannouli, Evangelia A.; Hader, Christiane; Pinkerneil, Maria; Hoffmann, Michèle J.; Schulz, Wolfgang A.

    2017-01-01

    Disturbances in histone acetyltransferases (HATs) are common in cancers. In urothelial carcinoma (UC), p300 and CBP are often mutated, whereas the GNAT family HATs GCN5 and PCAF (General Control Nonderepressible 5, p300/CBP-Associated Factor) are often upregulated. Here, we explored the effects of specific siRNA-mediated knockdown of GCN5, PCAF or both in four UC cell lines (UCCs). Expression of various HATs and marker proteins was measured by qRT-PCR and western blot. Cellular effects of knockdowns were analyzed by flow cytometry and ATP-, caspase-, and colony forming-assays. GCN5 was regularly upregulated in UCCs, whereas PCAF was variable. Knockdown of GCN5 or both GNATs, but not of PCAF alone, diminished viability and inhibited clonogenic growth in 2/4 UCCs, inducing cell cycle changes and caspase-3/7 activity. PCAF knockdown elicited GCN5 mRNA upregulation. Double knockdown increased c-MYC and MDM2 (Mouse Double Minute 2) in most cell lines. In conclusion, GCN5 upregulation is especially common in UCCs. GCN5 knockdown impeded growth of specific UCCs, whereas PCAF knockdown elicited minor effects. The limited sensitivity towards GNAT knockdown and its variation between the cell lines might be due to compensatory effects including HAT, c-MYC and MDM2 upregulation. Our results predict that developing drugs targeting individual HATs for UC treatment may be challenging. PMID:28678170

  11. Targeted mutagenesis of aryl hydrocarbon receptor 2a and 2b genes in Atlantic killifish (Fundulus heteroclitus)

    PubMed Central

    Aluru, Neelakanteswar; Karchner, Sibel I.; Franks, Diana G.; Nacci, Diane; Champlin, Denise; Hahn, Mark E.

    2014-01-01

    Understanding molecular mechanisms of toxicity is facilitated by experimental manipulations, such as disruption of function by gene targeting, that are especially challenging in non-standard model species with limited genomic resources. While loss-of-function approaches have included gene knock-down using morpholino-modified oligonucleotides and random mutagenesis using mutagens or retroviruses, more recent approaches include targeted mutagenesis using zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 technology. These latter methods provide more accessible opportunities to explore gene function in non-traditional model species. To facilitate evaluations of toxic mechanisms for important categories of aryl hydrocarbon pollutants, whose actions are known to be receptor mediated, we used ZFN and CRISPR-Cas9 approaches to generate aryl hydrocarbon receptor 2a (AHR2a) and AHR2b gene mutations in Atlantic killifish (Fundulus heteroclitus) embryos. This killifish is a particularly valuble non-traditional model for this study, with multiple paralogs of AHR whose functions are not well characterized. In addition, some populations of this species have evolved resistance to toxicants such as halogenated aromatic hydrocarbons. AHR-null killifish will be valuable for characterizing the role of the individual AHR paralogs in evolved resistance, as well as in normal development. We first used five-finger ZFNs targeting exons 1 and 3 of AHR2a. Subsequently, CRISPR-Cas9 guide RNAs were designed to target regions in exon 2 and 3 of AHR2a and AHR2b. We successfully induced frameshift mutations in AHR2a exon 3 with ZFN and CRISPR-Cas9 guide RNAs, with mutation frequencies of 10% and 16%, respectively. In AHR2b, mutations were induced using CRISPR-Cas9 guide RNAs targeting sites in both exon 2 (17%) and exon 3 (63%). We screened AHR2b exon 2 CRISPR-Cas9-injected embryos for

  12. Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

    PubMed

    Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

    2015-04-20

    Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early developmental defects in the hematopoietic lineage.

    PubMed

    Tulpule, Asmin; Lensch, M William; Miller, Justine D; Austin, Karyn; D'Andrea, Alan; Schlaeger, Thorsten M; Shimamura, Akiko; Daley, George Q

    2010-04-29

    Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNA interference (RNAi) strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicate that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease.

  14. Investigating knockdown resistance (kdr) mechanism against pyrethroids/DDT in the malaria vector Anopheles funestus across Africa.

    PubMed

    Irving, Helen; Wondji, Charles S

    2017-08-09

    Understanding the molecular basis of insecticide resistance is key to improve the surveillance and monitoring of malaria vector populations under control. In the major malaria vector Anopheles funestus, little is currently known about the role of the knockdown resistance (kdr) mechanism. Here, we investigated the presence and contribution of knockdown resistance (kdr) to pyrethroids/DDT resistance observed in Anopheles funestus across Africa. Pyrosequencing genotyping and sequencing of the voltage gated sodium channel (VGSC) gene did not detect the common L1014F mutation in field collected An. funestus across Africa. Amplification and cloning of the full-length of the sodium channel gene in pyrethroid resistant mosquitoes revealed evidences of alternative splicing events with three transcripts of 2092, 2061 and 2117 amino acids (93% average similarity to An. gambiae). Several amino acid changes were detected close to the domain II of the protein such as L928R, F938 W, I939S, L802S and T1008 M. However, all these mutations are found at low frequency and their role in pyrethroid resistance could not be established. The presence of the exclusive alternative splicing at exon 19 was not associated with resistance phenotype. Analysis of patterns of genetic diversity of the VGSC gene revealed a high polymorphism level of this gene across Africa with no evidence of directional selection suggesting a limited role for knockdown resistance in pyrethroid resistance in An. funestus. Patterns of genetic differentiation correlate with previous observations of the existence of barriers to gene flow Africa-wide with southern population significantly differentiated from other regions. Despite an apparent limited role of knockdown resistance in An. funestus, it is necessary to continue to monitor the contribution of the mutations detected here as increasing selection from insecticide-based interventions may change the dynamic in field populations as previously observed in other

  15. Knockdown of Mediator Complex Subunit 19 Suppresses the Growth and Invasion of Prostate Cancer Cells

    PubMed Central

    Zhao, Hongwei; Lv, Wei; Chen, Jian; Wan, Fengchun; Liu, Dongfu; Gao, Zhenli; Wu, Jitao

    2017-01-01

    Prostate cancer (PCa) is one of the most common cancers in elderly men. Mediator Complex Subunit 19 (Med19) is overexpressed and plays promotional roles in many cancers. However, the roles of Med19 in PCa are still obscure. In this study, by using immunohistochemical staining, we found higher expression level of Med19 in PCa tissues than in adjacent benign prostate tissues. We then knocked down the Med19 expression in PCa cell lines LNCaP and PC3 by using lentivirus siRNA. Cell proliferation, anchor-independent growth, migration, and invasion were suppressed in Med19 knockdown PCa cells. In nude mice xenograft model, we found that Med19 knockdown PCa cells formed smaller tumors with lower proliferation index than did control cells. In the mechanism study, we found that Med19 could regulate genes involved in cell proliferation, cell cycle, and epithelial-mesenchymal transition, including P27, pAKT, pPI3K, IGF1R, E-Cadherin, N-Cadherin, Vimentin, ZEB2, Snail-1 and Snail-2. Targeting Med19 in PCa cells could inhibit the PCa growth and metastasis, and might be a therapeutic option for PCa in the future. PMID:28125713

  16. LSD1 knockdown reveals novel histone lysine methylation in human breast cancer MCF-7 cells.

    PubMed

    Jin, Yue; Huo, Bo; Fu, Xueqi; Cheng, Zhongyi; Zhu, Jun; Zhang, Yu; Hao, Tian; Hu, Xin

    2017-08-01

    Histone lysine methylation, which plays an important role in the regulation of gene expression, genome stability, chromosome conformation and cell differentiation, is a dynamic process that is collaboratively regulated by lysine methyltransferases (KMTs) and lysine demethylases (KDMs). LSD1, the first identified KDMs, catalyzes the demethylation of mono- and di-methylated H3K4 and H3K9. Here, we systematically investigated the effects of LSD1 knockdown on histone methylations. Surprisingly, in addition to H3K4 and H3K9, the methylation level on other histone lysines, such as H3K27, H3K36 and H3K79, are also increased. The expression of SOX2, E-cadherin and FoxA2 are increased upon LSD1 knockdown, and the methylation level of H3K4, H3K27 and H3K36 in the promoter region of these genes are all changed after LSD1 knockdown. Our results show that LSD1 knockdown has a broad effect on histone lysine methylation, which indicates that LSD1 regulates histone lysine methylation in collaboration with other KMTs and KDMs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Double Knockdown of Prolyyl Hydroxylase and Factor Inhibiting HIF with Non-Viral Minicircle Gene Therapy Enhances Stem Cell Mobilization and Angiogenesis After Myocardial Infarction

    PubMed Central

    Huang, Mei; Nguyen, Patricia; Jia, Fangjun; Hu, Shijun; Gong, Yongquan; de Almeida, Patricia E.; Wang, Li; Nag, Divya; Kay, Mark A.; Giaccia, Amato J; Robbins, Robert C.; Wu, Joseph C.

    2011-01-01

    Background Under normoxic conditions, hypoxia inducible factor-1 alpha (HIF-1α) is rapidly degraded by two hydroxylases, prolyl hydroxylase (PHD) and factor inhibiting HIF-1 (FIH). Because HIF-1α mediates the cardioprotective response to ischemic injury, its up-regulation may be an effective therapeutic option for ischemic heart failure. Methods and Results PHD and FIH were cloned from mouse embryonic stem cells. The best candidate short hairpin sequences for inhibiting PHD isoenzyme 2 (shPHD2) and FIH (shFIH) were inserted into novel non-viral minicircle vectors. In vitro studies after cell transfection of mouse C2C12 myoblasts, HL-1 atrial myocytes, and c-kit+ cardiac progenitor cells (CPCs) demonstrated higher expression of angiogenesis factors in the double knockdown group compared to the single knockdown and shScramble control groups. To confirm in vitro data, shRNA minicircle vectors were injected intramyocardially following LAD ligation in adult FVB mice (n=60). Functional studies using magnetic resonance imaging (MRI), echocardiography, and pressure-volume (PV) loops showed greater improvement in cardiac function in the double knockdown group. To assess mechanism(s) of this functional recovery, we performed a cell trafficking experiment, which demonstrated significantly greater recruitment of bone marrow cells to the ischemic myocardium in the double knockdown group. Fluorescence activated cell sorting (FACS) showed significantly higher activation of endogenous c-kit+ cardiac progenitor cells. Immunostaining showed increased neovascularization and decreased apoptosis in areas of injured myocardium. Finally, western blots and laser capture microdissection (LCM) analysis confirmed up-regulation of HIF-1α protein and angiogenesis genes, respectively. Conclusions We demonstrated that HIF-1α up-regulation by double knockdown of PHD and FIH synergistically increases stem cell mobilization and myocardial angiogenesis, leading to improved cardiac function. PMID

  18. tCRISPRi: tunable and reversible, one-step control of gene expression

    NASA Astrophysics Data System (ADS)

    Li, Xin-Tian; Jun, Yonggun; Erickstad, Michael J.; Brown, Steven D.; Parks, Adam; Court, Donald L.; Jun, Suckjoon

    2016-12-01

    The ability to control the level of gene expression is a major quest in biology. A widely used approach employs deletion of a nonessential gene of interest (knockout), or multi-step recombineering to move a gene of interest under a repressible promoter (knockdown). However, these genetic methods are laborious, and limited for quantitative study. Here, we report a tunable CRISPR-cas system, “tCRISPRi”, for precise and continuous titration of gene expression by more than 30-fold. Our tCRISPRi system employs various previous advancements into a single strain: (1) We constructed a new strain containing a tunable arabinose operon promoter PBAD to quantitatively control the expression of CRISPR-(d)Cas protein over two orders of magnitude in a plasmid-free system. (2) tCRISPRi is reversible, and gene expression is repressed under knockdown conditions. (3) tCRISPRi shows significantly less than 10% leaky expression. (4) Most important from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step of oligo recombineering. Our results show that tCRISPRi, in combination with recombineering, provides a simple and easy-to-implement tool for gene expression control, and is ideally suited for construction of both individual strains and high-throughput tunable knockdown libraries.

  19. Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei

    2014-10-10

    Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less

  20. Evolving phage vectors for cell targeted gene delivery.

    PubMed

    Larocca, David; Burg, Michael A; Jensen-Pergakes, Kristen; Ravey, Edward Prenn; Gonzalez, Ana Maria; Baird, Andrew

    2002-03-01

    We adapted filamentous phage vectors for targeted gene delivery to mammalian cells by inserting a mammalian reporter gene expression cassette (GFP) into the vector backbone and fusing the pIII coat protein to a cell targeting ligand (i.e. FGF2, EGF). Like transfection with animal viral vectors, targeted phage gene delivery is concentration, time, and ligand dependent. Importantly, targeted phage particles are specific for the appropriate target cell surface receptor. Phage have distinct advantages over existing gene therapy vectors because they are simple, economical to produce at high titer, have no intrinsic tropism for mammalian cells, and are relatively simple to genetically modify and evolve. Initially transduction by targeted phage particles was low resulting in foreign gene expression in 1-2% of transfected cells. We increased transduction efficiency by modifying both the transfection protocol and vector design. For example, we stabilized the display of the targeting ligand to create multivalent phagemid-based vectors with transduction efficiencies of up to 45% in certain cell lines when combined with genotoxic treatment. Taken together, these studies establish that the efficiency of phage-mediated gene transfer can be significantly improved through genetic modification. We are currently evolving phage vectors with enhanced cell targeting, increased stability, reduced immunogenicity and other properties suitable for gene therapy.

  1. Targeting gene therapy to cancer: a review.

    PubMed

    Dachs, G U; Dougherty, G J; Stratford, I J; Chaplin, D J

    1997-01-01

    In recent years the idea of using gene therapy as a modality in the treatment of diseases other than genetically inherited, monogenic disorders has taken root. This is particularly obvious in the field of oncology where currently more than 100 clinical trials have been approved worldwide. This report will summarize some of the exciting progress that has recently been made with respect to both targeting the delivery of potentially therapeutic genes to tumor sites and regulating their expression within the tumor microenvironment. In order to specifically target malignant cells while at the same time sparing normal tissue, cancer gene therapy will need to combine highly selective gene delivery with highly specific gene expression, specific gene product activity, and, possibly, specific drug activation. Although the efficient delivery of DNA to tumor sites remains a formidable task, progress has been made in recent years using both viral (retrovirus, adenovirus, adeno-associated virus) and nonviral (liposomes, gene gun, injection) methods. In this report emphasis will be placed on targeted rather than high-efficiency delivery, although those would need to be combined in the future for effective therapy. To date delivery has been targeted to tumor-specific and tissue-specific antigens, such as epithelial growth factor receptor, c-kit receptor, and folate receptor, and these will be described in some detail. To increase specificity and safety of gene therapy further, the expression of the therapeutic gene needs to be tightly controlled within the target tissue. Targeted gene expression has been analyzed using tissue-specific promoters (breast-, prostate-, and melanoma-specific promoters) and disease-specific promoters (carcinoembryonic antigen, HER-2/neu, Myc-Max response elements, DF3/MUC). Alternatively, expression could be regulated externally with the use of radiation-induced promoters or tetracycline-responsive elements. Another novel possibility that will be

  2. Effects of PHENYLALANINE AMMONIA LYASE ( PAL) knockdown on cell wall composition, biomass digestibility, and biotic and abiotic stress responses in Brachypodium

    DOE PAGES

    Cass, Cynthia L.; Peraldi, Antoine; Dowd, Patrick F.; ...

    2015-06-19

    The phenylpropanoid pathway in plants synthesizes a variety of structural and defence compounds, and is an important target in efforts to reduce cell wall lignin for improved biomass conversion to biofuels. Little is known concerning the trade-offs in grasses when perturbing the function of the first gene family in the pathway, PHENYLALANINE AMMONIA LYASE ( PAL). Therefore, PAL isoforms in the model grass Brachypodium distachyon were targeted, by RNA interference (RNAi), and large reductions (up to 85%) in stem tissue transcript abundance for two of the eight putative BdPAL genes were identified. The cell walls of stems of BdPAL-knockdown plantsmore » had reductions of 43% in lignin and 57% in cell wall-bound ferulate, and a nearly 2-fold increase in the amounts of polysaccharide-derived carbohydrates released by thermochemical and hydrolytic enzymic partial digestion. PAL-knockdown plants exhibited delayed development and reduced root growth, along with increased susceptibilities to the fungal pathogens Fusarium culmorum and Magnaporthe oryzae. Surprisingly, these plants generally had wild-type (WT) resistances to caterpillar herbivory, drought, and ultraviolet light. RNA sequencing analyses revealed that the expression of genes associated with stress responses including ethylene biosynthesis and signalling were significantly altered in PAL knocked-down plants under non-challenging conditions. These data reveal that, although an attenuation of the phenylpropanoid pathway increases carbohydrate availability for biofuel, it can adversely affect plant growth and disease resistance to fungal pathogens. Lastly, the data identify notable differences between the stress responses of these monocot pal mutants versus Arabidopsis (a dicot) pal mutants and provide insights into the challenges that may arise when deploying phenylpropanoid pathway-altered bioenergy crops.« less

  3. Effects of PHENYLALANINE AMMONIA LYASE ( PAL) knockdown on cell wall composition, biomass digestibility, and biotic and abiotic stress responses in Brachypodium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cass, Cynthia L.; Peraldi, Antoine; Dowd, Patrick F.

    The phenylpropanoid pathway in plants synthesizes a variety of structural and defence compounds, and is an important target in efforts to reduce cell wall lignin for improved biomass conversion to biofuels. Little is known concerning the trade-offs in grasses when perturbing the function of the first gene family in the pathway, PHENYLALANINE AMMONIA LYASE ( PAL). Therefore, PAL isoforms in the model grass Brachypodium distachyon were targeted, by RNA interference (RNAi), and large reductions (up to 85%) in stem tissue transcript abundance for two of the eight putative BdPAL genes were identified. The cell walls of stems of BdPAL-knockdown plantsmore » had reductions of 43% in lignin and 57% in cell wall-bound ferulate, and a nearly 2-fold increase in the amounts of polysaccharide-derived carbohydrates released by thermochemical and hydrolytic enzymic partial digestion. PAL-knockdown plants exhibited delayed development and reduced root growth, along with increased susceptibilities to the fungal pathogens Fusarium culmorum and Magnaporthe oryzae. Surprisingly, these plants generally had wild-type (WT) resistances to caterpillar herbivory, drought, and ultraviolet light. RNA sequencing analyses revealed that the expression of genes associated with stress responses including ethylene biosynthesis and signalling were significantly altered in PAL knocked-down plants under non-challenging conditions. These data reveal that, although an attenuation of the phenylpropanoid pathway increases carbohydrate availability for biofuel, it can adversely affect plant growth and disease resistance to fungal pathogens. Lastly, the data identify notable differences between the stress responses of these monocot pal mutants versus Arabidopsis (a dicot) pal mutants and provide insights into the challenges that may arise when deploying phenylpropanoid pathway-altered bioenergy crops.« less

  4. Zinc-finger protein-targeted gene regulation: Genomewide single-gene specificity

    PubMed Central

    Tan, Siyuan; Guschin, Dmitry; Davalos, Albert; Lee, Ya-Li; Snowden, Andrew W.; Jouvenot, Yann; Zhang, H. Steven; Howes, Katherine; McNamara, Andrew R.; Lai, Albert; Ullman, Chris; Reynolds, Lindsey; Moore, Michael; Isalan, Mark; Berg, Lutz-Peter; Campos, Bradley; Qi, Hong; Spratt, S. Kaye; Case, Casey C.; Pabo, Carl O.; Campisi, Judith; Gregory, Philip D.

    2003-01-01

    Zinc-finger protein transcription factors (ZFP TFs) can be designed to control the expression of any desired target gene, and thus provide potential therapeutic tools for the study and treatment of disease. Here we report that a ZFP TF can repress target gene expression with single-gene specificity within the human genome. A ZFP TF repressor that binds an 18-bp recognition sequence within the promoter of the endogenous CHK2 gene gives a >10-fold reduction in CHK2 mRNA and protein. This level of repression was sufficient to generate a functional phenotype, as demonstrated by the loss of DNA damage-induced CHK2-dependent p53 phosphorylation. We determined the specificity of repression by using DNA microarrays and found that the ZFP TF repressed a single gene (CHK2) within the monitored genome in two different cell types. These data demonstrate the utility of ZFP TFs as precise tools for target validation, and highlight their potential as clinical therapeutics. PMID:14514889

  5. Conditional RNAi: towards a silent gene therapy.

    PubMed

    Lee, Sang-Kyung; Kumar, Priti

    2009-07-02

    RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.

  6. Targeted polymeric nanoparticles for cancer gene therapy

    PubMed Central

    Kim, Jayoung; Wilson, David R.; Zamboni, Camila G.; Green, Jordan J.

    2015-01-01

    In this article, advances in designing polymeric nanoparticles for targeted cancer gene therapy are reviewed. Characterization and evaluation of biomaterials, targeting ligands, and transcriptional elements are each discussed. Advances in biomaterials have driven improvements to nanoparticle stability and tissue targeting, conjugation of ligands to the surface of polymeric nanoparticles enable binding to specific cancer cells, and the design of transcriptional elements has enabled selective DNA expression specific to the cancer cells. Together, these features have improved the performance of polymeric nanoparticles as targeted non-viral gene delivery vectors to treat cancer. As polymeric nanoparticles can be designed to be biodegradable, non-toxic, and to have reduced immunogenicity and tumorigenicity compared to viral platforms, they have significant potential for clinical use. Results of polymeric gene therapy in clinical trials and future directions for the engineering of nanoparticle systems for targeted cancer gene therapy are also presented. PMID:26061296

  7. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

    PubMed

    Piras, Bryan A; O'Connor, Daniel M; French, Brent A

    2013-01-01

    AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

  8. Knockdown of RhoA expression alters ovarian cancer biological behavior in vitro and in nude mice.

    PubMed

    Wang, Xiaoxia; Jiang, Wenyan; Kang, Jiali; Liu, Qicai; Nie, Miaoling

    2015-08-01

    RhoA regulates cell proliferation, migration, angiogenesis and gene expression. Altered RhoA activity contributes to cancer progression. The present study investigated the effects of RhoA knockdown on the regulation of ovarian cancer biological behavior in vitro and in nude mice. The expression of RhoA was knocked down using a lentivirus carrying RhoA short hairpin RNA (shRNA) in ovarian cancer cells and was confirmed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The altered ovarian cancer biological behaviors were assayed by cell viability, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling (TUNEL), migration, invasion, and nude mice tumorigenicity assays, while the altered gene expression was detected by RT-qPCR and western blot analysis. The results showed that lentivirus-carrying RhoA shRNA significantly suppressed RhoA expression in ovarian cancer cells, which suppressed tumor cell viability, migration, invasion and adhesion in vitro. RhoA silencing also inhibited the tumorigenicity of ovarian cancer cells in nude mice, which was characterized by the suppression of tumor xenograft formation and growth and induction of tumor cell apoptosis. The results of the present study demonstrated that knockdown of RhoA expression had a significant antitumor effect on ovarian cancer cells in vitro and in nude mice, suggesting that RhoA may be a target for the development of a novel therapeutic strategy in the control of ovarian cancer.

  9. Gene targeting in mosquito cells: a demonstration of 'knockout' technology in extrachromosomal gene arrays

    PubMed Central

    Eggleston, Paul; Zhao, Yuguang

    2001-01-01

    Background Gene targeting would offer a number of advantages over current transposon-based strategies for insect transformation. These include freedom from both position effects associated with quasi-random integration and concerns over transgene instability mediated by endogenous transposases, independence from phylogenetic restrictions on transposon mobility and the ability to generate gene knockouts. Results We describe here our initial investigations of gene targeting in the mosquito. The target site was a hygromycin resistance gene, stably maintained as part of an extrachromosomal array. Using a promoter-trap strategy to enrich for targeted events, a neomycin resistance gene was integrated into the target site. This resulted in knockout of hygromycin resistance concurrent with the expression of high levels of neomycin resistance from the resident promoter. PCR amplification of the targeted site generated a product that was specific to the targeted cell line and consistent with precise integration of the neomycin resistance gene into the 5' end of the hygromycin resistance gene. Sequencing of the PCR product and Southern analysis of cellular DNA subsequently confirmed this molecular structure. Conclusions These experiments provide the first demonstration of gene targeting in mosquito tissue and show that mosquito cells possess the necessary machinery to bring about precise integration of exogenous sequences through homologous recombination. Further development of these procedures and their extension to chromosomally located targets hold much promise for the exploitation of gene targeting in a wide range of medically and economically important insect species. PMID:11513755

  10. RNA therapeutics targeting osteoclast-mediated excessive bone resorption

    PubMed Central

    Wang, Yuwei; Grainger, David W

    2011-01-01

    RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356

  11. The Mechanism of Gene Targeting in Human Somatic Cells

    PubMed Central

    Kan, Yinan; Ruis, Brian; Lin, Sherry; Hendrickson, Eric A.

    2014-01-01

    Gene targeting in human somatic cells is of importance because it can be used to either delineate the loss-of-function phenotype of a gene or correct a mutated gene back to wild-type. Both of these outcomes require a form of DNA double-strand break (DSB) repair known as homologous recombination (HR). The mechanism of HR leading to gene targeting, however, is not well understood in human cells. Here, we demonstrate that a two-end, ends-out HR intermediate is valid for human gene targeting. Furthermore, the resolution step of this intermediate occurs via the classic DSB repair model of HR while synthesis-dependent strand annealing and Holliday Junction dissolution are, at best, minor pathways. Moreover, and in contrast to other systems, the positions of Holliday Junction resolution are evenly distributed along the homology arms of the targeting vector. Most unexpectedly, we demonstrate that when a meganuclease is used to introduce a chromosomal DSB to augment gene targeting, the mechanism of gene targeting is inverted to an ends-in process. Finally, we demonstrate that the anti-recombination activity of mismatch repair is a significant impediment to gene targeting. These observations significantly advance our understanding of HR and gene targeting in human cells. PMID:24699519

  12. Simple Monitoring of Gene Targeting Efficiency in Human Somatic Cell Lines Using the PIGA Gene

    PubMed Central

    Karnan, Sivasundaram; Konishi, Yuko; Ota, Akinobu; Takahashi, Miyuki; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2012-01-01

    Gene targeting in most of human somatic cell lines has been labor-intensive because of low homologous recombination efficiency. The development of an experimental system that permits a facile evaluation of gene targeting efficiency in human somatic cell lines is the first step towards the improvement of this technology and its application to a broad range of cell lines. In this study, we utilized phosphatidylinositol glycan anchor biosynthesis class A (PIGA), a gene essential for the synthesis of glycosylphosphatidyl inositol (GPI) anchors, as a reporter of gene targeting events in human somatic cell lines. Targeted disruption of PIGA was quantitatively detected with FLAER, a reagent that specifically binds to GPI anchors. Using this PIGA-based reporter system, we successfully detected adeno-associated virus (AAV)-mediated gene targeting events both with and without promoter-trap enrichment of gene-targeted cell population. The PIGA-based reporter system was also capable of reproducing previous findings that an AAV-mediated gene targeting achieves a remarkably higher ratio of homologous versus random integration (H/R ratio) of targeting vectors than a plasmid-mediated gene targeting. The PIGA-based system also detected an approximately 2-fold increase in the H/R ratio achieved by a small negative selection cassette introduced at the end of the AAV-based targeting vector with a promoter-trap system. Thus, our PIGA-based system is useful for monitoring AAV-mediated gene targeting and will assist in improving gene targeting technology in human somatic cell lines. PMID:23056640

  13. Knockdown of long noncoding RNA 00152 (LINC00152) inhibits human retinoblastoma progression.

    PubMed

    Li, Songhe; Wen, Dacheng; Che, Songtian; Cui, Zhihua; Sun, Yabin; Ren, Hua; Hao, Jilong

    2018-01-01

    A growing body of evidence supports the involvement of long noncoding RNA 00152 (LINC00152) in the progression and metastasis of multiple cancers. However, the exact roles of LINC00152 in the progression of human retinoblastoma (RB) remain unknown. We explored the expression and biological function of human RB. The expression level of LINC00152 in RB tissues and cells was analyzed using quantitative real-time PCR. The function of LINC00152 was determined using a series of in vitro assays. In vivo, a nude mouse model was established to analyze the function of LINC00152. Gene and protein expressions were detected using quantitative real-time PCR and Western blot assays, respectively. The expression of LINC00152 mRNA was upregulated in RB tissues and cell lines. Knockdown of LINC00152 significantly inhibited cell proliferation, colony formation, migration, and invasion and promoted cell apoptosis and caspase-3 and caspase-8 activities in vitro, as well as suppressing tumorigenesis in vivo. We identified several genes related to proliferation, apoptosis, and invasion including Ki-67, Bcl-2, and MMP-9 that were transcriptionally inactivated by LINC00152. Taken together, these data implicate LINC00152 as a therapeutic target in RB.

  14. Anti-tumor effect of estrogen-related receptor alpha knockdown on uterine endometrial cancer

    PubMed Central

    Matsushima, Hiroshi; Mori, Taisuke; Ito, Fumitake; Yamamoto, Takuro; Akiyama, Makoto; Kokabu, Tetsuya; Yoriki, Kaori; Umemura, Shiori; Akashi, Kyoko; Kitawaki, Jo

    2016-01-01

    Estrogen-related receptor (ERR)α presents structural similarities with estrogen receptor (ER)α. However, it is an orphan receptor not binding to naturally occurring estrogens. This study was designed to investigate the role of ERRα in endometrial cancer progression. Immunohistochemistry analysis on 50 specimens from patients with endometrial cancer showed that ERRα was expressed in all examined tissues and the elevated expression levels of ERRα were associated with advanced clinical stages and serous histological type (p < 0.01 for each). ERRα knockdown with siRNA suppressed angiogenesis via VEGF and cell proliferation in vitro (p < 0.01). Cell cycle and apoptosis assays using flow cytometry and western blot revealed that ERRα knockdown induced cell cycle arrest during the mitotic phase followed by apoptosis initiated by caspase-3. Additionally, ERRα knockdown sensitized cells to paclitaxel. A significant reduction of tumor growth and angiogenesis was also observed in ERRα knockdown xenografts (p < 0.01). These findings indicate that ERRα may serve as a novel molecular target for the treatment of endometrial cancer. PMID:27153547

  15. Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex.

    PubMed

    Zhang, Rui; Xu, Jian; Zhao, Jian; Bai, Jinghui

    2017-07-11

    MicroRNAs have been proved to participate in multiple biological processes in cancers. For developing resistance to cytotoxic drug, cancer cells, especially the cancer stem cells, usually change their microRNA expression profile to survive in hostile environments. In the present study, we found that expression of microRNA-27a was increased in colorectal cancer stem cells. High level of microRNA-27a was indicated to induce the resistance to TNF-related apoptosis-inducing ligand (TRAIL). Knockdown of microRNA-27a resensitized colorectal cancer stem cells to TRAIL-induced cell death. Mechanically, the gene of Apaf-1, which is associated with the mitochondrial apoptosis, was demonstrated to be the target of microRNA-27a in colorectal cancer stem cells. Knockdown of microRNA-27a increased the expression level of Apaf-1, thus enhancing the formation of Apaf-1-caspase-9 complex and subsequently promoting the TRAIL-induced apoptosis in colorectal cancer stem cells. These findings suggested that knockdown of microRNA-27a in colorectal cancer stem cells by the specific antioligonucleotides was potential to reverse the chemoresistance to TRAIL. It may represent a novel therapeutic strategy for treating the colorectal cancer more effectively.

  16. HSP27 knockdown produces synergistic induction of apoptosis by HSP90 and kinase inhibitors in glioblastoma multiforme.

    PubMed

    Belkacemi, Louiza; Hebb, Matthew O

    2014-09-01

    The heat-shock proteins HSP27 and HSP90 perpetuate the malignant nature of glioblastoma multiforme (GBM) and offer promise as targets for novel cancer therapeutics. The present study sought to define synergistic antitumor benefits of concurrent HSP27-knockdown and the HSP90 inhibitor, 17-N-allylamino-17-demethoxygeldanamycin (17-AAG) or, comparatively, the non-selective kinase inhibitor, staurosporine, in GBM cells. Dose-response relations were determined for 17-AAG and staurosporine in three GBM cell lines. HSP27-targeted siRNA was administered alone or in combination with subtherapeutic concentrations of each drug and cells were evaluated for viability, proliferation and apoptosis. Adjuvant HSP27 knockdown with 17-AAG or staurosporine produced marked and synergistic decrease in GBM cell viability and proliferation, with robust elevation of apoptotic fractions and caspase-3 activation. HSP27 knockdown confers potent chemosensitization of GBM cells. These novel data support the development of HSP-targeting strategies and, specifically, anti-HSP27 agents for the treatment of GBM. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Identification of an alternative knockdown resistance (kdr)-like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage-gated sodium channel gene.

    PubMed

    Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley

    2014-06-01

    Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.

  18. More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

    PubMed Central

    Ladunga, Istvan

    2007-01-01

    Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

  19. Loss-of-function mutation in Hippo suppressed enlargement of lysosomes and neurodegeneration caused by dFIG4 knockdown.

    PubMed

    Kushimura, Yukie; Azuma, Yumiko; Mizuta, Ikuko; Muraoka, Yuuka; Kyotani, Akane; Yoshida, Hideki; Tokuda, Takahiko; Mizuno, Toshiki; Yamaguchi, Masamitsu

    2018-05-08

    Charcot-Marie-Tooth disease (CMT) is the most common hereditary neuropathy, and more than 80 CMT-causing genes have been identified to date. CMT4J is caused by a loss-of-function mutation in the Factor-Induced-Gene 4 (FIG4) gene, the product of which plays important roles in endosome-lysosome homeostasis. We hypothesized that Mammalian sterile 20-like kinase (MST) 1 and 2, tumor-suppressor genes, are candidate modifiers of CMT4J. We therefore examined the interaction between dFIG4 and Hippo (hpo), Drosophila counterparts of FIG4 and MSTs, respectively, using the Drosophila CMT4J model with the knockdown of dFIG4. The loss-of-function allele of hpo improved the rough eye morphology, locomotive dysfunction accompanied by structural defects in the presynaptic terminals of motoneurons, and the enlargement of lysosomes caused by the knockdown of dFIG4. Therefore, we identified hpo as a modifier of phenotypes induced by the knockdown of dFIG4. These results in Drosophila may provide an insight into the pathogenesis of CMT4J and contribute toward the development of disease-modifying therapy for CMT. We also identified the regulation of endosome-lysosome homeostasis as a novel probable function of Hippo/MST.

  20. Functional analysis of sex-determination genes by gene silencing with LNA-DNA gapmers in the silkworm, Bombyx mori.

    PubMed

    Sakai, Hiroki; Sakaguchi, Honami; Aoki, Fugaku; Suzuki, Masataka G

    2015-08-01

    The sexual fate of B. mori is determined genetically; ZW, female and ZZ, male. Recently, we successfully identified a strong candidate gene at the top of the sex determination cascade in B. mori. This gene was termed Feminizer (Fem) and revealed to be a source of Fem-piRNA. Further, we found that B. mori doublesex (Bmdsx) splicing was markedly altered to produce the male-type isoform when a Fem-piRNA inhibitor was injected into ZW embryos. Moreover, knockdown of Masculinizer (Masc), a Fem-piRNA target gene, altered to produce the female-type isoform of Bmdsx in male embryos. However, it remains unclear as to whether Masc directly regulates the sex-specific expression of Bmdsx. In previous studies, we determined that the male-specific isoform of the Bombyx homolog of IGF-II mRNA-binding protein (Imp(M)) was involved in the male-specific splicing of Bmdsx. In an attempt to clarify the genetic relationship between Fem, Masc, Imp(M), and Bmdsx, knockdown experiments were performed. Knockdown of Fem shifted into male-type Bmdsx, Imp(M) and Masc in female embryos. Knockdown of Masc led to the production of the female-type Bmdsx and a dramatic reduction in Imp(M) expression in male embryos. Knockdown of Imp(M) shifted Bmdsx splice mode from the male-type into the female-type. Our results suggest that: (1) Fem reduces Masc expression, (2) Masc dramatically induces Imp(M) expression, and (3) Imp(M) shifting Bmdsx splice mode from the female-type into the male-type. Based on these findings, we propose a possible genetic cascade regulating sex determination in B. mori. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Knockdown of long non-coding RNA HOTAIR increases miR-454-3p by targeting Stat3 and Atg12 to inhibit chondrosarcoma growth

    PubMed Central

    Bao, Xing; Ren, Tingting; Huang, Yi; Sun, Kunkun; Wang, Shidong; Liu, Kuisheng; Zheng, Bingxin; Guo, Wei

    2017-01-01

    Current practices for the therapy of chondrosarcoma, including wide-margin surgical resection and chemotherapy, are less than satisfactory. Recently, emerging evidence has demonstrated that long non-coding RNAs (lncRNAs) have an essential role in the initiation and progression of tumors. As a typical lncRNA, HOTAIR is significantly overexpressed in various tumors. However, the function and potential biological mechanisms of HOTAIR in human chondrosarcoma remain unknown. Quantitative RT-PCR demonstrated that HOTAIR expression was upregulated in chondrosarcoma tissues and cell lines. High HOTAIR expression is correlated with tumor stage and poor prognosis. Functional experiments reveal that HOTAIR knockdown leads to growth inhibition of human chondrosarcoma cells in vitro and in vivo. In addition to cycle arrest and apoptosis, knockdown of HOTAIR inhibits autophagy, which favors cell death. Mechanistically, we demonstrated that HOTAIR induced DNA methylation of miR-454-3p by recruiting EZH2 and DNMT1 to the miR-454-3p promoter regions, which markedly silences miR-454-3p expression. Further analysis revealed that STAT3 and ATG12 are targets of miR-454-3p, initiate HOTAIR deficiency-induced apoptosis and reduce autophagy. Collectively, our data reveal the roles and functional mechanisms of HOTAIR in human chondrosarcoma and suggest that HOTAIR may act as a prognostic biomarker and potential therapeutic target for chondrosarcoma. PMID:28182000

  2. Knockdown of long non-coding RNA HOTAIR increases miR-454-3p by targeting Stat3 and Atg12 to inhibit chondrosarcoma growth.

    PubMed

    Bao, Xing; Ren, Tingting; Huang, Yi; Sun, Kunkun; Wang, Shidong; Liu, Kuisheng; Zheng, Bingxin; Guo, Wei

    2017-02-09

    Current practices for the therapy of chondrosarcoma, including wide-margin surgical resection and chemotherapy, are less than satisfactory. Recently, emerging evidence has demonstrated that long non-coding RNAs (lncRNAs) have an essential role in the initiation and progression of tumors. As a typical lncRNA, HOTAIR is significantly overexpressed in various tumors. However, the function and potential biological mechanisms of HOTAIR in human chondrosarcoma remain unknown. Quantitative RT-PCR demonstrated that HOTAIR expression was upregulated in chondrosarcoma tissues and cell lines. High HOTAIR expression is correlated with tumor stage and poor prognosis. Functional experiments reveal that HOTAIR knockdown leads to growth inhibition of human chondrosarcoma cells in vitro and in vivo. In addition to cycle arrest and apoptosis, knockdown of HOTAIR inhibits autophagy, which favors cell death. Mechanistically, we demonstrated that HOTAIR induced DNA methylation of miR-454-3p by recruiting EZH2 and DNMT1 to the miR-454-3p promoter regions, which markedly silences miR-454-3p expression. Further analysis revealed that STAT3 and ATG12 are targets of miR-454-3p, initiate HOTAIR deficiency-induced apoptosis and reduce autophagy. Collectively, our data reveal the roles and functional mechanisms of HOTAIR in human chondrosarcoma and suggest that HOTAIR may act as a prognostic biomarker and potential therapeutic target for chondrosarcoma.

  3. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  4. Targeted gene flow for conservation.

    PubMed

    Kelly, Ella; Phillips, Ben L

    2016-04-01

    Anthropogenic threats often impose strong selection on affected populations, causing rapid evolutionary responses. Unfortunately, these adaptive responses are rarely harnessed for conservation. We suggest that conservation managers pay close attention to adaptive processes and geographic variation, with an eye to using them for conservation goals. Translocating pre-adapted individuals into recipient populations is currently considered a potentially important management tool in the face of climate change. Targeted gene flow, which involves moving individuals with favorable traits to areas where these traits would have a conservation benefit, could have a much broader application in conservation. Across a species' range there may be long-standing geographic variation in traits or variation may have rapidly developed in response to a threatening process. Targeted gene flow could be used to promote natural resistance to threats to increase species resilience. We suggest that targeted gene flow is a currently underappreciated strategy in conservation that has applications ranging from the management of invasive species and their impacts to controlling the impact and virulence of pathogens. © 2015 Society for Conservation Biology.

  5. Bacteriophage-Derived Vectors for Targeted Cancer Gene Therapy

    PubMed Central

    Pranjol, Md Zahidul Islam; Hajitou, Amin

    2015-01-01

    Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration. PMID:25606974

  6. Bacteriophage-derived vectors for targeted cancer gene therapy.

    PubMed

    Pranjol, Md Zahidul Islam; Hajitou, Amin

    2015-01-19

    Cancer gene therapy expanded and reached its pinnacle in research in the last decade. Both viral and non-viral vectors have entered clinical trials, and significant successes have been achieved. However, a systemic administration of a vector, illustrating safe, efficient, and targeted gene delivery to solid tumors has proven to be a major challenge. In this review, we summarize the current progress and challenges in the targeted gene therapy of cancer. Moreover, we highlight the recent developments of bacteriophage-derived vectors and their contributions in targeting cancer with therapeutic genes following systemic administration.

  7. Gene Therapy and Targeted Toxins for Glioma

    PubMed Central

    Castro, Maria G.; Candolfi, Marianela; Kroeger, Kurt; King, Gwendalyn D.; Curtin, James F.; Yagiz, Kader; Mineharu, Yohei; Assi, Hikmat; Wibowo, Mia; Muhammad, AKM Ghulam; Foulad, David; Puntel, Mariana; Lowenstein, Pedro R.

    2011-01-01

    The most common primary brain tumor in adults is glioblastoma. These tumors are highly invasive and aggressive with a mean survival time of nine to twelve months from diagnosis to death. Current treatment modalities are unable to significantly prolong survival in patients diagnosed with glioblastoma. As such, glioma is an attractive target for developing novel therapeutic approaches utilizing gene therapy. This review will examine the available preclinical models for glioma including xenographs, syngeneic and genetic models. Several promising therapeutic targets are currently being pursued in pre-clinical investigations. These targets will be reviewed by mechanism of action, i.e., conditional cytotoxic, targeted toxins, oncolytic viruses, tumor suppressors/oncogenes, and immune stimulatory approaches. Preclinical gene therapy paradigms aim to determine which strategies will provide rapid tumor regression and long-term protection from recurrence. While a wide range of potential targets are being investigated preclinically, only the most efficacious are further transitioned into clinical trial paradigms. Clinical trials reported to date are summarized including results from conditionally cytotoxic, targeted toxins, oncolytic viruses and oncogene targeting approaches. Clinical trial results have not been as robust as preclinical models predicted; this could be due to the limitations of the GBM models employed. Once this is addressed, and we develop effective gene therapies in models that better replicate the clinical scenario, gene therapy will provide a powerful approach to treat and manage brain tumors. PMID:21453286

  8. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

  9. Knockdown of AMPKα2 Promotes Pulmonary Arterial Smooth Muscle Cells Proliferation via mTOR/Skp2/p27Kip1 Signaling Pathway

    PubMed Central

    Ke, Rui; Liu, Lu; Zhu, Yanting; Li, Shaojun; Xie, Xinming; Li, Fangwei; Song, Yang; Yang, Lan; Gao, Li; Li, Manxiang

    2016-01-01

    It has been shown that activation of adenosine monophosphate-activated protein kinase (AMPK) suppresses proliferation of a variety of tumor cells as well as nonmalignant cells. In this study, we used post-transcriptional gene silencing with small interfering RNA (siRNA) to specifically examine the effect of AMPK on pulmonary arterial smooth muscle cells (PASMCs) proliferation and to further elucidate its underlying molecular mechanisms. Our results showed that knockdown of AMPKα2 promoted primary cultured PASMCs proliferation; this was accompanied with the elevation of phosphorylation of mammalian target of rapamycin (mTOR) and S-phase kinase-associated protein 2 (Skp2) protein level and reduction of p27Kip1. Importantly, prior silencing of mTOR with siRNA abolished AMPKα2 knockdown-induced Skp2 upregulation, p27Kip1 reduction as well as PASMCs proliferation. Furthermore, pre-depletion of Skp2 by siRNA also eliminated p27Kip1 downregulation and PASMCs proliferation caused by AMPKα2 knockdown. Taken together, our study indicates that AMPKα2 isoform plays an important role in regulation of PASMCs proliferation by modulating mTOR/Skp2/p27Kip1 axis, and suggests that activation of AMPKα2 might have potential value in the prevention and treatment of pulmonary arterial hypertension. PMID:27258250

  10. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

    PubMed

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

    2015-11-01

    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  11. Generation of novel resistance genes using mutation and targeted gene editing.

    PubMed

    Gal-On, Amit; Fuchs, Marc; Gray, Stewart

    2017-10-01

    Classical breeding for virus resistance is a lengthy process and is restricted by the availability of resistance genes. Precise genome editing is a 'dream technology' to improve plants for virus resistance and these tools have opened new and very promising ways to generate virus resistant plants by disrupting host susceptibility genes, or by increasing the expression of viral resistance genes. However, precise targets must be identified and their roles understood to minimize potential negative effects on the plant. Nonetheless, the opportunities for genome editing are expanding, as are the technologies to generate effective and broad-spectrum resistance against plant viruses. Here we provide insights into recent progress related to gene targets and gene editing technologies. Published by Elsevier B.V.

  12. Integrative ChIP-seq/microarray analysis identifies a CTNNB1 target signature enriched in intestinal stem cells and colon cancer.

    PubMed

    Watanabe, Kazuhide; Biesinger, Jacob; Salmans, Michael L; Roberts, Brian S; Arthur, William T; Cleary, Michele; Andersen, Bogi; Xie, Xiaohui; Dai, Xing

    2014-01-01

    Deregulation of canonical Wnt/CTNNB1 (beta-catenin) pathway is one of the earliest events in the pathogenesis of colon cancer. Mutations in APC or CTNNB1 are highly frequent in colon cancer and cause aberrant stabilization of CTNNB1, which activates the transcription of Wnt target genes by binding to chromatin via the TCF/LEF transcription factors. Here we report an integrative analysis of genome-wide chromatin occupancy of CTNNB1 by chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-seq) and gene expression profiling by microarray analysis upon RNAi-mediated knockdown of CTNNB1 in colon cancer cells. We observed 3629 CTNNB1 binding peaks across the genome and a significant correlation between CTNNB1 binding and knockdown-induced gene expression change. Our integrative analysis led to the discovery of a direct Wnt target signature composed of 162 genes. Gene ontology analysis of this signature revealed a significant enrichment of Wnt pathway genes, suggesting multiple feedback regulations of the pathway. We provide evidence that this gene signature partially overlaps with the Lgr5+ intestinal stem cell signature, and is significantly enriched in normal intestinal stem cells as well as in clinical colorectal cancer samples. Interestingly, while the expression of the CTNNB1 target gene set does not correlate with survival, elevated expression of negative feedback regulators within the signature predicts better prognosis. Our data provide a genome-wide view of chromatin occupancy and gene regulation of Wnt/CTNNB1 signaling in colon cancer cells.

  13. Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

    PubMed Central

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-01-01

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

  14. Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

    PubMed

    Firnhaber, Christopher; Hammarlund, Marc

    2013-11-01

    Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

  15. Problem-Solving Test: Targeted Gene Disruption

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…

  16. Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex

    PubMed Central

    Zhang, Rui; Xu, Jian; Zhao, Jian; Bai, Jinghui

    2017-01-01

    MicroRNAs have been proved to participate in multiple biological processes in cancers. For developing resistance to cytotoxic drug, cancer cells, especially the cancer stem cells, usually change their microRNA expression profile to survive in hostile environments. In the present study, we found that expression of microRNA-27a was increased in colorectal cancer stem cells. High level of microRNA-27a was indicated to induce the resistance to TNF-related apoptosis-inducing ligand (TRAIL). Knockdown of microRNA-27a resensitized colorectal cancer stem cells to TRAIL-induced cell death. Mechanically, the gene of Apaf-1, which is associated with the mitochondrial apoptosis, was demonstrated to be the target of microRNA-27a in colorectal cancer stem cells. Knockdown of microRNA-27a increased the expression level of Apaf-1, thus enhancing the formation of Apaf-1-caspase-9 complex and subsequently promoting the TRAIL-induced apoptosis in colorectal cancer stem cells. These findings suggested that knockdown of microRNA-27a in colorectal cancer stem cells by the specific antioligonucleotides was potential to reverse the chemoresistance to TRAIL. It may represent a novel therapeutic strategy for treating the colorectal cancer more effectively. PMID:28423356

  17. Specific c-Jun target genes in malignant melanoma.

    PubMed

    Schummer, Patrick; Kuphal, Silke; Vardimon, Lily; Bosserhoff, Anja K; Kappelmann, Melanie

    2016-05-03

    A fundamental event in the development and progression of malignant melanoma is the de-regulation of cancer-relevant transcription factors. We recently showed that c-Jun is a main regulator of melanoma progression and, thus, is the most important member of the AP-1 transcription factor family in this disease. Surprisingly, no cancer-related specific c-Jun target genes in melanoma were described in the literature, so far. Therefore, we focused on pre-existing ChIP-Seq data (Encyclopedia of DNA Elements) of 3 different non-melanoma cell lines to screen direct c-Jun target genes. Here, a specific c-Jun antibody to immunoprecipitate the associated promoter DNA was used. Consequently, we identified 44 direct c-Jun targets and a detailed analysis of 6 selected genes confirmed their deregulation in malignant melanoma. The identified genes were differentially regulated comparing 4 melanoma cell lines and normal human melanocytes and we confirmed their c-Jun dependency. Direct interaction between c-Jun and the promoter/enhancer regions of the identified genes was confirmed by us via ChIP experiments. Interestingly, we revealed that the direct regulation of target gene expression via c-Jun can be independent of the existence of the classical AP-1 (5´-TGA(C/G)TCA-3´) consensus sequence allowing for the subsequent down- or up-regulation of the expression of these cancer-relevant genes. In summary, the results of this study indicate that c-Jun plays a crucial role in the development and progression of malignant melanoma via direct regulation of cancer-relevant target genes and that inhibition of direct c-Jun targets through inhibition of c-Jun is a potential novel therapeutic option for treatment of malignant melanoma.

  18. YAP and MRTF-A, transcriptional co-activators of RhoA-mediated gene expression, are critical for glioblastoma tumorigenicity.

    PubMed

    Yu, Olivia M; Benitez, Jorge A; Plouffe, Steven W; Ryback, Daniel; Klein, Andrea; Smith, Jeff; Greenbaum, Jason; Delatte, Benjamin; Rao, Anjana; Guan, Kun-Liang; Furnari, Frank B; Chaim, Olga Meiri; Miyamoto, Shigeki; Brown, Joan Heller

    2018-06-11

    The role of YAP (Yes-associated protein 1) and MRTF-A (myocardin-related transcription factor A), two transcriptional co-activators regulated downstream of GPCRs (G protein-coupled receptors) and RhoA, in the growth of glioblastoma cells and in vivo glioblastoma multiforme (GBM) tumor development was explored using human glioblastoma cell lines and tumor-initiating cells derived from patient-derived xenografts (PDX). Knockdown of these co-activators in GSC-23 PDX cells using short hairpin RNA significantly attenuated in vitro self-renewal capability assessed by limiting dilution, oncogene expression, and neurosphere formation. Orthotopic xenografts of the MRTF-A and YAP knockdown PDX cells formed significantly smaller tumors and were of lower morbidity than wild-type cells. In vitro studies used PDX and 1321N1 glioblastoma cells to examine functional responses to sphingosine 1-phosphate (S1P), a GPCR agonist that activates RhoA signaling, demonstrated that YAP signaling was required for cell migration and invasion, whereas MRTF-A was required for cell adhesion; both YAP and MRTF-A were required for proliferation. Gene expression analysis by RNA-sequencing of S1P-treated MRTF-A or YAP knockout cells identified 44 genes that were induced through RhoA and highly dependent on YAP, MRTF-A, or both. Knockdown of F3 (tissue factor (TF)), a target gene regulated selectively through YAP, blocked cell invasion and migration, whereas knockdown of HBEGF (heparin-binding epidermal growth factor-like growth factor), a gene selectively induced through MRTF-A, prevented cell adhesion in response to S1P. Proliferation was sensitive to knockdown of target genes regulated through either or both YAP and MRTF-A. Expression of TF and HBEGF was also selectively decreased in tumors from PDX cells lacking YAP or MRTF-A, indicating that these transcriptional pathways are regulated in preclinical GBM models and suggesting that their activation through GPCRs and RhoA contributes to growth and

  19. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    PubMed

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Genetic architecture of a hormonal response to gene knockdown in honey bees.

    PubMed

    Ihle, Kate E; Rueppell, Olav; Huang, Zachary Y; Wang, Ying; Fondrk, M Kim; Page, Robert E; Amdam, Gro V

    2015-01-01

    Variation in endocrine signaling is proposed to underlie the evolution and regulation of social life histories, but the genetic architecture of endocrine signaling is still poorly understood. An excellent example of a hormonally influenced set of social traits is found in the honey bee (Apis mellifera): a dynamic and mutually suppressive relationship between juvenile hormone (JH) and the yolk precursor protein vitellogenin (Vg) regulates behavioral maturation and foraging of workers. Several other traits cosegregate with these behavioral phenotypes, comprising the pollen hoarding syndrome (PHS) one of the best-described animal behavioral syndromes. Genotype differences in responsiveness of JH to Vg are a potential mechanistic basis for the PHS. Here, we reduced Vg expression via RNA interference in progeny from a backcross between 2 selected lines of honey bees that differ in JH responsiveness to Vg reduction and measured JH response and ovary size, which represents another key aspect of the PHS. Genetic mapping based on restriction site-associated DNA tag sequencing identified suggestive quantitative trait loci (QTL) for ovary size and JH responsiveness. We confirmed genetic effects on both traits near many QTL that had been identified previously for their effect on various PHS traits. Thus, our results support a role for endocrine control of complex traits at a genetic level. Furthermore, this first example of a genetic map of a hormonal response to gene knockdown in a social insect helps to refine the genetic understanding of complex behaviors and the physiology that may underlie behavioral control in general. © The American Genetic Association. 2015.

  1. Genetic Architecture of a Hormonal Response to Gene Knockdown in Honey Bees

    PubMed Central

    Rueppell, Olav; Huang, Zachary Y.; Wang, Ying; Fondrk, M. Kim; Page, Robert E.; Amdam, Gro V.

    2015-01-01

    Variation in endocrine signaling is proposed to underlie the evolution and regulation of social life histories, but the genetic architecture of endocrine signaling is still poorly understood. An excellent example of a hormonally influenced set of social traits is found in the honey bee (Apis mellifera): a dynamic and mutually suppressive relationship between juvenile hormone (JH) and the yolk precursor protein vitellogenin (Vg) regulates behavioral maturation and foraging of workers. Several other traits cosegregate with these behavioral phenotypes, comprising the pollen hoarding syndrome (PHS) one of the best-described animal behavioral syndromes. Genotype differences in responsiveness of JH to Vg are a potential mechanistic basis for the PHS. Here, we reduced Vg expression via RNA interference in progeny from a backcross between 2 selected lines of honey bees that differ in JH responsiveness to Vg reduction and measured JH response and ovary size, which represents another key aspect of the PHS. Genetic mapping based on restriction site-associated DNA tag sequencing identified suggestive quantitative trait loci (QTL) for ovary size and JH responsiveness. We confirmed genetic effects on both traits near many QTL that had been identified previously for their effect on various PHS traits. Thus, our results support a role for endocrine control of complex traits at a genetic level. Furthermore, this first example of a genetic map of a hormonal response to gene knockdown in a social insect helps to refine the genetic understanding of complex behaviors and the physiology that may underlie behavioral control in general. PMID:25596612

  2. On the role of PDZ domain-encoding genes in Drosophila border cell migration.

    PubMed

    Aranjuez, George; Kudlaty, Elizabeth; Longworth, Michelle S; McDonald, Jocelyn A

    2012-11-01

    Cells often move as collective groups during normal embryonic development and wound healing, although the mechanisms governing this type of migration are poorly understood. The Drosophila melanogaster border cells migrate as a cluster during late oogenesis and serve as a powerful in vivo genetic model for collective cell migration. To discover new genes that participate in border cell migration, 64 out of 66 genes that encode PDZ domain-containing proteins were systematically targeted by in vivo RNAi knockdown. The PDZ domain is one of the largest families of protein-protein interaction domains found in eukaryotes. Proteins that contain PDZ domains participate in a variety of biological processes, including signal transduction and establishment of epithelial apical-basal polarity. Targeting PDZ proteins effectively assesses a larger number of genes via the protein complexes and pathways through which these proteins function. par-6, a known regulator of border cell migration, was a positive hit and thus validated the approach. Knockdown of 14 PDZ domain genes disrupted migration with multiple RNAi lines. The candidate genes have diverse predicted cellular functions and are anticipated to provide new insights into the mechanisms that control border cell movement. As a test of this concept, two genes that disrupted migration were characterized in more detail: big bang and the Dlg5 homolog CG6509. We present evidence that Big bang regulates JAK/STAT signaling, whereas Dlg5/CG6509 maintains cluster cohesion. Moreover, these results demonstrate that targeting a selected class of genes by RNAi can uncover novel regulators of collective cell migration.

  3. Small cell lung cancer growth is inhibited by miR-342 through its effect of the target gene IA-2.

    PubMed

    Xu, Huanyu; Cai, Tao; Carmona, Gilberto N; Abuhatzira, Liron; Notkins, Abner L

    2016-09-26

    Small cell lung cancers (SCLC) are tumors of neuroendocrine origin. Previous in vitro studies from our laboratory showed that SCLC expresses high levels of the transmembrane dense core vesicle protein IA-2 (islet cell antigen-2) as compared to normal lung cells. IA-2, through its effect on dense core vesicles (DCVs), is known to be involved in the secretion of hormones and neurotransmitters. It is believed that the dysregulated release of the neurotransmitter Acetylcholine (ACh) by DCVs has an autocrine effect on SCLC cell growth. Recently, we found that IA-2 is a target of the microRNA miR-342 and that miR-342 mimics suppress the expression of IA-2. The present experiments were initiated to see whether IA-2 and/or miR-342 affect the growth of SCLC. SCLC cell growth was evaluated following the knockdown of endogenous IA-2 with RNAi or by overexpressing miR-342 with a mimic. The secretion and content of ACh in SCLC cells was analyzed using a human acetylcholine ELISA (enzyme-linked immunosorbent assay) kit. The knockdown of endogenous IA-2 by RNAi reduced SCLC cell growth within 4 days by 40 % or more. Similar results were obtained when these cell lines were transfected with a miR-342 mimic. The knockdown of IA-2 by RNAi or miR-342 with a mimic also resulted in a significant decrease in the secretion of ACh, one of the autocrine hormones secreted by SCLC. Further studies revealed that the growth of SCLC cell lines that had been treated with the miR-342 mimic was restored to nearly normal levels by treatment with ACh. Our studies show for the first time that both miR-342 and its target gene IA-2 are involved in the growth process of SCLC cells and act by their effect on autocrine secretion. These findings point to possible new therapeutic approaches for the treatment of autocrine-induced tumor proliferation.

  4. Drosophila CLOCK target gene characterization: implications for circadian tissue-specific gene expression

    PubMed Central

    Abruzzi, Katharine Compton; Rodriguez, Joseph; Menet, Jerome S.; Desrochers, Jennifer; Zadina, Abigail; Luo, Weifei; Tkachev, Sasha; Rosbash, Michael

    2011-01-01

    CLOCK (CLK) is a master transcriptional regulator of the circadian clock in Drosophila. To identify CLK direct target genes and address circadian transcriptional regulation in Drosophila, we performed chromatin immunoprecipitation (ChIP) tiling array assays (ChIP–chip) with a number of circadian proteins. CLK binding cycles on at least 800 sites with maximal binding in the early night. The CLK partner protein CYCLE (CYC) is on most of these sites. The CLK/CYC heterodimer is joined 4–6 h later by the transcriptional repressor PERIOD (PER), indicating that the majority of CLK targets are regulated similarly to core circadian genes. About 30% of target genes also show cycling RNA polymerase II (Pol II) binding. Many of these generate cycling RNAs despite not being documented in prior RNA cycling studies. This is due in part to different RNA isoforms and to fly head tissue heterogeneity. CLK has specific targets in different tissues, implying that important CLK partner proteins and/or mechanisms contribute to gene-specific and tissue-specific regulation. PMID:22085964

  5. Knockdown of HDAC1 expression suppresses invasion and induces apoptosis in glioma cells.

    PubMed

    Wang, Xiao-Qiang; Bai, Hong-Min; Li, Shi-Ting; Sun, Hui; Min, Ling-Zhao; Tao, Bang-Bao; Zhong, Jun; Li, Bin

    2017-07-18

    Glioma is the most common malignant tumor of the central nervous system, with a low survival rate of five years worldwide. Although high expression and prognostic value of histone deacetylase 1 (HDAC1) have been recently reported in various types of human tumors, the molecular mechanism underlying the biological function of HDAC1 in glioma is still unclear. We found that HDAC1 was elevated in glioma tissues and cell lines. HDAC1 expression was closely related with pathological grade and overall survival of patients with gliomas. Downregulation of HDAC1 inhibited cell proliferation, prevented invasion of glioma cell lines, and induced cell apoptosis. The expression of apoptosis and metastasis related molecules were detected by RT-PCR and Western blot, respectively, in U251 and T98G cells with HDAC1 knockdown. We found that HDAC1 knockdown upregulated expression of BIM, BAX, cleaved CASPASE3 and E-CADHERIN, and decreased expression of TWIST1, SNAIL and MMP9 in U251 and T98G cells with HDAC1 knockdown. In vivo data showed that knockdown of HDAC1 inhibited tumor growth in nude mice. In summary, HDAC1 may therefore be considered an unfavorable progression indicator for glioma patients, and may also serve as a potential therapeutic target.

  6. The knock-down of the expression of MdMLO19 reduces susceptibility to powdery mildew (Podosphaera leucotricha) in apple (Malus domestica).

    PubMed

    Pessina, Stefano; Angeli, Dario; Martens, Stefan; Visser, Richard G F; Bai, Yuling; Salamini, Francesco; Velasco, Riccardo; Schouten, Henk J; Malnoy, Mickael

    2016-10-01

    Varieties resistant to powdery mildew (PM; caused by Podosphaera leucotricha) are a major component of sustainable apple production. Resistance can be achieved by knocking-out susceptibility S-genes to be singled out among members of the MLO (Mildew Locus O) gene family. Candidates are MLO S-genes of phylogenetic clade V up-regulated upon PM inoculation, such as MdMLO11 and 19 (clade V) and MdMLO18 (clade VII). We report the knock-down through RNA interference of MdMLO11 and 19, as well as the complementation of resistance with MdMLO18 in the Arabidopsis thaliana triple mlo mutant Atmlo2/6/12. The knock-down of MdMLO19 reduced PM disease severity by 75%, whereas the knock-down of MdMLO11, alone or in combination with MdMLO19, did not result in any reduction or additional reduction of susceptibility compared with MdMLO19 alone. The test in A. thaliana excluded a role for MdMLO18 in PM susceptibility. Cell wall appositions (papillae) were present in both PM-resistant and PM-susceptible plants, but were larger in resistant lines. No obvious negative phenotype was observed in plants with mlo genes knocked down. Apparently, MdMLO19 plays the pivotal role in apple PM susceptibility and its knock-down induces a very significant level of resistance. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. STAT3 or USF2 Contributes to HIF Target Gene Specificity

    PubMed Central

    Pawlus, Matthew R.; Wang, Liyi; Murakami, Aya; Dai, Guanhai; Hu, Cheng-Jun

    2013-01-01

    The HIF1- and HIF2-mediated transcriptional responses play critical roles in solid tumor progression. Despite significant similarities, including their binding to promoters of both HIF1 and HIF2 target genes, HIF1 and HIF2 proteins activate unique subsets of target genes under hypoxia. The mechanism for HIF target gene specificity has remained unclear. Using siRNA or inhibitor, we previously reported that STAT3 or USF2 is specifically required for activation of endogenous HIF1 or HIF2 target genes. In this study, using reporter gene assays and chromatin immuno-precipitation, we find that STAT3 or USF2 exhibits specific binding to the promoters of HIF1 or HIF2 target genes respectively even when over-expressed. Functionally, HIF1α interacts with STAT3 to activate HIF1 target gene promoters in a HIF1α HLH/PAS and N-TAD dependent manner while HIF2α interacts with USF2 to activate HIF2 target gene promoters in a HIF2α N-TAD dependent manner. Physically, HIF1α HLH and PAS domains are required for its interaction with STAT3 while both N- and C-TADs of HIF2α are involved in physical interaction with USF2. Importantly, addition of functional USF2 binding sites into a HIF1 target gene promoter increases the basal activity of the promoter as well as its response to HIF2+USF2 activation while replacing HIF binding site with HBS from a HIF2 target gene does not change the specificity of the reporter gene. Importantly, RNA Pol II on HIF1 or HIF2 target genes is primarily associated with HIF1α or HIF2α in a STAT3 or USF2 dependent manner. Thus, we demonstrate here for the first time that HIF target gene specificity is achieved by HIF transcription partners that are required for HIF target gene activation, exhibit specific binding to the promoters of HIF1 or HIF2 target genes and selectively interact with HIF1α or HIF2α protein. PMID:23991099

  8. Anti-CD22 Antibody Targeting of pH-responsive Micelles Enhances Small Interfering RNA Delivery and Gene Silencing in Lymphoma Cells

    PubMed Central

    Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W

    2011-01-01

    The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells. PMID:21629223

  9. Anti-CD22 antibody targeting of pH-responsive micelles enhances small interfering RNA delivery and gene silencing in lymphoma cells.

    PubMed

    Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W

    2011-08-01

    The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells.

  10. The CDK inhibitor p21 is a novel target gene of ATF4 and contributes to cell survival under ER stress.

    PubMed

    Inoue, Yasumichi; Kawachi, Shiori; Ohkubo, Tsubasa; Nagasaka, Mai; Ito, Shogo; Fukuura, Keishi; Itoh, Yuka; Ohoka, Nobumichi; Morishita, Daisuke; Hayashi, Hidetoshi

    2017-11-01

    Activating transcription factor 4 (ATF4) is well known for its role in the endoplasmic reticulum (ER) stress response. ATF4 also transcriptionally induces multiple effectors that determine cell fate depending on cellular context. In addition, ATF4 can communicate both pro-apoptotic and pro-survival signals. How ATF4 mediates its prosurvival roles, however, requires further investigation. Here, we report that the CDK inhibitor p21 is a novel target gene of ATF4. We identified two ATF4-responsive elements, one of which directly binds ATF4, within the first intron of the p21 gene. Importantly, overexpression of p21 enhances cell survival following ER stress induction, while p21 knockdown increases cell death. These results suggest that p21 induction plays a vital role in the cellular response to ER stress and indicate that p21 is a prosurvival effector of ATF4. © 2017 Federation of European Biochemical Societies.

  11. 5-HT2C Receptor Knockdown in the Amygdala Inhibits Neuropathic-Pain-Related Plasticity and Behaviors.

    PubMed

    Ji, Guangchen; Zhang, Wei; Mahimainathan, Lenin; Narasimhan, Madhusudhanan; Kiritoshi, Takaki; Fan, Xiuzhen; Wang, Jigong; Green, Thomas A; Neugebauer, Volker

    2017-02-08

    Neuroplasticity in the amygdala drives pain-related behaviors. The central nucleus (CeA) serves major amygdala output functions and can generate emotional-affective behaviors and modulate nocifensive responses. The CeA receives excitatory and inhibitory inputs from the basolateral nucleus (BLA) and serotonin receptor subtype 5-HT 2C R in the BLA, but not CeA, has been implicated anxiogenic behaviors and anxiety disorders. Here, we tested the hypothesis that 5-HT 2C R in the BLA plays a critical role in CeA plasticity and neuropathic pain behaviors in the rat spinal nerve ligation (SNL) model. Local 5-HT 2C R knockdown in the BLA with stereotaxic injection of 5-HT 2C R shRNA AAV vector decreased vocalizations and anxiety- and depression-like behaviors and increased sensory thresholds of SNL rats, but had no effect in sham controls. Extracellular single-unit recordings of CeA neurons in anesthetized rats showed that 5-HT 2C R knockdown blocked the increase in neuronal activity (increased responsiveness, irregular spike firing, and increased burst activity) in SNL rats. At the synaptic level, 5-HT 2C R knockdown blocked the increase in excitatory transmission from BLA to CeA recorded in brain slices from SNL rats using whole-cell patch-clamp conditions. Inhibitory transmission was decreased by 5-HT 2C R knockdown in control and SNL conditions to a similar degree. The findings can be explained by immunohistochemical data showing increased expression of 5-HT 2C R in non-GABAergic BLA cells in SNL rats. The results suggest that increased 5-HT 2C R in the BLA contributes to neuropathic-pain-related amygdala plasticity by driving synaptic excitation of CeA neurons. As a rescue strategy, 5-HT 2C R knockdown in the BLA inhibits neuropathic-pain-related behaviors. SIGNIFICANCE STATEMENT Neuroplasticity in the amygdala has emerged as an important pain mechanism. This study identifies a novel target and rescue strategy to control abnormally enhanced amygdala activity in an

  12. The effects of Kiaa0319 knockdown on cortical and subcortical anatomy in male rats

    PubMed Central

    Szalkowski, Caitlin E.; Fiondella, Christopher F.; Truong, Dongnhu T.; Rosen, Glenn D.; LoTurco, Joseph J.; Fitch, Roslyn H.

    2012-01-01

    Developmental dyslexia is a disorder characterized by a specific deficit in reading despite adequate overall intelligence and educational resources. The neurological substrate underlying these significant behavioral impairments is not known. Studies of post mortem brain tissue from male and female dyslexic individuals revealed focal disruptions of neuronal migration concentrated in the left hemisphere, along with aberrant symmetry of the right and left the planum temporale, and changes in cell size distribution within the medial geniculate nucleus of the thalamus (Galaburda et al., 1985; Humphreys et al., 1990). More recent neuroimaging studies have identified several changes in the brains of dyslexic individuals, including regional changes in gray matter, changes in white matter, and changes in patterns of functional activation. In a further effort to elucidate the etiology of dyslexia, epidemiological and genetic studies have identified several candidate dyslexia susceptibility genes. Some recent work has investigated associations between some of these genetic variants and structural changes in the brain. Variants of one candidate dyslexia susceptibility gene, KIAA0319, have been linked to morphological changes in the cerebellum and functional activational changes in the superior temporal sulcus (Jamadar et al., 2011; Pinel et al., 2012). Animal models have been used to create a knockdown of Kiaa0319 (the rodent homolog of the human gene) via in utero RNA interference in order to study the gene’s effects on brain development and behavior. Studies using this animal model have demonstrated that knocking down the gene leads to focal disruptions of neuronal migration in the form of ectopias and heterotopias, similar to those observed in the brains of human dyslexics. However, further changes to the structure of the brain have not been studied following this genetic disruption. The current study sought to determine the effects of embryonic Kiaa0319 knockdown on

  13. Evaluation of hepatitis B viral replication and proteomic analysis of HepG2.2.15 cell line after knockdown of HBx.

    PubMed

    Xie, Hai-Yang; Cheng, Jun; Xing, Chun-Yang; Wang, Jin-Jin; Su, Rong; Wei, Xu-Yong; Zhou, Lin; Zheng, Shu-Sen

    2011-06-01

    Hepatitis B virus (HBV) is one of the major pathogens of human liver disease. Studies have shown that HBV X protein (HBx) plays an important role in promoting viral gene expression and replication. In this study we performed a global proteomic profiling to identify the downstream functional proteins of HBx, thereby detecting the mechanisms of action of HBx on virion replication. HBx in the HepG2.2.15 cell line was knocked down by the transfection of small interfering RNA (siRNA). The replication level of HBV was evaluated by microparticle enzyme immunoassay analysis of HBsAg and HBeAg in the culture supernatant, and real-time quantitative PCR analysis of HBV DNA. Two-dimensional electrophoresis combined with MALDI-TOF/TOF was performed to analyze the changes in protein expression profile after treatment with HBx siRNA. Knockdown of HBx disturbed HBV replication in vitro. HBx target siRNA significantly inhibited the expression of HBsAg, HBeAg and the replication of HBV DNA. Twelve significantly changed proteins (7 upregulated and 5 downregulated) were successfully identified by MALDI-TOF/TOF using proteomics differential expression analysis after the knockdown of HBx. Among these identified proteins, HSP70 was validated by Western blotting. The results of the study indicated the positive effect of HBx on HBV replication, and a group of downstream target proteins of HBx may be responsible for this effect.

  14. CREBBP knockdown enhances RAS/RAF/MEK/ERK signaling in Ras pathway mutated acute lymphoblastic leukemia but does not modulate chemotherapeutic response.

    PubMed

    Dixon, Zach A; Nicholson, Lindsay; Zeppetzauer, Martin; Matheson, Elizabeth; Sinclair, Paul; Harrison, Christine J; Irving, Julie A E

    2017-04-01

    Relapsed acute lymphoblastic leukemia is the most common cause of cancer-related mortality in young people and new therapeutic strategies are needed to improve outcome. Recent studies have shown that heterozygous inactivating mutations in the histone acetyl transferase, CREBBP , are particularly frequent in relapsed childhood acute lymphoblastic leukemia and associated with a hyperdiploid karyotype and KRAS mutations. To study the functional impact of CREBBP haploinsufficiency in acute lymphoblastic leukemia, RNA interference was used to knock down expression of CREBBP in acute lymphoblastic leukemia cell lines and various primagraft acute lymphoblastic leukemia cells. We demonstrate that attenuation of CREBBP results in reduced acetylation of histone 3 lysine 18, but has no significant impact on cAMP-dependent target gene expression. Impaired induction of glucocorticoid receptor targets was only seen in 1 of 4 CREBBP knockdown models, and there was no significant difference in glucocorticoid-induced apoptosis, sensitivity to other acute lymphoblastic leukemia chemotherapeutics or histone deacetylase inhibitors. Importantly, we show that CREBBP directly acetylates KRAS and that CREBBP knockdown enhances signaling of the RAS/RAF/MEK/ERK pathway in Ras pathway mutated acute lymphoblastic leukemia cells, which are still sensitive to MEK inhibitors. Thus, CREBBP mutations might assist in enhancing oncogenic RAS signaling in acute lymphoblastic leukemia but do not alter response to MEK inhibitors. Copyright© Ferrata Storti Foundation.

  15. Multi-targeted priming for genome-wide gene expression assays.

    PubMed

    Adomas, Aleksandra B; Lopez-Giraldez, Francesc; Clark, Travis A; Wang, Zheng; Townsend, Jeffrey P

    2010-08-17

    Complementary approaches to assaying global gene expression are needed to assess gene expression in regions that are poorly assayed by current methodologies. A key component of nearly all gene expression assays is the reverse transcription of transcribed sequences that has traditionally been performed by priming the poly-A tails on many of the transcribed genes in eukaryotes with oligo-dT, or by priming RNA indiscriminately with random hexamers. We designed an algorithm to find common sequence motifs that were present within most protein-coding genes of Saccharomyces cerevisiae and of Neurospora crassa, but that were not present within their ribosomal RNA or transfer RNA genes. We then experimentally tested whether degenerately priming these motifs with multi-targeted primers improved the accuracy and completeness of transcriptomic assays. We discovered two multi-targeted primers that would prime a preponderance of genes in the genomes of Saccharomyces cerevisiae and Neurospora crassa while avoiding priming ribosomal RNA or transfer RNA. Examining the response of Saccharomyces cerevisiae to nitrogen deficiency and profiling Neurospora crassa early sexual development, we demonstrated that using multi-targeted primers in reverse transcription led to superior performance of microarray profiling and next-generation RNA tag sequencing. Priming with multi-targeted primers in addition to oligo-dT resulted in higher sensitivity, a larger number of well-measured genes and greater power to detect differences in gene expression. Our results provide the most complete and detailed expression profiles of the yeast nitrogen starvation response and N. crassa early sexual development to date. Furthermore, our multi-targeting priming methodology for genome-wide gene expression assays provides selective targeting of multiple sequences and counter-selection against undesirable sequences, facilitating a more complete and precise assay of the transcribed sequences within the genome.

  16. Fe₃O₄ Nanoparticles in Targeted Drug/Gene Delivery Systems.

    PubMed

    Shen, Lazhen; Li, Bei; Qiao, Yongsheng

    2018-02-23

    Fe₃O₄ nanoparticles (NPs), the most traditional magnetic nanoparticles, have received a great deal of attention in the biomedical field, especially for targeted drug/gene delivery systems, due to their outstanding magnetism, biocompatibility, lower toxicity, biodegradability, and other features. Naked Fe₃O₄ NPs are easy to aggregate and oxidize, and thus are often made with various coatings to realize superior properties for targeted drug/gene delivery. In this review, we first list the three commonly utilized synthesis methods of Fe₃O₄ NPs, and their advantages and disadvantages. In the second part, we describe coating materials that exhibit noticeable features that allow functionalization of Fe₃O₄ NPs and summarize their methods of drug targeting/gene delivery. Then our efforts will be devoted to the research status and progress of several different functionalized Fe₃O₄ NP delivery systems loaded with chemotherapeutic agents, and we present targeted gene transitive carriers in detail. In the following section, we illuminate the most effective treatment systems of the combined drug and gene therapy. Finally, we propose opportunities and challenges of the clinical transformation of Fe₃O₄ NPs targeting drug/gene delivery systems.

  17. Integrative ChIP-seq/Microarray Analysis Identifies a CTNNB1 Target Signature Enriched in Intestinal Stem Cells and Colon Cancer

    PubMed Central

    Watanabe, Kazuhide; Biesinger, Jacob; Salmans, Michael L.; Roberts, Brian S.; Arthur, William T.; Cleary, Michele; Andersen, Bogi; Xie, Xiaohui; Dai, Xing

    2014-01-01

    Background Deregulation of canonical Wnt/CTNNB1 (beta-catenin) pathway is one of the earliest events in the pathogenesis of colon cancer. Mutations in APC or CTNNB1 are highly frequent in colon cancer and cause aberrant stabilization of CTNNB1, which activates the transcription of Wnt target genes by binding to chromatin via the TCF/LEF transcription factors. Here we report an integrative analysis of genome-wide chromatin occupancy of CTNNB1 by chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-seq) and gene expression profiling by microarray analysis upon RNAi-mediated knockdown of CTNNB1 in colon cancer cells. Results We observed 3629 CTNNB1 binding peaks across the genome and a significant correlation between CTNNB1 binding and knockdown-induced gene expression change. Our integrative analysis led to the discovery of a direct Wnt target signature composed of 162 genes. Gene ontology analysis of this signature revealed a significant enrichment of Wnt pathway genes, suggesting multiple feedback regulations of the pathway. We provide evidence that this gene signature partially overlaps with the Lgr5+ intestinal stem cell signature, and is significantly enriched in normal intestinal stem cells as well as in clinical colorectal cancer samples. Interestingly, while the expression of the CTNNB1 target gene set does not correlate with survival, elevated expression of negative feedback regulators within the signature predicts better prognosis. Conclusion Our data provide a genome-wide view of chromatin occupancy and gene regulation of Wnt/CTNNB1 signaling in colon cancer cells. PMID:24651522

  18. BLISTER Regulates Polycomb-Target Genes, Represses Stress-Regulated Genes and Promotes Stress Responses in Arabidopsis thaliana.

    PubMed

    Kleinmanns, Julia A; Schatlowski, Nicole; Heckmann, David; Schubert, Daniel

    2017-01-01

    HIGHLIGHTS The PRC2 interacting protein BLISTER likely acts downstream of PRC2 to silence Polycomb target genes and is a key regulator of specific stress responses in Arabidopsis . Polycomb group (PcG) proteins are key epigenetic regulators of development. The highly conserved Polycomb repressive complex 2 (PRC2) represses thousands of target genes by trimethylating H3K27 (H3K27me3). Plant specific PcG components and functions are largely unknown, however, we previously identified the plant-specific protein BLISTER (BLI) as a PRC2 interactor. BLI regulates PcG target genes and promotes cold stress resistance. To further understand the function of BLI , we analyzed the transcriptional profile of bli-1 mutants. Approximately 40% of the up-regulated genes in bli are PcG target genes, however, bli-1 mutants did not show changes in H3K27me3 levels at all tested genes, indicating that BLI regulates PcG target genes downstream of or in parallel to PRC2. Interestingly, a significant number of BLI regulated H3K27me3 target genes is regulated by the stress hormone absciscic acid (ABA). We further reveal an overrepresentation of genes responding to abiotic stresses such as drought, high salinity, or heat stress among the up-regulated genes in bli mutants. Consistently, bli mutants showed reduced desiccation stress tolerance. We conclude that the PRC2 associated protein BLI is a key regulator of stress-responsive genes in Arabidopsis : it represses ABA-responsive PcG target genes, likely downstream of PRC2, and promotes resistance to several stresses such as cold and drought.

  19. Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish.

    PubMed

    Viringipurampeer, I A; Shan, X; Gregory-Evans, K; Zhang, J P; Mohammadi, Z; Gregory-Evans, C Y

    2014-05-01

    Achromatopsia is a progressive autosomal recessive retinal disease characterized by early loss of cone photoreceptors and later rod photoreceptor loss. In most cases, mutations have been identified in CNGA3, CNGB3, GNAT2, PDE6C or PDE6H genes. Owing to this genetic heterogeneity, mutation-independent therapeutic schemes aimed at preventing cone cell death are very attractive treatment strategies. In pde6c(w59) mutant zebrafish, cone photoreceptors expressed high levels of receptor-interacting protein kinase 1 (RIP1) and receptor-interacting protein kinase 3 (RIP3) kinases, key regulators of necroptotic cell death. In contrast, rod photoreceptor cells were alternatively immunopositive for caspase-3 indicating activation of caspase-dependent apoptosis in these cells. Morpholino gene knockdown of rip3 in pde6c(w59) embryos rescued the dying cone photoreceptors by inhibiting the formation of reactive oxygen species and by inhibiting second-order neuron remodelling in the inner retina. In rip3 morphant larvae, visual function was restored in the cones by upregulation of the rod phosphodiesterase genes (pde6a and pde6b), compensating for the lack of cone pde6c suggesting that cones are able to adapt to their local environment. Furthermore, we demonstrated through pharmacological inhibition of RIP1 and RIP3 activity that cone cell death was also delayed. Collectively, these results demonstrate that the underlying mechanism of cone cell death in the pde6c(w59) mutant retina is through necroptosis, whereas rod photoreceptor bystander death occurs through a caspase-dependent mechanism. This suggests that targeting the RIP kinase signalling pathway could be an effective therapeutic intervention in retinal degeneration patients. As bystander cell death is an important feature of many retinal diseases, combinatorial approaches targeting different cell death pathways may evolve as an important general principle in treatment.

  20. Progress in gene targeting and gene therapy for retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farrar, G.J.; Humphries, M.M.; Erven, A.

    1994-09-01

    Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less

  1. Large scale RNAi screen in Tribolium reveals novel target genes for pest control and the proteasome as prime target.

    PubMed

    Ulrich, Julia; Dao, Van Anh; Majumdar, Upalparna; Schmitt-Engel, Christian; Schwirz, Jonas; Schultheis, Dorothea; Ströhlein, Nadi; Troelenberg, Nicole; Grossmann, Daniela; Richter, Tobias; Dönitz, Jürgen; Gerischer, Lizzy; Leboulle, Gérard; Vilcinskas, Andreas; Stanke, Mario; Bucher, Gregor

    2015-09-03

    Insect pest control is challenged by insecticide resistance and negative impact on ecology and health. One promising pest specific alternative is the generation of transgenic plants, which express double stranded RNAs targeting essential genes of a pest species. Upon feeding, the dsRNA induces gene silencing in the pest resulting in its death. However, the identification of efficient RNAi target genes remains a major challenge as genomic tools and breeding capacity is limited in most pest insects impeding whole-animal-high-throughput-screening. We use the red flour beetle Tribolium castaneum as a screening platform in order to identify the most efficient RNAi target genes. From about 5,000 randomly screened genes of the iBeetle RNAi screen we identify 11 novel and highly efficient RNAi targets. Our data allowed us to determine GO term combinations that are predictive for efficient RNAi target genes with proteasomal genes being most predictive. Finally, we show that RNAi target genes do not appear to act synergistically and that protein sequence conservation does not correlate with the number of potential off target sites. Our results will aid the identification of RNAi target genes in many pest species by providing a manageable number of excellent candidate genes to be tested and the proteasome as prime target. Further, the identified GO term combinations will help to identify efficient target genes from organ specific transcriptomes. Our off target analysis is relevant for the sequence selection used in transgenic plants.

  2. NFI Transcription Factors Interact with FOXA1 to Regulate Prostate-Specific Gene Expression

    PubMed Central

    Elliott, Amicia D.; DeGraff, David J.; Anderson, Philip D.; Anumanthan, Govindaraj; Yamashita, Hironobu; Sun, Qian; Friedman, David B.; Hachey, David L.; Yu, Xiuping; Sheehan, Jonathan H.; Ahn, Jung-Mo; Raj, Ganesh V.; Piston, David W.; Gronostajski, Richard M.; Matusik, Robert J.

    2014-01-01

    Androgen receptor (AR) action throughout prostate development and in maintenance of the prostatic epithelium is partly controlled by interactions between AR and forkhead box (FOX) transcription factors, particularly FOXA1. We sought to identity additional FOXA1 binding partners that may mediate prostate-specific gene expression. Here we identify the nuclear factor I (NFI) family of transcription factors as novel FOXA1 binding proteins. All four family members (NFIA, NFIB, NFIC, and NFIX) can interact with FOXA1, and knockdown studies in androgen-dependent LNCaP cells determined that modulating expression of NFI family members results in changes in AR target gene expression. This effect is probably mediated by binding of NFI family members to AR target gene promoters, because chromatin immunoprecipitation (ChIP) studies found that NFIB bound to the prostate-specific antigen enhancer. Förster resonance energy transfer studies revealed that FOXA1 is capable of bringing AR and NFIX into proximity, indicating that FOXA1 facilitates the AR and NFI interaction by bridging the complex. To determine the extent to which NFI family members regulate AR/FOXA1 target genes, motif analysis of publicly available data for ChIP followed by sequencing was undertaken. This analysis revealed that 34.4% of peaks bound by AR and FOXA1 contain NFI binding sites. Validation of 8 of these peaks by ChIP revealed that NFI family members can bind 6 of these predicted genomic elements, and 4 of the 8 associated genes undergo gene expression changes as a result of individual NFI knockdown. These observations suggest that NFI regulation of FOXA1/AR action is a frequent event, with individual family members playing distinct roles in AR target gene expression. PMID:24801505

  3. Genotoxic chemical carcinogens target inducible genes in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamilton, J.W.; McCaffrey, J.; Caron, R.M.

    1994-12-31

    Our laboratory is interested in whether carcinogen-induced DNA damage is distributed nonrandomly in the genome - that is, {open_quotes}targeted{close_quotes} to specific genes or gene regions in vivo. As an indirect measure of whether targeting occurs at the gene level, we have examined whether carcinogens differentially alter the expression of individual genes. We have compared the effects of model genotoxic carcinogens that principally induce either strand breaks, simple alkylations, bulky lesions, or DNA cross-links on the expression of several constitutive and inducible genes in a simple in vivo system, the chick embryo. Each agent was examined for its effects on genemore » expression over a 24 hour period corresponding to the period of maximal DNA damage and repair induced by each compound. The doses used in these studies represented the maximum doses that caused no overt toxicity over a 96 hour period but that induced significant levels of DNA damage. Our results demonstrate that inducible genes are targeted by chemical carcinogens. We hypothesize that such effects may be a result of DNA damage specifically altering DNA-protein interactions within the promoters of inducible genes.« less

  4. Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

    PubMed Central

    Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

    2018-01-01

    Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

  5. Inducible knockdown of pregnancy-associated plasma protein-A gene expression in adult female mice extends life span.

    PubMed

    Bale, Laurie K; West, Sally A; Conover, Cheryl A

    2017-08-01

    Pregnancy-associated plasma protein-A (PAPP-A) knockout (KO) mice, generated through homologous recombination in embryonic stem cells, have a significantly increased lifespan compared to wild-type littermates. However, it is unknown whether this longevity advantage would pertain to PAPP-A gene deletion in adult animals. In the present study, we used tamoxifen (Tam)-inducible Cre recombinase-mediated excision of the floxed PAPP-A (fPAPP-A) gene in mice at 5 months of age. fPAPP-A mice, which were either positive (pos) or negative (neg) for Tam-Cre, received Tam treatment with quarterly boosters. Only female mice could be used with this experimental design. fPAPP-A/neg and fPAPP-A/pos mice had similar weights at the start of the experiment and showed equivalent weight gain. We found that fPAPP-A/pos mice had a significant extension of life span (P = 0.005). The median life span was increased by 21% for fPAPP-A/pos compared to fPAPP-A/neg mice. Analysis of mortality in life span quartiles indicated that the proportion of deaths of fPAPP-A/pos mice were lower than fPAPP-A/neg mice at young adult ages (P = 0.002 for 601-800 days) and higher than fPAPP-A/neg mice at older ages (P = 0.004 for >1000 days). Thus, survival curves and age-specific mortality indicate that female mice with knockdown of PAPP-A gene expression as adults have an extended healthy life span. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  6. Knockdown of Decoy Receptor 3 Impairs Growth and Invasiveness of Hepatocellular Carcinoma Cell Line of HepG2.

    PubMed

    Zhou, Xiao-Na; Li, Guang-Ming; Xu, Ying-Chen; Zhao, Tuan-Jie; Wu, Ji-Xiang

    2016-11-05

    Decoy receptor 3 (DcR3) binds to Fas ligand (FasL) and inhibits FasL-induced apoptosis. The receptor is overexpressed in hepatocellular carcinoma (HCC), and it is associated with the growth and metastatic spread of tumors. DcR3 holds promises as a new target for the treatment of HCC, but little is known regarding the molecular mechanisms underlying the oncogenic properties of DcR3. The present work, therefore, examined the role of DcR3 in regulating the growth and invasive property of liver cancer cell HepG2. HepG2 cells were stably transfected with lentivirus-based short hairpin RNA vector targeting DcR3. After the knockdown of DcR3 was confirmed, cell proliferation, clone formation, ability of migrating across transwell membrane, and wound healing were assessed in vitro. Matrix metalloproteinase-9 (MMP 9) and vascular epithelial growth factor (VEGF)-C and D expressions of the DcR3 knockdown were also studied. Comparisons between multiple groups were done using one-way analysis of variance (ANOVA), while pairwise comparisons were performed using Student's t test. P< 0.05 was regarded statistically significant. DcR3 was overexpressed in HepG2 compared to other HCC cell lines and normal hepatocyte Lo-2. Stable knockdown of DcR3 slowed down the growth of HepG2 (P < 0.05) and reduced the number of clones formed by 50% compared to those without DcR3 knockdown (P < 0.05). The knockdown also reduced the migration of HepG2 across transwell matrix membrane by five folds compared to the control (P < 0.05) and suppressed the closure of scratch wound (P < 0.05). In addition, the messenger RNA levels of MMP 9, VEGF-C, and VEGF-D were significantly suppressed by DcR3 knockdown by 90% when compared with the mock control (P < 0.05). Loss of DcR3 impaired the growth and invasive property of HCC cell line of HepG2. Targeting DcR3 may be a potential therapeutic approach for the treatment of HCC.

  7. Knockdown of Decoy Receptor 3 Impairs Growth and Invasiveness of Hepatocellular Carcinoma Cell Line of HepG2

    PubMed Central

    Zhou, Xiao-Na; Li, Guang-Ming; Xu, Ying-Chen; Zhao, Tuan-Jie; Wu, Ji-Xiang

    2016-01-01

    Background: Decoy receptor 3 (DcR3) binds to Fas ligand (FasL) and inhibits FasL-induced apoptosis. The receptor is overexpressed in hepatocellular carcinoma (HCC), and it is associated with the growth and metastatic spread of tumors. DcR3 holds promises as a new target for the treatment of HCC, but little is known regarding the molecular mechanisms underlying the oncogenic properties of DcR3. The present work, therefore, examined the role of DcR3 in regulating the growth and invasive property of liver cancer cell HepG2. Methods: HepG2 cells were stably transfected with lentivirus-based short hairpin RNA vector targeting DcR3. After the knockdown of DcR3 was confirmed, cell proliferation, clone formation, ability of migrating across transwell membrane, and wound healing were assessed in vitro. Matrix metalloproteinase-9 (MMP 9) and vascular epithelial growth factor (VEGF)-C and D expressions of the DcR3 knockdown were also studied. Comparisons between multiple groups were done using one-way analysis of variance (ANOVA), while pairwise comparisons were performed using Student's t test. P < 0.05 was regarded statistically significant. Results: DcR3 was overexpressed in HepG2 compared to other HCC cell lines and normal hepatocyte Lo-2. Stable knockdown of DcR3 slowed down the growth of HepG2 (P < 0.05) and reduced the number of clones formed by 50% compared to those without DcR3 knockdown (P < 0.05). The knockdown also reduced the migration of HepG2 across transwell matrix membrane by five folds compared to the control (P < 0.05) and suppressed the closure of scratch wound (P < 0.05). In addition, the messenger RNA levels of MMP 9, VEGF-C, and VEGF-D were significantly suppressed by DcR3 knockdown by 90% when compared with the mock control (P < 0.05). Conclusions: Loss of DcR3 impaired the growth and invasive property of HCC cell line of HepG2. Targeting DcR3 may be a potential therapeutic approach for the treatment of HCC. PMID:27779171

  8. Targeting the chromatin remodeling enzyme BRG1 increases the efficacy of chemotherapy drugs in breast cancer cells

    PubMed Central

    Wu, Qiong; Sharma, Soni; Cui, Hang; LeBlanc, Scott E.; Zhang, Hong; Muthuswami, Rohini; Nickerson, Jeffrey A.; Imbalzano, Anthony N.

    2016-01-01

    Brahma related gene product 1 (BRG1) is an ATPase that drives the catalytic activity of a subset of the mammalian SWI/SNF chromatin remodeling enzymes. BRG1 is overexpressed in most human breast cancer tumors without evidence of mutation and is required for breast cancer cell proliferation. We demonstrate that knockdown of BRG1 sensitized triple negative breast cancer cells to chemotherapeutic drugs used to treat breast cancer. An inhibitor of the BRG1 bromodomain had no effect on breast cancer cell viability, but an inhibitory molecule that targets the BRG1 ATPase activity recapitulated the increased drug efficacy observed in the presence of BRG1 knockdown. We further demonstrate that inhibition of BRG1 ATPase activity blocks the induction of ABC transporter genes by these chemotherapeutic drugs and that BRG1 binds to ABC transporter gene promoters. This inhibition increased intracellular concentrations of the drugs, providing a likely mechanism for the increased chemosensitivity. Since ABC transporters and their induction by chemotherapy drugs are a major cause of chemoresistance and treatment failure, these results support the idea that targeting the enzymatic activity of BRG1 would be an effective adjuvant therapy for breast cancer. PMID:27029062

  9. Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

    PubMed Central

    Santangeloyz, K.S.; Bertoneyz, A.L.

    2011-01-01

    summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this

  10. Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

    PubMed

    Santangelo, K S; Bertone, A L

    2011-12-01

    To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted

  11. Screening for microsatellite instability target genes in colorectal cancers

    PubMed Central

    Vilkki, S; Launonen, V; Karhu, A; Sistonen, P; Vastrik, I; Aaltonen, L

    2002-01-01

    Background: Defects in the DNA repair system lead to genetic instability because replication errors are not corrected. This type of genetic instability is a key event in the malignant progression of HNPCC and a subset of sporadic colon cancers and mutation rates are particularly high at short repetitive sequences. Somatic deletions of coding mononucleotide repeats have been detected, for example, in the TGFßRII and BAX genes, and recently many novel target genes for microsatellite instability (MSI) have been proposed. Novel target genes are likely to be discovered in the future. More data should be created on background mutation rates in MSI tumours to evaluate mutation rates observed in the candidate target genes. Methods: Mutation rates in 14 neutral intronic repeats were evaluated in MSI tumours. Bioinformatic searches combined with keywords related to cancer and tumour suppressor or CRC related gene homology were used to find new candidate MSI target genes. By comparison of mutation frequencies observed in intronic mononucleotide repeats versus exonic coding repeats of potential MSI target genes, the significance of the exonic mutations was estimated. Results: As expected, the length of an intronic mononucleotide repeat correlated positively with the number of slippages for both G/C and A/T repeats (p=0.0020 and p=0.0012, respectively). BRCA1, CtBP1, and Rb1 associated CtIP and other candidates were found in a bioinformatic search combined with keywords related to cancer. Sequencing showed a significantly increased mutation rate in the exonic A9 repeat of CtIP (25/109=22.9%) as compared with similar intronic repeats (p≤0.001). Conclusions: We propose a new candidate MSI target gene CtIP to be evaluated in further studies. PMID:12414815

  12. Fascin-1 knock-down of human glioma cells reduces their microvilli/filopodia while improving their susceptibility to lymphocyte-mediated cytotoxicity

    PubMed Central

    Hoa, Neil T; Ge, Lisheng; Erickson, Kate L; Kruse, Carol A; Cornforth, Andrew N; Kuznetsov, Yurii; McPherson, Alex; Martini, Filippo; Jadus, Martin R

    2015-01-01

    Cancer cells derived from Glioblastoma multiforme possess membranous protrusions allowing these cells to infiltrate surrounding tissue, while resisting lymphocyte cytotoxicity. Microvilli and filopodia are supported by actin filaments cross-linked by fascin. Fascin-1 was genetically silenced within human U251 glioma cells; these knock-down glioma cells lost their microvilli/filopodia. The doubling time of these fascin-1 knock-down cells was doubled that of shRNA control U251 cells. Fascin-1 knock-down cells lost their transmigratory ability responding to interleukin-6 or insulin-like growth factor-1. Fascin-1 silenced U251 cells were more easily killed by cytolytic lymphocytes. Fascin-1 knock-down provides unique opportunities to augment glioma immunotherapy by simultaneously targeting several key glioma functions: like cell transmigration, cell division and resisting immune responses. PMID:25901196

  13. CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation.

    PubMed

    Miki, Daisuke; Zhang, Wenxin; Zeng, Wenjie; Feng, Zhengyan; Zhu, Jian-Kang

    2018-05-17

    Homologous recombination-based gene targeting is a powerful tool for precise genome modification and has been widely used in organisms ranging from yeast to higher organisms such as Drosophila and mouse. However, gene targeting in higher plants, including the most widely used model plant Arabidopsis thaliana, remains challenging. Here we report a sequential transformation method for gene targeting in Arabidopsis. We find that parental lines expressing the bacterial endonuclease Cas9 from the egg cell- and early embryo-specific DD45 gene promoter can improve the frequency of single-guide RNA-targeted gene knock-ins and sequence replacements via homologous recombination at several endogenous sites in the Arabidopsis genome. These heritable gene targeting can be identified by regular PCR. Our approach enables routine and fine manipulation of the Arabidopsis genome.

  14. RNA targeting with CRISPR-Cas13.

    PubMed

    Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng

    2017-10-12

    RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.

  15. The knockdown of chloroplastic ascorbate peroxidases reveals its regulatory role in the photosynthesis and protection under photo-oxidative stress in rice.

    PubMed

    Caverzan, Andréia; Bonifacio, Aurenivia; Carvalho, Fabricio E L; Andrade, Claudia M B; Passaia, Gisele; Schünemann, Mariana; Maraschin, Felipe Dos Santos; Martins, Marcio O; Teixeira, Felipe K; Rauber, Rafael; Margis, Rogério; Silveira, Joaquim Albenisio Gomes; Margis-Pinheiro, Márcia

    2014-01-01

    The inactivation of the chloroplast ascorbate peroxidases (chlAPXs) has been thought to limit the efficiency of the water-water cycle and photo-oxidative protection under stress conditions. In this study, we have generated double knockdown rice (Oryza sativa L.) plants in both OsAPX7 (sAPX) and OsAPX8 (tAPX) genes, which encode chloroplastic APXs (chlAPXs). By employing an integrated approach involving gene expression, proteomics, biochemical and physiological analyses of photosynthesis, we have assessed the role of chlAPXs in the regulation of the protection of the photosystem II (PSII) activity and CO2 assimilation in rice plants exposed to high light (HL) and methyl violagen (MV). The chlAPX knockdown plants were affected more severely than the non-transformed (NT) plants in the activity and structure of PSII and CO2 assimilation in the presence of MV. Although MV induced significant increases in pigment content in the knockdown plants, the increases were apparently not sufficient for protection. Treatment with HL also caused generalized damage in PSII in both types of plants. The knockdown and NT plants exhibited differences in photosynthetic parameters related to efficiency of utilization of light and CO2. The knockdown plants overexpressed other antioxidant enzymes in response to the stresses and increased the GPX activity in the chloroplast-enriched fraction. Our data suggest that a partial deficiency of chlAPX expression modulate the PSII activity and integrity, reflecting the overall photosynthesis when rice plants are subjected to acute oxidative stress. However, under normal growth conditions, the knockdown plants exhibit normal phenotype, biochemical and physiological performance. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Knockdown of FoxP2 alters spine density in Area X of the zebra finch.

    PubMed

    Schulz, S B; Haesler, S; Scharff, C; Rochefort, C

    2010-10-01

    Mutations in the gene encoding the transcription factor FoxP2 impair human speech and language. We have previously shown that deficits in vocal learning occur in zebra finches after reduction of FoxP2 in Area X, a striatal nucleus involved in song acquisition. We recently showed that FoxP2 is expressed in newly generated spiny neurons (SN) in adult Area X as well as in the ventricular zone (VZ) from which the SN originates. Moreover, their recruitment to Area X increases transiently during the song learning phase. The present report therefore investigated whether FoxP2 is involved in the structural plasticity of Area X. We assessed the proliferation, differentiation and morphology of SN after lentivirally mediated knockdown of FoxP2 in Area X or in the VZ during the song learning phase. Proliferation rate was not significantly affected by knockdown of FoxP2 in the VZ. In addition, FoxP2 reduction both in the VZ and in Area X did not affect the number of new neurons in Area X. However, at the fine-structural level, SN in Area X bore fewer spines after FoxP2 knockdown. This effect was even more pronounced when neurons received the knockdown before differentiation, i.e. as neuroblasts in the VZ. These results suggest that FoxP2 might directly or indirectly regulate spine dynamics in Area X and thereby influence song plasticity. Together, these data present the first evidence for a role of FoxP2 in the structural plasticity of dendritic spines and complement the emerging evidence of physiological synaptic plasticity in FoxP2 mouse models. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society. No claim to original US government works.

  17. Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins

    PubMed Central

    Kfoury, N.; Kapatos, G.

    2009-01-01

    CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292

  18. Targeted gene therapy and cell reprogramming in Fanconi anemia

    PubMed Central

    Rio, Paula; Baños, Rocio; Lombardo, Angelo; Quintana-Bustamante, Oscar; Alvarez, Lara; Garate, Zita; Genovese, Pietro; Almarza, Elena; Valeri, Antonio; Díez, Begoña; Navarro, Susana; Torres, Yaima; Trujillo, Juan P; Murillas, Rodolfo; Segovia, Jose C; Samper, Enrique; Surralles, Jordi; Gregory, Philip D; Holmes, Michael C; Naldini, Luigi; Bueren, Juan A

    2014-01-01

    Gene targeting is progressively becoming a realistic therapeutic alternative in clinics. It is unknown, however, whether this technology will be suitable for the treatment of DNA repair deficiency syndromes such as Fanconi anemia (FA), with defects in homology-directed DNA repair. In this study, we used zinc finger nucleases and integrase-defective lentiviral vectors to demonstrate for the first time that FANCA can be efficiently and specifically targeted into the AAVS1 safe harbor locus in fibroblasts from FA-A patients. Strikingly, up to 40% of FA fibroblasts showed gene targeting 42 days after gene editing. Given the low number of hematopoietic precursors in the bone marrow of FA patients, gene-edited FA fibroblasts were then reprogrammed and re-differentiated toward the hematopoietic lineage. Analyses of gene-edited FA-iPSCs confirmed the specific integration of FANCA in the AAVS1 locus in all tested clones. Moreover, the hematopoietic differentiation of these iPSCs efficiently generated disease-free hematopoietic progenitors. Taken together, our results demonstrate for the first time the feasibility of correcting the phenotype of a DNA repair deficiency syndrome using gene-targeting and cell reprogramming strategies. PMID:24859981

  19. Sertoli cell specific knockdown of RAR-related orphan receptor (ROR) alpha at puberty reduces sperm count in rats.

    PubMed

    Mandal, Kamal; Sarkar, Rajesh K; Sen Sharma, Souvik; Jain, Ayushi; Majumdar, Subeer S

    2018-01-30

    Globally, there is an alarming decline in sperm count. Very often hormonal supplementation fails to restore normal sperm count. Sertoli cells (Sc) present within seminiferous tubules provide appropriate niche and factors required for the differentiation of germ cells (Gc) into mature sperm (spermatogenesis). Functionally compromised Sc may be one of the reasons for failure of hormones to facilitate normal spermatogenesis. Although role of secretory proteins and signaling molecules of Sc has been studied well, role of transcription factors regulating sperm count has not been addressed appropriately. Retinoic acid receptor-related orphan receptor (ROR)-alpha is one of such transcription factors reported in testis but its role in testicular function is not yet known. In a separate study, we found abundant ROR-alpha binding sites on promoter regions of several genes upregulated in pubertal rat Sc as compared to infant Sc. Immunostaining studies also revealed presence of ROR alpha in nucleus of pubertal Sc. We generated a transgenic knockdown rat model expressing shRNA targeted to ROR-alpha under Sc specific promoter, which is transcriptionally active only at and after puberty. ROR-alpha knockdown animals were found to have abnormal association of Sc and Gc, including Gc sloughing and restricted release of sperm. The knockdown animals displayed compromised spermatogenesis leading to significant reduction in sperm count. This is the first report describing the Sc specific role of ROR-alpha in maintaining quantitatively normal sperm output. Identification of various such molecules can generate avenues to limit or reverse an alarmingly declining sperm count witnessed globally in men. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.

    PubMed

    Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K

    2017-01-01

    The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.

  1. RNA interference-mediated knockdown of the hydroxyacid-oxoacid transhydrogenase gene decreases thiamethoxam resistance in adults of the whitefly Bemisia tabaci

    PubMed Central

    Yang, Xin; Xie, Wen; Li, Ru-mei; Zhou, Xiao-mao; Wang, Shao-li; Wu, Qing-jun; Yang, Ni-na; Xia, Ji-xing; Yang, Ze-zong; Guo, Li-tao; Liu, Ya-ting; Zhang, You-jun

    2017-01-01

    Bemisia tabaci has developed a high level of resistance to thiamethoxam, a second generation neonicotinoid insecticide that has been widely used to control this pest. In this study, we investigated whether hydroxyacid-oxoacid transhydrogenase (HOT) is involved in resistance to the neonicotinoid insecticide thiamethoxam in the whitefly. We cloned the full-length gene that encodes HOT in B. tabaci. Its cDNA contains a 1428-bp open reading frame encoding 475 amino acid residues. Then we evaluated the mRNA expression level of HOT in different developmental stages, and found HOT expression was significantly greater in thiamethoxam resistance adults than in thiamethoxam susceptible adults. Subsequently, seven field populations of B. tabaci adults were sampled, the expression of mRNA level of HOT significant positive correlated with thiamethoxam resistance level. At last, we used a modified gene silencing system to knock-down HOT expression in B. tabaci adults. The results showed that the HOT mRNA levels decreased by 57% and thiamethoxam resistance decreased significantly after 2 days of feeding on a diet containing HOT dsRNA. The results indicated that down-regulation of HOT expression decreases thiamethoxam resistance in B. tabaci adults. PMID:28117358

  2. The Influence of Endocrine Disrupting Chemicals on the Proliferation of ERα Knockdown-Human Breast Cancer Cell Line MCF-7; New Attempts by RNAi Technology

    PubMed Central

    Miyakoshi, Takashi; Miyajima, Katsuhiro; Takekoshi, Susumu; Osamura, Robert Yoshiyuki

    2009-01-01

    Bisphenol A (BPA) is a monomer use in manufacturing a wide range of chemical products which include epoxy resins and polycarbonate. It has been reported that BPA increases the cell proliferation activity of human breast cancer MCF-7 cells as well as 17-β estradiol (E2) and diethylstilbestrol (DES). However, BPA induces target genes through ER-dependent and ER-independent manners which are different from the actions induced by E2. Therefore, BPA may be unique in estrogen-dependent cell proliferation compared to other endocrine disrupting chemicals (EDCs). In the present study, to test whether ERα is essential to the BPA-induced proliferation on MCF-7 cells, we suppressed the ERα expression of MCF-7 cells by RNA interference (RNAi). Proliferation effects in the presence of E2, DES and BPA were not observed in ERα-knockdown MCF-7 cells in comparison with control MCF-7. In addition, a marker of proliferative potential, MIB-1 labeling index (LI), showed no change in BPA-treated groups compared with vehicle-treated groups on ERα-knockdown MCF-7 cells. In conclusion, we demonstrated that ERα has a role in BPA-induced cell proliferation as well as E2 and DES. Moreover, this study indicated that the direct knockdown of ERα using RNAi serves as an additional tool to evaluate, in parallel with MCF-7 cell proliferation assay, for potential EDCs. PMID:19492024

  3. Enhanced radiosensitivity and radiation-induced apoptosis in glioma CD133-positive cells by knockdown of SirT1 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, C.-J.; Hsu, C.-C.; Department of Surgery, Chi-Mei Medical Center, Taipei, Taiwan

    2009-03-06

    CD133-expressing glioma cells play a critical role in tumor recovery after treatment and are resistant to radiotherapy. Herein, we demonstrated that glioblastoma-derived CD133-positive cells (GBM-CD133{sup +}) are capable of self-renewal and express high levels of embryonic stem cell genes and SirT1 compared to GBM-CD133{sup -} cells. To evaluate the role of SirT1 in GBM-CD133{sup +}, we used a lentiviral vector expressing shRNA to knock-down SirT1 expression (sh-SirT1) in GBM-CD133{sup +}. Silencing of SirT1 significantly enhanced the sensitivity of GBM-CD133{sup +} to radiation and increased the level of radiation-mediated apoptosis. Importantly, knock-down of SirT1 increased the effectiveness of radiotherapy in themore » inhibition of tumor growth in nude mice transplanted with GBM-CD133{sup +}. Kaplan-Meier survival analysis indicated that the mean survival rate of GBM-CD133{sup +} mice treated with radiotherapy was significantly improved by Sh-SirT1 as well. In sum, these results suggest that SirT1 is a potential target for increasing the sensitivity of GBM and glioblastoma-associated cancer stem cells to radiotherapy.« less

  4. [A mini-review of targeting gene-virotherapy of cancer].

    PubMed

    Liu, Xin-Yuan; Gu, Jin-Fa

    2006-10-01

    New progress has been made on the project "targeting gene-virotherapy of cancer" proposed by us, which is "targeting dual gene-virotherapy of cancer". By the use of two genes, all the xenograft tumors in nude mice could be completely eliminated. The researches have been published in international journals, such as Hepatology and Cancer Research (a highlight paper). In this study, a further superior strategy--"double targeting virus-dual gene therapy" was introduced. This strategy was specialized by the use of tumor specific promoter to control the tumor specific suppressor gene, such as alpha-fetoprotein (AFP), which controls hepatoma specific suppressor gene LFIRE or HCCS1. In addition, a second tumor specific promoter, such as hTERT or survivin was used to control E1A or E1B in the construct, as hTERT-E1A-AFP-E1B-HCCS1 or LFIRE, a double tumor specific promoter controlling hepatoma specific LFIRE or HCCS1 gene. By the combined use of this construct with a very strong antitumor construct, such as hTERT-E1A-AFP-E1B-IL-24, a strategy with both excellent tumor killing effect and excellent safety with very little damage to normal cells was obtained. Therefore, double targeting virus-dual gene therapy might be one of the most potential strategies for cancer treatment. Furthermore, a new type of interferon was also introduced, which might be an ideal antitumor drug.

  5. Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene.

    PubMed

    Fourtounis, Jimmy; Wang, I-Ming; Mathieu, Marie-Claude; Claveau, David; Loo, Tenneille; Jackson, Aimee L; Peters, Mette A; Therien, Alex G; Boie, Yves; Crackower, Michael A

    2012-10-12

    Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.

  6. Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

    PubMed

    Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

    2010-11-01

    We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

  7. [MACF1 knockdown in glioblastoma multiforme cells increases temozolomide-induced cytotoxicity].

    PubMed

    Xie, Si-di; Chen, Zi-Yang; Wang, Hai; He, Min-Yi; Lu, Yun-Tao; Lei, Bing-Xi; Li, He-Zhen; Liu, Ya-Wei; Qi, Song-Tao

    2017-09-20

    To investigate the role of microtubule-actin crosslinking factor 1 (MACF1) in the response of glioma cells to temozolomide (TMZ). TMZ was applied to a human gliomablastoma cell line (U87) and changes in the protein expression and cellular localization were determined with Western blot, RT-PCR, and immunofluorescence. The responses of the cells with MACF1 expression knockdown by RNA interference to TMZ were assessed. TMZ-induced effects on MACF1 expression were also assessed by immunohistochemistry in a nude mouse model bearing human glioblastoma xenografts. TMZ resulted in significantly increased MACF1 expression (by about 2 folds) and changes in its localization in the gliomablastoma cells both in vitro and in vivo (P<0.01). Knockdown of MACF1 reduced the proliferation (by 45%) of human glioma cell lines treated with TMZ (P<0.01). TMZ-induced changes in MACF1 expression was accompanied by cytoskeletal rearrangement. MACF1 may be a potential therapeutic target for glioblastoma.

  8. Targeted gene therapy and cell reprogramming in Fanconi anemia.

    PubMed

    Rio, Paula; Baños, Rocio; Lombardo, Angelo; Quintana-Bustamante, Oscar; Alvarez, Lara; Garate, Zita; Genovese, Pietro; Almarza, Elena; Valeri, Antonio; Díez, Begoña; Navarro, Susana; Torres, Yaima; Trujillo, Juan P; Murillas, Rodolfo; Segovia, Jose C; Samper, Enrique; Surralles, Jordi; Gregory, Philip D; Holmes, Michael C; Naldini, Luigi; Bueren, Juan A

    2014-06-01

    Gene targeting is progressively becoming a realistic therapeutic alternative in clinics. It is unknown, however, whether this technology will be suitable for the treatment of DNA repair deficiency syndromes such as Fanconi anemia (FA), with defects in homology-directed DNA repair. In this study, we used zinc finger nucleases and integrase-defective lentiviral vectors to demonstrate for the first time that FANCA can be efficiently and specifically targeted into the AAVS1 safe harbor locus in fibroblasts from FA-A patients. Strikingly, up to 40% of FA fibroblasts showed gene targeting 42 days after gene editing. Given the low number of hematopoietic precursors in the bone marrow of FA patients, gene-edited FA fibroblasts were then reprogrammed and re-differentiated toward the hematopoietic lineage. Analyses of gene-edited FA-iPSCs confirmed the specific integration of FANCA in the AAVS1 locus in all tested clones. Moreover, the hematopoietic differentiation of these iPSCs efficiently generated disease-free hematopoietic progenitors. Taken together, our results demonstrate for the first time the feasibility of correcting the phenotype of a DNA repair deficiency syndrome using gene-targeting and cell reprogramming strategies. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  9. Gene-carried hepatoma targeting complex induced high gene transfection efficiency with low toxicity and significant antitumor activity.

    PubMed

    Zhao, Qing-Qing; Hu, Yu-Lan; Zhou, Yang; Li, Ni; Han, Min; Tang, Gu-Ping; Qiu, Feng; Tabata, Yasuhiko; Gao, Jian-Qing

    2012-01-01

    The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity. A liver cancer-targeted specific peptide (FQHPSF sequence) was successfully synthesized and linked with chitosan-linked polyethylenimine (CP) to form a new targeted gene delivery vector called CPT (CP/peptide). The structure of CPT was confirmed by (1)H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/ DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model. The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT was confirmed and the vector showed low cytotoxicity and strong targeting specificity to liver tumors in vitro. The in vivo study results showed that interleukin-12 delivered by the new gene vector CPT/DNA significantly enhanced the antitumor effect on ascites tumor-bearing imprinting control region mice as compared with polyethylenimine (25 kDa), CP, and other controls, which further demonstrate the targeting specificity of the new synthesized polymer. The synthesized CPT copolymer was proven to be an effective liver cancer-targeted vector for therapeutic gene

  10. Specific genetic modifications of domestic animals by gene targeting and animal cloning

    PubMed Central

    Wang, Bin; Zhou, Jiangfeng

    2003-01-01

    The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined. PMID:14614774

  11. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    PubMed

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  12. A comparison of Agrobacterium-mediated transformation and protoplast-mediated transformation with CRISPR-Cas9 and bipartite gene targeting substrates, as effective gene targeting tools for Aspergillus carbonarius.

    PubMed

    Weyda, István; Yang, Lei; Vang, Jesper; Ahring, Birgitte K; Lübeck, Mette; Lübeck, Peter S

    2017-04-01

    In recent years, versatile genetic tools have been developed and applied to a number of filamentous fungi of industrial importance. However, the existing techniques have limitations when it comes to achieve the desired genetic modifications, especially for efficient gene targeting. In this study, we used Aspergillus carbonarius as a host strain due to its potential as a cell factory, and compared three gene targeting techniques by disrupting the ayg1 gene involved in the biosynthesis of conidial pigment in A. carbonarius. The absence of the ayg1 gene leads to phenotypic change in conidia color, which facilitated the analysis on the gene targeting frequency. The examined transformation techniques included Agrobacterium-mediated transformation (AMT) and protoplast-mediated transformation (PMT). Furthermore, the PMT for the disruption of the ayg1 gene was carried out with bipartite gene targeting fragments and the recently adapted CRISPR-Cas9 system. All three techniques were successful in generating Δayg1 mutants, but showed different efficiencies. The most efficient method for gene targeting was AMT, but further it was shown to be dependent on the choice of Agrobacterium strain. However, there are different advantages and disadvantages of all three gene targeting methods which are discussed, in order to facilitate future approaches for fungal strain improvements. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. RNAi phenotype profiling of kinases identifies potential therapeutic targets in Ewing's sarcoma.

    PubMed

    Arora, Shilpi; Gonzales, Irma M; Hagelstrom, R Tanner; Beaudry, Christian; Choudhary, Ashish; Sima, Chao; Tibes, Raoul; Mousses, Spyro; Azorsa, David O

    2010-08-18

    Ewing's sarcomas are aggressive musculoskeletal tumors occurring most frequently in the long and flat bones as a solitary lesion mostly during the teen-age years of life. With current treatments, significant number of patients relapse and survival is poor for those with metastatic disease. As part of novel target discovery in Ewing's sarcoma, we applied RNAi mediated phenotypic profiling to identify kinase targets involved in growth and survival of Ewing's sarcoma cells. Four Ewing's sarcoma cell lines TC-32, TC-71, SK-ES-1 and RD-ES were tested in high throughput-RNAi screens using a siRNA library targeting 572 kinases. Knockdown of 25 siRNAs reduced the growth of all four Ewing's sarcoma cell lines in replicate screens. Of these, 16 siRNA were specific and reduced proliferation of Ewing's sarcoma cells as compared to normal fibroblasts. Secondary validation and preliminary mechanistic studies highlighted the kinases STK10 and TNK2 as having important roles in growth and survival of Ewing's sarcoma cells. Furthermore, knockdown of STK10 and TNK2 by siRNA showed increased apoptosis. In summary, RNAi-based phenotypic profiling proved to be a powerful gene target discovery strategy, leading to successful identification and validation of STK10 and TNK2 as two novel potential therapeutic targets for Ewing's sarcoma.

  14. Cancer gene therapy with targeted adenoviruses.

    PubMed

    Bachtarzi, Houria; Stevenson, Mark; Fisher, Kerry

    2008-11-01

    Clinical experience with adenovirus vectors has highlighted the need for improved delivery and targeting. This manuscript aims to provide an overview of the techniques currently under development for improving adenovirus delivery to malignant cells in vivo. Primary research articles reporting improvements in adenoviral gene delivery are described. Strategies include genetic modification of viral coat proteins, non-genetic modifications including polymer encapsulation approaches and pharmacological interventions. Reprogramming adenovirus tropism in vitro has been convincingly demonstrated using a range of genetic and physical strategies. These studies have provided new insights into our understanding of virology and the field is progressing. However, there are still some limitations that need special consideration before adenovirus-targeted cancer gene therapy emerges as a routine treatment in the clinical setting.

  15. Differential Sensitivity of Target Genes to Translational Repression by miR-17~92

    PubMed Central

    Jin, Hyun Yong; Oda, Hiroyo; Chen, Pengda; Kang, Seung Goo; Valentine, Elizabeth; Liao, Lujian; Zhang, Yaoyang; Gonzalez-Martin, Alicia; Shepherd, Jovan; Head, Steven R.; Kim, Pyeung-Hyeun; Fu, Guo; Liu, Wen-Hsien; Han, Jiahuai

    2017-01-01

    MicroRNAs (miRNAs) are thought to exert their functions by modulating the expression of hundreds of target genes and each to a small degree, but it remains unclear how small changes in hundreds of target genes are translated into the specific function of a miRNA. Here, we conducted an integrated analysis of transcriptome and translatome of primary B cells from mutant mice expressing miR-17~92 at three different levels to address this issue. We found that target genes exhibit differential sensitivity to miRNA suppression and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA under physiological conditions. Transgenic expression and deletion of the same miRNA gene regulate largely distinct sets of target genes. miR-17~92 controls target gene expression mainly through translational repression and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide molecular insights into a model in which miRNAs exert their specific functions through a small number of key target genes. PMID:28241004

  16. Targeting LC3 and Beclin-1 autophagy genes suppresses proliferation, survival, migration and invasion by inhibition of Cyclin-D1 and uPAR/Integrin β1/ Src signaling in triple negative breast cancer cells.

    PubMed

    Hamurcu, Zuhal; Delibaşı, Nesrin; Geçene, Seda; Şener, Elif Funda; Dönmez-Altuntaş, Hamiyet; Özkul, Yusuf; Canatan, Halit; Ozpolat, Bulent

    2018-03-01

    Autophagy is a catabolic process for degrading dysfunctional proteins and organelles, and closely associated with cancer cell survival under therapeutic, metabolic stress, hypoxia, starvation and lack of growth factors, contributing to resistance to therapies. However, the role of autophagy in breast cancer cells is not well understood. In the present study, we investigated the role of autophagy in highly aggressive and metastatic triple negative breast cancer (TNBC) and non-metastatic breast cancer cells and demonstrated that the knockdown of autophagy-related genes (LC3 and Beclin-1) inhibited autophagy and significantly suppressed cell proliferation, colony formation, migration/invasion and induced apoptosis in MDA-MB-231 and BT-549 TNBC cells. Knockdown of LC3 and Beclin-1 led to inhibition of multiple proto-oncogenic signaling pathways, including cyclin D1, uPAR/integrin-β1/Src, and PARP1. In conclusion, our study suggests that LC3 and Beclin-1 are required for cell proliferation, survival, migration and invasion, and may contribute to tumor growth and progression of highly aggressive and metastatic TNBC cells and therapeutic targeting of autophagy genes may be a potential therapeutic strategy for TNBC in breast cancer.

  17. PTTG1, A novel androgen responsive gene is required for androgen-induced prostate cancer cell growth and invasion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Zheng; Jin, Bo; Jin, Yaqiong

    Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that themore » PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.« less

  18. An RNAi-mediated screen identifies novel targets for next-generation antiepileptic drugs based on increased expression of the homeostatic regulator pumilio.

    PubMed

    Lin, Wei-Hsiang; He, Miaomiao; Fan, Yuen Ngan; Baines, Richard A

    2018-05-02

    Despite availability of a diverse range of anti-epileptic drugs (AEDs), only about two-thirds of epilepsy patients respond well to drug treatment. Thus, novel targets are required to catalyse the design of next-generation AEDs. Manipulation of neuron firing-rate homoeostasis, through enhancing Pumilio (Pum) activity, has been shown to be potently anticonvulsant in Drosophila. In this study, we performed a genome-wide RNAi screen in S2R + cells, using a luciferase-based dPum activity reporter and identified 1166 genes involved in dPum regulation. Of these genes, we focused on 699 genes that, on knock-down, potentiate dPum activity/expression. Of this subgroup, 101 genes are activity-dependent based on comparison with genes previously identified as activity-dependent by RNA-sequencing. Functional cluster analysis shows these genes are enriched in pathways involved in DNA damage, regulation of cell cycle and proteasomal protein catabolism. To test for anticonvulsant activity, we utilised an RNA-interference approach in vivo. RNAi-mediated knockdown showed that 57/101 genes (61%) are sufficient to significantly reduce seizure duration in the characterized seizure mutant, para bss . We further show that chemical inhibitors of protein products of some of the genes targeted are similarly anticonvulsant. Finally, to establish whether the anticonvulsant activity of identified compounds results from increased dpum transcription, we performed a luciferase-based assay to monitor dpum promoter activity. Third instar larvae exposed to sodium fluoride, gemcitabine, metformin, bestatin, WP1066 or valproic acid all showed increased dpum promoter activity. Thus, this study validates Pum as a favourable target for AED design and, moreover, identifies a number of lead compounds capable of increasing the expression of this homeostatic regulator.

  19. Thioredoxin reductase 1 knockdown enhances selenazolidine cytotoxicity in human lung cancer cells via mitochondrial dysfunction

    PubMed Central

    Poerschke, Robyn L.; Moos, Philip J.

    2010-01-01

    Thioredoxin reductase (TR1) is a selenoprotein that is involved in cellular redox status control and deoxyribonucleotide biosynthesis. Many cancers, including lung, overexpress TR1, making it a potential cancer therapy target. Previous work has shown that TR1 knockdown enhances the sensitivity of cancer cells to anticancer treatments, as well as certain selenocompounds. However, it is unknown if TR1 knockdown produces similar effect on the sensitivity of human lung cancer cells. To further elucidate the role of TR1 in the mechanism of selenocompounds in lung cancer, a lentiviral microRNA delivery system to knockdown TR1 expression in A549 human lung adenocarcinoma cells was utilized. Cell viability was assessed after 48 hr treatment with the selenocysteine prodrug selenazolidines 2-butylselenazolidine-4(R)-carboxylic acid (BSCA) and 2-cyclohexylselenazolidine-4-(R)-carboxylic acid (ChSCA), selenocystine (SECY), methylseleninic acid (MSA), 1,4-phenylenebis(methylene)selenocyanate (p-XSC), and selenomethionine (SEM). TR1 knockdown increased the cytotoxicity of BSCA, ChSCA, and SECY but did not sensitize cells to MSA, SEM, or p-XSC. GSH and TR1 depletion together decreased cell viability, while no change was observed with GSH depletion alone. Reactive oxygen species generation was induced only in TR1 knockdown cells treated with the selenazolidines or SECY. These three compounds also decreased total intracellular glutathione levels and oxidized thioredoxin, but in a TR1 independent manner. TR1 knockdown increased selenazolidine and SECY-induced mitochondrial membrane depolarization, as well as DNA strand breaks and AIF translocation from the mitochondria. These results indicate the ability of TR1 to modulate the cytotoxic effects of BSCA, ChSCA and SECY in human lung cancer cells through mitochondrial dysfunction. PMID:20920480

  20. Knockdown of Both Mitochondrial Isocitrate Dehydrogenase Enzymes In Pancreatic Beta Cells Inhibits Insulin Secretion

    PubMed Central

    MacDonald, Michael J.; Brown, Laura J.; Longacre, Melissa J.; Stoker, Scott W.; Kendrick, Mindy A.; Hasan, Noaman M.

    2013-01-01

    Background There are three isocitrate dehydrogenases (IDHs) in the pancreatic insulin cell; IDH1 (cytosolic) and IDH2 (mitochondrial) use NADP(H). IDH3 is mitochondrial, uses NAD(H) and was believed to be the IDH that supports the citric acid cycle. Methods With shRNAs targeting mRNAs for these enzymes we generated cell lines from INS-1 832/13 cells with severe (80%–90%) knockdown of the mitochondrial IDHs separately and together in the same cell line. Results With knockdown of both mitochondrial IDH’s mRNA, enzyme activity and protein level, but not with knockdown of one mitochondrial IDH, glucose- and BCH (an allosteric activator of glutamate dehydrogenase)-plus-glutamine-stimulated insulin release were inhibited. Cellular levels of citrate, α-ketoglutarate, malate and ATP were altered in patterns consistent with blockage at the mitochondrial IDH reactions. We were able to generate only 50% knockdown of Idh1 mRNA in multiple cell lines (without inhibition of insulin release) possibly because greater knockdown of IDH1 was not compatible with cell line survival. Conclusions The mitochondrial IDHs are redundant for insulin secretion. When both enzymes are severely knocked down, their low activities (possibly assisted by transport of IDH products and other metabolic intermediates from the cytosol into mitochondria) are sufficient for cell growth, but inadequate for insulin secretion when the requirement for intermediates is certainly more rapid. The results also indicate that IDH2 can support the citric acid cycle. General Significance As almost all mammalian cells possess substantial amounts of all three IDH enzymes, the biological principles suggested by these results are probably extrapolatable to many tissues. PMID:23876293

  1. Targeted gene deletion of miRNAs in mice by TALEN system.

    PubMed

    Takada, Shuji; Sato, Tempei; Ito, Yoshiaki; Yamashita, Satoshi; Kato, Tomoko; Kawasumi, Miyuri; Kanai-Azuma, Masami; Igarashi, Arisa; Kato, Tomomi; Tamano, Moe; Asahara, Hiroshi

    2013-01-01

    Mice are among the most valuable model animal species with an enormous amount of heritage in genetic modification studies. However, targeting genes in mice is sometimes difficult, especially for small genes, such as microRNAs (miRNAs) and targeting genes in repeat sequences. Here we optimized the application of TALEN system for mice and successfully obtained gene targeting technique in mice for intergenic region and series of microRNAs. Microinjection of synthesized RNA of TALEN targeting each gene in one cell stage of embryo was carried out and injected oocytes were transferred into pseudopregnant ICR female mice, producing a high success rate of the targeted deletion of miRNA genes. In our condition, TALEN RNA without poly(A) tail worked better than that of with poly(A) tail. This mutated allele in miRNA was transmitted to the next generation, suggesting the successful germ line transmission of this targeting method. Consistent with our notion of miRNAs maturation mechanism, in homozygous mutant mice of miR-10a, the non- mutated strand of miRNAs expression was completely diminished. This method will lead us to expand and accelerate our genetic research using mice in a high throughput way.

  2. Knockdown of SALL4 Protein Enhances All-trans Retinoic Acid-induced Cellular Differentiation in Acute Myeloid Leukemia Cells*

    PubMed Central

    Liu, Li; Liu, Liang; Leung, Lai-Han; Cooney, Austin J.; Chen, Changyi; Rosengart, Todd K.; Ma, Yupo; Yang, Jianchang

    2015-01-01

    All-trans retinoic acid (ATRA) is a differentiation agent that revolutionized the treatment of acute promyelocytic leukemia. However, it has not been useful for other types of acute myeloid leukemia (AML). Here we explored the effect of SALL4, a stem cell factor, on ATRA-induced AML differentiation in both ATRA-sensitive and ATRA-resistant AML cells. Aberrant SALL4 expression has been found in nearly all human AML cases, whereas, in normal bone marrow and peripheral blood cells, its expression is only restricted to hematopoietic stem/progenitor cells. We reason that, in AMLs, SALL4 activation may prevent cell differentiation and/or protect self-renewal that is seen in normal hematopoietic stem/progenitor cells. Indeed, our studies show that ATRA-mediated myeloid differentiation can be largely blocked by exogenous expression of SALL4, whereas ATRA plus SALL4 knockdown causes significantly increased AML differentiation and cell death. Mechanistic studies indicate that SALL4 directly associates with retinoic acid receptor α and modulates ATRA target gene expression. SALL4 is shown to recruit lysine-specific histone demethylase 1 (LSD1) to target genes and alter the histone methylation status. Furthermore, coinhibition of LSD1 and SALL4 plus ATRA treatment exhibited the strongest anti-AML effect. These findings suggest that SALL4 plays an unfavorable role in ATRA-based regimes, highlighting an important aspect of leukemia therapy. PMID:25737450

  3. RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

    NASA Astrophysics Data System (ADS)

    Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Yoon, Ho Sup; Swee Chuan, Tjin; Yong, Ken-Tye

    2015-09-01

    RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications.

  4. RNA-guided genome editing for target gene mutations in wheat.

    PubMed

    Upadhyay, Santosh Kumar; Kumar, Jitesh; Alok, Anshu; Tuli, Rakesh

    2013-12-09

    The clustered, regularly interspaced, short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system has been used as an efficient tool for genome editing. We report the application of CRISPR-Cas-mediated genome editing to wheat (Triticum aestivum), the most important food crop plant with a very large and complex genome. The mutations were targeted in the inositol oxygenase (inox) and phytoene desaturase (pds) genes using cell suspension culture of wheat and in the pds gene in leaves of Nicotiana benthamiana. The expression of chimeric guide RNAs (cgRNA) targeting single and multiple sites resulted in indel mutations in all the tested samples. The expression of Cas9 or sgRNA alone did not cause any mutation. The expression of duplex cgRNA with Cas9 targeting two sites in the same gene resulted in deletion of DNA fragment between the targeted sequences. Multiplexing the cgRNA could target two genes at one time. Target specificity analysis of cgRNA showed that mismatches at the 3' end of the target site abolished the cleavage activity completely. The mismatches at the 5' end reduced cleavage, suggesting that the off target effects can be abolished in vivo by selecting target sites with unique sequences at 3' end. This approach provides a powerful method for genome engineering in plants.

  5. RNAi-mediated knock-down of Dab and Numb attenuate Aβ levels via γ-secretase mediated APP processing

    PubMed Central

    2012-01-01

    Amyloid-β-protein (Aβ), the key component of senile plaques in Alzheimer's disease (AD) brain, is produced from amyloid precursor protein (APP) by cleavage of β-secretase and then γ-secretase. APP adaptor proteins with phosphotyrosine-binding (PTB) domains, including Dab (gene: DAB) and Numb (gene: NUMB), can bind to and interact with the conserved YENPTY-motif in the APP C-terminus. Here we describe, for the first time, the effects of RNAi knock-down of Dab and Numb expression on APP processing and Aβ production. RNAi knock-down of Dab and Numb in H4 human neuroglioma cells stably transfected to express either FL-APP (H4-FL-APP cells) or APP-C99 (H4-APP-C99 cells) increased levels of APP-C-terminal fragments (APP-CTFs) and lowered Aβ levels in both cell lines by inhibiting γ-secretase cleavage of APP. Finally, RNAi knock-down of APP also reduced levels of Numb in H4-APP cells. These findings suggest that pharmacologically blocking interaction of APP with Dab and Numb may provide novel therapeutic strategies of AD. The notion of attenuating γ-secretase cleavage of APP via the APP adaptor proteins, Dab and Numb, is particularly attractive with regard to therapeutic potential, given that side effects of γ-secretase inhibition owing to impaired proteolysis of other γ-secretase substrates, e.g. Notch, might be avoided. PMID:23211096

  6. RNAi-mediated knock-down of Dab and Numb attenuate Aβ levels via γ-secretase mediated APP processing.

    PubMed

    Xie, Zhongcong; Dong, Yuanlin; Maeda, Uta; Xia, Weiming; Tanzi, Rudolph E

    2012-03-22

    Amyloid-β-protein (Aβ), the key component of senile plaques in Alzheimer's disease (AD) brain, is produced from amyloid precursor protein (APP) by cleavage of β-secretase and then γ-secretase. APP adaptor proteins with phosphotyrosine-binding (PTB) domains, including Dab (gene: DAB) and Numb (gene: NUMB), can bind to and interact with the conserved YENPTY-motif in the APP C-terminus. Here we describe, for the first time, the effects of RNAi knock-down of Dab and Numb expression on APP processing and Aβ production. RNAi knock-down of Dab and Numb in H4 human neuroglioma cells stably transfected to express either FL-APP (H4-FL-APP cells) or APP-C99 (H4-APP-C99 cells) increased levels of APP-C-terminal fragments (APP-CTFs) and lowered Aβ levels in both cell lines by inhibiting γ-secretase cleavage of APP. Finally, RNAi knock-down of APP also reduced levels of Numb in H4-APP cells. These findings suggest that pharmacologically blocking interaction of APP with Dab and Numb may provide novel therapeutic strategies of AD. The notion of attenuating γ-secretase cleavage of APP via the APP adaptor proteins, Dab and Numb, is particularly attractive with regard to therapeutic potential, given that side effects of γ-secretase inhibition owing to impaired proteolysis of other γ-secretase substrates, e.g. Notch, might be avoided.

  7. Insecticidal potency of RNAi-based catalase knockdown in Rhynchophorus ferrugineus (Oliver) (Coleoptera: Curculionidae).

    PubMed

    Al-Ayedh, Hassan; Rizwan-Ul-Haq, Muhammad; Hussain, Abid; Aljabr, Ahmed M

    2016-11-01

    Palm trees around the world are prone to notorious Rhynchophorus ferrugineus, which causes heavy losses of palm plantations. In Middle Eastern countries, this pest is a major threat to date palm orchards. Conventional pest control measures with the major share of synthetic insecticides have resulted in insect resistance and environmental issues. Therefore, in order to explore better alternatives, the RNAi approach was employed to knock down the catalase gene in fifth and tenth larval instars with different dsRNA application methods, and their insecticidal potency was studied. dsRNA of 444 bp was prepared to knock down catalase in R. ferrugineus. Out of the three dsRNA application methods, dsRNA injection into larvae was the most effective, followed by dsRNA application by artificial feeding. Both methods resulted in significant catalase knockdown in various tissues, especially the midgut. As a result, the highest growth inhibition of 123.49 and 103.47% and larval mortality of 80 and 40% were observed in fifth-instar larvae, whereas larval growth inhibition remained at 86.83 and 69.08% with larval mortality at 30 and 10% in tenth-instar larvae after dsRNA injection and artificial diet treatment. The topical application method was the least efficient, with the lowest larval growth inhibition of 57.23 and 45.61% and 0% mortality in fifth- and tenth-instar larvae. Generally, better results were noted at the high dsRNA dose of 5 µL. Catalase enzyme is found in most insect body tissues, and thus its dsRNA can cause broad-scale gene knockdown within the insect body, depending upon the application method. Significant larval mortality and growth inhibition after catalase knockdown in R. ferrugineus confirms its insecticidal potency and suggests a bright future for RNAi-based bioinsecticides in pest control. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  8. CRISPR/Cas9 Allows Efficient and Complete Knock-In of a Destabilization Domain-Tagged Essential Protein in a Human Cell Line, Allowing Rapid Knockdown of Protein Function

    PubMed Central

    Park, Arnold; Won, Sohui T.; Pentecost, Mickey; Bartkowski, Wojciech; Lee, Benhur

    2014-01-01

    Although modulation of protein levels is an important tool for study of protein function, it is difficult or impossible to knockdown or knockout genes that are critical for cell growth or viability. For such genes, a conditional knockdown approach would be valuable. The FKBP protein-based destabilization domain (DD)-tagging approach, which confers instability to the tagged protein in the absence of the compound Shield-1, has been shown to provide rapid control of protein levels determined by Shield-1 concentration. Although a strategy to knock-in DD-tagged protein at the endogenous loci has been employed in certain parasite studies, partly due to the relative ease of knock-in as a result of their mostly haploid lifecycles, this strategy has not been demonstrated in diploid or hyperploid mammalian cells due to the relative difficulty of achieving complete knock-in in all alleles. The recent advent of CRISPR/Cas9 homing endonuclease-mediated targeted genome cleavage has been shown to allow highly efficient homologous recombination at the targeted locus. We therefore assessed the feasibility of using CRISPR/Cas9 to achieve complete knock-in to DD-tag the essential gene Treacher Collins-Franceschetti syndrome 1 (TCOF1) in human 293T cells. Using a double antibiotic selection strategy to select clones with at least two knock-in alleles, we obtained numerous complete knock-in clones within three weeks of initial transfection. DD-TCOF1 expression in the knock-in cells was Shield-1 concentration-dependent, and removal of Shield-1 resulted in destabilization of DD-TCOF1 over the course of hours. We further confirmed that the tagged TCOF1 retained the nucleolar localization of the wild-type untagged protein, and that destabilization of DD-TCOF1 resulted in impaired cell growth, as expected for a gene implicated in ribosome biogenesis. CRISPR/Cas9-mediated homologous recombination to completely knock-in a DD tag likely represents a generalizable and efficient strategy to

  9. CRISPR/Cas9 allows efficient and complete knock-in of a destabilization domain-tagged essential protein in a human cell line, allowing rapid knockdown of protein function.

    PubMed

    Park, Arnold; Won, Sohui T; Pentecost, Mickey; Bartkowski, Wojciech; Lee, Benhur

    2014-01-01

    Although modulation of protein levels is an important tool for study of protein function, it is difficult or impossible to knockdown or knockout genes that are critical for cell growth or viability. For such genes, a conditional knockdown approach would be valuable. The FKBP protein-based destabilization domain (DD)-tagging approach, which confers instability to the tagged protein in the absence of the compound Shield-1, has been shown to provide rapid control of protein levels determined by Shield-1 concentration. Although a strategy to knock-in DD-tagged protein at the endogenous loci has been employed in certain parasite studies, partly due to the relative ease of knock-in as a result of their mostly haploid lifecycles, this strategy has not been demonstrated in diploid or hyperploid mammalian cells due to the relative difficulty of achieving complete knock-in in all alleles. The recent advent of CRISPR/Cas9 homing endonuclease-mediated targeted genome cleavage has been shown to allow highly efficient homologous recombination at the targeted locus. We therefore assessed the feasibility of using CRISPR/Cas9 to achieve complete knock-in to DD-tag the essential gene Treacher Collins-Franceschetti syndrome 1 (TCOF1) in human 293T cells. Using a double antibiotic selection strategy to select clones with at least two knock-in alleles, we obtained numerous complete knock-in clones within three weeks of initial transfection. DD-TCOF1 expression in the knock-in cells was Shield-1 concentration-dependent, and removal of Shield-1 resulted in destabilization of DD-TCOF1 over the course of hours. We further confirmed that the tagged TCOF1 retained the nucleolar localization of the wild-type untagged protein, and that destabilization of DD-TCOF1 resulted in impaired cell growth, as expected for a gene implicated in ribosome biogenesis. CRISPR/Cas9-mediated homologous recombination to completely knock-in a DD tag likely represents a generalizable and efficient strategy to

  10. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  11. Adapted Resistance to the Knockdown Effect of shRNA-Derived Srsf3 siRNAs in Mouse Littermates | Center for Cancer Research

    Cancer.gov

    Gene silencing techniques are widely used to control gene expression and have potential for RNAi-based therapeutics. In this report, transgenic mouse lines were created for conditional knockdown of Srsf3 (SRp20) expression in liver and mammary gland tissues by expressing Srsf3-specific shRNAs driven by a U6 promoter.

  12. SMARCA4 regulates gene expression and higher-order chromatin structure in proliferating mammary epithelial cells

    PubMed Central

    Barutcu, A. Rasim; Lajoie, Bryan R.; Fritz, Andrew J.; McCord, Rachel P.; Nickerson, Jeffrey A.; van Wijnen, Andre J.; Lian, Jane B.; Stein, Janet L.; Dekker, Job; Stein, Gary S.; Imbalzano, Anthony N.

    2016-01-01

    The packaging of DNA into chromatin plays an important role in transcriptional regulation and nuclear processes. Brahma-related gene-1 SMARCA4 (also known as BRG1), the essential ATPase subunit of the mammalian SWI/SNF chromatin remodeling complex, uses the energy from ATP hydrolysis to disrupt nucleosomes at target regions. Although the transcriptional role of SMARCA4 at gene promoters is well-studied, less is known about its role in higher-order genome organization. SMARCA4 knockdown in human mammary epithelial MCF-10A cells resulted in 176 up-regulated genes, including many related to lipid and calcium metabolism, and 1292 down-regulated genes, some of which encode extracellular matrix (ECM) components that can exert mechanical forces and affect nuclear structure. ChIP-seq analysis of SMARCA4 localization and SMARCA4-bound super-enhancers demonstrated extensive binding at intergenic regions. Furthermore, Hi-C analysis showed extensive SMARCA4-mediated alterations in higher-order genome organization at multiple resolutions. First, SMARCA4 knockdown resulted in clustering of intra- and inter-subtelomeric regions, demonstrating a novel role for SMARCA4 in telomere organization. SMARCA4 binding was enriched at topologically associating domain (TAD) boundaries, and SMARCA4 knockdown resulted in weakening of TAD boundary strength. Taken together, these findings provide a dynamic view of SMARCA4-dependent changes in higher-order chromatin organization and gene expression, identifying SMARCA4 as a novel component of chromatin organization. PMID:27435934

  13. Synthesis of galactosyl compounds for targeted gene delivery.

    PubMed

    Ren, T; Zhang, G; Liu, D

    2001-11-01

    Cell-specific DNA delivery offers a great potential for targeted gene therapy. Toward this end, we have synthesized a series of compounds carrying galactose residues as a targeting ligand for asialoglycoprotein receptors of hepatocytes and primary amine groups as a functional domain for DNA binding. Biological activity of these galactosyl compounds in DNA delivery was evaluated in HepG2 and BL-6 cells and compared with respect to the number of galactose residues as well as primary amine groups in each molecule. Transfection experiments using a firefly luciferase gene as a reporter revealed that compounds with multivalent binding properties were more active in DNA delivery. An optimal transfection activity in HepG2 cells requires seven primary amine groups and a minimum of two galactose residues in each molecule. The transfection activity of compounds carrying multi-galactose residues can be inhibited by asialofetuin, a natural substrate for asialoglycoprotein receptors of hepatocytes, suggesting that gene transfer by these galactosyl compounds is asialoglycoprotein receptor-mediated. These results provide direct evidence in support of our new strategy for the use of small and synthetic compounds for cell specific and targeted gene delivery.

  14. Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).

    PubMed

    Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash

    2015-01-01

    The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Genomic identification of direct target genes of LEAFY

    PubMed Central

    William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

    2004-01-01

    The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

  16. Identification of HMX1 target genes: A predictive promoter model approach

    PubMed Central

    Boulling, Arnaud; Wicht, Linda

    2013-01-01

    Purpose A homozygous mutation in the H6 family homeobox 1 (HMX1) gene is responsible for a new oculoauricular defect leading to eye and auricular developmental abnormalities as well as early retinal degeneration (MIM 612109). However, the HMX1 pathway remains poorly understood, and in the first approach to better understand the pathway’s function, we sought to identify the target genes. Methods We developed a predictive promoter model (PPM) approach using a comparative transcriptomic analysis in the retina at P15 of a mouse model lacking functional Hmx1 (dmbo mouse) and its respective wild-type. This PPM was based on the hypothesis that HMX1 binding site (HMX1-BS) clusters should be more represented in promoters of HMX1 target genes. The most differentially expressed genes in the microarray experiment that contained HMX1-BS clusters were used to generate the PPM, which was then statistically validated. Finally, we developed two genome-wide target prediction methods: one that focused on conserving PPM features in human and mouse and one that was based on the co-occurrence of HMX1-BS pairs fitting the PPM, in human or in mouse, independently. Results The PPM construction revealed that sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) (Sgcg), teashirt zinc finger homeobox 2 (Tshz2), and solute carrier family 6 (neurotransmitter transporter, glycine) (Slc6a9) genes represented Hmx1 targets in the mouse retina at P15. Moreover, the genome-wide target prediction revealed that mouse genes belonging to the retinal axon guidance pathway were targeted by Hmx1. Expression of these three genes was experimentally validated using a quantitative reverse transcription PCR approach. The inhibitory activity of Hmx1 on Sgcg, as well as protein tyrosine phosphatase, receptor type, O (Ptpro) and Sema3f, two targets identified by the PPM, were validated with luciferase assay. Conclusions Gene expression analysis between wild-type and dmbo mice allowed us to develop a PPM

  17. Applications of CRISPR/Cas9 technology for targeted mutagenesis, gene replacement and stacking of genes in higher plants.

    PubMed

    Luo, Ming; Gilbert, Brian; Ayliffe, Michael

    2016-07-01

    Mutagenesis continues to play an essential role for understanding plant gene function and, in some instances, provides an opportunity for plant improvement. The development of gene editing technologies such as TALENs and zinc fingers has revolutionised the targeted mutation specificity that can now be achieved. The CRISPR/Cas9 system is the most recent addition to gene editing technologies and arguably the simplest requiring only two components; a small guide RNA molecule (sgRNA) and Cas9 endonuclease protein which complex to recognise and cleave a specific 20 bp target site present in a genome. Target specificity is determined by complementary base pairing between the sgRNA and target site sequence enabling highly specific, targeted mutation to be readily engineered. Upon target site cleavage, error-prone endogenous repair mechanisms produce small insertion/deletions at the target site usually resulting in loss of gene function. CRISPR/Cas9 gene editing has been rapidly adopted in plants and successfully undertaken in numerous species including major crop species. Its applications are not restricted to mutagenesis and target site cleavage can be exploited to promote sequence insertion or replacement by recombination. The multiple applications of this technology in plants are described.

  18. Hypoxia regulates alternative splicing of HIF and non-HIF target genes.

    PubMed

    Sena, Johnny A; Wang, Liyi; Heasley, Lynn E; Hu, Cheng-Jun

    2014-09-01

    Hypoxia is a common characteristic of many solid tumors. The hypoxic microenvironment stabilizes hypoxia-inducible transcription factor 1α (HIF1α) and 2α (HIF2α/EPAS1) to activate gene transcription, which promotes tumor cell survival. The majority of human genes are alternatively spliced, producing RNA isoforms that code for functionally distinct proteins. Thus, an effective hypoxia response requires increased HIF target gene expression as well as proper RNA splicing of these HIF-dependent transcripts. However, it is unclear if and how hypoxia regulates RNA splicing of HIF targets. This study determined the effects of hypoxia on alternative splicing (AS) of HIF and non-HIF target genes in hepatocellular carcinoma cells and characterized the role of HIF in regulating AS of HIF-induced genes. The results indicate that hypoxia generally promotes exon inclusion for hypoxia-induced, but reduces exon inclusion for hypoxia-reduced genes. Mechanistically, HIF activity, but not hypoxia per se is found to be necessary and sufficient to increase exon inclusion of several HIF targets, including pyruvate dehydrogenase kinase 1 (PDK1). PDK1 splicing reporters confirm that transcriptional activation by HIF is sufficient to increase exon inclusion of PDK1 splicing reporter. In contrast, transcriptional activation of a PDK1 minigene by other transcription factors in the absence of endogenous HIF target gene activation fails to alter PDK1 RNA splicing. This study demonstrates a novel function of HIF in regulating RNA splicing of HIF target genes. ©2014 American Association for Cancer Research.

  19. Identification of Homeotic Target Genes in Drosophila Melanogaster Including Nervy, a Proto-Oncogene Homologue

    PubMed Central

    Feinstein, P. G.; Kornfeld, K.; Hogness, D. S.; Mann, R. S.

    1995-01-01

    In Drosophila, the specific morphological characteristics of each segment are determined by the homeotic genes that regulate the expression of downstream target genes. We used a subtractive hybridization procedure to isolate activated target genes of the homeotic gene Ultrabithorax (Ubx). In addition, we constructed a set of mutant genotypes that measures the regulatory contribution of individual homeotic genes to a complex target gene expression pattern. Using these mutants, we demonstrate that homeotic genes can regulate target gene expression at the start of gastrulation, suggesting a previously unknown role for the homeotic genes at this early stage. We also show that, in abdominal segments, the levels of expression for two target genes increase in response to high levels of Ubx, demonstrating that the normal down-regulation of Ubx in these segments is functional. Finally, the DNA sequence of cDNAs for one of these genes predicts a protein that is similar to a human proto-oncogene involved in acute myeloid leukemias. These results illustrate potentially general rules about the homeotic control of target gene expression and suggest that subtractive hybridization can be used to isolate interesting homeotic target genes. PMID:7498738

  20. Intramyocardial Injection of siRNAs Can Efficiently Establish Myocardial Tissue-Specific Renalase Knockdown Mouse Model.

    PubMed

    Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili

    2016-01-01

    Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.

  1. Multifunctional Nucleus-targeting Nanoparticles with Ultra-high Gene Transfection Efficiency for In Vivo Gene Therapy

    PubMed Central

    Li, Ling; Li, Xia; Wu, Yuzhe; Song, Linjiang; Yang, Xi; He, Tao; Wang, Ning; Yang, Suleixin; Zeng, Yan; Wu, Qinjie; Qian, Zhiyong; Wei, Yuquan; Gong, Changyang

    2017-01-01

    Cancer stem cell-like cells (CSCL) are responsible for tumor recurrence associated with conventional therapy (e.g. surgery, radiation, and chemotherapy). Here, we developed a novel multifunctional nucleus-targeting nanoparticle-based gene delivery system which is capable of targeting and eradicating CSCL. These nanoparticles can facilitate efficient endosomal escape and spontaneously penetrate into nucleus without additional nuclear localization signal. They also induced extremely high gene transfection efficiency (>95%) even in culture medium containing 30% serum, which significantly surpassed that of some commercial transfection reagents, such as Lipofectamine 2000 and Lipofectamine 3000 etc. Especially, when loaded with the TRAIL gene, this system mediated remarkable depletion of CSCL. Upon systemic administration, the nanoparticles accumulated in tumor sites while sparing the non-cancer tissues and significantly inhibited the growth of tumors with no evident systemic toxicity. Taken together, our results suggest that these novel multifunctional, nucleus-targeting nanoparticles are a very promising in vivo gene delivery system capable of targeting CSCL and represent a new treatment candidate for improving the survival of cancer patients. PMID:28529641

  2. Effects of simultaneous knockdown of HER2 and PTK6 on malignancy and tumor progression in human breast cancer cells.

    PubMed

    Ludyga, Natalie; Anastasov, Natasa; Rosemann, Michael; Seiler, Jana; Lohmann, Nadine; Braselmann, Herbert; Mengele, Karin; Schmitt, Manfred; Höfler, Heinz; Aubele, Michaela

    2013-04-01

    Breast cancer is the most common malignancy in women of the Western world. One prominent feature of breast cancer is the co- and overexpression of HER2 and protein tyrosine kinase 6 (PTK6). According to the current clinical cancer therapy guidelines, HER2-overexpressing tumors are routinely treated with trastuzumab, a humanized monoclonal antibody targeting HER2. Approximately, 30% of HER2-overexpressing breast tumors at least initially respond to the anti-HER2 therapy, but a subgroup of these tumors develops resistance shortly after the administration of trastuzumab. A PTK6-targeted therapy does not yet exist. Here, we show for the first time that the simultaneous knockdown in vitro, compared with the single knockdown of HER2 and PTK6, in particular in the trastuzumab-resistant JIMT-1 cells, leads to a significantly decreased phosphorylation of crucial signaling proteins: mitogen-activated protein kinase 1/3 (MAPK 1/3, ERK 1/2) and p38 MAPK, and (phosphatase and tensin homologue deleted on chromosome ten) PTEN that are involved in tumorigenesis. In addition, dual knockdown strongly reduced the migration and invasion of the JIMT-1 cells. Moreover, the downregulation of HER2 and PTK6 led to an induction of p27, and the dual knockdown significantly diminished cell proliferation in JIMT-1 and T47D cells. In vivo experiments showed significantly reduced levels of tumor growth following HER2 or PTK6 knockdown. Our results indicate a novel strategy also for the treatment of trastuzumab resistance in tumors. Thus, the inhibition of these two signaling proteins may lead to a more effective control of breast cancer. ©2013 AACR.

  3. Targeted gene flow and rapid adaptation in an endangered marsupial.

    PubMed

    Kelly, Ella; Phillips, Ben L

    2018-06-13

    Targeted gene flow is an emerging conservation strategy. It involves translocating individuals with favorable genes to areas where they will have a conservation benefit. The applications for targeted gene flow are wide-ranging, but include pre-adapting natives to the arrival of invasive species. The endangered carnivorous marsupial, the northern quoll, has declined rapidly since the introduction of the cane toad, which fatally poisons quolls that attack them. There are, however, a few remaining toad-invaded quoll populations in which the quolls survive because they know not to eat cane toads. It is this "toad-smart" behavior that we hope to promote through targeted gene flow. For targeted gene flow to be feasible, however, toad-smarts must have a genetic basis. To assess this, we used a common garden experiment and found offspring from toad-exposed populations were substantially less likely to eat toads than those with toad-naïve parents. Hybrid offspring showed similar responses to quolls with two toad-exposed parents, indicating the trait may be dominant. Together, these results suggest a heritable trait and rapid adaptive response in small number of toad-impacted populations. Although questions remain about outbreeding depression, our results are encouraging for targeted gene flow: suggesting it should be possible to introduce toad-smart behavior into soon to be impacted quoll populations. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Knockdown of BAG3 sensitizes bladder cancer cells to treatment with the BH3 mimetic ABT-737.

    PubMed

    Mani, Jens; Antonietti, Patrick; Rakel, Stefanie; Blaheta, Roman; Bartsch, Georg; Haferkamp, Axel; Kögel, Donat

    2016-02-01

    BAG3 is overexpressed in several malignancies and mediates a non-canonical, selective form of (macro)autophagy. By stabilizing pro-survival Bcl-2 proteins in complex with HSP70, BAG3 can also exert an apoptosis-antagonizing function. ABT-737 is a high affinity Bcl-2 inhibitor that fails to target Mcl-1. This failure may confer resistance in various cancers. Urothelial cancer cells were treated with the BH3 mimetics ABT-737 and (-)-gossypol, a pan-Bcl-2 inhibitor which inhibits also Mcl-1. To clarify the importance of the core autophagy regulator ATG5 and BAG3 in ABT-737 treatment, cell lines carrying a stable lentiviral knockdown of ATG5 and BAG3 were created. The synergistic effect of ABT-737 and pharmaceutical inhibition of BAG3 with the HSF1 inhibitor KRIBB11 or sorafenib was also evaluated. Total cell death and apoptosis were quantified by FACS analysis of propidium iodide, annexin. Target protein analysis was conducted by Western blotting. Knockdown of BAG3 significantly downregulated Mcl-1 protein levels and sensitized urothelial cancer cells to apoptotic cell death induced by ABT-737, while inhibition of bulk autophagy through depletion of ATG5 had no discernible effect on cell death. Similar to knockdown of BAG3, pharmacological targeting of the BAG3/Mcl-1 pathway with KRIBB11 was capable to sensitize both cell lines to treatment with ABT-737. Our results show that BAG3, but not bulk autophagy has a major role in the response of bladder cancer cells to BH3 mimetics. They also suggest that BAG3 is a suitable target for combined therapies aimed at synergistically inducing apoptosis in bladder cancer.

  5. Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

    PubMed Central

    2012-01-01

    Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

  6. 20-Hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body.

    PubMed

    Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

    2013-08-01

    Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcR (DN) ) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body.

  7. 20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body

    PubMed Central

    Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

    2013-01-01

    Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061

  8. Time-controllable Nkcc1 knockdown replicates reversible hearing loss in postnatal mice.

    PubMed

    Watabe, Takahisa; Xu, Ming; Watanabe, Miho; Nabekura, Junichi; Higuchi, Taiga; Hori, Karin; Sato, Mitsuo P; Nin, Fumiaki; Hibino, Hiroshi; Ogawa, Kaoru; Masuda, Masatsugu; Tanaka, Kenji F

    2017-10-19

    Identification of the causal effects of specific proteins on recurrent and partially reversible hearing loss has been difficult because of the lack of an animal model that provides reversible gene knockdown. We have developed the transgenic mouse line Actin-tTS::Nkcc1 tetO/tetO for manipulatable expression of the cochlear K + circulation protein, NKCC1. Nkcc1 transcription was blocked by the binding of a tetracycline-dependent transcriptional silencer to the tetracycline operator sequences inserted upstream of the Nkcc1 translation initiation site. Administration of the tetracycline derivative doxycycline reversibly regulated Nkcc1 knockdown. Progeny from pregnant/lactating mothers fed doxycycline-free chow from embryonic day 0 showed strong suppression of Nkcc1 expression (~90% downregulation) and Nkcc1 null phenotypes at postnatal day 35 (P35). P35 transgenic mice from mothers fed doxycycline-free chow starting at P0 (delivery) showed weaker suppression of Nkcc1 expression (~70% downregulation) and less hearing loss with mild cochlear structural changes. Treatment of these mice at P35 with doxycycline for 2 weeks reactivated Nkcc1 transcription to control levels and improved hearing level at high frequency; i.e., these doxycycline-treated mice exhibited partially reversible hearing loss. Thus, development of the Actin-tTS::Nkcc1 tetO/tetO transgenic mouse line provides a mouse model for the study of variable hearing loss through reversible knockdown of Nkcc1.

  9. Mitochondrial aquaporin-8 knockdown in human hepatoma HepG2 cells causes ROS-induced mitochondrial depolarization and loss of viability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchissio, Maria Julia; Francés, Daniel Eleazar Antonio; Carnovale, Cristina Ester

    Human aquaporin-8 (AQP8) channels facilitate the diffusional transport of H{sub 2}O{sub 2} across membranes. Since AQP8 is expressed in hepatic inner mitochondrial membranes, we studied whether mitochondrial AQP8 (mtAQP8) knockdown in human hepatoma HepG2 cells impairs mitochondrial H{sub 2}O{sub 2} release, which may lead to organelle dysfunction and cell death. We confirmed AQP8 expression in HepG2 inner mitochondrial membranes and found that 72 h after cell transfection with siRNAs targeting two different regions of the human AQP8 molecule, mtAQP8 protein specifically decreased by around 60% (p < 0.05). Studies in isolated mtAQP8-knockdown mitochondria showed that H{sub 2}O{sub 2} release, assessedmore » by Amplex Red, was reduced by about 45% (p < 0.05), an effect not observed in digitonin-permeabilized mitochondria. mtAQP8-knockdown cells showed an increase in mitochondrial ROS, assessed by dichlorodihydrofluorescein diacetate (+ 120%, p < 0.05) and loss of mitochondrial membrane potential (− 80%, p < 0.05), assessed by tetramethylrhodamine-coupled quantitative fluorescence microscopy. The mitochondria-targeted antioxidant MitoTempol prevented ROS accumulation and dissipation of mitochondrial membrane potential. Cyclosporin A, a mitochondrial permeability transition pore blocker, also abolished the mtAQP8 knockdown-induced mitochondrial depolarization. Besides, the loss of viability in mtAQP8 knockdown cells verified by MTT assay, LDH leakage, and trypan blue exclusion test could be prevented by cyclosporin A. Our data on human hepatoma HepG2 cells suggest that mtAQP8 facilitates mitochondrial H{sub 2}O{sub 2} release and that its defective expression causes ROS-induced mitochondrial depolarization via the mitochondrial permeability transition mechanism, and cell death. -- Highlights: ► Aquaporin-8 is expressed in mitochondria of human hepatoma HepG2 cells. ► Aquaporin-8 knockdown impairs mitochondrial H{sub 2}O{sub 2} release and increases ROS.

  10. A de novo X;8 translocation creates a PTK2-THOC2 gene fusion with THOC2 expression knockdown in a patient with psychomotor retardation and congenital cerebellar hypoplasia

    PubMed Central

    Di Gregorio, Eleonora; Bianchi, Federico T.; Schiavi, Alfonso; Chiotto, Alessandra M.A.; Rolando, Marco; di Cantogno, Ludovica Verdun; Grosso, Enrico; Cavalieri, Simona; Calcia, Alessandro; Lacerenza, Daniela; Zuffardi, Orsetta; Retta, Saverio Francesco; Stevanin, Giovanni; Marelli, Cecilia; Durr, Alexandra; Forlani, Sylvie; Chelly, Jamel; Montarolo, Francesca; Tempia, Filippo; Beggs, Hilary E.; Reed, Robin; Squadrone, Stefania; Abete, Maria C.; Brussino, Alessandro; Ventura, Natascia; Di Cunto, Ferdinando; Brusco, Alfredo

    2014-01-01

    We identified a balanced de novo translocation involving chromosomes Xq25 and 8q24 in an eight year-old girl with a non-progressive form of congenital ataxia, cognitive impairment and cerebellar hypoplasia. Breakpoint definition showed that the promoter of the Protein Tyrosine Kinase 2 (PTK2, also known as Focal Adhesion Kinase, FAK) gene on chromosome 8q24.3 is translocated 2 kb upstream of the THO complex subunit 2 (THOC2) gene on chromosome Xq25. PTK2 is a well-known non-receptor tyrosine kinase whereas THOC2 encodes a component of the evolutionarily conserved multiprotein THO complex, involved in mRNA export from nucleus. The translocation generated a sterile fusion transcript under the control of the PTK2 promoter, affecting expression of both PTK2 and THOC2 genes. PTK2 is involved in cell adhesion and, in neurons, plays a role in axonal guidance, and neurite growth and attraction. However, PTK2 haploinsufficiency alone is unlikely to be associated with human disease. Therefore, we studied the role of THOC2 in the CNS using three models: 1) THOC2 ortholog knockout in C. elegans which produced functional defects in specific sensory neurons; 2) Thoc2 knockdown in primary rat hippocampal neurons which increased neurite extension; 3) Thoc2 knockdown in neuronal stem cells (LC1) which increased their in vitro growth rate without modifying apoptosis levels. We suggest that THOC2 can play specific roles in neuronal cells and, possibly in combination with PTK2 reduction, may affect normal neural network formation, leading to cognitive impairment and cerebellar congenital hypoplasia. PMID:23749989

  11. A comparative study of disease genes and drug targets in the human protein interactome

    PubMed Central

    2015-01-01

    Background Disease genes cause or contribute genetically to the development of the most complex diseases. Drugs are the major approaches to treat the complex disease through interacting with their targets. Thus, drug targets are critical for treatment efficacy. However, the interrelationship between the disease genes and drug targets is not clear. Results In this study, we comprehensively compared the network properties of disease genes and drug targets for five major disease categories (cancer, cardiovascular disease, immune system disease, metabolic disease, and nervous system disease). We first collected disease genes from genome-wide association studies (GWAS) for five disease categories and collected their corresponding drugs based on drugs' Anatomical Therapeutic Chemical (ATC) classification. Then, we obtained the drug targets for these five different disease categories. We found that, though the intersections between disease genes and drug targets were small, disease genes were significantly enriched in targets compared to their enrichment in human protein-coding genes. We further compared network properties of the proteins encoded by disease genes and drug targets in human protein-protein interaction networks (interactome). The results showed that the drug targets tended to have higher degree, higher betweenness, and lower clustering coefficient in cancer Furthermore, we observed a clear fraction increase of disease proteins or drug targets in the near neighborhood compared with the randomized genes. Conclusions The study presents the first comprehensive comparison of the disease genes and drug targets in the context of interactome. The results provide some foundational network characteristics for further designing computational strategies to predict novel drug targets and drug repurposing. PMID:25861037

  12. A comparative study of disease genes and drug targets in the human protein interactome.

    PubMed

    Sun, Jingchun; Zhu, Kevin; Zheng, W; Xu, Hua

    2015-01-01

    Disease genes cause or contribute genetically to the development of the most complex diseases. Drugs are the major approaches to treat the complex disease through interacting with their targets. Thus, drug targets are critical for treatment efficacy. However, the interrelationship between the disease genes and drug targets is not clear. In this study, we comprehensively compared the network properties of disease genes and drug targets for five major disease categories (cancer, cardiovascular disease, immune system disease, metabolic disease, and nervous system disease). We first collected disease genes from genome-wide association studies (GWAS) for five disease categories and collected their corresponding drugs based on drugs' Anatomical Therapeutic Chemical (ATC) classification. Then, we obtained the drug targets for these five different disease categories. We found that, though the intersections between disease genes and drug targets were small, disease genes were significantly enriched in targets compared to their enrichment in human protein-coding genes. We further compared network properties of the proteins encoded by disease genes and drug targets in human protein-protein interaction networks (interactome). The results showed that the drug targets tended to have higher degree, higher betweenness, and lower clustering coefficient in cancer Furthermore, we observed a clear fraction increase of disease proteins or drug targets in the near neighborhood compared with the randomized genes. The study presents the first comprehensive comparison of the disease genes and drug targets in the context of interactome. The results provide some foundational network characteristics for further designing computational strategies to predict novel drug targets and drug repurposing.

  13. A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis

    PubMed Central

    Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor

    2014-01-01

    BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552

  14. An RNA Origami Octahedron with Intrinsic siRNAs for Potent Gene Knockdown.

    PubMed

    Høiberg, Hans Christian; Sparvath, Steffen M; Andersen, Veronica L; Kjems, Jørgen; Andersen, Ebbe S

    2018-05-26

    The fields of DNA and RNA nanotechnology have established nucleic acids as valuable building blocks for functional nanodevices with applications in nanomedicine. Here, a simple method for designing and assembling a 3D scaffolded RNA origami wireframe structure with intrinsic functioning small interfering RNAs (siRNAs) embedded is introduced. Uniquely, the method uses an mRNA fragment as scaffold strand, which is folded by sequence-complementarity of nine shorter synthetic strands. High-yield production of the intended 3D structure is verified by transmission electron microscopy (TEM). Production of functional siRNAs is facilitated by incorporating recognition sites for Dicer at selected locations in the structure, and efficient silencing of a target reporter gene is demonstrated. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Fe3O4 Nanoparticles in Targeted Drug/Gene Delivery Systems

    PubMed Central

    Shen, Lazhen; Li, Bei; Qiao, Yongsheng

    2018-01-01

    Fe3O4 nanoparticles (NPs), the most traditional magnetic nanoparticles, have received a great deal of attention in the biomedical field, especially for targeted drug/gene delivery systems, due to their outstanding magnetism, biocompatibility, lower toxicity, biodegradability, and other features. Naked Fe3O4 NPs are easy to aggregate and oxidize, and thus are often made with various coatings to realize superior properties for targeted drug/gene delivery. In this review, we first list the three commonly utilized synthesis methods of Fe3O4 NPs, and their advantages and disadvantages. In the second part, we describe coating materials that exhibit noticeable features that allow functionalization of Fe3O4 NPs and summarize their methods of drug targeting/gene delivery. Then our efforts will be devoted to the research status and progress of several different functionalized Fe3O4 NP delivery systems loaded with chemotherapeutic agents, and we present targeted gene transitive carriers in detail. In the following section, we illuminate the most effective treatment systems of the combined drug and gene therapy. Finally, we propose opportunities and challenges of the clinical transformation of Fe3O4 NPs targeting drug/gene delivery systems. PMID:29473914

  16. Knockdown of Lmo7 inhibits chick myogenesis.

    PubMed

    Possidonio, Ana C B; Soares, Carolina P; Fontenele, Marcio; Morris, Eduardo R; Mouly, Vincent; Costa, Manoel L; Mermelstein, Claudia

    2016-02-01

    The multifunctional protein Lmo7 has been implicated in some aspects of myogenesis in mammals. Here we studied the distribution and expression of Lmo7 and the effects of Lmo7 knockdown in primary cultures of chick skeletal muscle cells. Lmo7 was localized within the nuclei of myoblasts and at the perinuclear region of myotubes. Knockdown of Lmo7 using siRNA specific to chick reduces the number and width of myotubes and the number of MyoD positive-myoblasts. Both Wnt3a enriched medium and Bio, activators of the Wnt/beta-catenin pathway, could rescue the effects of the Lmo7 knockdown suggesting a crosstalk between the Wnt/beta-catenin and Lmo7-mediated signaling pathways. Our data shows a role of Lmo7 during the initial events of chick skeletal myogenesis, particularly in myoblast survival. © 2016 Federation of European Biochemical Societies.

  17. Bacteriophages and medical oncology: targeted gene therapy of cancer.

    PubMed

    Bakhshinejad, Babak; Karimi, Marzieh; Sadeghizadeh, Majid

    2014-08-01

    Targeted gene therapy of cancer is of paramount importance in medical oncology. Bacteriophages, viruses that specifically infect bacterial cells, offer a variety of potential applications in biomedicine. Their genetic flexibility to go under a variety of surface modifications serves as a basis for phage display methodology. These surface manipulations allow bacteriophages to be exploited for targeted delivery of therapeutic genes. Moreover, the excellent safety profile of these viruses paves the way for their potential use as cancer gene therapy platforms. The merge of phage display and combinatorial technology has led to the emergence of phage libraries turning phage display into a high throughput technology. Random peptide libraries, as one of the most frequently used phage libraries, provide a rich source of clinically useful peptide ligands. Peptides are known as a promising category of pharmaceutical agents in medical oncology that present advantages such as inexpensive synthesis, efficient tissue penetration and the lack of immunogenicity. Phage peptide libraries can be screened, through biopanning, against various targets including cancer cells and tissues that results in obtaining cancer-homing ligands. Cancer-specific peptides isolated from phage libraries show huge promise to be utilized for targeting of various gene therapy vectors towards malignant cells. Beyond doubt, bacteriophages will play a more impressive role in the future of medical oncology.

  18. Protein Arginine Methyltransferase 7 Regulates Cellular Response to DNA Damage by Methylating Promoter Histones H2A and H4 of the Polymerase δ Catalytic Subunit Gene, POLD1*

    PubMed Central

    Karkhanis, Vrajesh; Wang, Li; Tae, Sookil; Hu, Yu-Jie; Imbalzano, Anthony N.; Sif, Saïd

    2012-01-01

    Covalent modification of histones by protein arginine methyltransferases (PRMTs) impacts genome organization and gene expression. In this report, we show that PRMT7 interacts with the BRG1-based hSWI/SNF chromatin remodeling complex and specifically methylates histone H2A Arg-3 (H2AR3) and histone H4 Arg-3 (H4R3). To elucidate the biological function of PRMT7, we knocked down its expression in NIH 3T3 cells and analyzed global gene expression. Our findings show that PRMT7 negatively regulates expression of genes involved in DNA repair, including ALKBH5, APEX2, POLD1, and POLD2. Chromatin immunoprecipitation (ChIP) revealed that PRMT7 and dimethylated H2AR3 and H4R3 are enriched at target DNA repair genes in parental cells, whereas PRMT7 knockdown caused a significant decrease in PRMT7 recruitment and H2AR3/H4R3 methylation. Decreased PRMT7 expression also resulted in derepression of target DNA repair genes and enhanced cell resistance to DNA-damaging agents. Furthermore, we show that BRG1 co-localizes with PRMT7 on target promoters and that expression of a catalytically inactive form of BRG1 results in derepression of PRMT7 target DNA repair genes. Remarkably, reducing expression of individual PRMT7 target DNA repair genes showed that only the catalytic subunit of DNA polymerase, POLD1, was able to resensitize PRMT7 knock-down cells to DNA-damaging agents. These results provide evidence for the important role played by PRMT7 in epigenetic regulation of DNA repair genes and cellular response to DNA damage. PMID:22761421

  19. Protein arginine methyltransferase 7 regulates cellular response to DNA damage by methylating promoter histones H2A and H4 of the polymerase δ catalytic subunit gene, POLD1.

    PubMed

    Karkhanis, Vrajesh; Wang, Li; Tae, Sookil; Hu, Yu-Jie; Imbalzano, Anthony N; Sif, Saïd

    2012-08-24

    Covalent modification of histones by protein arginine methyltransferases (PRMTs) impacts genome organization and gene expression. In this report, we show that PRMT7 interacts with the BRG1-based hSWI/SNF chromatin remodeling complex and specifically methylates histone H2A Arg-3 (H2AR3) and histone H4 Arg-3 (H4R3). To elucidate the biological function of PRMT7, we knocked down its expression in NIH 3T3 cells and analyzed global gene expression. Our findings show that PRMT7 negatively regulates expression of genes involved in DNA repair, including ALKBH5, APEX2, POLD1, and POLD2. Chromatin immunoprecipitation (ChIP) revealed that PRMT7 and dimethylated H2AR3 and H4R3 are enriched at target DNA repair genes in parental cells, whereas PRMT7 knockdown caused a significant decrease in PRMT7 recruitment and H2AR3/H4R3 methylation. Decreased PRMT7 expression also resulted in derepression of target DNA repair genes and enhanced cell resistance to DNA-damaging agents. Furthermore, we show that BRG1 co-localizes with PRMT7 on target promoters and that expression of a catalytically inactive form of BRG1 results in derepression of PRMT7 target DNA repair genes. Remarkably, reducing expression of individual PRMT7 target DNA repair genes showed that only the catalytic subunit of DNA polymerase, POLD1, was able to resensitize PRMT7 knock-down cells to DNA-damaging agents. These results provide evidence for the important role played by PRMT7 in epigenetic regulation of DNA repair genes and cellular response to DNA damage.

  20. A targeted resequencing gene panel for focal epilepsy.

    PubMed

    Hildebrand, Michael S; Myers, Candace T; Carvill, Gemma L; Regan, Brigid M; Damiano, John A; Mullen, Saul A; Newton, Mark R; Nair, Umesh; Gazina, Elena V; Milligan, Carol J; Reid, Christopher A; Petrou, Steven; Scheffer, Ingrid E; Berkovic, Samuel F; Mefford, Heather C

    2016-04-26

    We report development of a targeted resequencing gene panel for focal epilepsy, the most prevalent phenotypic group of the epilepsies. The targeted resequencing gene panel was designed using molecular inversion probe (MIP) capture technology and sequenced using massively parallel Illumina sequencing. We demonstrated proof of principle that mutations can be detected in 4 previously genotyped focal epilepsy cases. We searched for both germline and somatic mutations in 251 patients with unsolved sporadic or familial focal epilepsy and identified 11 novel or very rare missense variants in 5 different genes: CHRNA4, GRIN2B, KCNT1, PCDH19, and SCN1A. Of these, 2 were predicted to be pathogenic or likely pathogenic, explaining ∼0.8% of the cohort, and 8 were of uncertain significance based on available data. We have developed and validated a targeted resequencing panel for focal epilepsies, the most important clinical class of epilepsies, accounting for about 60% of all cases. Our application of MIP technology is an innovative approach that will be advantageous in the clinical setting because it is highly sensitive, efficient, and cost-effective for screening large patient cohorts. Our findings indicate that mutations in known genes likely explain only a small proportion of focal epilepsy cases. This is not surprising given the established clinical and genetic heterogeneity of these disorders and underscores the importance of further gene discovery studies in this complex syndrome. © 2016 American Academy of Neurology.

  1. Targeted Exome Sequencing of Krebs Cycle Genes Reveals Candidate Cancer-Predisposing Mutations in Pheochromocytomas and Paragangliomas.

    PubMed

    Remacha, Laura; Comino-Méndez, Iñaki; Richter, Susan; Contreras, Laura; Currás-Freixes, María; Pita, Guillermo; Letón, Rocío; Galarreta, Antonio; Torres-Pérez, Rafael; Honrado, Emiliano; Jiménez, Scherezade; Maestre, Lorena; Moran, Sebastian; Esteller, Manel; Satrústegui, Jorgina; Eisenhofer, Graeme; Robledo, Mercedes; Cascón, Alberto

    2017-10-15

    Purpose: Mutations in Krebs cycle genes are frequently found in patients with pheochromocytomas/paragangliomas. Disruption of SDH, FH or MDH2 enzymatic activities lead to accumulation of specific metabolites, which give rise to epigenetic changes in the genome that cause a characteristic hypermethylated phenotype. Tumors showing this phenotype, but no alterations in the known predisposing genes, could harbor mutations in other Krebs cycle genes. Experimental Design: We used downregulation and methylation of RBP1, as a marker of a hypermethylation phenotype, to select eleven pheochromocytomas and paragangliomas for targeted exome sequencing of a panel of Krebs cycle-related genes. Methylation profiling, metabolite assessment and additional analyses were also performed in selected cases. Results: One of the 11 tumors was found to carry a known cancer-predisposing somatic mutation in IDH1 A variant in GOT2 , c.357A>T, found in a patient with multiple tumors, was associated with higher tumor mRNA and protein expression levels, increased GOT2 enzymatic activity in lymphoblastic cells, and altered metabolite ratios both in tumors and in GOT2 knockdown HeLa cells transfected with the variant. Array methylation-based analysis uncovered a somatic epigenetic mutation in SDHC in a patient with multiple pheochromocytomas and a gastrointestinal stromal tumor. Finally, a truncating germline IDH3B mutation was found in a patient with a single paraganglioma showing an altered α-ketoglutarate/isocitrate ratio. Conclusions: This study further attests to the relevance of the Krebs cycle in the development of PCC and PGL, and points to a potential role of other metabolic enzymes involved in metabolite exchange between mitochondria and cytosol. Clin Cancer Res; 23(20); 6315-24. ©2017 AACR . ©2017 American Association for Cancer Research.

  2. A system for the measurement of gene targeting efficiency in human cell lines using an antibiotic resistance-GFP fusion gene.

    PubMed

    Konishi, Yuko; Karnan, Sivasundaram; Takahashi, Miyuki; Ota, Akinobu; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2012-09-01

    Gene targeting in a broad range of human somatic cell lines has been hampered by inefficient homologous recombination. To improve this technology and facilitate its widespread application, it is critical to first have a robust and efficient research system for measuring gene targeting efficiency. Here, using a fusion gene consisting of hygromycin B phosphotransferase and 3'-truncated enhanced GFP (HygR-5' EGFP) as a reporter gene, we created a molecular system monitoring the ratio of homologous to random integration (H/R ratio) of targeting vectors into the genome. Cell clones transduced with a reporter vector containing HygR-5' EGFP were efficiently established from two human somatic cell lines. Established HygR-5' EGFP reporter clones retained their capacity to monitor gene targeting efficiency for a longer duration than a conventional reporter system using an unfused 5' EGFP gene. With the HygR-5' EGFP reporter system, we reproduced previous findings of gene targeting frequency being up-regulated by the use of an adeno-associated viral (AAV) backbone, a promoter-trap system, or a longer homology arm in a targeting vector, suggesting that this system accurately monitors H/R ratio. Thus, our HygR-5' EGFP reporter system will assist in the development of an efficient AAV-based gene targeting technology.

  3. Immuno-Oncology-The Translational Runway for Gene Therapy: Gene Therapeutics to Address Multiple Immune Targets.

    PubMed

    Weß, Ludger; Schnieders, Frank

    2017-12-01

    Cancer therapy is once again experiencing a paradigm shift. This shift is based on extensive clinical experience demonstrating that cancer cannot be successfully fought by addressing only single targets or pathways. Even the combination of several neo-antigens in cancer vaccines is not sufficient for successful, lasting tumor eradication. The focus has therefore shifted to the immune system's role in cancer and the striking abilities of cancer cells to manipulate and/or deactivate the immune system. Researchers and pharma companies have started to target the processes and cells known to support immune surveillance and the elimination of tumor cells. Immune processes, however, require novel concepts beyond the traditional "single-target-single drug" paradigm and need parallel targeting of diverse cells and mechanisms. This review gives a perspective on the role of gene therapy technologies in the evolving immuno-oncology space and identifies gene therapy as a major driver in the development and regulation of effective cancer immunotherapy. Present challenges and breakthroughs ranging from chimeric antigen receptor T-cell therapy, gene-modified oncolytic viruses, combination cancer vaccines, to RNA therapeutics are spotlighted. Gene therapy is recognized as the most prominent technology enabling effective immuno-oncology strategies.

  4. Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

    PubMed

    Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

    2011-08-23

    Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

  5. Predicting essential genes for identifying potential drug targets in Aspergillus fumigatus.

    PubMed

    Lu, Yao; Deng, Jingyuan; Rhodes, Judith C; Lu, Hui; Lu, Long Jason

    2014-06-01

    Aspergillus fumigatus (Af) is a ubiquitous and opportunistic pathogen capable of causing acute, invasive pulmonary disease in susceptible hosts. Despite current therapeutic options, mortality associated with invasive Af infections remains unacceptably high, increasing 357% since 1980. Therefore, there is an urgent need for the development of novel therapeutic strategies, including more efficacious drugs acting on new targets. Thus, as noted in a recent review, "the identification of essential genes in fungi represents a crucial step in the development of new antifungal drugs". Expanding the target space by rapidly identifying new essential genes has thus been described as "the most important task of genomics-based target validation". In previous research, we were the first to show that essential gene annotation can be reliably transferred between distantly related four Prokaryotic species. In this study, we extend our machine learning approach to the much more complex Eukaryotic fungal species. A compendium of essential genes is predicted in Af by transferring known essential gene annotations from another filamentous fungus Neurospora crassa. This approach predicts essential genes by integrating diverse types of intrinsic and context-dependent genomic features encoded in microbial genomes. The predicted essential datasets contained 1674 genes. We validated our results by comparing our predictions with known essential genes in Af, comparing our predictions with those predicted by homology mapping, and conducting conditional expressed alleles. We applied several layers of filters and selected a set of potential drug targets from the predicted essential genes. Finally, we have conducted wet lab knockout experiments to verify our predictions, which further validates the accuracy and wide applicability of the machine learning approach. The approach presented here significantly extended our ability to predict essential genes beyond orthologs and made it possible to

  6. Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

    PubMed

    Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

    2018-06-01

    The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Seamless Genome Editing in Rice via Gene Targeting and Precise Marker Elimination.

    PubMed

    Nishizawa-Yokoi, Ayako; Saika, Hiroaki; Toki, Seiichi

    2016-01-01

    Positive-negative selection using hygromycin phosphotransferase (hpt) and diphtheria toxin A-fragment (DT-A) as positive and negative selection markers, respectively, allows enrichment of cells harboring target genes modified via gene targeting (GT). We have developed a successful GT system employing positive-negative selection and subsequent precise marker excision via the piggyBac transposon derived from the cabbage looper moth to introduce desired modifications into target genes in the rice genome. This approach could be applied to the precision genome editing of almost all endogenous genes throughout the genome, at least in rice.

  8. Feedback regulation of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 via ATM/Chk2 pathway contributes to the resistance of MCF-7 breast cancer cells to cisplatin.

    PubMed

    Lv, Juan; Qian, Ying; Ni, Xiaoyan; Xu, Xiuping; Dong, Xuejun

    2017-03-01

    The methyl methanesulfonate and ultraviolet-sensitive gene clone 81 protein is a structure-specific nuclease that plays important roles in DNA replication and repair. Knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 has been found to sensitize cancer cells to chemotherapy. However, the underlying molecular mechanism is not well understood. We found that methyl methanesulfonate and ultraviolet-sensitive gene clone 81 was upregulated and the ATM/Chk2 pathway was activated at the same time when MCF-7 cells were treated with cisplatin. By using lentivirus targeting methyl methanesulfonate and ultraviolet-sensitive gene clone 81 gene, we showed that knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 enhanced cell apoptosis and inhibited cell proliferation in MCF-7 cells under cisplatin treatment. Abrogation of ATM/Chk2 pathway inhibited cell viability in MCF-7 cells in response to cisplatin. Importantly, we revealed that ATM/Chk2 was required for the upregulation of methyl methanesulfonate and ultraviolet-sensitive gene clone 81, and knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 resulted in inactivation of ATM/Chk2 pathway in response to cisplatin. Meanwhile, knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 activated the p53/Bcl-2 pathway in response to cisplatin. These data suggest that the ATM/Chk2 may promote the repair of DNA damage caused by cisplatin by sustaining methyl methanesulfonate and ultraviolet-sensitive gene clone 81, and the double-strand breaks generated by methyl methanesulfonate and ultraviolet-sensitive gene clone 81 may activate the ATM/Chk2 pathway in turn, which provide a novel mechanism of how methyl methanesulfonate and ultraviolet-sensitive gene clone 81 modulates DNA damage response and repair.

  9. Cancer cell-selective promoter recognition accompanies antitumor effect by glucocorticoid receptor-targeted gold nanoparticle

    NASA Astrophysics Data System (ADS)

    Sau, Samaresh; Agarwalla, Pritha; Mukherjee, Sudip; Bag, Indira; Sreedhar, Bojja; Pal-Bhadra, Manika; Patra, Chitta Ranjan; Banerjee, Rajkumar

    2014-05-01

    Nanoparticles, such as gold nanoparticles (GNP), upon convenient modifications perform multi tasks catering to many biomedical applications. However, GNP or any other type of nanoparticles is yet to achieve the feat of intracellular regulation of endogenous genes of choice such as through manipulation of a gene-promoter in a chromosome. As for gene modulation and delivery, GNP (or other nanoparticles) showed only limited gene therapy potential, which relied on the delivery of `exogenous' genes invoking gene knockdown or replacement. Practically, there are no instances for the nanoparticle-mediated promoter regulation of `endogenous' genes, more so, as a cancer selective phenomenon. In this regard, we report the development of a simple, easily modifiable GNP-formulation, which promoted/up-regulated the expression of a specific category of `endogenous' genes, the glucocorticoid responsive genes. This genetic up-regulation was induced in only cancer cells by modified GNP-mediated transcriptional activation of its cytoplasmic receptor, glucocorticoid receptor (GR). Normal cells and their GR remained primarily unperturbed by this GNP-formulation. The most potent gene up-regulating GNP-formulation down-regulated a cancer-specific proliferative signal, phospho-Akt in cancer cells, which accompanied retardation of tumor growth in the murine melanoma model. We show that GR-targeted GNPs may find potential use in the targeting and modulation of genetic information in cancer towards developing novel anticancer therapeutics.Nanoparticles, such as gold nanoparticles (GNP), upon convenient modifications perform multi tasks catering to many biomedical applications. However, GNP or any other type of nanoparticles is yet to achieve the feat of intracellular regulation of endogenous genes of choice such as through manipulation of a gene-promoter in a chromosome. As for gene modulation and delivery, GNP (or other nanoparticles) showed only limited gene therapy potential, which relied

  10. PRKC-ζ Expression Promotes the Aggressive Phenotype of Human Prostate Cancer Cells and Is a Novel Target for Therapeutic Intervention

    PubMed Central

    Yao, Sheng; Bee, Alix; Brewer, Daniel; Dodson, Andrew; Beesley, Carol; Ke, Youqiang; Ambroisine, Laurence; Fisher, Gabrielle; Møller, Heinrich; Dickinson, Tim; Gerard, Patricia; Lian, Lu-Yu; Risk, Janet; Lane, Brian; Smith, Paul; Reuter, Victor; Berney, Daniel; Gosden, Christine; Scardino, Peter; Cuzick, Jack; Djamgoz, Mustafa B.A.; Cooper, Colin; Foster, Christopher S.

    2010-01-01

    We show protein kinase C–zeta (PKC-ζ) to be a novel predictive biomarker for survival from prostate cancer (P < 0.001). We also confirm that transcription of the PRKC-ζ gene is crucial to the malignant phenotype of human prostate cancer. Following siRNA silencing of PRKC-ζ in PC3-M prostate cancer cells, stable transfectant cell line si-PRKC-ζ-PC3-MT1-6 is phenotypically nonmalignant in vitro and in vivo. Genome-wide expression analysis identified 373 genes to be differentially expressed in the knockdown cells and 4 key gene networks to be significantly perturbed during phenotype modulation. Functional interconnection between some of the modulated genes is revealed, although these may be within different regulatory pathways, emphasizing the complexity of their mutual interdependence. Genes with altered expression following PRKC-ζ knockdown include HSPB1, RAD51, and ID1 that we have previously described to be critical in prostatic malignancy. Because expression of PRKC-ζ is functionally involved in promoting the malignant phenotype, we propose PKC-ζ as a novel and biologically relevant target for therapeutic intervention in prostate cancer. PMID:21779455

  11. Polo-like kinase 1, a new therapeutic target in hepatocellular carcinoma

    PubMed Central

    Mok, Wei Chuen; Wasser, Shanthi; Tan, Theresa; Lim, Seng Gee

    2012-01-01

    AIM: To investigate the role of polo-like kinase 1 (PLK1) as a therapeutic target for hepatocellular carcinoma (HCC). METHODS: PLK1 gene expression was evaluated in HCC tissue and HCC cell lines. Gene knockdown with short-interfering RNA (siRNA) was used to study PLK1 gene and protein expression using real-time reverse transcription polymerase chain reaction (RT-PCR) and Western blotting, and cell proliferation using 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2(4-sulfophenyl)-2H-tetrazolium (MTS) and bromodeoxyuridine (BrdU) assays. Apoptosis was evaluated using the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, and caspase-inhibition assay. Huh-7 cells were transplanted into nude mice and co-cultured with PLK1 siRNA or control siRNA, and tumor progression was compared with controls. RESULTS: RT-PCR showed that PLK1 was overexpressed 12-fold in tumor samples compared with controls, and also was overexpressed in Huh-7 cells. siRNA against PLK1 showed a reduction in PLK1 gene and protein expression of up to 96% in Huh-7 cells, and a reduction in cell proliferation by 68% and 92% in MTS and BrdU cell proliferation assays, respectively. There was a 3-fold increase in apoptosis events, and TUNEL staining and caspase-3 assays suggested that this was caspase-independent. The pan-caspase inhibitor Z-VAD-FMK was unable to rescue the apoptotic cells. Immnofluorescence co-localized endonuclease-G to fragmented chromosomes, implicating it in apoptosis. Huh-7 cells transplanted subcutaneously into nude mice showed tumor regression in siPLK1-treated mice, but not in controls. CONCLUSION: Knockdown of PLK1 overexpression in HCC was shown to be a potential therapeutic target, leading to apoptosis through the endonuclease-G pathway. PMID:22826617

  12. Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene.

    PubMed

    Finckbeiner, Steve; Ko, Pin-Joe; Carrington, Blake; Sood, Raman; Gross, Kenneth; Dolnick, Bruce; Sufrin, Janice; Liu, Paul

    2011-09-26

    Despite detailed in vivo knowledge of glycolytic enolases and many bacterial non-enolase members of the superfamily, little is known about the in vivo function of vertebrate non-enolase enolase superfamily members (ENOSF1s). Results of previous studies suggest involvement of the β splice form of ENOSF1 in breast and colon cancers. This study used the zebrafish (Danio rerio) as a vertebrate model of ENOSF1β function. Whole mount in situ hybridization (WISH) showed that zebrafish ENOSF1β (enosf1b) is zygotic and expressed ubiquitously through the first 24 hours post fertilization (hpf). After 24 hpf, enosf1b expression is restricted to the notochord. Embryos injected with enosf1b-EGFP mRNA grew slower than EGFP mRNA-injected embryos but caught up to the EGFP-injected embryos by 48 hpf. Embryos injected with ATG or exon 10 enosf1b mRNA-targeting morpholinos had kinked notochords, shortened anterior-posterior axes, and circulatory edema. WISH for ntl or pax2a expression showed that embryos injected with either morpholino have deformed notochord and pronephros. TUNEL staining revealed increased apoptosis in the peri-notochord region. This study is the first report of ENOSF1 function in a vertebrate and shows that ENOSF1 is required for embryonic development. Increased apoptosis following enosf1b knockdown suggests a potential survival advantage for increased ENOSF1β expression in human cancers.

  13. Transient knockdown and overexpression reveal a developmental role for the zebrafish enosf1b gene

    PubMed Central

    2011-01-01

    Background Despite detailed in vivo knowledge of glycolytic enolases and many bacterial non-enolase members of the superfamily, little is known about the in vivo function of vertebrate non-enolase enolase superfamily members (ENOSF1s). Results of previous studies suggest involvement of the β splice form of ENOSF1 in breast and colon cancers. This study used the zebrafish (Danio rerio) as a vertebrate model of ENOSF1β function. Results Whole mount in situ hybridization (WISH) showed that zebrafish ENOSF1β (enosf1b) is zygotic and expressed ubiquitously through the first 24 hours post fertilization (hpf). After 24 hpf, enosf1b expression is restricted to the notochord. Embryos injected with enosf1b-EGFP mRNA grew slower than EGFP mRNA-injected embryos but caught up to the EGFP-injected embryos by 48 hpf. Embryos injected with ATG or exon 10 enosf1b mRNA-targeting morpholinos had kinked notochords, shortened anterior-posterior axes, and circulatory edema. WISH for ntl or pax2a expression showed that embryos injected with either morpholino have deformed notochord and pronephros. TUNEL staining revealed increased apoptosis in the peri-notochord region. Conclusions This study is the first report of ENOSF1 function in a vertebrate and shows that ENOSF1 is required for embryonic development. Increased apoptosis following enosf1b knockdown suggests a potential survival advantage for increased ENOSF1β expression in human cancers. PMID:21943404

  14. Targeted systemic gene therapy and molecular imaging of cancer contribution of the vascular-targeted AAVP vector.

    PubMed

    Hajitou, Amin

    2010-01-01

    Gene therapy and molecular-genetic imaging have faced a major problem: the lack of an efficient systemic gene delivery vector. Unquestionably, eukaryotic viruses have been the vectors of choice for gene delivery to mammalian cells; however, they have had limited success in systemic gene therapy. This is mainly due to undesired uptake by the liver and reticuloendothelial system, broad tropism for mammalian cells causing toxicity, and their immunogenicity. On the other hand, prokaryotic viruses such as bacteriophage (phage) have no tropism for mammalian cells, but can be engineered to deliver genes to these cells. However, phage-based vectors have inherently been considered poor vectors for mammalian cells. We have reported a new generation of vascular-targeted systemic hybrid prokaryotic-eukaryotic vectors as chimeras between an adeno-associated virus (AAV) and targeted bacteriophage (termed AAV/phage; AAVP). In this hybrid vector, the targeted bacteriophage serves as a shuttle to deliver the AAV transgene cassette inserted in an intergenomic region of the phage DNA genome. As a proof of concept, we assessed the in vivo efficacy of vector in animal models of cancer by displaying on the phage capsid the cyclic Arg-Gly-Asp (RGD-4C) ligand that binds to alphav integrin receptors specifically expressed on the angiogenic blood vessels of tumors. The ligand-directed vector was able to specifically deliver imaging and therapeutic transgenes to tumors in mice, rats, and dogs while sparing the normal organs. This chapter reviews some gene transfer strategies and the potential of the vascular-targeted AAVP vector for enhancing the effectiveness of existing systemic gene delivery and genetic-imaging technologies. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  15. STAT3 Target Genes Relevant to Human Cancers

    PubMed Central

    Carpenter, Richard L.; Lo, Hui-Wen

    2014-01-01

    Since its discovery, the STAT3 transcription factor has been extensively studied for its function as a transcriptional regulator and its role as a mediator of development, normal physiology, and pathology of many diseases, including cancers. These efforts have uncovered an array of genes that can be positively and negatively regulated by STAT3, alone and in cooperation with other transcription factors. Through regulating gene expression, STAT3 has been demonstrated to play a pivotal role in many cellular processes including oncogenesis, tumor growth and progression, and stemness. Interestingly, recent studies suggest that STAT3 may behave as a tumor suppressor by activating expression of genes known to inhibit tumorigenesis. Additional evidence suggested that STAT3 may elicit opposing effects depending on cellular context and tumor types. These mixed results signify the need for a deeper understanding of STAT3, including its upstream regulators, parallel transcription co-regulators, and downstream target genes. To help facilitate fulfilling this unmet need, this review will be primarily focused on STAT3 downstream target genes that have been validated to associate with tumorigenesis and/or malignant biology of human cancers. PMID:24743777

  16. Magnetic nanoparticles for targeted therapeutic gene delivery and magnetic-inducing heating on hepatoma

    NASA Astrophysics Data System (ADS)

    Yuan, Chenyan; An, Yanli; Zhang, Jia; Li, Hongbo; Zhang, Hao; Wang, Ling; Zhang, Dongsheng

    2014-08-01

    Gene therapy holds great promise for treating cancers, but their clinical applications are being hampered due to uncontrolled gene delivery and expression. To develop a targeted, safe and efficient tumor therapy system, we constructed a tissue-specific suicide gene delivery system by using magnetic nanoparticles (MNPs) as carriers for the combination of gene therapy and hyperthermia on hepatoma. The suicide gene was hepatoma-targeted and hypoxia-enhanced, and the MNPs possessed the ability to elevate temperature to the effective range for tumor hyperthermia as imposed on an alternating magnetic field (AMF). The tumoricidal effects of targeted gene therapy associated with hyperthermia were evaluated in vitro and in vivo. The experiment demonstrated that hyperthermia combined with a targeted gene therapy system proffer an effective tool for tumor therapy with high selectivity and the synergistic effect of hepatoma suppression.

  17. Intraperitoneal AAV9-shRNA inhibits target expression in neonatal skeletal and cardiac muscles.

    PubMed

    Mayra, Azat; Tomimitsu, Hiroyuki; Kubodera, Takayuki; Kobayashi, Masaki; Piao, Wenying; Sunaga, Fumiko; Hirai, Yukihiko; Shimada, Takashi; Mizusawa, Hidehiro; Yokota, Takanori

    2011-02-11

    Systemic injections of AAV vectors generally transduce to the liver more effectively than to cardiac and skeletal muscles. The short hairpin RNA (shRNA)-expressing AAV9 (shRNA-AAV9) can also reduce target gene expression in the liver, but not enough in cardiac or skeletal muscles. Higher doses of shRNA-AAV9 required for inhibiting target genes in cardiac and skeletal muscles often results in shRNA-related toxicity including microRNA oversaturation that can induce fetal liver failure. In this study, we injected high-dose shRNA-AAV9 to neonates and efficiently silenced genes in cardiac and skeletal muscles without inducing liver toxicity. This is because AAV is most likely diluted or degraded in the liver than in cardiac or skeletal muscle during cell division after birth. We report that this systemically injected shRNA-AAV method does not induce any major side effects, such as liver dysfunction, and the dose of shRNA-AAV is sufficient for gene silencing in skeletal and cardiac muscle tissues. This novel method may be useful for generating gene knockdown in skeletal and cardiac mouse tissues, thus providing mouse models useful for analyzing diseases caused by loss-of-function of target genes. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Knockdown of SLC41A1 magnesium transporter promotes mineralization and attenuates magnesium inhibition during osteogenesis of mesenchymal stromal cells.

    PubMed

    Tsao, Yu-Tzu; Shih, Ya-Yi; Liu, Yu-An; Liu, Yi-Shiuan; Lee, Oscar K

    2017-02-21

    Magnesium is essential for numerous physiological functions. Magnesium exists mostly in bone and the amount is dynamically regulated by skeletal remodeling. Accelerating bone mass loss occurs when magnesium intake is insufficient; whereas high magnesium could lead to mineralization defects. However, the underlying magnesium regulatory mechanisms remain elusive. In the present study, we investigated the effects of high extracellular magnesium concentration on osteogenic differentiation of mesenchymal stromal/stem cells (MSCs) and the role of magnesium transporter SLC41A1 in the mineralization process. Murine MSCs derived from the bone marrow of BALB/c mouse or commercially purchased human MSCs were treated with osteogenic induction medium containing 5.8 mM magnesium chloride and the osteogenic differentiation efficiency was compared with that of MSCs in normal differentiation medium containing 0.8 mM magnesium chloride by cell morphology, gene expression profile of osteogenic markers, and Alizarin Red staining. Slc41a1 gene knockdown in MSCs was performed by siRNA transfection using Lipofectamine RNAiMAX, and the differentiation efficiency of siRNA-treated MSCs was also assessed. High concentration of extracellular magnesium ion inhibited mineralization during osteogenic differentiation of MSCs. Early osteogenic marker genes including osterix, alkaline phosphatase, and type I collagen were significantly downregulated in MSCs under high concentration of magnesium, whereas late marker genes such as osteopontin, osteocalcin, and bone morphogenetic protein 2 were upregulated with statistical significance compared with those in normal differentiation medium containing 0.8 mM magnesium. siRNA treatment targeting SLC41A1 magnesium transporter, a member of the solute carrier family with a predominant Mg 2+ efflux system, accelerated the mineralization process and ameliorated the inhibition of mineralization caused by high concentration of magnesium. High concentration of

  19. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

    PubMed Central

    McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

  20. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

    PubMed

    Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

  1. Genetic Validation of Aminoacyl-tRNA Synthetases as Drug Targets in Trypanosoma brucei

    PubMed Central

    Kalidas, Savitha; Cestari, Igor; Monnerat, Severine; Li, Qiong; Regmi, Sandesh; Hasle, Nicholas; Labaied, Mehdi; Parsons, Marilyn; Stuart, Kenneth

    2014-01-01

    Human African trypanosomiasis (HAT) is an important public health threat in sub-Saharan Africa. Current drugs are unsatisfactory, and new drugs are being sought. Few validated enzyme targets are available to support drug discovery efforts, so our goal was to obtain essentiality data on genes with proven utility as drug targets. Aminoacyl-tRNA synthetases (aaRSs) are known drug targets for bacterial and fungal pathogens and are required for protein synthesis. Here we survey the essentiality of eight Trypanosoma brucei aaRSs by RNA interference (RNAi) gene expression knockdown, covering an enzyme from each major aaRS class: valyl-tRNA synthetase (ValRS) (class Ia), tryptophanyl-tRNA synthetase (TrpRS-1) (class Ib), arginyl-tRNA synthetase (ArgRS) (class Ic), glutamyl-tRNA synthetase (GluRS) (class 1c), threonyl-tRNA synthetase (ThrRS) (class IIa), asparaginyl-tRNA synthetase (AsnRS) (class IIb), and phenylalanyl-tRNA synthetase (α and β) (PheRS) (class IIc). Knockdown of mRNA encoding these enzymes in T. brucei mammalian stage parasites showed that all were essential for parasite growth and survival in vitro. The reduced expression resulted in growth, morphological, cell cycle, and DNA content abnormalities. ThrRS was characterized in greater detail, showing that the purified recombinant enzyme displayed ThrRS activity and that the protein localized to both the cytosol and mitochondrion. Borrelidin, a known inhibitor of ThrRS, was an inhibitor of T. brucei ThrRS and showed antitrypanosomal activity. The data show that aaRSs are essential for T. brucei survival and are likely to be excellent targets for drug discovery efforts. PMID:24562907

  2. Acute multi-sgRNA knockdown of KEOPS complex genes reproduces the microcephaly phenotype of the stable knockout zebrafish model

    PubMed Central

    Schneider, Ronen; Hoogstraten, Charlotte A.; Schapiro, David; Majmundar, Amar J.; Kolb, Amy; Eddy, Kaitlyn; Shril, Shirlee; Braun, Daniela A.; Poduri, Annapurna

    2018-01-01

    Until recently, morpholino oligonucleotides have been widely employed in zebrafish as an acute and efficient loss-of-function assay. However, off-target effects and reproducibility issues when compared to stable knockout lines have compromised their further use. Here we employed an acute CRISPR/Cas approach using multiple single guide RNAs targeting simultaneously different positions in two exemplar genes (osgep or tprkb) to increase the likelihood of generating mutations on both alleles in the injected F0 generation and to achieve a similar effect as morpholinos but with the reproducibility of stable lines. This multi single guide RNA approach resulted in median likelihoods for at least one mutation on each allele of >99% and sgRNA specific insertion/deletion profiles as revealed by deep-sequencing. Immunoblot showed a significant reduction for Osgep and Tprkb proteins. For both genes, the acute multi-sgRNA knockout recapitulated the microcephaly phenotype and reduction in survival that we observed previously in stable knockout lines, though milder in the acute multi-sgRNA knockout. Finally, we quantify the degree of mutagenesis by deep sequencing, and provide a mathematical model to quantitate the chance for a biallelic loss-of-function mutation. Our findings can be generalized to acute and stable CRISPR/Cas targeting for any zebrafish gene of interest. PMID:29346415

  3. Acute multi-sgRNA knockdown of KEOPS complex genes reproduces the microcephaly phenotype of the stable knockout zebrafish model.

    PubMed

    Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Schneider, Ronen; Hoogstraten, Charlotte A; Ullmann, Jeremy F P; Schapiro, David; Majmundar, Amar J; Kolb, Amy; Eddy, Kaitlyn; Shril, Shirlee; Braun, Daniela A; Poduri, Annapurna; Hildebrandt, Friedhelm

    2018-01-01

    Until recently, morpholino oligonucleotides have been widely employed in zebrafish as an acute and efficient loss-of-function assay. However, off-target effects and reproducibility issues when compared to stable knockout lines have compromised their further use. Here we employed an acute CRISPR/Cas approach using multiple single guide RNAs targeting simultaneously different positions in two exemplar genes (osgep or tprkb) to increase the likelihood of generating mutations on both alleles in the injected F0 generation and to achieve a similar effect as morpholinos but with the reproducibility of stable lines. This multi single guide RNA approach resulted in median likelihoods for at least one mutation on each allele of >99% and sgRNA specific insertion/deletion profiles as revealed by deep-sequencing. Immunoblot showed a significant reduction for Osgep and Tprkb proteins. For both genes, the acute multi-sgRNA knockout recapitulated the microcephaly phenotype and reduction in survival that we observed previously in stable knockout lines, though milder in the acute multi-sgRNA knockout. Finally, we quantify the degree of mutagenesis by deep sequencing, and provide a mathematical model to quantitate the chance for a biallelic loss-of-function mutation. Our findings can be generalized to acute and stable CRISPR/Cas targeting for any zebrafish gene of interest.

  4. ZEB1 knockdown mediated using polypeptide cationic micelles inhibits metastasis and effects sensitization to a chemotherapeutic drug for cancer therapy

    NASA Astrophysics Data System (ADS)

    Fang, Shengtao; Wu, Lei; Li, Mingxing; Yi, Huqiang; Gao, Guanhui; Sheng, Zonghai; Gong, Ping; Ma, Yifan; Cai, Lintao

    2014-08-01

    Metastasis and drug resistance are the main causes for the failure in clinical cancer therapy. Emerging evidence suggests an intricate role of epithelial-mesenchymal transition (EMT) and cancer stem cells (CSCs) in metastasis and drug resistance. The EMT-activator ZEB1 is crucial in malignant tumor progression by linking EMT-activation and stemness-maintenance. Here, we used multifunctional polypeptide micelle nanoparticles (NP) as nanocarriers for the delivery of ZEB1 siRNA and doxorubicin (DOX). The nanocarriers could effectively deliver siRNA to the cytoplasm and knockdown the target gene in H460 cells and H460 xenograft tumors, leading to reduced EMT and repressed CSC properties in vitro and in vivo. The complex micelle nanoparticles with ZEB1 siRNA (siRNA-NP) significantly reduced metastasis in the lung. When DOX and siRNA were co-delivered by the nanocarriers (siRNA-DOX-NP), a synergistic therapeutic effect was observed, resulting in dramatic inhibition of tumor growth in a H460 xenograft model. These results demonstrated that the siRNA-NP or siRNA-DOX-NP complex targeting ZEB1 could be developed into a new therapeutic approach for non-small cell lung cancer (NSCLC) treatment.Metastasis and drug resistance are the main causes for the failure in clinical cancer therapy. Emerging evidence suggests an intricate role of epithelial-mesenchymal transition (EMT) and cancer stem cells (CSCs) in metastasis and drug resistance. The EMT-activator ZEB1 is crucial in malignant tumor progression by linking EMT-activation and stemness-maintenance. Here, we used multifunctional polypeptide micelle nanoparticles (NP) as nanocarriers for the delivery of ZEB1 siRNA and doxorubicin (DOX). The nanocarriers could effectively deliver siRNA to the cytoplasm and knockdown the target gene in H460 cells and H460 xenograft tumors, leading to reduced EMT and repressed CSC properties in vitro and in vivo. The complex micelle nanoparticles with ZEB1 siRNA (siRNA-NP) significantly reduced

  5. Study of the Role of siRNA Mediated Promoter Methylation in DNMT3B Knockdown and Alteration of Promoter Methylation of CDH1, GSTP1 Genes in MDA-MB -453 Cell Line.

    PubMed

    Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas

    2017-01-01

    Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.

  6. Identification of Genes Potentially Regulated by Human Polynucleotide Phosphorylase (hPNPaseold-35) Using Melanoma as a Model

    PubMed Central

    Sokhi, Upneet K.; Bacolod, Manny D.; Dasgupta, Santanu; Emdad, Luni; Das, Swadesh K.; Dumur, Catherine I.; Miles, Michael F.; Sarkar, Devanand; Fisher, Paul B.

    2013-01-01

    Human Polynucleotide Phosphorylase (hPNPaseold-35 or PNPT1) is an evolutionarily conserved 3′→5′ exoribonuclease implicated in the regulation of numerous physiological processes including maintenance of mitochondrial homeostasis, mtRNA import and aging-associated inflammation. From an RNase perspective, little is known about the RNA or miRNA species it targets for degradation or whose expression it regulates; except for c-myc and miR-221. To further elucidate the functional implications of hPNPaseold-35 in cellular physiology, we knocked-down and overexpressed hPNPaseold-35 in human melanoma cells and performed gene expression analyses to identify differentially expressed transcripts. Ingenuity Pathway Analysis indicated that knockdown of hPNPaseold-35 resulted in significant gene expression changes associated with mitochondrial dysfunction and cholesterol biosynthesis; whereas overexpression of hPNPaseold-35 caused global changes in cell-cycle related functions. Additionally, comparative gene expression analyses between our hPNPaseold-35 knockdown and overexpression datasets allowed us to identify 77 potential “direct” and 61 potential “indirect” targets of hPNPaseold-35 which formed correlated networks enriched for cell-cycle and wound healing functional association, respectively. These results provide a comprehensive database of genes responsive to hPNPaseold-35 expression levels; along with the identification new potential candidate genes offering fresh insight into cellular pathways regulated by PNPT1 and which may be used in the future for possible therapeutic intervention in mitochondrial- or inflammation-associated disease phenotypes. PMID:24143183

  7. Histidine-rich stabilized polyplexes for cMet-directed tumor-targeted gene transfer

    NASA Astrophysics Data System (ADS)

    Kos, Petra; Lächelt, Ulrich; Herrmann, Annika; Mickler, Frauke Martina; Döblinger, Markus; He, Dongsheng; Krhač Levačić, Ana; Morys, Stephan; Bräuchle, Christoph; Wagner, Ernst

    2015-03-01

    Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing terminal cysteines for redox-sensitive polyplex stabilization, were assembled by solid-phase supported syntheses. The resulting oligomers exhibited a greatly enhanced cellular uptake and gene transfer over non-targeted control sequences, confirming the efficacy and target-specificity of the formed polyplexes. Implementation of endosomal escape-promoting histidines in the cationic core was required for gene expression without additional endosomolytic agent. The histidine-enriched polyplexes demonstrated stability in serum as well as receptor-specific gene transfer in vivo upon intratumoral injection. The co-formulation with an analogous PEG-free cationic oligomer led to a further compaction of pDNA polyplexes with an obvious change of shape as demonstrated by transmission electron microscopy. Such compaction was critically required for efficient intravenous gene delivery which resulted in greatly enhanced, cMBP2 ligand-dependent gene expression in the distant tumor.Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing

  8. Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.

    PubMed

    Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut

    2015-09-30

    The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

  9. Neurobiology of autism gene products: towards pathogenesis and drug targets.

    PubMed

    Kleijer, Kristel T E; Schmeisser, Michael J; Krueger, Dilja D; Boeckers, Tobias M; Scheiffele, Peter; Bourgeron, Thomas; Brose, Nils; Burbach, J Peter H

    2014-03-01

    The genetic heterogeneity of autism spectrum disorders (ASDs) is enormous, and the neurobiology of proteins encoded by genes associated with ASD is very diverse. Revealing the mechanisms on which different neurobiological pathways in ASD pathogenesis converge may lead to the identification of drug targets. The main objective is firstly to outline the main molecular networks and neuronal mechanisms in which ASD gene products participate and secondly to answer the question how these converge. Finally, we aim to pinpoint drug targets within these mechanisms. Literature review of the neurobiological properties of ASD gene products with a special focus on the developmental consequences of genetic defects and the possibility to reverse these by genetic or pharmacological interventions. The regulation of activity-dependent protein synthesis appears central in the pathogenesis of ASD. Through sequential consequences for axodendritic function, neuronal disabilities arise expressed as behavioral abnormalities and autistic symptoms in ASD patients. Several known ASD gene products have their effect on this central process by affecting protein synthesis intrinsically, e.g., through enhancing the mammalian target of rapamycin (mTOR) signal transduction pathway or through impairing synaptic function in general. These are interrelated processes and can be targeted by compounds from various directions: inhibition of protein synthesis through Lovastatin, mTOR inhibition using rapamycin, or mGluR-related modulation of synaptic activity. ASD gene products may all feed into a central process of translational control that is important for adequate glutamatergic regulation of dendritic properties. This process can be modulated by available compounds but may also be targeted by yet unexplored routes.

  10. Single molecule targeted sequencing for cancer gene mutation detection.

    PubMed

    Gao, Yan; Deng, Liwei; Yan, Qin; Gao, Yongqian; Wu, Zengding; Cai, Jinsen; Ji, Daorui; Li, Gailing; Wu, Ping; Jin, Huan; Zhao, Luyang; Liu, Song; Ge, Liangjin; Deem, Michael W; He, Jiankui

    2016-05-19

    With the rapid decline in cost of sequencing, it is now affordable to examine multiple genes in a single disease-targeted clinical test using next generation sequencing. Current targeted sequencing methods require a separate step of targeted capture enrichment during sample preparation before sequencing. Although there are fast sample preparation methods available in market, the library preparation process is still relatively complicated for physicians to use routinely. Here, we introduced an amplification-free Single Molecule Targeted Sequencing (SMTS) technology, which combined targeted capture and sequencing in one step. We demonstrated that this technology can detect low-frequency mutations using artificially synthesized DNA sample. SMTS has several potential advantages, including simple sample preparation thus no biases and errors are introduced by PCR reaction. SMTS has the potential to be an easy and quick sequencing technology for clinical diagnosis such as cancer gene mutation detection, infectious disease detection, inherited condition screening and noninvasive prenatal diagnosis.

  11. Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

    PubMed

    Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

    2016-09-12

    Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

  12. Analyses of interactions among pair-rule genes and the gap gene Krüppel in Bombyx segmentation.

    PubMed

    Nakao, Hajime

    2015-09-01

    In the short-germ insect Tribolium, a pair-rule gene circuit consisting of the Tribolium homologs of even-skipped, runt, and odd-skipped (Tc-eve, Tc-run and Tc-odd, respectively) has been implicated in segment formation. To examine the application of the model to other taxa, I studied the expression and function of pair-rule genes in Bombyx mori, together with a Bombyx homolog of Krüppel (Bm-Kr), a known gap gene. Knockdown embryos of Bombyx homologs of eve, run and odd (Bm-eve, Bm-run and Bm-odd) exhibited asegmental phenotypes similar to those of Tribolium knockdowns. However, pair-rule gene interactions were similar to those of both Tribolium and Drosophila, which, different from Tribolium, shows a hierarchical segmentation mode. Additionally, the Bm-odd expression pattern shares characteristics with those of Drosophila pair-rule genes that receive upstream regulatory input. On the other hand, Bm-Kr knockdowns exhibited a large posterior segment deletion as observed in short-germ insects. However, a detailed analysis of these embryos indicated that Bm-Kr modulates expression of pair-rule genes like in Drosophila, although the mechanisms appear to be different. This suggested hierarchical interactions between Bm-Kr and pair-rule genes. Based on these results, I concluded that the pair-rule gene circuit model that describes Tribolium development is not applicable to Bombyx. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. SPARC (secreted protein acidic and rich in cysteine) knockdown protects mice from acute liver injury by reducing vascular endothelial cell damage

    PubMed Central

    Peixoto, E; Atorrasagasti, C; Aquino, JB; Militello, R; Bayo, J; Fiore, E; Piccioni, F; Salvatierra, E; Alaniz, L; García, MG; Bataller, R; Corrales, F; Gidekel, M; Podhajcer, O; Colombo, MI; Mazzolini, G

    2015-01-01

    Secreted protein, acidic and rich in cysteine (SPARC) is involved in many biological process including liver fibrogenesis, but its role in acute liver damage is unknown. To examine the role of SPARC in acute liver injury, we used SPARC knock-out (SPARC−/−) mice. Two models of acute liver damage were used: concanavalin A (Con A) and the agonistic anti-CD95 antibody Jo2. SPARC expression levels were analyzed in liver samples from patients with acute-on-chronic alcoholic hepatitis (AH). SPARC expression is increased on acute-on-chronic AH patients. Knockdown of SPARC decreased hepatic damage in the two models of liver injury. SPARC−/− mice showed a marked reduction in Con A-induced necroinflammation. Infiltration by CD4+ T cells, expression of tumor necrosis factor-α and interleukin-6 and apoptosis were attenuated in SPARC−/− mice. Sinusoidal endothelial cell monolayer was preserved and was less activated in Con A-treated SPARC−/− mice. SPARC knockdown reduced Con A-induced autophagy of cultured human microvascular endothelial cells (HMEC-1). Hepatic transcriptome analysis revealed several gene networks that may have a role in the attenuated liver damaged found in Con A-treated SPARC−/− mice. SPARC has a significant role in the development of Con A-induced severe liver injury. These results suggest that SPARC could represent a therapeutic target in acute liver injury. PMID:25410742

  14. Production of Prnp-/- goats by gene targeting in adult fibroblasts.

    PubMed

    Zhu, Caihong; Li, Bei; Yu, Guohua; Chen, Jianquan; Yu, Huiqing; Chen, Juan; Xu, Xujun; Wu, Youbing; Zhang, Aimin; Cheng, Guoxiang

    2009-04-01

    Homozygous mice devoid of functional Prnp are resistant to scrapie and prion propagation, but heterozygous mice for Prnp disruption still suffer from prion disease and prion deposition. We have previously generated heterozygous cloned goats with one allele of Prnp functional disruption. To obtain goats with both alleles of Prnp be disrupted which would be resistant to scrapie completely, a second-round gene targeting was applied to disrupt the wild type allele of Prnp in the heterozygous goats. By second-round gene targeting, we successfully disrupted the wild type allele of Prnp in primary Prnp (+/-) goat skin fibroblasts and obtained a Prnp (-/-) cell line without Prnp expression. This is the first report on successful targeting modification in primary adult somatic cells of animals. These cells were used as nuclear donors for somatic cell cloning to produce Prnp (-/-) goats. A total of 57 morulae or blastocytes developed from the reconstructed embryos were transferred to 31 recipients, which produced 7 pregnancies at day 35. At 73 days of gestation, we obtained one cloned fetus with Prnp (-/-) genotype. Our research not only indicated that multiple genetic modifications could be accomplished by multi-round gene targeting in primary somatic cells, but also provided strong evidence that gene targeting in adult cells other than fetal cells could be applied to introduce precise genetic modifications in animals without destroying the embryos.

  15. Knockdown of peroxiredoxin V increases glutamate‑induced apoptosis in HT22 hippocampal neuron cells.

    PubMed

    Shen, Gui-Nan; Liu, Lei; Feng, Li; Jin, Yu; Jin, Mei-Hua; Han, Ying-Hao; Jin, Cheng-Hao; Jin, Yong-Zhe; Lee, Dong-Soek; Kwon, Tae Ho; Cui, Yu-Dong; Sun, Hu-Nan

    2018-06-01

    High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated the regulatory effect of Prx V on glutamate‑induced effects on viability and apoptosis in HT22 cells. Western blotting was used for protein expression analysis and Annexin V/PI staining and flow cytometry for determination of apoptosis. The results demonstrated that glutamate may ROS‑dependently increase HT22 cell apoptosis and upregulate Prx V protein levels. Furthermore, knockdown of Prx V protein expression with a lentivirus significantly enhanced HT22 cell apoptosis mediated by glutamate, which was reversed by inhibition of ROS with N‑acetyl‑L‑cysteine. Inhibiting the extracellular signal‑regulated kinase (ERK) signaling pathway with PD98059, a specific inhibitor for ERK phosphorylation, markedly decreased glutamate‑induced HT22 cell apoptosis in Prx V knockdown cells, indicating the potential involvement of ERK signaling in glutamate‑induced HT22 cell apoptosis. In addition, an increase in nuclear apoptosis‑inducing factor was observed in Prx V knockdown HT22 cells following glutamate treatment, compared with mock cells, whereas no differences in B‑cell lymphoma‑2 and cleaved‑caspase‑3 protein expression levels were observed between mock and Prx V knockdown cells. The results of the present study indicated that Prx V may have potential as a therapeutic molecular target for glutamate‑induced neuronal cell death and provide novel insight into the role of Prx V in oxidative‑stress induced neuronal cell death.

  16. Lifespan and reproduction in brain-specific miR-29-knockdown mouse.

    PubMed

    Takeda, Toru; Tanabe, Hiroyuki

    2016-03-18

    The microRNA miR-29 is widely distributed and highly expressed in adult mouse brain during the mouse's lifetime. We recently created conditional mutant mice whose miR-29 was brain-specifically knocked down through overexpression of an antisense RNA transgene against miR-29. To explore a role for brain miR-29 in maximizing organismal fitness, we assessed somatic growth, reproduction, and lifespan in the miR-29-knockdown (KD) mice and their wild-type (WT) littermates. The KD mice were developmentally indistinguishable from WT mice with respect to gross morphology and physical activity. Fertility testing revealed that KD males were subfertile, whereas KD females were hyperfertile, only in terms of reproductive success, when compared to their gender-matched WT correspondents. Another phenotypic difference between KD and WT animals appeared in their lifespan data; KD males displayed an overall increasing tendency in post-reproductive survival relative to WT males. In contrast, KD females were prone to shorter lifespans than WT females. These results clarify that brain-targeted miR-29 knockdown affects both lifespan and reproduction in a gender-dependent manner, and moreover that the reciprocal responsiveness to the miR-29 knockdown between these two phenotypes in both genders closely follow life-course models based on the classical trade-off prediction wherein elaborate early-life energetic investment in reproduction entails accelerated late-life declines in survival, and vice versa. Thus, this study identified miR-29 as the first mammalian miRNA that is directly implicated in the lifetime trade-off between the two major fitness components, lifespan and reproduction. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia.

    PubMed

    Hamid, Penny Humaidah; Prastowo, Joko; Widyasari, Anis; Taubert, Anja; Hermosilla, Carlos

    2017-06-05

    Aedes aegypti is the main vector of several arthropod-borne viral infections in the tropics profoundly affecting humans, such as dengue fever (DF), West Nile (WN), chikungunya and more recently Zika. Eradication of Aedes still largely depends on insecticides, which is the most cost-effective strategy, and often inefficient due to resistance development in exposed Aedes populations. We here conducted a study of Ae. aegypti resistance towards several insecticides regularly used in the city of Denpasar, Bali, Indonesia. Aedes aegypti egg samples were collected with ovitraps and thereafter hatched in the insectary of the Gadjah Mada University. The F0 generation was used for all bioassay-related experiments and knockdown resistance (kdr) assays. Results clearly showed resistance development of Ae. aegypti against tested insecticides. Mortalities of Ae. aegypti were less than 90% with highest resistance observed against 0.75% permethrin. Mosquitoes from the southern parts of Denpasar presented high level of resistance pattern in comparison to those from the western and northern parts of Denpasar. Kdr analysis of voltage-gated sodium channel (Vgsc) gene showed significant association to S989P and V1016G mutations linked to resistance phenotypes against 0.75% permethrin. Conversely, Ae. aegypti F1534C gene mutation did not result in any significant correlation to resistance development. Periodically surveillance of insecticide resistances in Ae. aegypti mosquitoes will help local public health authorities to set better goals and allow proper evaluation of on-going mosquito control strategies. Initial detection of insecticide resistance will contribute to conduct proper actions in delaying mosquito resistance development such as insecticide rotation or combination of compounds in order to prolong chemical efficacy in combating Ae. aegypti vectors in Indonesia.

  18. Knockdown of angiopoietin-like 2 mimics the benefits of intermittent fasting on insulin responsiveness and weight loss.

    PubMed

    Martel, Cécile; Pinçon, Anthony; Bélanger, Alexandre Maxime; Luo, Xiaoyan; Gillis, Marc-Antoine; de Montgolfier, Olivia; Thorin-Trescases, Nathalie; Thorin, Éric

    2018-01-01

    Angiopoietin-like 2 (ANGPTL2) is an inflammatory adipokine linking obesity to insulin resistance. Intermittent fasting, on the other hand, is a lifestyle intervention able to prevent obesity and diabetes but difficult to implement and maintain. Our objectives were to characterize a link between ANGPTL2 and intermittent fasting and to investigate whether the knockdown of ANGPTL2 reproduces the benefits of intermittent fasting on weight gain and insulin responsiveness in knockdown and wild-type littermates mice. Intermittent fasting, access to food ad libitum once every other day, was initiated at the age of three months and maintained for four months. Intermittent fasting decreased by 63% (p < 0.05) gene expression of angptl2 in adipose tissue of wild-type mice. As expected, intermittent fasting improved insulin sensitivity (p < 0.05) and limited weight gain (p < 0.05) in wild-type mice. Knockdown mice fed ad libitum, however, were comparable to wild-type mice following the intermittent fasting regimen: insulin sensitivity and weight gain were identical, while intermittent fasting had no additional impact on these parameters in knockdown mice. Energy intake was similar between both wild-type fed intermittent fasting and ANGPTL2 knockdown mice fed ad libitum, suggesting that intermittent fasting and knockdown of ANGPTL2 equally lower feeding efficiency. These results suggest that the reduction of ANGPTL2 could be a useful and promising strategy to prevent obesity and insulin resistance, although further investigation of the mechanisms linking ANGPTL2 and intermittent fasting is warranted. Impact statement Intermittent fasting is an efficient diet pattern to prevent weight gain and improve insulin sensitivity. It is, however, a difficult regimen to follow and compliance is expected to be very low. In this work, we demonstrate that knockdown of ANGPTL2 in mice fed ad libitum mimics the beneficial effects of intermittent fasting on weight gain and insulin

  19. Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

    PubMed

    Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

    2015-01-01

    Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

  20. Sirtuin 3, a New Target of PGC-1α, Plays an Important Role in the Suppression of ROS and Mitochondrial Biogenesis

    PubMed Central

    Kong, Xingxing; Wang, Rui; Xue, Yuan; Liu, Xiaojun; Zhang, Huabing; Chen, Yong; Fang, Fude; Chang, Yongsheng

    2010-01-01

    Background Sirtuin 3 (SIRT3) is one of the seven mammalian sirtuins, which are homologs of the yeast Sir2 gene. SIRT3 is the only sirtuin with a reported association with the human life span. Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) plays important roles in adaptive thermogenesis, gluconeogenesis, mitochondrial biogenesis and respiration. PGC-1α induces several key reactive oxygen species (ROS)-detoxifying enzymes, but the molecular mechanism underlying this is not well understood. Results Here we show that PGC-1α strongly stimulated mouse Sirt3 gene expression in muscle cells and hepatocytes. Knockdown of PGC-1α led to decreased Sirt3 gene expression. PGC-1α activated the mouse SIRT3 promoter, which was mediated by an estrogen-related receptor (ERR) binding element (ERRE) (−407/−399) mapped to the promoter region. Chromatin immunoprecipitation and electrophoretic mobility shift assays confirmed that ERRα bound to the identified ERRE and PGC-1α co-localized with ERRα in the mSirt3 promoter. Knockdown of ERRα reduced the induction of Sirt3 by PGC-1α in C2C12 myotubes. Furthermore, Sirt3 was essential for PGC-1α-dependent induction of ROS-detoxifying enzymes and several components of the respiratory chain, including glutathione peroxidase-1, superoxide dismutase 2, ATP synthase 5c, and cytochrome c. Overexpression of SIRT3 or PGC-1α in C2C12 myotubes decreased basal ROS level. In contrast, knockdown of mSIRT3 increased basal ROS level and blocked the inhibitory effect of PGC-1α on cellular ROS production. Finally, SIRT3 stimulated mitochondrial biogenesis, and SIRT3 knockdown decreased the stimulatory effect of PGC-1α on mitochondrial biogenesis in C2C12 myotubes. Conclusion Our results indicate that Sirt3 functions as a downstream target gene of PGC-1α and mediates the PGC-1α effects on cellular ROS production and mitochondrial biogenesis. Thus, SIRT3 integrates cellular energy metabolism and ROS generation. The

  1. Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells.

    PubMed

    Yunoki, Tatsuya; Tabuchi, Yoshiaki; Hayashi, Atsushi; Kondo, Takashi

    2016-07-01

    BCL2-associated athanogene 3 (BAG3), a co-chaperone of the heat shock 70 kDa protein (HSPA) family of proteins, is a cytoprotective protein that acts against various stresses, including heat stress. The aim of the present study was to identify gene networks involved in the enhancement of hyperthermia (HT) sensitivity by the knockdown (KD) of BAG3 in human oral squamous cell carcinoma (OSCC) cells. Although a marked elevation in the protein expression of BAG3 was detected in human the OSCC HSC-3 cells exposed to HT at 44˚C for 90 min, its expression was almost completely suppressed in the cells transfected with small interfering RNA against BAG3 (siBAG) under normal and HT conditions. The silencing of BAG3 also enhanced the cell death that was increased in the HSC-3 cells by exposure to HT. Global gene expression analysis revealed many genes that were differentially expressed by >2-fold in the cells exposed to HT and transfected with siBAG. Moreover, Ingenuity® pathways analysis demonstrated two unique gene networks, designated as Pro-cell death and Anti-cell death, which were obtained from upregulated genes and were mainly associated with the biological functions of induction and the prevention of cell death, respectively. Of note, the expression levels of genes in the Pro-cell death and Anti-cell death gene networks were significantly elevated and reduced in the HT + BAG3-KD group compared to those in the HT control group, respectively. These results provide further insight into the molecular mechanisms involved in the enhancement of HT sensitivity by the silencing of BAG3 in human OSCC cells.

  2. Knockdown of antiapoptotic genes in breast cancer cells by siRNA loaded into hybrid nanoparticles

    NASA Astrophysics Data System (ADS)

    João de Mello, Leônidas, Jr.; Rosa Souza, Gabriela Regina; Winter, Evelyn; Silva, Adny Henrique; Pittella, Frederico; Creczynski-Pasa, Tânia Beatriz

    2017-04-01

    Tumorigenesis is related to an imbalance in controlling mechanisms of apoptosis. Expression of the genes BCL-2 and BCL-xL results in the promotion of cell survival by inhibiting apoptosis. Thus, a novel approach to suppress antiapoptotic genes is the use of small interfering RNA (siRNA) in cancer cells. However, there are some limitations for the application of siRNA such as the need for vectors to pass the cell membrane and deliver the nucleic acid. In this study CaP-siRNA-PEG-polyanion hybrid nanoparticles were developed to promote siRNA delivery to cultured human breast cancer cells (MCF-7) in order to evaluate whether the silencing of antiapoptotic genes BCL-2 and BCL-xL by siRNA would increase cancer cell death. After 48 h of incubation the expression of BCL-2 and BCL-xL genes decreased to 49% and 23%, respectively. The siRNA sequence used induced cancer cell death at a concentration of 200 nM siRNA after 72 h of incubation. As the targeted proteins are related to the resistance to chemotherapeutic drugs, the nanocarriers systems were also tested in the presence of doxorubicin (DOX). The results showed a significant reduction in the CC50 of the DOX, after silencing the antiapoptotic genes. In addition, an increase in apoptotic cell counts for both incubations conditions was observed as well. In conclusion, silencing antiapoptotic genes such as BCL-2 and BCL-xL through the use of siRNA carried by hybrid nanoparticles showed to be effective in vitro, and presents a promising strategy for pre-clinical analysis, especially when combined with DOX against breast cancer.

  3. Identification of STAT target genes in adipocytes

    PubMed Central

    Zhao, Peng; Stephens, Jacqueline M.

    2013-01-01

    Adipocytes play important roles in lipid storage, energy homeostasis and whole body insulin sensitivity. Studies in the last two decades have identified the hormones and cytokines that activate specific STATs in adipocytes in vitro and in vivo. Five of the seven STAT family members are expressed in adipocyte (STATs 1, 3, 5A, 5B and 6). Many transcription factors, including STATs, have been shown to play an important role in adipose tissue development and function. This review will summarize the importance of adipocytes, indicate the cytokines and hormones that utilize the JAK-STAT signaling pathway in fat cells and focus on the identification of STAT target genes in mature adipocytes. To date, specific target genes have been identified for STATs, 1, 5A and 5B, but not for STATs 3 and 6. PMID:24058802

  4. Concerted effects of heterogeneous nuclear ribonucleoprotein C1/C2 to control vitamin D-directed gene transcription and RNA splicing in human bone cells.

    PubMed

    Zhou, Rui; Park, Juw Won; Chun, Rene F; Lisse, Thomas S; Garcia, Alejandro J; Zavala, Kathryn; Sea, Jessica L; Lu, Zhi-Xiang; Xu, Jianzhong; Adams, John S; Xing, Yi; Hewison, Martin

    2017-01-25

    Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH) 2 D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH) 2 D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH) 2 D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH) 2 D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH) 2 D-mediated induction of transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Bioinformatics approaches to predict target genes from transcription factor binding data.

    PubMed

    Essebier, Alexandra; Lamprecht, Marnie; Piper, Michael; Bodén, Mikael

    2017-12-01

    Transcription factors regulate gene expression and play an essential role in development by maintaining proliferative states, driving cellular differentiation and determining cell fate. Transcription factors are capable of regulating multiple genes over potentially long distances making target gene identification challenging. Currently available experimental approaches to detect distal interactions have multiple weaknesses that have motivated the development of computational approaches. Although an improvement over experimental approaches, existing computational approaches are still limited in their application, with different weaknesses depending on the approach. Here, we review computational approaches with a focus on data dependency, cell type specificity and usability. With the aim of identifying transcription factor target genes, we apply available approaches to typical transcription factor experimental datasets. We show that approaches are not always capable of annotating all transcription factor binding sites; binding sites should be treated disparately; and a combination of approaches can increase the biological relevance of the set of genes identified as targets. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    PubMed

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  7. Stable Toll-Like Receptor 10 Knockdown in THP-1 Cells Reduces TLR-Ligand-Induced Proinflammatory Cytokine Expression.

    PubMed

    Le, Hai Van; Kim, Jae Young

    2016-06-01

    Toll-like receptor 10 (TLR10) is the only orphan receptor whose natural ligand and function are unknown among the 10 human TLRs. In this study, to test whether TLR10 recognizes some known TLR ligands, we established a stable TLR10 knockdown human monocytic cell line THP-1 using TLR10 short hairpin RNA lentiviral particle and puromycin selection. Among 60 TLR10 knockdown clones that were derived from each single transduced cell, six clones were randomly selected, and then one of those clones, named E7, was chosen for the functional study. E7 exhibited approximately 50% inhibition of TLR10 mRNA and protein expression. Of all the TLRs, only the expression of TLR10 changed significantly in this cell line. Additionally, phorbol 12-myristate 13-acetate-induced macrophage differentiation of TLR10 knockdown cells was not affected in the knockdown cells. When exposed to TLR ligands, such as synthetic diacylated lipoprotein (FSL-1), lipopolysaccharide (LPS), and flagellin, significant induction of proinflammatory cytokine gene expression including Interleukin-8 (IL-8), Interleukin-1 beta (IL-1β), Tumor necrosis factor-alpha (TNF-α) and Chemokine (C-C Motif) Ligand 20 (CCL20) expression, was found in the control THP-1 cells, whereas the TLR10 knockdown cells exhibited a significant reduction in the expression of IL-8, IL-1β, and CCL20. TNF-α was the only cytokine for which the expression did not decrease in the TLR10 knockdown cells from that measured in the control cells. Analysis of putative binding sites for transcription factors using a binding-site-prediction program revealed that the TNF-α promoter does not have putative binding sites for AP-1 or c-Jun, comprising a major transcription factor along with NF-κB for TLR signaling. Our results suggest that TLR10 is involved in the recognition of FSL-1, LPS, and flagellin and TLR-ligand-induced expression of TNF-α does not depend on TLR10.

  8. Xander: employing a novel method for efficient gene-targeted metagenomic assembly

    DOE PAGES

    Wang, Qiong; Fish, Jordan A.; Gilman, Mariah; ...

    2015-08-05

    Here, metagenomics can provide important insight into microbial communities. However, assembling metagenomic datasets has proven to be computationally challenging. Current methods often assemble only fragmented partial genes. We present a novel method for targeting assembly of specific protein-coding genes. This method combines a de Bruijn graph, as used in standard assembly approaches, and a protein profile hidden Markov model (HMM) for the gene of interest, as used in standard annotation approaches. These are used to create a novel combined weighted assembly graph. Xander performs both assembly and annotation concomitantly using information incorporated in this graph. We demonstrate the utility ofmore » this approach by assembling contigs for one phylogenetic marker gene and for two functional marker genes, first on Human Microbiome Project (HMP)-defined community Illumina data and then on 21 rhizosphere soil metagenomic datasets from three different crops totaling over 800 Gbp of unassembled data. We compared our method to a recently published bulk metagenome assembly method and a recently published gene-targeted assembler and found our method produced more, longer, and higher quality gene sequences. In conclusion, xander combines gene assignment with the rapid assembly of full-length or near full-length functional genes from metagenomic data without requiring bulk assembly or post-processing to find genes of interest. HMMs used for assembly can be tailored to the targeted genes, allowing flexibility to improve annotation over generic annotation pipelines.« less

  9. Xander: employing a novel method for efficient gene-targeted metagenomic assembly.

    PubMed

    Wang, Qiong; Fish, Jordan A; Gilman, Mariah; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

    2015-01-01

    Metagenomics can provide important insight into microbial communities. However, assembling metagenomic datasets has proven to be computationally challenging. Current methods often assemble only fragmented partial genes. We present a novel method for targeting assembly of specific protein-coding genes. This method combines a de Bruijn graph, as used in standard assembly approaches, and a protein profile hidden Markov model (HMM) for the gene of interest, as used in standard annotation approaches. These are used to create a novel combined weighted assembly graph. Xander performs both assembly and annotation concomitantly using information incorporated in this graph. We demonstrate the utility of this approach by assembling contigs for one phylogenetic marker gene and for two functional marker genes, first on Human Microbiome Project (HMP)-defined community Illumina data and then on 21 rhizosphere soil metagenomic datasets from three different crops totaling over 800 Gbp of unassembled data. We compared our method to a recently published bulk metagenome assembly method and a recently published gene-targeted assembler and found our method produced more, longer, and higher quality gene sequences. Xander combines gene assignment with the rapid assembly of full-length or near full-length functional genes from metagenomic data without requiring bulk assembly or post-processing to find genes of interest. HMMs used for assembly can be tailored to the targeted genes, allowing flexibility to improve annotation over generic annotation pipelines. This method is implemented as open source software and is available at https://github.com/rdpstaff/Xander_assembler.

  10. The NSL Complex Regulates Housekeeping Genes in Drosophila

    PubMed Central

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  11. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests.

    PubMed

    Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E

    2018-02-01

    RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.

  12. Innate immunity: Bacterial cell-wall muramyl peptide targets the conserved transcription factor YB-1.

    PubMed

    Laman, A G; Lathe, R; Savinov, G V; Shepelyakovskaya, A O; Boziev, Kh M; Baidakova, L K; Chulin, A N; Brovko, F A; Svirshchevskaya, E V; Kotelevtsev, Y; Eliseeva, I A; Guryanov, S G; Lyabin, D N; Ovchinnikov, L P; Ivanov, V T

    2015-07-08

    The bacterial cell wall muramyl dipeptides MDP and glucosaminyl-MDP (GMDP) are powerful immunostimulators but their binding target remains controversial. We previously reported expression cloning of GMDP-binding polypeptides and identification of Y-box protein 1 (YB-1) as their sole target. Here we show specific binding of GMDP to recombinant YB-1 protein and subcellular colocalization of YB-1 and GMDP. GMDP binding to YB-1 upregulated gene expression levels of NF-κB2, a mediator of innate immunity. Furthermore, YB-1 knockdown abolished GMDP-induced Nfkb2 expression. GMDP/YB-1 stimulation led to NF-κB2 cleavage, transport of activated NF-κB2 p52 to the nucleus, and upregulation of NF-κB2-dependent chemokine Cxcr4 gene expression. Therefore, our findings identify YB-1 as new target for muramyl peptide signaling. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  13. Generation of TALE nickase-mediated gene-targeted cows expressing human serum albumin in mammary glands.

    PubMed

    Luo, Yan; Wang, Yongsheng; Liu, Jun; Cui, Chenchen; Wu, Yongyan; Lan, Hui; Chen, Qi; Liu, Xu; Quan, Fusheng; Guo, Zekun; Zhang, Yong

    2016-02-08

    Targeting exogenous genes at milk protein loci via gene-targeting technology is an ideal strategy for producing large quantities of pharmaceutical proteins. Transcription-activator-like effector (TALE) nucleases (TALENs) are an efficient genome-editing tool. However, the off-target effects may lead to unintended gene mutations. In this study, we constructed TALENs and TALE nickases directed against exon 2 of the bovine β-lactoglobulin (BLG) locus. The nickases can induce a site-specific DNA single-strand break, without inducing double-strand break and nonhomologous end joining mediated gene mutation, and lower cell apoptosis rate than TALENs. After co-transfecting the bovine fetal fibroblasts with human serum albumin (HSA) gene-targeting vector and TALE nickase expression vectors, approximately 4.8% (40/835) of the cell clones contained HSA at BLG locus. Unexpectedly, one homozygous gene-targeted cell clone (1/835, 0.1%) was obtained by targeting both alleles of BLG in a single round of transfection. The recombinant protein mimicking the endogenous BLG was highly expressed and correctly folded in the mammary glands of the targeted cows, and the expression level of HSA was significantly increased in the homozygous targeted cows. Results suggested that the combination of TALE nickase-mediated gene targeting and somatic cell nuclear transfer is a feasible and safe approach in producing gene-targeted livestock.

  14. Self-focusing therapeutic gene delivery with intelligent gene vector swarms: intra-swarm signalling through receptor transgene expression in targeted cells.

    PubMed

    Tolmachov, Oleg E

    2015-01-01

    Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo

  15. EBF factors drive expression of multiple classes of target genes governing neuronal development.

    PubMed

    Green, Yangsook S; Vetter, Monica L

    2011-04-30

    Early B cell factor (EBF) family members are transcription factors known to have important roles in several aspects of vertebrate neurogenesis, including commitment, migration and differentiation. Knowledge of how EBF family members contribute to neurogenesis is limited by a lack of detailed understanding of genes that are transcriptionally regulated by these factors. We performed a microarray screen in Xenopus animal caps to search for targets of EBF transcriptional activity, and identified candidate targets with multiple roles, including transcription factors of several classes. We determined that, among the most upregulated candidate genes with expected neuronal functions, most require EBF activity for some or all of their expression, and most have overlapping expression with ebf genes. We also found that the candidate target genes that had the most strongly overlapping expression patterns with ebf genes were predicted to be direct transcriptional targets of EBF transcriptional activity. The identification of candidate targets that are transcription factor genes, including nscl-1, emx1 and aml1, improves our understanding of how EBF proteins participate in the hierarchy of transcription control during neuronal development, and suggests novel mechanisms by which EBF activity promotes migration and differentiation. Other candidate targets, including pcdh8 and kcnk5, expand our knowledge of the types of terminal differentiated neuronal functions that EBF proteins regulate.

  16. RNA interference in a cestode reveals specific silencing of selected highly expressed gene transcripts.

    PubMed

    Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G

    2010-04-01

    Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for

  17. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.

    PubMed

    Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M

    2015-02-18

    Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Mutations in six nephrosis genes delineate a pathogenic pathway amenable to treatment.

    PubMed

    Ashraf, Shazia; Kudo, Hiroki; Rao, Jia; Kikuchi, Atsuo; Widmeier, Eugen; Lawson, Jennifer A; Tan, Weizhen; Hermle, Tobias; Warejko, Jillian K; Shril, Shirlee; Airik, Merlin; Jobst-Schwan, Tilman; Lovric, Svjetlana; Braun, Daniela A; Gee, Heon Yung; Schapiro, David; Majmundar, Amar J; Sadowski, Carolin E; Pabst, Werner L; Daga, Ankana; van der Ven, Amelie T; Schmidt, Johanna M; Low, Boon Chuan; Gupta, Anjali Bansal; Tripathi, Brajendra K; Wong, Jenny; Campbell, Kirk; Metcalfe, Kay; Schanze, Denny; Niihori, Tetsuya; Kaito, Hiroshi; Nozu, Kandai; Tsukaguchi, Hiroyasu; Tanaka, Ryojiro; Hamahira, Kiyoshi; Kobayashi, Yasuko; Takizawa, Takumi; Funayama, Ryo; Nakayama, Keiko; Aoki, Yoko; Kumagai, Naonori; Iijima, Kazumoto; Fehrenbach, Henry; Kari, Jameela A; El Desoky, Sherif; Jalalah, Sawsan; Bogdanovic, Radovan; Stajić, Nataša; Zappel, Hildegard; Rakhmetova, Assel; Wassmer, Sharon-Rose; Jungraithmayr, Therese; Strehlau, Juergen; Kumar, Aravind Selvin; Bagga, Arvind; Soliman, Neveen A; Mane, Shrikant M; Kaufman, Lewis; Lowy, Douglas R; Jairajpuri, Mohamad A; Lifton, Richard P; Pei, York; Zenker, Martin; Kure, Shigeo; Hildebrandt, Friedhelm

    2018-05-17

    No efficient treatment exists for nephrotic syndrome (NS), a frequent cause of chronic kidney disease. Here we show mutations in six different genes (MAGI2, TNS2, DLC1, CDK20, ITSN1, ITSN2) as causing NS in 17 families with partially treatment-sensitive NS (pTSNS). These proteins interact and we delineate their roles in Rho-like small GTPase (RLSG) activity, and demonstrate deficiency for mutants of pTSNS patients. We find that CDK20 regulates DLC1. Knockdown of MAGI2, DLC1, or CDK20 in cultured podocytes reduces migration rate. Treatment with dexamethasone abolishes RhoA activation by knockdown of DLC1 or CDK20 indicating that steroid treatment in patients with pTSNS and mutations in these genes is mediated by this RLSG module. Furthermore, we discover ITSN1 and ITSN2 as podocytic guanine nucleotide exchange factors for Cdc42. We generate Itsn2-L knockout mice that recapitulate the mild NS phenotype. We, thus, define a functional network of RhoA regulation, thereby revealing potential therapeutic targets.

  19. Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, T; Huang, S; Zhao, XF

    Recent studies indicate that the DNA recognition domain of transcription activator-like (TAL) effectors can be combined with the nuclease domain of FokI restriction enzyme to produce TAL effector nucleases (TALENs) that, in pairs, bind adjacent DNA target sites and produce double-strand breaks between the target sequences, stimulating non-homologous end-joining and homologous recombination. Here, we exploit the four prevalent TAL repeats and their DNA recognition cipher to develop a 'modular assembly' method for rapid production of designer TALENs (dTALENs) that recognize unique DNA sequence up to 23 bases in any gene. We have used this approach to engineer 10 dTALENs tomore » target specific loci in native yeast chromosomal genes. All dTALENs produced high rates of site-specific gene disruptions and created strains with expected mutant phenotypes. Moreover, dTALENs stimulated high rates (up to 34%) of gene replacement by homologous recombination. Finally, dTALENs caused no detectable cytotoxicity and minimal levels of undesired genetic mutations in the treated yeast strains. These studies expand the realm of verified TALEN activity from cultured human cells to an intact eukaryotic organism and suggest that low-cost, highly dependable dTALENs can assume a significant role for gene modifications of value in human and animal health, agriculture and industry.« less

  20. A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

    PubMed

    Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

    2008-04-01

    Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

  1. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing.

    PubMed

    Amabile, Angelo; Migliara, Alessandro; Capasso, Paola; Biffi, Mauro; Cittaro, Davide; Naldini, Luigi; Lombardo, Angelo

    2016-09-22

    Gene silencing is instrumental to interrogate gene function and holds promise for therapeutic applications. Here, we repurpose the endogenous retroviruses' silencing machinery of embryonic stem cells to stably silence three highly expressed genes in somatic cells by epigenetics. This was achieved by transiently expressing combinations of engineered transcriptional repressors that bind to and synergize at the target locus to instruct repressive histone marks and de novo DNA methylation, thus ensuring long-term memory of the repressive epigenetic state. Silencing was highly specific, as shown by genome-wide analyses, sharply confined to the targeted locus without spreading to nearby genes, resistant to activation induced by cytokine stimulation, and relieved only by targeted DNA demethylation. We demonstrate the portability of this technology by multiplex gene silencing, adopting different DNA binding platforms and interrogating thousands of genomic loci in different cell types, including primary T lymphocytes. Targeted epigenome editing might have broad application in research and medicine. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Stable knock-down of the sphingosine 1-phosphate receptor S1P1 influences multiple functions of human endothelial cells.

    PubMed

    Krump-Konvalinkova, Vera; Yasuda, Satoshi; Rubic, Tina; Makarova, Natalia; Mages, Jörg; Erl, Wolfgang; Vosseler, Claudia; Kirkpatrick, C James; Tigyi, Gabor; Siess, Wolfgang

    2005-03-01

    Sphingosine 1-phosphate (S1P) is a bioactive phospholipid acting both as a ligand for the G protein-coupled receptors S1P1-5 and as a second messenger. Because S1P1 knockout is lethal in the transgenic mouse, an alternative approach to study the function of S1P1 in endothelial cells is needed. All human endothelial cells analyzed expressed abundant S1P1 transcripts. We permanently silenced (by RNA interference) the expression of S1P1 in the human endothelial cell lines AS-M.5 and ISO-HAS.1. The S1P1 knock-down cells manifested a distinct morphology and showed neither actin ruffles in response to S1P nor an angiogenic reaction. In addition, these cells were more sensitive to oxidant stress-mediated injury. New S1P1-dependent gene targets were identified in human endothelial cells. S1P1 silencing decreased the expression of platelet-endothelial cell adhesion molecule-1 and VE-cadherin and abolished the induction of E-selectin after cell stimulation with lipopolysaccharide or tumor necrosis factor-alpha. Microarray analysis revealed downregulation of further endothelial specific transcripts after S1P1 silencing. Long-term silencing of S1P1 enabled us for the first time to demonstrate the involvement of S1P1 in key functions of endothelial cells and to identify new S1P1-dependent gene targets.

  3. Knockdown of Fruit Flies by Imidacloprid Nanoaerosol.

    PubMed

    Morozov, Victor N; Kanev, Igor L

    2015-10-20

    This report describes the effects of nanoaerosol particles (NAPs) from imidacloprid (IMI) on fruit flies. NAPs were produced using a newly developed generator which employs electro-hydrodynamic atomization of IMI solution in ethanol. Exposure of Drosophila melanogaster to the IMI NAPs at a concentration of C = 2.7 ± 0.1 ng/cm(3) caused knockdown in half of the flies in T50 = 88 ± 14 min at 22 °C and in T50 = 36 ± 2 min at 33 °C. A number of special experiments precluded IMI volatilization and contact or oral action of IMI upon exposure to the NAPs. It was shown that only the fraction of NAPs in the size range of 7-300 nm is responsible for the knockdown and that dependence of T50 on the NAPs' fraction mass follows Haber's rule, C × T50 = const. Comparison with the oral doses obtained when flies were fed an IMI-sucrose mixture revealed that the inhaled doses that caused knockdown were 2 orders of magnitude lower than the oral ones. This new technology may be used to quickly eliminate insects with nanoaerosols of nonvolatile insecticides in greenhouses and other closed environments.

  4. Knockdown of Cbp/P300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 inhibits cell division and increases apoptosis in gastric cancer.

    PubMed

    Tang, Ze; He, Gan; Xu, Jie; Zhongfu, Li

    2017-05-01

    Cbp/P300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) is a pleiotropic protein associated with numerous cell functions, including transcription and differentiation. The role of CITED2 has been investigated in a number of malignancies; however, the roles of this protein in gastric cancers remain unclear. Therefore, we determined the role of CITED2 in gastric cancers. Gastric cancer cell lines (MKN74, MKN28, 7901, and AGS) were used to assess CITED2 transcript levels. Messenger RNA levels were determined using quantitative polymerase chain reaction. Lentiviral vectors containing CITED2 small interfering RNA were used to knockdown CITED2 expression. Cell proliferation was assessed with fluorescent imaging and 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assays. Apoptosis and cell cycle stages were assessed through flow cytometry, and formation of colonies was determined using a fluorescent microscope. All cell lines tested in this study expressed CITED2. The cell line expressing the highest levels of CITED2 (MKN74) showed significant knockdown of endogenous CITED2 expression on lentiviral infection. Cell proliferation was shown to be lower in CITED2 knockdown MKN74 cells. G1/S-phase cell cycle arrest was observed on silencing of CITED2 in MKN74 cells. A significant increase in apoptosis was observed on CITED2 knock down in MKN74 cells, while colony forming ability was significantly inhibited after knock down of CITED2. CITED2 supports gastric cancer cell colony formation and proliferation while inhibiting apoptosis making it a potential gene therapy target for gastric cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Enhancer connectome in primary human cells identifies target genes of disease-associated DNA elements

    PubMed Central

    Mumbach, Maxwell R; Satpathy, Ansuman T; Boyle, Evan A; Dai, Chao; Gowen, Benjamin G; Cho, Seung Woo; Nguyen, Michelle L; Rubin, Adam J; Granja, Jeffrey M; Kazane, Katelynn R; Wei, Yuning; Nguyen, Trieu; Greenside, Peyton G; Corces, M Ryan; Tycko, Josh; Simeonov, Dimitre R; Suliman, Nabeela; Li, Rui; Xu, Jin; Flynn, Ryan A; Kundaje, Anshul; Khavari, Paul A; Marson, Alexander; Corn, Jacob E; Quertermous, Thomas; Greenleaf, William J; Chang, Howard Y

    2018-01-01

    The challenge of linking intergenic mutations to target genes has limited molecular understanding of human diseases. Here we show that H3K27ac HiChIP generates high-resolution contact maps of active enhancers and target genes in rare primary human T cell subtypes and coronary artery smooth muscle cells. Differentiation of naive T cells into T helper 17 cells or regulatory T cells creates subtype-specific enhancer–promoter interactions, specifically at regions of shared DNA accessibility. These data provide a principled means of assigning molecular functions to autoimmune and cardiovascular disease risk variants, linking hundreds of noncoding variants to putative gene targets. Target genes identified with HiChIP are further supported by CRISPR interference and activation at linked enhancers, by the presence of expression quantitative trait loci, and by allele-specific enhancer loops in patient-derived primary cells. The majority of disease-associated enhancers contact genes beyond the nearest gene in the linear genome, leading to a fourfold increase in the number of potential target genes for autoimmune and cardiovascular diseases. PMID:28945252

  6. PTEN knockdown alters dendritic spine/protrusion morphology, not density

    PubMed Central

    Haws, Michael E.; Jaramillo, Thomas C.; Espinosa-Becerra, Felipe; Widman, Allie; Stuber, Garret D.; Sparta, Dennis R.; Tye, Kay M.; Russo, Scott J.; Parada, Luis F.; Kaplitt, Michael; Bonci, Antonello; Powell, Craig M.

    2014-01-01

    Mutations in phosphatase and tensin homolog deleted on chromosome ten (PTEN) are implicated in neuropsychiatric disorders including autism. Previous studies report that PTEN knockdown in neurons in vivo leads to increased spine density and synaptic activity. To better characterize synaptic changes in neurons lacking PTEN, we examined the effects of shRNA knockdown of PTEN in basolateral amygdala neurons on synaptic spine density and morphology using fluorescent dye confocal imaging. Contrary to previous studies in dentate gyrus, we find that knockdown of PTEN in basolateral amygdala leads to a significant decrease in total spine density in distal dendrites. Curiously, this decreased spine density is associated with increased miniature excitatory post-synaptic current frequency and amplitude, suggesting an increase in number and function of mature spines. These seemingly contradictory findings were reconciled by spine morphology analysis demonstrating increased mushroom spine density and size with correspondingly decreased thin protrusion density at more distal segments. The same analysis of PTEN conditional deletion in dentate gyrus demonstrated that loss of PTEN does not significantly alter total density of dendritic protrusions in the dentate gyrus, but does decrease thin protrusion density and increases density of more mature mushroom spines. These findings suggest that, contrary to previous reports, PTEN knockdown may not induce de novo spinogenesis, but instead may increase synaptic activity by inducing morphological and functional maturation of spines. Furthermore, behavioral analysis of basolateral amygdala PTEN knockdown suggests that these changes limited only to the basolateral amygdala complex may not be sufficient to induce increased anxiety-related behaviors. PMID:24264880

  7. Mining, identification and function analysis of microRNAs and target genes in peanut (Arachis hypogaea L.).

    PubMed

    Zhang, Tingting; Hu, Shuhao; Yan, Caixia; Li, Chunjuan; Zhao, Xiaobo; Wan, Shubo; Shan, Shihua

    2017-02-01

    In the present investigation, a total of 60 conserved peanut (Arachis hypogaea L.) microRNA (miRNA) sequences, belonging to 16 families, were identified using bioinformatics methods. There were 392 target gene sequences, identified from 58 miRNAs with Target-align software and BLASTx analyses. Gene Ontology (GO) functional analysis suggested that these target genes were involved in mediating peanut growth and development, signal transduction and stress resistance. There were 55 miRNA sequences, verified employing a poly (A) tailing test, with a success rate of up to 91.67%. Twenty peanut target gene sequences were randomly selected, and the 5' rapid amplification of the cDNA ends (5'-RACE) method were used to validate the cleavage sites of these target genes. Of these, 14 (70%) peanut miRNA targets were verified by means of gel electrophoresis, cloning and sequencing. Furthermore, functional analysis and homologous sequence retrieval were conducted for target gene sequences, and 26 target genes were chosen as the objects for stress resistance experimental study. Real-time fluorescence quantitative PCR (qRT-PCR) technology was applied to measure the expression level of resistance-associated miRNAs and their target genes in peanut exposed to Aspergillus flavus (A. flavus) infection and drought stress, respectively. In consequence, 5 groups of miRNAs & targets were found accorded with the mode of miRNA negatively controlling the expression of target genes. This study, preliminarily determined the biological functions of some resistance-associated miRNAs and their target genes in peanut. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. A Functional Genomics Approach to Identify Novel Breast Cancer Gene Targets in Yeast

    DTIC Science & Technology

    2004-05-01

    AD Award Number: DAMD17-03-1-0232 TITLE: A Functional Genomics Approach to Identify Novel Breast Cancer Gene Targets in Yeast PRINCIPAL INVESTIGATOR...Approach to Identify Novel Breast DAMD17-03-1-0232 Cancer Gene Targets in Yeast 6. A UTHOR(S) Craig Bennett, Ph.D. 7. PERFORMING ORGANIZA TION NAME(S...Unlimited 13. ABSTRACT (Maximum 200 Words) We are using the yeast Saccharomyces cerevisiae to identify new cancer gene targets that interact with the

  9. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    PubMed

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  10. Tuning Gene Activity by Inducible and Targeted Regulation of Gene Expression in Minimal Bacterial Cells.

    PubMed

    Mariscal, Ana M; Kakizawa, Shigeyuki; Hsu, Jonathan Y; Tanaka, Kazuki; González-González, Luis; Broto, Alicia; Querol, Enrique; Lluch-Senar, Maria; Piñero-Lambea, Carlos; Sun, Lijie; Weyman, Philip D; Wise, Kim S; Merryman, Chuck; Tse, Gavin; Moore, Adam J; Hutchison, Clyde A; Smith, Hamilton O; Tomita, Masaru; Venter, J Craig; Glass, John I; Piñol, Jaume; Suzuki, Yo

    2018-05-22

    Functional genomics studies in minimal mycoplasma cells enable unobstructed access to some of the most fundamental processes in biology. Conventional transposon bombardment and gene knockout approaches often fail to reveal functions of genes that are essential for viability, where lethality precludes phenotypic characterization. Conditional inactivation of genes is effective for characterizing functions central to cell growth and division, but tools are limited for this purpose in mycoplasmas. Here we demonstrate systems for inducible repression of gene expression based on clustered regularly interspaced short palindromic repeats-mediated interference (CRISPRi) in Mycoplasma pneumoniae and synthetic Mycoplasma mycoides, two organisms with reduced genomes actively used in systems biology studies. In the synthetic cell, we also demonstrate inducible gene expression for the first time. Time-course data suggest rapid kinetics and reversible engagement of CRISPRi. Targeting of six selected endogenous genes with this system results in lowered transcript levels or reduced growth rates that agree with lack or shortage of data in previous transposon bombardment studies, and now produces actual cells to analyze. The ksgA gene encodes a methylase that modifies 16S rRNA, rendering it vulnerable to inhibition by the antibiotic kasugamycin. Targeting the ksgA gene with CRISPRi removes the lethal effect of kasugamycin and enables cell growth, thereby establishing specific and effective gene modulation with our system. The facile methods for conditional gene activation and inactivation in mycoplasmas open the door to systematic dissection of genetic programs at the core of cellular life.

  11. Identification and consequences of miRNA-target interactions--beyond repression of gene expression.

    PubMed

    Hausser, Jean; Zavolan, Mihaela

    2014-09-01

    Comparative genomics analyses and high-throughput experimental studies indicate that a microRNA (miRNA) binds to hundreds of sites across the transcriptome. Although the knockout of components of the miRNA biogenesis pathway has profound phenotypic consequences, most predicted miRNA targets undergo small changes at the mRNA and protein levels when the expression of the miRNA is perturbed. Alternatively, miRNAs can establish thresholds in and increase the coherence of the expression of their target genes, as well as reduce the cell-to-cell variability in target gene expression. Here, we review the recent progress in identifying miRNA targets and the emerging paradigms of how miRNAs shape the dynamics of target gene expression.

  12. Gene Therapy Targeting Glaucoma: Where Are We?

    PubMed Central

    Liu, Xuyang; Rasmussen, Carol A.; Gabelt, B’Ann T.; Brandt, Curtis R.; Kaufman, Paul L.

    2010-01-01

    In a chronic disease such as glaucoma, a therapy that provides a long lasting local effect, with minimal systemic side effects, while circumventing the issue of patient compliance, is very attractive. The field of gene therapy is growing rapidly and ocular applications are expanding. Our understanding of the molecular pathogenesis of glaucoma is leading to greater specificity in ocular tissue targeting. Improvements in gene delivery techniques, refinement of vector construction methods, and development of better animal models combine to bring this potential therapy closer to reality. PMID:19539835

  13. A High-Throughput Fluorescence-Based Assay System for Appetite-Regulating Gene and Drug Screening

    PubMed Central

    Shimada, Yasuhito; Hirano, Minoru; Nishimura, Yuhei; Tanaka, Toshio

    2012-01-01

    The increasing number of people suffering from metabolic syndrome and obesity is becoming a serious problem not only in developed countries, but also in developing countries. However, there are few agents currently approved for the treatment of obesity. Those that are available are mainly appetite suppressants and gastrointestinal fat blockers. We have developed a simple and rapid method for the measurement of the feeding volume of Danio rerio (zebrafish). This assay can be used to screen appetite suppressants and enhancers. In this study, zebrafish were fed viable paramecia that were fluorescently-labeled, and feeding volume was measured using a 96-well microplate reader. Gene expression analysis of brain-derived neurotrophic factor (bdnf), knockdown of appetite-regulating genes (neuropeptide Y, preproinsulin, melanocortin 4 receptor, agouti related protein, and cannabinoid receptor 1), and the administration of clinical appetite suppressants (fluoxetine, sibutramine, mazindol, phentermine, and rimonabant) revealed the similarity among mechanisms regulating appetite in zebrafish and mammals. In combination with behavioral analysis, we were able to evaluate adverse effects on locomotor activities from gene knockdown and chemical treatments. In conclusion, we have developed an assay that uses zebrafish, which can be applied to high-throughput screening and target gene discovery for appetite suppressants and enhancers. PMID:23300705

  14. Nanoparticle-mediated knockdown of DNA repair sensitizes cells to radiotherapy and extends survival in a genetic mouse model of glioblastoma.

    PubMed

    Kievit, Forrest M; Wang, Kui; Ozawa, Tatsuya; Tarudji, Aria W; Silber, John R; Holland, Eric C; Ellenbogen, Richard G; Zhang, Miqin

    2017-10-01

    Glioblastoma (GBM) remains incurable, and recurrent tumors rarely respond to standard-of-care radiation and chemo-therapies. Therefore, strategies that enhance the effects of these therapies should provide significant benefits to GBM patients. We have developed a nanoparticle delivery vehicle that can stably bind and protect nucleic acids for specific delivery into brain tumor cells. These nanoparticles can deliver therapeutic siRNAs to sensitize GBM cells to radiotherapy and improve GBM treatment via systemic administration. We show that nanoparticle-mediated knockdown of the DNA repair protein apurinic endonuclease 1 (Ape1) sensitizes GBM cells to radiotherapy and extend survival in a genetic mouse model of GBM. Specific knockdown of Ape1 activity by 30% in brain tumor tissue doubled the extended survival achieved with radiotherapy alone. Ape1 is a promising target for increasing the effectiveness of radiotherapy, and nanoparticle-mediated delivery of siRNA is a promising strategy for tumor specific knockdown of Ape1. Copyright © 2017. Published by Elsevier Inc.

  15. Long non-coding RNA expression profile in Cdk5-knockdown mouse skin.

    PubMed

    Ji, Kaiyuan; Fan, Ruiwen; Zhang, Junzhen; Yang, Shanshan; Dong, Changsheng

    2018-06-08

    To elucidate the Cdk5 regulatory molecular mechanism in skin, we generated Cdk5-knockdown mice and subjected their skins to lncRNA sequencing. The results showed that there were 4533 novel lncRNAs from 142 lncRNA families. In total, 693 lncRNAs were significantly differentially expressed. Alignment analysis of the lncRNAs in miRBase identified 45 pre-mRNAs. By KEGG PATHWAY Database analysis, we found that lncRNAs (lnc-NONMMUT064276.2, lnc-NONMMUT075728.1, and lnc-NONMMUT039653.2) may regulate pigmentation by regulating target genes. To reveal potential antisense lncRNA-mRNA interactions, we searched all lncRNA-mRNA duplexes using RNAplex, and found 97 lncRNAs interacted with mRNAs. The luciferase assay confirmed that TCONS_00049140 binded to Krt80 by the co-transfection of pVAX1-TCONS_00049140 and pGL0-Krt80 expression plasmids in 293T cell, based on the bioinformatics analysis. Overexpression of TCONS_00049140 in mouse melanocytes down-regulated Krt80 and resulted in the phenotype of increased cell proliferation and increased melanin production. The results suggested that TCONS_00049140 contributed to skin thickening through Krt80. Our findings provide a direction for research of the molecular mechanism of Cdk5 function. Copyright © 2017. Published by Elsevier B.V.

  16. Targeting endogenous proteins for degradation through the affinity-directed protein missile system.

    PubMed

    Fulcher, Luke J; Hutchinson, Luke D; Macartney, Thomas J; Turnbull, Craig; Sapkota, Gopal P

    2017-05-01

    Targeted proteolysis of endogenous proteins is desirable as a research toolkit and in therapeutics. CRISPR/Cas9-mediated gene knockouts are irreversible and often not feasible for many genes. Similarly, RNA interference approaches necessitate prolonged treatments, can lead to incomplete knockdowns and are often associated with off-target effects. Targeted proteolysis can overcome these limitations. In this report, we describe an affinity-directed protein missile (AdPROM) system that harbours the von Hippel-Lindau (VHL) protein, the substrate receptor of the Cullin2 (CUL2) E3 ligase complex, tethered to polypeptide binders that selectively bind and recruit endogenous target proteins to the CUL2-E3 ligase complex for ubiquitination and proteasomal degradation. By using synthetic monobodies that selectively bind the protein tyrosine phosphatase SHP2 and a camelid-derived VHH nanobody that selectively binds the human ASC protein, we demonstrate highly efficient AdPROM-mediated degradation of endogenous SHP2 and ASC in human cell lines. We show that AdPROM-mediated loss of SHP2 in cells impacts SHP2 biology. This study demonstrates for the first time that small polypeptide binders that selectively recognize endogenous target proteins can be exploited for AdPROM-mediated destruction of the target proteins. © 2017 The Authors.

  17. Targeting endogenous proteins for degradation through the affinity-directed protein missile system

    PubMed Central

    Fulcher, Luke J.; Hutchinson, Luke D.; Macartney, Thomas J.; Turnbull, Craig

    2017-01-01

    Targeted proteolysis of endogenous proteins is desirable as a research toolkit and in therapeutics. CRISPR/Cas9-mediated gene knockouts are irreversible and often not feasible for many genes. Similarly, RNA interference approaches necessitate prolonged treatments, can lead to incomplete knockdowns and are often associated with off-target effects. Targeted proteolysis can overcome these limitations. In this report, we describe an affinity-directed protein missile (AdPROM) system that harbours the von Hippel–Lindau (VHL) protein, the substrate receptor of the Cullin2 (CUL2) E3 ligase complex, tethered to polypeptide binders that selectively bind and recruit endogenous target proteins to the CUL2-E3 ligase complex for ubiquitination and proteasomal degradation. By using synthetic monobodies that selectively bind the protein tyrosine phosphatase SHP2 and a camelid-derived VHH nanobody that selectively binds the human ASC protein, we demonstrate highly efficient AdPROM-mediated degradation of endogenous SHP2 and ASC in human cell lines. We show that AdPROM-mediated loss of SHP2 in cells impacts SHP2 biology. This study demonstrates for the first time that small polypeptide binders that selectively recognize endogenous target proteins can be exploited for AdPROM-mediated destruction of the target proteins. PMID:28490657

  18. Identification of downstream metastasis-associated target genes regulated by LSD1 in colon cancer cells.

    PubMed

    Chen, Jiang; Ding, Jie; Wang, Ziwei; Zhu, Jian; Wang, Xuejian; Du, Jiyi

    2017-03-21

    This study aims to identify downstream target genes regulated by lysine-specific demethylase 1 (LSD1) in colon cancer cells and investigate the molecular mechanisms of LSD1 influencing invasion and metastasis of colon cancer. We obtained the expression changes of downstream target genes regulated by small-interfering RNA-LSD1 and LSD1-overexpression via gene expression profiling in two human colon cancer cell lines. An Affymetrix Human Transcriptome Array 2.0 was used to identify differentially expressed genes (DEGs). We screened out LSD1-target gene associated with proliferation, metastasis, and invasion from DEGs via Gene Ontology and Pathway Studio. Subsequently, four key genes (CABYR, FOXF2, TLE4, and CDH1) were computationally predicted as metastasis-related LSD1-target genes. ChIp-PCR was applied after RT-PCR and Western blot validations to detect the occupancy of LSD1-target gene promoter-bound LSD1. A total of 3633 DEGs were significantly upregulated, and 4642 DEGs were downregulated in LSD1-silenced SW620 cells. A total of 4047 DEGs and 4240 DEGs were upregulated and downregulated in LSD1-overexpressed HT-29 cells, respectively. RT-PCR and Western blot validated the microarray analysis results. ChIP assay results demonstrated that LSD1 might be negative regulators for target genes CABYR and CDH1. The expression level of LSD1 is negatively correlated with mono- and dimethylation of histone H3 lysine4(H3K4) at LSD1- target gene promoter region. No significant mono-methylation and dimethylation of H3 lysine9 methylation was detected at the promoter region of CABYR and CDH1. LSD1- depletion contributed to the upregulation of CABYR and CDH1 through enhancing the dimethylation of H3K4 at the LSD1-target genes promoter. LSD1- overexpression mediated the downregulation of CABYR and CDH1expression through decreasing the mono- and dimethylation of H3K4 at LSD1-target gene promoter in colon cancer cells. CABYR and CDH1 might be potential LSD1-target genes in colon

  19. Reduced 64Cu uptake and tumor growth inhibition by knockdown of human copper transporter 1 in xenograft mouse model of prostate cancer.

    PubMed

    Cai, Huawei; Wu, Jiu-sheng; Muzik, Otto; Hsieh, Jer-Tsong; Lee, Robert J; Peng, Fangyu

    2014-04-01

    RNA-PC-3 or 39 ± 22 mm(3) for Lenti-hCtr1-shRNA-DU-145) were significantly smaller than those without knockdown of hCtr1 (536 ± 191 mm(3) for Lenti- SCR-shRNA-PC-3 or 208 ± 104 mm(3) for Lenti-SCR-shRNA-DU-145, P < 0.01). Overall, data indicated that hCtr1 is a promising theranostic target, which can be further developed for metabolic imaging of prostate cancer using (64)CuCl2 PET/CT and personalized cancer therapy targeting copper metabolism.

  20. Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

    PubMed Central

    Loftus, Stacie K.; Baxter, Laura L.; Cronin, Julia C.; Fufa, Temesgen D.; Pavan, William J.

    2017-01-01

    Summary Hypoxia and HIF1α signaling direct tissue-specific gene responses regulating tumor progression, invasion and metastasis. By integrating HIF1α knockdown and hypoxia-induced gene expression changes, this study identifies a melanocyte-specific, HIF1α-dependent/hypoxia-responsive gene expression signature. Integration of these gene expression changes with HIF1α ChIP-Seq analysis identifies 81 HIF1α direct target genes in melanocytes. The expression levels for ten of the HIF1α direct targets – GAPDH, PKM, PPAT, DARS, DTWD1, SEH1L, ZNF292, RLF, AGTRAP, and GPC6 – are significantly correlated with reduced time of Disease Free Status (DFS) in melanoma by logistic regression (P-value =0.0013) and ROC curve analysis (AUC= 0.826, P-value<0.0001). This HIF1α-regulated profile defines a melanocyte-specific response under hypoxia, and demonstrates the role of HIF1α as an invasive cell state gatekeeper in regulating cellular metabolism, chromatin and transcriptional regulation, vascularization and invasion. PMID:28168807

  1. Targeted Gene Deletion in Cordyceps militaris Using the Split-Marker Approach.

    PubMed

    Lou, HaiWei; Ye, ZhiWei; Yun, Fan; Lin, JunFang; Guo, LiQiong; Chen, BaiXiong; Mu, ZhiXian

    2018-05-01

    The macrofungus Cordyceps militaris contains many kinds of bioactive ingredients that are regulated by functional genes, but the functions of many genes in C. militaris are still unknown. In this study, to improve the frequency of homologous integration, a genetic transformation system based on a split-marker approach was developed for the first time in C. militaris to knock out a gene encoding a terpenoid synthase (Tns). The linear and split-marker deletion cassettes were constructed and introduced into C. militaris protoplasts by PEG-mediated transformation. The transformation of split-marker fragments resulted in a higher efficiency of targeted gene disruption than the transformation of linear deletion cassettes did. The color phenotype of the Tns gene deletion mutants was different from that of wild-type C. militaris. Moreover, a PEG-mediated protoplast transformation system was established, and stable genetic transformants were obtained. This method of targeted gene deletion represents an important tool for investigating the role of C. militaris genes.

  2. Ski co-repressor complexes maintain the basal repressed state of the TGF-beta target gene, SMAD7, via HDAC3 and PRMT5.

    PubMed

    Tabata, Takanori; Kokura, Kenji; Ten Dijke, Peter; Ishii, Shunsuke

    2009-01-01

    The products encoded by ski and its related gene, sno, (Ski and Sno) act as transcriptional co-repressors and interact with other co-repressors such as N-CoR/SMRT and mSin3A. Ski and Sno mediate transcriptional repression by various repressors, including Mad, Rb and Gli3. Ski/Sno also suppress transcription induced by multiple activators, such as Smads and c-Myb. In particular, the inhibition of TGF-beta-induced transcription by binding to Smads is correlated with the oncogenic activity of Ski and Sno. However, the molecular mechanism by which Ski and Sno mediate transcriptional repression remains unknown. In this study, we report the purification and characterization of Ski complexes. The Ski complexes purified from HeLa cells contained histone deacetylase 3 (HDAC3) and protein arginine methyltransferase 5 (PRMT5), in addition to multiple Smad proteins (Smad2, Smad3 and Smad4). Chromatin immunoprecipitation assays indicated that these components of the Ski complexes were localized on the SMAD7 gene promoter, which is the TGF-beta target gene, in TGF-beta-untreated HepG2 cells. Knockdown of these components using siRNA led to up-regulation of SMAD7 mRNA. These results indicate that Ski complexes serve to maintain a TGF-beta-responsive promoter at a repressed basal level via the activities of histone deacetylase and histone arginine methyltransferase.

  3. Megalin-mediated specific uptake of chitosan/siRNA nanoparticles in mouse kidney proximal tubule epithelial cells enables AQP1 gene silencing.

    PubMed

    Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen

    2014-01-01

    RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases.

  4. Megalin-Mediated Specific Uptake of Chitosan/siRNA Nanoparticles in Mouse Kidney Proximal Tubule Epithelial Cells Enables AQP1 Gene Silencing

    PubMed Central

    Gao, Shan; Hein, San; Dagnæs-Hansen, Frederik; Weyer, Kathrin; Yang, Chuanxu; Nielsen, Rikke; Christensen, Erik I; Fenton, Robert A; Kjems, Jørgen

    2014-01-01

    RNAi-based strategies provide a great therapeutic potential for treatment of various human diseases including kidney disorders, but face the challenge of in vivo delivery and specific targeting. The chitosan delivery system has previously been shown to target siRNA specifically to the kidneys in mice when administered intravenously. Here we confirm by 2D and 3D bioimaging that chitosan formulated siRNA is retained in the kidney for more than 48 hours where it accumulates in proximal tubule epithelial cells (PTECs), a process that was strongly dependent on the molecular weight of chitosan. Chitosan/siRNA nanoparticles, administered to chimeric mice with conditional knockout of the megalin gene, distributed almost exclusively in cells that expressed megalin, implying that the chitosan/siRNA particle uptake was mediated by a megalin-dependent endocytotic pathway. Knockdown of the water channel aquaporin 1 (AQP1) by up to 50% in PTECs was achieved utilizing the systemic i.v. delivery of chitosan/AQP1 siRNA in mice. In conclusion, specific targeting PTECs with the chitosan nanoparticle system may prove to be a useful strategy for knockdown of specific genes in PTECs, and provides a potential therapeutic strategy for treating various kidney diseases. PMID:25157280

  5. MicroRNA expression, target genes, and signaling pathways in infants with a ventricular septal defect.

    PubMed

    Chai, Hui; Yan, Zhaoyuan; Huang, Ke; Jiang, Yuanqing; Zhang, Lin

    2018-02-01

    This study aimed to systematically investigate the relationship between miRNA expression and the occurrence of ventricular septal defect (VSD), and characterize the miRNA target genes and pathways that can lead to VSD. The miRNAs that were differentially expressed in blood samples from VSD and normal infants were screened and validated by implementing miRNA microarrays and qRT-PCR. The target genes regulated by differentially expressed miRNAs were predicted using three target gene databases. The functions and signaling pathways of the target genes were enriched using the GO database and KEGG database, respectively. The transcription and protein expression of specific target genes in critical pathways were compared in the VSD and normal control groups using qRT-PCR and western blotting, respectively. Compared with the normal control group, the VSD group had 22 differentially expressed miRNAs; 19 were downregulated and three were upregulated. The 10,677 predicted target genes participated in many biological functions related to cardiac development and morphogenesis. Four target genes (mGLUR, Gq, PLC, and PKC) were involved in the PKC pathway and four (ECM, FAK, PI3 K, and PDK1) were involved in the PI3 K-Akt pathway. The transcription and protein expression of these eight target genes were significantly upregulated in the VSD group. The 22 miRNAs that were dysregulated in the VSD group were mainly downregulated, which may result in the dysregulation of several key genes and biological functions related to cardiac development. These effects could also be exerted via the upregulation of eight specific target genes, the subsequent over-activation of the PKC and PI3 K-Akt pathways, and the eventual abnormal cardiac development and VSD.

  6. Overexpression of HOXA4 and HOXA9 genes promotes self-renewal and contributes to colon cancer stem cell overpopulation.

    PubMed

    Bhatlekar, Seema; Viswanathan, Vignesh; Fields, Jeremy Z; Boman, Bruce M

    2018-02-01

    Because HOX genes encode master regulatory transcription factors that regulate stem cells (SCs) during development and aberrant expression of HOX genes occurs in various cancers, our goal was to determine if dysregulation of HOX genes is involved in the SC origin of colorectal cancer (CRC). We previously reported that HOXA4 and HOXD10 are expressed in the colonic SC niche and are overexpressed in CRC. HOX gene expression was studied in SCs from human colon tissue and CRC cells (CSCs) using qPCR and immunostaining. siRNA-mediated knockdown of HOX expression was used to evaluate the role of HOX genes in modulating cancer SC (CSC) phenotype at the level of proliferation, SC marker expression, and sphere formation. All-trans-retinoic-acid (ATRA), a differentiation-inducing agent was evaluated for its effects on HOX expression and CSC growth. We found that HOXA4 and HOXA9 are up-regulated in CRC SCs. siRNA knockdown of HOXA4 and HOXA9 reduced: (i) proliferation and sphere-formation and (ii) gene expression of known SC markers (ALDH1, CD166, LGR5). These results indicate that proliferation and self-renewal ability of CRC SCs are reduced in HOXA4 and HOXA9 knockdown cells. ATRA decreased HOXA4, HOXA9, and HOXD10 expression in parallel with reduction in ALDH1 expression, self-renewal, and proliferation. Overall, our findings indicate that overexpression of HOXA4 and HOXA9 contributes to self-renewal and overpopulation of SCs in CRC. Strategies designed to modulate HOX expression may provide ways to target malignant SCs and to develop more effective therapies for CRC. © 2017 Wiley Periodicals, Inc.

  7. Knock-Down of the IFR1 Protein Perturbs the Homeostasis of Reactive Electrophile Species and Boosts Photosynthetic Hydrogen Production in Chlamydomonas reinhardtii

    PubMed Central

    Venkanna, Deepak; Südfeld, Christian; Baier, Thomas; Homburg, Sarah V.; Patel, Anant V.; Wobbe, Lutz; Kruse, Olaf

    2017-01-01

    The protein superfamily of short-chain dehydrogenases/reductases (SDR), including members of the atypical type (aSDR), covers a huge range of catalyzed reactions and in vivo substrates. This superfamily also comprises isoflavone reductase-like (IRL) proteins, which are aSDRs highly homologous to isoflavone reductases from leguminous plants. The molecular function of IRLs in non-leguminous plants and green microalgae has not been identified as yet, but several lines of evidence point at their implication in reactive oxygen species homeostasis. The Chlamydomonas reinhardtii IRL protein IFR1 was identified in a previous study, analyzing the transcriptomic changes occurring during the acclimation to sulfur deprivation and anaerobiosis, a condition that triggers photobiological hydrogen production in this microalgae. Accumulation of the cytosolic IFR1 protein is induced by sulfur limitation as well as by the exposure of C. reinhardtii cells to reactive electrophile species (RES) such as reactive carbonyls. The latter has not been described for IRL proteins before. Over-accumulation of IFR1 in the singlet oxygen response 1 (sor1) mutant together with the presence of an electrophile response element, known to be required for SOR1-dependent gene activation as a response to RES, in the promoter of IFR1, indicate that IFR1 expression is controlled by the SOR1-dependent pathway. An implication of IFR1 into RES homeostasis, is further implied by a knock-down of IFR1, which results in a diminished tolerance toward RES. Intriguingly, IFR1 knock-down has a positive effect on photosystem II (PSII) stability under sulfur-deprived conditions used to trigger photobiological hydrogen production, by reducing PSII-dependent oxygen evolution, in C. reinhardtii. Reduced PSII photoinhibition in IFR1 knock-down strains prolongs the hydrogen production phase resulting in an almost doubled final hydrogen yield compared to the parental strain. Finally, IFR1 knock-down could be successfully

  8. Knock-Down of the IFR1 Protein Perturbs the Homeostasis of Reactive Electrophile Species and Boosts Photosynthetic Hydrogen Production in Chlamydomonas reinhardtii.

    PubMed

    Venkanna, Deepak; Südfeld, Christian; Baier, Thomas; Homburg, Sarah V; Patel, Anant V; Wobbe, Lutz; Kruse, Olaf

    2017-01-01

    The protein superfamily of short-chain dehydrogenases/reductases (SDR), including members of the atypical type (aSDR), covers a huge range of catalyzed reactions and in vivo substrates. This superfamily also comprises isoflavone reductase-like (IRL) proteins, which are aSDRs highly homologous to isoflavone reductases from leguminous plants. The molecular function of IRLs in non-leguminous plants and green microalgae has not been identified as yet, but several lines of evidence point at their implication in reactive oxygen species homeostasis. The Chlamydomonas reinhardtii IRL protein IFR1 was identified in a previous study, analyzing the transcriptomic changes occurring during the acclimation to sulfur deprivation and anaerobiosis, a condition that triggers photobiological hydrogen production in this microalgae. Accumulation of the cytosolic IFR1 protein is induced by sulfur limitation as well as by the exposure of C. reinhardtii cells to reactive electrophile species (RES) such as reactive carbonyls. The latter has not been described for IRL proteins before. Over-accumulation of IFR1 in the singlet oxygen response 1 ( sor1 ) mutant together with the presence of an electrophile response element, known to be required for SOR1-dependent gene activation as a response to RES, in the promoter of IFR1 , indicate that IFR1 expression is controlled by the SOR1-dependent pathway. An implication of IFR1 into RES homeostasis, is further implied by a knock-down of IFR1 , which results in a diminished tolerance toward RES. Intriguingly, IFR1 knock-down has a positive effect on photosystem II (PSII) stability under sulfur-deprived conditions used to trigger photobiological hydrogen production, by reducing PSII-dependent oxygen evolution, in C. reinhardtii . Reduced PSII photoinhibition in IFR1 knock-down strains prolongs the hydrogen production phase resulting in an almost doubled final hydrogen yield compared to the parental strain. Finally, IFR1 knock-down could be

  9. Identification of apoptosis-related PLZF target genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernardo, Maria Victoria; Yelo, Estefania; Gimeno, Lourdes

    2007-07-27

    The PLZF gene encodes a BTB/POZ-zinc finger-type transcription factor, involved in physiological development, proliferation, differentiation, and apoptosis. In this paper, we investigate proliferation, survival, and gene expression regulation in stable clones from the human haematopoietic K562, DG75, and Jurkat cell lines with inducible expression of PLZF. In Jurkat cells, but not in K562 and DG75 cells, PLZF induced growth suppression and apoptosis in a cell density-dependent manner. Deletion of the BTB/POZ domain of PLZF abrogated growth suppression and apoptosis. PLZF was expressed with a nuclear speckled pattern distinctively in the full-length PLZF-expressing Jurkat clones, suggesting that the nuclear speckled localizationmore » is required for PLZF-induced apoptosis. By microarray analysis, we identified that the apoptosis-inducer TP53INP1, ID1, and ID3 genes were upregulated, and the apoptosis-inhibitor TERT gene was downregulated. The identification of apoptosis-related PLZF target genes may have biological and clinical relevance in cancer typified by altered PLZF expression.« less

  10. Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.

    PubMed

    Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro

    2018-05-03

    Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.

  11. MiR-661 inhibits glioma cell proliferation, migration and invasion by targeting hTERT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zhen, E-mail: lizhen7111@163.com; Liu, Yun-hui; Diao, Hong-yu

    In this study, we analyzed the functional role of miR-661 in glioma cell proliferation, migration and invasion. We found that overexpression of miR-661 obviously suppressed the proliferation, migration and invasion of glioma cells. MiRNA target prediction algorithms implied that hTERT is a candidate target gene for miR-661. A fluorescent reporter assay confirmed that miR-661 could lead to hTERT gene silencing by recognizing and specifically binding to the predicted site of the hTERT mRNA 3′ untranslated region (3′UTR) specifically. Furthermore, hTERT knockdown significantly decreased the growth and viability of glioma cells. These results indicate that miR-661 can inhibit glioma cell proliferation,more » migration and invasion by targeting hTERT. - Highlights: • MiR-661 was downregulated in glioma tissues and functional as a tumor suppressor. • MiR-661 modulates cell proliferation, invasion and migration of glioma cells. • MiR-661 directly target hTERT in glioma cells. • MiR-661 inhibits glioma cell tumorgenesis by targeting hTERT.« less

  12. Knockdown of long non-coding RNA XIST increases blood–tumor barrier permeability and inhibits glioma angiogenesis by targeting miR-137

    PubMed Central

    Yu, H; Xue, Y; Wang, P; Liu, X; Ma, J; Zheng, J; Li, Z; Li, Z; Cai, H; Liu, Y

    2017-01-01

    Antiangiogenic therapy plays a significant role in combined glioma treatment. However, poor permeability of the blood–tumor barrier (BTB) limits the transport of chemotherapeutic agents, including antiangiogenic drugs, into tumor tissues. Long non-coding RNAs (lncRNAs) have been implicated in various diseases, especially malignant tumors. The present study found that lncRNA X-inactive-specific transcript (XIST) was upregulated in endothelial cells that were obtained in a BTB model in vitro. XIST knockdown increased BTB permeability and inhibited glioma angiogenesis. The analysis of the mechanism of action revealed that the reduction of XIST inhibited the expression of the transcription factor forkhead box C1 (FOXC1) and zonula occludens 2 (ZO-2) by upregulating miR-137. FOXC1 decreased BTB permeability by increasing the promoter activity and expression of ZO-1 and occludin, and promoted glioma angiogenesis by increasing the promoter activity and expression of chemokine (C–X–C motif) receptor 7b (CXCR7). Overall, the present study demonstrates that XIST plays a pivotal role in BTB permeability and glioma angiogenesis, and the inhibition of XIST may be a potential target for the clinical management of glioma. PMID:28287613

  13. Effects of gene knockdown of CNP on ventricular remodeling after myocardial ischemia-reperfusion injury through NPRB/Cgmp signaling pathway in rats.

    PubMed

    Wu, Lian-He; Zhang, Qi; Zhang, Shen; Meng, Lu-Yu; Wang, Yan-Chi; Sheng, Cun-Jian

    2018-02-01

    This study aimed to explore effects of CNP on ventricular remodeling following myocardial ischemia-reperfusion (I/R) injury through the NPRB/cGMP signaling pathway. Rat cardiomyocytes were assigned into: control, I/R, I/R + CNP, and I/R + 8-Br-cGMP groups. ELISA, qRT-PCR, and Western blotting were used to detect cGMP content and expression, respectively. After model establishment of I/R rats, normal control, CNP -/- control, I/R, and CNP -/- groups were set. Indexes of heart were detected using echocardiography and hemodynamics. ELISA was used to measure serum CNP, cGMP, LDH, cTn I, CK-MB, TNF-α, and IL-6 levels. Myocardial infarct was identified by TTC staining, and apoptosis conditions by TUNEL staining. QRT-PCR and Western blotting were adopted to detect expressions of CNP, NPRB, cGMP, and apoptosis-related genes. Compared with control group, cGMP contents and expression in the I/R, I/R + CNP and I/R + 8-Br-cGMP groups were decreased. Levels of LVEDV, LVESV, LVDS, LVDD, IVSD, LVM, LVEDP, and LVSP were higher in the I/R, CNP -/- control, and CNP -/- groups than normal control group while LVEF, SV, CO, and ±dp/dtmax were lower. Compared with the normal control group, LDH, cTn I, CK-MB, TNF-α, and IL-6 were higher in the I/R, CNP -/- control and CNP -/- groups; pathological changes and myocardial infarction were observed in the I/R, CNP -/- control, and CNP -/- groups; expressions of apoptosis-related genes in those groups were higher; while CNP, NPRB, cGMP, and Bcl-2 expressions were decreased. We came to the conclusion that gene knockdown of CNP blocks the NPRB/cGMP signaling pathway, thereby aggravating myocardial I/R injury and causing ventricular remodeling in rats. © 2017 Wiley Periodicals, Inc.

  14. Knockdown of DISC1 by in utero gene transfer disturbs postnatal dopaminergic maturation in the frontal cortex and leads to adult behavioral deficits

    PubMed Central

    Niwa, Minae; Kamiya, Atsushi; Murai, Rina; Kubo, Ken-ichiro; Gruber, Aaron J; Tomita, Kenji; Lu, Lingling; Tomisato, Shuta; Jaaro-Peled, Hanna; Seshadri, Saurav; Hiyama, Hideki; Huang, Beverly; Kohda, Kazuhisa; Noda, Yukihiro; O’Donnell, Patricio; Nakajima, Kazunori; Sawa, Akira; Nabeshima, Toshitaka

    2011-01-01

    SUMMARY Adult brain function and behavior are influenced by neuronal network formation during development. Genetic susceptibility factors for adult psychiatric illnesses, such as Neuregulin-1 and Disrupted-in-Schizophrenia-1 (DISC1), influence adult high brain functions, including cognition and information processing. These factors have roles during neurodevelopment and are likely to cooperate, forming “pathways” or “signalosomes.” Here we report the potential to generate an animal model via in utero gene transfer in order to address an important question of how nonlethal deficits in early development may affect postnatal brain maturation and high brain functions in adulthood, which are impaired in various psychiatric illnesses, such as schizophrenia. We show that transient knockdown of DISC1 in the pre- and peri-natal stages, specifically in a lineage of pyramidal neurons mainly in the prefrontal cortex, leads to selective abnormalities in postnatal mesocortical dopaminergic maturation and behavioral abnormalities associated with disturbed cortical neurocircuitry after puberty. PMID:20188653

  15. Human microRNA target analysis and gene ontology clustering by GOmir, a novel stand-alone application

    PubMed Central

    Roubelakis, Maria G; Zotos, Pantelis; Papachristoudis, Georgios; Michalopoulos, Ioannis; Pappa, Kalliopi I; Anagnou, Nicholas P; Kossida, Sophia

    2009-01-01

    Background microRNAs (miRNAs) are single-stranded RNA molecules of about 20–23 nucleotides length found in a wide variety of organisms. miRNAs regulate gene expression, by interacting with target mRNAs at specific sites in order to induce cleavage of the message or inhibit translation. Predicting or verifying mRNA targets of specific miRNAs is a difficult process of great importance. Results GOmir is a novel stand-alone application consisting of two separate tools: JTarget and TAGGO. JTarget integrates miRNA target prediction and functional analysis by combining the predicted target genes from TargetScan, miRanda, RNAhybrid and PicTar computational tools as well as the experimentally supported targets from TarBase and also providing a full gene description and functional analysis for each target gene. On the other hand, TAGGO application is designed to automatically group gene ontology annotations, taking advantage of the Gene Ontology (GO), in order to extract the main attributes of sets of proteins. GOmir represents a new tool incorporating two separate Java applications integrated into one stand-alone Java application. Conclusion GOmir (by using up to five different databases) introduces miRNA predicted targets accompanied by (a) full gene description, (b) functional analysis and (c) detailed gene ontology clustering. Additionally, a reverse search initiated by a potential target can also be conducted. GOmir can freely be downloaded BRFAA. PMID:19534746

  16. Human microRNA target analysis and gene ontology clustering by GOmir, a novel stand-alone application.

    PubMed

    Roubelakis, Maria G; Zotos, Pantelis; Papachristoudis, Georgios; Michalopoulos, Ioannis; Pappa, Kalliopi I; Anagnou, Nicholas P; Kossida, Sophia

    2009-06-16

    microRNAs (miRNAs) are single-stranded RNA molecules of about 20-23 nucleotides length found in a wide variety of organisms. miRNAs regulate gene expression, by interacting with target mRNAs at specific sites in order to induce cleavage of the message or inhibit translation. Predicting or verifying mRNA targets of specific miRNAs is a difficult process of great importance. GOmir is a novel stand-alone application consisting of two separate tools: JTarget and TAGGO. JTarget integrates miRNA target prediction and functional analysis by combining the predicted target genes from TargetScan, miRanda, RNAhybrid and PicTar computational tools as well as the experimentally supported targets from TarBase and also providing a full gene description and functional analysis for each target gene. On the other hand, TAGGO application is designed to automatically group gene ontology annotations, taking advantage of the Gene Ontology (GO), in order to extract the main attributes of sets of proteins. GOmir represents a new tool incorporating two separate Java applications integrated into one stand-alone Java application. GOmir (by using up to five different databases) introduces miRNA predicted targets accompanied by (a) full gene description, (b) functional analysis and (c) detailed gene ontology clustering. Additionally, a reverse search initiated by a potential target can also be conducted. GOmir can freely be downloaded BRFAA.

  17. Network Architecture Predisposes an Enzyme to Either Pharmacologic or Genetic Targeting.

    PubMed

    Jensen, Karin J; Moyer, Christian B; Janes, Kevin A

    2016-02-24

    Chemical inhibition and genetic knockdown of enzymes are not equivalent in cells, but network-level mechanisms that cause discrepancies between knockdown and inhibitor perturbations are not understood. Here we report that enzymes regulated by negative feedback are robust to knockdown but susceptible to inhibition. Using the Raf-MEK-ERK kinase cascade as a model system, we find that ERK activation is resistant to genetic knockdown of MEK but susceptible to a comparable degree of chemical MEK inhibition. We demonstrate that negative feedback from ERK to Raf causes this knockdown-versus-inhibitor discrepancy in vivo. Exhaustive mathematical modeling of three-tiered enzyme cascades suggests that this result is general: negative autoregulation or feedback favors inhibitor potency, whereas positive autoregulation or feedback favors knockdown potency. Our findings provide a rationale for selecting pharmacologic versus genetic perturbations in vivo and point out the dangers of using knockdown approaches in search of drug targets.

  18. Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action

    PubMed Central

    2013-01-01

    Background Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Methods Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Results Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. Conclusions This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the

  19. Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action.

    PubMed

    Lanz, Thomas A; Guilmette, Edward; Gosink, Mark M; Fischer, James E; Fitzgerald, Lawrence W; Stephenson, Diane T; Pletcher, Mathew T

    2013-11-15

    Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the broadest efficacy across the diverse

  20. Targeted Mutagenesis of Duplicated Genes in Soybean with Zinc-Finger Nucleases1[W][OA

    PubMed Central

    Curtin, Shaun J.; Zhang, Feng; Sander, Jeffry D.; Haun, William J.; Starker, Colby; Baltes, Nicholas J.; Reyon, Deepak; Dahlborg, Elizabeth J.; Goodwin, Mathew J.; Coffman, Andrew P.; Dobbs, Drena; Joung, J. Keith; Voytas, Daniel F.; Stupar, Robert M.

    2011-01-01

    We performed targeted mutagenesis of a transgene and nine endogenous soybean (Glycine max) genes using zinc-finger nucleases (ZFNs). A suite of ZFNs were engineered by the recently described context-dependent assembly platform—a rapid, open-source method for generating zinc-finger arrays. Specific ZFNs targeting DICER-LIKE (DCL) genes and other genes involved in RNA silencing were cloned into a vector under an estrogen-inducible promoter. A hairy-root transformation system was employed to investigate the efficiency of ZFN mutagenesis at each target locus. Transgenic roots exhibited somatic mutations localized at the ZFN target sites for seven out of nine targeted genes. We next introduced a ZFN into soybean via whole-plant transformation and generated independent mutations in the paralogous genes DCL4a and DCL4b. The dcl4b mutation showed efficient heritable transmission of the ZFN-induced mutation in the subsequent generation. These findings indicate that ZFN-based mutagenesis provides an efficient method for making mutations in duplicate genes that are otherwise difficult to study due to redundancy. We also developed a publicly accessible Web-based tool to identify sites suitable for engineering context-dependent assembly ZFNs in the soybean genome. PMID:21464476

  1. Normal Collagen and Bone Production by Gene-targeted Human Osteogenesis Imperfecta iPSCs

    PubMed Central

    Deyle, David R; Khan, Iram F; Ren, Gaoying; Wang, Pei-Rong; Kho, Jordan; Schwarze, Ulrike; Russell, David W

    2012-01-01

    Osteogenesis imperfecta (OI) is caused by dominant mutations in the type I collagen genes. In principle, the skeletal abnormalities of OI could be treated by transplantation of patient-specific, bone-forming cells that no longer express the mutant gene. Here, we develop this approach by isolating mesenchymal cells from OI patients, inactivating their mutant collagen genes by adeno-associated virus (AAV)-mediated gene targeting, and deriving induced pluripotent stem cells (iPSCs) that were expanded and differentiated into mesenchymal stem cells (iMSCs). Gene-targeted iMSCs produced normal collagen and formed bone in vivo, but were less senescent and proliferated more than bone-derived MSCs. To generate iPSCs that would be more appropriate for clinical use, the reprogramming and selectable marker transgenes were removed by Cre recombinase. These results demonstrate that the combination of gene targeting and iPSC derivation can be used to produce potentially therapeutic cells from patients with genetic disease. PMID:22031238

  2. Retinoic Acid Receptor β: A Potential Therapeutic Target in Retinoic Acid Treatment of Endometrial Cancer.

    PubMed

    Tsuji, Keita; Utsunomiya, Hiroki; Miki, Yasuhiro; Hanihara, Mayu; Fue, Misaki; Takagi, Kiyoshi; Nishimoto, Mitsuo; Suzuki, Fumihiko; Yaegashi, Nobuo; Suzuki, Takashi; Ito, Kiyoshi

    2017-05-01

    Several studies have reported that retinoic acid (RA) might be used to treat malignancies. The effects of RA are mediated by the RA receptor (RAR), and RARα/RARβ especially acts as a tumor suppressor. However, little is known about its role in human endometrial cancer. In this study, we examined the effects of all-trans RA (ATRA) on progression of human endometrial cancer cell line, RL95-2 and Hec1A. We then examined the expression of RARα and RARβ in 50 endometrial cancer tissues by using immunohistochemistry. We found inhibitory effects of ATRA on cell proliferation, apoptosis, and migration in RL95-2 cells, but not in Hec1A cells. RARα or RARβ knockdown individually could not cancel out the inhibition of cell proliferation by ATRA in RL95-2 cells, but simultaneous knockdown of RARα and RARβ could block its effect on proliferation. RARα and RARβ knockdown dose dependently reduced the inhibition of migration by ATRA, but the effect was more pronounced with RARβ knockdown than with RARα knockdown. We confirmed that RARβ gene was directly regulated by ATRA in microarray and real-time reverse transcription polymerase chain reaction. Furthermore, the RARβ agonist (BMS453) significantly suppressed proliferation of RL95-2 cells. In immunohistochemical analysis, RARα expression was positively correlated with tumor grade, and RARβ showed the opposite tendency in endometrial cancer. Retinoic acid might have multiple antitumor effects, and RARβ may be a potent therapeutic target in RA treatment for endometrial cancers.

  3. The past and presence of gene targeting: from chemicals and DNA via proteins to RNA.

    PubMed

    Geel, T M; Ruiters, M H J; Cool, R H; Halby, L; Voshart, D C; Andrade Ruiz, L; Niezen-Koning, K E; Arimondo, P B; Rots, M G

    2018-06-05

    The ability to target DNA specifically at any given position within the genome allows many intriguing possibilities and has inspired scientists for decades. Early gene-targeting efforts exploited chemicals or DNA oligonucleotides to interfere with the DNA at a given location in order to inactivate a gene or to correct mutations. We here describe an example towards correcting a genetic mutation underlying Pompe's disease using a nucleotide-fused nuclease (TFO-MunI). In addition to the promise of gene correction, scientists soon realized that genes could be inactivated or even re-activated without inducing potentially harmful DNA damage by targeting transcriptional modulators to a particular gene. However, it proved difficult to fuse protein effector domains to the first generation of programmable DNA-binding agents. The engineering of gene-targeting proteins (zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs)) circumvented this problem. The disadvantage of protein-based gene targeting is that a fusion protein needs to be engineered for every locus. The recent introduction of CRISPR/Cas offers a flexible approach to target a (fusion) protein to the locus of interest using cheap designer RNA molecules. Many research groups now exploit this platform and the first human clinical trials have been initiated: CRISPR/Cas has kicked off a new era of gene targeting and is revolutionizing biomedical sciences.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).

  4. The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.

    PubMed

    Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María

    2016-09-01

    The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

  5. Identification of potential target genes of ROR-alpha in THP1 and HUVEC cell lines.

    PubMed

    Gulec, Cagri; Coban, Neslihan; Ozsait-Selcuk, Bilge; Sirma-Ekmekci, Sema; Yildirim, Ozlem; Erginel-Unaltuna, Nihan

    2017-04-01

    ROR-alpha is a nuclear receptor, activity of which can be modulated by natural or synthetic ligands. Due to its possible involvement in, and potential therapeutic target for atherosclerosis, we aimed to identify ROR-alpha target genes in monocytic and endothelial cell lines. We performed chromatin immunoprecipitation (ChIP) followed by tiling array (ChIP-on-chip) for ROR-alpha in monocytic cell line THP1 and endothelial cell line HUVEC. Following bioinformatic analysis of the array data, we tested four candidate genes in terms of dependence of their expression level on ligand-mediated ROR-alpha activity, and two of them in terms of promoter occupancy by ROR-alpha. Bioinformatic analyses of ChIP-on-chip data suggested that ROR-alpha binds to genomic regions near the transcription start site (TSS) of more than 3000 genes in THP1 and HUVEC. Potential ROR-alpha target genes in both cell types seem to be involved mainly in membrane receptor activity, signal transduction and ion transport. While SPP1 and IKBKA were shown to be direct target genes of ROR-alpha in THP1 monocytes, inflammation related gene HMOX1 and heat shock protein gene HSPA8 were shown to be potential target genes of ROR-alpha. Our results suggest that ROR-alpha may regulate signaling receptor activity, and transmembrane transport activity through its potential target genes. ROR-alpha seems also to play role in cellular sensitivity to environmental substances like arsenite and chloroprene. Although, the expression analyses have shown that synthetic ROR-alpha ligands can modulate some of potential ROR-alpha target genes, functional significance of ligand-dependent modulation of gene expression needs to be confirmed with further analyses. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-04

    The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

  7. A versatile strategy for gene trapping and trap conversion in emerging model organisms.

    PubMed

    Kontarakis, Zacharias; Pavlopoulos, Anastasios; Kiupakis, Alexandros; Konstantinides, Nikolaos; Douris, Vassilis; Averof, Michalis

    2011-06-01

    Genetic model organisms such as Drosophila, C. elegans and the mouse provide formidable tools for studying mechanisms of development, physiology and behaviour. Established models alone, however, allow us to survey only a tiny fraction of the morphological and functional diversity present in the animal kingdom. Here, we present iTRAC, a versatile gene-trapping approach that combines the implementation of unbiased genetic screens with the generation of sophisticated genetic tools both in established and emerging model organisms. The approach utilises an exon-trapping transposon vector that carries an integrase docking site, allowing the targeted integration of new constructs into trapped loci. We provide proof of principle for iTRAC in the emerging model crustacean Parhyale hawaiensis: we generate traps that allow specific developmental and physiological processes to be visualised in unparalleled detail, we show that trapped genes can be easily cloned from an unsequenced genome, and we demonstrate targeting of new constructs into a trapped locus. Using this approach, gene traps can serve as platforms for generating diverse reporters, drivers for tissue-specific expression, gene knockdown and other genetic tools not yet imagined.

  8. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  9. Adenosine-to-Inosine Editing of MicroRNA-487b Alters Target Gene Selection After Ischemia and Promotes Neovascularization.

    PubMed

    van der Kwast, Reginald V C T; van Ingen, Eva; Parma, Laura; Peters, Hendrika A B; Quax, Paul H A; Nossent, A Yaël

    2018-02-02

    Adenosine-to-inosine editing of microRNAs has the potential to cause a shift in target site selection. 2'-O-ribose-methylation of adenosine residues, however, has been shown to inhibit adenosine-to-inosine editing. To investigate whether angiomiR miR487b is subject to adenosine-to-inosine editing or 2'-O-ribose-methylation during neovascularization. Complementary DNA was prepared from C57BL/6-mice subjected to hindlimb ischemia. Using Sanger sequencing and endonuclease digestion, we identified and validated adenosine-to-inosine editing of the miR487b seed sequence. In the gastrocnemius muscle, pri-miR487b editing increased from 6.7±0.4% before to 11.7±1.6% ( P =0.02) 1 day after ischemia. Edited pri-miR487b is processed into a novel microRNA, edited miR487b, which is also upregulated after ischemia. We confirmed editing of miR487b in multiple human primary vascular cell types. Short interfering RNA-mediated knockdown demonstrated that editing is adenosine deaminase acting on RNA 1 and 2 dependent. Using reverse-transcription at low dNTP concentrations followed by quantitative-PCR, we found that the same adenosine residue is methylated in mice and human primary cells. In the murine gastrocnemius, the estimated methylation fraction increased from 32.8±14% before to 53.6±12% 1 day after ischemia. Short interfering RNA knockdown confirmed that methylation is fibrillarin dependent. Although we could not confirm that methylation directly inhibits editing, we do show that adenosine deaminase acting on RNA 1 and 2 and fibrillarin negatively influence each other's expression. Using multiple luciferase reporter gene assays, we could demonstrate that editing results in a complete switch of target site selection. In human primary cells, we confirmed the shift in miR487b targeting after editing, resulting in a edited miR487b targetome that is enriched for multiple proangiogenic pathways. Furthermore, overexpression of edited miR487b, but not wild-type miR487b, stimulates

  10. Targeted Antiangiogenesis Gene Therapy Using Targeted Cationic Microbubbles Conjugated with CD105 Antibody Compared with Untargeted Cationic and Neutral Microbubbles

    PubMed Central

    Zhou, Yu; Gu, Haitao; Xu, Yan; Li, Fan; Kuang, Shaojing; Wang, Zhigang; Zhou, Xiyuan; Ma, Huafeng; Li, Pan; Zheng, Yuanyi; Ran, Haitao; Jian, Jia; Zhao, Yajing; Song, Weixiang; Wang, Qiushi; Wang, Dong

    2015-01-01

    Objective This study aimed to develop targeted cationic microbubbles conjugated with a CD105 antibody (CMB105) for use in targeted vascular endothelial cell gene therapy and ultrasound imaging. We compared the results with untargeted cationic microbubbles (CMB) and neutral microbubbles (NMB). Methods CMB105 were prepared and compared with untargeted CMB and NMB. First, the microbubbles were characterized in terms of size, zeta-potential, antibody binding ability and plasmid DNA loading capacity. A tumor model of subcutaneous breast cancer in nude mice was used for our experiments. The ability of different types of microbubbles to target HUVECs in vitro and tumor neovascularization in vivo was measured. The endostatin gene was selected for its outstanding antiangiogenesis effect. For in vitro experiments, the transfection efficiency and cell cycle were analyzed using flow cytometry, and the transcription and expression of endostatin were measured by qPCR and Western blotting, respectively. Vascular tube cavity formation and tumor cell invasion were used to evaluate the antiangiogenesis gene therapy efficiency in vitro. Tumors were exposed to ultrasound irradiation with different types of microbubbles, and the gene therapy effects were investigated by detecting apoptosis induction and changes in tumor volume. Results CMB105 and CMB differed significantly from NMB in terms of zeta-potential, and the DNA loading capacities were 16.76±1.75 μg, 18.21±1.22 μg, and 0.48±0.04 μg per 5×108 microbubbles, respectively. The charge coupling of plasmid DNA to CMB105 was not affected by the presence of the CD105 antibody. Both CMB105 and CMB could target to HUVECs in vitro, whereas only CMB105 could target to tumor neovascularization in vivo. In in vitro experiments, the transfection efficiency of CMB105 was 24.7-fold higher than the transfection efficiency of NMB and 1.47-fold higher than the transfection efficiency of CMB (P<0.05). With ultrasound-targeted microbubble

  11. Targeted antiangiogenesis gene therapy using targeted cationic microbubbles conjugated with CD105 antibody compared with untargeted cationic and neutral microbubbles.

    PubMed

    Zhou, Yu; Gu, Haitao; Xu, Yan; Li, Fan; Kuang, Shaojing; Wang, Zhigang; Zhou, Xiyuan; Ma, Huafeng; Li, Pan; Zheng, Yuanyi; Ran, Haitao; Jian, Jia; Zhao, Yajing; Song, Weixiang; Wang, Qiushi; Wang, Dong

    2015-01-01

    This study aimed to develop targeted cationic microbubbles conjugated with a CD105 antibody (CMB105) for use in targeted vascular endothelial cell gene therapy and ultrasound imaging. We compared the results with untargeted cationic microbubbles (CMB) and neutral microbubbles (NMB). CMB105 were prepared and compared with untargeted CMB and NMB. First, the microbubbles were characterized in terms of size, zeta-potential, antibody binding ability and plasmid DNA loading capacity. A tumor model of subcutaneous breast cancer in nude mice was used for our experiments. The ability of different types of microbubbles to target HUVECs in vitro and tumor neovascularization in vivo was measured. The endostatin gene was selected for its outstanding antiangiogenesis effect. For in vitro experiments, the transfection efficiency and cell cycle were analyzed using flow cytometry, and the transcription and expression of endostatin were measured by qPCR and Western blotting, respectively. Vascular tube cavity formation and tumor cell invasion were used to evaluate the antiangiogenesis gene therapy efficiency in vitro. Tumors were exposed to ultrasound irradiation with different types of microbubbles, and the gene therapy effects were investigated by detecting apoptosis induction and changes in tumor volume. CMB105 and CMB differed significantly from NMB in terms of zeta-potential, and the DNA loading capacities were 16.76±1.75 μg, 18.21±1.22 μg, and 0.48±0.04 μg per 5×10(8) microbubbles, respectively. The charge coupling of plasmid DNA to CMB105 was not affected by the presence of the CD105 antibody. Both CMB105 and CMB could target to HUVECs in vitro, whereas only CMB105 could target to tumor neovascularization in vivo. In in vitro experiments, the transfection efficiency of CMB105 was 24.7-fold higher than the transfection efficiency of NMB and 1.47-fold higher than the transfection efficiency of CMB (P<0.05). With ultrasound-targeted microbubble destruction (UTMD

  12. Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

    PubMed

    Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

    2015-06-30

    Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

  13. Protein targeting in the analysis of learning and memory: a potential alternative to gene targeting.

    PubMed

    Gerlai, R; Williams, S P; Cairns, B; Van Bruggen, N; Moran, P; Shih, A; Caras, I; Sauer, H; Phillips, H S; Winslow, J W

    1998-11-01

    Gene targeting using homologous recombination in embryonic stem (ES) cells offers unprecedented precision with which one may manipulate single genes and investigate the in vivo effects of defined mutations in the mouse. Geneticists argue that this technique abrogates the lack of highly specific pharmacological tools in the study of brain function and behavior. However, by now it has become clear that gene targeting has some limitations too. One problem is spatial and temporal specificity of the generated mutation, which may appear in multiple brain regions or even in other organs and may also be present throughout development, giving rise to complex, secondary phenotypical alterations. This may be a disadvantage in the functional analysis of a number of genes associated with learning and memory processes. For example, several proteins, including neurotrophins--cell-adhesion molecules--and protein kinases, that play a significant developmental role have recently been suggested to be also involved in neural and behavioral plasticity. Knocking out genes of such proteins may lead to developmental alterations or even embryonic lethality in the mouse, making it difficult to study their function in neural plasticity, learning, and memory. Therefore, alternative strategies to gene targeting may be needed. Here, we suggest a potentially useful in vivo strategy based on systemic application of immunoadhesins, genetically engineered fusion proteins possessing the Fc portion of the human IgG molecule and, for example, a binding domain of a receptor of interest. These proteins are stable in vivo and exhibit high binding specificity and affinity for the endogenous ligand of the receptor, but lack the ability to signal. Thus, if delivered to the brain, immunoadhesins may specifically block signalling of the receptor of interest. Using osmotic minipumps, the protein can be infused in a localized region of the brain for a specified period of time (days or weeks). Thus, the location

  14. AHR2 morpholino knockdown reduces the toxicity of total particulate matter to zebrafish embryos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Massarsky, Andrey, E-mail: andrey.massarsky@duke.e

    The zebrafish embryo has been proposed as a ‘bridge model’ to study the effects of cigarette smoke on early development. Previous studies showed that exposure to total particulate matter (TPM) led to adverse effects in developing zebrafish, and suggested that the antioxidant and aryl hydrocarbon receptor (AHR) pathways play important roles. This study investigated the roles of these two pathways in mediating TPM toxicity. The study consisted of four experiments. In experiment I, zebrafish embryos were exposed from 6 h post fertilization (hpf) until 96 hpf to TPM{sub 0.5} and TPM{sub 1.0} (corresponding to 0.5 and 1.0 μg/mL equi-nicotine units)more » in the presence or absence of an antioxidant (N-acetyl cysteine/NAC) or a pro-oxidant (buthionine sulfoximine/BSO). In experiment II, TPM exposures were performed in embryos that were microinjected with nuclear factor erythroid 2-related factor 2 (Nrf2), AHR2, cytochrome P450 1A (CYP1A), or CYP1B1 morpholinos, and deformities were assessed. In experiment III, embryos were exposed to TPM, and embryos/larvae were collected at 24, 48, 72, and 96 hpf to assess several genes associated with the antioxidant and AHR pathways. Lastly, experiment IV assessed the activity and protein levels of CYP1A and CYP1B1 after exposure to TPM. We demonstrate that the incidence of TPM-induced deformities was generally not affected by NAC/BSO treatments or Nrf2 knockdown. In contrast, AHR2 knockdown reduced, while CYP1A or CYP1B1 knockdowns elevated the incidence of some deformities. Moreover, as shown by gene expression the AHR pathway, but not the antioxidant pathway, was induced in response to TPM exposure, providing further evidence for its importance in mediating TPM toxicity. - Highlights: • Total particulate matter (TPM) is the particulate phase of cigarette smoke. • Zebrafish is proposed as a ‘bridge model’ to study the effects of TPM. • We investigate the roles of antioxidant and aryl hydrocarbon receptor (AHR

  15. Fndc5 knockdown induced suppression of mitochondrial integrity and significantly decreased cardiac differentiation of mouse embryonic stem cells.

    PubMed

    Nazem, Shima; Rabiee, Farzaneh; Ghaedi, Kamran; Babashah, Sadegh; Sadeghizadeh, Majid; Nasr-Esfahani, Mohammad Hossein

    2018-06-01

    Fibronectin type III domain-containing 5 protein (Fndc5) is a glycosylated protein with elevated expression in high energy demanded tissues as heart, brain, and muscle. It has been shown that upregulation of Fndc5 is regulated by peroxisome proliferator-activated receptor-γ coactivator-1 alpha (PGC-1α), which is known as a master regulator of mitochondrial function and biogenesis. Also, our group indicated that Fndc5 expression increases gradually during cardiac differentiation of mouse embryonic stem cells (mESCs). In this paper, to clarify the importance of Fndc5 in cardiac differentiation, we south to knock down Fndc5 expression by generation a stably transduced mESC line that derives the expression of a short hairpin RNA (shRNA) against Fndc5 gene following doxycycline (Dox) induction. Knock-down of Fndc5 demonstrated a considerable decrease in expression of cardiac progenitor and cardiomyocyte markers. Considering the fact that mitochondria play a crucial role in cardiac differentiation of ESCs, we investigated the role of Fndc5, as a downstream target of PGC1-α, on mitochondrial indices. Results showed that expression of nuclear encoded mitochondrial genes including PGC1-α, Atp5b, Ndufb5, and SOD2 significantly decreased. Moreover, mitochondrial membrane potential (ΔΨm) and relative ATP content of cardiomyocytes decreased markedly with relative ROS level increase. Together, our results suggest that Fndc5 attenuates process of cardiac differentiation of mESCs which is associated with modulation of mitochondrial function and gene expression. © 2017 Wiley Periodicals, Inc.

  16. Targeted gene disruption in Koji mold Aspergillus oryzae.

    PubMed

    Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

    2011-01-01

    Filamentous fungi have received attentions as hosts for heterologous protein production because of their high secretion capability and eukaryotic post-translational modifications. One of the safest hosts for heterologous protein production is Koji mold Aspergillus oryzae since it has been used in the production of Japanese fermented foods for over 1,000 years. The production levels of proteins from higher eukaryotes are much lower than those of homologous (fungal) proteins. Bottlenecks in the heterologous protein production are suggested to be proteolytic degradation of the produced protein in the medium and the secretory pathway. For construction of excellent host strains, many genes causing the bottlenecks should be disrupted rapidly and efficiently. We developed a marker recycling system with the highly efficient gene-targeting background in A. oryzae. By employing this technique, we performed multiple gene disruption of the ten protease genes. The decuple protease gene disruptant showed fourfold production level of a heterologous protein compared with the wild-type strain.

  17. Retinoschisislike alterations in the mouse eye caused by gene targeting of the Norrie disease gene.

    PubMed

    Ruether, K; van de Pol, D; Jaissle, G; Berger, W; Tornow, R P; Zrenner, E

    1997-03-01

    To investigate the retinal function and morphology of mice carrying a replacement mutation in exon 2 of the Norrie disease gene. Recently, Norrie disease mutant mice have been generated using gene targeting technology. The mutation removes the 56 N-terminal amino acids of the Norrie gene product. Ganzfeld electroretinograms (ERGs) were obtained in five animals hemizygous or homozygous for the mutant gene and in three female animals heterozygous for the mutant gene. As controls, three males carrying the wild-type gene were examined. Electroretinogram testing included rod a- and b-wave V-log I functions, oscillatory potentials, and cone responses. The fundus morphology has been visualized by scanning laser ophthalmoscopy. Rod and cone ERG responses and fundus morphology were not significantly different among female heterozygotes and wild-type mice. In contrast, the hemizygous mice displayed a severe loss of ERG b-wave, leading to a negatively shaped scotopic ERG and a marked reduction of oscillatory potentials. The a-wave was normal at low intensities, and only with brighter flashes was there a moderate amplitude loss. Cone amplitudes were barely recordable in the gene-targeted males. Ophthalmoscopy revealed snowflakelike vitreal changes, retinoschisis, and pigment epithelium irregularities in hemizygotes and homozygotes, but no changes in female heterozygotes. The negatively shaped scotopic ERG in male mice with a Norrie disease gene mutation probably was caused by retinoschisis. Pigment epithelial changes and degenerations of the outer retina are relatively mild. These findings may be a clue to the embryonal retinoschisislike pathogenesis of Norrie disease in humans or it may indicate a different expression of the Norrie disease gene defect in mice compared to that in humans.

  18. Amastin Knockdown in Leishmania braziliensis Affects Parasite-Macrophage Interaction and Results in Impaired Viability of Intracellular Amastigotes.

    PubMed

    de Paiva, Rita Marcia Cardoso; Grazielle-Silva, Viviane; Cardoso, Mariana Santos; Nakagaki, Brenda Naemi; Mendonça-Neto, Rondon Pessoa; Canavaci, Adriana Monte Cassiano; Souza Melo, Normanda; Martinelli, Patrícia Massara; Fernandes, Ana Paula; daRocha, Wanderson Duarte; Teixeira, Santuza M R

    2015-12-01

    Leishmaniasis, a human parasitic disease with manifestations ranging from cutaneous ulcerations to fatal visceral infection, is caused by several Leishmania species. These protozoan parasites replicate as extracellular, flagellated promastigotes in the gut of a sandfly vector and as amastigotes inside the parasitophorous vacuole of vertebrate host macrophages. Amastins are surface glycoproteins encoded by large gene families present in the genomes of several trypanosomatids and highly expressed in the intracellular amastigote stages of Trypanosoma cruzi and Leishmania spp. Here, we showed that the genome of L. braziliensis contains 52 amastin genes belonging to all four previously described amastin subfamilies and that the expression of members of all subfamilies is upregulated in L. braziliensis amastigotes. Although primary sequence alignments showed no homology to any known protein sequence, homology searches based on secondary structure predictions indicate that amastins are related to claudins, a group of proteins that are components of eukaryotic tight junction complexes. By knocking-down the expression of δ-amastins in L. braziliensis, their essential role during infection became evident. δ-amastin knockdown parasites showed impaired growth after in vitro infection of mouse macrophages and completely failed to produce infection when inoculated in BALB/c mice, an attenuated phenotype that was reverted by the re-expression of an RNAi-resistant amastin gene. Further highlighting their essential role in host-parasite interactions, electron microscopy analyses of macrophages infected with amastin knockdown parasites showed significant alterations in the tight contact that is normally observed between the surface of wild type amastigotes and the membrane of the parasitophorous vacuole.

  19. Alpha2,3-sialyltransferase III knockdown sensitized ovarian cancer cells to cisplatin-induced apoptosis.

    PubMed

    Wang, Xiaoyu; Zhang, Yiting; Lin, Haiyingjie; Liu, Yan; Tan, Yi; Lin, Jie; Gao, Fenze; Lin, Shaoqiang

    2017-01-22

    Emerging evidence indicates that β-galactoside-α2,3-sialyltransferase III (ST3Gal3) involves in development, inflammation, neoplastic transformation, and metastasis. However, the role of ST3Gal3 in regulating cancer chemoresistance remains elusive. Herein, we investigated the functional effects of ST3Gal3 in cisplatin-resistant ovarian cancer cells. We found that the levels of ST3Gal3 mRNA differed significantly among ovarian cancer cell lines. HO8910PM cells that have high invasive and metastatic capacity express elevated ST3Gal3 mRNA and are resistant to cisplatin, comparing to SKOV3 cells that have a lower level of ST3Gal3 expression and are more chemosensitive to cisplatin. We found that the expression of ST3Gal3 has reverse correlation with the dosage of cisplatin used in both SKOV3 and HO8910PM cells, and high dose of cisplatin could down-regulate ST3Gal3 expression. We then examined the functional effects of ST3Gal3 knockdown in cancer cell lines using FACS analysis. The number of apoptotic cells was much higher in cells if ST3Gal3 expression was knocked down by siRNA and/or by treating cells with higher dosage of cisplatin in comparison to control cells. Interestingly, in HO8910PM cells with ST3Gal3 knockdown, the levels of caspase 8 and caspase 3 proteins increased, which was more obvious in cells treated with both ST3Gal3 knockdown and cisplatin, suggesting that ST3Gal3 knockdown synergistically enhanced cisplatin-induced apoptosis in ovarian cancer cells. Taken together, these results uncover an alternative mechanism of cisplatin-resistance through ST3Gal3 and open a window for effective prevention of chemoresistance and relapse of ovarian cancer by targeting ST3Gal3. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. MiR-22 is frequently downregulated in medulloblastomas and inhibits cell proliferation via the novel target PAPST1.

    PubMed

    Xu, Qing-Fu; Pan, Ya-Wen; Li, Li-Chao; Zhou, Zheng; Huang, Qi-Lin; Pang, Jesse Chung-Sean; Zhu, Xiao-Peng; Ren, Yong; Yang, Hui; Ohgaki, Hiroko; Lv, Sheng-Qing

    2014-11-01

    Medulloblastoma is the most frequent malignant central nervous system tumor in children. MicroRNAs (miRs) are small, non-coding RNAs that target protein-coding and non-coding RNAs, and play roles in a variety of cellular processes through regulation of multiple targets. In the present study, we analyzed miR-22 expression and its effect in cell proliferation and apoptosis in medulloblastomas. Quantitative reverse transcription PCR (RT-PCR) revealed significantly lower expression of miR-22 in 19 out of 27 (70%) medulloblastomas, D341, DAOY, ONS-76 medulloblastoma cell lines, compared with normal cerebellum. Forced expression of miR-22 by lentiviral vector transfection reduced cell proliferation and induced apoptosis, while knockdown of miR-22 increased proliferative activity in DAOY and ONS-76 cells. DAOY cells with miR-22 overexpression in nude mice yielded tumors smaller than those originated from control DAOY cells. Microarray analysis in DAOY cells with forced miR-22 expression showed significant changes in expression profiles, PAPST1 being the most significantly (10 folds) downregulated gene. Quantitative RT-PCR revealed PAPST1 mRNA upregulation in 18 out of 27 (67%) medulloblastomas. In addition, a luciferase reporter assay in ONS-76 and DAOY cells suggested that miR-22 directly targets the PAPST1 gene, and lentivirus-mediated knockdown of PAPST1 suppressed proliferation of DAOY and ONS-76 medulloblastoma cells. These results suggest that frequently downregulated miR-22 expression is associated with cell proliferation in medulloblastomas, and this may be at least in part via PAPST1, which is a novel target of miR-22. © 2014 International Society of Neuropathology.

  1. In vivo Discovery of Immunotherapy Targets in the Tumor Microenvironment

    PubMed Central

    Zhou, Penghui; Shaffer, Donald R.; Arias, Diana A. Alvarez; Nakazaki, Yukoh; Pos, Wouter; Torres, Alexis J.; Cremasco, Viviana; Dougan, Stephanie K.; Cowley, Glenn S.; Elpek, Kutlu; Brogdon, Jennifer; Lamb, John; Turley, Shannon; Ploegh, Hidde L.; Root, David E.; Love, J. Christopher; Dranoff, Glenn; Hacohen, Nir; Cantor, Harvey; Wucherpfennig, Kai W.

    2014-01-01

    Recent clinical trials showed that targeting of inhibitory receptors on T cells induces durable responses in a subset of cancer patients, despite advanced disease. However, the regulatory switches controlling T cell function in immunosuppressive tumors are not well understood. Here we show that such inhibitory mechanisms can be systematically discovered in the tumor microenvironment. We devised an in vivo pooled shRNA screen in which shRNAs targeting negative regulators became highly enriched in tumors by releasing a block on T cell proliferation upon tumor antigen recognition. Such shRNAs were identified by deep sequencing of the shRNA cassette from T cells infiltrating tumor or control tissues. One of the target genes was Ppp2r2d, a regulatory subunit of the PP2A phosphatase family: In tumors, Ppp2r2d knockdown inhibited T cell apoptosis and enhanced T cell proliferation as well as cytokine production. Key regulators of immune function can thus be discovered in relevant tissue microenvironments. PMID:24476824

  2. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

  3. Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

    PubMed

    Byrne, Susan M; Church, George M

    2015-01-01

    CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

  4. CDC2 Mediates Progestin Initiated Endometrial Stromal Cell Proliferation: A PR Signaling to Gene Expression Independently of Its Binding to Chromatin

    PubMed Central

    Vallejo, Griselda; Mestre-Citrinovitz, Ana C.; Ballaré, Cecilia; Beato, Miguel; Saragüeta, Patricia

    2014-01-01

    Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the peri-implantation phase of pregnancy. We showed that picomolar concentration of progestin R5020 mimics this control in UIII endometrial stromal cells via ERK1-2 and AKT activation mediated by interaction of Progesterone Receptor (PR) with Estrogen Receptor beta (ERb) and without transcriptional activity of endogenous PR and ER. Here we identify early downstream targets of cytoplasmic PR signaling and their possible role in endometrial stromal cell proliferation. Microarray analysis of global gene expression changes in UIII cells treated for 45 min with progestin identified 97 up- and 341 down-regulated genes. The most over-represented molecular functions were transcription factors and regulatory factors associated with cell proliferation and cell cycle, a large fraction of which were repressors down-regulated by hormone. Further analysis verified that progestins regulate Ccnd1, JunD, Usf1, Gfi1, Cyr61, and Cdkn1b through PR-mediated activation of ligand-free ER, ERK1-2 or AKT, in the absence of genomic PR binding. ChIP experiments show that progestin promoted the interaction of USF1 with the proximal promoter of the Cdc2 gene. Usf1 knockdown abolished Cdc2 progestin-dependent transcriptional regulation and cell proliferation, which also blocked Cdc2 knockdown. We conclude that progestin-induced proliferation of endometrial stromal cells is mediated by ERK1-2 and AKT dependent early regulation of USF1, which directly induces Cdc2. To our knowledge, this is the first description of early target genes of progestin-activated classical PR via crosstalk with protein kinases and independently of hormone receptor binding to the genomic targets. PMID:24859236

  5. Hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation system for cancer gene therapy

    PubMed Central

    Javan, Bita; Shahbazi, Majid

    2017-01-01

    Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809

  6. Silencing a sugar transporter gene reduces growth and fecundity in the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae).

    PubMed

    Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai

    2015-07-17

    The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.

  7. Liver as a target for oligonucleotide therapeutics.

    PubMed

    Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

    2013-12-01

    Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to

  8. Identification of regulatory targets of tissue-specific transcription factors: application to retina-specific gene regulation

    PubMed Central

    Qian, Jiang; Esumi, Noriko; Chen, Yangjian; Wang, Qingliang; Chowers, Itay; Zack, Donald J.

    2005-01-01

    Identification of tissue-specific gene regulatory networks can yield insights into the molecular basis of a tissue's development, function and pathology. Here, we present a computational approach designed to identify potential regulatory target genes of photoreceptor cell-specific transcription factors (TFs). The approach is based on the hypothesis that genes related to the retina in terms of expression, disease and/or function are more likely to be the targets of retina-specific TFs than other genes. A list of genes that are preferentially expressed in retina was obtained by integrating expressed sequence tag, SAGE and microarray datasets. The regulatory targets of retina-specific TFs are enriched in this set of retina-related genes. A Bayesian approach was employed to integrate information about binding site location relative to a gene's transcription start site. Our method was applied to three retina-specific TFs, CRX, NRL and NR2E3, and a number of potential targets were predicted. To experimentally assess the validity of the bioinformatic predictions, mobility shift, transient transfection and chromatin immunoprecipitation assays were performed with five predicted CRX targets, and the results were suggestive of CRX regulation in 5/5, 3/5 and 4/5 cases, respectively. Together, these experiments strongly suggest that RP1, GUCY2D, ABCA4 are novel targets of CRX. PMID:15967807

  9. miR-26a suppresses autophagy in swine Sertoli cells by targeting ULK2.

    PubMed

    Ran, M; Li, Z; Cao, R; Weng, B; Peng, F; He, C; Chen, B

    2018-05-14

    A large number of microRNAs (miRNAs) have been detected from porcine testicular tissues thanks to the development of high-throughput sequencing technology. However, the regulatory roles of most identified miRNAs in swine testicular development or spermatogenesis are poorly understood. In our previous study, ULK2 (uncoordinated-51-like kinase 2) was predicted as a target gene of miR-26a. In this study, we aimed to investigate the role of miR-26a in swine Sertoli cell autophagy. The relative expression of miR-26a and ULK2 levels has a significant negative correlation (R 2  = .5964, p ≤ .01) in nine developmental stages of swine testicular tissue. Dual-luciferase reporter assay results show that miR-26a directly targets the 3'UTR of the ULK2 gene (position 618-624). In addition, both the mRNA and protein expression of ULK2 were downregulated by miR-26a in swine Sertoli cells. These results indicate that miR-26a targets the ULK2 gene and downregulates its expression in swine Sertoli cells. Based on the expression of marker genes (LC3, p62 and Beclin-1), overexpression of miR-26a or knock-down of ULK2 inhibits swine Sertoli cell autophagy. Taken together, these findings demonstrate that miR-26a suppresses autophagy in swine Sertoli cells by targeting ULK2. © 2018 Blackwell Verlag GmbH.

  10. RNAi-mediated disruption of neuropeptide genes, nlp-3 and nlp-12, cause multiple behavioral defects in Meloidogyne incognita.

    PubMed

    Dash, Manoranjan; Dutta, Tushar K; Phani, Victor; Papolu, Pradeep K; Shivakumara, Tagginahalli N; Rao, Uma

    2017-08-26

    Owing to the current deficiencies in chemical control options and unavailability of novel management strategies, root-knot nematode (M. incognita) infections remain widespread with significant socio-economic impacts. Helminth nervous systems are peptide-rich and appear to be putative drug targets that could be exploited by antihelmintic chemotherapy. Herein, to characterize the novel peptidergic neurotransmitters, in silico mining of M. incognita genomic and transciptomic datasets revealed the presence of 16 neuropeptide-like protein (nlp) genes with structural hallmarks of neuropeptide preproproteins; among which 13 nlps were PCR-amplified and sequenced. Two key nlp genes (Mi-nlp-3 and Mi-nlp-12) were localized to the basal bulb and tail region of nematode body via in situ hybridization assay. Mi-nlp-3 and Mi-nlp-12 were greatly expressed (in qRT-PCR assay) in the pre-parasitic juveniles and adult females, suggesting the association of these genes in host recognition, development and reproduction of M. incognita. In vitro knockdown of Mi-nlp-3 and Mi-nlp-12 via RNAi demonstrated the significant reduction in attraction and penetration of M. incognita in tomato root in Pluronic gel medium. A pronounced perturbation in development and reproduction of NLP-silenced worms was also documented in adzuki beans in CYG growth pouches. The deleterious phenotypes obtained due to NLP knockdown suggests that transgenic plants engineered to express RNA constructs targeting nlp genes may emerge as an environmentally viable option to manage nematode problems in crop plants. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Ultrasound-Mediated Vascular Gene Transfection by Cavitation of Endothelial-Targeted Cationic Microbubbles

    PubMed Central

    Xie, Aris; Belcik, Todd; Qi, Yue; Morgan, Terry K.; Champaneri, Shivam A.; Taylor, Sarah; Davidson, Brian P.; Zhao, Yan; Klibanov, Alexander L.; Kuliszewski, Michael A.; Leong-Poi, Howard; Ammi, Azzdine; Lindner, Jonathan R.

    2013-01-01

    OBJECTIVES Ultrasound-mediated gene delivery can be amplified by acoustic disruption of microbubble carriers that undergo cavitation. We hypothesized that endothelial targeting of microbubbles bearing cDNA is feasible and, through optimizing proximity to the vessel wall, increases the efficacy of gene transfection. BACKGROUND Contrast ultrasound-mediated gene delivery is a promising approach for site-specific gene therapy, although there are concerns with the reproducibility of this technique and the safety when using high-power ultrasound. METHODS Cationic lipid-shelled decafluorobutane microbubbles bearing a targeting moiety were prepared and compared with nontargeted microbubbles. Microbubble targeting efficiency to endothelial adhesion molecules (P-selectin or intercellular adhesion molecule [ICAM]-1) was tested using in vitro flow chamber studies, intravital microscopy of tumor necrosis factor-alpha (TNF-α)–stimulated murine cremaster muscle, and targeted contrast ultrasound imaging of P-selectin in a model of murine limb ischemia. Ultrasound-mediated transfection of luciferase reporter plasmid charge coupled to microbubbles in the post-ischemic hindlimb muscle was assessed by in vivo optical imaging. RESULTS Charge coupling of cDNA to the microbubble surface was not influenced by the presence of targeting ligand, and did not alter the cavitation properties of cationic microbubbles. In flow chamber studies, surface conjugation of cDNA did not affect attachment of targeted microbubbles at microvascular shear stresses (0.6 and 1.5 dyne/cm2). Attachment in vivo was also not affected by cDNA according to intravital microscopy observations of venular adhesion of ICAM-1–targeted microbubbles and by ultrasound molecular imaging of P-selectin–targeted microbubbles in the post-ischemic hindlimb in mice. Transfection at the site of high acoustic pressures (1.0 and 1.8 MPa) was similar for control and P-selectin–targeted microbubbles but was associated with

  12. Folic-Acid-Targeted Self-Assembling Supramolecular Carrier for Gene Delivery.

    PubMed

    Liao, Rongqiang; Yi, Shouhui; Liu, Manshuo; Jin, Wenling; Yang, Bo

    2015-07-27

    A targeting gene carrier for cancer-specific delivery was successfully developed through a "multilayer bricks-mortar" strategy. The gene carrier was composed of adamantane-functionalized folic acid (FA-AD), an adamantane-functionalized poly(ethylene glycol) derivative (PEG-AD), and β-cyclodextrin-grafted low-molecular-weight branched polyethylenimine (PEI-CD). Carriers produced by two different self-assembly schemes, involving either precomplexation of the PEI-CD with the FA-AD and PEG-AD before pDNA condensation (Method A) or pDNA condensation with the PEI-CD prior to addition of the FA-AD and PEG-AD to engage host-guest complexation (Method B) were investigated for their ability to compact pDNA into nanoparticles. Cell viability studies show that the material produced by the Method A assembly scheme has lower cytotoxicity than branched PEI 25 kDa (PEI-25KD) and that the transfection efficiency is maintained. These findings suggest that the gene carrier, based on multivalent host-guest interactions, could be an effective, targeted, and low-toxicity carrier for delivering nucleic acid to target cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Neuromedin U receptor 2 knockdown in the paraventricular nucleus modifies behavioral responses to obesogenic high-fat food and leads to increased body weight.

    PubMed

    Benzon, C R; Johnson, S B; McCue, D L; Li, D; Green, T A; Hommel, J D

    2014-01-31

    Neuromedin U (NMU) is a highly conserved neuropeptide which regulates food intake and body weight. Transgenic mice lacking NMU are hyperphagic and obese, making NMU a novel target for understanding and treating obesity. Neuromedin U receptor 2 (NMUR2) is a high-affinity receptor for NMU found in discrete regions of the central nervous system, in particular the paraventricular nucleus of the hypothalamus (PVN), where it may be responsible for mediating the anorectic effects of NMU. We hypothesized that selective knock down of NMUR2 in the PVN of rats would increase their sensitivity to the reinforcing properties of food resulting in increased intake and preference for high-fat obesogenic food. To this end, we used viral-mediated RNAi to selectively knock down NMUR2 gene expression in the PVN. In rats fed a standard chow, NMUR2 knockdown produced no significant effect on food intake or body weight. However, when the same rats were fed a high-fat diet (45% fat), they consumed significantly more food, gained more body weight, and had increased feed efficiency relative to controls. Furthermore, NMUR2 knockdown rats demonstrated significantly greater binge-type food consumption of the high-fat diet and showed a greater preference for higher-fat food. These results demonstrate that NMUR2 signaling in the PVN regulates consumption and preference for high-fat foods without disrupting feeding behavior associated with non-obesogenic standard chow. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. EVI1, a target gene for amplification at 3q26, antagonizes transforming growth factor-β-mediated growth inhibition in hepatocellular carcinoma

    PubMed Central

    Yasui, Kohichiroh; Konishi, Chika; Gen, Yasuyuki; Endo, Mio; Dohi, Osamu; Tomie, Akira; Kitaichi, Tomoko; Yamada, Nobuhisa; Iwai, Naoto; Nishikawa, Taichiro; Yamaguchi, Kanji; Moriguchi, Michihisa; Sumida, Yoshio; Mitsuyoshi, Hironori; Tanaka, Shinji; Arii, Shigeki; Itoh, Yoshito

    2015-01-01

    EVI1 (ecotropic viral integration site 1) is one of the most aggressive oncogenes associated with myeloid leukemia. We investigated DNA copy number aberrations in human hepatocellular carcinoma (HCC) cell lines using a high-density oligonucleotide microarray. We found that a novel amplification at the chromosomal region 3q26 occurs in the HCC cell line JHH-1, and that MECOM (MDS1 and EVI1 complex locus), which lies within the 3q26 region, was amplified. Quantitative PCR analysis of the three transcripts transcribed from MECOM indicated that only EVI1, but not the fusion transcript MDS1–EVI1 or MDS1, was overexpressed in JHH-1 cells and was significantly upregulated in 22 (61%) of 36 primary HCC tumors when compared with their non-tumorous counterparts. A copy number gain of EVI1 was observed in 24 (36%) of 66 primary HCC tumors. High EVI1 expression was significantly associated with larger tumor size and higher level of des-γ-carboxy prothrombin, a tumor marker for HCC. Knockdown of EVI1 resulted in increased induction of the cyclin-dependent kinase inhibitor p15INK4B by transforming growth factor (TGF)-β and decreased expression of c-Myc, cyclin D1, and phosphorylated Rb in TGF-β-treated cells. Consequently, knockdown of EVI1 led to reduced DNA synthesis and cell viability. Collectively, our results suggest that EVI1 is a probable target gene that acts as a driving force for the amplification at 3q26 in HCC and that the oncoprotein EVI1 antagonizes TGF-β-mediated growth inhibition of HCC cells. PMID:25959919

  15. Evaluation of Acanthamoeba Myosin-IC as a Potential Therapeutic Target

    PubMed Central

    Lorenzo-Morales, Jacob; López-Arencibia, Atteneri; Reyes-Batlle, María; Piñero, José E.; Valladares, Basilio; Maciver, Sutherland K.

    2014-01-01

    Members of the genus Acanthamoeba are facultative pathogens of humans, causing a sight-threatening keratitis and a fatal encephalitis. We have targeted myosin-IC by using small interfering RNA (siRNA) silencing as a therapeutic approach, since it is known that the function of this protein is vital for the amoeba. In this work, specific siRNAs against the Acanthamoeba myosin-IC gene were developed. Treated and control amoebae were cultured in growth and encystment media to evaluate the induced effects after myosin-IC gene knockdown, as we have anticipated that cyst formation may be impaired. The effects of myosin-IC gene silencing were inhibition of cyst formation, inhibition of completion of cytokinesis, inhibition of osmoregulation under osmotic stress conditions, and death of the amoebae. The finding that myosin-IC silencing caused incompletion of cytokinesis is in agreement with earlier suggestions that the protein plays a role in cell locomotion, which is necessary to pull daughter cells apart after mitosis in a process known as “traction-mediated cytokinesis”. We conclude that myosin-IC is a very promising potential drug target for the development of much-needed antiamoebal drugs and that it should be further exploited for Acanthamoeba therapy. PMID:24468784

  16. Involvement of the Anopheles gambiae Nimrod gene family in mosquito immune responses.

    PubMed

    Estévez-Lao, Tania Y; Hillyer, Julián F

    2014-01-01

    Insects fight infection using a variety of signaling pathways and immune effector proteins. In Drosophila melanogaster, three members of the Nimrod gene family (draper, nimC1 and eater) bind bacteria, and this binding leads to phagocytosis by hemocytes. The Nimrod gene family has since been identified in other insects, but their function in non-drosophilids remains unknown. The purpose of this study was to identify the members of the Nimrod gene family in the malaria mosquito, Anopheles gambiae, and to assess their role in immunity. We identified and sequenced three members of this gene family, herein named draper, nimrod and eater, which are the orthologs of D. melanogaster draper, nimB2 and eater, respectively. The three genes are preferentially expressed in hemocytes and their peak developmental expression is in pupae and young adults. Infection induces the transcriptional upregulation of all three genes, but the magnitude of this upregulation becomes more attenuated as mosquitoes become older. RNAi-based knockdown of eater, but not draper or nimrod, decreased a mosquito's ability to kill Escherichia coli in the hemocoel. Knockdown of draper, eater, or any combination of Nimrod family genes rendered mosquitoes more likely to die from Staphylococcus epidermidis. Finally, knockdown of Nimrod family genes did not impact mRNA levels of the antimicrobial peptides defensin (def1), cecropin (cecA) or gambicin (gam1), but eater knockdown led to a decrease in mRNA levels of nitric oxide synthase. Together, these data show that members of the A. gambiae Nimrod gene family are positive regulators of the mosquito antibacterial response. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. An increase in liver PPARγ2 is an initial event to induce fatty liver in response to a diet high in butter: PPARγ2 knockdown improves fatty liver induced by high-saturated fat.

    PubMed

    Yamazaki, Tomomi; Shiraishi, Sayaka; Kishimoto, Kyoko; Miura, Shinji; Ezaki, Osamu

    2011-06-01

    The effects of a diet rich in saturated fat on fatty liver formation and the related mechanisms that induce fatty liver were examined. C57BL/6J mice were fed butter or safflower oil as a high-fat (HF) diet (40% fat calories) for 2, 4, 10, or 17 weeks. Although both HF diets induced similar levels of obesity, HF butter-fed mice showed a two to threefold increase in liver triacylglycerol (TG) concentration compared to HF safflower oil-fed mice at 4 or 10 weeks without hyperinsulinemia. At 4 weeks, increases in peroxisome proliferator-activated receptor γ2 (PPARγ2), CD36, and adipose differentiation-related protein (ADRP) mRNAs were observed in HF butter-fed mice; at 10 weeks, an increase in sterol regulatory element-binding protein-1c (SREBP-1c) was observed; at 17 weeks, these increases were attenuated. At 4 weeks, a single injection of adenoviral vector-based short hairpin interfering RNA against PPARγ2 in HF butter-fed mice reduced PPARγ protein and mRNA of its target genes (CD36 and ADRP) by 43%, 43%, and 39%, respectively, with a reduction in liver TG concentration by 38% in 5 days. PPARγ2 knockdown also reduced mRNAs in lipogenic genes (fatty-acid-synthase, stearoyl-CoA desaturase 1, acetyl-CoA carboxylase 1) without alteration of SREBP-1c mRNA. PPARγ2 knockdown reduced mRNAs in genes related to inflammation (CD68, interleukin-1β, tumor necrosis factor-α, and monocyte chemoattractant protein-1). In conclusion, saturated fatty acid-rich oil induced fatty liver in mice, and this was triggered initially by an increase in PPARγ2 protein in the liver, which led to increased expression of lipogenic genes. Inactivation of PPARγ2 may improve fatty liver induced by HF saturated fat. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Engineering liposomal nanoparticles for targeted gene therapy.

    PubMed

    Zylberberg, C; Gaskill, K; Pasley, S; Matosevic, S

    2017-08-01

    Recent mechanistic studies have attempted to deepen our understanding of the process by which liposome-mediated delivery of genetic material occurs. Understanding the interactions between lipid nanoparticles and cells is still largely elusive. Liposome-mediated delivery of genetic material faces systemic obstacles alongside entry into the cell, endosomal escape, lysosomal degradation and nuclear uptake. Rational design approaches for targeted delivery have been developed to reduce off-target effects and enhance transfection. These strategies, which have included the modification of lipid nanoparticles with target-specific ligands to enhance intracellular uptake, have shown significant promise at the proof-of-concept stage. Control of physical and chemical specifications of liposome composition, which includes lipid-to-DNA charge, size, presence of ester bonds, chain length and nature of ligand complexation, is integral to the performance of targeted liposomes as genetic delivery agents. Clinical advances are expected to rely on such systems in the therapeutic application of liposome nanoparticle-based gene therapy. Here, we discuss the latest breakthroughs in the development of targeted liposome-based agents for the delivery of genetic material, paying particular attention to new ligand and cationic lipid design as well as recent in vivo advances.

  19. CRISPR/Cas9-mediated gene knockout screens and target identification via whole-genome sequencing uncover host genes required for picornavirus infection.

    PubMed

    Kim, Heon Seok; Lee, Kyungjin; Bae, Sangsu; Park, Jeongbin; Lee, Chong-Kyo; Kim, Meehyein; Kim, Eunji; Kim, Minju; Kim, Seokjoong; Kim, Chonsaeng; Kim, Jin-Soo

    2017-06-23

    Several groups have used genome-wide libraries of lentiviruses encoding small guide RNAs (sgRNAs) for genetic screens. In most cases, sgRNA expression cassettes are integrated into cells by using lentiviruses, and target genes are statistically estimated by the readout of sgRNA sequences after targeted sequencing. We present a new virus-free method for human gene knockout screens using a genome-wide library of CRISPR/Cas9 sgRNAs based on plasmids and target gene identification via whole-genome sequencing (WGS) confirmation of authentic mutations rather than statistical estimation through targeted amplicon sequencing. We used 30,840 pairs of individually synthesized oligonucleotides to construct the genome-scale sgRNA library, collectively targeting 10,280 human genes ( i.e. three sgRNAs per gene). These plasmid libraries were co-transfected with a Cas9-expression plasmid into human cells, which were then treated with cytotoxic drugs or viruses. Only cells lacking key factors essential for cytotoxic drug metabolism or viral infection were able to survive. Genomic DNA isolated from cells that survived these challenges was subjected to WGS to directly identify CRISPR/Cas9-mediated causal mutations essential for cell survival. With this approach, we were able to identify known and novel genes essential for viral infection in human cells. We propose that genome-wide sgRNA screens based on plasmids coupled with WGS are powerful tools for forward genetics studies and drug target discovery. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION

    PubMed Central

    LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.

    2012-01-01

    Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte

  1. Drug2Gene: an exhaustive resource to explore effectively the drug-target relation network.

    PubMed

    Roider, Helge G; Pavlova, Nadia; Kirov, Ivaylo; Slavov, Stoyan; Slavov, Todor; Uzunov, Zlatyo; Weiss, Bertram

    2014-03-11

    Information about drug-target relations is at the heart of drug discovery. There are now dozens of databases providing drug-target interaction data with varying scope, and focus. Therefore, and due to the large chemical space, the overlap of the different data sets is surprisingly small. As searching through these sources manually is cumbersome, time-consuming and error-prone, integrating all the data is highly desirable. Despite a few attempts, integration has been hampered by the diversity of descriptions of compounds, and by the fact that the reported activity values, coming from different data sets, are not always directly comparable due to usage of different metrics or data formats. We have built Drug2Gene, a knowledge base, which combines the compound/drug-gene/protein information from 19 publicly available databases. A key feature is our rigorous unification and standardization process which makes the data truly comparable on a large scale, allowing for the first time effective data mining in such a large knowledge corpus. As of version 3.2, Drug2Gene contains 4,372,290 unified relations between compounds and their targets most of which include reported bioactivity data. We extend this set with putative (i.e. homology-inferred) relations where sufficient sequence homology between proteins suggests they may bind to similar compounds. Drug2Gene provides powerful search functionalities, very flexible export procedures, and a user-friendly web interface. Drug2Gene v3.2 has become a mature and comprehensive knowledge base providing unified, standardized drug-target related information gathered from publicly available data sources. It can be used to integrate proprietary data sets with publicly available data sets. Its main goal is to be a 'one-stop shop' to identify tool compounds targeting a given gene product or for finding all known targets of a drug. Drug2Gene with its integrated data set of public compound-target relations is freely accessible without

  2. Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis

    PubMed Central

    Chen, Zhen; Lai, Tsung-Ching; Jan, Yi-Hua; Lin, Feng-Mao; Wang, Wei-Chi; Xiao, Han; Wang, Yun-Ting; Sun, Wei; Cui, Xiaopei; Li, Ying-Shiuan; Fang, Tzan; Zhao, Hongwei; Padmanabhan, Chellappan; Sun, Ruobai; Wang, Danny Ling; Jin, Hailing; Chau, Gar-Yang; Huang, Hsien-Da; Hsiao, Michael; Shyy, John Y-J.

    2013-01-01

    Despite a general repression of translation under hypoxia, cells selectively upregulate a set of hypoxia-inducible genes. Results from deep sequencing revealed that Let-7 and miR-103/107 are hypoxia-responsive microRNAs (HRMs) that are strongly induced in vascular endothelial cells. In silico bioinformatics and in vitro validation showed that these HRMs are induced by HIF1α and target argonaute 1 (AGO1), which anchors the microRNA-induced silencing complex (miRISC). HRM targeting of AGO1 resulted in the translational desuppression of VEGF mRNA. Inhibition of HRM or overexpression of AGO1 without the 3′ untranslated region decreased hypoxia-induced angiogenesis. Conversely, AGO1 knockdown increased angiogenesis under normoxia in vivo. In addition, data from tumor xenografts and human cancer specimens indicate that AGO1-mediated translational desuppression of VEGF may be associated with tumor angiogenesis and poor prognosis. These findings provide evidence for an angiogenic pathway involving HRMs that target AGO1 and suggest that this pathway may be a suitable target for anti- or proangiogenesis strategies. PMID:23426184

  3. Dual CRISPR-Cas9 Cleavage Mediated Gene Excision and Targeted Integration in Yarrowia lipolytica.

    PubMed

    Gao, Difeng; Smith, Spencer; Spagnuolo, Michael; Rodriguez, Gabriel; Blenner, Mark

    2018-05-29

    CRISPR-Cas9 technology has been successfully applied in Yarrowia lipolytica for targeted genomic editing including gene disruption and integration; however, disruptions by existing methods typically result from small frameshift mutations caused by indels within the coding region, which usually resulted in unnatural protein. In this study, a dual cleavage strategy directed by paired sgRNAs is developed for gene knockout. This method allows fast and robust gene excision, demonstrated on six genes of interest. The targeted regions for excision vary in length from 0.3 kb up to 3.5 kb and contain both non-coding and coding regions. The majority of the gene excisions are repaired by perfect nonhomologous end-joining without indel. Based on this dual cleavage system, two targeted markerless integration methods are developed by providing repair templates. While both strategies are effective, homology mediated end joining (HMEJ) based method are twice as efficient as homology recombination (HR) based method. In both cases, dual cleavage leads to similar or improved gene integration efficiencies compared to gene excision without integration. This dual cleavage strategy will be useful for not only generating more predictable and robust gene knockout, but also for efficient targeted markerless integration, and simultaneous knockout and integration in Y. lipolytica. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Antibiotic Combinations That Enable One-Step, Targeted Mutagenesis of Chromosomal Genes.

    PubMed

    Lee, Wonsik; Do, Truc; Zhang, Ge; Kahne, Daniel; Meredith, Timothy C; Walker, Suzanne

    2018-06-08

    Targeted modification of bacterial chromosomes is necessary to understand new drug targets, investigate virulence factors, elucidate cell physiology, and validate results of -omics-based approaches. For some bacteria, reverse genetics remains a major bottleneck to progress in research. Here, we describe a compound-centric strategy that combines new negative selection markers with known positive selection markers to achieve simple, efficient one-step genome engineering of bacterial chromosomes. The method was inspired by the observation that certain nonessential metabolic pathways contain essential late steps, suggesting that antibiotics targeting a late step can be used to select for the absence of genes that control flux into the pathway. Guided by this hypothesis, we have identified antibiotic/counterselectable markers to accelerate reverse engineering of two increasingly antibiotic-resistant pathogens, Staphylococcus aureus and Acinetobacter baumannii. For S. aureus, we used wall teichoic acid biosynthesis inhibitors to select for the absence of tarO and for A. baumannii, we used colistin to select for the absence of lpxC. We have obtained desired gene deletions, gene fusions, and promoter swaps in a single plating step with perfect efficiency. Our method can also be adapted to generate markerless deletions of genes using FLP recombinase. The tools described here will accelerate research on two important pathogens, and the concept we outline can be readily adapted to any organism for which a suitable target pathway can be identified.

  5. Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams.

    PubMed

    Centanni, Tracy Michelle; Booker, Anne B; Chen, Fuyi; Sloan, Andrew M; Carraway, Ryan S; Rennaker, Robert L; LoTurco, Joseph J; Kilgard, Michael P

    2016-04-27

    Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC-) before any behavioral training. A separate group of 8 rats (3 DC-) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing

  6. Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams

    PubMed Central

    Booker, Anne B.; Chen, Fuyi; Sloan, Andrew M.; Carraway, Ryan S.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.

    2016-01-01

    Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC−) before any behavioral training. A separate group of 8 rats (3 DC−) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. SIGNIFICANCE STATEMENT Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of

  7. A Cellular High-Throughput Screening Approach for Therapeutic trans-Cleaving Ribozymes and RNAi against Arbitrary mRNA Disease Targets

    PubMed Central

    Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.

    2016-01-01

    Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a

  8. Inducible Knock-Down of the Mineralocorticoid Receptor in Mice Disturbs Regulation of the Renin-Angiotensin-Aldosterone System and Attenuates Heart Failure Induced by Pressure Overload.

    PubMed

    Montes-Cobos, Elena; Li, Xiao; Fischer, Henrike J; Sasse, André; Kügler, Sebastian; Didié, Michael; Toischer, Karl; Fassnacht, Martin; Dressel, Ralf; Reichardt, Holger M

    2015-01-01

    Mineralocorticoid receptor (MR) inactivation in mice results in early postnatal lethality. Therefore we generated mice in which MR expression can be silenced during adulthood by administration of doxycycline (Dox). Using a lentiviral approach, we obtained two lines of transgenic mice harboring a construct that allows for regulatable MR inactivation by RNAi and concomitant expression of eGFP. MR mRNA levels in heart and kidney of inducible MR knock-down mice were unaltered in the absence of Dox, confirming the tightness of the system. In contrast, two weeks after Dox administration MR expression was significantly diminished in a variety of tissues. In the kidney, this resulted in lower mRNA levels of selected target genes, which was accompanied by strongly increased serum aldosterone and plasma renin levels as well as by elevated sodium excretion. In the healthy heart, gene expression and the amount of collagen were unchanged despite MR levels being significantly reduced. After transverse aortic constriction, however, cardiac hypertrophy and progressive heart failure were attenuated by MR silencing, fibrosis was unaffected and mRNA levels of a subset of genes reduced. Taken together, we believe that this mouse model is a useful tool to investigate the role of the MR in pathophysiological processes.

  9. GATA4 and GATA6 Knockdown During Luteinization Inhibits Progesterone Production and Gonadotropin Responsiveness in the Corpus Luteum of Female Mice.

    PubMed

    Convissar, Scott M; Bennett, Jill; Baumgarten, Sarah C; Lydon, John P; DeMayo, Francesco J; Stocco, Carlos

    2015-12-01

    The surge of luteinizing hormone triggers the genomic reprogramming, cell differentiation, and tissue remodeling of the ovulated follicle, leading to the formation of the corpus luteum. During this process, called luteinization, follicular granulosa cells begin expressing a new set of genes that allow the resulting luteal cells to survive in a vastly different hormonal environment and to produce the extremely high amounts of progesterone (P4) needed to sustain pregnancy. To better understand the molecular mechanisms involved in the regulation of luteal P4 production in vivo, the transcription factors GATA4 and GATA6 were knocked down in the corpus luteum by crossing mice carrying Gata4 and Gata6 floxed genes with mice carrying Cre recombinase fused to the progesterone receptor. This receptor is expressed exclusively in granulosa cells after the luteinizing hormone surge, leading to recombination of floxed genes during follicle luteinization. The findings demonstrated that GATA4 and GATA6 are essential for female fertility, whereas targeting either factor alone causes subfertility. When compared to control mice, serum P4 levels and luteal expression of key steroidogenic genes were significantly lower in conditional knockdown mice. The results also showed that GATA4 and GATA6 are required for the expression of the receptors for prolactin and luteinizing hormone, the main luteotropic hormones in mice. The findings demonstrate that GATA4 and GATA6 are crucial regulators of luteal steroidogenesis and are required for the normal response of luteal cells to luteotropins. © 2015 by the Society for the Study of Reproduction, Inc.

  10. [siRNA-mediated tissue factor knockdown in porcine neonatal islet cell clusters in vitro].

    PubMed

    Ji, Ming; Yi, Shounan; Yu, Deling; Wang, Wei

    2011-12-01

    To determine the genetic modification on neonatal porcine islet cell clusters (NICC) by small interfering RNA (siRNA)-mediated tissue factor (TF) knockdown in vitro. Porcine NICC were transfected with 5 pairs of designed siRNA respectively or in different combinations with lipofectamine 2000. Transfected NICC were analyzed for TF gene by real-time PCR to select the siRNA which worked best. Meanwhile, the viability of NICC after the TF siRNA transfection was examined by FACS. The efficiency of TF gene and protein suppression was measured by real-time PCR and and FACS respectively. Real-time PCR and FACS showed that a 60% reduction in the TF gene expression and a 50% reduction in the protien level of TF on NICC were achieved by transfecting 3 pairs of selected siRNA. The siRNA transfection had no significant effect on the viability of NICC which was analyzed by FACS. The expression of TF on porcine NICC is efficiently suppressed by 3 pairs of designed siRNA in vitro.

  11. Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

    PubMed Central

    Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

    2016-01-01

    The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

  12. Hydroxyl-HIF2-alpha is potential therapeutic target for renal cell carcinomas

    PubMed Central

    Isono, Takahiro; Chano, Tokuhiro; Yoshida, Tetsuya; Kageyama, Susumu; Kawauchi, Akihiro; Suzaki, Masafumi; Yuasa, Takeshi

    2016-01-01

    Dormant cancer cells are deprivation-resistant, and cause a number of problems for therapeutic approaches for cancers. Renal cell carcinomas (RCCs) include deprivation-resistant cells that are resistant to various treatments. In this study, the specific characteristics of deprivation-resistant cells were transcriptionally identified by next generation sequencing. The hypoxia-inducible factors (HIF) transcription factor network was significantly enhanced in deprivation-resistant RCCs compared to the sensitive RCCs. Deprivation-resistant RCCs, that had lost Von Hippel-Lindau tumor suppressor expression, expressed hydroxyl-HIF2-alpha in the nucleus, but not sensitive-RCCs. Hydroxyl-HIF-alpha was also expressed in nuclei of RCC tissue samples. Knockdown for HIF2-alpha, but not HIF1-alpha, induced cell death related to a reduction in HIF-related gene expression in deprivation-resistant RCC cells. Chetomin, a nuclear HIF-inhibitor, induced marked level of cytotoxicity in deprivation-resistant cells, similar to the knockdown of HIF2-alpha. Therefore, hydroxyl-HIF2-alpha might be a potential therapeutic target for RCCs. PMID:27822416

  13. Systems biology approach to transplant tolerance: proof of concept experiments using RNA interference (RNAi) to knock down hub genes in Jurkat and HeLa cells in vitro.

    PubMed

    Lwin, Wint Wah; Park, Ken; Wauson, Matthew; Gao, Qin; Finn, Patricia W; Perkins, David; Khanna, Ajai

    2012-07-01

    Systems biology is gaining importance in studying complex systems such as the functional interconnections of human genes [1]. To investigate the molecular interactions involved in T cell immune responses, we used databases of physical gene-gene interactions to constructed molecular interaction networks (interconnections) with R language algorithms. This helped to identify highly interconnected "hub" genes AT(1)P5C1, IL6ST, PRKCZ, MYC, FOS, JUN, and MAPK1. We hypothesized that suppression of these hub genes in the gene network would result in significant phenotypic effects on T cells and examined this in vitro. The molecular interaction networks were then analyzed and visualized with Cytoscape. Jurkat and HeLa cells were transfected with siRNA for the selected hub genes. Cell proliferation was measured using ATP luminescence and BrdU labeling, which were measured 36, 72, and 96 h after activation. Following T cell stimulation, we found a significant decrease in ATP production (P < 0.05) when the hub genes ATP5C1 and PRKCZ were knocked down using siRNA transfection, whereas no difference in ATP production was observed in siRNA transfected HeLa cells. However, HeLa cells showed a significant (P < 0.05) decrease in cell proliferation when the genes MAPK1, IL6ST, ATP5C1, JUN, and FOS were knocked down. In both Jurkat and HeLa cells, targeted gene knockdown using siRNA showed decreased cell proliferation and ATP production in both Jurkat and HeLa cells. However, Jurkat T cells and HELA cells use different hub genes to regulate activation responses. This experiment provides proof of principle of applying siRNA knockdown of T cell hub genes to evaluate their proliferative capacity and ATP production. This novel concept outlines a systems biology approach to identify hub genes for targeted therapeutics. Published by Elsevier Inc.

  14. Targeting CDH17 Suppresses Tumor Progression in Gastric Cancer by Downregulating Wnt/β-Catenin Signaling

    PubMed Central

    Ren, Chao; Zeng, Zhao-lei; Wu, Wen-jing; Luo, Hui-yan; Zhou, Zhi-wei; Xu, Rui-hua

    2013-01-01

    Purpose Gastric cancer remains one of the leading causes of cancer death worldwide. Patients usually present late with local invasion or metastasis, for which there are no effective therapies available. Following previous studies that identified the adhesion molecule Cadherin-17(CDH17) as a potential marker for gastric carcinoma, we performed proof-of-principle studies to develop rational therapeutic approaches targeting CDH17 for treating this disease. Methods Immunohistochemistry was used to study the expression of CDH17 in 156 gastric carcinomas, and the relationship between survival and CDH17 expression was studied by multivariate analyses. The effect of RNA interference–mediated knockdown of CDH17 on proliferation of gastric carcinoma cell lines was examined in vitro and in vivo, as well as the effects on downstream signaling by immunoblotting. Results CDH17 was consistently up-regulated in human gastric cancers, and overall survival in patients with CDH17 upregulation was poorer than in those without expression of this gene (5 yrs overall survival rate 29.0% vs. 45.0%, P<0.01). Functional assays demonstrated that CDH17 knockdown inhibited cell proliferation, adhesion, migration, invasion, clonogenicity and induce G0/G1 arrest. In mice, shRNA-mediated CDH17 knockdown markedly inhibits tumor growth; intratumoral injection of CDH17 shRNAs results in significant antitumor effects on transplanted tumor models. The antitumor mechanisms underlying CDH17 inhibition involve inactivation of Wnt/β-catenin signaling. Conclusion Our results identify CDH17 as a biomarker of gastric carcinoma and attractive therapeutic target for this aggressive malignancy. PMID:23554857

  15. Id-1 gene and gene products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    DOEpatents

    Desprez, Pierre-Yves; Campisi, Judith

    2014-08-19

    A method for treatment of breast cancer and other types of cancer. The method comprises targeting and modulating Id-1 gene expression, if any, for the Id-1 gene, or gene products in breast or other epithelial cancers in a patient by delivering products that modulate Id-1 gene expression. When expressed, Id-1 gene is a prognostic indicator that cancer cells are invasive and metastatic.

  16. Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus▿

    PubMed Central

    Cosme, Ruth S. Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-01-01

    Human cytomegalovirus (HCMV), a member of the β subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

  17. Zinc-finger nuclease-mediated targeted insertion of reporter genes for quantitative imaging of gene expression in sea urchin embryos

    PubMed Central

    Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi

    2012-01-01

    To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830

  18. Knockdown of human deubiquitinase PSMD14 induces cell cycle arrest and senescence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Byrne, Ann; McLaren, Rajashree P.; Mason, Paul

    2010-01-15

    The PSMD14 (POH1, also known as Rpn11/MPR1/S13/CepP1) protein within the 19S complex (19S cap; PA700) is responsible for substrate deubiquitination during proteasomal degradation. The role of PSMD14 in cell proliferation and senescence was explored using siRNA knockdown in carcinoma cell lines. Our results reveal that down-regulation of PSMD14 by siRNA transfection had a considerable impact on cell viability causing cell arrest in the G0-G1 phase, ultimately leading to senescence. The molecular events associated with decreased cell proliferation, cell cycle arrest and senescence include down-regulation of cyclin B1-CDK1-CDC25C, down-regulation of cyclin D1 and up-regulation of p21{sup /Cip} and p27{sup /Kip1}. Mostmore » notably, phosphorylation of the retinoblastoma protein was markedly reduced in PSMD14 knockdown cells. A comparative study with PSMB5, a subunit of the 20S proteasome, revealed that PSMB5 and PSMD14 have different effects on cell cycle, senescence and associated molecular events. These data support the view that the 19S and 20S subunits of the proteasome have distinct biological functions and imply that targeting 19S and 20S would have distinct molecular consequences on tumor cells.« less

  19. Applications of Gene Targeting Technology to Mental Retardation and Developmental Disability Research

    ERIC Educational Resources Information Center

    Pimenta, Aurea F.; Levitt, Pat

    2005-01-01

    The human and mouse genome projects elucidated the sequence and position map of innumerous genes expressed in the central nervous system (CNS), advancing our ability to manipulate these sequences and create models to investigate regulation of gene expression and function. In this article, we reviewed gene targeting methodologies with emphasis on…

  20. Enrichment of putative PAX8 target genes at serous epithelial ovarian cancer susceptibility loci.

    PubMed

    Kar, Siddhartha P; Adler, Emily; Tyrer, Jonathan; Hazelett, Dennis; Anton-Culver, Hoda; Bandera, Elisa V; Beckmann, Matthias W; Berchuck, Andrew; Bogdanova, Natalia; Brinton, Louise; Butzow, Ralf; Campbell, Ian; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Dansonka-Mieszkowska, Agnieszka; Doherty, Jennifer Anne; Dörk, Thilo; Dürst, Matthias; Eccles, Diana; Fasching, Peter A; Flanagan, James; Gentry-Maharaj, Aleksandra; Glasspool, Rosalind; Goode, Ellen L; Goodman, Marc T; Gronwald, Jacek; Heitz, Florian; Hildebrandt, Michelle A T; Høgdall, Estrid; Høgdall, Claus K; Huntsman, David G; Jensen, Allan; Karlan, Beth Y; Kelemen, Linda E; Kiemeney, Lambertus A; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Levine, Douglas A; Li, Qiyuan; Lissowska, Jolanta; Lu, Karen H; Lubiński, Jan; Massuger, Leon F A G; McGuire, Valerie; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Monteiro, Alvaro N; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Permuth, Jennifer B; Phelan, Catherine; Pike, Malcolm C; Poole, Elizabeth M; Ramus, Susan J; Risch, Harvey A; Rossing, Mary Anne; Salvesen, Helga B; Schildkraut, Joellen M; Sellers, Thomas A; Sherman, Mark; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa; Terry, Kathryn L; Tworoger, Shelley S; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S; Wu, Anna H; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Freedman, Matthew L; Gayther, Simon A; Pharoah, Paul D P; Lawrenson, Kate

    2017-02-14

    Genome-wide association studies (GWAS) have identified 18 loci associated with serous ovarian cancer (SOC) susceptibility but the biological mechanisms driving these findings remain poorly characterised. Germline cancer risk loci may be enriched for target genes of transcription factors (TFs) critical to somatic tumorigenesis. All 615 TF-target sets from the Molecular Signatures Database were evaluated using gene set enrichment analysis (GSEA) and three GWAS for SOC risk: discovery (2196 cases/4396 controls), replication (7035 cases/21 693 controls; independent from discovery), and combined (9627 cases/30 845 controls; including additional individuals). The PAX8-target gene set was ranked 1/615 in the discovery (P GSEA <0.001; FDR=0.21), 7/615 in the replication (P GSEA =0.004; FDR=0.37), and 1/615 in the combined (P GSEA <0.001; FDR=0.21) studies. Adding other genes reported to interact with PAX8 in the literature to the PAX8-target set and applying an alternative to GSEA, interval enrichment, further confirmed this association (P=0.006). Fifteen of the 157 genes from this expanded PAX8 pathway were near eight loci associated with SOC risk at P<10 -5 (including six with P<5 × 10 -8 ). The pathway was also associated with differential gene expression after shRNA-mediated silencing of PAX8 in HeyA8 (P GSEA =0.025) and IGROV1 (P GSEA =0.004) SOC cells and several PAX8 targets near SOC risk loci demonstrated in vitro transcriptomic perturbation. Putative PAX8 target genes are enriched for common SOC risk variants. This finding from our agnostic evaluation is of particular interest given that PAX8 is well-established as a specific marker for the cell of origin of SOC.

  1. Enrichment of putative PAX8 target genes at serous epithelial ovarian cancer susceptibility loci

    PubMed Central

    Kar, Siddhartha P; Adler, Emily; Tyrer, Jonathan; Hazelett, Dennis; Anton-Culver, Hoda; Bandera, Elisa V; Beckmann, Matthias W; Berchuck, Andrew; Bogdanova, Natalia; Brinton, Louise; Butzow, Ralf; Campbell, Ian; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Dansonka-Mieszkowska, Agnieszka; Doherty, Jennifer Anne; Dörk, Thilo; Dürst, Matthias; Eccles, Diana; Fasching, Peter A; Flanagan, James; Gentry-Maharaj, Aleksandra; Glasspool, Rosalind; Goode, Ellen L; Goodman, Marc T; Gronwald, Jacek; Heitz, Florian; Hildebrandt, Michelle A T; Høgdall, Estrid; Høgdall, Claus K; Huntsman, David G; Jensen, Allan; Karlan, Beth Y; Kelemen, Linda E; Kiemeney, Lambertus A; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Levine, Douglas A; Li, Qiyuan; Lissowska, Jolanta; Lu, Karen H; Lubiński, Jan; Massuger, Leon F A G; McGuire, Valerie; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Monteiro, Alvaro N; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Permuth, Jennifer B; Phelan, Catherine; Pike, Malcolm C; Poole, Elizabeth M; Ramus, Susan J; Risch, Harvey A; Rossing, Mary Anne; Salvesen, Helga B; Schildkraut, Joellen M; Sellers, Thomas A; Sherman, Mark; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa; Terry, Kathryn L; Tworoger, Shelley S; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S; Wu, Anna H; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Freedman, Matthew L; Gayther, Simon A; Pharoah, Paul D P; Lawrenson, Kate

    2017-01-01

    Background: Genome-wide association studies (GWAS) have identified 18 loci associated with serous ovarian cancer (SOC) susceptibility but the biological mechanisms driving these findings remain poorly characterised. Germline cancer risk loci may be enriched for target genes of transcription factors (TFs) critical to somatic tumorigenesis. Methods: All 615 TF-target sets from the Molecular Signatures Database were evaluated using gene set enrichment analysis (GSEA) and three GWAS for SOC risk: discovery (2196 cases/4396 controls), replication (7035 cases/21 693 controls; independent from discovery), and combined (9627 cases/30 845 controls; including additional individuals). Results: The PAX8-target gene set was ranked 1/615 in the discovery (PGSEA<0.001; FDR=0.21), 7/615 in the replication (PGSEA=0.004; FDR=0.37), and 1/615 in the combined (PGSEA<0.001; FDR=0.21) studies. Adding other genes reported to interact with PAX8 in the literature to the PAX8-target set and applying an alternative to GSEA, interval enrichment, further confirmed this association (P=0.006). Fifteen of the 157 genes from this expanded PAX8 pathway were near eight loci associated with SOC risk at P<10−5 (including six with P<5 × 10−8). The pathway was also associated with differential gene expression after shRNA-mediated silencing of PAX8 in HeyA8 (PGSEA=0.025) and IGROV1 (PGSEA=0.004) SOC cells and several PAX8 targets near SOC risk loci demonstrated in vitro transcriptomic perturbation. Conclusions: Putative PAX8 target genes are enriched for common SOC risk variants. This finding from our agnostic evaluation is of particular interest given that PAX8 is well-established as a specific marker for the cell of origin of SOC. PMID:28103614

  2. Reducing AsA leads to leaf lesion and defence response in knock-down of the AsA biosynthetic enzyme GDP-D-mannose pyrophosphorylase gene in tomato plant.

    PubMed

    Zhang, Chanjuan; Ouyang, Bo; Yang, Changxian; Zhang, Xiaohui; Liu, Hui; Zhang, Yuyang; Zhang, Junhong; Li, Hanxia; Ye, Zhibiao

    2013-01-01

    As a vital antioxidant, L-ascorbic acid (AsA) affects diverse biological processes in higher plants. Lack of AsA in cell impairs plant development. In the present study, we manipulated a gene of GDP-mannose pyrophosphorylase which catalyzes the conversion of D-mannose-1-P to GDP-D-mannose in AsA biosynthetic pathway and found out the phenotype alteration of tomato. In the tomato genome, there are four members of GMP gene family and they constitutively expressed in various tissues in distinct expression patterns. As expected, over-expression of SlGMP3 increased total AsA contents and enhanced the tolerance to oxidative stress in tomato. On the contrary, knock-down of SlGMP3 significantly decreased AsA contents below the threshold level and altered the phenotype of tomato plants with lesions and further senescence. Further analysis indicated the causes for this symptom could result from failing to instantly deplete the reactive oxygen species (ROS) as decline of free radical scavenging activity. More ROS accumulated in the leaves and then triggered expressions of defence-related genes and mimic symptom occurred on the leaves similar to hypersensitive responses against pathogens. Consequently, the photosynthesis of leaves was dramatically fallen. These results suggested the vital roles of AsA as an antioxidant in leaf function and defence response of tomato.

  3. Knockdown and replacement therapy mediated by artificial mirtrons in spinocerebellar ataxia 7

    PubMed Central

    Curtis, Helen J.; Wood, Matthew J.A.

    2017-01-01

    Abstract We evaluate a knockdown-replacement strategy mediated by mirtrons as an alternative to allele-specific silencing using spinocerebellar ataxia 7 (SCA7) as a model. Mirtrons are introns that form pre-microRNA hairpins after splicing, producing RNAi effectors not processed by Drosha. Mirtron mimics may therefore avoid saturation of the canonical processing pathway. This method combines gene silencing mediated by an artificial mirtron with delivery of a functional copy of the gene such that both elements of the therapy are always expressed concurrently, minimizing the potential for undesirable effects and preserving wild-type function. This mutation- and single nucleotide polymorphism-independent method could be crucial in dominant diseases that feature both gain- and loss-of-function pathologies or have a heterogeneous genetic background. Here we develop mirtrons against ataxin 7 with silencing efficacy comparable to shRNAs, and introduce silent mutations into an ataxin 7 transgene such that it is resistant to their effect. We successfully express the transgene and one mirtron together from a single construct. Hence, we show that this method can be used to silence the endogenous allele of ataxin 7 and replace it with an exogenous copy of the gene, highlighting the efficacy and transferability across patient genotypes of this approach. PMID:28575281

  4. Knockdown of Tripartite-59 (TRIM59) Inhibits Cellular Proliferation and Migration in Human Cervical Cancer Cells.

    PubMed

    Aierken, Gulijiahan; Seyiti, Ayinuer; Alifu, Mayinuer; Kuerban, Gulina

    2017-03-13

    The tripartite motif (TRIM) family of proteins is a class of highly conservative proteins that have been implicated in multiple processes. TRIM59, one member of the TRIM family, has now received recognition as a key regulator in the development and progression of human diseases. However, its role in human tumorigenesis has remained largely unknown. In this study, the effects of TRIM59 expression on cell proliferation and migration were investigated in human cervical cancer cells. The expression of TRIM59 in clinical cervical cancer tissues and cervical cancer cells was initially determined by RT-PCR and Western blot. Specific shRNA against TRIM59 was then employed to knock down the expression of TRIM59 in cervical cancer lines HeLa and SiHa. The effects of TRIM59 knockdown on cell proliferation was assessed by MTT assay and colony formation assay. Transwell assay was conducted to reveal cell migration and invasion abilities before and after TRIM59 knockdown. Our results showed that the expression of TRIM59 was significantly elevated in cervical cancers. Knockdown of TRIM59 significantly inhibited cell proliferation and colony formation as well as cell migration and invasion abilities in cervical cancer HeLa and SiHa cells. Cell cycle progression analysis showed that TRIM59-depleted cells preferred to accumulate in the S phase. These data suggest that TRIM59 is a potential target that promotes the progression of cervical cancer.

  5. Many si/shRNAs can kill cancer cells by targeting multiple survival genes through an off-target mechanism

    PubMed Central

    van Dongen, Stijn; Haluck-Kangas, Ashley; Sarshad, Aishe A; Bartom, Elizabeth T; Kim, Kwang-Youn A; Scholtens, Denise M; Hafner, Markus; Zhao, Jonathan C; Murmann, Andrea E

    2017-01-01

    Over 80% of multiple-tested siRNAs and shRNAs targeting CD95 or CD95 ligand (CD95L) induce a form of cell death characterized by simultaneous activation of multiple cell death pathways preferentially killing transformed and cancer stem cells. We now show these si/shRNAs kill cancer cells through canonical RNAi by targeting the 3’UTR of critical survival genes in a unique form of off-target effect we call DISE (death induced by survival gene elimination). Drosha and Dicer-deficient cells, devoid of most miRNAs, are hypersensitive to DISE, suggesting cellular miRNAs protect cells from this form of cell death. By testing 4666 shRNAs derived from the CD95 and CD95L mRNA sequences and an unrelated control gene, Venus, we have identified many toxic sequences - most of them located in the open reading frame of CD95L. We propose that specific toxic RNAi-active sequences present in the genome can kill cancer cells. PMID:29063830

  6. Prediction of target genes for miR-140-5p in pulmonary arterial hypertension using bioinformatics methods.

    PubMed

    Li, Fangwei; Shi, Wenhua; Wan, Yixin; Wang, Qingting; Feng, Wei; Yan, Xin; Wang, Jian; Chai, Limin; Zhang, Qianqian; Li, Manxiang

    2017-12-01

    The expression of microRNA (miR)-140-5p is known to be reduced in both pulmonary arterial hypertension (PAH) patients and monocrotaline-induced PAH models in rat. Identification of target genes for miR-140-5p with bioinformatics analysis may reveal new pathways and connections in PAH. This study aimed to explore downstream target genes and relevant signaling pathways regulated by miR-140-5p to provide theoretical evidences for further researches on role of miR-140-5p in PAH. Multiple downstream target genes and upstream transcription factors (TFs) of miR-140-5p were predicted in the analysis. Gene ontology (GO) enrichment analysis indicated that downstream target genes of miR-140-5p were enriched in many biological processes, such as biological regulation, signal transduction, response to chemical stimulus, stem cell proliferation, cell surface receptor signaling pathways. Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis found that downstream target genes were mainly located in Notch, TGF-beta, PI3K/Akt, and Hippo signaling pathway. According to TF-miRNA-mRNA network, the important downstream target genes of miR-140-5p were PPI, TGF-betaR1, smad4, JAG1, ADAM10, FGF9, PDGFRA, VEGFA, LAMC1, TLR4, and CREB. After thoroughly reviewing published literature, we found that 23 target genes and seven signaling pathways were truly inhibited by miR-140-5p in various tissues or cells; most of these verified targets were in accordance with our present prediction. Other predicted targets still need further verification in vivo and in vitro .

  7. Pan-Cancer Analysis of the Mediator Complex Transcriptome Identifies CDK19 and CDK8 as Therapeutic Targets in Advanced Prostate Cancer.

    PubMed

    Brägelmann, Johannes; Klümper, Niklas; Offermann, Anne; von Mässenhausen, Anne; Böhm, Diana; Deng, Mario; Queisser, Angela; Sanders, Christine; Syring, Isabella; Merseburger, Axel S; Vogel, Wenzel; Sievers, Elisabeth; Vlasic, Ignacija; Carlsson, Jessica; Andrén, Ove; Brossart, Peter; Duensing, Stefan; Svensson, Maria A; Shaikhibrahim, Zaki; Kirfel, Jutta; Perner, Sven

    2017-04-01

    Purpose: The Mediator complex is a multiprotein assembly, which serves as a hub for diverse signaling pathways to regulate gene expression. Because gene expression is frequently altered in cancer, a systematic understanding of the Mediator complex in malignancies could foster the development of novel targeted therapeutic approaches. Experimental Design: We performed a systematic deconvolution of the Mediator subunit expression profiles across 23 cancer entities ( n = 8,568) using data from The Cancer Genome Atlas (TCGA). Prostate cancer-specific findings were validated in two publicly available gene expression cohorts and a large cohort of primary and advanced prostate cancer ( n = 622) stained by immunohistochemistry. The role of CDK19 and CDK8 was evaluated by siRNA-mediated gene knockdown and inhibitor treatment in prostate cancer cell lines with functional assays and gene expression analysis by RNAseq. Results: Cluster analysis of TCGA expression data segregated tumor entities, indicating tumor-type-specific Mediator complex compositions. Only prostate cancer was marked by high expression of CDK19 In primary prostate cancer, CDK19 was associated with increased aggressiveness and shorter disease-free survival. During cancer progression, highest levels of CDK19 and of its paralog CDK8 were present in metastases. In vitro , inhibition of CDK19 and CDK8 by knockdown or treatment with a selective CDK8/CDK19 inhibitor significantly decreased migration and invasion. Conclusions: Our analysis revealed distinct transcriptional expression profiles of the Mediator complex across cancer entities indicating differential modes of transcriptional regulation. Moreover, it identified CDK19 and CDK8 to be specifically overexpressed during prostate cancer progression, highlighting their potential as novel therapeutic targets in advanced prostate cancer. Clin Cancer Res; 23(7); 1829-40. ©2016 AACR . ©2016 American Association for Cancer Research.

  8. In Vivo Knockdown of Pathogenic Proteins via Specific and Nongenetic Inhibitor of Apoptosis Protein (IAP)-dependent Protein Erasers (SNIPERs).

    PubMed

    Ohoka, Nobumichi; Okuhira, Keiichiro; Ito, Masahiro; Nagai, Katsunori; Shibata, Norihito; Hattori, Takayuki; Ujikawa, Osamu; Shimokawa, Kenichiro; Sano, Osamu; Koyama, Ryokichi; Fujita, Hisashi; Teratani, Mika; Matsumoto, Hirokazu; Imaeda, Yasuhiro; Nara, Hiroshi; Cho, Nobuo; Naito, Mikihiko

    2017-03-17

    Many diseases, especially cancers, result from aberrant or overexpression of pathogenic proteins. Specific inhibitors against these proteins have shown remarkable therapeutic effects, but these are limited mainly to enzymes. An alternative approach that may have utility in drug development relies on selective degradation of pathogenic proteins via small chimeric molecules linking an E3 ubiquitin ligase to the targeted protein for proteasomal degradation. To this end, we recently developed a protein knockdown system based on hybrid small molecule SNIPERs ( S pecific and N ongenetic I AP-dependent P rotein Er asers) that recruit inhibitor of the apoptosis protein (IAP) ubiquitin ligases to specifically degrade targeted proteins. Here, we extend our previous study to show a proof of concept of the SNIPER technology in vivo By incorporating a high affinity IAP ligand, we developed a novel SNIPER against estrogen receptor α (ERα), SNIPER(ER)-87, that has a potent protein knockdown activity. The SNIPER(ER) reduced ERα levels in tumor xenografts and suppressed the growth of ERα-positive breast tumors in mice. Mechanistically, it preferentially recruits X-linked IAP (XIAP) rather than cellular IAP1, to degrade ERα via the ubiquitin-proteasome pathway. With this IAP ligand, potent SNIPERs against other pathogenic proteins, BCR-ABL, bromodomain-containing protein 4 (BRD4), and phosphodiesterase-4 (PDE4) could also be developed. These results indicate that forced ubiquitylation by SNIPERs is a useful method to achieve efficient protein knockdown with potential therapeutic activities and could also be applied to study the role of ubiquitylation in many cellular processes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. ARNetMiT R Package: association rules based gene co-expression networks of miRNA targets.

    PubMed

    Özgür Cingiz, M; Biricik, G; Diri, B

    2017-03-31

    miRNAs are key regulators that bind to target genes to suppress their gene expression level. The relations between miRNA-target genes enable users to derive co-expressed genes that may be involved in similar biological processes and functions in cells. We hypothesize that target genes of miRNAs are co-expressed, when they are regulated by multiple miRNAs. With the usage of these co-expressed genes, we can theoretically construct co-expression networks (GCNs) related to 152 diseases. In this study, we introduce ARNetMiT that utilize a hash based association rule algorithm in a novel way to infer the GCNs on miRNA-target genes data. We also present R package of ARNetMiT, which infers and visualizes GCNs of diseases that are selected by users. Our approach assumes miRNAs as transactions and target genes as their items. Support and confidence values are used to prune association rules on miRNA-target genes data to construct support based GCNs (sGCNs) along with support and confidence based GCNs (scGCNs). We use overlap analysis and the topological features for the performance analysis of GCNs. We also infer GCNs with popular GNI algorithms for comparison with the GCNs of ARNetMiT. Overlap analysis results show that ARNetMiT outperforms the compared GNI algorithms. We see that using high confidence values in scGCNs increase the ratio of the overlapped gene-gene interactions between the compared methods. According to the evaluation of the topological features of ARNetMiT based GCNs, the degrees of nodes have power-law distribution. The hub genes discovered by ARNetMiT based GCNs are consistent with the literature.

  10. Tumor-targeted inhibition by a novel strategy - mimoretrovirus expressing siRNA targeting the Pokemon gene.

    PubMed

    Tian, Zhiqiang; Wang, Huaizhi; Jia, Zhengcai; Shi, Jinglei; Tang, Jun; Mao, Liwei; Liu, Hongli; Deng, Yijing; He, Yangdong; Ruan, Zhihua; Li, Jintao; Wu, Yuzhang; Ni, Bing

    2010-12-01

    Pokemon gene has crucial but versatile functions in cell differentiation, proliferation and tumorigenesis. It is a master regulator of the ARF-HDM2-p53 and Rb-E2F pathways. The facts that the expression of Pokemon is essential for tumor formation and many kinds of tumors over-express the Pokemon gene make it an attractive target for therapeutic intervention for cancer treatment. In this study, we used an RNAi strategy to silence the Pokemon gene in a cervical cancer model. To address the issues involving tumor specific delivery and durable expression of siRNA, we applied the Arg-Gly-Asp (RGD) peptide ligand and polylysine (K(18)) fusion peptide to encapsulate a recombinant retrovirus plasmid expressing a siRNA targeting the Pokemon gene and produced the 'mimoretrovirus'. At charge ratio 2.0 of fusion peptide/plasmid, the mimoretrovirus formed stable and homogenous nanoparticles, and provided complete DNase I protection and complete gel retardation. This nanoparticle inhibited SiHa cell proliferation and invasion, while it promoted SiHa cell apoptosis. The binding of the nanoparticle to SiHa cells was mediated via the RGD-integrin α(v)β(3) interaction, as evidenced by the finding that unconjugated RGD peptide inhibited this binding significantly. This tumor-targeting mimoretrovirus exhibited excellent anti-tumor capacity in vivo in a nude mouse model. Moreover, the mimoretrovirus inhibited tumor growth with a much higher efficiency than recombinant retrovirus expressing siRNA or the K(18)/P4 nanoparticle lacking the RGD peptide. Results suggest that the RNAi/RGD-based mimoretrovirus developed in this study represents a novel anti-tumor strategy that may be applicable to most research involving cancer therapy and, thus, has promising potential as a cervical cancer treatment.

  11. Soft computing model for optimized siRNA design by identifying off target possibilities using artificial neural network model.

    PubMed

    Murali, Reena; John, Philips George; Peter S, David

    2015-05-15

    The ability of small interfering RNA (siRNA) to do posttranscriptional gene regulation by knocking down targeted genes is an important research topic in functional genomics, biomedical research and in cancer therapeutics. Many tools had been developed to design exogenous siRNA with high experimental inhibition. Even though considerable amount of work has been done in designing exogenous siRNA, design of effective siRNA sequences is still a challenging work because the target mRNAs must be selected such that their corresponding siRNAs are likely to be efficient against that target and unlikely to accidentally silence other transcripts due to sequence similarity. In some cases, siRNAs may tolerate mismatches with the target mRNA, but knockdown of genes other than the intended target could make serious consequences. Hence to design siRNAs, two important concepts must be considered: the ability in knocking down target genes and the off target possibility on any nontarget genes. So before doing gene silencing by siRNAs, it is essential to analyze their off target effects in addition to their inhibition efficacy against a particular target. Only a few methods have been developed by considering both efficacy and off target possibility of siRNA against a gene. In this paper we present a new design of neural network model with whole stacking energy (ΔG) that enables to identify the efficacy and off target effect of siRNAs against target genes. The tool lists all siRNAs against a particular target with their inhibition efficacy and number of matches or sequence similarity with other genes in the database. We could achieve an excellent performance of Pearson Correlation Coefficient (R=0. 74) and Area Under Curve (AUC=0.906) when the threshold of whole stacking energy is ≥-34.6 kcal/mol. To the best of the author's knowledge, this is one of the best score while considering the "combined efficacy and off target possibility" of siRNA for silencing a gene. The proposed model

  12. Curcumin inhibits anchorage-independent growth of HT29 human colon cancer cells by targeting epigenetic restoration of the tumor suppressor gene DLEC1.

    PubMed

    Guo, Yue; Shu, Limin; Zhang, Chengyue; Su, Zheng-Yuan; Kong, Ah-Ng Tony

    2015-03-15

    Colorectal cancer remains the most prevalent malignancy in humans. The impact of epigenetic alterations on the development of this complex disease is now being recognized. The dynamic and reversible nature of epigenetic modifications makes them a promising target in colorectal cancer chemoprevention and treatment. Curcumin (CUR), the major component in Curcuma longa, has been shown as a potent chemopreventive phytochemical that modulates various signaling pathways. Deleted in lung and esophageal cancer 1 (DLEC1) is a tumor suppressor gene with reduced transcriptional activity and promoter hypermethylation in various cancers, including colorectal cancer. In the present study, we aimed to investigate the inhibitory role of DLEC1 in anchorage-independent growth of the human colorectal adenocarcinoma HT29 cells and epigenetic regulation by CUR. Specifically, we found that CUR treatment inhibited colony formation of HT29 cells, whereas stable knockdown of DLEC1 using lentiviral short hairpin RNA vector increased cell proliferation and colony formation. Knockdown of DLEC1 in HT29 cells attenuated the ability of CUR to inhibit anchorage-independent growth. Methylation-specific polymerase chain reaction (MSP), bisulfite genomic sequencing, and methylated DNA immunoprecipitation revealed that CUR decreased CpG methylation of the DLEC1 promoter in HT29 cells after 5 days of treatment, corresponding to increased mRNA expression of DLEC1. Furthermore, CUR decreased the protein expression of DNA methyltransferases and subtypes of histone deacetylases (HDAC4, 5, 6, and 8). Taken together, our results suggest that the inhibitory effect of CUR on anchorage-independent growth of HT29 cells could, at least in part, involve the epigenetic demethylation and up-regulation of DLEC1. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Blood-Derived Smooth Muscle Cells as a Target for Gene Delivery

    PubMed Central

    Yang, Zhe; Shao, Hongwei; Tan, Yaohong; Eton, Darwin; Yu, Hong

    2008-01-01

    Objective To examine the feasibility of using blood-derived smooth muscle cells (BD-SMCs) as a target for to deliver therapeutic proteins. Materials and Methods Mononuclear cells (MNC) were isolated from peripheral blood. The outgrowth colonies from MNC culture were differentiated into BD-SMCs in media containing platelet-derived growth factor BB. Phenotypic characterization of BD-SMCs was assessed by immunocytochemistry. Cell proliferation, gene transfer efficiency with a retroviral vector, apoptosis, and the biological activity of the transduced gene product from the BD-SMCs were evaluated in vitro and in vivo in comparison with vascular derived SMC (VSMCs). Results BD-SMCs stained positive for SMC markers. No significant difference was observed between BD-SMCs and VSMCs in cell proliferation, migration, adhesiveness, and gene transfer efficiency. After BD-SMCs were transduced with a retroviral vector carrying the secreted alkaline phosphatase gene (SEAP), 174 ± 50 μg biologically active SEAP was produced per 106 cells over 24 hrs. After injecting 5×106 cells expressing SEAP intravenously into rabbits, SEAP concentration increased significantly in the circulation from 0.14 ± 0.04 μg/ml to 2.34 ± 0.16 μg/ml 3 days after cell injection (P<0.01, n=3). Circulating levels of SEAP decreased to 1.76 μg /ml one week later and remained at this level up to 8 weeks, then declined to pre-cell injection level at 12 weeks. VSMC in vivo gene expression data were equivalent. Conclusion BD-SMCs have similar characteristics to mature VSMCs, and can be used as a novel target for gene transfer to deliver a therapeutic protein. Clinical relevance Cell-based therapy strategies offer the potential to correct a wide spectrum of inherited and acquired human diseases. Translation to a clinical trial will require a detailed pre-clinical study to understand the characteristics of the isolated cells. BD-SMC are practical and effective targets for ex vivo genetic engineering. They are

  14. Target mimics: an embedded layer of microRNA-involved gene regulatory networks in plants.

    PubMed

    Meng, Yijun; Shao, Chaogang; Wang, Huizhong; Jin, Yongfeng

    2012-05-21

    MicroRNAs (miRNAs) play an essential role in gene regulation in plants. At the same time, the expression of miRNA genes is also tightly controlled. Recently, a novel mechanism called "target mimicry" was discovered, providing another layer for modulating miRNA activities. However, except for the artificial target mimics manipulated for functional studies on certain miRNA genes, only one example, IPS1 (Induced by Phosphate Starvation 1)-miR399 was experimentally confirmed in planta. To date, few analyses for comprehensive identification of natural target mimics have been performed in plants. Thus, limited evidences are available to provide detailed information for interrogating the questionable issue whether target mimicry was widespread in planta, and implicated in certain biological processes. In this study, genome-wide computational prediction of endogenous miRNA mimics was performed in Arabidopsis and rice, and dozens of target mimics were identified. In contrast to a recent report, the densities of target mimic sites were found to be much higher within the untranslated regions (UTRs) when compared to those within the coding sequences (CDSs) in both plants. Some novel sequence characteristics were observed for the miRNAs that were potentially regulated by the target mimics. GO (Gene Ontology) term enrichment analysis revealed some functional insights into the predicted mimics. After degradome sequencing data-based identification of miRNA targets, the regulatory networks constituted by target mimics, miRNAs and their downstream targets were constructed, and some intriguing subnetworks were further exploited. These results together suggest that target mimicry may be widely implicated in regulating miRNA activities in planta, and we hope this study could expand the current understanding of miRNA-involved regulatory networks.

  15. Ultrasound-mediated vascular gene transfection by cavitation of endothelial-targeted cationic microbubbles.

    PubMed

    Xie, Aris; Belcik, Todd; Qi, Yue; Morgan, Terry K; Champaneri, Shivam A; Taylor, Sarah; Davidson, Brian P; Zhao, Yan; Klibanov, Alexander L; Kuliszewski, Michael A; Leong-Poi, Howard; Ammi, Azzdine; Lindner, Jonathan R

    2012-12-01

    Ultrasound-mediated gene delivery can be amplified by acoustic disruption of microbubble carriers that undergo cavitation. We hypothesized that endothelial targeting of microbubbles bearing cDNA is feasible and, through optimizing proximity to the vessel wall, increases the efficacy of gene transfection. Contrast ultrasound-mediated gene delivery is a promising approach for site-specific gene therapy, although there are concerns with the reproducibility of this technique and the safety when using high-power ultrasound. Cationic lipid-shelled decafluorobutane microbubbles bearing a targeting moiety were prepared and compared with nontargeted microbubbles. Microbubble targeting efficiency to endothelial adhesion molecules (P-selectin or intercellular adhesion molecule [ICAM]-1) was tested using in vitro flow chamber studies, intravital microscopy of tumor necrosis factor-alpha (TNF-α)-stimulated murine cremaster muscle, and targeted contrast ultrasound imaging of P-selectin in a model of murine limb ischemia. Ultrasound-mediated transfection of luciferase reporter plasmid charge coupled to microbubbles in the post-ischemic hindlimb muscle was assessed by in vivo optical imaging. Charge coupling of cDNA to the microbubble surface was not influenced by the presence of targeting ligand, and did not alter the cavitation properties of cationic microbubbles. In flow chamber studies, surface conjugation of cDNA did not affect attachment of targeted microbubbles at microvascular shear stresses (0.6 and 1.5 dyne/cm(2)). Attachment in vivo was also not affected by cDNA according to intravital microscopy observations of venular adhesion of ICAM-1-targeted microbubbles and by ultrasound molecular imaging of P-selectin-targeted microbubbles in the post-ischemic hindlimb in mice. Transfection at the site of high acoustic pressures (1.0 and 1.8 MPa) was similar for control and P-selectin-targeted microbubbles but was associated with vascular rupture and hemorrhage. At 0.6 MPa

  16. TRAF1 knockdown alleviates palmitate-induced insulin resistance in HepG2 cells through NF-κB pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wanlu; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, 19 Qixiu Road, Nantong 226001, Jiangsu Province; Tang, Zhuqi

    High-fat diet (HFD) and inflammation are key contributors to insulin resistance (IR) and Type 2 diabetes mellitus (T2DM). With HFD, plasma free fatty acids (FFAs) can activate the nuclear factor-κB (NF-κB) in target tissues, then initiate negative crosstalk between FFAs and insulin signaling. However, the molecular link between IR and inflammation remains to be identified. We here reported that tumor necrosis factor receptor-associated factor 1 (TRAF1), an adapter in signal transduction, was involved in the onset of IR in hepatocytes. TRAF1 was significantly up-regulated in insulin-resistant liver tissues and palmitate (PA)-treated HepG2 cells. In addition, we showed that depletion ofmore » TRAF1 led to inhibition of the activity of NF-κB. Given the fact that the activation of NF-κB played a facilitating role in IR, the phosphorylation of Akt and GSK3β was also analyzed. We found that depletion of TRAF1 markedly reversed PA-induced attenuation of the phosphorylation of Akt and GSK3β in the cells. The accumulation of lipid droplets in hepatocyte and expression of two key gluconeogenic enzymes, PEPCK and G6Pase, were also determined and found to display a similar tendency with the phosphorylation of Akt and GSK3β. Glucose uptake assay indicated that knocking down TRAF1 blocked the effect of PA on the suppression of glucose uptake. These data implicated that TRAF1 knockdown might alleviate PA-induced IR in HepG2 cells through NF-κB pathway. - Highlights: • TRAF1 accelerated PA-induced IR in HepG2 cells mediated through NF-κB signaling. • Knockdown of TRAF1 alleviated PA-induced IR in HepG2 cells. • Knockdown of TRAF1 alleviated PA-induced lipid accumulation in HepG2 cells. • Knockdown of TRAF1 reversed PA-induced suppression of glucose uptake in HepG2 cells. • Knockdown of TRAF1 reversed PA-induced gluconeogenesis in HepG2 cells.« less

  17. Integrated computational biology analysis to evaluate target genes for chronic myelogenous leukemia.

    PubMed

    Zheng, Yu; Wang, Yu-Ping; Cao, Hongbao; Chen, Qiusheng; Zhang, Xi

    2018-06-05

    Although hundreds of genes have been linked to chronic myelogenous leukemia (CML), many of the results lack reproducibility. In the present study, data across multiple modalities were integrated to evaluate 579 CML candidate genes, including literature‑based CML‑gene relation data, Gene Expression Omnibus RNA expression data and pathway‑based gene‑gene interaction data. The expression data included samples from 76 patients with CML and 73 healthy controls. For each target gene, four metrics were proposed and tested with case/control classification. The effectiveness of the four metrics presented was demonstrated by the high classification accuracy (94.63%; P<2x10‑4). Cross metric analysis suggested nine top candidate genes for CML: Epidermal growth factor receptor, tumor protein p53, catenin β 1, janus kinase 2, tumor necrosis factor, abelson murine leukemia viral oncogene homolog 1, vascular endothelial growth factor A, B‑cell lymphoma 2 and proto‑oncogene tyrosine‑protein kinase. In addition, 145 CML candidate pathways enriched with 485 out of 579 genes were identified (P<8.2x10‑11; q=0.005). In conclusion, weighted genetic networks generated using computational biology may be complementary to biological experiments for the evaluation of known or novel CML target genes.

  18. New TFII-I family target genes involved in embryonic development.

    PubMed

    Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

    2009-09-04

    Two members of the TFII-I family transcription factor genes, GTF2I and GTF2IRD1, are the prime candidates responsible for the craniofacial and cognitive abnormalities of Williams syndrome patients. We have previously generated mouse lines with targeted disruption of Gtf2i and Gtf2ird1. Microarray analysis revealed significant changes in the expression profile of mutant embryos. Here we described three unknown genes that were dramatically down-regulated in mutants. The 2410018M08Rik/Scand3 gene encodes a protein of unknown function with CHCH and hATC domains. Scand3 is down-regulated during mouse embryonic stem cell (ES) differentiation. 4933436H12Rik is a testis-specific gene, which encodes a protein with no known domains. It is expressed in mouse ES cells. 1110008P08Rik/Kbtbd7 encodes an adapter protein with BTB/POZ, BACK, and Kelch motifs, previously shown to recruit substrates to the enzymatic complexes of the histone modifying or E3 ubiquitin ligase activities. Based on its expression pattern Kbtbd7 may have a specific role in brain development and function. All three genes possess well-conserved TFII-I-binding consensus sites within proximal promoters. Therefore our analysis suggests that these genes can be direct targets of TFII-I proteins and their impaired expression, as a result of the GTF2I and GTF2IRD1 haploinsufficiency, could contribute to the etiology of Williams syndrome.

  19. Gene therapy to target ER stress in brain diseases.

    PubMed

    Valenzuela, Vicente; Martínez, Gabriela; Duran-Aniotz, Claudia; Hetz, Claudio

    2016-10-01

    Gene therapy based on the use of Adeno-associated viruses (AAVs) is emerging as a safe and stable strategy to target molecular pathways involved in a variety of brain diseases. Endoplasmic reticulum (ER) stress is proposed as a transversal feature of most animal models and clinical samples from patients affected with neurodegenerative diseases. Manipulation of the unfolded protein response (UPR), a major homeostatic reaction under ER stress conditions, had proved beneficial in diverse models of neurodegeneration. Although increasing number of drugs are available to target ER stress, the use of small molecules to treat chronic brain diseases is challenging because of poor blood brain barrier permeability and undesirable side effects due to the role of the UPR in the physiology of peripheral organs. Gene therapy is currently considered a possible future alternative to circumvent these problems by the delivery of therapeutic agents to selective regions and cell types of the nervous system. Here we discuss current efforts to design gene therapy strategies to alleviate ER stress on a disease context. This article is part of a Special Issue entitled SI:ER stress. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

    PubMed

    Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

    2014-05-16

    Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

  1. Changes in gene expression in PBMCs profiles of PPARα target genes in obese and non-obese individuals during fasting.

    PubMed

    Felicidade, Ingrid; Marcarini, Juliana Cristina; Carreira, Clísia Mara; Amarante, Marla Karine; Afman, Lydia A; Mantovani, Mário Sérgio; Ribeiro, Lúcia Regina

    2015-01-01

    The prevalence of obesity has risen dramatically and the World Health Organization estimates that 700 million people will be obese worldwide by 2015. Approximately, 50% of the Brazilian population above 20 years of age is overweight, and 16% is obese. This study aimed to evaluate the differences in the expression of PPARα target genes in human peripheral blood mononuclear cells (PBMCs) and free fatty acids (FFA) in obese and non-obese individuals after 24 h of fasting. We first presented evidence that Brazilian people exhibit expression changes in PPARα target genes in PBMCs under fasting conditions. Q-PCR was utilized to assess the mRNA expression levels of target genes. In both groups, the FFA concentrations increased significantly after 24 h of fasting. The basal FFA mean concentration was two-fold higher in the obese group compared with the non-obese group. After fasting, all genes evaluated in this study showed increased expression levels compared with basal expression in both groups. However, our results reveal no differences in gene expression between the obese and non-obese, more studies are necessary to precisely delineate the associated mechanisms, particularly those that include groups with different degrees of obesity and patients with diabetes mellitus type 2 because the expression of the main genes that are involved in β-oxidation and glucose level maintenance are affected by these factors. © 2014 S. Karger AG, Basel.

  2. Effects of Nrf2 knockdown on the properties of irradiated cell conditioned medium from A549 human lung cancer cells.

    PubMed

    Yoshino, Hironori; Murakami, Kanna; Nawamaki, Mikoto; Kashiwakura, Ikuo

    2018-05-01

    The nuclear factor erythroid 2-related factor 2 (Nrf2) plays an important role in cellular defense against oxidative stress. Recent studies have demonstrated that Nrf2 is a useful target for cancer treatment, including radiation therapy. Ionizing radiation affects, not only the irradiated cells, but also the non-irradiated neighboring cells, and this effect is known as radiation-induced bystander effect. Upon exposure to radiation, the irradiated cells transmit signals to the non-irradiated cells via gap junctions or soluble factors. These signals in turn cause biological effects, such as a decrease in the clonogenic potential and cell death, in the non-irradiated neighboring cells. Nrf2 inhibition enhances cellular radiosensitivity. However, whether this modification of radiosensitivity by Nrf2 inhibition affects the radiation-induced bystander effects is unknown. In this study, we prepared an Nrf2 knockdown human lung cancer cell A549 and investigated whether the effects of irradiated cell conditioned medium (ICCM) on cell growth and cell death induction of non-irradiated cells vary depending on the Nrf2 knockdown. We found that Nrf2 knockdown resulted in a decrease in the cell growth and an increase in the radiosensitivity of A549 cells. When non-irradiated A549 cells were transfected with control siRNA and treated with ICCM, no significant difference was observed in the cell growth and proportion of Annexin V + dead cells between ICCM from non-irradiated cells and that from 2 or 8 Gy-irradiated cells. Similarly, no significant difference was observed in the cell growth and cell death induction upon treatment with ICCM in the Nrf2 knockdown A549 cells. Taken together, these results suggest that Nrf2 knockdown decreases cell growth and enhances the radiosensitivity of A549 cells; however, it does not alter the effect of ICCM on cell growth.

  3. Knockdown of SLC39A7 inhibits cell growth and induces apoptosis in human colorectal cancer cells.

    PubMed

    Sheng, Nengquan; Yan, Li; You, Weiqiang; Tan, Gewen; Gong, Jianfeng; Chen, Hongqi; Yang, Yi; Hu, Landian; Wang, Zhigang

    2017-10-01

    SLC39A7 (zip7) is a zinc transporter that plays a key role in intestinal epithelial self-renewal. However, little is known about SLC39A7 in colorectal cancer. To assess the biological function of SLC39A7 in colorectal cancer, the expression of SLC39A7 in human colorectal tumors and five colorectal cancer cell lines were evaluated by Oncomine Cancer Microarray Database and western blot analysis. In addition, short hairpin RNAs specifically targeting SLC39A7 were transfected into HCT116 and SW1116 cells to knockdown SLC39A7 expression. Then, the effects of SLC39A7 knockdown on colorectal cancer cells were detected by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide, colony-forming assay and flow cytometry. Our results showed that colorectal tumors have higher expression levels of SLC39A7 than normal colon tissues. Knockdown of SLC39A7 exhibited a significant decrease in cell viability and proliferation of colorectal cancer cells. It was also shown that knockdown of SLC39A7 interfered with cell cycle progression and induced G2/M cell cycle arrest, as well as boosted early and late apoptosis in colorectal cancer cells. Furthermore, downregulation of SLC39A7 promoted the cleavage of PARP and enhanced the expression of Bad, Caspase-9, and cleaved-Caspase-3, as well as suppressed Bcl-2 expression. In conclusion, our results suggest that SLC39A7 plays a crucial role in the proliferation and survival of colorectal cancer cells, which associates with colorectal tumorigenesis. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer.

    PubMed

    Quintero, Melissa; Adamoski, Douglas; Reis, Larissa Menezes Dos; Ascenção, Carolline Fernanda Rodrigues; Oliveira, Krishina Ratna Sousa de; Gonçalves, Kaliandra de Almeida; Dias, Marília Meira; Carazzolle, Marcelo Falsarella; Dias, Sandra Martha Gomes

    2017-11-07

    Triple-negative breast cancer (TNBC) is characterized by a lack of estrogen and progesterone receptor expression (ESR and PGR, respectively) and an absence of human epithelial growth factor receptor (ERBB2) amplification. Approximately 15-20% of breast malignancies are TNBC. Patients with TNBC often have an unfavorable prognosis. In addition, TNBC represents an important clinical challenge since it does not respond to hormone therapy. In this work, we integrated high-throughput mRNA sequencing (RNA-Seq) data from normal and tumor tissues (obtained from The Cancer Genome Atlas, TCGA) and cell lines obtained through in-house sequencing or available from the Gene Expression Omnibus (GEO) to generate a unified list of differentially expressed (DE) genes. Methylome and proteomic data were integrated to our analysis to give further support to our findings. Genes that were overexpressed in TNBC were then curated to retain new potentially druggable targets based on in silico analysis. Knocking-down was used to assess gene importance for TNBC cell proliferation. Our pipeline analysis generated a list of 243 potential new targets for treating TNBC. We finally demonstrated that knock-down of Guanylate-Binding Protein 1 (GBP1 ), one of the candidate genes, selectively affected the growth of TNBC cell lines. Moreover, we showed that GBP1 expression was controlled by epidermal growth factor receptor (EGFR) in breast cancer cell lines. We propose that GBP1 is a new potential druggable therapeutic target for treating TNBC with enhanced EGFR expression.

  5. Target genes discovery through copy number alteration analysis in human hepatocellular carcinoma.

    PubMed

    Gu, De-Leung; Chen, Yen-Hsieh; Shih, Jou-Ho; Lin, Chi-Hung; Jou, Yuh-Shan; Chen, Chian-Feng

    2013-12-21

    High-throughput short-read sequencing of exomes and whole cancer genomes in multiple human hepatocellular carcinoma (HCC) cohorts confirmed previously identified frequently mutated somatic genes, such as TP53, CTNNB1 and AXIN1, and identified several novel genes with moderate mutation frequencies, including ARID1A, ARID2, MLL, MLL2, MLL3, MLL4, IRF2, ATM, CDKN2A, FGF19, PIK3CA, RPS6KA3, JAK1, KEAP1, NFE2L2, C16orf62, LEPR, RAC2, and IL6ST. Functional classification of these mutated genes suggested that alterations in pathways participating in chromatin remodeling, Wnt/β-catenin signaling, JAK/STAT signaling, and oxidative stress play critical roles in HCC tumorigenesis. Nevertheless, because there are few druggable genes used in HCC therapy, the identification of new therapeutic targets through integrated genomic approaches remains an important task. Because a large amount of HCC genomic data genotyped by high density single nucleotide polymorphism arrays is deposited in the public domain, copy number alteration (CNA) analyses of these arrays is a cost-effective way to reveal target genes through profiling of recurrent and overlapping amplicons, homozygous deletions and potentially unbalanced chromosomal translocations accumulated during HCC progression. Moreover, integration of CNAs with other high-throughput genomic data, such as aberrantly coding transcriptomes and non-coding gene expression in human HCC tissues and rodent HCC models, provides lines of evidence that can be used to facilitate the identification of novel HCC target genes with the potential of improving the survival of HCC patients.

  6. Identification of highly effective target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis.

    PubMed

    Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K

    2018-03-22

    Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.

  7. Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †

    PubMed Central

    Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming

    2008-01-01

    Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818

  8. Advances in plant gene-targeted and functional markers: a review

    PubMed Central

    2013-01-01

    Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the

  9. Amyloid precursor protein regulates migration and metalloproteinase gene expression in prostate cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyazaki, Toshiaki; Ikeda, Kazuhiro; Horie-Inoue, Kuniko

    Highlights: • APP knockdown reduced proliferation and migration of prostate cancer cells. • APP knockdown reduced expression of metalloproteinase and EMT-related genes. • APP overexpression promoted LNCaP cell migration. • APP overexpression increased expression of metalloproteinase and EMT-related genes. - Abstract: Amyloid precursor protein (APP) is a type I transmembrane protein, and one of its processed forms, β-amyloid, is considered to play a central role in the development of Alzheimer’s disease. We previously showed that APP is a primary androgen-responsive gene in prostate cancer and that its increased expression is correlated with poor prognosis for patients with prostate cancer. APPmore » has also been implicated in several human malignancies. Nevertheless, the mechanism underlying the pro-proliferative effects of APP on cancers is still not well-understood. In the present study, we explored a pathophysiological role for APP in prostate cancer cells using siRNA targeting APP (siAPP). The proliferation and migration of LNCaP and DU145 prostate cancer cells were significantly suppressed by siAPP. Differentially expressed genes in siAPP-treated cells compared to control siRNA-treated cells were identified by microarray analysis. Notably, several metalloproteinase genes, such as ADAM10 and ADAM17, and epithelial–mesenchymal transition (EMT)-related genes, such as VIM, and SNAI2, were downregulated in siAPP-treated cells as compared to control cells. The expression of these genes was upregulated in LNCaP cells stably expressing APP when compared with control cells. APP-overexpressing LNCaP cells exhibited enhanced migration in comparison to control cells. These results suggest that APP may contribute to the proliferation and migration of prostate cancer cells by modulating the expression of metalloproteinase and EMT-related genes.« less

  10. Engineering nucleases for gene targeting: safety and regulatory considerations.

    PubMed

    Pauwels, Katia; Podevin, Nancy; Breyer, Didier; Carroll, Dana; Herman, Philippe

    2014-01-25

    Nuclease-based gene targeting (NBGT) represents a significant breakthrough in targeted genome editing since it is applicable from single-celled protozoa to human, including several species of economic importance. Along with the fast progress in NBGT and the increasing availability of customized nucleases, more data are available about off-target effects associated with the use of this approach. We discuss how NBGT may offer a new perspective for genetic modification, we address some aspects crucial for a safety improvement of the corresponding techniques and we also briefly relate the use of NBGT applications and products to the regulatory oversight. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. PLGA/polymeric liposome for targeted drug and gene co-delivery.

    PubMed

    Wang, Hanjie; Zhao, Peiqi; Su, Wenya; Wang, Sheng; Liao, Zhenyu; Niu, Ruifang; Chang, Jin

    2010-11-01

    Chemotherapy is one of the most effective approaches to treat cancers in the clinic, but the problems, such as multidrug resistance (MDR), low bioavailability and toxicity, severely constrain the further application of chemotherapy. Our group recently reported that cationic PLGA/folate coated PEGlated polymeric liposome core-shell nanoparticles (PLGA/FPL NPs). It was self-assembled from a hydrophobic PLGA core and a hydrophilic folate coated PEGlated lipid shell for targeting co-delivery of drug and gene. Hydrophobic drugs can be incorporated into the core and the cationic shell of the drug-loaded nanoparticles can be used to bind DNA. The drug-loaded PLGA/FPL NPs/DNA complexes offer advantages to overcome these problems mentioned above, such as co-delivery of drugs and DNA to improving the chemosensitivity of cancer cells at a gene level, and targeting delivery of drug to the cancer tissue that enhance the bioavailability and reduce the toxicity. The experiment showed that nanoparticles have core-shell structure with nanosize, sustained drug release profile and good DNA-binding ability. Importantly, the core-shell nanoparticles achieve the possibility of co-delivering drugs and genes to the same cells with high gene transfection and drug delivery efficiency. Our data suggest that the PLGA/FPL NPs may be a useful drug and gene co-delivery system. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Cap 'n' collar C regulates genes responsible for imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata.

    PubMed

    Gaddelapati, Sharath Chandra; Kalsi, Megha; Roy, Amit; Palli, Subba Reddy

    2018-08-01

    The Colorado potato beetle (CPB), Leptinotarsa decemlineata developed resistance to imidacloprid after exposure to this insecticide for multiple generations. Our previous studies showed that xenobiotic transcription factor, cap 'n' collar isoform C (CncC) regulates the expression of multiple cytochrome P450 genes, which play essential roles in resistance to plant allelochemicals and insecticides. In this study, we sought to obtain a comprehensive picture of the genes regulated by CncC in imidacloprid-resistant CPB. We performed sequencing of RNA isolated from imidacloprid-resistant CPB treated with dsRNA targeting CncC or gene coding for green fluorescent protein (control). Comparative transcriptome analysis showed that CncC regulated the expression of 1798 genes, out of which 1499 genes were downregulated in CncC knockdown beetles. Interestingly, expression of 79% of imidacloprid induced P450 genes requires CncC. We performed quantitative real-time PCR to verify the reduction in the expression of 20 genes including those coding for detoxification enzymes (P450s, glutathione S-transferases, and esterases) and ABC transporters. The genes coding for ABC transporters are induced in insecticide resistant CPB and require CncC for their expression. Knockdown of genes coding for ABC transporters simultaneously or individually caused an increase in imidacloprid-induced mortality in resistant beetles confirming their contribution to insecticide resistance. These studies identified CncC as a transcription factor involved in regulation of genes responsible for imidacloprid resistance. Small molecule inhibitors of CncC or suppression of CncC by RNAi could provide effective synergists for pest control or management of insecticide resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Identification and analysis of ZFPM2 as a target gene of miR-17-92 cluster in chicken.

    PubMed

    Zhang, Xiao-fei; Song, He; Liu, Jing; Zhang, Wen-jian; Yan, Xiao-hong; Li, Hui; Wang, Ning

    2017-04-20

    The miR-17-92 cluster plays important roles in a variety of physiological and pathological processes in mammals. Previously, we showed that miR-17-92 cluster promotes chicken preadipocyte proliferation; however, the mechanism for its action is unknown. In order to explore the mechanism by which miR-17-92 cluster promotes chicken preadipocyte proliferation, CCK8 proliferation assay was performed to determine the effect of ZFPM2 knockdown on chicken preadipocyte proliferation. The results showed that ZFPM2 knockdown significantly promoted chicken preadipocyte proliferation (P<0.01). Consistent with the CCK8 results, the mRNA levels of cell proliferation marker genes, i.e., Cyclin D1, PCNA and Ki67, were markedly increased in the si-ZFPM2-transfected preadipocytes (P<0.01 or P<0.05). Bioinformatics analysis showed that there were two potential miRNA binding sites for the four individual members of miR-17-92 cluster in the ZFPM2 3'UTR, one for miR-17-5p and miR-20a and the other for miR-19a and miR-19b. To test whether ZFPM2 is a target for the miR-17-92 cluster, the ZFPM2 3'UTR reporter (psi-CHECK2-ZFPM2-3'UTR-WT) and its mutant reporter (psi-CHECK2-ZFPM2-3'UTR-MUT) were constructed. Reporter assays showed that overexpression of miR-17-92 cluster significantly inhibited the luciferase reporter activity of psi-CHECK2-ZFPM2-3'UTR-WT (P<0.01), as compared with control vector (empty pcDNA3.1). Transfection of miR-17-5p, miR-19a and miR-20a inhibitors increased the reporter activities of psi-CHECK2-ZFPM2-3'UTR-WT (P<0.01 or P<0.05). In contrast, transfection of miR-17-5p, miR-19a, and miR-20a inhibitors had no obvious effect on reporter activity of psi-CHECK2-ZFPM2-3'UTR-MUT. Further qRT-PCR analysis showed that miR-17-5p, miR-20a and miR-19a inhibitors significantly elevated the endogenous ZFPM2 mRNA expression (P<0.01 or P<0.05). Cotransfection of either miR-17-5p or miR-19a inhibitor and siZFPM2 showed that both inhibitors tended to reduce only slightly the promoting

  14. Adeno-associated virus–targeted disruption of the CFTR gene in cloned ferrets

    PubMed Central

    Sun, Xingshen; Yan, Ziying; Yi, Yaling; Li, Ziyi; Lei, Diana; Rogers, Christopher S.; Chen, Juan; Zhang, Yulong; Welsh, Michael J.; Leno, Gregory H.; Engelhardt, John F.

    2008-01-01

    Somatic cell gene targeting combined with nuclear transfer cloning presents tremendous potential for the creation of new, large-animal models of human diseases. Mouse disease models often fail to reproduce human phenotypes, underscoring the need for the generation and study of alternative disease models. Mice deficient for CFTR have been poor models for cystic fibrosis (CF), lacking many aspects of human CF lung disease. In this study, we describe the production of a CFTR gene–deficient model in the domestic ferret using recombinant adeno-associated virus–mediated gene targeting in fibroblasts, followed by nuclear transfer cloning. As part of this approach, we developed a somatic cell rejuvenation protocol using serial nuclear transfer to produce live CFTR-deficient clones from senescent gene-targeted fibroblasts. We transferred 472 reconstructed embryos into 11 recipient jills and obtained 8 healthy male ferret clones heterozygous for a disruption in exon 10 of the CFTR gene. To our knowledge, this study represents the first description of genetically engineered ferrets and describes an approach that may be of substantial utility in modeling not only CF, but also other genetic diseases. PMID:18324338

  15. LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer.

    PubMed

    Choi, Sul Ki; Kim, Hoe Suk; Jin, Tiefeng; Moon, Woo Kyung

    2017-02-14

    Lysyl oxidase (LOX) family genes catalyze collagen cross-link formation. To determine the effects of lysyl oxidase-like 4 (LOXL4) expression on breast tumor formation and metastasis, we evaluated primary tumor growth and lung metastasis in mice injected with LOXL4-knockdown MDA-MB-231 triple-negative human breast cancer cells. In addition, we analyzed overall survival in breast cancer patients based on LOXL4 expression using a public online database. In the mouse xenograft model, LOXL4 knockdown increased primary tumor growth and lung colonization as well as collagen I and IV, lysine hydroxylase 1 and 2, and prolyl 4-hydroxylase subunit alpha 1 and 2 levels. Second harmonic generation imaging revealed that LOXL4 knockdown resulted in the thickening of collagen bundles within tumors. In addition, weak LOXL4 expression was associated with poor overall survival in breast cancer patients from the BreastMark dataset, and this association was strongest in triple-negative breast cancer patients. These results demonstrate that weak LOXL4 expression leads to remodeling of the extracellular matrix through induction of collagen synthesis, deposition, and structural changes. These alterations in turn promote tumor growth and metastasis and are associated with poor clinical outcomes in triple-negative breast cancer.

  16. Genetic amplification of PPME1 in gastric and lung cancer and its potential as a novel therapeutic target

    PubMed Central

    Li, Jing; Han, Sufang; Qian, Ziliang; Su, Xinying; Fan, Shuqiong; Fu, Jiangang; Liu, Yuanjie; Yin, Xiaolu; Gao, Zeren; Zhang, Jingchuan; Yu, De-Hua; Ji, Qunsheng

    2014-01-01

    Protein phosphatase methylesterase 1 (PPME1) is a protein phosphatase 2A (PP2A)-specific methyl esterase that negatively regulates PP2A through demethylation at its carboxy terminal leucine 309 residue. Emerging evidence shows that the upregulation of PPME1 is associated with poor prognosis in glioblastoma patients. By performing an array comparative genomic hybridization analysis to detect copy number changes, we have been the first to identify PPME1 gene amplification in 3.8% (5/131) of Chinese gastric cancer (GC) samples and 3.1% (4/124) of Chinese lung cancer (LC) samples. This PPME1 gene amplification was confirmed by fluorescence in situ hybridization analysis and is correlated with elevated protein expression, as determined by immunohistochemistry analysis. To further investigate the role of PPME1 amplification in tumor growth, short-hairpin RNA-mediated gene silencing was employed. A knockdown of PPME1 expression resulted in a significant inhibition of cell proliferation and induction of cell apoptosis in PPME1-amplified human cancer cell lines SNU668 (GC) and Oka-C1 (LC), but not in nonamplified MKN1 (GC) and HCC95 (LC) cells. The PPME1 gene knockdown also led to a consistent decrease in PP2A demethylation at leucine 309, which was correlated with the downregulation of cellular Erk and AKT phosphorylation. Our data indicate that PPME1 could be an attractive therapeutic target for a subset of GCs and LCs. PMID:24253382

  17. [Discovery of the target genes inhibited by formic acid in Candida shehatae].

    PubMed

    Cai, Peng; Xiong, Xujie; Xu, Yong; Yong, Qiang; Zhu, Junjun; Shiyuan, Yu

    2014-01-04

    At transcriptional level, the inhibitory effects of formic acid was investigated on Candida shehatae, a model yeast strain capable of fermenting xylose to ethanol. Thereby, the target genes were regulated by formic acid and the transcript profiles were discovered. On the basis of the transcriptome data of C. shehatae metabolizing glucose and xylose, the genes responsible for ethanol fermentation were chosen as candidates by the combined method of yeast metabolic pathway analysis and manual gene BLAST search. These candidates were then quantitatively detected by RQ-PCR technique to find the regulating genes under gradient doses of formic acid. By quantitative analysis of 42 candidate genes, we finally identified 10 and 5 genes as markedly down-regulated and up-regulated targets by formic acid, respectively. With regard to gene transcripts regulated by formic acid in C. shehatae, the markedly down-regulated genes ranking declines as follows: xylitol dehydrogenase (XYL2), acetyl-CoA synthetase (ACS), ribose-5-phosphate isomerase (RKI), transaldolase (TAL), phosphogluconate dehydrogenase (GND1), transketolase (TKL), glucose-6-phosphate dehydrogenase (ZWF1), xylose reductase (XYL1), pyruvate dehydrogenase (PDH) and pyruvate decarboxylase (PDC); and a declining rank for up-regulated gens as follows: fructose-bisphosphate aldolase (ALD), glucokinase (GLK), malate dehydrogenase (MDH), 6-phosphofructokinase (PFK) and alcohol dehydrogenase (ADH).

  18. microRNA-328 inhibits cervical cancer cell proliferation and tumorigenesis by targeting TCF7L2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Xuan; Department of Gynaecology, Yantai Yuhuangding Hospital, Qingdao University School of Medicine, Yantai; Xia, Ying, E-mail: YingXia2006@qq.com

    microRNAs (miRNAs) play a vital role in tumor development and progression. In this study, we aimed to determine the expression and biological roles of miR-328 in cervical cancer and identify its direct target gene. Our data showed that miR-328 was significantly downregulated in human cervical cancer tissues and cells. Re-expression of miR-328 inhibited cervical cancer cell proliferation and colony formation in vitro and suppressed the growth of xenograft tumors in vivo. Bioinformatic analysis predicted TCF7L2 (an essential effector of canonical Wnt signaling) as a target gene of miR-328, which was confirmed by luciferase reporter assays. Enforced expression of miR-328 led to amore » decline in the expression of endogenous TCF7L2 in cervical cancer cells. In cervical cancer tissues, TCF7L2 protein levels were negatively correlated with miR-328 expression levels (r = −0.462, P = 0.017). Small interfering RNA-mediated knockdown of TCF7L2 significantly impaired the proliferation and colony formation of cervical cancer cells. Ectopic expression of a miRNA-resistant form of TCF7L2 significantly reversed the growth suppressive effects of miR-328 on cervical cancer cells, which was accompanied by induction of cyclin D1 expression. Taken together, our results provide first evidence for the growth suppressive activity of miR-328 in cervical cancer, which is largely ascribed to downregulation of TCF7L2. Restoration of miR-328 may have therapeutic potential in cervical cancer. -- Highlights: •miR-328 inhibits cervical cancer cell growth and tumorigenesis. •TCF7L2 is a direct target gene of miR-328 in cervical cancer. •Knockdown of TCF7L2 impairs the proliferation and colony formation of cervical cancer cells.« less

  19. Variables and Strategies in Development of Therapeutic Post-Transcriptional Gene Silencing Agents

    PubMed Central

    Sullivan, Jack M.; Yau, Edwin H.; Kolniak, Tiffany A.; Sheflin, Lowell G.; Taggart, R. Thomas; Abdelmaksoud, Heba E.

    2011-01-01

    Post-transcriptional gene silencing (PTGS) agents such as ribozymes, RNAi and antisense have substantial potential for gene therapy of human retinal degenerations. These technologies are used to knockdown a specific target RNA and its cognate protein. The disease target mRNA may be a mutant mRNA causing an autosomal dominant retinal degeneration or a normal mRNA that is overexpressed in certain diseases. All PTGS technologies depend upon the initial critical annealing event of the PTGS ligand to the target RNA. This event requires that the PTGS agent is in a conformational state able to support hybridization and that the target have a large and accessible single-stranded platform to allow rapid annealing, although such platforms are rare. We address the biocomplexity that currently limits PTGS therapeutic development with particular emphasis on biophysical variables that influence cellular performance. We address the different strategies that can be used for development of PTGS agents intended for therapeutic translation. These issues apply generally to the development of PTGS agents for retinal, ocular, or systemic diseases. This review should assist the interested reader to rapidly appreciate critical variables in PTGS development and facilitate initial design and testing of such agents against new targets of clinical interest. PMID:21785698

  20. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria

    PubMed Central

    Rogers, Matthew B; Patron, Nicola J; Keeling, Patrick J

    2007-01-01

    Background Horizontal or lateral transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial and archaeal genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood. In particular, gene flow from eukaryotes to prokaryotes is rarely documented with strong support, which is unusual since prokaryotic genomes appear to readily accept foreign genes. Results Here, we show that abundant marine cyanobacteria in the related genera Synechococcus and Prochlorococcus acquired a key Calvin cycle/glycolytic enzyme from a eukaryote. Two non-homologous forms of fructose bisphosphate aldolase (FBA) are characteristic of eukaryotes and prokaryotes respectively. However, a eukaryotic gene has been inserted immediately upstream of the ancestral prokaryotic gene in several strains (ecotypes) of Synechococcus and Prochlorococcus. In one lineage this new gene has replaced the ancestral gene altogether. The eukaryotic gene is most closely related to the plastid-targeted FBA from red algae. This eukaryotic-type FBA once replaced the plastid/cyanobacterial type in photosynthetic eukaryotes, hinting at a possible functional advantage in Calvin cycle reactions. The strains that now possess this eukaryotic FBA are scattered across the tree of Synechococcus and Prochlorococcus, perhaps because the gene has been transferred multiple times among cyanobacteria, or more likely because it has been selectively retained only in certain lineages. Conclusion A gene for plastid-targeted FBA has been transferred from red algae to cyanobacteria, where it has inserted itself beside its non-homologous, functional analogue. Its current distribution in Prochlorococcus and Synechococcus is punctate, suggesting a complex history since its introduction to this group. PMID:17584924

  1. A Convenient Cas9-based Conditional Knockout Strategy for Simultaneously Targeting Multiple Genes in Mouse.

    PubMed

    Chen, Jiang; Du, Yinan; He, Xueyan; Huang, Xingxu; Shi, Yun S

    2017-03-31

    The most powerful way to probe protein function is to characterize the consequence of its deletion. Compared to conventional gene knockout (KO), conditional knockout (cKO) provides an advanced gene targeting strategy with which gene deletion can be performed in a spatially and temporally restricted manner. However, for most species that are amphiploid, the widely used Cre-flox conditional KO (cKO) system would need targeting loci in both alleles to be loxP flanked, which in practice, requires time and labor consuming breeding. This is considerably significant when one is dealing with multiple genes. CRISPR/Cas9 genome modulation system is advantaged in its capability in targeting multiple sites simultaneously. Here we propose a strategy that could achieve conditional KO of multiple genes in mouse with Cre recombinase dependent Cas9 expression. By transgenic construction of loxP-stop-loxP (LSL) controlled Cas9 (LSL-Cas9) together with sgRNAs targeting EGFP, we showed that the fluorescence molecule could be eliminated in a Cre-dependent manner. We further verified the efficacy of this novel strategy to target multiple sites by deleting c-Maf and MafB simultaneously in macrophages specifically. Compared to the traditional Cre-flox cKO strategy, this sgRNAs-LSL-Cas9 cKO system is simpler and faster, and would make conditional manipulation of multiple genes feasible.

  2. CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

    PubMed

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-07-25

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

  3. [Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

    PubMed

    Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

    2010-06-01

    A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

  4. Cdx ParaHox genes acquired distinct developmental roles after gene duplication in vertebrate evolution.

    PubMed

    Marlétaz, Ferdinand; Maeso, Ignacio; Faas, Laura; Isaacs, Harry V; Holland, Peter W H

    2015-08-01

    The functional consequences of whole genome duplications in vertebrate evolution are not fully understood. It remains unclear, for instance, why paralogues were retained in some gene families but extensively lost in others. Cdx homeobox genes encode conserved transcription factors controlling posterior development across diverse bilaterians. These genes are part of the ParaHox gene cluster. Multiple Cdx copies were retained after genome duplication, raising questions about how functional divergence, overlap, and redundancy respectively contributed to their retention and evolutionary fate. We examined the degree of regulatory and functional overlap between the three vertebrate Cdx genes using single and triple morpholino knock-down in Xenopus tropicalis followed by RNA-seq. We found that one paralogue, Cdx4, has a much stronger effect on gene expression than the others, including a strong regulatory effect on FGF and Wnt genes. Functional annotation revealed distinct and overlapping roles and subtly different temporal windows of action for each gene. The data also reveal a colinear-like effect of Cdx genes on Hox genes, with repression of Hox paralogy groups 1 and 2, and activation increasing from Hox group 5 to 11. We also highlight cases in which duplicated genes regulate distinct paralogous targets revealing pathway elaboration after whole genome duplication. Despite shared core pathways, Cdx paralogues have acquired distinct regulatory roles during development. This implies that the degree of functional overlap between paralogues is relatively low and that gene expression pattern alone should be used with caution when investigating the functional evolution of duplicated genes. We therefore suggest that developmental programmes were extensively rewired after whole genome duplication in the early evolution of vertebrates.

  5. Therapeutic gene targeting approaches for the treatment of dyslipidemias and atherosclerosis.

    PubMed

    Mäkinen, Petri I; Ylä-Herttuala, Seppo

    2013-04-01

    Despite improved therapies, cardiovascular diseases are the leading cause of morbidity and mortality worldwide. Therefore, new therapeutic approaches are still needed. In the gene therapy field, RNA interference (RNAi) and regulation of microRNAs (miRNAs) have gained a lot of attention in addition to traditional overexpression based strategies. Here, recent findings in therapeutic gene silencing and modulation of small RNA expression related to atherogenesis and dyslipidemia are summarized. Novel gene therapy approaches for the treatment of hyperlipidemia have been addressed. Antisense oligonucleotide and RNAi-based therapies against apolipoprotein B100 and proprotein convertase subtilisin/kexin type 9 have shown already efficacy in preclinical and clinical trials. In addition, several miRNAs dysregulated in atherosclerotic lesions and regulating cholesterol homeostasis have been found, which may represent novel targets for future therapies. New therapies for lowering lipid levels are now being tested in clinical trials, and both antisense oligonucleotide and RNAi-based therapies have shown promising results in lowering cholesterol levels. However, the modulation of inflammatory component in atherosclerosis by gene therapy and targeting of the effects to plaques are still difficult challenges.

  6. Targeting PIM kinase enhances the activity of sunitinib in renal cell carcinoma.

    PubMed

    Mahalingam, D; Espitia, C M; Medina, E C; Esquivel, J A; Kelly, K R; Bearss, D; Choy, G; Taverna, P; Carew, J S; Giles, F J; Nawrocki, S T

    2011-11-08

    Upregulation of PIM kinase expression has been reported in many malignancies, suggesting that inhibition of PIM kinase activity may be an attractive therapeutic strategy. We hypothesised that inhibition of PIM kinase activity with SGI-1776, a novel small molecule inhibitor of PIM kinase activity, would reduce the viability of renal cell carcinoma (RCC) cells and enhance the activity of sunitinib. Immunoblotting, qRT-PCR, and gene expression arrays were carried out to identify genes modulated by SGI-1776 treatment. The anticancer activity of SGI-1776 and sunitinib was determined by viability and apoptosis assays and in tumour xenografts in vivo. Treatment with SGI-1776 led to a decrease in phosphorylated and total c-Myc levels, which resulted in the modulation of c-Myc target genes. SGI-1776 in combination with sunitinib induced a further reduction in c-Myc levels, which was associated with enhanced anticancer activity. siRNA-mediated knockdown of c-Myc demonstrated that its expression has a key role in regulating the sensitivity to the combination of SGI-1776 and sunitinib. Importantly, the combination significantly reduced tumour burden in two RCC xenograft models compared with single-agent therapy and was very well tolerated. These data indicate that targeting PIM kinase signalling is a promising treatment strategy for RCC. 2011 Cancer Research UK

  7. An Assessment of Database-Validated microRNA Target Genes in Normal Colonic Mucosa: Implications for Pathway Analysis.

    PubMed

    Slattery, Martha L; Herrick, Jennifer S; Stevens, John R; Wolff, Roger K; Mullany, Lila E

    2017-01-01

    Determination of functional pathways regulated by microRNAs (miRNAs), while an essential step in developing therapeutics, is challenging. Some miRNAs have been studied extensively; others have limited information. In this study, we focus on 254 miRNAs previously identified as being associated with colorectal cancer and their database-identified validated target genes. We use RNA-Seq data to evaluate messenger RNA (mRNA) expression for 157 subjects who also had miRNA expression data. In the replication phase of the study, we replicated associations between 254 miRNAs associated with colorectal cancer and mRNA expression of database-identified target genes in normal colonic mucosa. In the discovery phase of the study, we evaluated expression of 18 miR-NAs (those with 20 or fewer database-identified target genes along with miR-21-5p, miR-215-5p, and miR-124-3p which have more than 500 database-identified target genes) with expression of 17 434 mRNAs to identify new targets in colon tissue. Seed region matches between miRNA and newly identified targeted mRNA were used to help determine direct miRNA-mRNA associations. From the replication of the 121 miRNAs that had at least 1 database-identified target gene using mRNA expression methods, 97.9% were expressed in normal colonic mucosa. Of the 8622 target miRNA-mRNA associations identified in the database, 2658 (30.2%) were associated with gene expression in normal colonic mucosa after adjusting for multiple comparisons. Of the 133 miRNAs with database-identified target genes by non-mRNA expression methods, 97.2% were expressed in normal colonic mucosa. After adjustment for multiple comparisons, 2416 miRNA-mRNA associations remained significant (19.8%). Results from the discovery phase based on detailed examination of 18 miRNAs identified more than 80 000 miRNA-mRNA associations that had not previously linked to the miRNA. Of these miRNA-mRNA associations, 15.6% and 14.8% had seed matches for CRCh38 and CRCh37

  8. Knockdown of metallothionein 1 and 2 does not affect atrophy or oxidant activity in a novel in vitro model.

    PubMed

    Hyldahl, Robert D; O'Fallon, Kevin S; Schwartz, Lawrence M; Clarkson, Priscilla M

    2010-11-01

    Skeletal muscle atrophy is a significant health problem that results in decreased muscle size and function and has been associated with increases in oxidative stress. The molecular mechanisms that regulate muscle atrophy, however, are largely unknown. The metallothioneins (MT), a family of genes with antioxidant properties, have been found to be consistently upregulated during muscle atrophy, although their function during muscle atrophy is unknown. Therefore, we hypothesized that MT knockdown would result in greater oxidative stress and an enhanced atrophy response in C(2)C(12) myotubes subjected to serum reduction (SR), a novel atrophy-inducing stimulus. Forty-eight hours before SR, myotubes were transfected with small interfering RNA (siRNA) sequences designed to decrease MT expression. Muscle atrophy and oxidative stress were then measured at baseline and for 72 h following SR. Muscle atrophy was quantified by immunocytochemistry and myotube diameter measurements. Oxidative stress was measured using the fluorescent probe 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein. SR resulted in a significant increase in oxidative stress and a decrease in myotube size and protein content. However, there were no differences observed in the extent of muscle atrophy or oxidant activity following MT knockdown. We therefore conclude that the novel SR model results in a strong atrophy response and an increase in oxidant activity in cultured myotubes and that knockdown of MT does not affect that response.

  9. NHR-23 dependent collagen and hedgehog-related genes required for molting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kouns, Nathaniel A.; Nakielna, Johana; Behensky, Frantisek

    2011-10-07

    Highlights: {yields} NHR-23 is a critical regulator of nematode development and molting. {yields} The manuscript characterizes the loss-of-function phenotype of an nhr-23 mutant. {yields} Whole genome expression analysis identifies new potential targets of NHR-23. {yields} Hedgehog-related genes are identified as NHR-23 dependent genes. {yields} New link between sterol mediated signaling and regulation by NHR-23 is found. -- Abstract: NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparativemore » expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa.« less

  10. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation.

    PubMed

    Zhang, Hui; Zhang, Jinshan; Wei, Pengliang; Zhang, Botao; Gou, Feng; Feng, Zhengyan; Mao, Yanfei; Yang, Lan; Zhang, Heng; Xu, Nanfei; Zhu, Jian-Kang

    2014-08-01

    The CRISPR/Cas9 system has been demonstrated to efficiently induce targeted gene editing in a variety of organisms including plants. Recent work showed that CRISPR/Cas9-induced gene mutations in Arabidopsis were mostly somatic mutations in the early generation, although some mutations could be stably inherited in later generations. However, it remains unclear whether this system will work similarly in crops such as rice. In this study, we tested in two rice subspecies 11 target genes for their amenability to CRISPR/Cas9-induced editing and determined the patterns, specificity and heritability of the gene modifications. Analysis of the genotypes and frequency of edited genes in the first generation of transformed plants (T0) showed that the CRISPR/Cas9 system was highly efficient in rice, with target genes edited in nearly half of the transformed embryogenic cells before their first cell division. Homozygotes of edited target genes were readily found in T0 plants. The gene mutations were passed to the next generation (T1) following classic Mendelian law, without any detectable new mutation or reversion. Even with extensive searches including whole genome resequencing, we could not find any evidence of large-scale off-targeting in rice for any of the many targets tested in this study. By specifically sequencing the putative off-target sites of a large number of T0 plants, low-frequency mutations were found in only one off-target site where the sequence had 1-bp difference from the intended target. Overall, the data in this study point to the CRISPR/Cas9 system being a powerful tool in crop genome engineering. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. ABCC6 knockdown in HepG2 cells induces a senescent-like cell phenotype.

    PubMed

    Miglionico, Rocchina; Ostuni, Angela; Armentano, Maria Francesca; Milella, Luigi; Crescenzi, Elvira; Carmosino, Monica; Bisaccia, Faustino

    2017-01-01

    Pseudoxanthoma elasticum (PXE) is characterized by progressive ectopic mineralization of elastic fibers in dermal, ocular and vascular tissues. No effective treatment exists. It is caused by inactivating mutations in the gene encoding for the ATP-binding cassette, sub-family C member 6 transporter (ABCC6), which is mainly expressed in the liver. The ABCC6 substrate (s) and the PXE pathomechanism remain unknown. Recent studies have shown that overexpression of ABCC6 in HEK293 cells results in efflux of ATP, which is rapidly converted into nucleoside monophosphates and pyrophosphate (PPi). Since the latter inhibits mineralization, it was proposed that the absence of circulating PPi in PXE patients results in the characteristic ectopic mineralization. These studies also demonstrated that the presence of ABCC6 modifies cell secretory activity and suggested that ABCC6 can change the cell phenotype. Stable ABCC6 knockdown HepG2 clones were generated using small hairpin RNA (shRNA) technology. The intracellular glutathione and ROS levels were determined. Experiments using cell cycle analysis, real-time PCR and western blot were performed on genes involved in the senescence phenotype. To shed light on the physiological role of ABCC6, we focused on the phenotype of HepG2 cells that lack ABCC6 activity. Interestingly, we found that ABCC6 knockdown HepG2 cells show: 1) intracellular reductive stress; 2) cell cycle arrest in G1 phase; 3) upregulation of p21 Cip p53 independent; and 4) downregulation of lamin A/C. These findings show that the absence of ABCC6 profoundly changes the HepG2 phenotype, suggesting that the PXE syndrome is a complex metabolic disease that is not exclusively related to the absence of pyrophosphate in the bloodstream.

  12. Deletion of a target gene in Indica rice via CRISPR/Cas9.

    PubMed

    Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan

    2017-08-01

    Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.

  13. In silico prediction of novel therapeutic targets using gene-disease association data.

    PubMed

    Ferrero, Enrico; Dunham, Ian; Sanseau, Philippe

    2017-08-29

    Target identification and validation is a pressing challenge in the pharmaceutical industry, with many of the programmes that fail for efficacy reasons showing poor association between the drug target and the disease. Computational prediction of successful targets could have a considerable impact on attrition rates in the drug discovery pipeline by significantly reducing the initial search space. Here, we explore whether gene-disease association data from the Open Targets platform is sufficient to predict therapeutic targets that are actively being pursued by pharmaceutical companies or are already on the market. To test our hypothesis, we train four different classifiers (a random forest, a support vector machine, a neural network and a gradient boosting machine) on partially labelled data and evaluate their performance using nested cross-validation and testing on an independent set. We then select the best performing model and use it to make predictions on more than 15,000 genes. Finally, we validate our predictions by mining the scientific literature for proposed therapeutic targets. We observe that the data types with the best predictive power are animal models showing a disease-relevant phenotype, differential expression in diseased tissue and genetic association with the disease under investigation. On a test set, the neural network classifier achieves over 71% accuracy with an AUC of 0.76 when predicting therapeutic targets in a semi-supervised learning setting. We use this model to gain insights into current and failed programmes and to predict 1431 novel targets, of which a highly significant proportion has been independently proposed in the literature. Our in silico approach shows that data linking genes and diseases is sufficient to predict novel therapeutic targets effectively and confirms that this type of evidence is essential for formulating or strengthening hypotheses in the target discovery process. Ultimately, more rapid and automated target

  14. Novel targeted therapy for neuroblastoma: silencing the MXD3 gene using siRNA.

    PubMed

    Duong, Connie; Yoshida, Sakiko; Chen, Cathy; Barisone, Gustavo; Diaz, Elva; Li, Yueju; Beckett, Laurel; Chung, Jong; Antony, Reuben; Nolta, Jan; Nitin, Nitin; Satake, Noriko

    2017-09-01

    BackgroundNeuroblastoma is the second most common extracranial cancer in children. Current therapies for neuroblastoma, which use a combination of chemotherapy drugs, have limitations for high-risk subtypes and can cause significant long-term adverse effects in young patients. Therefore, a new therapy is needed. In this study, we investigated the transcription factor MXD3 as a potential therapeutic target in neuroblastoma.MethodsMXD3 expression was analyzed in five neuroblastoma cell lines by immunocytochemistry and quantitative real-time reverse transcription PCR, and in 18 primary patient tumor samples by immunohistochemistry. We developed nanocomplexes using siRNA and superparamagnetic iron oxide nanoparticles to target MXD3 in neuroblastoma cell lines in vitro as a single-agent therapeutic and in combination with doxorubicin, vincristine, cisplatin, or maphosphamide-common drugs used in current neuroblastoma treatment.ResultsMXD3 was highly expressed in neuroblastoma cell lines and in patient tumors that had high-risk features. Neuroblastoma cells treated in vitro with the MXD3 siRNA nanocomplexes showed MXD3 protein knockdown and resulted in cell apoptosis. Furthermore, on combining MXD3 siRNA nanocomplexes with each of the four drugs, all showed additive efficacy.ConclusionThese results indicate that MXD3 is a potential new target and that the use of MXD3 siRNA nanocomplexes is a novel therapeutic approach for neuroblastoma.

  15. Knockdown of POLDIP2 suppresses tumor growth and invasion capacity and is linked to unfavorable transformation ability and metastatic feature in non-small cell lung cancer.

    PubMed

    Chen, Ying-Chieh; Kuo, Chih-Chi; Chian, Chih-Feng; Tzao, Ching; Chang, Shan-Yueh; Shih, Yu-Lueng; Lin, Ya-Wen; Yu, Mu-Hsien; Su, Her-Young

    2018-07-01

    The main problem in the treatment of non-small cell lung cancer (NSCLC) is metastasis. Epithelial-mesenchymal transition (EMT) is known as the critical signaling in tumor progression, metastasis, and also the drug resistance. In this study, we reported a novel gene Polymerase delta-interacting protein 2 (POLDIP2) was downregulated in NSCLC tissues and first demonstrated that overexpression of POLDIP2 increased the anchorage-independent growth (AIG) and invasiveness of H1299 cells. In addition, we examined that knockdown of POLDIP2 in H1299 and A549 cells reduced tumorigenicity and metastatic capacity in vitro and also in vivo. Moreover, downregulation of the cell proliferation marker cyclin D1 and EMT markers CDH2, Slug, and Twist was showed in H1299 cells by POLDIP2 knockdown, suggesting that the inhibition of malignancy was affected by modulating key genes for tumor growth and invasiveness. Taken together, our study is the first study that demonstrated that POLDIP2 gene was function as an oncogene in NSCLC and implied the oncogenic ability might be through promoting cell proliferation or EMT. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. The human RHOX gene cluster: target genes and functional analysis of gene variants in infertile men.

    PubMed

    Borgmann, Jennifer; Tüttelmann, Frank; Dworniczak, Bernd; Röpke, Albrecht; Song, Hye-Won; Kliesch, Sabine; Wilkinson, Miles F; Laurentino, Sandra; Gromoll, Jörg

    2016-11-15

    The X-linked reproductive homeobox (RHOX) gene cluster encodes transcription factors preferentially expressed in reproductive tissues. This gene cluster has important roles in male fertility based on phenotypic defects of Rhox-mutant mice and the finding that aberrant RHOX promoter methylation is strongly associated with abnormal human sperm parameters. However, little is known about the molecular mechanism of RHOX function in humans. Using gene expression profiling, we identified genes regulated by members of the human RHOX gene cluster. Some genes were uniquely regulated by RHOXF1 or RHOXF2/2B, while others were regulated by both of these transcription factors. Several of these regulated genes encode proteins involved in processes relevant to spermatogenesis; e.g. stress protection and cell survival. One of the target genes of RHOXF2/2B is RHOXF1, suggesting cross-regulation to enhance transcriptional responses. The potential role of RHOX in human infertility was addressed by sequencing all RHOX exons in a group of 250 patients with severe oligozoospermia. This revealed two mutations in RHOXF1 (c.515G > A and c.522C > T) and four in RHOXF2/2B (-73C > G, c.202G > A, c.411C > T and c.679G > A), of which only one (c.202G > A) was found in a control group of men with normal sperm concentration. Functional analysis demonstrated that c.202G > A and c.679G > A significantly impaired the ability of RHOXF2/2B to regulate downstream genes. Molecular modelling suggested that these mutations alter RHOXF2/F2B protein conformation. By combining clinical data with in vitro functional analysis, we demonstrate how the X-linked RHOX gene cluster may function in normal human spermatogenesis and we provide evidence that it is impaired in human male fertility.

  17. Comparison of quantitative PCR assays for Escherichia coli targeting ribosomal RNA and single copy genes

    EPA Science Inventory

    Aims: Compare specificity and sensitivity of quantitative PCR (qPCR) assays targeting single and multi-copy gene regions of Escherichia coli. Methods and Results: A previously reported assay targeting the uidA gene (uidA405) was used as the basis for comparing the taxono...

  18. ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

    PubMed Central

    Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

    1997-01-01

    ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to

  19. Systemic p53 gene therapy of cancer with immunolipoplexes targeted by anti-transferrin receptor scFv.

    PubMed Central

    Xu, L.; Tang, W. H.; Huang, C. C.; Alexander, W.; Xiang, L. M.; Pirollo, K. F.; Rait, A.; Chang, E. H.

    2001-01-01

    BACKGROUND: A long-standing goal in genetic therapy for cancer is a systemic gene delivery system that selectively targets tumor cells, including metastases. Here we describe a novel cationic immunolipoplex system that shows high in vivo gene transfer efficiency and anti- tumor efficacy when used for systemic p53 gene therapy of cancer. MATERIALS AND METHODS: A cationic immunolipoplex incorporating a biosynthetically lipid-tagged, anti-transferrin receptor single-chain antibody (TfRscFv), was designed to target tumor cells both in vitro and in vivo. A human breast cancer metastasis model was employed to evaluate the in vivo efficacy of systemically administered, TfRscFv-immunolipoplex-mediated, p53 gene therapy in combination with docetaxel. RESULTS: The TfRscFv-targeting cationic immunolipoplex had a size of 60-100 nm, showed enhanced tumor cell binding, and improved targeted gene delivery and transfection efficiencies, both in vitro and in vivo. The p53 tumor suppressor gene was not only systemically delivered by the immunolipoplex to human tumor xenografts in nude mice but also functionally expressed. In the nude mouse breast cancer metastasis model, the combination of the p53 gene delivered by the systemic administration of the TfRscFv-immunolipoplex and docetaxel resulted in significantly improved efficacy with prolonged survival. CONCLUSIONS: This is the first report using scFv-targeting immunolipoplexes for systemic gene therapy. The TfRscFv has a number of advantages over the transferrin (Tf) molecule itself: (1) scFv has a much smaller size than Tf producing a smaller immunolipoplex giving better penetration into solid tumors; (2) unlike Tf, the scFv is a recombinant protein, not a blood product; (3) large scale production and strict quality control of the recombinant scFv, as well as scFv-immunolipoplex, are feasible. The sensitization of tumors to chemotherapy by this tumor-targeted and efficient p53 gene delivery method could lower the effective dose of

  20. Oligopeptide complex for targeted non-viral gene delivery to adipocytes

    NASA Astrophysics Data System (ADS)

    Won, Young-Wook; Adhikary, Partho Protim; Lim, Kwang Suk; Kim, Hyung Jin; Kim, Jang Kyoung; Kim, Yong-Hee

    2014-12-01

    Commercial anti-obesity drugs acting in the gastrointestinal tract or the central nervous system have been shown to have limited efficacy and severe side effects. Anti-obesity drug development is thus focusing on targeting adipocytes that store excess fat. Here, we show that an adipocyte-targeting fusion-oligopeptide gene carrier consisting of an adipocyte-targeting sequence and 9-arginine (ATS-9R) selectively transfects mature adipocytes by binding to prohibitin. Injection of ATS-9R into obese mice confirmed specific binding of ATS-9R to fat vasculature, internalization and gene expression in adipocytes. We also constructed a short-hairpin RNA (shRNA) for silencing fatty-acid-binding protein 4 (shFABP4), a key lipid chaperone in fatty-acid uptake and lipid storage in adipocytes. Treatment of obese mice with ATS-9R/shFABP4 led to metabolic recovery and body-weight reduction (>20%). The ATS-9R/shFABP4 oligopeptide complex could prove to be a safe therapeutic approach to regress and treat obesity as well as obesity-induced metabolic syndromes.