Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.
2011-01-01
Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692
Targeted gene insertion for molecular medicine.
Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán
2008-11-01
Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.
Utilization of next generation sequencing for analyzing transgenic insertions in plum
USDA-ARS?s Scientific Manuscript database
When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...
Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi
2012-01-01
To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Cain-Hom, Carol; Splinter, Erik; van Min, Max; Simonis, Marieke; van de Heijning, Monique; Martinez, Maria; Asghari, Vida
2017-01-01
Abstract Cre/LoxP technology is widely used in the field of mouse genetics for spatial and/or temporal regulation of gene function. For Cre lines generated via pronuclear microinjection of a Cre transgene construct, the integration site is random and in most cases not known. Integration of a transgene can disrupt an endogenous gene, potentially interfering with interpretation of the phenotype. In addition, knowledge of where the transgene is integrated is important for planning of crosses between animals carrying a conditional allele and a given Cre allele in case the alleles are on the same chromosome. We have used targeted locus amplification (TLA) to efficiently map the transgene location in seven previously published Cre and CreERT2 transgenic lines. In all lines, transgene insertion was associated with structural changes of variable complexity, illustrating the importance of testing for rearrangements around the integration site. In all seven lines the exact integration site and breakpoint sequences were identified. Our methods, data and genotyping assays can be used as a resource for the mouse community and our results illustrate the power of the TLA method to not only efficiently map the integration site of any transgene, but also provide additional information regarding the transgene integration events. PMID:28053125
Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi
2016-07-01
Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre
Cain-Hom, Carol; Splinter, Erik; van Min, Max; Simonis, Marieke; van de Heijning, Monique; Martinez, Maria; Asghari, Vida; Cox, J Colin; Warming, Søren
2017-05-05
Cre/LoxP technology is widely used in the field of mouse genetics for spatial and/or temporal regulation of gene function. For Cre lines generated via pronuclear microinjection of a Cre transgene construct, the integration site is random and in most cases not known. Integration of a transgene can disrupt an endogenous gene, potentially interfering with interpretation of the phenotype. In addition, knowledge of where the transgene is integrated is important for planning of crosses between animals carrying a conditional allele and a given Cre allele in case the alleles are on the same chromosome. We have used targeted locus amplification (TLA) to efficiently map the transgene location in seven previously published Cre and CreERT2 transgenic lines. In all lines, transgene insertion was associated with structural changes of variable complexity, illustrating the importance of testing for rearrangements around the integration site. In all seven lines the exact integration site and breakpoint sequences were identified. Our methods, data and genotyping assays can be used as a resource for the mouse community and our results illustrate the power of the TLA method to not only efficiently map the integration site of any transgene, but also provide additional information regarding the transgene integration events. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Facility target insert shielding assessment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mocko, Michal
2015-10-06
Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In themore » present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.« less
Garrels, Wiebke; Mátés, Lajos; Holler, Stephanie; Dalda, Anna; Taylor, Ulrike; Petersen, Björn; Niemann, Heiner; Izsvák, Zsuzsanna; Ivics, Zoltán; Kues, Wilfried A.
2011-01-01
Genetic engineering can expand the utility of pigs for modeling human diseases, and for developing advanced therapeutic approaches. However, the inefficient production of transgenic pigs represents a technological bottleneck. Here, we assessed the hyperactive Sleeping Beauty (SB100X) transposon system for enzyme-catalyzed transgene integration into the embryonic porcine genome. The components of the transposon vector system were microinjected as circular plasmids into the cytoplasm of porcine zygotes, resulting in high frequencies of transgenic fetuses and piglets. The transgenic animals showed normal development and persistent reporter gene expression for >12 months. Molecular hallmarks of transposition were confirmed by analysis of 25 genomic insertion sites. We demonstrate germ-line transmission, segregation of individual transposons, and continued, copy number-dependent transgene expression in F1-offspring. In addition, we demonstrate target-selected gene insertion into transposon-tagged genomic loci by Cre-loxP-based cassette exchange in somatic cells followed by nuclear transfer. Transposase-catalyzed transgenesis in a large mammalian species expands the arsenal of transgenic technologies for use in domestic animals and will facilitate the development of large animal models for human diseases. PMID:21897845
Mouse genetic corneal disease resulting from transgenic insertional mutagenesis
Ramalho, J S; Gregory-Evans, K; Huxley, C; Seabra, M C
2004-01-01
Background/aims: To report the generation of a new mouse model for a genetically determined corneal abnormality that occurred in transgenesis experiments. Methods: Transgenic mice expressing mutant forms of Rab27a, a GTPase that has been implicated in the pathogenesis of choroideremia, were generated. Results: Only one transgenic line (T27aT15) exhibited an unexpected eye phenotype. T27aT15 mice developed corneal opacities, usually unilateral, and cataracts, resulting in some cases in phthisical eyes. Histologically, the corneal stroma was thickened and vacuolated, and both epithelium and endothelium were thinned. The posterior segment of the eye was also affected with abnormal pigmentation, vessel narrowing, and abnormal leakage of dye upon angiography but was histologically normal. Conclusion: Eye abnormality in T27aT15 mice results from random insertional mutagenesis of the transgene as it was only observed in one line. The corneal lesion observed in T27aT15 mice most closely resembles posterior polymorphous corneal dystrophy and might result from the disruption of the equivalent mouse locus. PMID:14977782
USDA-ARS?s Scientific Manuscript database
Inserts and insert sites in transgenic, commercial papaya line 55-1 derivatives Rainbow and SunUp were characterized as part of a petition to Japan to allow import of fresh fruit of these cultivars from the U.S. and to provide data for a larger study aimed at understanding the global impact of DNA t...
Brough, Rachel; Papanastasiou, Antigoni M; Porter, Andrew CG
2007-01-01
Background The ability to regulate transgene expression has many applications, mostly concerning the analysis of gene function. Desirable induction characteristics, such as low un-induced expression, high induced expression and limited cellular heterogeneity, can be seriously impaired by chromosomal position effects at the site of transgene integration. Many clones may therefore need to be screened before one with optimal induction characteristics is identified. Furthermore, such screens must be repeated for each new transgene investigated, and comparisons between clones with different transgenes is complicated by their different integration sites. Results To circumvent these problems we have developed a "screen and insert" strategy in which clones carrying a transgene for a fluorescent reporter are first screened for those with optimal induction characteristics. Site-specific recombination (SSR) is then be used repeatedly to insert any new transgene at the reporter transgene locus of such clones so that optimal induction characteristics are conferred upon it. Here we have tested in a human fibrosarcoma cell line (HT1080) two of many possible implementations of this approach. Clones (e.g. Rht14-10) in which a GFP reporter gene is very stringently regulated by the tetracycline (tet) transactivator (tTA) protein were first identified flow-cytometrically. Transgenes encoding luciferase, I-SceI endonuclease or Rad52 were then inserted by SSR at a LoxP site adjacent to the GFP gene resulting stringent tet-regulated transgene expression. In clone Rht14-10, increases in expression from essentially background levels (+tet) to more than 104-fold above background (-tet) were reproducibly detected after Cre-mediated insertion of either the luciferase or the I-SceI transgenes. Conclusion Although previous methods have made use of SSR to integrate transgenes at defined sites, none has effectively combined this with a pre-selection step to identify integration sites that support
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Zhang, D J; Liu, J X; Lu, Z Y; Li, C L; Comada, E; Yang, M S
2015-07-27
Poplar-cotton agro-ecosystems are the main agricultural planting modes of cotton fields in China. With increasing acres devoted to transgenic insect-resistant poplar and transgenic insect-resistant cotton, studies examining the effects of transgenic plants on target and non-target insects become increasingly important. We systematically surveyed populations of both target pests and non-target insects for 4 different combinations of poplar-cotton eco-systems over 3 years. Transgenic Bt cotton strongly resisted the target insects Fall webworm moth [Hyphantria cunea (Drury)], Sylepta derogata Fabrieius, and American bollworm (Heliothis armigera), but no clear impact on non-target insect cotton aphids (Aphis gossypii). Importantly, intercrops containing transgenic Pb29 poplar significantly increased the inhibitory effects of Bt cotton on Fall webworm moth in ecosystem IV. Highly resistant Pb29 poplar reduced populations of the target pests Grnsonoma minutara Hubner and non-target insect poplar leaf aphid (Chaitophorus po-pulialbae), while Fall webworm moth populations were unaffected. We determined the effects of Bt toxin from transgenic poplar and cotton on target and non-target pests in different ecosystems of cotton-poplar intercrops and identified the synergistic effects of such combinations toward both target and non-target insects.
Insertion device and method for accurate and repeatable target insertion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gubeli, III, Joseph F.; Shinn, Michelle D.; Bevins, Michael E.
The present invention discloses a device and a method for inserting and positioning a target within a free electron laser, particle accelerator, or other such device that generates or utilizes a beam of energy or particles. The system includes a three-point registration mechanism that insures angular and translational accuracy and repeatability of positioning upon multiple insertions within the same structure.
Geisler, Anja; Schön, Christian; Größl, Tobias; Pinkert, Sandra; Stein, Elisabeth A; Kurreck, Jens; Vetter, Roland; Fechner, Henry
2013-01-01
Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206–mediated skeletal muscle-specific silencing of miR-206TS–bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1–mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3′ portion of the miR-206, even enhanced the miR-206– mediated transgene repression. In vivo expression of m206TS-3G– and miR-122TS–containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs. PMID:23439498
Zeng, Fang; Li, Zicong; Cai, Gengyuan; Gao, Wenchao; Jiang, Gelong; Liu, Dewu; Urschitz, Johann; Moisyadi, Stefan; Wu, Zhenfang
2016-01-01
Previously we successfully produced a group of EGFP-expressing founder transgenic pigs by a newly developed efficient and simple pig transgenesis method based on cytoplasmic injection of piggyBac plasmids. In this study, we investigated the growth and reproduction performance, and characterized the transgene insertion, transmission and expression patterns in transgenic pigs generated by piggyBac transposition. Results showed that transgene has no injurious effect on the growth and reproduction of transgenic pigs. Multiple copies of monogenic EGFP transgene were inserted at noncoding sequences of host genome, and passed from founder transgenic pigs to their transgenic offspring in segregation or linkage manner. The EGFP transgene was ubiquitously expressed in transgenic pigs, and its expression intensity was associated with transgene copy number but not related to its promoter DNA methylation level. To the best of our knowledge, this is first study that fully described the growth and reproduction performance, transgene insertion, expression and transmission profiles in transgenic pigs produced by piggyBac system. It not only demonstrates that piggyBac transposition-mediated gene transfer is an effective and favourable approach for pig transgenesis, but also provides scientific information for understanding the transgene insertion, expression and transmission patterns in transgenic animals produced by piggyBac transposition. PMID:27565868
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Folate receptor‐targeted aminoglycoside‐derived polymers for transgene expression in cancer cells
Godeshala, Sudhakar; Nitiyanandan, Rajeshwar; Thompson, Brian; Goklany, Sheba; Nielsen, David R.
2016-01-01
Abstract Targeted delivery of anticancer therapeutics can potentially overcome the limitations associated with current chemotherapeutic regimens. Folate receptors are overexpressed in several cancers, including ovarian, triple‐negative breast and bladder cancers, making them attractive for targeted delivery of nucleic acid therapeutics to these tumors. This work describes the synthesis, characterization and evaluation of folic acid‐conjugated, aminoglycoside‐derived polymers for targeted delivery of transgenes to breast and bladder cancer cell lines. Transgene expression was significantly higher with FA‐conjugated aminoglycoside‐derived polymers than with Lipofectamine, and these polymers demonstrated minimal cytotoxicty. Competitive inhibition using free folic acid significantly reduced transgene expression efficacy of folate‐targeted polymers, suggesting a role for folate receptor‐mediated uptake. High efficacy FA‐targeted polymers were employed to deliver a plasmid expressing the TRAIL protein, which induced death in cancer cells. These results indicate that FA‐conjugated aminoglycoside‐derived polymers are promising for targeted delivery of nucleic acids to cancer cells that overexpress folate receptors. PMID:29313013
Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira
2011-02-01
Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.
Simmons, Michael J; Haley, Kevin J; Grimes, Craig D; Raymond, John D; Niemi, Jarad B
2002-01-01
Drosophila were genetically transformed with a hobo transgene that contains a terminally truncated but otherwise complete P element fused to the promoter from the Drosophila hsp70 gene. Insertions of this H(hsp/CP) transgene on either of the major autosomes produced the P transposase in both the male and female germlines, but not in the soma. Heat-shock treatments significantly increased transposase activity in the female germline; in the male germline, these treatments had little effect. The transposase activity of two insertions of the H(hsp/CP) transgene was not significantly greater than their separate activities, and one insertion of this transgene reduced the transposase activity of P(ry(+), Delta2-3)99B, a stable P transgene, in the germline as well as in the soma. These observations suggest that, through alternate splicing, the H(hsp/CP) transgene produces a repressor that feeds back negatively to regulate transposase expression or function in both the somatic and germline tissues. The H(hsp/CP) transgenes are able to induce gonadal dysgenesis when the transposase they encode has P-element targets to attack. However, this ability and the ability to induce P-element excisions are repressed by the P cytotype, a chromosomal/cytoplasmic state that regulates P elements in the germline. PMID:12019234
Quadros, Rolen M; Miura, Hiromi; Harms, Donald W; Akatsuka, Hisako; Sato, Takehito; Aida, Tomomi; Redder, Ronald; Richardson, Guy P; Inagaki, Yutaka; Sakai, Daisuke; Buckley, Shannon M; Seshacharyulu, Parthasarathy; Batra, Surinder K; Behlke, Mark A; Zeiner, Sarah A; Jacobi, Ashley M; Izu, Yayoi; Thoreson, Wallace B; Urness, Lisa D; Mansour, Suzanne L; Ohtsuka, Masato; Gurumurthy, Channabasavaiah B
2017-05-17
Conditional knockout mice and transgenic mice expressing recombinases, reporters, and inducible transcriptional activators are key for many genetic studies and comprise over 90% of mouse models created. Conditional knockout mice are generated using labor-intensive methods of homologous recombination in embryonic stem cells and are available for only ~25% of all mouse genes. Transgenic mice generated by random genomic insertion approaches pose problems of unreliable expression, and thus there is a need for targeted-insertion models. Although CRISPR-based strategies were reported to create conditional and targeted-insertion alleles via one-step delivery of targeting components directly to zygotes, these strategies are quite inefficient. Here we describe Easi-CRISPR (Efficient additions with ssDNA inserts-CRISPR), a targeting strategy in which long single-stranded DNA donors are injected with pre-assembled crRNA + tracrRNA + Cas9 ribonucleoprotein (ctRNP) complexes into mouse zygotes. We show for over a dozen loci that Easi-CRISPR generates correctly targeted conditional and insertion alleles in 8.5-100% of the resulting live offspring. Easi-CRISPR solves the major problem of animal genome engineering, namely the inefficiency of targeted DNA cassette insertion. The approach is robust, succeeding for all tested loci. It is versatile, generating both conditional and targeted insertion alleles. Finally, it is highly efficient, as treating an average of only 50 zygotes is sufficient to produce a correctly targeted allele in up to 100% of live offspring. Thus, Easi-CRISPR offers a comprehensive means of building large-scale Cre-LoxP animal resources.
Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio
2017-03-01
Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Schacherer, Lindsey J; Xie, Weiping; Owens, Michaela A; Alarcon, Clara; Hu, Tiger X
2016-09-01
Liquid chromatography coupled with tandem mass spectrometry is increasingly used for protein detection for transgenic crops research. Currently this is achieved with protein reference standards which may take a significant time or efforts to obtain and there is a need for rapid protein detection without protein reference standards. A sensitive and specific method was developed to detect target proteins in transgenic maize leaf crude extract at concentrations as low as ∼30 ng mg(-1) dry leaf without the need of reference standards or any sample enrichment. A hybrid Q-TRAP mass spectrometer was used to monitor all potential tryptic peptides of the target proteins in both transgenic and non-transgenic samples. The multiple reaction monitoring-initiated detection and sequencing (MIDAS) approach was used for initial peptide/protein identification via Mascot database search. Further confirmation was achieved by direct comparison between transgenic and non-transgenic samples. Definitive confirmation was provided by running the same experiments of synthetic peptides or protein standards, if available. A targeted proteomic mass spectrometry method using MIDAS approach is an ideal methodology for detection of new proteins in early stages of transgenic crop research and development when neither protein reference standards nor antibodies are available. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Transgene manipulation in zebrafish by using recombinases.
Dong, Jie; Stuart, Gary W
2004-01-01
Although much remains to be done, our results to date suggest that efficient and precise genome engineering in zebrafish will be possible in the future by using Cre recombinase and SB transposase in combination with their respective target sites. In this study, we provide the first evidence that Cre recombinase can mediate effective site-specific deletion of transgenes in zebrafish. We found that the efficiency of target site utilization could approach 100%, independent of whether the target site was provided transiently by injection or stably within an integrated transgene. Microinjection of Cre mRNA appeared to be slightly more effective for this purpose than microinjection of Cre-expressing plasmid DNA. Our work has not yet progressed to the point where SB-mediated mobilization of our transgene constructs would be observed. However, a recent report has demonstrated that SB can enhance transgenesis rates sixfold over conventional methods by efficiently mediating multiple single-copy insertion of transgenes into the zebrafish genome (Davidson et al., 2003). Therefore, it seems likely that a combined system should eventually allow both SB-mediated transgene mobilization and Cre-mediated transgene modification. Our goal is to validate methods for the precise reengineering of the zebrafish genome by using a combination of Cre-loxP and SB transposon systems. These methods can be used to delete, replace, or mobilize large pieces of DNA or to modify the genome only when and where required by the investigator. For example, it should be possible to deliver particular RNAi genes to well-expressed chromosomal loci and then exchange them easily with alternative RNAi genes for the specific suppression of alternative targets. As a nonviral vector for gene therapy, the transposon component allows for the possibility of highly efficient integration, whereas the Cre-loxP component can target the integration and/or exchange of foreign DNA into specific sites within the genome. The
Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.
Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia
2016-09-12
Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.
Kahlon, Jagroop Gill; Jacobsen, Hans-Jörg; Cahill, James F; Hall, Linda M
2017-10-01
Genetically modified crops have raised concerns about unintended consequences on non-target organisms including beneficial soil associates. Pea transformed with four antifungal genes 1-3 β glucanase, endochitinase, polygalacturonase-inhibiting proteins, and stilbene synthase is currently under field-testing for efficacy against fungal diseases in Canada. Transgenes had lower expression in the roots than leaves in greenhouse experiment. To determine the impact of disease-tolerant pea or gene products on colonization by non-target arbuscular mycorrhizae and nodulation by rhizobium, a field trial was established. Transgene insertion, as single gene or stacked genes, did not alter root colonization by arbuscular mycorrhiza fungus (AMF) or root nodulation by rhizobium inoculation in the field. We found no effect of transgenes on the plant growth and performance although, having a dual inoculant with both AMF and rhizobium yielded higher fresh weight shoot-to-root ratio in all the lines tested. This initial risk assessment of transgenic peas expressing antifungal genes showed no deleterious effect on non-target organisms.
USDA-ARS?s Scientific Manuscript database
Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understandin...
Asemu, Girma; Fishbein, Kenneth; Lao, Qi Zong; Ravindran, Arippa; Herbert, Ron; Canuto, Holly C; Spencer, Richard G; Soldatov, Nikolai M
2011-01-01
Based on stable integration of recombinant DNA into a host genome, transgenic technology has become an important genetic engineering methodology. An organism whose genetic characteristics have been altered by the insertion of foreign DNA is supposed to exhibit a new phenotype associated with the function of the transgene. However, successful insertion may not be sufficient to achieve specific modification of function. In this study we describe a strain of transgenic mouse, G7-882, generated by incorporation into the mouse genome of human CaV 1.2 α(1C) cDNA deprived of 3'-UTR to exclude transcription. We found that, in response to chronic infusion of isoproterenol, G7-882 develops dilated cardiomyopathy, a misleading "transgenic artifact" compatible with the expected function of the incorporated "correct" transgene. Specifically, using magnetic resonance imaging (MRI), we found that chronic β-adrenergic stimulation of G7-882 mice caused left ventricular hypertrophy and aggravated development of dilated cardiomyopathy, although no significant changes in the kinetics, density and voltage dependence of the calcium current were observed in G7-882 cardiomyocytes as compared to cells from wild type mice. This result illustrates the possibility that even when a functional transgene is expressed, an observed change in phenotype may be due to the artifact of "incidental incorporation" leading to misleading conclusions. To exclude this possibility and thus provide a robust tool for exploring biological function, the new transgenic phenotype must be replicated in several independently generated transgenic strains.
Fertility comparison between wild type and transgenic mice by in vitro fertilization.
Vasudevan, Kuzhalini; Raber, James; Sztein, Jorge
2010-08-01
Transgenic mice are increasingly used as animal models for studies of gene function and regulation of mammalian genes. Although there has been continuous and remarkable progress in the development of transgenic technology over several decades, many aspects of the resulting transgenic model's phenotype cannot be completely predicted. For example, it is well known that as a consequence of the random insertion of the injected DNA construct, several founder mice of the new line need to be analyzed for possible differences in phenotype secondary to different insertion sites. The Knock out technique for transgenic production disrupts a specific gene by insertion or homologous recombination creating a null expression or replacement of the gene with a marker to localize it expression. This modification could result in pleiotropic phenotype if the gene is also expressed in tissues other than the target organs. Although the future breeding performance of the newly created model is critical to many studies, it is rarely anticipated that the new integrations could modify the reproductive profile of the new transgenic line. To date, few studies have demonstrated the difference between the parent strain's reproductive performance and the newly developed transgenic model. This study was designed to determine whether a genetic modification, knock out (KO) or transgenics, not anticipated to affect reproductive performance could affect the resulting reproductive profile of the newly developed transgenic mouse. More specifically, this study is designed to study the impact of the genetic modification on the ability of gametes to be fertilized in vitro. We analyzed the reproductive performance of mice with different background strains: FVB/N, C57BL/6 (129Sv/J x C57Bl/6)F1 and outbred CD1((R)) and compared them to mice of the same strain carrying a transgene or KO which was not anticipated to affect fertility. In vitro Fertilization was used to analyze the fertility of the mice. Oocytes
Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong; Qu, Shaohong
2015-01-01
Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops. © 2015 American Society of Plant Biologists. All Rights Reserved.
He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin
2012-01-01
Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125
Cho, S; Son, J H; Park, D H; Aoki, C; Song, X; Smith, G P; Joh, T H
1996-01-01
Neurotransmitters play a variety of important roles during nervous system development. In the present study, we hypothesized that neurotransmitter phenotype of both projecting and target cells is an important factor for the final synaptic linkage and its specificity. To test this hypothesis, we used transgenic techniques to convert serotonin/melatonin-producing cells of the pineal gland into cells that also produce dopamine and investigated the innervation of the phenotypically altered target cells. This phenotypic alteration markedly reduced the noradrenergic innervation originating from the superior cervical ganglia. Although the mechanism by which the reduction occurs is presently unknown, quantitative enzyme-linked immunoassay showed the presence of the equivalent amounts of nerve growth factor (NGF) in the control and transgenic pineal glands, suggesting that it occurred in a NGF-independent manner. The results suggest that target neurotransmitter phenotype influences the formation of afferent connections during development. Images Fig. 3 Fig. 4 PMID:8610132
Garg, Renu; Tolbert, Melanie; Oakes, Judy L; Clemente, Thomas E; Bost, Kenneth L; Piller, Kenneth J
2007-07-01
Enterotoxigenic Escherichia coli (ETEC) strains are a major cause of enteric diseases affecting livestock and humans. Edible transgenic plants producing E. coli fimbrial subunit proteins have the potential to vaccinate against these diseases, but have not reached their full potential as a renewable source of oral vaccines due in part to insufficient levels of recombinant protein accumulation. Previously, we reported that cytosol targeting of the E. coli K99 fimbrial subunit antigen resulted in FanC accumulation to approximately 0.4% of total soluble protein in soybean leaves (Piller et al. in Planta 222:6-18, 2005). In this study, we report on the subcellular targeting of FanC to chloroplasts. Twenty-two transgenic T1 progeny derived from seven individual T0 transformation events were characterized, and 17 accumulated transgenic FanC. All of the characterized events displayed relatively low T-DNA complexity, and all exhibited proper targeting of FanC to the chloroplast. Accumulation of chloroplast-targeted FanC was approximately 0.08% of total soluble leaf protein, or approximately 5-fold less than cytosol-targeted FanC. Protein analysis of leaves at various stages of maturity suggested stability of chloroplast-targeted FanC throughout leaf maturation. Furthermore, mice immunized intraperitoneally with protein extract derived from transgenic leaves expressing chloroplast-targeted FanC developed significant antibody titers against FanC. This is the first report of subcellular targeting of a vaccine subunit antigen in soybean.
Gao, Xiaoqing; Zhou, Jie; Li, Jun; Zou, Xiaowei; Zhao, Jianhua; Li, Qingliang; Xia, Ran; Yang, Ruifang; Wang, Dekai; Zuo, Zhaoxue; Tu, Jumin; Tao, Yuezhi; Chen, Xiaoyun; Xie, Qi; Zhu, Zengrong
2015-01-01
Marker-free transgenic plants can be developed through transposon-mediated transgene reintegration, which allows intact transgene insertion with defined boundaries and requires only a few primary transformants. In this study, we improved the selection strategy and validated that the maize (Zea mays) Activator/Dissociation (Ds) transposable element can be routinely used to generate marker-free transgenic plants. A Ds-based gene of interest was linked to green fluorescent protein in transfer DNA (T-DNA), and a green fluorescent protein-aided counterselection against T-DNA was used together with polymerase chain reaction (PCR)-based positive selection for the gene of interest to screen marker-free progeny. To test the efficacy of this strategy, we cloned the Bacillus thuringiensis (Bt) δ-endotoxin gene into the Ds elements and transformed transposon vectors into rice (Oryza sativa) cultivars via Agrobacterium tumefaciens. PCR assays of the transposon empty donor site exhibited transposition in somatic cells in 60.5% to 100% of the rice transformants. Marker-free (T-DNA-free) transgenic rice plants derived from unlinked germinal transposition were obtained from the T1 generation of 26.1% of the primary transformants. Individual marker-free transgenic rice lines were subjected to thermal asymmetric interlaced-PCR to determine Ds(Bt) reintegration positions, reverse transcription-PCR and enzyme-linked immunosorbent assay to detect Bt expression levels, and bioassays to confirm resistance against the striped stem borer Chilo suppressalis. Overall, we efficiently generated marker-free transgenic plants with optimized transgene insertion and expression. The transposon-mediated marker-free platform established in this study can be used in rice and possibly in other important crops. PMID:25371551
Decano, Julius L.; Moran, Anne Marie; Ruiz-Opazo, Nelson; Herrera, Victoria L. M.
2011-01-01
Purpose Given that carotid vasa vasorum neovascularization is associated with increased risk for stroke and cardiac events, the present in vivo study was designed to investigate molecular imaging of carotid artery vasa vasorum neovascularization via target-specific contrast-enhanced ultrasound (CEU) micro-imaging. Procedures Molecular imaging was performed in male transgenic rats with carotid artery disease and non-transgenic controls using dual endothelin1/VEGFsp receptor (DEspR)-targeted microbubbles (MBD) and the Vevo770 micro-imaging system and CEU imaging software. Results DEspR-targeted CEU-positive imaging exhibited significantly higher contrast intensity signal (CIS)-levels and pre-/post-destruction CIS-differences in seven of 13 transgenic rats, in contrast to significantly lower CIS-levels and differences in control isotype-targeted microbubble (MBC)-CEU imaging (n =8) and in MBD CEU-imaging of five non-transgenic control rats (P<0.0001). Ex vivo immunofluorescence analysis demonstrated binding of MBD to DEspR-positive endothelial cells; and association of DEspR-targeted increased contrast intensity signals with DEspR expression in vasa vasorum neovessel and intimal lesions. In vitro analysis demonstrated dose-dependent binding of MBD to DEspR-positive human endothelial cells with increasing %cells bound and number of MBD per cell, in contrast to MBC or non-labeled microbubbles (P<0.0001). Conclusion In vivo DEspR-targeted molecular imaging detected increased DEspR-expression in carotid artery lesions and in expanded vasa vasorum neovessels in transgenic rats with carotid artery disease. Future studies are needed to determine predictive value for stroke or heart disease in this transgenic atherosclerosis rat model and translational applications. PMID:20972637
Murray, James D; Maga, Elizabeth A
2016-06-01
At the time of the first Transgenic Animal Research Conference, the lack of knowledge about promoter, enhancer and coding regions of genes of interest greatly hampered our efforts to create transgenes that would express appropriately in livestock. Additionally, we were limited to gene insertion by pronuclear microinjection. As predicted then, widespread genome sequencing efforts and technological advancements have profoundly altered what we can do. There have been many developments in technology to create transgenic animals since we first met at Granlibakken in 1997, including the advent of somatic cell nuclear transfer-based cloning and gene editing. We can now create new transgenes that will express when and where we want and can target precisely in the genome where we want to make a change or insert a transgene. With the large number of sequenced genomes, we have unprecedented access to sequence information including, control regions, coding regions, and known allelic variants. These technological developments have ushered in new and renewed enthusiasm for the production of transgenic animals among scientists and animal agriculturalists around the world, both for the production of more relevant biomedical research models as well as for agricultural applications. However, even though great advancements have been made in our ability to control gene expression and target genetic changes in our animals, there still are no genetically engineered animal products on the market for food. World-wide there has been a failure of the regulatory processes to effectively move forward. Estimates suggest the world will need to increase our current food production 70 % by 2050; that is we will have to produce the total amount of food each year that has been consumed by mankind over the past 500 years. The combination of transgenic animal technology and gene editing will become increasingly more important tools to help feed the world. However, to date the practical benefits of
[Methods of hygromycin B phosphotransferase activity assay in transgenic plant].
Zhuo, Qin; Yang, Xiaoguang
2004-07-01
Hygromycin B phosphotransferase (HPT) is a widely used selectable marker protein of transgenic plant. Detection of its activity is critical to studies on the development of various transgenic plants, silence of inserted gene, marker-free system development and safety assessment of transgenic food. In this paper, several methods for detecting the activity of this enzyme were reviewed.
Horizontal gene transfer does not occur between sFat-1 transgenic pigs and nontransgenic pigs.
Tang, M X; Zheng, X M; Hou, J; Qian, L L; Jiang, S W; Cui, W T; Li, K
2013-03-01
We previously generated and characterized synthesized fatty acid desaturase-1 (sFat-1) transgenic pigs that had increased concentrations of ω-3 unsaturated fatty acid in their meat. The objective was to assess whether the inserted foreign gene in sFat-1 transgenic pigs was able to transfer and integrate into the genome of nontransgenic pigs by suckling or mating. Tests for suckling-mediated horizontal gene transfer (HGT) included sFat-1 transgenic sows nursing nontransgenic piglets and sFat-1 transgenic piglets suckling nontransgenic sows. Tests for mating-mediated HGT were performed by male sFat-1 transgenic pigs mated with nontransgenic females and female sFat-1 transgenic pigs mated with nontransgenic males. Polymerase chain reaction was used to detect the sFat-1 gene fragment in various tissues sampled from nontransgenic pigs. The foreign target gene sFat-1 was not detected in the genomic DNA of various tissues and organs sampled from nontransgenic pigs. Therefore, we concluded that HGT from transgenic pigs to wild type pigs via suckling or mating was unlikely. Copyright © 2013 Elsevier Inc. All rights reserved.
Lobo, N F; Hua-Van, A; Li, X; Nolen, B M; Fraser, M J
2002-04-01
Mosquito-vectored diseases such as yellow fever and dengue fever continue to have a substantial impact on human populations world-wide. Novel strategies for control of these mosquito vectored diseases can arise through the development of reliable systems for genetic manipulation of the insect vector. A piggyBac vector marked with the Drosophila melanogaster cinnabar (cn) gene was used to transform the white-eyed khw strain of Aedes aegypti. Microinjection of preblastoderm embryos resulted in four families of cinnabar transformed insects. An overall transformation frequency of 4%, with a range of 0% to as high as 13% for individual experiments, was achieved when using a heat-shock induced transposase providing helper plasmid. Southern hybridizations indicated multiple insertion events in three of four transgenic lines, while the presence of duplicated target TTAA sites at either ends of individual insertions confirmed characteristic piggyBac transposition events in these three transgenic lines. The transgenic phenotype has remained stable for more than twenty generations. The transformations effected using the piggyBac element establish the potential of this element as a germ-line transformation vector for Aedine mosquitoes.
Wan, Guijun; Dang, Zhihao; Wu, Gang; Parajulee, Megha N; Ge, Feng; Chen, Fajun
2014-05-01
The approval of transgenic Bacillus thuringiensis (Bt) rice by China was momentous for biotech crops, although it has yet to be approved for commercial production. Non-target pest problems in rice paddies, such as the three ecologically similar species of planthoppers Nilaparvata lugens, Laodelphax striatellus and Sogatella furcifera, could become increasingly serious under global climate change. Fused (Cry1Ab/Cry1Ac) and single (Cry1Ab) transgenic Bt rice were evaluated for effects on species-specific responses of planthoppers to elevated carbon dioxide (CO2) and temperature. Transgenic Bt rice lines significantly modified species-specific responses of the planthoppers to elevated CO2 and temperature. High temperature appears to favour outbreaks of S. furcifera relative to N. lugens and L. striatellus when feeding upon fused transgenic Bt rice, especially at elevated CO2 . Elevated CO2 at high temperature appears to be a factor reducing S. furcifera occurrence when feeding upon single transgenic Bt rice. Different types of transgenic Bt rice alter the species-specific responses of non-target planthoppers to elevated CO2 and temperature. Compared with their non-transgenic parental lines, the single transgenic Bt rice shows better performance in controlling the non-target planthopper S. furcifera by comparison with the fused transgenic Bt rice under elevated CO2 and temperature. It is suggested that multitypes of transgenic Bt rice be used in the field simultaneously in order to take advantage of high transgenic diversity for optimal performance against all pests in paddy fields. © 2013 Society of Chemical Industry.
Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.
2011-01-01
Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235
2015-01-01
We have developed an improved tool for imaging acidic tumors by reporting the insertion of a transmembrane helix: the pHLIP-Fluorescence Insertion REporter (pHLIP-FIRE). In acidic tissues, such as tumors, peptides in the pHLIP family insert as α-helices across cell membranes. The cell-inserting end of the pHLIP-FIRE peptide has a fluorophore–fluorophore or fluorophore–quencher pair. A pair member is released by disulfide cleavage after insertion into the reducing environment inside a cell, resulting in dequenching of the probe. Thus, the fluorescence of the pHLIP-FIRE probe is enhanced upon cell-insertion in the targeted tissues but is suppressed elsewhere due to quenching. Targeting studies in mice bearing breast tumors show strong signaling by pHLIP-FIRE, with a contrast index of ∼17, demonstrating (i) direct imaging of pHLIP insertion and (ii) cargo translocation in vivo. Imaging and targeted cargo delivery should each have clinical applications. PMID:25184440
Accurate measure of transgene copy number in crop plants using droplet digital PCR
USDA-ARS?s Scientific Manuscript database
Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...
Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster
Lin, Chun-Chieh; Potter, Christopher J.
2016-01-01
Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272
Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun
2018-01-24
The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.
Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena
2014-12-10
Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.
The dynamics of long-term transgene expression in engrafted neural stem cells.
Lee, Jean-Pyo; Tsai, David J; In Park, Kook; Harvey, Alan R; Snyder, Evan Y
2009-07-01
To assess the dynamics and confounding variables that influence transgene expression in neural stem cells (NSCs), we generated distinct NSC clones from the same pool of cells, carrying the same reporter gene transcribed from the same promoter, transduced by the same retroviral vector, and transplanted similarly at the same differentiation state, at the same time and location, into the brains of newborn mouse littermates, and monitored in parallel for over a year in vivo (without immunosuppression). Therefore, the sole variables were transgene chromosomal insertion site and copy number. We then adapted and optimized a technique that tests, at the single cell level, persistence of stem cell-mediated transgene expression in vivo based on correlating the presence of the transgene in a given NSC's nucleus (by fluorescence in situ hybridization [FISH]) with the frequency of that transgene's product within the same cell (by combined immunohistochemistry [IHC]). Under the above-stated conditions, insertion site is likely the most contributory variable dictating transgene downregulation in an NSC after 3 months in vivo. We also observed that this obstacle could be effectively and safely counteracted by simple serial infections (as few as three) inserting redundant copies of the transgene into the prospective donor NSC. (The preservation of normal growth control mechanisms and an absence of tumorigenic potential can be readily screened and ensured ex vivo prior to transplantation.) The combined FISH/IHC strategy employed here for monitoring the dynamics of transgene expression at the single cell level in vivo may be used for other types of therapeutic and housekeeping genes in endogenous and exogenous stem cells of many organs and lineages. Copyright 2009 Wiley-Liss, Inc.
Zhang, Lijing; Cao, Hua; Zhang, Jiaxin; Yang, Chengli; Hu, Tingting; Li, Huili; Yang, Wu; He, Gu; Song, Xiangrong; Tong, Aiping; Guo, Gang; Li, Rui; Jiang, Yu; Liu, Jiyan; Cai, Lulu; Zheng, Yu
2017-02-01
Specific delivery of drugs to bone tissue is very challenging due to the architecture and structure of bone tissue. A seven-repeat sequence of aspartate, a representative bone-targeting oligopeptide, is preferentially used for targeted therapy for bone diseases. In this study, Asp7-cholesterol((Asp)7-CHOL) was synthesized and (Asp)7-CHOL-modified liposome loaded with doxorubicin (DOX) was successfully prepared using both pre-insertion (pre-L) and post-insertion (post-L) methods. The formulation was optimized according to particle size, zeta potential and the drug-loading efficiency of the liposome. In addition, the bone affinity of the (Asp)7-CHOL-modified liposome was evaluated using a hydroxyapatite (HA) absorption method. The results suggested that (Asp)7-CHOL-modified liposome show excellent HA absorption; pre-L showed slightly higher HA binding than post-L. However, post-L had a higher DOX entrapment efficiency than pre-L. In vivo imaging further demonstrated that pre-L showed a higher bone-targeting efficiency than post-L, which was consistent with in vitro results. In all, (Asp)7-CHOL-modified liposome showed excellent bone-targeting activity, suggesting their potential for use as a drug delivery system for bone disease-targeted therapies.
Caudell, David; Harper, David P; Novak, Rachel L; Pierce, Rachel M; Slape, Christopher; Wolff, Linda; Aplan, Peter D
2010-02-11
The t(10;11) translocation results in a CALM-AF10 fusion gene in a subset of leukemia patients. Expression of a CALM-AF10 transgene results in leukemia, with prolonged latency and incomplete penetrance, suggesting that additional events are necessary for leukemic transformation. CALM-AF10 mice infected with the MOL4070LTR retrovirus developed acute leukemia, and ligation-mediated polymerase chain reaction was used to identify retroviral insertions at 19 common insertion sites, including Zeb2, Nf1, Mn1, Evi1, Ift57, Mpl, Plag1, Kras, Erg, Vav1, and Gata1. A total of 26% (11 of 42) of the mice had retroviral integrations near Zeb2, a transcriptional corepressor leading to overexpression of the Zeb2-transcript. A total of 91% (10 of 11) of mice with Zeb2 insertions developed B-lineage acute lymphoblastic leukemia, suggesting that Zeb2 activation promotes the transformation of CALM-AF10 hematopoietic precursors toward B-lineage leukemias. More than half of the mice with Zeb2 integrations also had Nf1 integrations, suggesting cooperativity among CALM-AF10, Zeb2, and Ras pathway mutations. We searched for Nras, Kras, and Ptpn11 point mutations in the CALM-AF10 leukemic mice. Three mutations were identified, all of which occurred in mice with Zeb2 integrations, consistent with the hypothesis that Zeb2 and Ras pathway activation promotes B-lineage leukemic transformation in concert with CALM-AF10.
Caudell, David; Harper, David P.; Novak, Rachel L.; Pierce, Rachel M.; Slape, Christopher; Wolff, Linda
2010-01-01
The t(10;11) translocation results in a CALM-AF10 fusion gene in a subset of leukemia patients. Expression of a CALM-AF10 transgene results in leukemia, with prolonged latency and incomplete penetrance, suggesting that additional events are necessary for leukemic transformation. CALM-AF10 mice infected with the MOL4070LTR retrovirus developed acute leukemia, and ligation-mediated polymerase chain reaction was used to identify retroviral insertions at 19 common insertion sites, including Zeb2, Nf1, Mn1, Evi1, Ift57, Mpl, Plag1, Kras, Erg, Vav1, and Gata1. A total of 26% (11 of 42) of the mice had retroviral integrations near Zeb2, a transcriptional corepressor leading to overexpression of the Zeb2-transcript. A total of 91% (10 of 11) of mice with Zeb2 insertions developed B-lineage acute lymphoblastic leukemia, suggesting that Zeb2 activation promotes the transformation of CALM-AF10 hematopoietic precursors toward B-lineage leukemias. More than half of the mice with Zeb2 integrations also had Nf1 integrations, suggesting cooperativity among CALM-AF10, Zeb2, and Ras pathway mutations. We searched for Nras, Kras, and Ptpn11 point mutations in the CALM-AF10 leukemic mice. Three mutations were identified, all of which occurred in mice with Zeb2 integrations, consistent with the hypothesis that Zeb2 and Ras pathway activation promotes B-lineage leukemic transformation in concert with CALM-AF10. PMID:20007546
Zhang, Ran; Yin, Yinliang; Zhang, Yujun; Li, Kexin; Zhu, Hongxia; Gong, Qin; Wang, Jianwu; Hu, Xiaoxiang; Li, Ning
2012-01-01
As the number of transgenic livestock increases, reliable detection and molecular characterization of transgene integration sites and copy number are crucial not only for interpreting the relationship between the integration site and the specific phenotype but also for commercial and economic demands. However, the ability of conventional PCR techniques to detect incomplete and multiple integration events is limited, making it technically challenging to characterize transgenes. Next-generation sequencing has enabled cost-effective, routine and widespread high-throughput genomic analysis. Here, we demonstrate the use of next-generation sequencing to extensively characterize cattle harboring a 150-kb human lactoferrin transgene that was initially analyzed by chromosome walking without success. Using this approach, the sites upstream and downstream of the target gene integration site in the host genome were identified at the single nucleotide level. The sequencing result was verified by event-specific PCR for the integration sites and FISH for the chromosomal location. Sequencing depth analysis revealed that multiple copies of the incomplete target gene and the vector backbone were present in the host genome. Upon integration, complex recombination was also observed between the target gene and the vector backbone. These findings indicate that next-generation sequencing is a reliable and accurate approach for the molecular characterization of the transgene sequence, integration sites and copy number in transgenic species. PMID:23185606
Transgenic breeding of anti-Bombyx mori L. nuclear polyhedrosis virus silkworm Bombyx mori.
Yang, Huijuan; Fan, Wei; Wei, Hao; Zhang, Jinwei; Zhou, Zhonghua; Li, Jianying; Lin, Jianrong; Ding, Nong; Zhong, Boxiong
2008-10-01
Silkworm strains resistant to Bombyx mori L. nuclear polyhedrosis virus were obtained through transgenic experiments. piggyBac transposon with an A3 promoter were randomly inserted into the silkworm, driving the enhanced green fluorescent protein (EGFP) reporter gene into the silkworm genome. Polymerase chain reaction results verified the insertion of the extraneous EGFP gene, and fluorescence microscopy showed that the EGFP was expressed in the midgut tissue. The morbidity ratio of the nuclear polyhedrosis decreased from 90% in the original silkworm strain to 66.7% in the transgenic silkworm strain. Compared with the resistance to the Bombyx mori L. nuclear polyhedrosis virus in the Qiufeng strain, which is commonly used in the production, there was an increase of 33 centesimal points in the transgenic silkworms. The antivirotic character in the Chunhua x Qiuyue strain, which was bred from a different transgenic family, was about 10 centesimal points higher than that in the Qiufeng x Baiyu, another crossbreed used in production. Our results indicated a good application value of the transposon-inserted mutation in the breeding of anti-BmNPV silkworm strain.
Gasanov, N B; Toshchakov, S V; Georgiev, P G; Maksimenko, O G
2015-01-01
Mammalian cell lines are widely used to produce recombinant proteins. Stable transgenic cell lines usually contain many insertions of the expression vector in one genomic region. Transcription through transgene can be one of the reasons for target gene repression after prolonged cultivation of cell lines. In the present work, we used the known transcription terminators from the SV40 virus, as well as the human β- and γ-globin genes, to prevent transcription through transgene. The transcription terminators were shown to increase and stabilize the expression of the EGFP reporter gene in transgenic lines of Chinese hamster ovary (CHO) cells. Hence, transcription terminators can be used to create stable mammalian cells with a high and stable level of recombinant protein production.
Wang, Xujing; Tang, Qiaoling; Dong, Lei; Dong, Yufeng; Su, Yueyan; Jia, Shirong; Wang, Zhixing
2014-07-01
Insect resistance and herbicide tolerance are the dominant traits of commercialized transgenic cotton. In this study, we constructed a general standard reference plasmid for transgenic cotton detection. Target genes, including the cowpea trypsin gene cptI, the insect resistance gene cry1Ab/1Ac, the herbicide tolerance gene cp4-epsps, the Agrobacterium tumefaciens nopaline synthase (Nos) terminator that exists in transgenic cotton and part of the endogenous cotton SadI gene were amplified from plasmids pCPT1, pBT, pCP4 and pBI121 and from DNA of the nontransgenic cotton line K312, respectively. The genes cry1Ab/1Ac and cptI, as well as cp4-epsps and the Nos terminator gene, were ligated together to form the fusion genes cptI-Bt and cp4-Nos, respectively, by overlapping PCR. We checked the validity of genes Sad1, cptI-Bt and cp4-Nos by DNA sequencing. Then, positive clones of cptI-Bt, cp4-Nos and Sad1 were digested with the corresponding restriction enzymes and ligated sequentially into vector pCamBIA2300, which contains the CAMV 35S promoter and nptII gene, to form the reference plasmid pMCS. Qualitative detection showed that pMCS is a good positive control for transgenic cotton detection. Real-time PCR detection efficiencies with pMCS as a calibrator ranged from 94.35% to 98.67% for the standard curves of the target genes (R(2)⩾0.998). The relative standard deviation of the mean value for the known sample was 11.95%. These results indicate that the strategy of using the pMCS plasmid as a reference material is feasible and reliable for the detection of transgenic cotton. Therefore, this plasmid can serve as a useful reference tool for qualitative and quantitative detection of single or stacked trait transgenic cotton, thus paving the way for the identification of various products containing components of transgenic cotton. Copyright © 2014 Elsevier Inc. All rights reserved.
Chen, Shuqing; Hou, Chengxiang; Bi, Honglun; Wang, Yueqiang; Xu, Jun; Li, Muwang; James, Anthony A; Huang, Yongping; Tan, Anjiang
2017-04-15
We developed a novel antiviral strategy by combining transposon-based transgenesis and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system for the direct cleavage of Bombyx mori nucleopolyhedrovirus (BmNPV) genome DNA to promote virus clearance in silkworms. We demonstrate that transgenic silkworms constitutively expressing Cas9 and guide RNAs targeting the BmNPV immediate early-1 ( ie-1 ) and me53 genes effectively induce target-specific cleavage and subsequent mutagenesis, especially large (∼7-kbp) segment deletions in BmNPV genomes, and thus exhibit robust suppression of BmNPV proliferation. Transgenic animals exhibited higher and inheritable resistance to BmNPV infection than wild-type animals. Our approach will not only contribute to modern sericulture but also shed light on future antiviral therapy. IMPORTANCE Pathogen genome targeting has shown its potential in antiviral research. However, transgenic CRISPR/Cas9 system-mediated viral genome targeting has not been reported as an antiviral strategy in a natural animal host of a virus. Our data provide an effective approach against BmNPV infection in a real-world biological system and demonstrate the potential of transgenic CRISPR/Cas9 systems in antiviral research in other species. Copyright © 2017 Chen et al.
Chen, Shuqing; Hou, Chengxiang; Bi, Honglun; Wang, Yueqiang; Xu, Jun; Li, Muwang; James, Anthony A.
2017-01-01
ABSTRACT We developed a novel antiviral strategy by combining transposon-based transgenesis and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system for the direct cleavage of Bombyx mori nucleopolyhedrovirus (BmNPV) genome DNA to promote virus clearance in silkworms. We demonstrate that transgenic silkworms constitutively expressing Cas9 and guide RNAs targeting the BmNPV immediate early-1 (ie-1) and me53 genes effectively induce target-specific cleavage and subsequent mutagenesis, especially large (∼7-kbp) segment deletions in BmNPV genomes, and thus exhibit robust suppression of BmNPV proliferation. Transgenic animals exhibited higher and inheritable resistance to BmNPV infection than wild-type animals. Our approach will not only contribute to modern sericulture but also shed light on future antiviral therapy. IMPORTANCE Pathogen genome targeting has shown its potential in antiviral research. However, transgenic CRISPR/Cas9 system-mediated viral genome targeting has not been reported as an antiviral strategy in a natural animal host of a virus. Our data provide an effective approach against BmNPV infection in a real-world biological system and demonstrate the potential of transgenic CRISPR/Cas9 systems in antiviral research in other species. PMID:28122981
Identification of two integration sites in favor of transgene expression in Trichoderma reesei.
Qin, Lina; Jiang, Xianzhang; Dong, Zhiyang; Huang, Jianzhong; Chen, Xiuzhen
2018-01-01
The ascomycete fungus Trichoderma reesei was widely used as a biotechnological workhorse for production of cellulases and recombinant proteins due to its large capacity of protein secretion. Transgenesis by random integration of a gene of interest (GOI) into the genome of T. reesei can generate series of strains that express different levels of the indicated transgene. The insertion site of the GOI plays an important role in the ultimate production of the targeted proteins. However, so far no systematic studies have been made to identify transgene integration loci for optimal expression of the GOI in T. reesei . Currently, only the locus of exocellobiohydrolases I encoding gene ( cbh1) is widely used as a promising integration site to lead to high expression level of the GOI. No additional sites associated with efficient gene expression have been characterized. To search for gene integration sites that benefit for the secreted expression of GOI, the food-and-mouth disease virus 2A protein was applied for co-expression of an Aspergillus niger lipA gene and Discosoma sp. DsRed1 gene in T. reesei, by random integration of the expression cassette into the genome. We demonstrated that the fluorescent intensity of RFP (red fluorescent protein) inside of the cell was well correlated with the secreted lipase yields, based on which, we successfully developed a high-throughput screening method to screen strains with relatively higher secreted expression of the GOI (in this study, lipase). The copy number and the insertion sites of the transgene were investigated among the selected highly expressed strains. Eventually, in addition to cbh1 gene locus, two other genome insertion loci that efficiently facilitate gene expression in T. reesei were identified. We have successfully developed a high-throughput screening method to screen strains with optimal expression of the indicated secreted proteins in T. reesei . Moreover, we identified two optimal genome loci for transgene
NASA Astrophysics Data System (ADS)
Khosla, Deepak; Huber, David J.; Martin, Kevin
2017-05-01
This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).
Genomic localization of the Z/EG transgene in the mouse genome.
Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel
2010-02-01
The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira
2012-01-06
Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less
Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano
2013-09-01
An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.
Cardiac phenotype induced by a dysfunctional α1C transgene
Lao, Qi Zong; Ravindran, Arippa; Herbert, Ron; Canuto, Holly C
2011-01-01
Based on stable integration of recombinant DNA into a host genome, transgenic technology has become an important genetic engineering methodology. An organism whose genetic characteristics have been altered by the insertion of foreign DNA is supposed to exhibit a new phenotype associated with the function of the transgene. However, successful insertion may not be sufficient to achieve specific modification of function. In this study we describe a strain of transgenic mouse, G7-882, generated by incorporation into the mouse genome of human Cav1.2 α1C cDNA deprived of 3′-UTR to exclude transcription. We found that, in response to chronic infusion of isoproterenol, G7-882 develops dilated cardiomyopathy, a misleading “transgenic artifact” compatible with the expected function of the incorporated “correct” transgene. Specifically, using magnetic resonance imaging (MRI), we found that chronic β-adrenergic stimulation of G7-882 mice caused left ventricular hypertrophy and aggravated development of dilated cardiomyopathy, although no significant changes in the kinetics, density and voltage dependence of the calcium current were observed in G7-882 cardiomyocytes as compared to cells from wild type mice. This result illustrates the possibility that even when a functional transgene is expressed, an observed change in phenotype may be due to the artifact of “incidental incorporation” leading to misleading conclusions. To exclude this possibility and thus provide a robust tool for exploring biological function, the new transgenic phenotype must be replicated in several independently generated transgenic strains. PMID:21224729
Kung, Yi-Jung; Bau, Huey-Jiunn; Wu, Yi-Ling; Huang, Chiung-Huei; Chen, Tsui-Miao; Yeh, Shyi-Dong
2009-11-01
During the field tests of coat protein (CP)-transgenic papaya lines resistant to Papaya ringspot virus (PRSV), another Potyvirus sp., Papaya leaf-distortion mosaic virus (PLDMV), appeared as an emerging threat to the transgenic papaya. In this investigation, an untranslatable chimeric construct containing the truncated CP coding region of the PLDMV P-TW-WF isolate and the truncated CP coding region with the complete 3' untranslated region of PRSV YK isolate was transferred into papaya (Carica papaya cv. Thailand) via Agrobacterium-mediated transformation to generate transgenic plants with resistance to PLDMV and PRSV. Seventy-five transgenic lines were obtained and challenged with PRSV YK or PLDMV P-TW-WF by mechanical inoculation under greenhouse conditions. Thirty-eight transgenic lines showing no symptoms 1 month after inoculation were regarded as highly resistant lines. Southern and Northern analyses revealed that four weakly resistant lines have one or two inserts of the construct and accumulate detectable amounts of transgene transcript, whereas nine resistant lines contain two or three inserts without significant accumulation of transgene transcript. The results indicated that double virus resistance in transgenic lines resulted from double or more copies of the insert through the mechanism of RNA-mediated posttranscriptional gene silencing. Furthermore, three of nine resistant lines showed high levels of resistance to heterologous PRSV strains originating from Hawaii, Thailand, and Mexico. Our transgenic lines have great potential for controlling a number of PRSV strains and PLDMV in Taiwan and elsewhere.
Accurate measurement of transgene copy number in crop plants using droplet digital PCR
USDA-ARS?s Scientific Manuscript database
Technical abstract: Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently ...
Abdelmonem, Rehab; El Nabarawi, Mohamed; Attia, Alshaimaa
2018-11-01
The aim of this study was to formulate granisetron hydrochloride (GH) spanlastic in mucoadhesive gels and lyophilized inserts for intranasal administration to improve GH bioavailability and brain targeting. Carpapol 934 and HPMC were incorporated in GH spanlastic in nasal gels (GHSpNGs). Gelatin and HPMC as matrix former, glycine as a collapse protecting and mannitol as an insert filler and sweeting agent were used to prepare GH spanlastic loaded in lyophilized inserts (GHSpNIs). The prepared GHSpNGs were characterized for pH measurement, drug content, rheology, and in vitro drug release. The prepared GHSpNIs were characterized for drug content, surface pH, GH release, and mucoadhesion. Biological investigations including pharmacokinetics studies and brain drug targeting efficiency dimensions were performed on rats (LC-MS/MS). The results showed thixotropic pseudoplastic gels and white insert with pH values in a physiological range, drug content (89.9-98.6%), (82.4-98.38%) for gel and insert, respectively and rapid release rate of GH. Biological studies showed that C max and AUC 0-6 h in brain and plasma after intranasal administration of gel and insert were higher compared to IV administration of GH solution. A high brain targeting efficiency (199.3%, 230%) for gel and insert, respectively and a direct nose to brain transport (49.8%, 56.95%) for gel and insert, respectively confirmed that there is a direct nose to brain transport of GH following nasal administration of GH spanlastic loaded in nasal gel and insert. GHSpNIs can be considered as potential novel drug delivery system intended for brain targeting via the nasal rout of administration than GHSpNGs.
Kwan, H; Pecenka, V; Tsukamoto, A; Parslow, T G; Guzman, R; Lin, T P; Muller, W J; Lee, F S; Leder, P; Varmus, H E
1992-01-01
The Wnt-1 and int-2 proto-oncogenes are transcriptionally activated by mouse mammary tumor virus insertion mutations in virus-induced tumors and encode secretory glycoproteins. To determine whether these two genes can cooperate during carcinogenesis, we have crossed two previously characterized lines of transgenic mice to obtain bitransgenic animals carrying both Wnt-1 and int-2 transgenes under the control of the mouse mammary tumor virus long terminal repeat. Mammary carcinomas appear earlier and with higher frequency in the bitransgenic animals, especially the males, than in either parental line. Nearly all bitransgenic males develop mammary neoplasms within 8 months of birth, whereas only 15% of Wnt-1 transgenic males and none of the int-2 transgenic males have tumors. In virgin bitransgenic females, tumors occur approximately 2 months earlier than in their Wnt-1 transgenic siblings; int-2 transgenic females rarely exhibit tumors. Preneoplastic glands from the bitransgenic animals of either sex demonstrate pronounced epithelial hyperplasia similar to that seen in Wnt-1 transgenic virgin females and males, and both transgenes are expressed in the hyperplastic glands and mammary tumors. RNA from the int-2 transgene is more abundant in mammary glands from bitransgenic animals than from int-2 transgenic animals; the increase is associated with high levels of RNA specific for keratin genes 14 and 18, suggesting that Wnt-1-induced epithelial hyperplasia is responsible for the observed increase in expression of the int-2 transgene. Images PMID:1530875
Gladyshev, Eugene A; Arkhipova, Irina R
2009-12-15
Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.
Targeting diseased tissues by pHLIP insertion at low cell surface pH.
Andreev, Oleg A; Engelman, Donald M; Reshetnyak, Yana K
2014-01-01
The discovery of the pH Low Insertion Peptides (pHLIPs®) provides an opportunity to develop imaging and drug delivery agents targeting extracellular acidity. Extracellular acidity is associated with many pathological states, such as those in cancer, ischemic stroke, neurotrauma, infection, lacerations, and others. The metabolism of cells in injured or diseased tissues often results in the acidification of the extracellular environment, so acidosis might be useful as a general marker for the imaging and treatment of diseased states if an effective targeting method can be developed. The molecular mechanism of a pHLIP peptide is based on pH-dependent membrane-associated folding. pHLIPs, being moderately hydrophobic peptides, have high affinities for cellular membranes at normal pH, but fold and insert across membranes at low pH, allowing them to sense pH at the surfaces of cells in diseased tissues, where it is the lowest. Here we discuss the main principles of pHLIP interactions with membrane lipid bilayers at neutral and low pHs, the possibility of tuning the folding and insertion pH by peptide sequence variation, and potential applications of pHLIPs for imaging, therapy and image-guided interventions.
Target-matched insertion gain derived from three different hearing aid selection procedures.
Punch, J L; Shovels, A H; Dickinson, W W; Calder, J H; Snead, C
1995-11-01
Three hearing aid selection procedures were compared to determine if any one was superior in producing prescribed real-ear insertion gain. For each of three subject groups, 12 in-the-ear style hearing aids with Class D circuitry and similar dispenser controls were ordered from one of three manufacturers. Subject groups were classified based on the type of information included on the hearing aid order form: (1) the subject's audiogram, (2) a three-part matrix specifying the desired maximum output, full-on gain, and frequency response slope of the hearing aid, or (3) the desired 2-cc coupler full-in grain of the hearing aid, based on real-ear coupler difference (RECD) measurements. Following electroacoustic adjustments aimed at approximating a commonly used target insertion gain formula, results revealed no significant differences among any of the three selection procedures with respect to obtaining acceptable insertion gain values.
Accurate measurement of transgene copy number in crop plants using droplet digital PCR.
Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger
2017-06-01
Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Design and construction of targeted AAVP vectors for mammalian cell transduction.
Hajitou, Amin; Rangel, Roberto; Trepel, Martin; Soghomonyan, Suren; Gelovani, Juri G; Alauddin, Mian M; Pasqualini, Renata; Arap, Wadih
2007-01-01
Bacteriophage (phage) evolved as bacterial viruses, but can be adapted to transduce mammalian cells through ligand-directed targeting to a specific receptor. We have recently reported a new generation of hybrid prokaryotic-eukaryotic vectors, which are chimeras of genetic cis-elements of recombinant adeno-associated virus and phage (termed AAVP). This protocol describes the design and construction of ligand-directed AAVP vectors, production of AAVP particles and the methodology to transduce mammalian cells in vitro and to target tissues in vivo after systemic administration. Targeted AAVP particles are made in a two-step process. First, a ligand peptide of choice is displayed on the coat protein to generate a targeted backbone phage vector. Then, a recombinant AAV carrying a mammalian transgene cassette is inserted into an intergenomic region. High-titer suspensions (approximately 10(10)-10(11) transducing units per microl) can be produced within 3 days after vector construction. Transgene expression by targeted AAVP usually reaches maximum levels within 1 week.
A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.
Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui
2009-04-01
Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.
Harvey-Samuel, Tim; Ant, Thomas; Gong, Hongfei; Morrison, Neil I; Alphey, Luke
2014-01-01
Genetic control strategies offer great potential for the sustainable and effective control of insect pests. These strategies involve the field release of transgenic insects with the aim of introducing engineered alleles into wild populations, either permanently or transiently. Their efficacy can therefore be reduced if transgene-associated fitness costs reduce the relative performance of released insects. We describe a method of measuring the fitness costs associated with transgenes by analyzing their evolutionary trajectories when placed in competition with wild-type alleles in replicated cage populations. Using this method, we estimated lifetime fitness costs associated with two repressible female-lethal transgenes in the diamondback moth and olive fly as being acceptable for field suppression programs. Furthermore, using these estimates of genotype-level fitness costs, we were able to project longer-term evolutionary trajectories for the transgenes investigated. Results from these projections demonstrate that although transgene-associated fitness costs will ultimately cause these transgenes to become extinct, even when engineered lethality is repressed, they may persist for varying periods of time before doing so. This implies that tetracycline-mediated transgene field persistence in these strains is unlikely and suggests that realistic estimates of transgene-associated fitness costs may be useful in trialing ‘uncoupled’ gene drive system components in the field. PMID:24944572
Harvey-Samuel, Tim; Ant, Thomas; Gong, Hongfei; Morrison, Neil I; Alphey, Luke
2014-05-01
Genetic control strategies offer great potential for the sustainable and effective control of insect pests. These strategies involve the field release of transgenic insects with the aim of introducing engineered alleles into wild populations, either permanently or transiently. Their efficacy can therefore be reduced if transgene-associated fitness costs reduce the relative performance of released insects. We describe a method of measuring the fitness costs associated with transgenes by analyzing their evolutionary trajectories when placed in competition with wild-type alleles in replicated cage populations. Using this method, we estimated lifetime fitness costs associated with two repressible female-lethal transgenes in the diamondback moth and olive fly as being acceptable for field suppression programs. Furthermore, using these estimates of genotype-level fitness costs, we were able to project longer-term evolutionary trajectories for the transgenes investigated. Results from these projections demonstrate that although transgene-associated fitness costs will ultimately cause these transgenes to become extinct, even when engineered lethality is repressed, they may persist for varying periods of time before doing so. This implies that tetracycline-mediated transgene field persistence in these strains is unlikely and suggests that realistic estimates of transgene-associated fitness costs may be useful in trialing 'uncoupled' gene drive system components in the field.
A Tupaia paramyxovirus vector system for targeting and transgene expression.
Engeland, Christine E; Bossow, Sascha; Hudacek, Andrew W; Hoyler, Birgit; Förster, Judith; Veinalde, Rūta; Jäger, Dirk; Cattaneo, Roberto; Ungerechts, Guy; Springfeld, Christoph
2017-09-01
Viruses from the diverse family of Paramyxoviridae include important pathogens and are applied in gene therapy and for cancer treatment. The Tupaia paramyxovirus (TPMV), isolated from the kidney of a tree shrew, does not infect human cells and neutralizing antibodies against other Paramyxoviridae do not cross-react with TPMV. Here, we present a vector system for de novo generation of infectious TPMV that allows for insertion of additional genes as well as targeting using antibody single-chain variable fragments. We show that the recombinant TPMV specifically infect cells expressing the targeted receptor and replicate in human cells. This vector system provides a valuable tool for both basic research and therapeutic applications.
Yang, Xiao; Wang, Feng; Su, Jun; Lu, Bao-Rong
2012-01-01
Background The spread of insect-resistance transgenes from genetically engineered (GE) rice to its coexisting weedy rice (O. sativa f. spontanea) populations via gene flow creates a major concern for commercial GE rice cultivation. Transgene flow to weedy rice seems unavoidable. Therefore, characterization of potential fitness effect brought by the transgenes is essential to assess environmental consequences caused by crop-weed transgene flow. Methodology/Principal Findings Field performance of fitness-related traits was assessed in advanced hybrid progeny of F4 generation derived from a cross between an insect-resistant transgenic (Bt/CpTI) rice line and a weedy strain. The performance of transgene-positive hybrid progeny was compared with the transgene-negative progeny and weedy parent in pure and mixed planting of transgenic and nontransgenic plants under environmental conditions with natural vs. low insect pressure. Results showed that under natural insect pressure the insect-resistant transgenes could effectively suppress target insects and bring significantly increased fitness to transgenic plants in pure planting, compared with nontransgenic plants (including weedy parent). In contrast, no significant differences in fitness were detected under low insect pressure. However, such increase in fitness was not detected in the mixed planting of transgenic and nontransgenic plants due to significantly reduced insect pressure. Conclusions/Significance Insect-resistance transgenes may have limited fitness advantages to hybrid progeny resulted from crop-weed transgene flow owning to the significantly reduced ambient target insect pressure when an insect-resistant GE crop is grown. Given that the extensive cultivation of an insect-resistant GE crop will ultimately reduce the target insect pressure, the rapid spread of insect-resistance transgenes in weedy populations in commercial GE crop fields may be not likely to happen. PMID:22815975
Rothermel, Markus; Brunert, Daniela; Zabawa, Christine; Díaz-Quesada, Marta; Wachowiak, Matt
2013-09-18
Tools enabling the manipulation of well defined neuronal subpopulations are critical for probing complex neuronal networks. Cre recombinase (Cre) mouse driver lines in combination with the Cre-dependent expression of proteins using viral vectors--in particular, recombinant adeno-associated viral vectors (rAAVs)--have emerged as a widely used platform for achieving transgene expression in specified neural populations. However, the ability of rAAVs to further specify neuronal subsets on the basis of their anatomical connectivity has been reported as limited or inconsistent. Here, we systematically tested a variety of widely used neurotropic rAAVs for their ability to mediate retrograde gene transduction in the mouse brain. We tested pseudotyped rAAVs of several common serotypes (rAAV 2/1, 2/5, and 2/9) as well as constructs both with and without Cre-dependent expression switches. Many of the rAAVs tested--in particular, though not exclusively, Cre-dependent vectors--showed a robust capacity for retrograde infection and transgene expression. Retrograde expression was successful over distances as large as 6 mm and in multiple neuron types, including olfactory projection neurons, neocortical pyramidal cells projecting to distinct targets, and corticofugal and modulatory projection neurons. Retrograde infection using transgenes such as ChR2 allowed for optical control or optically assisted electrophysiological identification of neurons defined genetically as well as by their projection target. These results establish a widely accessible tool for achieving combinatorial specificity and stable, long-term transgene expression to isolate precisely defined neuron populations in the intact animal.
Rothermel, Markus; Brunert, Daniela; Zabawa, Christine; Díaz-Quesada, Marta
2013-01-01
Tools enabling the manipulation of well defined neuronal subpopulations are critical for probing complex neuronal networks. Cre recombinase (Cre) mouse driver lines in combination with the Cre-dependent expression of proteins using viral vectors—in particular, recombinant adeno-associated viral vectors (rAAVs)—have emerged as a widely used platform for achieving transgene expression in specified neural populations. However, the ability of rAAVs to further specify neuronal subsets on the basis of their anatomical connectivity has been reported as limited or inconsistent. Here, we systematically tested a variety of widely used neurotropic rAAVs for their ability to mediate retrograde gene transduction in the mouse brain. We tested pseudotyped rAAVs of several common serotypes (rAAV 2/1, 2/5, and 2/9) as well as constructs both with and without Cre-dependent expression switches. Many of the rAAVs tested—in particular, though not exclusively, Cre-dependent vectors—showed a robust capacity for retrograde infection and transgene expression. Retrograde expression was successful over distances as large as 6 mm and in multiple neuron types, including olfactory projection neurons, neocortical pyramidal cells projecting to distinct targets, and corticofugal and modulatory projection neurons. Retrograde infection using transgenes such as ChR2 allowed for optical control or optically assisted electrophysiological identification of neurons defined genetically as well as by their projection target. These results establish a widely accessible tool for achieving combinatorial specificity and stable, long-term transgene expression to isolate precisely defined neuron populations in the intact animal. PMID:24048849
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
The growth performance of F1 transgenic mutiara catfish
NASA Astrophysics Data System (ADS)
Iskandar; Buwono, I. D.; Agung, M. U. K.
2018-04-01
The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.
UV exposure, genetic targets in melanocytic tumors and transgenic mouse models.
de Gruijl, Frank R; van Kranen, Henk J; van Schanke, Arne
2005-01-01
The genetic changes and corruption of kinase activity in melanomas appear to revolve around a central axis: mitogenic signaling along the RAS pathway down to transcription regulation by pRB. Epidemiological studies point to the importance of ultraviolet (UV) radiation in the etiology of melanoma, but where and how UV radiation is targeted to contribute to the oncogenic signaling remains obscure. Animal models of melanoma genesis could serve to clarify this issue, but many of these models are not responsive to UV exposure. Most interesting advances have been made by using transgenic mice that carry genetic defects that are known to be relevant to human melanoma: specifically, dysfunction in the tumor suppressive action of p16INK4a or a receptor tyrosine kinase/RAS pathway, that is constitutively activated in melanocytes. The latter types of mice appear to be most responsive to (neonatal) UV exposure. Whether this is due to a general increase in target cells by melanocytosis and a paucity or complete lack of pigment, or a possible UV-induced response of the promoter-enhancer of the transgene or a genuinely independent and additional genetic alteration caused by UV exposure needs to be established. Importantly, the full effect of UV radiation needs to be ascertained in mice with different pigmentation by varying the wavelengths, UV-B versus UV-A1, and the exposure schedules, i.e. neonatal versus adult and chronic versus intermittent overexposure. Intermittent UV-B overexposure deserves special attention because it most strongly evokes proliferative responses in melanocytes.
Vrljicak, Pavle; Tao, Shijie; Varshney, Gaurav K; Quach, Helen Ngoc Bao; Joshi, Adita; LaFave, Matthew C; Burgess, Shawn M; Sampath, Karuna
2016-04-07
DNA transposons and retroviruses are important transgenic tools for genome engineering. An important consideration affecting the choice of transgenic vector is their insertion site preferences. Previous large-scale analyses of Ds transposon integration sites in plants were done on the basis of reporter gene expression or germ-line transmission, making it difficult to discern vertebrate integration preferences. Here, we compare over 1300 Ds transposon integration sites in zebrafish with Tol2 transposon and retroviral integration sites. Genome-wide analysis shows that Ds integration sites in the presence or absence of marker selection are remarkably similar and distributed throughout the genome. No strict motif was found, but a preference for structural features in the target DNA associated with DNA flexibility (Twist, Tilt, Rise, Roll, Shift, and Slide) was observed. Remarkably, this feature is also found in transposon and retroviral integrations in maize and mouse cells. Our findings show that structural features influence the integration of heterologous DNA in genomes, and have implications for targeted genome engineering. Copyright © 2016 Vrljicak et al.
Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss
2011-01-01
We studied xylem anatomy and hydraulic architecture in 14 transgenic insertion events and a control line of hybrid poplar (Populus spp.) that varied in lignin content. Transgenic events had different levels of down-regulation of two genes encoding 4-coumarate:coenzyme A ligase (4CL). Two-year-old trees were characterized after...
Ubiquitin fusion expression and tissue-dependent targeting of hG-CSF in transgenic tobacco
2011-01-01
Background Human granulocyte colony-stimulating factor (hG-CSF) is an important human cytokine which has been widely used in oncology and infection protection. To satisfy clinical needs, expression of recombinant hG-CSF has been studied in several organisms, including rice cell suspension culture and transient expression in tobacco leaves, but there was no published report on its expression in stably transformed plants which can serve as a more economical expression platform with potential industrial application. Results In this study, hG-CSF expression was investigated in transgenic tobacco leaves and seeds in which the accumulation of hG-CSF could be enhanced through fusion with ubiquitin by up to 7 fold in leaves and 2 fold in seeds, leading to an accumulation level of 2.5 mg/g total soluble protein (TSP) in leaves and 1.3 mg/g TSP in seeds, relative to hG-CSF expressed without a fusion partner. Immunoblot analysis showed that ubiquitin was processed from the final protein product, and ubiquitination was up-regulated in all transgenic plants analyzed. Driven by CaMV 35S promoter and phaseolin signal peptide, hG-CSF was observed to be secreted into apoplast in leaves but deposited in protein storage vacuole (PSV) in seeds, indicating that targeting of the hG-CSF was tissue-dependent in transgenic tobacco. Bioactivity assay showed that hG-CSF expressed in both seeds and leaves was bioactive to support the proliferation of NFS-60 cells. Conclusions In this study, the expression of bioactive hG-CSF in transgenic plants was improved through ubiquitin fusion strategy, demonstrating that protein expression can be enhanced in both plant leaves and seeds through fusion with ubiquitin and providing a typical case of tissue-dependent expression of recombinant protein in transgenic plants. PMID:21985646
Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng
2014-03-28
Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.
Competitive release and outbreaks of non-target pests associated with transgenic Bt cotton.
Zeilinger, Adam R; Olson, Dawn M; Andow, David A
2016-06-01
The adoption of transgenic Bt cotton has, in some cases, led to environmental and economic benefits through reduced insecticide use. However, the distribution of these benefits and associated risks among cotton growers and cotton-growing regions has been uneven due in part to outbreaks of non-target or secondary pests, thereby requiring the continued use of synthetic insecticides. In the southeastern USA, Bt cotton adoption has resulted in increased abundance of and damage from stink bug pests, Euschistus servus and Nezara viridula (Heteroptera: Pentatomidae). While the impact of increased stink bug abundance has been well-documented, the causes have remained unclear. We hypothesize that release from competition with Bt-susceptible target pests may drive stink bug outbreaks in Bt cotton. We first examined the evidence for competitive release of stink bugs through meta-analysis of previous studies. We then experimentally tested if herbivory by Bt-susceptible Helicoverpa zea increases stink bug leaving rates and deters oviposition on non-Bt cotton. Consistent with previous studies, we found differences in leaving rates only for E servus, but we found that both species strongly avoided ovipositing on H. zea-damaged plants. Considering all available evidence, competitive release of stink bug populations in Bt cotton likely contributes to outbreaks, though the relative importance of competitive release remains an open question. Ecological risk assessments of Bt crops and other transgenic insecticidal crops would benefit from greater understanding of the ecological mechanisms underlying non-target pest outbreaks and greater attention to indirect ecological effects more broadly.
Wu, Hongsheng; Zhang, Yuhong; Liu, Ping; Xie, Jiaqin; He, Yunyu; Deng, Congshuang; De Clercq, Patrick; Pang, Hong
2014-01-01
Recently, several invasive mealybugs (Hemiptera: Pseudococcidae) have rapidly spread to Asia and have become a serious threat to the production of cotton including transgenic cotton. Thus far, studies have mainly focused on the effects of mealybugs on non-transgenic cotton, without fully considering their effects on transgenic cotton and trophic interactions. Therefore, investigating the potential effects of mealybugs on transgenic cotton and their key natural enemies is vitally important. A first study on the effects of transgenic cotton on a non-target mealybug, Ferrisia virgata (Cockerell) (Hemiptera: Pseudococcidae) was performed by comparing its development, survival and body weight on transgenic cotton leaves expressing Cry1Ac (Bt toxin) + CpTI (Cowpea Trypsin Inhibitor) with those on its near-isogenic non-transgenic line. Furthermore, the development, survival, body weight, fecundity, adult longevity and feeding preference of the mealybug predator Cryptolaemus montrouzieri Mulsant (Coleoptera: Coccinellidae) was assessed when fed F. virgata maintained on transgenic cotton. In order to investigate potential transfer of Cry1Ac and CpTI proteins via the food chain, protein levels in cotton leaves, mealybugs and ladybirds were quantified. Experimental results showed that F. virgata could infest this bivalent transgenic cotton. No significant differences were observed in the physiological parameters of the predator C. montrouzieri offered F. virgata reared on transgenic cotton or its near-isogenic line. Cry1Ac and CpTI proteins were detected in transgenic cotton leaves, but no detectable levels of both proteins were present in the mealybug or its predator when reared on transgenic cotton leaves. Our bioassays indicated that transgenic cotton poses a negligible risk to the predatory coccinellid C. montrouzieri via its prey, the mealybug F. virgata. PMID:24751821
Wu, Hongsheng; Zhang, Yuhong; Liu, Ping; Xie, Jiaqin; He, Yunyu; Deng, Congshuang; De Clercq, Patrick; Pang, Hong
2014-01-01
Recently, several invasive mealybugs (Hemiptera: Pseudococcidae) have rapidly spread to Asia and have become a serious threat to the production of cotton including transgenic cotton. Thus far, studies have mainly focused on the effects of mealybugs on non-transgenic cotton, without fully considering their effects on transgenic cotton and trophic interactions. Therefore, investigating the potential effects of mealybugs on transgenic cotton and their key natural enemies is vitally important. A first study on the effects of transgenic cotton on a non-target mealybug, Ferrisia virgata (Cockerell) (Hemiptera: Pseudococcidae) was performed by comparing its development, survival and body weight on transgenic cotton leaves expressing Cry1Ac (Bt toxin) + CpTI (Cowpea Trypsin Inhibitor) with those on its near-isogenic non-transgenic line. Furthermore, the development, survival, body weight, fecundity, adult longevity and feeding preference of the mealybug predator Cryptolaemus montrouzieri Mulsant (Coleoptera: Coccinellidae) was assessed when fed F. virgata maintained on transgenic cotton. In order to investigate potential transfer of Cry1Ac and CpTI proteins via the food chain, protein levels in cotton leaves, mealybugs and ladybirds were quantified. Experimental results showed that F. virgata could infest this bivalent transgenic cotton. No significant differences were observed in the physiological parameters of the predator C. montrouzieri offered F. virgata reared on transgenic cotton or its near-isogenic line. Cry1Ac and CpTI proteins were detected in transgenic cotton leaves, but no detectable levels of both proteins were present in the mealybug or its predator when reared on transgenic cotton leaves. Our bioassays indicated that transgenic cotton poses a negligible risk to the predatory coccinellid C. montrouzieri via its prey, the mealybug F. virgata.
Survival of Skin Graft between Transgenic Cloned Dogs and Non-Transgenic Cloned Dogs
Kim, Geon A; Oh, Hyun Ju; Kim, Min Jung; Jo, Young Kwang; Choi, Jin; Park, Jung Eun; Park, Eun Jung; Lim, Sang Hyun; Yoon, Byung Il; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun
2014-01-01
Whereas it has been assumed that genetically modified tissues or cells derived from somatic cell nuclear transfer (SCNT) should be accepted by a host of the same species, their immune compatibility has not been extensively explored. To identify acceptance of SCNT-derived cells or tissues, skin grafts were performed between cloned dogs that were identical except for their mitochondrial DNA (mtDNA) haplotypes and foreign gene. We showed here that differences in mtDNA haplotypes and genetic modification did not elicit immune responses in these dogs: 1) skin tissues from genetically-modified cloned dogs were successfully transplanted into genetically-modified cloned dogs with different mtDNA haplotype under three successive grafts over 63 days; and 2) non-transgenic cloned tissues were accepted into transgenic cloned syngeneic recipients with different mtDNA haplotypes and vice versa under two successive grafts over 63 days. In addition, expression of the inserted gene was maintained, being functional without eliciting graft rejection. In conclusion, these results show that transplanting genetically-modified tissues into normal, syngeneic or genetically-modified recipient dogs with different mtDNA haplotypes do not elicit skin graft rejection or affect expression of the inserted gene. Therefore, therapeutically valuable tissue derived from SCNT with genetic modification might be used safely in clinical applications for patients with diseased tissues. PMID:25372489
Nishimura, Christopher D; Brenner, Daniel A; Mukherjee, Malini; Hirsch, Rachel A; Ott, Leah; Wu, Meng-Fen; Liu, Hao; Dakhova, Olga; Orange, Jordan S; Brenner, Malcolm K; Lin, Charles Y; Arber, Caroline
2017-12-21
Adoptively transferred T-cell receptor (TCR)-engineered T cells depend on host-derived costimulation and cytokine signals for their full and sustained activation. However, in patients with cancer, both signals are frequently impaired. Hence, we developed a novel strategy that combines both essential signals in 1 transgene by expressing the nonlymphoid hematopoietic growth factor receptor c-MPL (myeloproliferative leukemia), the receptor for thrombopoietin (TPO), in T cells. c-MPL signaling activates pathways shared with conventional costimulatory and cytokine receptor signaling. Thus, we hypothesized that host-derived TPO, present in the tumor microenvironment, or pharmacological c-MPL agonists approved by the US Food and Drug Administration could deliver both signals to c-MPL-engineered TCR-transgenic T cells. We found that c-MPL + polyclonal T cells expand and proliferate in response to TPO, and persist longer after adoptive transfer in immunodeficient human TPO-transgenic mice. In TCR-transgenic T cells, c-MPL activation enhances antitumor function, T-cell expansion, and cytokine production and preserves a central memory phenotype. c-MPL signaling also enables sequential tumor cell killing, enhances the formation of effective immune synapses, and improves antileukemic activity in vivo in a leukemia xenograft model. We identify the type 1 interferon pathway as a molecular mechanism by which c-MPL mediates immune stimulation in T cells. In conclusion, we present a novel immunotherapeutic strategy using c-MPL-enhanced transgenic T cells responding to either endogenously produced TPO (a microenvironment factor in hematologic malignancies) or c-MPL-targeted pharmacological agents. © 2017 by The American Society of Hematology.
Maffettone, Carmen; Chen, Guohua; Drozdov, Ignat; Ouzounis, Christos; Pantopoulos, Kostas
2010-04-13
Iron regulatory proteins, IRP1 and IRP2, bind to mRNAs harboring iron responsive elements and control their expression. IRPs may also perform additional functions. Thus, IRP1 exhibited apparent tumor suppressor properties in a tumor xenograft model. Here we examined the effects of IRP2 in a similar setting. Human H1299 lung cancer cells or clones engineered for tetracycline-inducible expression of wild type IRP2, or the deletion mutant IRP2(Delta73) (lacking a specific insert of 73 amino acids), were injected subcutaneously into nude mice. The induction of IRP2 profoundly stimulated the growth of tumor xenografts, and this response was blunted by addition of tetracycline in the drinking water of the animals, to turnoff the IRP2 transgene. Interestingly, IRP2(Delta73) failed to promote tumor growth above control levels. As expected, xenografts expressing the IRP2 transgene exhibited high levels of transferrin receptor 1 (TfR1); however, the expression of other known IRP targets was not affected. Moreover, these xenografts manifested increased c-MYC levels and ERK1/2 phosphorylation. A microarray analysis identified distinct gene expression patterns between control and tumors containing IRP2 or IRP1 transgenes. By contrast, gene expression profiles of control and IRP2(Delta73)-related tumors were more similar, consistently with their growth phenotype. Collectively, these data demonstrate an apparent pro-oncogenic activity of IRP2 that depends on its specific 73 amino acids insert, and provide further evidence for a link between IRPs and cancer biology.
Maffettone, Carmen; Chen, Guohua; Drozdov, Ignat; Ouzounis, Christos; Pantopoulos, Kostas
2010-01-01
Iron regulatory proteins, IRP1 and IRP2, bind to mRNAs harboring iron responsive elements and control their expression. IRPs may also perform additional functions. Thus, IRP1 exhibited apparent tumor suppressor properties in a tumor xenograft model. Here we examined the effects of IRP2 in a similar setting. Human H1299 lung cancer cells or clones engineered for tetracycline-inducible expression of wild type IRP2, or the deletion mutant IRP2Δ73 (lacking a specific insert of 73 amino acids), were injected subcutaneously into nude mice. The induction of IRP2 profoundly stimulated the growth of tumor xenografts, and this response was blunted by addition of tetracycline in the drinking water of the animals, to turnoff the IRP2 transgene. Interestingly, IRP2Δ73 failed to promote tumor growth above control levels. As expected, xenografts expressing the IRP2 transgene exhibited high levels of transferrin receptor 1 (TfR1); however, the expression of other known IRP targets was not affected. Moreover, these xenografts manifested increased c-MYC levels and ERK1/2 phosphorylation. A microarray analysis identified distinct gene expression patterns between control and tumors containing IRP2 or IRP1 transgenes. By contrast, gene expression profiles of control and IRP2Δ73-related tumors were more similar, consistently with their growth phenotype. Collectively, these data demonstrate an apparent pro-oncogenic activity of IRP2 that depends on its specific 73 amino acids insert, and provide further evidence for a link between IRPs and cancer biology. PMID:20405006
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia
2015-01-01
RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control. PMID:26435695
Babenko, Vladimir N; Makunin, Igor V; Brusentsova, Irina V; Belyaeva, Elena S; Maksimov, Daniil A; Belyakin, Stepan N; Maroy, Peter; Vasil'eva, Lyubov A; Zhimulev, Igor F
2010-05-21
Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions compared to the genome average or neighboring regions. In contrast, Minos-based transposons show no paucity in URs but have a strong bias to testis-specific genes. We estimated the suppression level in 2,852 stocks carrying a single P-element by analysis of eye color determined by the mini-white marker gene and demonstrate that the proportion of suppressed transgenes in URs is more than three times higher than in the flanking regions or the genomic average. The suppressed transgenes reside in intergenic, genic or promoter regions of the annotated genes. We speculate that the low insertion frequency of P-elements and piggyBacs in URs partially results from suppression of transgenes that potentially could prevent identification of transgenes due to complete suppression of the marker gene. In a similar manner, the proportion of suppressed transgenes is higher in loci replicating late or very late in Kc cells and these loci have a lower density of P-elements and piggyBac insertions. In transgenes with two marker genes suppression of mini-white gene in eye coincides with suppression of yellow gene in bristles. Our results suggest that the late replication domains have a high inactivation potential apparently linked to the silenced or closed chromatin state in these regions, and that such inactivation potential is largely maintained in different tissues.
USDA-ARS?s Scientific Manuscript database
Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...
Progress of targeted genome modification approaches in higher plants.
Cardi, Teodoro; Neal Stewart, C
2016-07-01
Transgene integration in plants is based on illegitimate recombination between non-homologous sequences. The low control of integration site and number of (trans/cis)gene copies might have negative consequences on the expression of transferred genes and their insertion within endogenous coding sequences. The first experiments conducted to use precise homologous recombination for gene integration commenced soon after the first demonstration that transgenic plants could be produced. Modern transgene targeting categories used in plant biology are: (a) homologous recombination-dependent gene targeting; (b) recombinase-mediated site-specific gene integration; (c) oligonucleotide-directed mutagenesis; (d) nuclease-mediated site-specific genome modifications. New tools enable precise gene replacement or stacking with exogenous sequences and targeted mutagenesis of endogeneous sequences. The possibility to engineer chimeric designer nucleases, which are able to target virtually any genomic site, and use them for inducing double-strand breaks in host DNA create new opportunities for both applied plant breeding and functional genomics. CRISPR is the most recent technology available for precise genome editing. Its rapid adoption in biological research is based on its inherent simplicity and efficacy. Its utilization, however, depends on available sequence information, especially for genome-wide analysis. We will review the approaches used for genome modification, specifically those for affecting gene integration and modification in higher plants. For each approach, the advantages and limitations will be noted. We also will speculate on how their actual commercial development and implementation in plant breeding will be affected by governmental regulations.
GEC-targeted HO-1 expression reduces proteinuria in glomerular immune injury.
Duann, Pu; Lianos, Elias A
2009-09-01
Induction of heme oxygenase (HO)-1 is a key defense mechanism against oxidative stress. Compared with tubules, glomeruli are refractory to HO-1 upregulation in response to injury. This can be a disadvantage as it may be associated with insufficient production of cytoprotective heme-degradation metabolites. We, therefore, explored whether 1) targeted HO-1 expression can be achieved in glomeruli without altering their physiological integrity and 2) this expression reduces proteinuria in immune injury induced by an anti-glomerular basement membrane (GBM) antibody (Ab). We employed a 4.125-kb fragment of a mouse nephrin promoter downstream to which a FLAG-tagged hHO-1 cDNA sequence was inserted and subsequently generated transgenic mice from the FVB/N parental strain. There was a 16-fold higher transgene expression in the kidney than nonspecific background (liver) while the transprotein immunolocalized in glomerular epithelial cells (GEC). There was no change in urinary protein excretion, indicating that GEC-targeted HO-1 expression had no effect on glomerular protein permeability. Urinary protein excretion in transgenic mice with anti-GBM Ab injury (days 3 and 6) was significantly lower compared with wild-type controls. There was no significant change in renal expression levels of profibrotic (TGF-beta1) or anti-inflammatory (IL-10) cytokines in transgenic mice with anti-GBM Ab injury. These observations indicate that GEC-targeted HO-1 expression does not alter glomerular physiological integrity and reduces proteinuria in glomerular immune injury.
GEC-targeted HO-1 expression reduces proteinuria in glomerular immune injury
Duann, Pu; Lianos, Elias A.
2009-01-01
Induction of heme oxygenase (HO)-1 is a key defense mechanism against oxidative stress. Compared with tubules, glomeruli are refractory to HO-1 upregulation in response to injury. This can be a disadvantage as it may be associated with insufficient production of cytoprotective heme-degradation metabolites. We, therefore, explored whether 1) targeted HO-1 expression can be achieved in glomeruli without altering their physiological integrity and 2) this expression reduces proteinuria in immune injury induced by an anti-glomerular basement membrane (GBM) antibody (Ab). We employed a 4.125-kb fragment of a mouse nephrin promoter downstream to which a FLAG-tagged hHO-1 cDNA sequence was inserted and subsequently generated transgenic mice from the FVB/N parental strain. There was a 16-fold higher transgene expression in the kidney than nonspecific background (liver) while the transprotein immunolocalized in glomerular epithelial cells (GEC). There was no change in urinary protein excretion, indicating that GEC-targeted HO-1 expression had no effect on glomerular protein permeability. Urinary protein excretion in transgenic mice with anti-GBM Ab injury (days 3 and 6) was significantly lower compared with wild-type controls. There was no significant change in renal expression levels of profibrotic (TGF-β1) or anti-inflammatory (IL-10) cytokines in transgenic mice with anti-GBM Ab injury. These observations indicate that GEC-targeted HO-1 expression does not alter glomerular physiological integrity and reduces proteinuria in glomerular immune injury. PMID:19587144
Wang, Yong Sheng; He, Xiaoning; Du, Yue; Su, Jianmin; Gao, Mingqing; Ma, Yefei; Hua, Song; Quan, Fusheng; Liu, Jun; Zhang, Yong
2015-09-01
This study aimed to assess the effects of the intracellular pathogen resistance 1 (Ipr1) transgene on preventing infection of Mycobacterium bovis in cattle. A specific expression vector for the Ipr1 gene was constructed and inserted in the genome between surfactant protein A and methionine adenosyltransferase I of bovine fetal fibroblasts. After SCNT, cleavage (86.9% vs. 87.4%, P > 0.05) and blastocyst developmental rates (34.6% vs. 33.5%, P > 0.05) were similar between transgenic and nontransgenic bovine fetal fibroblasts. Four surviving and one dead Ipr1-transgenic female cattle were produced by transfer of the SCNT blastocysts. Polymerase chain reaction and Southern blot analyses confirmed that the Ipr1 transgene of the cattle was located at the expected site. Inserting Ipr1 gene did not affect the expression of the surrounding genes. Main death modality of M bovis-infected peripheral blood mononuclear cells (PBMCs) derived from Ipr1-transgenic cattle was apoptosis, whereas that of PBMCs from control cattle was necrosis. In addition, the number of colony-forming units in PBMCs of Ipr1-transgenic cattle was significantly lower than that of the control cattle (P < 0.05). The finding that expression of Ipr1 transgene in PBMCs significantly increased anti-M bovis activity suggested breeding anti-M bovis cattle population by the transgenic SCNT technique could be a feasible strategy. Copyright © 2015 Elsevier Inc. All rights reserved.
[Effects of agricultural activities and transgenic crops on agricultural biodiversity].
Zhang, Xi-Tao; Luo, Hong-Bing; Li, Jun-Sheng; Huang, Hai; Liu, Yong-Bo
2014-09-01
Agricultural biodiversity is a key part of the ecosystem biodiversity, but it receives little concern. The monoculture, environmental pollution and habitat fragmentation caused by agricultural activities have threatened agricultural biodiversity over the past 50 years. To optimize agricultural management measures for crop production and environmental protection, we reviewed the effects of agricultural activities, including cultivation patterns, plastic mulching, chemical additions and the cultivation of transgenic crops, on agricultural biodiversity. The results showed that chemical pesticides and fertilizers had the most serious influence and the effects of transgenic crops varied with other factors like the specific transgene inserted in crops. The environmental risk of transgenic crops should be assessed widely through case-by-case methods, particularly its potential impacts on agricultural biodiversity. It is important to consider the protection of agricultural biodiversity before taking certain agricultural practices, which could improve agricultural production and simultaneously reduce the environmental impacts.
Dumitrache, Alexandru; Natzke, Jace; Rodriguez, Jr., Miguel; ...
2016-11-18
Five different types of transgenic ( GAUT4, miRNA, MYB4, COMT and FPGS) Panicum virgatum L. (switchgrass) were grown in a field in Knoxville, Tenn., USA over two consecutive years between 2011 and 2015 in separate experiments. Clonal replicates were established (year-one) and produced much greater biomass during the second year. After each growing season the above ground biomass was analyzed for cell wall sugars and for recalcitrance to enzymatic digestibility, and biofuel using a separate hydrolysis and fermentation (SHF) screen. Here, each transgenic event and control had more glucan, xylan and less ethanol (g/g basis) from the second year ofmore » growth relative to the first year plants. There was no correlation between plant carbohydrate content and biofuel production. In each of cell wall-targeted transgenics, GAUT4, MYB4, COMT and FPGS, the second year of growth resulted in increased carbohydrate abundance (up to 12%) and reduced recalcitrance through higher ethanol yields (up to 21%) over the non-transgenic control plants.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dumitrache, Alexandru; Natzke, Jace; Rodriguez, Jr., Miguel
Five different types of transgenic ( GAUT4, miRNA, MYB4, COMT and FPGS) Panicum virgatum L. (switchgrass) were grown in a field in Knoxville, Tenn., USA over two consecutive years between 2011 and 2015 in separate experiments. Clonal replicates were established (year-one) and produced much greater biomass during the second year. After each growing season the above ground biomass was analyzed for cell wall sugars and for recalcitrance to enzymatic digestibility, and biofuel using a separate hydrolysis and fermentation (SHF) screen. Here, each transgenic event and control had more glucan, xylan and less ethanol (g/g basis) from the second year ofmore » growth relative to the first year plants. There was no correlation between plant carbohydrate content and biofuel production. In each of cell wall-targeted transgenics, GAUT4, MYB4, COMT and FPGS, the second year of growth resulted in increased carbohydrate abundance (up to 12%) and reduced recalcitrance through higher ethanol yields (up to 21%) over the non-transgenic control plants.« less
Long, Dingpei; Lu, Weijian; Zhang, Yuli; Bi, Lihui; Xiang, Zhonghuai; Zhao, Aichun
2015-01-01
We developed an efficient strategy that combines a method for the post-integration elimination of all transposon sequences, a site-specific recombination system, and an optimized fibroin H-chain expression system to produce a stable, replaceable, highly efficient transgene expression system in the silkworm (Bombyx mori) that overcomes the disadvantages of random insertion and post-integration instability of transposons. Here, we generated four different transgenic silkworm strains, and of one the transgenic strains, designated TS1-RgG2, with up to 16% (w/w) of the target protein in the cocoons, was selected. The subsequent elimination of all the transposon sequences from TS1-RgG2 was completed by the heat-shock-induced expression of the transposase in vivo. The resulting transgenic silkworm strain was designated TS3-g2 and contained only the attP-flanked optimized fibroin H-chain expression cassette in its genome. A phiC31/att-system-based recombinase-mediated cassette exchange (RMCE) method could be used to integrate other genes of interest into the same genome locus between the attP sites in TS3-g2. Controlling for position effects with phiC31-mediated RMCE will also allow the optimization of exogenous protein expression and fine gene function analyses in the silkworm. The strategy developed here is also applicable to other lepidopteran insects, to improve the ecological safety of transgenic strains in biocontrol programs. PMID:25739894
Genetically Targeted All-Optical Electrophysiology with a Transgenic Cre-Dependent Optopatch Mouse
Lou, Shan; Adam, Yoav; Weinstein, Eli N.; Williams, Erika; Williams, Katherine; Parot, Vicente; Kavokine, Nikita; Liberles, Stephen; Madisen, Linda; Zeng, Hongkui
2016-01-01
Recent advances in optogenetics have enabled simultaneous optical perturbation and optical readout of membrane potential in diverse cell types. Here, we develop and characterize a Cre-dependent transgenic Optopatch2 mouse line that we call Floxopatch. The animals expressed a blue-shifted channelrhodopsin, CheRiff, and a near infrared Archaerhodopsin-derived voltage indicator, QuasAr2, via targeted knock-in at the rosa26 locus. In Optopatch-expressing animals, we tested for overall health, genetically targeted expression, and function of the optogenetic components. In offspring of Floxopatch mice crossed with a variety of Cre driver lines, we observed spontaneous and optically evoked activity in vitro in acute brain slices and in vivo in somatosensory ganglia. Cell-type-specific expression allowed classification and characterization of neuronal subtypes based on their firing patterns. The Floxopatch mouse line is a useful tool for fast and sensitive characterization of neural activity in genetically specified cell types in intact tissue. SIGNIFICANCE STATEMENT Optical recordings of neural activity offer the promise of rapid and spatially resolved mapping of neural function. Calcium imaging has been widely applied in this mode, but is insensitive to the details of action potential waveforms and subthreshold events. Simultaneous optical perturbation and optical readout of single-cell electrical activity (“Optopatch”) has been demonstrated in cultured neurons and in organotypic brain slices, but not in acute brain slices or in vivo. Here, we describe a transgenic mouse in which expression of Optopatch constructs is controlled by the Cre-recombinase enzyme. This animal enables fast and robust optical measurements of single-cell electrical excitability in acute brain slices and in somatosensory ganglia in vivo, opening the door to rapid optical mapping of neuronal excitability. PMID:27798186
Recent advances in the development of new transgenic animal technology.
Miao, Xiangyang
2013-03-01
Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.
Altavilla, Giuseppe; Trabanelli, Cecilia; Merlin, Michela; Caputo, Antonella; Lanfredi, Massimo; Barbanti-Brodano, Giuseppe; Corallini, Alfredo
1999-01-01
To study the role in AIDS pathogenesis of the human immunodeficiency virus type 1 (HIV-1) Tat protein, a transactivator of viral and cellular genes, we generated transgenic mice with a recombinant DNA containing BK virus (BKV) early region and the HIV-1 tat gene, directed by its own promoter-enhancer. DNA hybridization revealed that the transgene is stably maintained in all organs of transgenic mice as a tandem insertion in a number of copies ranging from 5 to 20 per cell. In addition, tat and BKV RNA were expressed in all tissues. Transgenic mice developed three types of lesions: 1) tumors, 2) hyperplastic and dysplastic lesions, and 3) non-neoplastic lesions. Tumors of different histotypes, such as lymphomas, adenocarcinomas of skin glands, leiomyosarcomas, skin squamous cell carcinomas, hepatomas, hepatocarcinomas, and cavernous liver hemangiomas, developed in 29% of transgenic animals. The majority of tumors were malignant, invasive, and producing metastases. Conversely, tumors of only two histotypes (lymphomas and adenocarcinomas of skin glands) appeared in control mice. Hyperplastic and dysplastic lesions were more frequent in transgenic than in control mice and involved the skin or its adnexes, the liver and the rectum, indicating multiple targets for the activity of the transgene. Pyelonephritis, frequently complicated with hydronephrosis, inflammatory eye lesions, and amyloid depositions represented the most frequent non-neoplastic lesions detected in transgenic mice. Many of the pathological findings observed in this animal model are comparable to similar lesions appearing in AIDS patients, suggesting a relevant role for Tat in the pathogenesis of such lesions during the course of AIDS. PMID:10233861
Suerth, Julia D; Maetzig, Tobias; Brugman, Martijn H; Heinz, Niels; Appelt, Jens-Uwe; Kaufmann, Kerstin B; Schmidt, Manfred; Grez, Manuel; Modlich, Ute; Baum, Christopher; Schambach, Axel
2012-01-01
Comparative integrome analyses have highlighted alpharetroviral vectors with a relatively neutral, and thus favorable, integration spectrum. However, previous studies used alpharetroviral vectors harboring viral coding sequences and intact long-terminal repeats (LTRs). We recently developed self-inactivating (SIN) alpharetroviral vectors with an advanced split-packaging design. In a murine bone marrow (BM) transplantation model we now compared alpharetroviral, gammaretroviral, and lentiviral SIN vectors and showed that all vectors transduced hematopoietic stem cells (HSCs), leading to comparable, sustained multilineage transgene expression in primary and secondary transplanted mice. Alpharetroviral integrations were decreased near transcription start sites, CpG islands, and potential cancer genes compared with gammaretroviral, and decreased in genes compared with lentiviral integrations. Analyzing the transcriptome and intragenic integrations in engrafting cells, we observed stronger correlations between in-gene integration targeting and transcriptional activity for gammaretroviral and lentiviral vectors than for alpharetroviral vectors. Importantly, the relatively “extragenic” alpharetroviral integration pattern still supported long-term transgene expression upon serial transplantation. Furthermore, sensitive genotoxicity studies revealed a decreased immortalization incidence compared with gammaretroviral and lentiviral SIN vectors. We conclude that alpharetroviral SIN vectors have a favorable integration pattern which lowers the risk of insertional mutagenesis while supporting long-term transgene expression in the progeny of transplanted HSCs. PMID:22334016
[New advances in animal transgenic technology].
Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang
2010-06-01
Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.
UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.
UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less
Transgenic cloned sheep overexpressing ovine toll-like receptor 4.
Deng, Shoulong; Li, Guiguan; Zhang, Jinlong; Zhang, Xiaosheng; Cui, Maosheng; Guo, Yong; Liu, Guoshi; Li, Guangpeng; Feng, Jianzhong; Lian, Zhengxing
2013-07-01
An ovine fetal fibroblast cell line highly expressing TLR4 was established by inserting TLR4 into a reconstructive p3S-LoxP plasmid. Transgenic sheep overexpressing TLR4 were produced by transferring TLR4-transfected fetal fibroblasts into metaphase (M)II-stage enucleated oocytes (using SCNT). Because reconstructed embryos derived from MII-stage enucleated oocytes matured in vivo using a delayed-activated method had a higher pregnancy rate (18.52%) than that from MII-stage enucleated oocytes matured in vitro, the former procedure was used. Nine TLR4-transgenic live births were confirmed using polymerase chain reaction and Southern blot analysis. Increased expression of TLR4 at mRNA and protein levels in ear tissues of transgenic lambs were verified using reverse transcription polymerase chain reaction and immunohistochemistry, respectively. More toll-like receptor 4 protein was expressed by peripheral blood monocytes and/or macrophages collected from 3-month-old TLR4-transgenic than nontransgenic lambs at 0, 1, and 4 hours after lipopolysaccharide stimulation. Furthermore, interferon-γ and tumor necrosis factor α secreted by monocytes and/or macrophages of TLR4-transgenic lambs were significantly higher at 1 hour. Therefore, lipopolysaccharide-induced inflammatory responses from monocytes and/or macrophages occurred sooner in TLR4-transgenic lambs, consistent with an enhanced host immune response. In conclusion, transgenic sheep overexpressing TLR4 are a primary model to investigate the role of transgenic animals in disease resistance and have potential for breeding sheep with disease resistance. Copyright © 2013 Elsevier Inc. All rights reserved.
Lunar Orbit Insertion Targeting and Associated Outbound Mission Design for Lunar Sortie Missions
NASA Technical Reports Server (NTRS)
Condon, Gerald L.
2007-01-01
This report details the Lunar Orbit Insertion (LOI) arrival targeting and associated mission design philosophy for Lunar sortie missions with up to a 7-day surface stay and with global Lunar landing site access. It also documents the assumptions, methodology, and requirements validated by TDS-04-013, Integrated Transit Nominal and Abort Characterization and Sensitivity Study. This report examines the generation of the Lunar arrival parking orbit inclination and Longitude of the Ascending Node (LAN) targets supporting surface missions with global Lunar landing site access. These targets support the Constellation Program requirement for anytime abort (early return) by providing for a minimized worst-case wedge angle [and an associated minimum plane change delta-velocity (V) cost] between the Crew Exploration Vehicle (CEV) and the Lunar Surface Access Module (LSAM) for an LSAM launch anytime during the Lunar surface stay.
Yuan, Ren; Kulkarni, Trupti; Wei, Fu; Shah, Girish V
2005-01-14
It was previously shown that calcitonin-like pituitary peptide (pit-CT) is synthesized and secreted by gonadotrophs, and pit-CT inhibits PRL gene transcription and lactotroph cell proliferation. Present studies examined long-term consequences of pit-CT overexpression on the functioning of mouse anterior pituitary (AP) gland. Targeted overexpression of pit-CT in gonadotrophs of mouse pituitaries was achieved by generating mice overexpressing bovine luteinizing hormone (LH)-alpha subunit promoter-pit-CT cDNA transgene. Transgenic (pit-CT+) mice displayed chronic but selective overexpression of pit-CT in gonadotrophs. The mice also displayed a dramatic decline in PRL gene expression as assessed by PRL mRNA abundance, PRL immunohistochemistry (IHC) and serum PRL levels. LH secretion in pit-CT+ mice was also reduced, without any change in FSH secretion. Reproductive abnormalities such as prolonged estrous cycles, reduced pregnancy rate, delivery of smaller litters, increased neonatal mortality and deficient lactation were also observed. Administration of PRL during early pregnancy significantly increased the pregnancy rate and neonatal survival of newborns. These results demonstrate that overexpression of pit-CT leads to chronic hypoprolactinemia and reproductive dysfunction in female mice, and reinforces the possibility that gonadotroph-derived pit-CT is an important paracrine regulator of lactotroph function.
A Primer for Using Transgenic Insecticidal Cotton in Developing Countries
Showalter, Ann M.; Heuberger, Shannon; Tabashnik, Bruce E.; Carrière, Yves
2009-01-01
Many developing countries face the decision of whether to approve the testing and commercial use of insecticidal transgenic cotton and the task of developing adequate regulations for its use. In this review, we outline concepts and provide information to assist farmers, regulators and scientists in making decisions concerning this technology. We address seven critical topics: 1) molecular and breeding techniques used for the development of transgenic cotton cultivars, 2) properties of transgenic cotton cultivars and their efficacy against major insect pests, 3) agronomic performance of transgenic cotton in developing countries, 4) factors affecting transgene expression, 5) impact of gene flow between transgenic and non-transgenic cotton, 6) non-target effects of transgenic cotton, and 7) management of pest resistance to transgenic cotton. PMID:19613464
Characterization of GM events by insert knowledge adapted re-sequencing approaches
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-01-01
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728
Characterization of GM events by insert knowledge adapted re-sequencing approaches.
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-10-03
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.
Khurana, Neetika; Chauhan, Harsh; Khurana, Paramjit
2013-01-01
The small heat shock proteins (sHSPs) have been found to play a critical role in physiological stress conditions in protecting proteins from irreversible aggregation. To characterize the hloroplast targeted sHSP26 promoter in detail, deletion analysis of the promoter is carried out and analysed via transgenics in Arabidopsis. In the present study, complete assessment of the importance of CCAAT-box elements along with Heat shock elements (HSEs) in the promoter of sHSP26 was performed. Moreover, the importance of 5′ untranslated region (UTR) has also been established in the promoter via Arabidopsis transgenics. An intense GUS expression was observed after heat stress in the transgenics harbouring a full-length promoter, confirming the heat-stress inducibility of the promoter. Transgenic plants without UTR showed reduced GUS expression when compared to transgenic plants with UTR as was confirmed at the RNA and protein levels by qRT-PCR and GUS histochemical assays, thus suggesting the possible involvement of some regulatory elements present in the UTR in heat-stress inducibility of the promoter. Promoter activity was also checked under different abiotic stresses and revealed differential expression in different deletion constructs. Promoter analysis based on histochemical assay, real-time qPCR and fluorimetric analysis revealed that HSEs alone could not transcribe GUS gene significantly in sHSP26 promoter and CCAAT box elements contribute synergistically to the transcription. Our results also provide insight into the importance of 5`UTR of sHsp26 promoter thus emphasizing the probable role of imperfect CCAAT-box element or some novel cis-element with respect to heat stress. PMID:23349883
Transgenic mice in developmental toxicology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woychik, R.P.
1992-12-31
Advances in molecular biology and embryology are being utilized for the generation of transgenic mice, animals that contain specific additions, deletions, or modifications of genes or sequences in their DNA. Mouse embryonic stem cells and homologous recombination procedures have made it possible to target specific DNA structural alterations to highly localized region in the host chromosomes. The majority of the DNA structural rearrangements in transgenic mice can be passed through the germ line and used to establish new genetic traits in the carrier animals. Since the use of transgenic mice is having such an enormous impact on so many areasmore » of mammalian biological research, including developmental toxicology, the objective of this review is to briefly describe the fundamental methodologies for generating transgenic mice and to describe one particular application that has direct relevance to the field of genetic toxicology.« less
Transgenic mice in developmental toxicology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woychik, R.P.
1992-01-01
Advances in molecular biology and embryology are being utilized for the generation of transgenic mice, animals that contain specific additions, deletions, or modifications of genes or sequences in their DNA. Mouse embryonic stem cells and homologous recombination procedures have made it possible to target specific DNA structural alterations to highly localized region in the host chromosomes. The majority of the DNA structural rearrangements in transgenic mice can be passed through the germ line and used to establish new genetic traits in the carrier animals. Since the use of transgenic mice is having such an enormous impact on so many areasmore » of mammalian biological research, including developmental toxicology, the objective of this review is to briefly describe the fundamental methodologies for generating transgenic mice and to describe one particular application that has direct relevance to the field of genetic toxicology.« less
[Retrospect and prospect of transgenic fish breeding in China].
Wang, Yaping; He, Libo
2016-07-25
The first transgenic fish was generated in China about 30 years ago. Since then, considerable progress has been achieved for farmed fishes breeding with improvement of target traits of growth, disease resistance, stress tolerance, and nutrition qualities. Up to now, the technology of transgenic fish breeding is almost mature and the biosafety assessment is established. In this review, a successful example of the fast-growing transgenic common carp was presented and the foreground of transgenic fish breeding was also discussed and prospected.
Vast potential for using the piggyBac transposon to engineer transgenic plants
USDA-ARS?s Scientific Manuscript database
The acceptance of bioengineered plants by some nations is hampered by a number of factors, including the random insertion of a transgene into the host genome. Emerging technologies, such as site-specific nucleases, are enabling plant scientists to promote recombination or mutations at specific plant...
Lew, D; Brady, H; Klausing, K; Yaginuma, K; Theill, L E; Stauber, C; Karin, M; Mellon, P L
1993-04-01
During pituitary development, the homeo domain protein GHF-1 is required for generation of somatotropes and lactotropes and for growth hormone (GH) and prolactin (PRL) gene expression. GHF-1 mRNA is detectable several days before the emergence of GH- or PRL-expressing cells, suggesting the existence of a somatotropic progenitor cell in which GHF-1 transcription is first activated. We have immortalized this cell type by using the GHF-1 regulatory region to target SV40 T-antigen (Tag) tumorigenesis in transgenic mice. The GHF-Tag transgene caused developmental entrapment of somatotropic progenitor cells that express GHF-1 but not GH or PRL, resulting in dwarfism. Immortalized cell lines derived from a transgenic pituitary tumor maintain the characteristics of the somato/lactotropic progenitor in that they express GHF-1 mRNA and protein yet fail to activate GH or PRL transcription. Using these cells, we identified an enhancer that activates GHF-1 transcription at this early stage of development yet is inactive in cells representing later developmental stages of the somatotropic lineage or in other cell types. These experiments not only demonstrate the potential for immortalization of developmental progenitor cells using the regulatory regions from cell type-specific transcription factor genes but illustrate the power of such model systems in the study of developmental control.
Czubacka, Anna; Sacco, Ermanno; Olszak-Przybyś, Hanna; Doroszewska, Teresa
2017-05-01
Genetic transformation of plants allows us to obtain improved genotypes enriched with the desired traits. However, if transgenic lines were to be used in breeding programs the stability of inserted transgenes is essential. In the present study, we followed the inheritance of transgenes in hybrids originated from crossing two transgenic tobacco lines resistant to Potato virus Y (PVY): MN 944 LMV with the transgene containing Lettuce mosaic virus coat protein gene (LMV CP) and AC Gayed ROKY2 with PVY replicase gene (ROKY2). Progeny populations generated by successive self-pollination were analyzed with respect to the transgene segregation ratio and resistance to Potato virus Y in tests carried out under greenhouse conditions. The presence of the virus in inoculated plants was detected by DAS-ELISA method. The results demonstrated the Mendelian fashion of inheritance of transgenes which were segregated independently and stably. As a result, we obtained T 4 generation of hybrid with both transgenes stacked and which was highly resistant to PVY.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh
2012-10-01
Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.
Sadeqzadeh, Elham; Rahbarizadeh, Fatemeh; Ahmadvand, Davoud; Rasaee, Mohammad J; Parhamifar, Ladan; Moghimi, S Moein
2011-11-30
We provide evidence for combining a single domain antibody (nanobody)-based targeting approach with transcriptional targeting as a safe way to deliver lethal transgenes to MUC1 over-expressing cancer cells. From a nanobody immune library, we have isolated an anti-DF3/Mucin1 (MUC1) nanobody with high specificity for the MUC1 antigen, which is an aberrantly glycosylated glycoprotein over-expressed in tumours of epithelial origin. The anti-MUC1 nanobody was covalently linked to the distal end of poly(ethylene glycol)(3500) (PEG(3500)) in PEG(3500)-25kDa polyethylenimine (PEI) conjugates and the resultant macromolecular entity successfully condensed plasmids coding a transcriptionally targeted truncated-Bid (tBid) killer gene under the control of the cancer-specific MUC1 promoter. The engineered polyplexes exhibited favourable physicochemical characteristics for transfection and dramatically elevated the level of Bid/tBid expression in both MUC1 over-expressing caspase 3-deficient (MCF7 cells) and caspase 3-positive (T47D and SKBR3) tumour cell lines and, concomitantly, induced considerable cell death. Neither transgene expression nor cell death occurred when the MUC1 promoter was replaced with the CNS-specific synapsin I promoter. Since PEGylated PEI was only responsible for DNA compaction and played no significant role in direct transfection and cell killing, our attempts overcome previously reported PEI-mediated apoptotic and necrotic cell death, which is advantageous for future in vivo transcriptional targeting as this will minimize (or eliminate) non-targeted cell damage. Copyright © 2011 Elsevier B.V. All rights reserved.
Birchler, James A; Presting, Gernot G
2012-04-01
The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.
Transformation of pecan and regeneration of transgenic plants.
McGranahan, G H; Leslie, C A; Dandekar, A M; Uratsu, S L; Yates, I E
1993-09-01
A gene transfer system developed for walnut (Juglans regia L.) was successfully applied to pecan (Carya illinoensis [Wang] K. Koch). Repetitively embryogenic somatic embryos derived from open-pollinated seed of 'Elliott', 'Wichita', and 'Schley' were co-cultivated with Agrobacterium strain EHA 101/pCGN 7001, which contains marker genes for beta-glucuronidase activity and resistance to kanamycin. Several modifications of the standard walnut transformation techniques were tested, including a lower concentration of kanamycin and a modified induction medium, but these treatments had no measurable effect on efficiency of transformation. Nineteen of the 764 viable inoculated embryos produced transgenic subclones; 13 of these were from the line 'Elliott'6, 3 from 'Schley'5/3, and 3 from 'Wichita'9. Transgenic embryos of 'Wichita'9 germinated most readily and three subclones were successfully micropropagated. Three transgenic plants of one of these subclones were obtained by grafting the tissue cultured shoots to seedling pecan rootstock in the greenhouse. Gene insertion, initially detected by GUS activity, was confirmed by detection of integrated T-DNA sequences using Southern analysis.
Pradhan, Subrata; Chakraborty, Anirban; Sikdar, Narattam; Chakraborty, Saikat; Bhattacharyya, Jagannath; Mitra, Joy; Manna, Anulina; Dutta Gupta, Snehasish; Sen, Soumitra Kumar
2016-10-01
Genetically engineered rice lines with broad insecticidal properties against major lepidopteran pests were generated using a synthetic, truncated form of vegetative insecticidal protein (Syn vip3BR) from Bacillus thuringiensis. The selectable marker gene and the redundant transgene(s) were eliminated through Cre/ lox mediated recombination and genetic segregation to make consumer friendly Bt -rice. For sustainable resistance against lepidopteran insect pests, chloroplast targeted synthetic version of bioactive core component of a vegetative insecticidal protein (Syn vip3BR) of Bacillus thuringiensis was expressed in rice under the control of green-tissue specific ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene promoter. The transgenic plants (in Oryza sativa indica Swarna cultivar) showed high insect mortality rate in vitro against major rice pests, yellow stem borer (Scirpophaga incertulas), rice leaf folder (Cnaphalocrocis medinalis) and rice horn caterpillar (Melanitis leda ismene) in T1 generation, indicating insecticidal potency of Syn vip3BR. Under field conditions, the T1 plants showed considerable resistance against leaf folders and stem borers. The expression cassette (vip-lox-hpt-lox) as well as another vector with chimeric cre recombinase gene under constitutive rice ubiquitin1 gene promoter was designed for the elimination of selectable marker hygromycin phosphotransferase (hptII) gene. Crossing experiments were performed between T1 plants with single insertion site of vip-lox-hpt-lox T-DNA and one T1 plant with moderate expression of cre recombinase with linked bialaphos resistance (syn bar) gene. Marker gene excision was achieved in hybrids with up to 41.18 % recombination efficiency. Insect resistant transgenic lines, devoid of selectable marker and redundant transgene(s) (hptII + cre-syn bar), were established in subsequent generation through genetic segregation.
Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.
Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui
2018-01-01
The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.
Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System
Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui
2018-01-01
The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 (ie-1) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment. PMID:29503634
Tewari, Rita; Patzewitz, Eva-Maria; Poulin, Benoit; Stewart, Lindsay; Baker, David A
2014-01-01
With the inevitable selection of resistance to antimalarial drugs in treated populations, there is a need for new medicines to enter the clinic and new targets to progress through the drug discovery pipeline. In this study we set out to develop a transgenic rodent model for testing inhibitors of the Plasmodium falciparum cyclic GMP-dependent kinase in vivo. A model was needed that would allow us to investigate whether differences in amino acid sequence of this enzyme between species influences in vivo efficacy. Here we report the successful development of a transgenic P. berghei line in which the cyclic GMP-dependent protein kinase (PKG) was replaced by the P. falciparum orthologue. We demonstrate that the P. falciparum orthologue was able to functionally complement the endogenous P. berghei pkg gene throughout blood stage development and early sexual development. However, subsequent development in the mosquito was severely compromised. We show that this is due to a defect in the female lineage of the transgenic by using genetic crosses with both male and female deficient P. berghei lines. This defect could be due to expression of a female-specific target in the mosquito stages of P. berghei that cannot be phosphorylated by the P. falciparum kinase. Using a previously reported anti-coccidial inhibitor of the cyclic GMP-dependent protein kinase, we show no difference in in vivo efficacy between the transgenic and control P. berghei lines. This in vivo model will be useful for screening future generations of cyclic GMP-dependent protein kinase inhibitors and allowing us to overcome any species-specific differences in the enzyme primary sequence that would influence in vivo efficacy in the rodent model. The approach will also be applicable to in vivo testing of other antimalarial compounds where the target is known.
Gaupp, Stefanie; Arezzo, Joseph; Dutta, Dipankar J.; John, Gareth R.; Raine, Cedric S.
2013-01-01
Central nervous system hypomyelination is a feature common to a number of transgenic (Tg) mouse lines that express a variety of unrelated exogenous (i.e. non-CNS) transgenes. In this report we document hypomyelination structurally by immunocytochemistry and functionally in the Tg line MBP-JE, which overexpresses the chemokine CCL2 (MCP-1) within oligodendrocytes targeted by a myelin basic protein (MBP) promoter. Analysis of hypomyelinated optic nerves of Tg mice revealed progressive decrease in oligodendrocyte numbers with age (p < 0.01). Although molecular mechanisms underlying hypomyelination in this and other Tg models remain largely unknown, we present preliminary findings on oligodendrocyte progenitor cell (OPC) cultures in which, although OPC expressed CCR2, the receptor for CCL2, treatment with CCL2 had no significant effect on OPC proliferation, differentiation or apoptosis. We suggest that hypomyelination in the MBP-JE model might not be due to CCL2 expression but rather the result of transcriptional dysfunction related to random insertion of the MBP promoter that disrupts myelinogenesis and leads to oligodendrocytes demise. Because an MBP promoter is a common denominator in most Tg lines displaying hypomyelination, we hypothesize that use of myelin gene sequences in the regulator region of transgenic constructs might underlie this perturbation of myelination in such models. PMID:22082665
Cheng, Feixiong; Murray, James L; Zhao, Junfei; Sheng, Jinsong; Zhao, Zhongming; Rubin, Donald H
2016-09-01
Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.
Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange
Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.
2014-01-01
RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198
Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip
2017-02-01
Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.
EUVL back-insertion layout optimization
NASA Astrophysics Data System (ADS)
Civay, D.; Laffosse, E.; Chesneau, A.
2018-03-01
Extreme ultraviolet lithography (EUVL) is targeted for front-up insertion at advanced technology nodes but will be evaluated for back insertion at more mature nodes. EUVL can put two or more mask levels back on one mask, depending upon what level(s) in the process insertion occurs. In this paper, layout optimization methods are discussed that can be implemented when EUVL back insertion is implemented. The layout optimizations can be focused on improving yield, reliability or density, depending upon the design needs. The proposed methodology modifies the original two or more colored layers and generates an optimized single color EUVL layout design.
Tong, Qi; Liu, Xu; Su, Feng; Quan, Fusheng; Guo, Zekun; Zhang, Yong
2013-01-01
Antibiotic selectable marker genes have been widely used to generate transgenic animals. Once transgenic animals have been obtained, the selectable marker is no longer necessary but raises public concerns regarding biological safety. The aim of this study was to prepare competent antibiotic selectable marker free transgenic cells for somatic cell nuclear transfer (SCNT). PhiC31 intergrase was used to insert a transgene cassette into a “safe harbor” in the bovine genome. Then, Cre recombinase was employed to excise the selectable marker under the monitoring of a fluorescent double reporter. By visually tracking the phenotypic switch from red to green fluorescence, antibiotic selectable marker free cells were easily detected and sorted by fluorescence-activated cell sorting. For safety, we used phiC31 mRNA and cell-permeant Cre protein in this study. When used as donor nuclei for SCNT, these safe harbor integrated marker-free transgenic cells supported a similar developmental competence of SCNT embryos compared with that of non-transgenic cells. After embryo transfer, antibiotic selectable marker free transgenic cattle were generated and anti-bacterial recombinant human β-defensin-3 in milk was detected during their lactation period. Thus, this approach offers a rapid and safe alternative to produce antibiotic selectable marker free transgenic farm animals, thereby making it a valuable tool to promote the healthy development and welfare of transgenic farm animals. PMID:23658729
Tajima, Shoji; Shinohara, Keiko; Fukumoto, Maiko; Zaitsu, Reiko; Miyagawa, Junichi; Hino, Shinjiro; Fan, Jun; Akasaka, Koji; Matsuoka, Masao
2006-04-01
Sea urchin arylsulfatase (Ars) gene locus has features of an insulator, i.e., blocking of enhancer and promoter interaction, and protection of a transgene against positional effects [Akasaka et al. (1999) Cell. Mol. Biol. 45, 555-565]. To examine the effect of Ars insulator on long-term expression of a transgene, the insulator was inserted into LTR of retrovirus vector harboring hrGFP gene as a reporter, and then introduced into mouse myoblast cells. The isolated clones transduced with the reporter gene with or without Ars insulator were cultured for more than 20 wk in the absence of a selection reagent, and the expression of hrGFP was periodically determined. Expression of hrGFP in four clones transduced with the reporter gene without Ars insulator was completely silenced after 20 wk of culture. On the other hand, hrGFP was expressed in all clones with Ars insulator inserted in one of the two different orientations. Histone H3 deacetylation and DNA methylation of the 5'LTR promoter region, signs for heterochromatin and silencing, were suppressed in the clones that were expressing hrGFP. Ars insulator is effective in maintaining a transgene in mouse cells in an orientation-dependent manner, and will be a useful tool to ensure stable expression of a transgene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat
2012-01-06
Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, wemore » generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.« less
The a“MAZE”ing World of Lung-Specific Transgenic Mice
Rawlins, Emma L.
2012-01-01
The purpose of this review is to give a comprehensive overview of transgenic mouse lines suitable for studying gene function and cellular lineage relationships in lung development, homeostasis, injury, and repair. Many of the mouse strains reviewed in this Perspective have been widely shared within the lung research community, and new strains are continuously being developed. There are many transgenic lines that target subsets of lung cells, but it remains a challenge for investigators to select the correct transgenic modules for their experiment. This review covers the tetracycline- and tamoxifen-inducible systems and focuses on conditional lines that target the epithelial cells. We point out the limitations of each strain so investigators can choose the system that will work best for their scientific question. Current mesenchymal and endothelial lines are limited by the fact that they are not lung specific. These lines are summarized in a brief overview. In addition, useful transgenic reporter mice for studying lineage relationships, promoter activity, and signaling pathways will complete our lung-specific conditional transgenic mouse shopping list. PMID:22180870
Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.
Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves
2003-08-01
A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.
Handmade Cloned Transgenic Piglets Expressing the Nematode Fat-1 Gene
Zhang, Peng; Zhang, Yidi; Dou, Hongwei; Yin, Jingdong; Chen, Yu; Pang, Xinzhi; Vajta, Gabor; Bolund, Lars
2012-01-01
Abstract Production of transgenic animals via somatic cell nuclear transfer (SCNT) has been adapted worldwide, but this application is somewhat limited by its relatively low efficiency. In this study, we used handmade cloning (HMC) established previously to produce transgenic pigs that express the functional nematode fat-1 gene. Codon-optimized mfat-1 was inserted into eukaryotic expression vectors, which were transferred into primary swine donor cells. Reverse transcriptase PCR (RT-PCR), gas chromatography, and chromosome analyses were performed to select donor clones capable of converting n-6 into n-3 fatty acids. Blastocysts derived from the clones that lowered the n-6/n-3 ratio to approximately 1:1 were transferred surgically into the uteri of recipients for transgenic piglets. By HMC, 37% (n=558) of reconstructed embryos developed to the blastocyst stage after 7 days of culture in vitro, with an average cell number of 81±36 (n=14). Three recipients became pregnant after 408 day-6 blastocysts were transferred into four naturally cycling females, and a total of 14 live offspring were produced. The nematode mfat-1 effectively lowered the n-6/n-3 ratio in muscle and major organs of the transgenic pig. Our results will help to establish a reliable procedure and an efficient option in the production of transgenic animals. PMID:22686479
Nguyen, Quynh Anh; Lee, Dae-Seok; Jung, Jakyun; Bae, Hyeun-Jong
2015-01-01
The hyperthermostable β-glucosidase BglB of Thermotoga maritima was modified by adding a short C-terminal tetrapeptide (AFVY, which transports phaseolin to the vacuole, to its C-terminal sequence). The modified β-glucosidase BglB was transformed into tobacco (Nicotiana tabacum L.) plants. We observed a range of significant phenotypic changes in the transgenic plants compared to the wild-type (WT) plants. The transgenic plants had faster stem growth, earlier flowering, enhanced root systems development, an increased biomass biosynthesis rate, and higher salt stress tolerance in young plants compared to WT. In addition, programed cell death was enhanced in mature plants. Furthermore, the C-terminal AFVY tetrapeptide efficiently sorted T. maritima BglB into the vacuole, which was maintained in an active form and could perform its glycoside hydrolysis function on hormone conjugates, leading to elevated hormone [abscisic acid (ABA), indole 3-acetic acid (IAA), and cytokinin] levels that likely contributed to the phenotypic changes in the transgenic plants. The elevation of cytokinin led to upregulation of the transcription factor WUSCHELL, a homeodomain factor that regulates the development, division, and reproduction of stem cells in the shoot apical meristems. Elevation of IAA led to enhanced root development, and the elevation of ABA contributed to enhanced tolerance to salt stress and programed cell death. These results suggest that overexpressing vacuole-targeted T. maritima BglB may have several advantages for molecular farming technology to improve multiple targets, including enhanced production of the β-glucosidase BglB, increased biomass, and shortened developmental stages, that could play pivotal roles in bioenergy and biofuel production.
Single molecule Raman spectroscopic assay to detect transgene from GM plants.
Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph
2017-09-01
Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.
Hajitou, Amin
2010-01-01
Gene therapy and molecular-genetic imaging have faced a major problem: the lack of an efficient systemic gene delivery vector. Unquestionably, eukaryotic viruses have been the vectors of choice for gene delivery to mammalian cells; however, they have had limited success in systemic gene therapy. This is mainly due to undesired uptake by the liver and reticuloendothelial system, broad tropism for mammalian cells causing toxicity, and their immunogenicity. On the other hand, prokaryotic viruses such as bacteriophage (phage) have no tropism for mammalian cells, but can be engineered to deliver genes to these cells. However, phage-based vectors have inherently been considered poor vectors for mammalian cells. We have reported a new generation of vascular-targeted systemic hybrid prokaryotic-eukaryotic vectors as chimeras between an adeno-associated virus (AAV) and targeted bacteriophage (termed AAV/phage; AAVP). In this hybrid vector, the targeted bacteriophage serves as a shuttle to deliver the AAV transgene cassette inserted in an intergenomic region of the phage DNA genome. As a proof of concept, we assessed the in vivo efficacy of vector in animal models of cancer by displaying on the phage capsid the cyclic Arg-Gly-Asp (RGD-4C) ligand that binds to alphav integrin receptors specifically expressed on the angiogenic blood vessels of tumors. The ligand-directed vector was able to specifically deliver imaging and therapeutic transgenes to tumors in mice, rats, and dogs while sparing the normal organs. This chapter reviews some gene transfer strategies and the potential of the vascular-targeted AAVP vector for enhancing the effectiveness of existing systemic gene delivery and genetic-imaging technologies. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Transgenic manipulation of the metabolism of polyamines in poplar cells
Pratiksha Bhatnagar; Bernadette M. Glasheen; Suneet K. Bains; Stephanie L. Long; Rakesh Minocha; Christian Walter; Subhash C. Minocha
2001-01-01
The metabolism of polyamines (putrescine, spermidine, and spermine) has become the target of genetic manipulation because of their significance in plant development and possibly stress tolerance. We studied the polyamine metabolism in non-transgenic (NT) and transgenic cells of poplar (Populus nigra 3 maximowiczii) expressing a...
Radiation arteriopathy in the transgenic arteriovenous fistula model.
Lawton, Michael T; Arnold, Christine M; Kim, Yung J; Bogarin, Ernesto A; Stewart, Campbell L; Wulfstat, Amanda A; Derugin, Nikita; Deen, Dennis; Young, William L
2008-05-01
The transgenic arteriovenous fistula model, surgically constructed with transgenic mouse aorta interposed in common carotid artery-to-external jugular vein fistulae in nude rats, has a 4-month experimental window because patency and transgenic phenotype are lost over time. We adapted this model to investigate occlusive arteriopathy in brain arteriovenous malformations after radiosurgery by radiating grafted aorta before insertion in the fistula. We hypothesized that high-dose radiation would reproduce the arteriopathy observed clinically within the experimental time window and that deletions of endoglin (ENG) and endothelial nitric oxide synthase (eNOS) genes would modify the radiation response. Radiation arteriopathy in the common carotid arteries of 171 wild-type mice was examined with doses of 25, 80, 120, or 200 Gy (Experiment 1). Radiation arteriopathy in 68 wild-type arteriovenous fistulae was examined histologically and morphometrically with preoperative radiation doses of 0, 25, or 200 Gy (Experiment 2). Radiation arteriopathy in 51 transgenic arteriovenous fistulae (36 ENG and 15 eNOS knock-out fistulae) was examined using preoperative radiation doses of 0, 25, or 200 Gy (Experiment 3). High-dose radiation (200 Gy) of mouse common carotid arteries induced only mild arteriopathy (mean score, 0.66) without intimal hyperplasia and with high mortality (68%). Radiation arteriopathy in wild-type arteriovenous fistulae was severe (mean score, 3.5 at 200 Gy), with intimal hyperplasia and medial disruption at 3 months, decreasing luminal areas with increasing dose, and no mortality. Arteriopathy was robust in transgenic arteriovenous fistulae with ENG +/- and with eNOS +/-, with thick intimal hyperplasia in the former and distinct smooth muscle cell proliferation in the latter. The transgenic arteriovenous fistula model can be adapted to rapidly reproduce radiation arteriopathy observed in resected brain arteriovenous malformations after radiosurgery. High
Gavin, W; Blash, S; Buzzell, N; Pollock, D; Chen, L; Hawkins, N; Howe, J; Miner, K; Pollock, J; Porter, C; Schofield, M; Echelard, Y; Meade, H
2018-02-01
Production of transgenic founder goats involves introducing and stably integrating an engineered piece of DNA into the genome of the animal. At LFB USA, the ultimate use of these transgenic goats is for the production of recombinant human protein therapeutics in the milk of these dairy animals. The transgene or construct typically links a milk protein specific promoter sequence, the coding sequence for the gene of interest, and the necessary downstream regulatory sequences thereby directing expression of the recombinant protein in the milk during the lactation period. Over the time period indicated (1995-2012), pronuclear microinjection was used in a number of programs to insert transgenes into 18,120, 1- or 2- cell stage fertilized embryos. These embryos were transferred into 4180 synchronized recipient females with 1934 (47%) recipients becoming pregnant, 2594 offspring generated, and a 109 (4.2%) of those offspring determined to be transgenic. Even with new and improving genome editing tools now available, pronuclear microinjection is still the predominant and proven technology used in this commercial setting supporting regulatory filings and market authorizations when producing founder transgenic animals with large transgenes (> 10 kb) such as those necessary for directing monoclonal antibody production in milk.
Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum
2013-01-01
Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses
Pons, Elsa; Peris, Josep E; Peña, Leandro
2012-07-15
commonly used in citrus transformation were substantially equivalent to the non-transformed controls with regard to their overall agronomic performance, as based on the use of robust and powerful assessment techniques. Therefore, future studies of the possible pleiotropic effects induced by the integration and expression of transgenes in field-grown GM citrus may focus on the newly inserted trait(s) of biotechnological interest.
2012-01-01
selectable marker genes that are most commonly used in citrus transformation were substantially equivalent to the non-transformed controls with regard to their overall agronomic performance, as based on the use of robust and powerful assessment techniques. Therefore, future studies of the possible pleiotropic effects induced by the integration and expression of transgenes in field-grown GM citrus may focus on the newly inserted trait(s) of biotechnological interest. PMID:22794278
Advancing environmental risk assessment for transgenic biofeedstock crops
Wolt, Jeffrey D
2009-01-01
Transgenic modification of plants is a key enabling technology for developing sustainable biofeedstocks for biofuels production. Regulatory decisions and the wider acceptance and development of transgenic biofeedstock crops are considered from the context of science-based risk assessment. The risk assessment paradigm for transgenic biofeedstock crops is fundamentally no different from that of current generation transgenic crops, except that the focus of the assessment must consider the unique attributes of a given biofeedstock crop and its environmental release. For currently envisioned biofeedstock crops, particular emphasis in risk assessment will be given to characterization of altered metabolic profiles and their implications relative to non-target environmental effects and food safety; weediness and invasiveness when plants are modified for abiotic stress tolerance or are domesticated; and aggregate risk when plants are platforms for multi-product production. Robust risk assessments for transgenic biofeedstock crops are case-specific, initiated through problem formulation, and use tiered approaches for risk characterization. PMID:19883509
Nguyen, Quynh Anh; Lee, Dae-Seok; Jung, Jakyun; Bae, Hyeun-Jong
2015-01-01
The hyperthermostable β-glucosidase BglB of Thermotoga maritima was modified by adding a short C-terminal tetrapeptide (AFVY, which transports phaseolin to the vacuole, to its C-terminal sequence). The modified β-glucosidase BglB was transformed into tobacco (Nicotiana tabacum L.) plants. We observed a range of significant phenotypic changes in the transgenic plants compared to the wild-type (WT) plants. The transgenic plants had faster stem growth, earlier flowering, enhanced root systems development, an increased biomass biosynthesis rate, and higher salt stress tolerance in young plants compared to WT. In addition, programed cell death was enhanced in mature plants. Furthermore, the C-terminal AFVY tetrapeptide efficiently sorted T. maritima BglB into the vacuole, which was maintained in an active form and could perform its glycoside hydrolysis function on hormone conjugates, leading to elevated hormone [abscisic acid (ABA), indole 3-acetic acid (IAA), and cytokinin] levels that likely contributed to the phenotypic changes in the transgenic plants. The elevation of cytokinin led to upregulation of the transcription factor WUSCHELL, a homeodomain factor that regulates the development, division, and reproduction of stem cells in the shoot apical meristems. Elevation of IAA led to enhanced root development, and the elevation of ABA contributed to enhanced tolerance to salt stress and programed cell death. These results suggest that overexpressing vacuole-targeted T. maritima BglB may have several advantages for molecular farming technology to improve multiple targets, including enhanced production of the β-glucosidase BglB, increased biomass, and shortened developmental stages, that could play pivotal roles in bioenergy and biofuel production. PMID:26618153
Hook, Ch D; Samsonov, V V; Ublinskaya, A A; Kuvaeva, T M; Andreeva, E V; Gorbacheva, L Yu; Stoynova, N V
2016-11-01
Despite the abundance of genetic manipulation approaches, particularly for Escherichia coli, new techniques and increased flexibility in the application of existing techniques are required to address novel aims. The most widely used approaches for chromosome editing are based on bacteriophage site-specific and λRed/RecET-mediated homologous recombination. In the present study, these techniques were combined to develop a novel approach for in vivo cloning and targeted long-length chromosomal insertion. This approach permits direct λRed-mediated cloning of DNA fragment with lengths of 10kb or greater from the E. coli chromosome into the plasmid vector pGL2, which carries the ori of pSC101, the ϕ80-attP site of ϕ80 phage, and an excisable Cm R marker bracketed by λ-attL/attR sites. In pGL2-based recombinant plasmids, the origin of replication can be eliminated in vitro via hydrolysis by SceI endonuclease and recircularization by DNA ligase. The resulting ori-less circular recombinant DNA can be used for targeted insertion of the cloned sequence into the chromosome at a selected site via ϕ80 phage-specific integrase-mediated recombination using the Dual-In/Out approach (Minaeva et al., 2008). At the final stage of chromosomal editing, the Cm R -marker can be excised from the chromosome due to expression of the λint/xis genes. Notably, the desired fragment can be inserted as multiple copies in the chromosome by combining insertions at different sites in one strain using the P1 general transduction technique (Moore, 2011). The developed approach is useful for the construction of plasmidless, markerless recombinant strains for fundamental and industrial purposes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Watakabe, Ikuko; Hashimoto, Hisashi; Kimura, Yukiko; Yokoi, Saori; Naruse, Kiyoshi; Higashijima, Shin-Ichi
2018-01-01
Medaka ( Oryzias latipes ) is a popular animal model used in vertebrate genetic analysis. Recently, an efficient (~ 30%) knock-in system via non-homologous end joining (NHEJ) was established in zebrafish using the CRISPR/Cas9 system. If the same technique were applicable in medaka, it would greatly expand the usefulness of this model organism. The question of the applicability of CRISPR/Cas9 in medaka, however, has yet to be addressed. We report the highly efficient generation of knock-in transgenic medaka via non-homologous end joining (NHEJ). Donor plasmid containing a heat-shock promoter and a reporter gene was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, an sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. Broad transgene expression in the expression domain of a target gene was observed in approximately 25% of injected embryos. By raising these animals, we established stable knock-in transgenic fish with several different constructs for five genetic loci, obtaining transgenic founders at efficiencies of > 50% for all five loci. Further, we show that the method is useful for obtaining mutant alleles. In the experiments where transgene integrations were targeted between the transcription start site and the initiation methionine, the resultant transgenic fish became mutant alleles. With its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in via NHEJ will become a standard method for the generation of transgenic and mutant medaka.
Transgenic oil palm: production and projection.
Parveez, G K; Masri, M M; Zainal, A; Majid, N A; Yunus, A M; Fadilah, H H; Rasid, O; Cheah, S C
2000-12-01
Oil palm is an important economic crop for Malaysia. Genetic engineering could be applied to produce transgenic oil palms with high value-added fatty acids and novel products to ensure the sustainability of the palm oil industry. Establishment of a reliable transformation and regeneration system is essential for genetic engineering. Biolistic was initially chosen as the method for oil palm transformation as it has been the most successful method for monocotyledons to date. Optimization of physical and biological parameters, including testing of promoters and selective agents, was carried out as a prerequisite for stable transformation. This has resulted in the successful transfer of reporter genes into oil palm and the regeneration of transgenic oil palm, thus making it possible to improve the oil palm through genetic engineering. Besides application of the Biolistics method, studies on transformation mediated by Agrobacterium and utilization of the green fluorescent protein gene as a selectable marker gene have been initiated. Upon the development of a reliable transformation system, a number of useful targets are being projected for oil palm improvement. Among these targets are high-oleate and high-stearate oils, and the production of industrial feedstock such as biodegradable plastics. The efforts in oil palm genetic engineering are thus not targeted as commodity palm oil. Due to the long life cycle of the palm and the time taken to regenerate plants in tissue culture, it is envisaged that commercial planting of transgenic palms will not occur any earlier than the year 2020.
Drought stress-induced compositional changes in tolerant transgenic rice and its wild type.
Nam, Kyong-Hee; Kim, Do-Young; Shin, Hee Jae; Nam, Ki Jung; An, Joo Hee; Pack, In-Soon; Park, Jung-Ho; Jeong, Soon-Chun; Kim, Ho Bang; Kim, Chang-Gi
2014-06-15
Comparing well-watered versus deficit conditions, we evaluated the chemical composition of grains harvested from wild-type (WT) and drought-tolerant, transgenic rice (Oryza sativa L.). The latter had been developed by inserting AtCYP78A7, which encodes a cytochrome P450 protein. Two transgenic Lines, '10B-5' and '18A-4', and the 'Hwayoung' WT were grown under a rainout shelter. After the harvested grains were polished, their levels of key components, including proximates, amino acids, fatty acids, minerals and vitamins were analysed to determine the effect of watering system and genotype. Drought treatment significantly influenced the levels of some nutritional components in both transgenic and WT grains. In particular, the amounts of lignoceric acid and copper in the WT decreased by 12.6% and 39.5%, respectively, by drought stress, whereas those of copper and potassium in the transgenics rose by 88.1-113.3% and 10.4-11.9%, respectively, under water-deficit conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.
A double built-in containment strategy for production of recombinant proteins in transgenic rice.
Zhang, Xianwen; Wang, Dongfang; Zhao, Sinan; Shen, Zhicheng
2014-01-01
Using transgenic rice as a bioreactor for mass production of pharmaceutical proteins could potentially reduce the cost of production significantly. However, a major concern over the bioreactor transgenic rice is the risk of its unintended spreading into environment and into food or feed supplies. Here we report a mitigating method to prevent unwanted transgenic rice spreading by a double built-in containment strategy, which sets a selectively termination method and a visual tag technology in the T-DNA for transformation. We created transgenic rice with an inserted T-DNA that harbors a human proinsulin gene fused with the far-red fluorescent protein gene mKate_S158A, an RNAi cassette suppressing the expression of the rice bentazon detoxification enzyme CYP81A6, and an EPSPS gene as the selection marker for transformation. Herbicide spray tests indicated that such transgenic rice plants can be killed selectively by a spray of bentazon at regular field application dosage for rice weed control. Moreover, the transgenic rice seeds were bright red in color due to the fused far-red fluorescent protein, and could be easily visualized under daylight by naked eyes. Thus, the transgenic rice plants reported in this study could be selectively killed by a commonly used herbicide during their growth stage, and their seeds may be detected visually during processing and consumption after harvest. This double built-in containment strategy may greatly enhance the confinement of the transgenic rice.
Yum, Soo-Young; Lee, Song-Jeon; Park, Sin-Gi; Shin, In-Gang; Hahn, Sang-Eun; Choi, Woo-Jae; Kim, Hee-Soo; Kim, Hyeong-Jong; Bae, Seong-Hun; Lee, Je-Hyeong; Moon, Joo-Yeong; Lee, Woo-Sung; Lee, Ji-Hyun; Lee, Choong-Il; Kim, Seong-Jin; Jang, Goo
2018-05-23
Transposon-mediated, non-viral gene delivery is a powerful tool for generating stable cell lines and transgenic animals. However, as multi-copy insertion is the preferred integration pattern, there is the potential for uncontrolled changes in endogenous gene expression and detrimental effects in cells or animals. Our group has previously reported on the generation of several transgenic cattle by using microinjection of the Sleeping Beauty (SB) and PiggyBac (PB) transposons and seeks to explore the long-term effects of this technology on cattle. Transgenic cattle, one female (SNU-SB-1) and one male (SNU-PB-1), reached over 36 months of age with no significant health issues and normal blood parameters. The detection of transgene integration and fluorescent signal in oocytes and sperm suggested the capacity for germline transmission in both of the founder animals. After natural breeding, the founder transgenic cow delivered a male calf and secreted milk containing fluorescent transgenic proteins. The calf expressed green fluorescent protein in primary cells from ear skin, with no significant change in overall genomic stability and blood parameters. Three sites of transgene integration were identified by next-generation sequencing of the calf's genome. Overall, these data demonstrate that transposon-mediated transgenesis can be applied to cattle without being detrimental to their long-term genomic stability or general health. We further suggest that this technology may be usefully applied in other fields, such as the generation of transgenic animal models.
MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression
Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil
2012-01-01
Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors
Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos
2014-01-01
Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631
Liu, Tongxin; Wu, Hanyu; Cao, Dainan; Li, Qingyuan; Zhang, Yaqiong; Li, Ning; Hu, Xiaoxiang
2015-01-01
The expression of oviduct-specific recombinant proteins in transgenic chickens is a promising technology for the production of therapeutic biologics in eggs. In this study, we constructed a lentiviral vector encoding an expression cassette for human neutrophil defensin 4 (HNP4), a compound that displays high activity against Escherichia coli, and produced transgenic chickens that expressed the recombinant HNP4 protein in egg whites. After the antimicrobial activity of the recombinant HNP4 protein was tested at the cellular level, a 2.8-kb ovalbumin promoter was used to drive HNP4 expression specifically in oviduct tissues. From 669 injected eggs, 218 chickens were successfully hatched. Ten G0 roosters, with semens identified as positive for the transgene, were mated with wild-type hens to generate G1 chickens. From 1,274 total offspring, fifteen G1 transgenic chickens were positive for the transgene, which was confirmed by PCR and Southern blotting. The results of the Southern blotting and genome walking indicated that a single copy of the HNP4 gene was integrated into chromosomes 1, 2, 3, 4, 6 and 24 of the chickens. As expected, HNP4 expression was restricted to the oviduct tissues, and the levels of both transcriptional and translational HNP4 expression varied greatly in transgenic chickens with different transgene insertion sites. The amount of HNP4 protein expressed in the eggs of G1 and G2 heterozygous transgenic chickens ranged from 1.65 μg/ml to 10.18 μg/ml. These results indicated that the production of transgenic chickens that expressed HNP4 protein in egg whites was successful. PMID:26020529
Handmade Cloned Transgenic Sheep Rich in Omega-3 Fatty Acids
Dou, Hongwei; Chen, Lei; Chen, Longxin; Lin, Lin; Tan, Pingping; Vajta, Gabor; Gao, Jianfeng; Du, Yutao; Ma, Runlin Z.
2013-01-01
Technology of somatic cell nuclear transfer (SCNT) has been adapted worldwide to generate transgenic animals, although the traditional procedure relies largely on instrumental micromanipulation. In this study, we used the modified handmade cloning (HMC) established in cattle and pig to produce transgenic sheep with elevated levels of omega-3 (n−3) fatty acids. Codon-optimized nematode mfat-1 was inserted into a eukaryotic expression vector and was transferred into the genome of primary ovine fibroblast cells from a male Chinese merino sheep. Reverse transcriptase PCR, gas chromatography, and chromosome analyses were performed to select nuclear donor cells capable of converting omega-6 (n−6) into n−3 fatty acids. Blastocysts developed after 7 days of in vitro culture were surgically transplanted into the uterus of female ovine recipients of a local sheep breed in Xinjiang. For the HMC, approximately 8.9% (n = 925) of reconstructed embryos developed to the blastocyst stage. Four recipients became pregnant after 53 blastocysts were transplanted into 29 naturally cycling females, and a total of 3 live transgenic lambs were produced. Detailed analyses on one of the transgenic lambs revealed a single integration of the modified nematode mfat-1 gene at sheep chromosome 5. The transgenic sheep expressed functional n−3 fatty acid desaturase, accompanied by more than 2-folds reduction of n−6/n−3 ratio in the muscle (p<0.01) and other major organs/tissues (p<0.05). To our knowledge, this is the first report of transgenic sheep produced by the HMC. Compared to the traditional SCNT method, HMC showed an equivalent efficiency but proved cheaper and easier in operation. PMID:23437077
Batista, Rita; Martins, Isabel; Jeno, Paul; Ricardo, Cândido Pinto; Oliveira, Maria Margarida
2007-01-01
In spite of being among the main foods responsible for allergic reactions worldwide, soybean (Glycine max)-derived products continue to be increasingly widespread in a variety of food products due to their well-documented health benefits. Soybean also continues to be one of the elected target crops for genetic modification. The aim of this study was to characterize the soya proteome and, specifically, IgE-reactive proteins as well as to compare the IgE response in soya-allergic individuals to genetically modified Roundup Ready soya versus its non-transgenic control. We performed two-dimensional gel electrophoresis of protein extracts from a 5% genetically modified Roundup Ready flour sample and its non-transgenic control followed by Western blotting with plasma from 5 soya-sensitive individuals. We used peptide tandem mass spectrometry to identify soya proteins (55 protein matches), specifically IgE-binding ones, and to evaluate differences between transgenic and non-transgenic samples. We identified 2 new potential soybean allergens--one is maturation associated and seems to be part of the late embryogenesis abundant proteins group and the other is a cysteine proteinase inhibitor. None of the individuals tested reacted differentially to the transgenic versus non-transgenic samples under study. Soybean endogenous allergen expression does not seem to be altered after genetic modification. Proteomics should be considered a powerful tool for functional characterization of plants and for food safety assessment. Copyright (c) 2007 S. Karger AG, Basel.
Freiman, Aviad; Shlizerman, Lyudmila; Golobovitch, Sara; Yablovitz, Zeev; Korchinsky, Raia; Cohen, Yuval; Samach, Alon; Chevreau, Elisabeth; Le Roux, Pierre-Marie; Patocchi, Andrea; Flaishman, Moshe A
2012-06-01
Trees require a long maturation period, known as juvenile phase, before they can reproduce, complicating their genetic improvement as compared to annual plants. 'Spadona', one of the most important European pear (Pyrus communis L.) cultivars grown in Israel, has a very long juvenile period, up to 14 years, making breeding programs extremely slow. Progress in understanding the molecular basis of the transition to flowering has revealed genes that accelerate reproductive development when ectopically expressed in transgenic plants. A transgenic line of 'Spadona', named Early Flowering-Spadona (EF-Spa), was produced using a MdTFL1 RNAi cassette targeting the native pear genes PcTFL1-1 and PcTFL1-2. The transgenic line had three T-DNA insertions, one assigned to chromosome 2 and two to chromosome 14 PcTFL1-1 and PcTFL1-2 were completely silenced, and EF-Spa displayed an early flowering phenotype: flowers developed already in tissue culture and on most rooted plants 1-8 months after transfer to the greenhouse. EF-Spa developed solitary flowers from apical or lateral buds, reducing vegetative growth vigor. Pollination of EF-Spa trees generated normal-shaped fruits with viable F1 seeds. The greenhouse-grown transgenic F1 seedlings formed shoots and produced flowers 1-33 months after germination. Sequence analyses, of the non-transgenic F1 seedlings, demonstrated that this approach can be used to recover seedlings that have no trace of the T-DNA. Thus, the early flowering transgenic line EF-Spa obtained by PcTFL1 silencing provides an interesting tool to accelerate pear breeding.
MRE11 and RAD50, but not NBS1, are essential for gene targeting in the moss Physcomitrella patens.
Kamisugi, Yasuko; Schaefer, Didier G; Kozak, Jaroslav; Charlot, Florence; Vrielynck, Nathalie; Holá, Marcela; Angelis, Karel J; Cuming, Andrew C; Nogué, Fabien
2012-04-01
The moss Physcomitrella patens is unique among plant models for the high frequency with which targeted transgene insertion occurs via homologous recombination. Transgene integration is believed to utilize existing machinery for the detection and repair of DNA double-strand breaks (DSBs). We undertook targeted knockout of the Physcomitrella genes encoding components of the principal sensor of DNA DSBs, the MRN complex. Loss of function of PpMRE11 or PpRAD50 strongly and specifically inhibited gene targeting, whilst rates of untargeted transgene integration were relatively unaffected. In contrast, disruption of the PpNBS1 gene retained the wild-type capacity to integrate transforming DNA efficiently at homologous loci. Analysis of the kinetics of DNA-DSB repair in wild-type and mutant plants by single-nucleus agarose gel electrophoresis revealed that bleomycin-induced fragmentation of genomic DNA was repaired at approximately equal rates in each genotype, although both the Ppmre11 and Pprad50 mutants exhibited severely restricted growth and development and enhanced sensitivity to UV-B and bleomycin-induced DNA damage, compared with wild-type and Ppnbs1 plants. This implies that while extensive DNA repair can occur in the absence of a functional MRN complex; this is unsupervised in nature and results in the accumulation of deleterious mutations incompatible with normal growth and development.
MRE11 and RAD50, but not NBS1, are essential for gene targeting in the moss Physcomitrella patens
Kamisugi, Yasuko; Schaefer, Didier G.; Kozak, Jaroslav; Charlot, Florence; Vrielynck, Nathalie; Holá, Marcela; Angelis, Karel J.; Cuming, Andrew C.; Nogué, Fabien
2012-01-01
The moss Physcomitrella patens is unique among plant models for the high frequency with which targeted transgene insertion occurs via homologous recombination. Transgene integration is believed to utilize existing machinery for the detection and repair of DNA double-strand breaks (DSBs). We undertook targeted knockout of the Physcomitrella genes encoding components of the principal sensor of DNA DSBs, the MRN complex. Loss of function of PpMRE11 or PpRAD50 strongly and specifically inhibited gene targeting, whilst rates of untargeted transgene integration were relatively unaffected. In contrast, disruption of the PpNBS1 gene retained the wild-type capacity to integrate transforming DNA efficiently at homologous loci. Analysis of the kinetics of DNA-DSB repair in wild-type and mutant plants by single-nucleus agarose gel electrophoresis revealed that bleomycin-induced fragmentation of genomic DNA was repaired at approximately equal rates in each genotype, although both the Ppmre11 and Pprad50 mutants exhibited severely restricted growth and development and enhanced sensitivity to UV-B and bleomycin-induced DNA damage, compared with wild-type and Ppnbs1 plants. This implies that while extensive DNA repair can occur in the absence of a functional MRN complex; this is unsupervised in nature and results in the accumulation of deleterious mutations incompatible with normal growth and development. PMID:22210882
Lu, Yong Qing; Dai, Yang; Yu, Xiu Ying; Yu, Fu-Lan; Jiang, Shou Lin; Zhou, Zong Yuan; Chen, Fa Jun
2018-02-01
In recent years, the two issues of climate change including elevated CO 2 etc., and resistance of transgenic Bt crops against non-target insect pests have received widespread attention. Elevated CO 2 can affect the herbivorous insects. To date, there is no consensus about the effect of elevated CO 2 on the suck-feeding insect pests (non-target insect pests of transgenic Bt crops). Its effects on the suck-feeding behavior have rarely been reported. In this study, CO 2 levels were set up in artificial climate chamber to examined the effects of ambient (400 μL·L -1 ) and double-ambient (800 μL·L -1 ) CO 2 levels on the suck-feeding behavior, growth, development, and reproduction of the non-target insect pest of transgenic Bt rice, brown planthopper, Nilaparvata lugens. The results showed that CO 2 level significantly affected the egg and nymph duration, longevity and body mass of adults, and feeding behavior of the 4th and 5th instar nymphs, while had no effect on the fecundity of N. lugens. The duration of eggs and nymphs, and the longevity of female adults were significantly shortened by 4.0%, 4.2% and 6.6% respectively, the proportion of the macropterous adults was significantly increased by 11.6%, and the body mass of newly hatched female adults was significantly decreased by 2.2% by elevated CO 2 . In addition, elevated CO 2 significantly enhanced the stylet puncturing efficiency of the 4th and 5th instar nymphs of N. lugens. The duration ofphloem ingestion of the N4b waveform was significantly prolonged by 60.0% and 50.1%, and the frequency significantly was increased by 230.0% and 155.9% for the 4th and 5th instar nymphs of N. lugens by elevated CO 2 , respectively. It was concluded that double-ambient CO 2 could promote the growth and development of N. lugens through enhancing its suck-feeding, shorten the generation life-span and increase the macropertous adults' proportion of N. lugens. Thus, it could result in the occurrence of non-target rice
Alves, Victor Michelon; Hernández, Malva Isabel Medina
2017-01-01
The effects of transgenic compounds on non-target organisms remain poorly understood, especially in native insect species. Morphological changes (e.g., changes in body size and shape) may reflect possible responses to environmental stressors, like transgenic toxins. The dung beetle Canthon quinquemaculatus (Coleoptera: Scarabaeinae) is a non-target species found in transgenic crops. We evaluated whether C. quinquemaculatus individuals inhabiting corn fields cultivated with different seed types (conventional, creole and transgenic) present modifications in body shape compared to individuals inhabiting adjacent native forest fragments. We collected C. quinquemaculatus specimens across an agricultural landscape in southern Brazil, during the summer of 2015. Six populations were sampled: three maize crop populations each under a different seed type, and three populations of adjacent forests. After sampling, specimens were subjected to morphometric analyses to discover differences in body shape. We chose fifteen landmarks to describe body shape, and morphometric data were tested with Procrustes ANOVA and Discriminant Analysis. We found that body shape did not differ between individuals collected in conventional and creole crops with their respective adjacent forests (p > 0.05); however, transgenic crop populations differed significantly from those collected in adjacent forests (p < 0.05). Insects in transgenic maize are more oval and have a retraction in the abdominal region, compared with the respective adjacent forest, this result shows the possible effect of transgenic crops on non-target species. This may have implications for the ecosystem service of organic matter removal, carried out by these organisms. PMID:29065452
Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P
2017-10-01
A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.
Designer proton-channel transgenic algae for photobiological hydrogen production
Lee, James Weifu [Knoxville, TN
2011-04-26
A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.
How well will stacked transgenic pest/herbicide resistances delay pests from evolving resistance?
Gressel, Jonathan; Gassmann, Aaron J; Owen, Micheal Dk
2017-01-01
Resistance has evolved to single transgenic traits engineered into crops for arthropod and herbicide resistances, and can be expected to evolve to the more recently introduced pathogen resistances. Combining transgenes against the same target pest is being promoted as the solution to the problem. This solution will work if used pre-emptively, but where resistance has evolved to one member of a stack, resistance should easily evolve for the second gene in most cases. We propose and elaborate criteria that could be used to evaluate the value of stacked traits for pest resistance management. Stacked partners must: target the same pest species; be in a tandem construct to preclude segregation; be synchronously expressed in the same tissues; have similar tissue persistence; target pest species that are still susceptible to at least two stacked partners. Additionally, transgene products must not be degraded in the same manner, and there should be a lack of cross-resistance to stacked transgenes or to their products. With stacked herbicide resistance transgenes, both herbicides must be used and have the same persistence. If these criteria are followed, and integrated with other pest management practices, resistance may be considerably delayed. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Sexually mature transgenic American chestnut trees via embryogenic suspension-based transformation.
Andrade, Gisele M; Nairn, Campbell J; Le, Huong T; Merkle, Scott A
2009-09-01
The availability of a system for direct transfer of anti-fungal candidate genes into American chestnut (Castanea dentata), devastated by a fungal blight in the last century, would offer an alternative or supplemental approach to conventional breeding for production of chestnut trees resistant to the blight fungus and other pathogens. By taking advantage of the strong ability of embryogenic American chestnut cultures to proliferate in suspension, a high-throughput Agrobacterium tumefaciens-mediated transformation protocol for stable integration of foreign genes into the tree was established. Proembryogenic masses (PEMs) were co-cultivated with A. tumefaciens strain AGL1 harboring the plasmid pCAMBIA 2301, followed by stringent selection with 50 or 100 mg/l Geneticin. A protocol employing size-fractionation to enrich for small PEMs to use as target material and selection in suspension culture was applied to rapidly produce transgenic events with an average efficiency of four independent transformation events per 50 mg of target tissue and minimal escapes. Mature somatic embryos, representing 18 transgenic events and derived from multiple American chestnut target genotypes, were germinated and over 100 transgenic somatic seedlings were produced and acclimatized to greenhouse conditions. Multiple vigorous transgenic somatic seedlings produced functional staminate flowers within 3 years following regeneration.
Enhanced resistance to citrus canker in transgenic mandarin expressing Xa21 from rice.
Omar, Ahmad A; Murata, Mayara M; El-Shamy, Hesham A; Graham, James H; Grosser, Jude W
2018-04-01
Genetic engineering approaches offer an alternative method to the conventional breeding of Citrus sp. 'W. Murcott' mandarin (a hybrid of 'Murcott' and an unknown pollen parent) is one of the most commercially important cultivars grown in many regions around the world. Transformation of 'W. Murcott' mandarin was achieved by direct DNA uptake using a protoplast transformation system. DNA construct (pAO3), encoding Green Fluorescent Protein (GFP) and the cDNA of Xa21, a Xanthomonas resistance gene from rice, was used to transform protoplasts of 'W. Murcott' mandarin. Following citrus protoplast culture and regeneration, transformed micro calli were microscopically designated via GFP expression, physically isolated from non-transformed tissue, and cultured on somatic embryogenesis induction medium. More than 150 transgenic embryos were recovered and from them, ten transgenic lines were regenerated and cultured on rooting medium for shoot elongation. Transgenic shoots were micrografted and established in the greenhouse with 3-5 replicates per line. The insertion of Xa21 and GFP was confirmed by PCR and southern blot analysis. GFP expression was verified by fluorescence microscopy and western blot analysis revealed expression of Xa21 although it was variable among transgenic lines, as shown by RT-qPCR. Transgenic plants challenged with the citrus canker pathogen by syringe inoculation showed a reduction in lesion number and bacterial populations within lesions compared to non-transgenic control plants. Transgenic 'W. Murcott' mandarin lines with improved canker resistance via protoplast transformation from embryogenic callus with the Xa21 gene from rice are being evaluated under field conditions to validate the level of resistance.
Bitrophic and tritrophic effects of Bt Cry3A transgenic potato on beneficial, non-target, beetles.
Ferry, Natalie; Mulligan, Evan A; Majerus, Michael E N; Gatehouse, Angharad M R
2007-12-01
Insect-resistant transgenic plants have been suggested to have unpredictable effects on the biodiversity of the agro-ecosystem, including potential effects on insect natural enemies, beneficial in control of crop pests. Whilst carnivorous as adults, many of these predators may also consume plant tissues, in particular plant pollen and nectar. Coleoptera are important in terms of agro-ecological research not only because of the large number of species in this order, but also because of their role as biological control agents. Thus any detrimental impact on this group of insects would be highly undesirable. The effects of potato expressing the coleopteran-specific Bacillus thuringiensis delta-endotoxin Cry3A (Bt Cry3A) on the ladybird beetle Harmonia axyridis and the carabid beetle Nebria brevicollis were investigated via the bitrophic interaction of the adult ladybird with potato flowers and the tritrophic interaction of the carabid consuming a non-target potato pest. Immunoassays confirmed accumulation of the transgene product in potato leaves and floral tissues (at levels of up to 0.01% (pollen) and 0.0285% (anthers) of total soluble protein). Despite H. axyridis and N. brevicollis belonging to the targeted insect order, no significant effects upon survival or overall body mass change of either beetle were observed. Furthermore, Bt Cry3A had no detrimental effects on reproductive fitness of either beetle species, either in terms of fecundity or subsequent egg viability. Behavioural analysis revealed no significant impact of Bt Cry3A on beetle activity or locomoter behaviour. Ligand blots indicate that this is due to either the absence of Bt-binding sites in brush border membrane vesicles (BBMV) isolated from Nebria brevicollis, or in the case of Harmonia axyridis, the binding did not functionally lead to behavioural or physical effects.
Metabolic changes in transgenic maize mature seeds over-expressing the Aspergillus niger phyA2.
Rao, Jun; Yang, Litao; Guo, Jinchao; Quan, Sheng; Chen, Guihua; Zhao, Xiangxiang; Zhang, Dabing; Shi, Jianxin
2016-02-01
Non-targeted metabolomics analysis revealed only intended metabolic changes in transgenic maize over-expressing the Aspergillus niger phyA2. Genetically modified (GM) crops account for a large proportion of modern agriculture worldwide, raising increasingly the public concerns of safety. Generally, according to substantial equivalence principle, if a GM crop is demonstrated to be equivalently safe to its conventional species, it is supposed to be safe. In this study, taking the advantage of an established non-target metabolomic profiling platform based on the combination of UPLC-MS/MS with GC-MS, we compared the mature seed metabolic changes in transgenic maize over-expressing the Aspergillus niger phyA2 with its non-transgenic counterpart and other 14 conventional maize lines. In total, levels of nine out of identified 210 metabolites were significantly changed in transgenic maize as compared with its non-transgenic counterpart, and the number of significantly altered metabolites was reduced to only four when the natural variations were taken into consideration. Notably, those four metabolites were all associated with targeted engineering pathway. Our results indicated that although both intended and non-intended metabolic changes occurred in the mature seeds of this GM maize event, only intended metabolic pathway was found to be out of the range of the natural metabolic variation in the metabolome of the transgenic maize. Therefore, only when natural metabolic variation was taken into account, could non-targeted metabolomics provide reliable objective compositional substantial equivalence analysis on GM crops.
Compositions and methods relating to transgenic plants and cellulosic ethanol production
Tien, Ming [State College, PA; Carlson, John [Port Matilda, PA; Liang, Haiying [Clemson, SC
2012-04-24
Transgenic lignocellulosic plants are provided according to embodiments of the present invention, the transgenic plants transformed with an expression cassette encoding a protein operably linked to a signal peptide which targets the protein to a cell wall of the transgenic plant, where at least 5% of the total amino acid residues of the protein are tyrosine, lysine, serine, threonine or cysteine. Methods of increasing lignin-protein bonds in a lignocellulosic plant are provided according to embodiments of the present invention which include expressing a recombinant nucleic acid in a lignocellulosic plant, the recombinant nucleic acid encoding a protein operably linked to a signal peptide which targets the protein to the cell wall of a plant, where at least 5% of the total amino acid residues of the protein are tyrosine, lysine, serine, threonine or cysteine.
Ravelonandro, M; Scorza, R; Callahan, A; Levy, L; Jacquet, C; Monsion, M; Damsteegt, V
2000-11-01
Sharka or plum pox, caused by Plum pox virus (PPV: genus Potyvirus; Family Potyviridae), is the most serious disease of Prunus. Most cultivated Prunus species are highly susceptible and conventional breeding has not produced highly resistant and commercially acceptable varieties. Success in developing virus-resistant herbaceous crops through genetic engineering led us to investigate this approach for resistance to PPV. Our programme aims to develop a biotechnological approach to PPV control that is effective and shown to be environmentally safe. The programme began with the cloning of the PPV coat protein (CP) gene and the development of a transformation system for plum (Prunus domestica). The CP construct was first tested in Nicotiana benthamiana in which it proved effective in producing transgenic plants with varying levels of CP expression. Some of these plants, particularly low PPV CP expressers, were resistant to PPV, or recovered from initial infection. Based on these results plum was transformed using the Agrobacterium tumefaciens system and both low and high PPV CP-expressing transgenic plum lines were obtained. These were inoculated with PPV by bud grafts in the greenhouse. Line C-5 proved to be highly resistant. It contained multiple copies of the insert, produced low levels of PPV CP mRNA, no detectable CP and the insert appeared to be methylated. These characteristics all suggest that the resistance of the C-5 clone is based on post-transcriptional gene silencing (PTGS). Field tests of C-5 and other transgenic lines in Poland, Romania and Spain have demonstrated that such trees when inoculated by bud-grafts allow a low level of PPV multiplication, from which they rapidly recover. C-5 plants exposed to natural infection for 3 years did not become infected, whereas control trees were infected in the first year. Hybrid plums having the C-5 PPV CP insert inherited from C-5 are virus-resistant, demonstrating the usefulness of C-5 as a parent in developing
Osteogenic capacity of transgenic flax scaffolds.
Gredes, Tomasz; Wróbel-Kwiatkowska, Magdalena; Dominiak, Marzena; Gedrange, Tomasz; Kunert-Keil, Christiane
2012-01-19
The modification of flax fibers to create biologically active dressings is of undoubted scientific and practical interest. Flax fibers, derived from transgenic flax expressing three bacterial genes for the synthesis of poly-3-hydroxybutyric acid (PHB), have better mechanical properties than unmodified flax fibers; do not show any inflammation response after subcutaneous insertion; and have a good in vitro and in vivo biocompatibility. The aim of this study was to examine the applicability of composites containing flax fibers of genetically modified (M50) or non-modified (wt-Nike) flax within a polylactide (PLA) matrix for bone regeneration. For this, the mRNA expression of genes coding for growth factors (insulin-like growth factor IGF1, IGF2, vascular endothelial growth factor), for osteogenic differentiation (alkaline phosphatase, osteocalcin, Runx2, Phex, type 1 and type 2 collagen), and for bone resorption markers [matrix metalloproteinase 8 (MMP8), acid phosphatase type 5] were analyzed using quantitative real-time polymerase chain reaction. We found a significant elevated mRNA expression of IGF1 with PLA and PLA-wt-Nike composites. The mRNA amount of MMP8 and osteocalcin was significantly decreased in all biocomposite-treated cranial tissue samples compared to controls, whereas the expression of all other tested transcripts did not show any differences. It is assumed that both flax composites are able to stimulate bone regeneration, but composites from transgenic flax plants producing PHB showed faster bone regeneration than composites of non-transgenic flax plants. The application of these linen membranes for bone tissue engineering should be proved in further studies.
Troy, Tammy-Claire; Turksen, Kursad
2007-06-01
Skin is one of the largest organs of the body, and is formed during development through a highly orchestrated process involving mesenchymal-epithelial interactions, cell commitment, and terminal differentiation. It protects against microorganism invasion and UV irradiation, inhibits water loss, regulates body temperature, and is an important part of the immune system. Using transgenic mouse technology, we have demonstrated that Claudin (Cldn)-containing tight junctions (TJs) are intricately involved in cell signaling during epidermal differentiation and that an epidermal suprabasal overexpression of Cldn6 results in a perturbed epidermal terminal differentiation program with distinct phenotypic abnormalities. To delineate the role of the Cldn cytoplasmic tail domain in epidermal differentiation, we engineered transgenic mice targeting the overexpression of a Cldn6 cytoplasmic tail-truncation mutant in the epidermis. Transgenic mice were characterized by a lethal barrier dysfunction in addition to the existence of hyperproliferative squamous invaginations/cysts replacing hair follicles. Immunohistochemical analysis revealed an epidermal cytoplasmic accumulation of Cldn6, Cldn11, Cldn12, and Cldn18, downregulation of Cldn1 and aberrant expression of various classical markers of epidermal differentiation; namely the basal keratins as well as K1, involucrin, loricrin, and filaggrin. Collectively these studies suggest an important role for Cldns in epidermal/hair follicle differentiation programs likely involving cross talk to signaling pathways (e.g., Notch) directing cell fate selection and differentiation.
Kumar, S; Arul, L; Talwar, D
2010-01-01
We report on generation of marker-free (‘clean DNA’) transgenic rice (Oryza sativa), carrying minimal gene-expression-cassettes of the genes of interest, and evaluation of its resistance to yellow stem borer Scirpophaga incertulas (Lepidoptera: Pyralidae). The transgenic indica rice harbours a translational fusion of 2 different Bacillus thuringiensis (Bt) genes, namely cry1B-1Aa, driven by the green-tissue-specific phosphoenol pyruvate carboxylase (PEPC) promoter. Mature seed-derived calli of an elite indica rice cultivar Pusa Basmati-1 were co-bombarded with gene-expression-cassettes (clean DNA fragments) of the Bt gene and the marker hpt gene, to generate marker-free transgenic rice plants. The clean DNA fragments for bombardment were obtained by restriction digestion and gel extraction. Through biolistic transformation, 67 independent transformants were generated. Transformation frequency reached 3.3%, and 81% of the transgenic plants were co-transformants. Stable integration of the Bt gene was confirmed, and the insert copy number was determined by Southern analysis. Western analysis and ELISA revealed a high level of Bt protein expression in transgenic plants. Progeny analysis confirmed stable inheritance of the Bt gene according to the Mendelian (3:1) ratio. Insect bioassays revealed complete protection of transgenic plants from yellow stem borer infestation. PCR analysis of T2 progeny plants resulted in the recovery of up to 4% marker-free transgenic rice plants.
Case Study: Polycystic Livers in a Transgenic Mouse Line
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.
Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycysticmore » livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.« less
Kakitani, Makoto; Oshima, Takeshi; Horikoshi, Kaori; Yoshitome, Tetsuo; Ueda, Akiko; Kajikawa, Miwa; Iba, Yumi; Ozone, Yoshinao; Ijima, Yuki; Yoshino, Tohko; Itoh, Mikiko; Seki, Sachiko; Aoki, Ayako; Ishihara, Toshie; Shionoya, Michiyo; Makino, Utako; Kitada, Rina; Ohguma, Atsuko; Ohta, Takami; Yoshida, Yoshimasa; Kudoh, Hiroe; Hanaoka, Kazunori; Sibuya, Kazunori; Ishida, Isao; Kakeda, Minoru; Yagi, Mikio; Yoneya, Takashi; Tomizuka, Kazuma
2005-01-01
A major challenge of the post-genomic era is the functional characterization of anonymous open reading frames (ORFs) identified by the Human Genome Project. In this context, there is a strong requirement for the development of technologies that enhance our ability to analyze gene functions at the level of the whole organism. Here, we describe a rapid and efficient procedure to generate transgenic chimaeric mice that continuously secrete a foreign protein into the systemic circulation. The transgene units were inserted into the genomic site adjacent to the endogenous immunoglobulin (Ig) κ locus by homologous recombination, using a modified mouse embryonic stem (ES) cell line that exhibits a high frequency of homologous recombination at the Igκ region. The resultant ES clones were injected into embryos derived from a B-cell-deficient host strain, thus producing chimaerism-independent, B-cell-specific transgene expression. This feature of the system eliminates the time-consuming breeding typically implemented in standard transgenic strategies and allows for evaluating the effect of ectopic transgene expression directly in the resulting chimaeric mice. To demonstrate the utility of this system we showed high-level protein expression in the sera and severe phenotypes in human EPO (hEPO) and murine thrombopoietin (mTPO) transgenic chimaeras. PMID:15914664
Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.
2014-01-01
Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215
Simmons, Michael J; Haley, Kevin J; Grimes, Craig D; Raymond, John D; Fong, Joseph C L
2002-01-01
Fusions between the Drosophila hsp70 promoter and three different incomplete P elements, KP, SP, and BP1, were inserted into the Drosophila genome by means of hobo transformation vectors and the resulting transgenic stocks were tested for repression of P-element transposase activity. Only the H(hsp/KP) transgenes repressed transposase activity, and the degree of repression was comparable to that of a naturally occurring KP element. The KP transgenes repressed transposase activity both with and without heat-shock treatments. Both the KP element and H(hsp/KP) transgenes repressed the transposase activity encoded by the modified P element in the P(ry(+), Delta2-3)99B transgene more effectively than that encoded by the complete P element in the H(hsp/CP)2 transgene even though the P(ry(+), Delta2-3)99B transgene was the stronger transposase source. Repression of both transposase sources appeared to be due to a zygotic effect of the KP element or transgene. There was no evidence for repression by a strictly maternal effect; nor was there any evidence for enhancement of KP repression by the joint maternal transmission of H(hsp/KP) and H(hsp/CP) transgenes. These results are consistent with the idea that KP-mediated repression of P-element activity involves a KP-repressor polypeptide that is not maternally transmitted and that KP-mediated repression is not strengthened by the 66-kD repressor produced by complete P elements through alternate splicing of their RNA. PMID:12019235
Singh, Amarjeet Kumar; Paritosh, Kumar; Kant, Uma; Burma, Pradeep Kumar; Pental, Deepak
2016-01-01
Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp), which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.
Compositions and methods relating to transgenic plants and cellulosic ethanol production
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tien, Ming; Carlson, John; Liang, Haiying
Transgenic lignocellulosic plants are provided according to embodiments of the present invention, the transgenic plants transformed with an expression cassette encoding a protein operably linked to a signal peptide which targets the protein to a cell wall of the transgenic plant, where at least 5% of the total amino acid residues of the protein are tyrosine, lysine, serine, threonine or cysteine. Methods of increasing lignin-protein bonds in a lignocellulosic plant are provided according to embodiments of the present invention which include expressing a recombinant nucleic acid in a lignocellulosic plant, the recombinant nucleic acid encoding a protein operably linked tomore » a signal peptide which targets the protein to the cell wall of a plant, where at least 5% of the total amino acid residues of the protein are tyrosine, lysine, serine, threonine or cysteine.« less
NASA Technical Reports Server (NTRS)
Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)
2002-01-01
Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.
The ecological risks of transgenic plants.
Giovannetti, Manuela
2003-01-01
Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.
Transgenic tobacco plants expressing atzA exhibit resistance and strong ability to degrade atrazine.
Wang, Huizhuan; Chen, Xiwen; Xing, Xuguang; Hao, Xiaohua; Chen, Defu
2010-12-01
Atrazine chlorohydrolase (AtzA) catalyzes hydrolytic dechlorination and can be used in detoxification of atrazine, a herbicide widely employed in the control of broadleaf weeds. In this study, to investigate the potential use of transgenic tobacco plants for phytoremediation of atrazine, atzA genes from Pseudomonas sp. strain ADP and Arthrobacter strain AD1 were transferred into tobacco. Three and four transgenic lines, expressing atzA-ADP and atzA-AD1, respectively, were produced by Agrobacterium-mediated transformation. Molecular characterization including PCR, RT-PCR and Southern blot revealed that atzA was inserted into the tobacco genome and stably inherited by and expressed in the progenies. Seeds of the T(1) transgenic lines had a higher germination percentage and longer roots than the untransformed plants in the presence of 40-150 mg/l atrazine. The T(2) transgenic lines grew taller, gained more dry biomass, and had higher total chlorophyll content than the untransformed plants after growing in soil containing 1 or 2 mg/kg atrazine for 90 days. No atrazine residue remained in the soil in which the T(2) transgenic lines were grown (except 401), while, in the case of the untransformed plants, 0.91 mg (81.3%) and 1.66 mg (74.1%) of the atrazine still remained in the soil containing 1 and 2 mg/kg of atrazine, respectively, indicating that the transgenic lines could degrade atrazine effectively. The transgenic tobacco lines developed could be useful for phytoremediation of atrazine-contaminated soil and water.
Liu, Yongbo; Ge, Feng; Liang, Yuyong; Wu, Gang; Li, Junsheng
2015-04-26
Transgene flow through pollen and seeds leads to transgenic volunteers and feral populations in the nature, and consumer choice and economic incentives determine whether transgenic crops will be cultivated in the field. Transgenic and non-transgenic plants are likely to coexist in the field and natural habitats, but their competitive interactions are not well understood. Field experiments were conducted in an agricultural ecosystem with insecticide spraying and a natural ecosystem, using Bt-transgenic rice (Oryza sativa) and its non-transgenic counterpart in pure and mixed stands with a replacement series. Insect damage and competition significantly decreased plant growth and reproduction under the coexistence of transgenic and conventional rice. Insect-resistant transgenic rice was not competitively superior to its counterpart under different densities in both agricultural and natural ecosystems, irrespective of insect infection. Fitness cost due to Bt-transgene expression occurred only in an agroecosystem, where the population yield decreased with increasing percentage of transgenic rice. The population yield fluctuated in a natural ecosystem, with slight differences among pure and mixed stands under plant competition or insect pressure. The presence of Chilo suppressalis infection increased the number of non-target insects. Plant growth and reproduction patterns, relative competition ability and population yield indicate that Bt-transgenic and non-transgenic rice can coexist in agroecosystems, whereas in more natural habitats, transgenic rice is likely to outcompete non-transgenic rice.
Transgenic plants with increased calcium stores
NASA Technical Reports Server (NTRS)
Robertson, Dominique (Inventor); Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Boss, Wendy (Inventor)
2004-01-01
The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Enhanced transgene expression in rice following selection controlled by weak promoters.
Zhou, Jie; Yang, Yong; Wang, Xuming; Yu, Feibo; Yu, Chulang; Chen, Juan; Cheng, Ye; Yan, Chenqi; Chen, Jianping
2013-03-27
Techniques that enable high levels of transgene expression in plants are attractive for the commercial production of plant-made recombinant pharmaceutical proteins or other gene transfer related strategies. The conventional way to increase the yield of desired transgenic products is to use strong promoters to control the expression of the transgene. Although many such promoters have been identified and characterized, the increase obtainable from a single promoter is ultimately limited to a certain extent. In this study, we report a method to magnify the effect of a single promoter by using a weak promoter-based selection system in transgenic rice. tCUP1, a fragment derived from the tobacco cryptic promoter (tCUP), was tested for its activity in rice by fusion to both a β-glucuronidase (GUS) reporter and a hygromycin phosphotransferase (HPT) selectable marker. The tCUP1 promoter allowed the recovery of transformed rice plants and conferred tissue specific expression of the GUS reporter, but was much weaker than the CaMV 35S promoter in driving a selectable marker for growth of resistant calli. However, in the resistant calli and regenerated transgenic plants selected by the use of tCUP1, the constitutive expression of green fluorescent protein (GFP) was dramatically increased as a result of the additive effect of multiple T-DNA insertions. The correlation between attenuated selection by a weak promoter and elevation of copy number and foreign gene expression was confirmed by using another relatively weak promoter from nopaline synthase (Nos). The use of weak promoter derived selectable markers leads to a high T-DNA copy number and then greatly increases the expression of the foreign gene. The method described here provides an effective approach to robustly enhance the expression of heterogenous transgenes through copy number manipulation in rice.
Niklaus, Michael; Gruissem, Wilhelm; Vanderschuren, Hervé
2011-01-01
Cassava is one of the most important crops in the tropics. Its industrial use for starch and biofuel production is also increasing its importance for agricultural production in tropical countries. In the last decade cassava biotechnology has emerged as a valuable alternative to the breeding constraints of this highly heterozygous crop for improved trait development of cassava germplasm. Cassava transformation remains difficult and time-consuming because of limitations in selecting transgenic tissues and regeneration of transgenic plantlets. We have recently reported an efficient and robust cassava transformation protocol using the hygromycin phosphotransferase II (hptII) gene as selection marker and the aminoglycoside hygromycin at optimal concentrations to maximize the regeneration of transgenic plantlets. In the present work, we expanded the transformation protocol to the use of the neomycin phosphotransferase II (nptII) gene as selection marker. Several aminoglycosides compatible with the use of nptII were tested and optimal concentrations for cassava transformation were determined. Given its efficiency equivalent to hptII as selection marker with the described protocol, the use of nptII opens new possibilities to engineer transgenic cassava lines with multiple T-DNA insertions and to produce transgenic cassava with a resistance marker gene that is already deregulated in several commercial transgenic crops.
Processing, targeting, and antifungal activity of stinging nettle agglutinin in transgenic tobacco.
Does, M P; Houterman, P M; Dekker, H L; Cornelissen, B J
1999-06-01
The gene encoding the precursor to stinging nettle (Urtica dioica L. ) isolectin I was introduced into tobacco (Nicotiana tabacum). In transgenic plants this precursor was processed to mature-sized lectin. The mature isolectin is deposited intracellularly, most likely in the vacuoles. A gene construct lacking the C-terminal 25 amino acids was also introduced in tobacco to study the role of the C terminus in subcellular trafficking. In tobacco plants that expressed this construct, the mutant precursor was correctly processed and the mature isolectin was targeted to the intercellular space. These results indicate the presence of a C-terminal signal for intracellular retention of stinging nettle lectin and most likely for sorting of the lectin to the vacuoles. In addition, correct processing of this lectin did not depend on vacuolar deposition. Isolectin I purified from tobacco displayed identical biological activities as isolectin I isolated from stinging nettle. In vitro antifungal assays on germinated spores of the fungi Botrytis cinerea, Trichoderma viride, and Colletotrichum lindemuthianum revealed that growth inhibition by stinging nettle isolectin I occurs at a specific phase of fungal growth and is temporal, suggesting that the fungi had an adaptation mechanism.
Processing, Targeting, and Antifungal Activity of Stinging Nettle Agglutinin in Transgenic Tobacco
Does, Mirjam P.; Houterman, Petra M.; Dekker, Henk L.; Cornelissen, Ben J.C.
1999-01-01
The gene encoding the precursor to stinging nettle (Urtica dioica L.) isolectin I was introduced into tobacco (Nicotiana tabacum). In transgenic plants this precursor was processed to mature-sized lectin. The mature isolectin is deposited intracellularly, most likely in the vacuoles. A gene construct lacking the C-terminal 25 amino acids was also introduced in tobacco to study the role of the C terminus in subcellular trafficking. In tobacco plants that expressed this construct, the mutant precursor was correctly processed and the mature isolectin was targeted to the intercellular space. These results indicate the presence of a C-terminal signal for intracellular retention of stinging nettle lectin and most likely for sorting of the lectin to the vacuoles. In addition, correct processing of this lectin did not depend on vacuolar deposition. Isolectin I purified from tobacco displayed identical biological activities as isolectin I isolated from stinging nettle. In vitro antifungal assays on germinated spores of the fungi Botrytis cinerea, Trichoderma viride, and Colletotrichum lindemuthianum revealed that growth inhibition by stinging nettle isolectin I occurs at a specific phase of fungal growth and is temporal, suggesting that the fungi had an adaptation mechanism. PMID:10364393
CRISPR/Cas9-mediated targeted mutagenesis of GmFT2a delays flowering time in soya bean.
Cai, Yupeng; Chen, Li; Liu, Xiujie; Guo, Chen; Sun, Shi; Wu, Cunxiang; Jiang, Bingjun; Han, Tianfu; Hou, Wensheng
2018-01-01
Flowering is an indication of the transition from vegetative growth to reproductive growth and has considerable effects on the life cycle of soya bean (Glycine max). In this study, we employed the CRISPR/Cas9 system to specifically induce targeted mutagenesis of GmFT2a, an integrator in the photoperiod flowering pathway in soya bean. The soya bean cultivar Jack was transformed with three sgRNA/Cas9 vectors targeting different sites of endogenous GmFT2a via Agrobacterium tumefaciens-mediated transformation. Site-directed mutations were observed at all targeted sites by DNA sequencing analysis. T1-generation soya bean plants homozygous for null alleles of GmFT2a frameshift mutated by a 1-bp insertion or short deletion exhibited late flowering under natural conditions (summer) in Beijing, China (N39°58', E116°20'). We also found that the targeted mutagenesis was stably heritable in the following T2 generation, and the homozygous GmFT2a mutants exhibited late flowering under both long-day and short-day conditions. We identified some 'transgene-clean' soya bean plants that were homozygous for null alleles of endogenous GmFT2a and without any transgenic element from the T1 and T2 generations. These 'transgene-clean' mutants of GmFT2a may provide materials for more in-depth research of GmFT2a functions and the molecular mechanism of photoperiod responses in soya bean. They will also contribute to soya bean breeding and regional introduction. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei
2018-07-01
Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.
Chai, Y; Calaf, G M; Zhou, H; Ghandhi, S A; Elliston, C D; Wen, G; Nohmi, T; Amundson, S A; Hei, T K
2013-01-01
Background: Although radiation-induced bystander effects have been confirmed using a variety of endpoints, the mechanism(s) underlying these effects are not well understood, especially for in vivo study. Methods: A 1-cm2 area (1 cm × 1 cm) in the lower abdominal region of gpt delta transgenic mice was irradiated with 5 Gy of 300 keV X-rays, and changes in out-of-field lung and liver were observed. Results: Compared with sham-treated controls, the Spi− mutation frequency increased 2.4-fold in non-targeted lung tissues at 24 h after partial body irradiation (PBIR). Consistent with dramatic Cyclooxygenase 2 (COX-2) induction in the non-targeted bronchial epithelial cells, increasing levels of prostaglandin, together with 8-hydroxydeoxyguanosine, in the out-of-field lung tissues were observed after PBIR. In addition, DNA double-strand breaks and apoptosis were induced in bystander lung tissues after PBIR. Conclusion: The PBIR induces DNA damage and mutagenesis in non-targeted lung tissues, especially in bronchial epithelial cells, and COX-2 has an essential role in bystander mutagenesis. PMID:23321513
Dong, Yufeng; Jin, Xi; Tang, Qiaoling; Zhang, Xin; Yang, Jiangtao; Liu, Xiaojing; Cai, Junfeng; Zhang, Xiaobing; Wang, Xujing; Wang, Zhixing
2017-01-01
Glyphosate is a widely used herbicide, due to its broad spectrum, low cost, low toxicity, high efficiency, and non-selective characteristics. Rice farmers rarely use glyphosate as a herbicide, because the crop is sensitive to this chemical. The development of transgenic glyphosate-tolerant rice could greatly improve the economics of rice production. Here, we transformed the Pseudomonas fluorescens G2 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene G2-EPSPS, which conferred tolerance to glyphosate herbicide into a widely used japonica rice cultivar, Zhonghua 11 (ZH11), to develop two highly glyphosate-tolerant transgenic rice lines, G2-6 and G2-7, with one exogenous gene integration. Seed germination tests and glyphosate-tolerance assays of plants grown in a greenhouse showed that the two transgenic lines could greatly improve glyphosate-tolerance compared with the wild-type; The glyphosate-tolerance field test indicated that both transgenic lines could grow at concentrations of 20,000 ppm glyphosate, which is more than 20-times the recommended concentration in the field. Isolation of the flanking sequence of transgenic rice G2-6 indicated that the 5′-terminal of T-DNA was inserted into chromosome 8 of the rice genome. An event-specific PCR test system was established and the limit of detection of the primers reached five copies. Overall, the G2-EPSPS gene significantly improved glyphosate-tolerance in transgenic rice; furthermore, it is a useful candidate gene for the future development of commercial transgenic rice. PMID:28611804
Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat; Sharkar, Mohammad Tofael Kabir; Noritake, Hidenao; Kimura, Wataru; Wu, Yi-Xin; Kobayashi, Yoshimasa; Uezato, Tadayoshi; Miura, Naoyuki
2012-01-06
The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, we generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with ∼50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age. Copyright © 2011 Elsevier Inc. All rights reserved.
Abnormal differentiation, hyperplasia and embryonic/perinatal lethality in BK5-T/t transgenic mice
Chen, Xin; Schneider-Broussard, Robin; Hollowell, Debra; McArthur, Mark; Jeter, Collene R.; Benavides, Fernando; DiGiovanni, John; Tang, Dean G.
2009-01-01
The cell-of-origin has a great impact on the types of tumors that develop and the stem/progenitor cells have long been considered main targets of malignant transformation. The SV40 large T and small t antigens (T/t), have been targeted to multiple differentiated cellular compartments in transgenic mice. In most of these studies, transgenic animals develop tumors without apparent defects in animal development. In this study, we used the bovine keratin 5 (BK5) promoter to target the T/t antigens to stem/progenitor cell-containing cytokeratin 5 (CK5) cellular compartment. A transgene construct, BK5-T/t, was made and microinjected into the male pronucleus of FVB/N mouse oocytes. After implanting ∼1700 embryos, only 7 transgenics were obtained, including 4 embryos (E9.5, E13, E15, and E20) and 3 postnatal animals, which died at P1, P2, and P18, respectively. Immunohistological analysis revealed aberrant differentiation and prominent hyperplasia in several transgenic CK5 tissues, especially the upper digestive organs (tongue, oral mucosa, esophagus, and forestomach) and epidermis, the latter of which also showed focal dysplasia. Altogether, these results indicate that constitutive expression of the T/t antigens in CK5 cellular compartment results in abnormal epithelial differentiation and leads to embryonic/perinatal animal lethality. PMID:19272531
Taking transgenic rice drought screening to the field.
Gaudin, Amélie C M; Henry, Amelia; Sparks, Adam H; Slamet-Loedin, Inez H
2013-01-01
Numerous transgenes have been reported to increase rice drought resistance, mostly in small-scale experiments under vegetative-stage drought stress, but few studies have included grain yield or field evaluations. Different definitions of drought resistance are currently in use for field-based and laboratory evaluations of transgenics, the former emphasizing plant responses that may not be linked to yield under drought. Although those fundamental studies use efficient protocols to uncover and validate gene functions, screening conditions differ greatly from field drought environments where the onset of drought stress symptoms is slow (2-3 weeks). Simplified screening methods, including severely stressed survival studies, are therefore not likely to identify transgenic events with better yield performance under drought in the target environment. As biosafety regulations are becoming established to allow field trials in some rice-producing countries, there is a need to develop relevant screening procedures that scale from preliminary event selection to greenhouse and field trials. Multilocation testing in a range of drought environments may reveal that different transgenes are necessary for different types of drought-prone field conditions. We describe here a pipeline to improve the selection efficiency and reproducibility of results across drought treatments and test the potential of transgenic rice for the development of drought-resistant material for agricultural purposes.
Gu, Xianbin; Gao, Zhihong; Zhuang, Weibing; Qiao, Yushan; Wang, Xiuyun; Mi, Lin; Zhang, Zhen; Lin, Zhilin
2013-05-01
Low-temperature stress is one of the major abiotic stresses in plants worldwide, and the dehydration responsive element binding protein (DREB) transcription factor induces expression of genes involved in environmental stress tolerance in plants. A proteomic approach based on two-dimensional gel electrophoresis (2-DE) and subsequent mass spectrometric identification was used to study the changes in the leaf proteome profiles of rd29A:RdreB1BI transgenic and non-transgenic strawberries exposed to low-temperature conditions. By comparing the proteomic profiles, we located 21 protein spots that were reproducibly up- or down-regulated by more than twofold between transgenic and non-transgenic strawberries. Eight identified proteins function in energy and metabolism, four in biosynthetic processes, four were stress and defense related, three spots were identified as cold-stress related expressed sequence tags (ESTs), and two were unknown proteins. The change patterns of low-temperature tolerance proteins, including photosynthetic proteins (RuBisCO large subunit and RuBisCO activase), cytoplasmic Cu/Zn-superoxide dismutase (Cu/Zn-SOD), late embryogenesis abundant protein 14-A (Lea14-A), eukaryotic translation initiation factor 5A (eIF5A), and cold-stress related ESTs, were differentially regulated between non-transgenic and rd29A:RdreB1BI transgenic strawberries. They are likely important gene products in the regulatory network of the RdreB1BI gene. Consequently, this study provides the first characterization of the transgenic strawberry proteome and the predicted target proteins of the RdreB1BI gene by using proteomic approaches. Copyright © 2013 Elsevier GmbH. All rights reserved.
Green, Larry L
2014-03-01
Transgenic mice have yielded seven of the ten currently-approved human antibody drugs, making them the most successful platform for the discovery of fully human antibody therapeutics. The use of the in vivo immune system helps drive this success by taking advantage of the natural selection process that produces antibodies with desirable characteristics. Appropriately genetically-engineered mice act as robust engines for the generation of diverse repertoires of affinity- matured fully human variable regions with intrinsic properties necessary for successful antibody drug development including high potency, specificity, manufacturability, solubility and low risk of immunogenicity. A broad range of mAb drug targets are addressable in these mice, comprising both secreted and transmembrane targets, including membrane multi-spanning targets, as well as human target antigens that share high sequence identity with their mouse orthologue. Transgenic mice can routinely yield antibodies with sub-nanomolar binding affinity for their antigen, with lead candidate mAbs frequently possessing affinities for binding to their target of less than 100 picomolar, without requiring any ex vivo affinity optimization. While the originator transgenic mice platforms are no longer broadly available, a new generation of transgenic platforms is in development for discovery of the next wave of human therapeutic antibodies.
USDA-ARS?s Scientific Manuscript database
Non-target effects of Cry1Ab x CP4 EPSPS and Cry1Ab + Cry3Bb1 x CP4 EPSPS Bt transgenic new maize hybrids on insidious flower bugs [Orius insidiosus (Say)] was studied in Nebraska (Mead, C lay Center, and Concord) during 2007 and 2008. The Bt effect was compared to CP4 EPSPS maize (isoline), convent...
Transgene × Environment Interactions in Genetically Modified Wheat
Zeller, Simon L.; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard
2010-01-01
Background The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. Methods and Findings We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Conclusions Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology. PMID:20635001
Transgene x environment interactions in genetically modified wheat.
Zeller, Simon L; Kalinina, Olena; Brunner, Susanne; Keller, Beat; Schmid, Bernhard
2010-07-12
The introduction of transgenes into plants may cause unintended phenotypic effects which could have an impact on the plant itself and the environment. Little is published in the scientific literature about the interrelation of environmental factors and possible unintended effects in genetically modified (GM) plants. We studied transgenic bread wheat Triticum aestivum lines expressing the wheat Pm3b gene against the fungus powdery mildew Blumeria graminis f.sp. tritici. Four independent offspring pairs, each consisting of a GM line and its corresponding non-GM control line, were grown under different soil nutrient conditions and with and without fungicide treatment in the glasshouse. Furthermore, we performed a field experiment with a similar design to validate our glasshouse results. The transgene increased the resistance to powdery mildew in all environments. However, GM plants reacted sensitive to fungicide spraying in the glasshouse. Without fungicide treatment, in the glasshouse GM lines had increased vegetative biomass and seed number and a twofold yield compared with control lines. In the field these results were reversed. Fertilization generally increased GM/control differences in the glasshouse but not in the field. Two of four GM lines showed up to 56% yield reduction and a 40-fold increase of infection with ergot disease Claviceps purpurea compared with their control lines in the field experiment; one GM line was very similar to its control. Our results demonstrate that, depending on the insertion event, a particular transgene can have large effects on the entire phenotype of a plant and that these effects can sometimes be reversed when plants are moved from the glasshouse to the field. However, it remains unclear which mechanisms underlie these effects and how they may affect concepts in molecular plant breeding and plant evolutionary ecology.
Hirai, Tadayoshi; Kurokawa, Natsuko; Duhita, Narendra; Hiwasa-Tanase, Kyoko; Kato, Kazuhisa; Kato, Ko; Ezura, Hiroshi
2011-09-28
High-level accumulation of the target recombinant protein is a significant issue in heterologous protein expression using transgenic plants. Miraculin, a taste-modifying protein, was accumulated in transgenic tomatoes using an expression cassette in which the miraculin gene was expressed by the cauliflower mosaic virus (CaMV) 35S promoter and the heat shock protein (HSP) terminator (MIR-HSP). The HSP terminator was derived from heat shock protein 18.2 in Arabidopsis thaliana . Using this HSP-containing cassette, the miraculin concentration in T0 transgenic tomato lines was 1.4-13.9% of the total soluble protein (TSP), and that in the T1 transgenic tomato line homozygous for the miraculin gene reached 17.1% of the TSP. The accumulation level of the target protein was comparable to levels observed with chloroplast transformation. The high-level accumulation of miraculin in T0 transgenic tomato lines achieved by the HSP terminator was maintained in the successive T1 generation, demonstrating the genetic stability of this accumulation system.
Generation of a transgenic cashmere goat using the piggyBac transposition system.
Bai, Ding-Ping; Yang, Ming-Ming; Qu, Lei; Chen, Yu-Lin
2017-04-15
The development of transgenic technologies in the Cashmere goat (Capra hircus) has the potential to improve the quality of the meat and wool. The piggyBac (PB) transposon system is highly efficient and can be used to transpose specific target genes into the genome. Here, we developed a PB transposon system to produce transgenic Cashmere goat fetal fibroblasts (GFFs) with the enhanced green fluorescent protein (EGFP). We then used the genetically modified GFFs as nuclear donors to generate transgenic embryos by somatic cell nuclear transfer (SCNT). The embryos (n = 40) were implanted into female goats (n = 20). One transgenic kid that expressed EGFP throughout the surface features of its body was born. This result demonstrated the usefulness of PB transposon system in generating transgenic Cashmere goats. Copyright © 2017 Elsevier Inc. All rights reserved.
Osteoblasts are target cells for transformation in c-fos transgenic mice
1993-01-01
We have generated transgenic mice expressing the proto-oncogene c-fos from an H-2Kb class I MHC promoter as a tool to identify and isolate cell populations which are sensitive to altered levels of Fos protein. All homozygous H2-c-fosLTR mice develop osteosarcomas with a short latency period. This phenotype is specific for c-fos as transgenic mice expressing the fos- and jun-related genes, fosB and c-jun, from the same regulatory elements do not develop any pathology despite high expression in bone tissues. The c-fos transgene is not expressed during embryogenesis but is expressed after birth in bone tissues before the onset of tumor formation, specifically in putative preosteoblasts, bone- forming osteoblasts, osteocytes, as well as in osteoblastic cells present within the tumors. Primary and clonal cell lines established from c-fos-induced tumors expressed high levels of exogenous c-fos as well as the bone cell marker genes, type I collagen, alkaline phosphatase, and osteopontin/2ar. In contrast, osteocalcin/BGP expression was either low or absent. All cell lines were tumorigenic in vivo, some of which gave rise to osteosarcomas, expressing exogenous c- fos mRNA, and Fos protein in osteoblastic cells. Detailed analysis of one osteogenic cell line, P1, and several P1-derived clonal cell lines indicated that bone-forming osteoblastic cells were transformed by Fos. The regulation of osteocalcin/BGP and alkaline phosphatase gene expression by 1,25-dihydroxyvitamin D3 was abrogated in P1-derived clonal cells, whereas glucocorticoid responsiveness was unaltered. These results suggest that high levels of Fos perturb the normal growth control of osteoblastic cells and exert specific effects on the expression of the osteoblast phenotype. PMID:8335693
Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D
2016-01-01
Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P < 0.04). Furthermore, transgene integration has been confirmed by sequencing in the majority of the mice treated with both vectors. Targeted alleles were 4.6-fold more common in livers of mice with GSD Ia, as compared with normal littermates, at 8 months following vector administration (P < 0.02). This suggests a selective advantage for vector-transduced hepatocytes following ZFN-mediated integration of the G6Pase vector. A short-term experiment also showed that 3-month-old mice receiving the ZFN had significantly-improved biochemical correction, in comparison with mice that received the donor vector alone. These data suggest that the use of ZFNs to drive integration of G6Pase at a safe harbor locus might improve vector persistence and efficacy, and lower mortality in GSD Ia. PMID:26865405
Wen, Wei; Hu, Rong; Bao, Ting; Zhang, Xiuhua; Wang, Shengfu
2015-09-15
In this work, a sensitive exonuclease-assisted amplification electrochemical aptasensor through insertion approach was developed for the detection of mucin 1 (MUC 1). In order to construct the aptasensor, 6-Mercapto-1-hexanol (MCH) was used to block partial sites of gold electrode (GE), followed by thiolated capture probe self-assembled on GE. Methylene blue (MB) labeled aptamer hybridized with capture probe at both ends to form double-strand DNA. For the MB labeled termini was close to GE, the electrochemical response was remarkable. The presence of MUC 1 caused the dissociation of the double-strand DNA owing to the specific recognition of aptamer to MUC 1. Then exonuclease I (Exo I) selectively digested the aptamer which bound with MUC 1, the released MUC 1 participated new binding with the rest aptamer. Insertion approach improved the reproducibility and Exo I-catalyzed target recycling improved the sensitivity of the aptasensor significantly. Under optimal experimental conditions, the proposed aptasensor had a good linear correlation ranged from 10 pM to 1 μM with a detection limit of 4 pM (Signal to Noise ratio, S/N=3). The strategy had great potential for the simple and sensitive detection of other cancer markers. Copyright © 2015 Elsevier B.V. All rights reserved.
Häcker, Irina; Harrell Ii, Robert A; Eichner, Gerrit; Pilitt, Kristina L; O'Brochta, David A; Handler, Alfred M; Schetelig, Marc F
2017-03-07
Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting.
Zhang, Qing; Yu, Hui; Zhang, Feng-zhen; Shen, Zhi-cheng
2013-10-01
Human serum albumin (HSA) is widely utilized for medical purposes and biochemical research. Transgenic rice has proved to be an attractive bioreactor for mass production of recombinant HSA (rHSA). However, transgene spread is a major environmental and food safety concern for transgenic rice expressing proteins of medical value. This study aimed to develop a selectively terminable transgenic rice line expressing HSA in rice seeds, and a simple process for recovery and purification of rHSA for economical manufacture. An HSA expression cassette was inserted into a T-DNA vector encoding an RNA interference (RNAi) cassette suppressing the CYP81A6 gene. This gene detoxifies the herbicide bentazon and is linked to the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) cassette which confers glyphosate tolerance. ANX Sepharose Fast Flow (ANX FF) anion exchange chromatography coupled with Butyl Sepharose High Performance (Butyl HP) hydrophobic interaction chromatography was used to purify rHSA. A transgenic rice line, HSA-84, was obtained with stable expression of rHSA of up to 0.72% of the total dry weight of the dehusked rice seeds. This line also demonstrated high sensitivity to bentazon, and thus could be killed selectively by a spray of bentazon. A two-step chromatography purification scheme was established to purify the rHSA from rice seeds to a purity of 99% with a recovery of 62.4%. Results from mass spectrometry and N-terminus sequencing suggested that the purified rHSA was identical to natural plasma-derived HSA. This study provides an alternative strategy for large-scale production of HSA with a built-in transgene safety control mechanism.
Transgenic perennial biofuel feedstocks and strategies for bioconfinement
The use of transgenic tools for the improvement of plant feedstocks will be required to realize the full economic and environmental benefits of cellulosic and other biofuels, particularly from perennial plants. Traits that are targets for improvement of biofuels crops include he...
Biofortified indica rice attains iron and zinc nutrition dietary targets in the field
Trijatmiko, Kurniawan R.; Dueñas, Conrado; Tsakirpaloglou, Nikolaos; Torrizo, Lina; Arines, Felichi Mae; Adeva, Cheryl; Balindong, Jeanette; Oliva, Norman; Sapasap, Maria V.; Borrero, Jaime; Rey, Jessica; Francisco, Perigio; Nelson, Andy; Nakanishi, Hiromi; Lombi, Enzo; Tako, Elad; Glahn, Raymond P.; Stangoulis, James; Chadha-Mohanty, Prabhjit; Johnson, Alexander A. T.; Tohme, Joe; Barry, Gerard; Slamet-Loedin, Inez H.
2016-01-01
More than two billion people are micronutrient deficient. Polished grains of popular rice varieties have concentration of approximately 2 μg g−1 iron (Fe) and 16 μg g−1 zinc (Zn). The HarvestPlus breeding programs for biofortified rice target 13 μg g−1 Fe and 28 μg g−1 Zn to reach approximately 30% of the estimated average requirement (EAR). Reports on engineering Fe content in rice have shown an increase up to 18 μg g−1 in glasshouse settings; in contrast, under field conditions, 4 μg g−1 was the highest reported concentration. Here, we report on selected transgenic events, field evaluated in two countries, showing 15 μg g−1 Fe and 45.7 μg g−1 Zn in polished grain. Rigorous selection was applied to 1,689 IR64 transgenic events for insert cleanliness and, trait and agronomic performances. Event NASFer-274 containing rice nicotianamine synthase (OsNAS2) and soybean ferritin (SferH-1) genes showed a single locus insertion without a yield penalty or altered grain quality. Endosperm Fe and Zn enrichment was visualized by X-ray fluorescence imaging. The Caco-2 cell assay indicated that Fe is bioavailable. No harmful heavy metals were detected in the grain. The trait remained stable in different genotype backgrounds. PMID:26806528
Li, Wenting; Wang, Kejun; Kang, Shimeng; Deng, Shoulong; Han, Hongbing; Lian, Ling; Lian, Zhengxing
2015-01-01
Foot and mouth disease induced by foot and mouth disease virus (FMDV) is severe threat to cloven-hoofed domestic animals. The gene 3Dpol in FMDV genome encodes the viral RNA polymerase, a vital element for FMDV replication. In this study, a conserved 3D-7414shRNA targeting FMDV-3Dpol gene was designed and injected into pronuclear embryos to produce the transgenic goats. Sixty-one goats were produced, of which, seven goats positively integrated 3D-7414shRNA. Loss of function assay demonstrated that siRNA effectively knockdown 3Dpol gene in skin epithelium cells of transgenic goats. Subsequently, the tongue epithelium cells from transgenic and non-transgenic goats were infected with FMDV O/YS/CHA/05 strain. A significant decrease of virus titres and virus copy number was observed in cells of transgenic goats compared with that of non-transgenic goats, which indicated that 3D-7414siRNA inhibited FMDV replication by interfering FMDV-3Dpol gene. Furthermore, we found that expression of TLR7, RIG-I and TRAF6 was lower in FMDV infected cells from transgenic goats compared to that from non-transgenic goats, which might result from lower virus copy number in transgenic goats’ cells. In conclusion, we successfully produced transgenic goats highly expressing 3D-7414siRNA targeting 3Dpol gene, and the tongue epithelium cells from the transgenic goats showed effective resistance to FMDV. PMID:26671568
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Krishnamurthy, Pavan K.; Rajamohamedsait, Hameetha B.; Gonzalez, Veronica; Rajamohamedsait, Wajitha J.; Ahmed, Nawal; Krishnaswamy, Senthilkumar; Sigurdsson, Einar M.
2016-01-01
Type 2 diabetes mellitus is characterized by the deposition of islet amyloid polypeptide (IAPP) as amyloid in islets, a process thought to be toxic to β-cells. To determine the feasibility of targeting these aggregates therapeutically, we vaccinated transgenic (Tg) mice that overexpress human IAPP and were fed a high-fat diet to promote their diabetic phenotype. Our findings indicate that prophylactic vaccination with IAPP and its derivative IAPP7-19-TT, protects wild-type female mice, but not males, from obesity-induced early mortality, and the derivative showed a strong trend for prolonging the lifespan of Tg females but not males. Furthermore, IAPP7-19-TT-immunized Tg females cleared a glucose bolus more efficiently than controls, while IAPP-immunized Tg females showed an impaired ability to clear a glucose bolus compared to their adjuvant injected Tg controls. Interestingly, IAPP or IAPP7-19-TT treatments had no effect on glucose clearance in Tg males. Overall, these beneficial effects of IAPP targeted immunization depend on Tg status, sex, and immunogen. Hence, future studies in this field should carefully consider these variables that clearly affect the therapeutic outcome. In conclusion, IAPP targeting immunotherapy may have benefits in patients with type 2 diabetes. PMID:27379014
Casanova, Fernando; Carney, Paul R; Sarntinoranont, Malisa
2014-11-30
Convection enhanced delivery (CED) infuses drugs directly into brain tissue. Needle insertion is required and results in tissue damage which can promote flowback along the needle track and improper targeting. The goal of this study was to evaluate friction stress (calculated from needle insertion force) as a measure of tissue contact and damage during needle insertion for varying insertion speeds. Forces and surface dimpling during needle insertion were measured in rat brain in vivo. Needle retraction forces were used to calculate friction stresses. These measures were compared to track damage from a previous study. Differences between brain tissues and soft hydrogels were evaluated for varying insertion speeds: 0.2, 2, and 10mm/s. In brain tissue, average insertion force and surface dimpling increased with increasing insertion speed. Average friction stress along the needle-tissue interface decreased with insertion speed (from 0.58 ± 0.27 to 0.16 ± 0.08 kPa). Friction stress varied between brain regions: cortex (0.227 ± 0.27 kPa), external capsule (0.222 ± 0.19 kPa), and CPu (0.383 ± 0.30 kPa). Hydrogels exhibited opposite trends for dimpling and friction stress with insertion speed. Previously, increasing needle damage with insertion speed has been measured with histological methods. Friction stress appears to decrease with increasing tissue damage and decreasing tissue contact, providing the potential for in vivo and real time evaluation along the needle track. Force derived friction stress decreased with increasing insertion speed and was smaller within white matter regions. Hydrogels exhibited opposite trends to brain tissue. Copyright © 2014 Elsevier B.V. All rights reserved.
Yang, Ching-Fu; Chen, Kuan-Chun; Cheng, Ying-Hui; Raja, Joseph A. J.; Huang, Ya-Ling; Chien, Wan-Chu; Yeh, Shyi-Dong
2014-01-01
Global threats of ssDNA geminivirus and ss(-)RNA tospovirus on crops necessitate the development of transgenic resistance. Here, we constructed a two-T DNA vector carrying a hairpin of the intergenic region (IGR) of Ageratum yellow vein virus (AYVV), residing in an intron inserted in an untranslatable nucleocapsid protein (NP) fragment of Melon yellow spot virus (MYSV). Transgenic tobacco lines highly resistant to AYVV and MYSV were generated. Accumulation of 24-nt siRNA, higher methylation levels on the IGR promoters of the transgene, and suppression of IGR promoter activity of invading AYVV indicate that AYVV resistance is mediated by transcriptional gene silencing. Lack of NP transcript and accumulation of corresponding siRNAs indicate that MYSV resistance is mediated through post-transcriptional gene silencing. Marker-free progenies with concurrent resistance to both AYVV and MYSV, stably inherited as dominant nuclear traits, were obtained. Hence, we provide a novel way for concurrent control of noxious DNA and RNA viruses with less biosafety concerns. PMID:25030413
Ignacimuthu, S; Ceasar, S Antony
2012-03-01
Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Elaswad, Ahmed; Alsaqufi, Ahmed; Perera, Dayan A; Qin, Zhenkui; Odin, Ramji; Vo, Khoi; Drescher, David; Robinson, Dalton; Dong, Sheng; Zhang, Dan; Shang, Mei; Abass, Nermeen; Das, Sanjay K; Bangs, Max; Dunham, Rex A
2018-06-01
Repressible knockdown approaches were investigated to manipulate for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown and an off-target gene, vasa, was monitored. Two potentially copper-sensitive repressible promoters, yeast ctr3 (M) and ctr3-reduced (Mctr), were coupled with four knockdown strategies separately including: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA), and ds-sh RNA-targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with copper sulfate as the repressor compound. Spawning rates of full-sibling P 1 fish exposed or not exposed to the constructs as treated and untreated embryos were 85 and 54%, respectively, indicating potential sterilization of fish and repression of the constructs. In F 1 fish, mRNA expressions of PGC marker genes for most constructs were downregulated in the untreated group and the knockdown was repressed in the treated group. Gonad development in transgenic, untreated F 1 channel catfish was reduced compared to non-transgenic fish for MctrN2, MN1, MN2, and MDND. For 3-year-old adults, gonad size in the transgenic untreated group was 93.4% smaller than the non-transgenic group for females and 92.3% for males. However, mean body weight of transgenic females (781.8 g) and males (883.8 g) was smaller than of non-transgenic counterparts (984.2 and 1254.3 g) at 3 years of age, a 25.8 and 41.9% difference for females and males, respectively. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but negative pleiotropic effects can result.
Rack Insertion End Effector (RIEE) guidance
NASA Technical Reports Server (NTRS)
Malladi, Narasimha S.
1994-01-01
NASA-KSC has developed a mechanism to handle and insert Racks into the Space Station Logistic Modules. This mechanism consists of a Base with 3 motorized degrees of freedom, a 3 section motorized Boom that goes from 15 to 44 feet in length, and a Rack Insertion End Effector (RIEE) with 5 hand wheels for precise alignment. During the 1993 NASA-ASEE Summer Faculty Fellowship Program at KSC, I designed an Active Vision (Camera) Arrangement and developed an algorithm to determine (1) the displacements required by the Room for its initial positioning and (2) the rotations required at the five hand-wheels of the RIEE, for the insertion of the Rack, using the centroids fo the Camera Images of the Location Targets in the Logistic Module. Presently, during the summer of '94, I completed the preliminary design of an easily portable measuring instrument using encoders to obtain the 3-Dimensional Coordinates of Location Targets in the Logistics Module relative to the RIEE mechanism frame. The algorithm developed in '93 can use the output of this instrument also. Simplification of the '93 work and suggestions for the future work are discussed.
Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice
Winchenbach, Jan; Düking, Tim; Berghoff, Stefan A.; Stumpf, Sina K.; Hülsmann, Swen; Nave, Klaus-Armin; Saher, Gesine
2016-01-01
Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions. PMID:28149504
Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice.
Winchenbach, Jan; Düking, Tim; Berghoff, Stefan A; Stumpf, Sina K; Hülsmann, Swen; Nave, Klaus-Armin; Saher, Gesine
2016-01-01
Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions.
Olovnikov, Ivan; Ryazansky, Sergei; Shpiz, Sergey; Lavrov, Sergey; Abramov, Yuri; Vaury, Chantal; Jensen, Silke; Kalmykova, Alla
2013-06-01
PIWI-interacting RNAs (piRNAs) provide defence against transposable element (TE) expansion in the germ line of metazoans. piRNAs are processed from the transcripts encoded by specialized heterochromatic clusters enriched in damaged copies of transposons. How these regions are recognized as a source of piRNAs is still elusive. The aim of this study is to determine how transgenes that contain a fragment of the Long Interspersed Nuclear Elements (LINE)-like I transposon lead to an acquired TE resistance in Drosophila. We show that such transgenes, being inserted in unique euchromatic regions that normally do not produce small RNAs, become de novo bidirectional piRNA clusters that silence I-element activity in the germ line. Strikingly, small RNAs of both polarities are generated from the entire transgene and flanking genomic sequences--not only from the transposon fragment. Chromatin immunoprecipitation analysis shows that in ovaries, the trimethylated histone 3 lysine 9 (H3K9me3) mark associates with transgenes producing piRNAs. We show that transgene-derived hsp70 piRNAs stimulate in trans cleavage of cognate endogenous transcripts with subsequent processing of the non-homologous parts of these transcripts into piRNAs.
Simpson, Sean; Collins, Bruce; Sommer, Jeff; Petters, Robert M.; Caballero, Ignacio; Platt, Jeff L.
2017-01-01
Transgenic pigs have become an attractive research model in the field of translational research, regenerative medicine, and stem cell therapy due to their anatomic, genetic and physiological similarities with humans. The development of fluorescent proteins as molecular tags has allowed investigators to track cell migration and engraftment levels after transplantation. Here we describe the development of two transgenic pig models via SCNT expressing a fusion protein composed of eGFP and porcine Histone 2B (pH2B). This fusion protein is targeted to the nucleosomes resulting a nuclear/chromatin eGFP signal. The first model (I) was generated via random insertion of pH2B-eGFP driven by the CAG promoter (chicken beta actin promoter and rabbit Globin poly A; pCAG-pH2B-eGFP) and protected by human interferon-β matrix attachment regions (MARs). Despite the consistent, high, and ubiquitous expression of the fusion protein pH2B-eGFP in all tissues analyzed, two independently generated Model I transgenic lines developed neurodegenerative symptoms including Wallerian degeneration between 3–5 months of age, requiring euthanasia. A second transgenic model (II) was developed via CRISPR-Cas9 mediated homology-directed repair (HDR) of IRES-pH2B-eGFP into the endogenous β-actin (ACTB) locus. Model II transgenic animals showed ubiquitous expression of pH2B-eGFP on all tissues analyzed. Unlike the pCAG-pH2B-eGFP/MAR line, all Model II animals were healthy and multiple pregnancies have been established with progeny showing the expected Mendelian ratio for the transmission of the pH2B-eGFP. Expression of pH2B-eGFP was used to examine the timing of the maternal to zygotic transition after IVF, and to examine chromosome segregation of SCNT embryos. To our knowledge this is the first viable transgenic pig model with chromatin-associated eGFP allowing both cell tracking and the study of chromatin dynamics in a large animal model. PMID:28081156
Production of recombinant albumin by a herd of cloned transgenic cattle.
Echelard, Yann; Williams, Jennifer L; Destrempes, Margaret M; Koster, Julie A; Overton, Susan A; Pollock, Daniel P; Rapiejko, Karen T; Behboodi, Esmail; Masiello, Nicholas C; Gavin, William G; Pommer, Jerry; Van Patten, Scott M; Faber, David C; Cibelli, Jose B; Meade, Harry M
2009-06-01
Purified plasma derived human albumin has been available as a therapeutic product since World War II. However, cost effective recombinant production of albumin has been challenging due to the amount needed and the complex folding pattern of the protein. In an effort to provide an abundant source of recombinant albumin, a herd of transgenic cows expressing high levels of rhA in their milk was generated. Expression cassettes efficiently targeting the secretion of human albumin to the lactating mammary gland were obtained and tested in transgenic mice. A high expressing transgene was transfected in primary bovine cell lines to produce karyoplasts for use in a somatic cell nuclear transfer program. Founder transgenic cows were produced from four independent cell lines. Expression levels varying from 1-2 g/l to more than 40 g/l of correctly folded albumin were observed. The animals expressing the highest levels of rhA exhibited shortened lactation whereas cows yielding 1-2 g/l had normal milk production. This herd of transgenic cattle is an easily scalable and well characterized source of rhA for biomedical uses.
[TSA improve transgenic porcine cloned embryo development and transgene expression].
Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua
2011-07-01
Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.
Viejo-Borbolla, A; Pizzato, M; Blair, E D; Schulz, T F
2005-03-01
Several groups have inserted targeting domains into the envelope glycoprotein (Env) of Moloney murine leukemia virus (MoMLV) in an attempt to produce targeted retroviral vectors for human gene therapy. While binding of these modified Envs to the target molecule expressed on the surface of human cells was observed, specific high-titer infection of human cells expressing the target molecule was not achieved. Here we investigate the initial steps in the entry process of targeted MoMLV vectors both in murine and human cells expressing the MoMLV receptor, the mouse cationic amino acid transporter-1 (mCAT-1). We show that insertion of a small ligand targeted to E-selectin and of a single chain antibody (scFv) targeted to folate-binding protein (FBP) into the N-terminus of MoMLV Env results in the reduction of the infectivity and the kinetics of entry of the MoMLV vectors. The use of soluble receptor-binding domain (sRBD), bafilomycin A1 (BafA1) and methyl-beta-cyclodextrin (MbetaC) increase the infectivity of the MoMLV vectors targeted to FBP (MoMLV-FBP) suggesting that the scFv targeted to FBP increases the threshold for fusion and might re-route entry of the targeted MoMLV-FBP vector towards an endocytic, non-productive pathway.
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Power, Christopher; Hui, Elizabeth; Vivithanaporn, Pornpun; Acharjee, Shaona; Polyak, Maria
2012-06-01
HIV-associated neurocognitive disorders (HAND) represent a constellation of neurological disabilities defined by neuropsychological impairments, neurobehavioral abnormalities and motor deficits. To gain insights into the mechanisms underlying the development of these disabilities, several transgenic models have been developed over the past two decades, which have provided important information regarding the cellular and molecular factors contributing to the neuropathogenesis of HAND. Herein, we concentrate on the neuropathogenic effects of HIV-1 Vpr expressed under the control of c-fms, resulting transgene expression in myeloid cells in both the central and peripheral nervous systems. Vpr's actions, possibly through its impact on cell cycle machinery, in brain culminate in neuronal and astrocyte injury and death through apoptosis involving activation of caspases-3, -6 and -9 depending on the individual target cell type. Indeed, these outcomes are also induced by soluble Vpr implying Vpr's effects stem from direct interaction with target cells. Remarkably, in vivo transgenic Vpr expression induces a neurodegenerative phenotype defined by neurobehavioral deficits and neuronal loss in the absence of frank inflammation. Implantation of another viral protein, hepatitis C virus (HCV) core, into Vpr transgenic animals' brains stimulated neuroinflammation and amplified the neurodegenerative disease phenotype, thereby recapitulating HCV's putative neuropathogenic actions. The availability of different transgenic models to study HIV neuropathogenesis represents exciting and innovative approaches to understanding disease mechanisms and perhaps developing new therapeutic strategies in the future.
Chakravarthy, Balu; Ito, Shingo; Atkinson, Trevor; Gaudet, Chantal; Ménard, Michel; Brown, Leslie; Whitfield, James
2014-03-14
The synthetic ~5 kDa ABP (amyloid-ß binding peptide) consists of a region of the 228 kDa human pericentrioloar material-1 (PCM-1) protein that selectively and avidly binds in vitro Aβ1-42 oligomers, believed to be key co-drivers of Alzheimer's disease (AD), but not monomers (Chakravarthy et al., (2013) [3]). ABP also prevents Aß1-42 from triggering the apoptotic death of cultured human SHSY5Y neuroblasts, likely by sequestering Aß oligomers, suggesting that it might be a potential AD therapeutic. Here we support this possibility by showing that ABP also recognizes and binds Aβ1-42 aggregates in sections of cortices and hippocampi from brains of AD transgenic mice and human AD patients. More importantly, ABP targets Aβ1-42 aggregates when microinjected into the hippocampi of the brains of live AD transgenic mice. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.
Kimura, Yukiko; Hisano, Yu; Kawahara, Atsuo; Higashijima, Shin-ichi
2014-10-08
The type II bacterial CRISPR/Cas9 system is rapidly becoming popular for genome-engineering due to its simplicity, flexibility, and high efficiency. Recently, targeted knock-in of a long DNA fragment via homology-independent DNA repair has been achieved in zebrafish using CRISPR/Cas9 system. This raised the possibility that knock-in transgenic zebrafish could be efficiently generated using CRISPR/Cas9. However, how widely this method can be applied for the targeting integration of foreign genes into endogenous genomic loci is unclear. Here, we report efficient generation of knock-in transgenic zebrafish that have cell-type specific Gal4 or reporter gene expression. A donor plasmid containing a heat-shock promoter was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, a sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. We have succeeded in establishing stable knock-in transgenic fish with several different constructs for 4 genetic loci at a frequency being exceeding 25%. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic zebrafish.
[Nuclear transfer of goat somatic cells transgenic for human lactoferrin].
Li, Lan; Shen, Wei; Pan, Qing-Yu; Min, Ling-Jiang; Sun, Yu-Jiang; Fang, Yong-Wei; Deng, Ji-Xian; Pan, Qing-Jie
2006-12-01
Transgenic animal mammary gland bioreactors are being used to produce recombinant proteins with appropriate post-translational modifications, and nuclear transfer of transgenic somatic cells is a more powerful method to produce mammary gland bioreactor. Here we describe efficient gene transfer and nuclear transfer in goat somatic cells. Gene targeting vector pGBC2LF was constructed by cloning human lactoferrin (LF) gene cDNA into exon 2 of the milk goat beta-casein gene, and the endogenous start condon was replaced by that of human LF gene. Goat fetal fibroblasts were transfected with linearized pGBC2LF and 14 cell lines were positive according to PCR and Southern blot. The transgenic cells were used as donor cells of nuclear transfer, and some of reconstructed embryos could develop to blastocyst in vitro.
Transgenic animal models of neurodegeneration based on human genetic studies
Richie, Christopher T.; Hoffer, Barry J.; Airavaara, Mikko
2011-01-01
The identification of genes linked to neurodegenerative diseases such as Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD) and Parkinson's disease (PD) has led to the development of animal models for studying mechanism and evaluating potential therapies. None of the transgenic models developed based on disease-associated genes have been able to fully recapitulate the behavioral and pathological features of the corresponding disease. However, there has been enormous progress made in identifying potential therapeutic targets and understanding some of the common mechanisms of neurodegeneration. In this review, we will discuss transgenic animal models for AD, ALS, HD and PD that are based on human genetic studies. All of the diseases discussed have active or complete clinical trials for experimental treatments that benefited from transgenic models of the disease. PMID:20931247
NASA Astrophysics Data System (ADS)
Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard
Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.
Zhu, Jin-Qi; Liu, Shumin; Ma, Yao; Zhang, Jia-Qi; Qi, Hai-Sheng; Wei, Zhao-Jun; Yao, Qiong; Zhang, Wen-Qing; Li, Sheng
2012-01-01
The adoption of pest-resistant transgenic plants to reduce yield loss and pesticide utilization has been successful in the past three decades. Recently, transgenic plant expressing double-stranded RNA (dsRNA) targeting pest genes emerges as a promising strategy for improving pest resistance in crops. The steroid hormone, 20-hydroxyecdysone (20E), predominately controls insect molting via its nuclear receptor complex, EcR-USP. Here we report that pest resistance is improved in transgenic tobacco plants expressing dsRNA of EcR from the cotton bollworm, Helicoverpa armigera, a serious lepidopteran pest for a variety of crops. When H. armigera larvae were fed with the whole transgenic tobacco plants expressing EcR dsRNA, resistance to H. armigera was significantly improved in transgenic plants. Meanwhile, when H. armigera larvae were fed with leaves of transgenic tobacco plants expressing EcR dsRNA, its EcR mRNA level was dramatically decreased causing molting defects and larval lethality. In addition, the transgenic tobacco plants expressing H. armigera EcR dsRNA were also resistant to another lepidopteran pest, the beet armyworm, Spodoptera exigua, due to the high similarity in the nucleotide sequences of their EcR genes. This study provides additional evidence that transgenic plant expressing dsRNA targeting insect-associated genes is able to improve pest resistance.
Cardiac-Targeted Transgenic Mutant Mitochondrial Enzymes
Kohler, James J.; Hosseini, Seyed H.; Green, Elgin; Hoying-Brandt, Amy; Cucoranu, Ioan; Haase, Chad P.; Russ, Rodney; Srivastava, Jaya; Ivey, Kristopher; Ludaway, Tomika; Kapoor, Victor; Abuin, Allison; Shapoval, Alexsey; Santoianni, Robert; Saada, Ann; Elpeleg, Orly; Lewis, William
2009-01-01
Mitochondrial (mt) DNA biogenesis is critical to cardiac contractility. DNA polymerase gamma (pol γ) replicates mtDNA, whereas thymidine kinase 2 (TK2) monophosphorylates pyrimidines intramitochondrially. Point mutations in POLG and TK2 result in clinical diseases associated with mtDNA depletion and organ dysfunction. Pyrimidine analogs (NRTIs) inhibit Pol γ and mtDNA replication. Cardiac “dominant negative” murine transgenes (TGs; Pol γ Y955G, and TK2 H121N or I212N) defined the role of each in the heart. mtDNA abundance, histopathological features, histochemistry, mitochondrial protein abundance, morphometry, and echocardiography were determined for TGs in “2 × 2” studies with or without pyrimidine analogs. Cardiac mtDNA abundance decreased in Y955C TGs (∼50%) but increased in H121N and I212N TGs (20-70%). Succinate dehydrogenase (SDH) increased in hearts of all mutants. Ultrastructural changes occurred in Y955C and H121N TGs. Histopathology demonstrated hypertrophy in H121N, LV dilation in I212N, and both hypertrophy and dilation in Y955C TGs. Antiretrovirals increased LV mass (≈50%) for all three TGs which combined with dilation indicates cardiomyopathy. Taken together, these studies demonstrate three manifestations of cardiac dysfunction that depend on the nature of the specific mutation and antiretroviral treatment. Mutations in genes for mtDNA biogenesis increase risk for defective mtDNA replication, leading to LV hypertrophy. PMID:18446447
Frazier, Courtney L.; San Filippo, Joseph; Lambowitz, Alan M.; Mills, David A.
2003-01-01
Despite their commercial importance, there are relatively few facile methods for genomic manipulation of the lactic acid bacteria. Here, the lactococcal group II intron, Ll.ltrB, was targeted to insert efficiently into genes encoding malate decarboxylase (mleS) and tetracycline resistance (tetM) within the Lactococcus lactis genome. Integrants were readily identified and maintained in the absence of a selectable marker. Since splicing of the Ll.ltrB intron depends on the intron-encoded protein, targeted invasion with an intron lacking the intron open reading frame disrupted TetM and MleS function, and MleS activity could be partially restored by expressing the intron-encoded protein in trans. Restoration of splicing from intron variants lacking the intron-encoded protein illustrates how targeted group II introns could be used for conditional expression of any gene. Furthermore, the modified Ll.ltrB intron was used to separately deliver a phage resistance gene (abiD) and a tetracycline resistance marker (tetM) into mleS, without the need for selection to drive the integration or to maintain the integrant. Our findings demonstrate the utility of targeted group II introns as a potential food-grade mechanism for delivery of industrially important traits into the genomes of lactococci. PMID:12571038
Sun, Xiao; Zhou, Wen; Liu, Hao; Zhang, Aijun; Ai, Chao-Ren; Zhou, Shuang-Shuang; Zhou, Chang-Xiang; Wang, Man-Qun
2013-01-01
Background Transgenic Bt rice line T2A-1 expresses a synthesized cry2A gene that shows high resistance to Lepidoptera pests, including Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Pyralidae). Plant volatile orientation cues and the physical characteristics of the leaf surface play key roles in host location or host-plant acceptance of phytophagous insects. These volatile compounds and physical traits may become altered in Bt rice and it is not known whether this influences the behavior of C. medinalis when searching for oviposition sites. Results The results of electronic nose analysis showed that the Radar map of Bt rice cultivars was analogous to the non- Bt rice cultivars at each growing stage. PCA analysis was able to partly discriminate between some of the Bt vs. non-Bt rice sensors, but could not to separate Bt cultivars from non-Bt cultivars. The total ion chromatogram between Bt and non-Bt rice cultivars at the seedling, booting and tillering stages were similar and 25 main compounds were identified by GC-MS. For most compounds, there was no significant difference in compound quantities between Bt and non-Bt rice cultivars at equivalent growth stages. The densities of the tubercle papicles and the trichomes on the upper and lower surfaces were statistically equal in Bt and non-Bt rice. The target pest, C. medinalis, was attracted to host rice plants, but it could not distinguish between the transgenic and the isogenic rice lines. Conclusions There were no significant differences between the Bt rice line, T2A-1 and the non-Bt rice for volatiles produced or in its physical characteristics and there were no negative impacts on C. medinalis oviposition behavior. These results add to the mounting evidence that Bt rice has no negative impact on the target insect oviposition behavior. PMID:24244410
Jhappan, C; Geiser, A G; Kordon, E C; Bagheri, D; Hennighausen, L; Roberts, A B; Smith, G H; Merlino, G
1993-01-01
Transforming growth factor-beta 1 (TGF-beta 1) possesses highly potent, diverse and often opposing cell-specific activities, and has been implicated in the regulation of a variety of physiologic and developmental processes. To determine the effects of in vivo overexpression of TGF-beta 1 on mammary gland function, transgenic mice were generated harboring a fusion gene consisting of the porcine TGF-beta 1 cDNA placed under the control of regulatory elements of the pregnancy-responsive mouse whey-acidic protein (WAP) gene. Females from two of four transgenic lines were unable to lactate due to inhibition of the formation of lobuloalveolar structures and suppression of production of endogenous milk protein. In contrast, ductal development of the mammary glands was not overtly impaired. There was a complete concordance in transgenic mice between manifestation of the lactation-deficient phenotype and expression of RNA from the WAP/TGF-beta 1 transgene, which was present at low levels in the virgin gland, but was greatly induced at mid-pregnancy. TGF-beta 1 was localized to numerous alveoli and to the periductal extracellular matrix in the mammary gland of transgenic females late in pregnancy by immunohistochemical analysis. Glands reconstituted from cultured transgenic mammary epithelial cells duplicated the inhibition of lobuloalveolar development observed in situ in the mammary glands of pregnant transgenic mice. Results from this transgenic model strongly support the hypothesis that TGF-beta 1 plays an important in vivo role in regulating the development and function of the mammary gland. Images PMID:8491177
van Erp, Harrie; Shockey, Jay; Zhang, Meng; Adhikari, Neil D.; Browse, John
2015-01-01
One goal of green chemistry is the production of industrially useful fatty acids (FAs) in crop plants. We focus on hydroxy fatty acids (HFAs) and conjugated polyenoic FAs (α-eleostearic acids [ESAs]) using Arabidopsis (Arabidopsis thaliana) as a model. These FAs are found naturally in seed oils of castor (Ricinus communis) and tung tree (Vernicia fordii), respectively, and used for the production of lubricants, nylon, and paints. Transgenic oils typically contain less target FA than that produced in the source species. We hypothesized that competition between endogenous and transgenic isozymes for substrates limits accumulation of unique FAs in Arabidopsis seeds. This hypothesis was tested by introducing a mutation in Arabidopsis diacylglycerol acyltransferase1 (AtDGAT1) in a line expressing castor FA hydroxylase and acyl-Coenzyme A:RcDGAT2 in its seeds. This led to a 17% increase in the proportion of HFA in seed oil. Expression of castor phospholipid:diacylglycerol acyltransferase 1A in this line increased the proportion of HFA by an additional 12%. To determine if our observations are more widely applicable, we investigated if isozyme competition influenced production of ESA. Expression of tung tree FA conjugase/desaturase in Arabidopsis produced approximately 7.5% ESA in seed lipids. Coexpression of VfDGAT2 increased ESA levels to approximately 11%. Overexpression of VfDGAT2 combined with suppression of AtDGAT1 increased ESA accumulation to 14% to 15%. Our results indicate that isozyme competition is a limiting factor in the engineering of unusual FAs in heterologous plant systems and that reduction of competition through mutation and RNA suppression may be a useful component of seed metabolic engineering strategies. PMID:25739701
Yu, Tsong-Ann; Chiang, Chu-Hui; Wu, Hui-Wen; Li, Chin-Mei; Yang, Ching-Fu; Chen, Jun-Han; Chen, Yu-Wen; Yeh, Shyi-Dong
2011-03-01
Zucchini yellow mosaic virus (ZYMV) and Papaya ringspot virus type W (PRSV W) are major limiting factors for production of watermelon worldwide. For the effective control of these two viruses by transgenic resistance, an untranslatable chimeric construct containing truncated ZYMV coat protein (CP) and PRSV W CP genes was transferred to commercial watermelon cultivars by Agrobacterium-mediated transformation. Using our protocol, a total of 27 putative transgenic lines were obtained from three cultivars of 'Feeling' (23 lines), 'China baby' (3 lines), and 'Quality' (1 line). PCR and Southern blot analyses confirmed that the chimeric construct was incorporated into the genomic DNA of the transformants. Greenhouse evaluation of the selected ten transgenic lines of 'Feeling' cultivar revealed that two immune lines conferred complete resistance to ZYMV and PRSV W, from which virus accumulation were not detected by Western blotting 4 weeks after inoculation. The transgenic transcript was not detected, but small interfering RNA (siRNA) was readily detected from the two immune lines and T(1) progeny of line ZW 10 before inoculation, indicating that RNA-mediated post-transcriptional gene silencing (PTGS) is the underlying mechanism for the double-virus resistance. The segregation ratio of T(1) progeny of the immune line ZW10 indicated that the single inserted transgene is nuclearly inherited and associated with the phenotype of double-virus resistance as a dominant trait. The transgenic lines derived from the commercial watermelon cultivars have great potential for control of the two important viruses and can be implemented directly without further breeding.
High-throughput analysis of T-DNA location and structure using sequence capture
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
High-throughput analysis of T-DNA location and structure using sequence capture
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...
2015-10-07
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
Mahillon, Jacques; Chandler, Michael
1998-01-01
Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster.
Giordano, Ennio; Rendina, Rosaria; Peluso, Ivana; Furia, Maria
2002-01-01
Specific silencing of target genes can be induced in a variety of organisms by providing homologous double-stranded RNA molecules. In vivo, these molecules can be generated either by transcription of sequences having an inverted-repeat (IR) configuration or by simultaneous transcription of sense-antisense strands. Since IR constructs are difficult to prepare and can stimulate genomic rearrangements, we investigated the silencing potential of symmetrically transcribed sequences. We report that Drosophila transgenes whose sense-antisense transcription was driven by two convergent arrays of Gal4-dependent UAS sequences can induce specific, dominant, and heritable repression of target genes. This effect is not dependent on a mechanism based on homology-dependent DNA/DNA interactions, but is directly triggered by transcriptional activation and is accompanied by specific depletion of the endogenous target RNA. Tissue-specific induction of these transgenes restricts the target gene silencing to selected body domains, and spreading phenomena described in other cases of post-transcriptional gene silencing (PTGS) were not observed. In addition to providing an additional tool useful for Drosophila functional genomic analysis, these results add further strength to the view that events of sense-antisense transcription may readily account for some, if not all, PTGS-cosuppression phenomena and can potentially play a relevant role in gene regulation. PMID:11861567
José, Anabel; Sobrevals, Luciano; Miguel Camacho-Sánchez, Juan; Huch, Meritxell; Andreu, Núria; Ayuso, Eduard; Navarro, Pilar; Alemany, Ramon; Fillat, Cristina
2013-01-01
Gene-based anticancer therapies delivered by adenoviruses are limited by the poor viral distribution into the tumor. In the current work we have explored the feasibility of targeting pancreatic tumors through a loco-regional route. We have taken advantage of the ductal network in the pancreas to retrogradelly inject adenoviruses through the common bile duct in two different mouse models of pancreatic carcinogenesis: The transgenic Ela-myc mice that develop mixed neoplasms displaying both acinar-like and duct-like neoplastic cells affecting the whole pancreas; and mice bearing PANC-1 and BxPC-3 orthotopic xenografts that constitute a model of localized human neoplastic tumors. We studied tumor targeting and the anticancer effects of newly thymidine kinase-engineered adenoviruses both in vitro and in vivo, and conducted comparative studies between intraductal or intravenous administration. Our data indicate that the intraductal delivery of adenovirus efficiently targets pancreatic tumors in the two mouse models. The in vivo application of AduPARTKT plus ganciclovir (GCV) treatment induced tumor regression in Ela-myc mice. Moreover, the intraductal injection of ICOVIR15-TKT oncolytic adenoviruses significantly improved mean survival of mice bearing PANC-1 and BxPC-3 pancreatic xenografts from 30 to 52 days and from 20 to 68 days respectively (p less than 0.0001) when combined with GCV. Of notice, both AduPARTKT and ICOVIR15-TKT antitumoral responses were stronger by ductal viral application than intravenously, in line with the 38-fold increase in pancreas transduction observed upon ductal administration. In summary our data show that cytotoxic adenoviruses retrogradelly injected to the pancreas can be a feasible approach to treat localized pancreatic tumors.
Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917
Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.
Fonseca, Cátia; Planchon, Sébastien; Serra, Tânia; Chander, Subhash; Saibo, Nelson J M; Renaut, Jenny; Oliveira, M Margarida; Batista, Rita
2015-01-01
Identification of differences between genetically modified plants and their original counterparts plays a central role in risk assessment strategy. Our main goal was to better understand the relevance of transgene presence, genetic, and epigenetic changes induced by transgene insertion, and in vitro culture in putative unintended differences between a transgenic and its comparator. Thus, we have used multiplex fluorescence 2DE coupled with MS to characterize the proteome of three different rice lines (Oryza sativa L. ssp. japonica cv. Nipponbare): a control conventional line (C), an Agrobacterium-transformed transgenic line (Ta) and a negative segregant (NSb). We observed that Ta and NSb appeared identical (with only one spot differentially abundant--fold difference ≥ 1.5), contrasting with the control (49 spots with fold difference ≥ 1.5, in both Ta and NSb vs. control). Given that in vitro culture was the only event in common between Ta and NSb, we hypothesize that in vitro culture stress was the most relevant condition contributing for the observed proteomic differences. MS protein identification support our hypothesis, indicating that Ta and NSb lines adjusted their metabolic pathways and altered the abundance of several stress related proteins in order to cope with in vitro culture. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu
2015-01-01
ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037
Ectopic transgene expression in the retina of four transgenic mouse lines
Gábriel, Robert; Erdélyi, Ferenc; Szabó, Gábor; Lawrence, J. Josh
2017-01-01
Retinal expression of transgenes was examined in four mouse lines. Two constructs were driven by the choline acetyltransferase (ChAT) promoter: green fluorescent protein conjugated to tau protein (tau-GFP) or cytosolic yellow fluorescent protein (YFP) generated through CRE recombinase-induced expression of Rosa26 (ChAT-CRE/ Rosa26YFP). Two other constructs targeted inhibitory interneurons: GABAergic horizontal and amacrine cells identified by glutamic acid decarboxylase (GAD65-GFP) or parvalbumin (PV) cells (PV-CRE/Rosa26YFP). Animals were transcardially perfused and retinal sections prepared. Antibodies against PV, calretinin (CALR), calbindin (CALB), and tyrosine hydroxylase (TH) were used to counterstain transgene-expressing cells. In PVxRosa and ChAT-tauGFP constructs, staining appeared in vertically oriented row of processes resembling Müller cells. In the ChATxRosa construct, populations of amacrine cells and neurons in the ganglion cell layer were labeled. Some cones also exhibited GFP fluorescence. CALR, PV and TH were found in none of these cells. Occasionally, we found GFP/ CALR and GFP/PV double-stained cells in the ganglion cell layer (GCL). In the GAD65-GFP construct, all layers of the neuroretina were labeled, except photoreceptors. Not all horizontal cells expressed GFP. We did not find GFP/TH double-labeled cells and GFP was rarely present in CALR-and CALB-containing cells. Many PV-positive neurons were also labeled for GFP, including small diameter amacrines. In the GCL, single labeling for GFP and PV was ascertained, as well as several CALR/PV double-stained neurons. In the GCL, cells triple labeled with GFP/CALR/ CALB were sparse. In conclusion, only one of the four transgenic constructs exhibited an expression pattern consistent with endogenous retinal protein expression, while the others strongly suggested ectopic gene expression. PMID:26563404
Family of pH-Low-Insertion-Peptides (pHLIPs)
NASA Astrophysics Data System (ADS)
Weerakkody, Dhammika; Moshnikova, Anna; Moshnikova, Valentina; Thakur, Mak; Rossi, Bethany; Engelman, Donald; Andreev, Oleg; Reshetnyak, Yana
2012-02-01
pHLIP (pH (Low) Insertion Peptide) is a novel delivery system for targeting of acidic diseased tissue such as solid tumors, sites of inflammation, arthritis and other pathological states. The molecular mechanism of pHLIP action is based on pH-dependent insertion and folding of pHLIP in membrane. We performed sequence variation and investigated 16 pHLIP variants with main goals of understanding the main principles of peptide-lipid interactions and tune delivery capability of pHLIP. The biophysical studies including thermodynamics and kinetics of the peptides interaction with a lipid bilayer of liposomes and cellular membranes were carried out. We found that peptides association to membrane at neutral and low pH could be modulated by 3-4 times. The apparent pK of transition from surface bound to membrane-inserted state could be tuned from 6.5 to 4.5. The rate of peptide's insertion across a bilayer could be enhanced 100 times compared to parent pHLIP. As a result, blood clearance and tumor targeting were modulated in a significant degree. The work is supported by NIH grants CA133890 to OAA, DME, YRK.
Krylov, V; Tlapáková, T; Mácha, J; Curlej, J; Ryban, L; Chrenek, P
2008-01-01
For chromosomal localization of the hFVIII human transgene in F2 and F3 generation of transgenic rabbits, FISH-TSA was applied. A short cDNA probe (1250 bp) targeted chromosomes 3, 7, 8, 9 and 18 of an F2 male (animal 1-3-8). Two transgenic offspring (F3) revealed signal positions in chromosome 3 and chromosomes 3 and 7, respectively. Sequencing and structure analysis of the rabbit orthologous gene revealed high similarity to its human counterpart. Part of the sequenced cDNA (1310 bp) served as a probe for FISH-TSA analysis. The rabbit gene was localized in the q arm terminus of the X chromosome. This result is in agreement with reciprocal chromosome painting between the rabbit and the human. The presented FISH-TSA method provides strong signals without any interspecies reactivity.
Gardner, Courtney M; Gwin, Carley A; Gunsch, Claudia K
2018-04-01
The use of transgenic crops has become increasingly common in the United States over the last several decades. Increasing evidence suggests that DNA may be protected from enzymatic digestion and acid hydrolysis in the digestive tract, suggesting that crop-derived transgenes may enter into wastewater treatment plants (WWTPs) intact. Given the historical use of antibiotic resistance genes as selection markers in transgenic crop development, it is important to consider the fate of these transgenes. Herein we detected and quantified crop-derived transgenes in WWTPs. All viable US WWTP samples were found to contain multiple gene targets (p35, nos, bla and nptII) at significantly higher levels than control samples. Control wastewater samples obtained from France, where transgenic crops are not cultivated, contained significantly fewer copies of the nptII gene than US activated and digester sludges. No significant differences were measured for the bla antibiotic resistance gene (ARG). In addition, a nested PCR (polymerase chain reaction) assay was developed that targeted the bla ARG located in regions flanked by the p35 promoter and nos terminator. Overall this work suggests that transgenic crops may have provided an environmental source of nptII; however, follow-up studies are needed to ascertain the viability of these genes as they exit WWTPs.
Wahnschaffe, U; Bitsch, A; Kielhorn, J; Mangelsdorf, I
2005-01-01
As part of a larger literature study on transgenic animals in mutagenicity testing, test results from the transgenic mutagenicity assays (lacI model; commercially available as the Big Blue® mouse, and the lacZ model; commercially available as the Muta™Mouse), were compared with the results on the same substances in the more traditional mouse bone marrow micronucleus test. 39 substances were found which had been tested in the micronucleus assay and in the above transgenic mouse systems. Although, the transgenic animal mutation assay is not directly comparable with the micronucleus test, because different genetic endpoints are examined: chromosome aberration versus gene mutation, the results for the majority of substances were in agreement. Both test systems, the transgenic mouse assay and the mouse bone marrow micronucleus test, have advantages and they complement each other. However, the transgenic animal assay has some distinct advantages over the micronucleus test: it is not restricted to one target organ and detects systemic as well as local mutagenic effects. PMID:15655069
Colitz, C M; Malarkey, D E; Woychik, R P; Wilkinson, J E
2000-09-01
Persistent hyperplastic tunica vasculosa lentis and persistent hyperplastic primary vitreous are congenital ocular anomalies that can lead to cataract formation. A line of insertional mutant mice, TgN3261Rpw, generated at the Oak Ridge National Laboratory in a large-scale insertional mutagenesis program was found to have a low incidence (8/243; 3.29%) of multiple developmental ocular abnormalities. The ocular abnormalities include persistent hyperplastic primary vitreous, persistent hyperplastic tunica vasculosa lentis, failure of cleavage of the anterior segment, retrolental fibrovascular membrane, posterior polar cataract, and detached retina. This transgenic mouse line provides an ontogenetic model because of the high degree of similarity of this entity in humans, dogs, and mice.
NASA Technical Reports Server (NTRS)
Love, J.; Scott, A. C.; Thompson, W. F.; Brown, C. S. (Principal Investigator)
2000-01-01
We show that the tightly regulated tetracycline-sensitive Top10 promoter system (Weinmann et al. Plant J. 1994, 5, 559-569) is functional in Arabidopsis thaliana. A pure breeding A. thaliana line (JL-tTA/8) was generated which expressed a chimeric fusion of the tetracycline repressor and the activation domain of Herpes simplex virus (tTA), from a single transgenic locus. Plants from this line were crossed with transgenics carrying the ER-targeted green fluorescent protein coding sequence (mGFP5) under control of the Top10 promoter sequence. Progeny from this cross displayed ER-targeted GFP fluorescence throughout the plant, indicating that the tTA-Top10 promoter interaction was functional in A. thaliana. GFP expression was repressed by 100 ng ml-1 tetracycline, an order of magnitude lower than the concentration used previously to repress expression in Nicotiana tabacum. Moreover, the level of GFP expression was controlled by varying the concentration of tetracycline in the medium, allowing a titred regulation of transgenic activity that was previously unavailable in A. thaliana. The kinetics of GFP activity were determined following de-repression of the Top10:mGFP5 transgene, with a visible ER-targeted GFP signal appearing from 24 to 48 h after de-repression.
Lilley, Catherine J.; Urwin, Peter E.; Atkinson, Howard J.
2012-01-01
Current and future global crop yields depend upon soil quality to which soil organisms make an important contribution. The European Union seeks to protect European soils and their biodiversity for instance by amending its Directive on pesticide usage. This poses a challenge for control of Globodera pallida (a potato cyst nematode) for which both natural resistance and rotational control are inadequate. One approach of high potential is transgenically based resistance. This work demonstrates the potential in the field of a new transgenic trait for control of G. pallida that suppresses root invasion. It also investigates its impact and that of a second transgenic trait on the non-target soil nematode community. We establish that a peptide that disrupts chemoreception of nematodes without a lethal effect provides resistance to G. pallida in both a containment and a field trial when precisely targeted under control of a root tip-specific promoter. In addition we combine DNA barcoding and quantitative PCR to recognise nematode genera from soil samples without microscope-based observation and use the method for nematode faunal analysis. This approach establishes that the peptide and a cysteine proteinase inhibitor that offer distinct bases for transgenic plant resistance to G. pallida do so without impact on the non-target nematode soil community. PMID:22359559
Green, Jayne; Wang, Dong; Lilley, Catherine J; Urwin, Peter E; Atkinson, Howard J
2012-01-01
Current and future global crop yields depend upon soil quality to which soil organisms make an important contribution. The European Union seeks to protect European soils and their biodiversity for instance by amending its Directive on pesticide usage. This poses a challenge for control of Globodera pallida (a potato cyst nematode) for which both natural resistance and rotational control are inadequate. One approach of high potential is transgenically based resistance. This work demonstrates the potential in the field of a new transgenic trait for control of G. pallida that suppresses root invasion. It also investigates its impact and that of a second transgenic trait on the non-target soil nematode community. We establish that a peptide that disrupts chemoreception of nematodes without a lethal effect provides resistance to G. pallida in both a containment and a field trial when precisely targeted under control of a root tip-specific promoter. In addition we combine DNA barcoding and quantitative PCR to recognise nematode genera from soil samples without microscope-based observation and use the method for nematode faunal analysis. This approach establishes that the peptide and a cysteine proteinase inhibitor that offer distinct bases for transgenic plant resistance to G. pallida do so without impact on the non-target nematode soil community.
Thamake, S I; Raut, S L; Ranjan, A P; Gryczynski, Z; Vishwanatha, J K
2011-01-21
This work reports the surface functionalization of polymeric PLGA nanoparticles by non-covalent insertion of a homo-bifunctional chemical crosslinker, bis(sulfosuccinimidyl) suberate (BS3) for targeted cancer therapy. We dissolved BS3 in aqueous solution of PVA during formulation of nanoparticles by a modified solid/oil/water emulsion solvent evaporation method. The non-covalent insertion of BS3 was confirmed by Fourier transform infrared (FTIR) spectroscopy. Curcumin and annexin A2 were used as a model drug and a cell specific target, respectively. Nanoparticles were characterized for particle size, zeta potential and surface morphology. The qualitative assessment of antibody attachment was performed by transmission electron microscopy (TEM) as well as confocal microscopy. The optimized formulation showed antibody attachment of 86%. However, antibody attachment was abolished upon blocking the functional groups of BS3. The availability of functional antibodies was evaluated by the presence of a light chain fraction after gel electrophoresis. We further evaluated the in vitro release kinetics of curcumin from antibody coated and uncoated nanoparticles. The release of curcumin is enhanced upon antibody attachment and followed an anomalous release pattern. We also observed that the cellular uptake of nanoparticles was significantly higher in annexin A2 positive cells than in negative cells. Therefore, these results demonstrate the potential use of this method for functionalization as well as to deliver chemotherapeutic agents for treating cancer.
NASA Astrophysics Data System (ADS)
Thamake, S. I.; Raut, S. L.; Ranjan, A. P.; Gryczynski, Z.; Vishwanatha, J. K.
2011-01-01
This work reports the surface functionalization of polymeric PLGA nanoparticles by non-covalent insertion of a homo-bifunctional chemical crosslinker, bis(sulfosuccinimidyl) suberate (BS3) for targeted cancer therapy. We dissolved BS3 in aqueous solution of PVA during formulation of nanoparticles by a modified solid/oil/water emulsion solvent evaporation method. The non-covalent insertion of BS3 was confirmed by Fourier transform infrared (FTIR) spectroscopy. Curcumin and annexin A2 were used as a model drug and a cell specific target, respectively. Nanoparticles were characterized for particle size, zeta potential and surface morphology. The qualitative assessment of antibody attachment was performed by transmission electron microscopy (TEM) as well as confocal microscopy. The optimized formulation showed antibody attachment of 86%. However, antibody attachment was abolished upon blocking the functional groups of BS3. The availability of functional antibodies was evaluated by the presence of a light chain fraction after gel electrophoresis. We further evaluated the in vitro release kinetics of curcumin from antibody coated and uncoated nanoparticles. The release of curcumin is enhanced upon antibody attachment and followed an anomalous release pattern. We also observed that the cellular uptake of nanoparticles was significantly higher in annexin A2 positive cells than in negative cells. Therefore, these results demonstrate the potential use of this method for functionalization as well as to deliver chemotherapeutic agents for treating cancer.
THE POTENTIAL ROLE OF REMOTE SENSING IN TRANSGENIC CROP MONITORING PROGRAMS
Sustainable agriculture combines efficient production with wise stewardship of the earth's resources. Development of environmentally benign production techniques is one focus of sustainable agriculture. The new transgenic crops producing toxic proteins that target specific crop p...
Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D
2011-09-01
Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.
Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A
2009-01-01
Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867
Transgenic algae engineered for higher performance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J
The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system.
Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei
2017-03-13
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H + -pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6-81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome.
Germ-Line Recombination Activity of the Widely Used hGFAP-Cre and Nestin-Cre Transgenes
Zhang, Jiong; Dublin, Pavel; Griemsmann, Stephanie; Klein, Alexandra; Brehm, Ralph; Bedner, Peter; Fleischmann, Bernd K.; Steinhäuser, Christian; Theis, Martin
2013-01-01
Herein we demonstrate with PCR, immunodetection and reporter gene approaches that the widely used human Glial Fibrillary Acidic Protein (hGFAP)-Cre transgene exhibits spontaneous germ-line recombination activity in leading to deletion in brain, heart and tail tissue with high frequency. The ectopic activity of hGFAP-Cre requires a rigorous control. We likewise observed that a second widely used nestin-Cre transgene shows germ-line deletion. Here we describe procedures to identify mice with germ-line recombination mediated by the hGFAP-Cre and nestin-Cre transgenes. Such control is essential to avoid pleiotropic effects due to germ-line deletion of loxP-flanked target genes and to maintain the CNS-restricted deletion status in transgenic mouse colonies. PMID:24349371
2014-01-01
Background The Sterile Insect Technique (SIT) is an accepted species-specific genetic control approach that acts as an insect birth control measure, which can be improved by biotechnological engineering to facilitate its use and widen its applicability. First transgenic insects carrying a single killing system have already been released in small scale trials. However, to evade resistance development to such transgenic approaches, completely independent ways of transgenic killing should be established and combined. Perspective Most established transgenic sexing and reproductive sterility systems are based on the binary tTA expression system that can be suppressed by adding tetracycline to the food. However, to create 'redundant killing' an additional independent conditional expression system is required. Here we present a perspective on the use of a second food-controllable binary expression system - the inducible Q system - that could be used in combination with site-specific recombinases to generate independent transgenic killing systems. We propose the combination of an already established transgenic embryonic sexing system to meet the SIT requirement of male-only releases based on the repressible tTA system together with a redundant male-specific reproductive sterility system, which is activated by Q-system controlled site-specific recombination and is based on a spermatogenesis-specifically expressed endonuclease acting on several species-specific target sites leading to chromosome shredding. Conclusion A combination of a completely independent transgenic sexing and a redundant reproductive male sterility system, which do not share any active components and mediate the induced lethality by completely independent processes, would meet the 'redundant killing' criteria for suppression of resistance development and could therefore be employed in large scale long-term suppression programs using biotechnologically enhanced SIT. PMID:25471733
Brain selective transgene expression in zebrafish using an NRSE derived motif
Bergeron, Sadie A.; Hannan, Markus C.; Codore, Hiba; Fero, Kandice; Li, Grace H.; Moak, Zachary; Yokogawa, Tohei; Burgess, Harold A.
2012-01-01
Transgenic technologies enable the manipulation and observation of circuits controlling behavior by permitting expression of genetically encoded reporter genes in neurons. Frequently though, neuronal expression is accompanied by transgene expression in non-neuronal tissues, which may preclude key experimental manipulations, including assessment of the contribution of neurons to behavior by ablation. To better restrict transgene expression to the nervous system in zebrafish larvae, we have used DNA sequences derived from the neuron-restrictive silencing element (NRSE). We find that one such sequence, REx2, when used in conjunction with several basal promoters, robustly suppresses transgene expression in non-neuronal tissues. Both in transient transgenic experiments and in stable enhancer trap lines, suppression is achieved without compromising expression within the nervous system. Furthermore, in REx2 enhancer trap lines non-neuronal expression can be de-repressed by knocking down expression of the NRSE binding protein RE1-silencing transcription factor (Rest). In one line, we show that the resulting pattern of reporter gene expression coincides with that of the adjacent endogenous gene, hapln3. We demonstrate that three common basal promoters are susceptible to the effects of the REx2 element, suggesting that this method may be useful for confining expression from many other promoters to the nervous system. This technique enables neural specific targeting of reporter genes and thus will facilitate the use of transgenic methods to manipulate circuit function in freely behaving larvae. PMID:23293587
Landscape of Insertion Polymorphisms in the Human Genome
Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.
2015-01-01
Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018
Tolmachov, Oleg E
2015-01-01
Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo
Javaid, Shaista; Amin, Imran; Jander, Georg; Mukhtar, Zahid; Saeed, Nasir A; Mansoor, Shahid
2016-10-06
The first generation transgenic crops used strong constitutive promoters for transgene expression. However, tissue-specific expression is desirable for more precise targeting of transgenes. Moreover, piercing/sucking insects, which are generally resistant to insecticidal Bacillus thuringiensis (Bt) proteins, have emerged as a major pests since the introduction of transgenic crops expressing these toxins. Phloem-specific promoters isolated from Banana bunchy top virus (BBTV) were used for the expression of two insecticidal proteins, Hadronyche versuta (Blue Mountains funnel-web spider) neurotoxin (Hvt) and onion leaf lectin, in tobacco (Nicotiana tabacum). Here we demonstrate that transgenic plants expressing Hvt alone or in combination with onion leaf lectin are resistant to Phenacoccus solenopsis (cotton mealybug), Myzus persicae (green peach aphids) and Bemisia tabaci (silver leaf whitefly). The expression of both proteins under different phloem-specific promoters resulted in close to 100% mortality and provided more rapid protection than Hvt alone. Our results suggest the employment of the Hvt and onion leaf lectin transgenic constructs at the commercial level will reduce the use of chemical pesticides for control of hemipteran insect pests.
Haigler, Candace H; Singh, Bir; Zhang, Deshui; Hwang, Sangjoon; Wu, Chunfa; Cai, Wendy X; Hozain, Mohamed; Kang, Wonhee; Kiedaisch, Brett; Strauss, Richard E; Hequet, Eric F; Wyatt, Bobby G; Jividen, Gay M; Holaday, A Scott
2007-04-01
Prior data indicated that enhanced availability of sucrose, a major product of photosynthesis in source leaves and the carbon source for secondary wall cellulose synthesis in fiber sinks, might improve fiber quality under abiotic stress conditions. To test this hypothesis, a family of transgenic cotton plants (Gossypium hirsutum cv. Coker 312 elite) was produced that over-expressed spinach sucrose-phosphate synthase (SPS) because of its role in regulation of sucrose synthesis in photosynthetic and heterotrophic tissues. A family of 12 independent transgenic lines was characterized in terms of foreign gene insertion, expression of spinach SPS, production of spinach SPS protein, and development of enhanced extractable V (max) SPS activity in leaf and fiber. Lines with the highest V (max) SPS activity were further characterized in terms of carbon partitioning and fiber quality compared to wild-type and transgenic null controls. Leaves of transgenic SPS over-expressing lines showed higher sucrose:starch ratio and partitioning of (14)C to sucrose in preference to starch. In two growth chamber experiments with cool nights, ambient CO(2) concentration, and limited light below the canopy, the transgenic line with the highest SPS activity in leaf and fiber had higher fiber micronaire and maturity ratio associated with greater thickness of the cellulosic secondary wall.
Abdallah, Cosette; Lejamtel, Charlène; Benzoubir, Nassima; Battaglia, Serena; Sidahmed-Adrar, Nazha; Desterke, Christophe; Lemasson, Matthieu; Rosenberg, Arielle R; Samuel, Didier; Bréchot, Christian; Pflieger, Delphine; Le Naour, François; Bourgeade, Marie-Françoise
2017-08-22
Hepatitis C virus (HCV) is a leading cause of liver diseases including the development of hepatocellular carcinoma (HCC). Particularly, core protein has been involved in HCV-related liver pathologies. However, the impact of HCV core on signaling pathways supporting the genesis of HCC remains largely elusive. To decipher the host cell signaling pathways involved in the oncogenic potential of HCV core, a global quantitative phosphoproteomic approach was carried out. This study shed light on novel differentially phosphorylated proteins, in particular several components involved in translation. Among the eukaryotic initiation factors that govern the translational machinery, 4E-BP1 represents a master regulator of protein synthesis that is associated with the development and progression of cancers due to its ability to increase protein expression of oncogenic pathways. Enhanced levels of 4E-BP1 in non-modified and phosphorylated forms were validated in human hepatoma cells and in mouse primary hepatocytes expressing HCV core, in the livers of HCV core transgenic mice as well as in HCV-infected human primary hepatocytes. The contribution of HCV core in carcinogenesis and the status of 4E-BP1 expression and phosphorylation were studied in HCV core/Myc double transgenic mice. HCV core increased the levels of 4E-BP1 expression and phosphorylation and significantly accelerated the onset of Myc-induced tumorigenesis in these double transgenic mice. These results reveal a novel function of HCV core in liver carcinogenesis potentiation. They position 4E-BP1 as a tumor-specific target of HCV core and support the involvement of the 4E-BP1/eIF4E axis in hepatocarcinogenesis.
Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing
Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand
2013-01-01
Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038
Bishop, Kathleen A; Harrington, Anne; Kouranova, Evguenia; Weinstein, Edward J; Rosen, Clifford J; Cui, Xiaoxia; Liaw, Lucy
2016-07-07
Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP) had an initial goal to develop a public resource of mouse embryonic stem (ES) cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7), for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation. Copyright © 2016 Bishop et al.
Aroonsri, Aiyada; Akinola, Olugbenga; Posayapisit, Navaporn; Songsungthong, Warangkhana; Uthaipibull, Chairat; Kamchonwongpaisan, Sumalee; Gbotosho, Grace O; Yuthavong, Yongyuth; Shaw, Philip J
2016-07-01
The mode of action of many antimalarial drugs is unknown. Chemogenomic profiling is a powerful method to address this issue. This experimental approach entails disruption of gene function and phenotypic screening for changes in sensitivity to bioactive compounds. Here, we describe the application of reverse genetics for chemogenomic profiling in Plasmodium. Plasmodium falciparum parasites harbouring a transgenic insertion of the glmS ribozyme downstream of the dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene were used for chemogenomic profiling of antimalarial compounds to identify those which target DHFR-TS. DHFR-TS expression can be attenuated by exposing parasites to glucosamine. Parasites with attenuated DHFR-TS expression were significantly more sensitive to antifolate drugs known to target DHFR-TS. In contrast, no change in sensitivity to other antimalarial drugs with different modes of action was observed. Chemogenomic profiling was performed using the Medicines for Malaria Venture (Switzerland) Malaria Box compound library, and two compounds were identified as novel DHFR-TS inhibitors. We also tested the glmS ribozyme in Plasmodium berghei, a rodent malaria parasite. The expression of reporter genes with downstream glmS ribozyme could be attenuated in transgenic parasites comparable with that obtained in P. falciparum. The chemogenomic profiling method was applied in a P. berghei line expressing a pyrimethamine-resistant Toxoplasma gondii DHFR-TS reporter gene under glmS ribozyme control. Parasites with attenuated expression of this gene were significantly sensitised to antifolates targeting DHFR-TS, but not other drugs with different modes of action. In conclusion, these data show that the glmS ribozyme reverse genetic tool can be applied for identifying primary targets of antimalarial compounds in human and rodent malaria parasites. Copyright © 2016 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.
Jin, Chuan; Fotaki, Grammatiki; Ramachandran, Mohanraj; Nilsson, Berith; Essand, Magnus; Yu, Di
2016-07-01
Chimeric antigen receptor (CAR) T-cell therapy is a new successful treatment for refractory B-cell leukemia. Successful therapeutic outcome depends on long-term expression of CAR transgene in T cells, which is achieved by delivering transgene using integrating gamma retrovirus (RV) or lentivirus (LV). However, uncontrolled RV/LV integration in host cell genomes has the potential risk of causing insertional mutagenesis. Herein, we describe a novel episomal long-term cell engineering method using non-integrating lentiviral (NILV) vector containing a scaffold/matrix attachment region (S/MAR) element, for either expression of transgenes or silencing of target genes. The insertional events of this vector into the genome of host cells are below detection level. CD19 CAR T cells engineered with a NILV-S/MAR vector have similar levels of CAR expression as T cells engineered with an integrating LV vector, even after numerous rounds of cell division. NILV-S/MAR-engineered CD19 CAR T cells exhibited similar cytotoxic capacity upon CD19(+) target cell recognition as LV-engineered T cells and are as effective in controlling tumor growth in vivo We propose that NILV-S/MAR vectors are superior to current options as they enable long-term transgene expression without the risk of insertional mutagenesis and genotoxicity. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
Conservative site-specific and single-copy transgenesis in human LINE-1 elements
Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter
2016-01-01
Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710
Xu, Xiaoli; Peng, Cheng; Wang, Xiaofu; Chen, Xiaoyun; Wang, Qiang; Xu, Junfeng
2016-12-01
This study evaluated the applicability of droplet digital PCR (ddPCR) as a tool for maize zygosity determination using quantitative real-time PCR (qPCR) as a reference technology. Quantitative real-time PCR is commonly used to determine transgene copy number or GMO zygosity characterization. However, its effectiveness is based on identical reaction efficiencies for the transgene and the endogenous reference gene. Additionally, a calibrator sample should be utilized for accuracy. Droplet digital PCR is a DNA molecule counting technique that directly counts the absolute number of target and reference DNA molecules in a sample, independent of assay efficiency or external calibrators. The zygosity of the transgene can be easily determined using the ratio of the quantity of the target gene to the reference single copy endogenous gene. In this study, both the qPCR and ddPCR methods were used to determine insect-resistant transgenic maize IE034 zygosity. Both methods performed well, but the ddPCR method was more convenient because of its absolute quantification property.
Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John
2002-11-01
Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.
Gagliardi, Assunta; Zaninelli, Mauro; Bini, Luca; Baldi, Antonella; Caccianiga, Marco; Reggi, Serena; Rossi, Luciana
2017-01-01
Tobacco seeds show a coat-imposed dormancy in which the seed envelope tissues (testa and endosperm) impose a physical constraint on the radicle protrusion. The germination-limiting process is represented by the endosperm rupture which is induced by cell-wall weakening. Transgenic tobacco seeds, obtained by insertion of exogenous genes codifying for seed-based oral vaccines (F18 and VT2eB), showed retarded germination with respect to the wild type and modified the expression of endogenous proteins. Morphological and proteomic analyses of wild type and transgenic seeds revealed new insights into factors influencing seed germination. Our data showed that the interference of exogenous DNA influences the germination rather than the dormancy release, by modifying the maturation process. Dry seeds of F18 and VT2eB transgenic lines accumulated a higher amount of reserve and stress–related proteins with respect to the wild type. Moreover, the storage proteins accumulated in tobacco F18 and VT2eB dry seeds have structural properties that do not enable the early limited proteolysis observed in the wild type. Morphological observations by electron and light microscopy revealed a retarded mobilization of the storage material from protein and lipid bodies in transgenic seeds, thus impairing water imbibition and embryo elongation. In addition, both F18 and VT2eB dry seeds are more rounded than the wild type. Both the morphological and biochemical characteristics of transgenic seeds mimic the seed persistent profile, in which their roundness enables them to be buried in the soil, while the higher content of storage material enables the hypocotyl to elongate more and the cotyledons to emerge. PMID:29216220
Onelli, Elisabetta; Moscatelli, Alessandra; Gagliardi, Assunta; Zaninelli, Mauro; Bini, Luca; Baldi, Antonella; Caccianiga, Marco; Reggi, Serena; Rossi, Luciana
2017-01-01
Tobacco seeds show a coat-imposed dormancy in which the seed envelope tissues (testa and endosperm) impose a physical constraint on the radicle protrusion. The germination-limiting process is represented by the endosperm rupture which is induced by cell-wall weakening. Transgenic tobacco seeds, obtained by insertion of exogenous genes codifying for seed-based oral vaccines (F18 and VT2eB), showed retarded germination with respect to the wild type and modified the expression of endogenous proteins. Morphological and proteomic analyses of wild type and transgenic seeds revealed new insights into factors influencing seed germination. Our data showed that the interference of exogenous DNA influences the germination rather than the dormancy release, by modifying the maturation process. Dry seeds of F18 and VT2eB transgenic lines accumulated a higher amount of reserve and stress-related proteins with respect to the wild type. Moreover, the storage proteins accumulated in tobacco F18 and VT2eB dry seeds have structural properties that do not enable the early limited proteolysis observed in the wild type. Morphological observations by electron and light microscopy revealed a retarded mobilization of the storage material from protein and lipid bodies in transgenic seeds, thus impairing water imbibition and embryo elongation. In addition, both F18 and VT2eB dry seeds are more rounded than the wild type. Both the morphological and biochemical characteristics of transgenic seeds mimic the seed persistent profile, in which their roundness enables them to be buried in the soil, while the higher content of storage material enables the hypocotyl to elongate more and the cotyledons to emerge.
Bockamp, Ernesto; Sprengel, Rolf; Eshkind, Leonid; Lehmann, Thomas; Braun, Jan M; Emmrich, Frank; Hengstler, Jan G
2008-03-01
Many mouse models are currently available, providing avenues to elucidate gene function and to recapitulate specific pathological conditions. To a large extent, successful translation of clinical evidence or analytical data into appropriate mouse models is possible through progress in transgenic or gene-targeting technology. Beginning with a review of standard mouse transgenics and conventional gene targeting, this article will move on to discussing the basics of conditional gene expression: the tetracycline (tet)-off and tet-on systems based on the transactivators tet-controlled transactivator (Tta) and reverse tet-on transactivator (rtTA) that allow downregulation or induction of gene expression; Cre or Flp recombinase-mediated modifications, including excision, inversion, insertion and interchromosomal translocation; combination of the tet and Cre systems, permitting inducible knockout, reporter gene activation or activation of point mutations; the avian retroviral system based on delivery of rtTA specifically into cells expressing the avian retroviral receptor, which enables cell type-specific, inducible gene expression; the tamoxifen system, one of the most frequently applied steroid receptor-based systems, allows rapid activation of a fusion protein between the gene of interest and a mutant domain of the estrogen receptor, whereby activation does not depend on transcription; and techniques for cell type-specific ablation. The diphtheria toxin receptor system offers the advantage that it can be combined with the 'zoo' of Cre recombinase driver mice. Having described the basics we move on to the cutting edge: generation of genome-wide sets of conditional knockout mice. To this end, large ongoing projects apply two strategies: gene trapping based on random integration of trapping vectors into introns leading to truncation of the transcript, and gene targeting, representing the directed approach using homologous recombination. It can be expected that in the near
Targeting ornithine decarboxylase in Myc-induced lymphomagenesis prevents tumor formation.
Nilsson, Jonas A; Keller, Ulrich B; Baudino, Troy A; Yang, Chunying; Norton, Sara; Old, Jennifer A; Nilsson, Lisa M; Neale, Geoffrey; Kramer, Debora L; Porter, Carl W; Cleveland, John L
2005-05-01
Checkpoints that control Myc-mediated proliferation and apoptosis are bypassed during tumorigenesis. Genes encoding polyamine biosynthetic enzymes are overexpressed in B cells from E mu-Myc transgenic mice. Here, we report that disabling one of these Myc targets, Ornithine decarboxylase (Odc), abolishes Myc-induced suppression of the Cdk inhibitors p21(Cip1) and p27(Kip1), thereby impairing Myc's proliferative, but not apoptotic, response. Moreover, lymphoma development was markedly delayed in E mu-Myc;Odc(+/-) transgenic mice and in E mu-Myc mice treated with the Odc inhibitor difluoromethylornithine (DFMO). Strikingly, tumors ultimately arising in E mu-Myc;Odc(+/-) transgenics lacked deletions of Arf, suggesting that targeting Odc forces other routes of transformation. Therefore, Odc is a critical Myc transcription target that regulates checkpoints that guard against tumorigenesis and is an effective target for cancer chemoprevention.
Yurek, D M; Hasselrot, U; Cass, W A; Sesenoglu-Laird, O; Padegimas, L; Cooper, M J
2015-01-22
In previous studies that used compacted DNA nanoparticles (DNP) to transfect cells in the brain, we observed higher transgene expression in the denervated striatum when compared to transgene expression in the intact striatum. We also observed that long-term transgene expression occurred in astrocytes as well as neurons. Based on these findings, we hypothesized that the higher transgene expression observed in the denervated striatum may be a function of increased gliosis. Several aging studies have also reported an increase of gliosis as a function of normal aging. In this study we used DNPs that encoded for human glial cell line-derived neurotrophic factor (hGDNF) and either a non-specific human polyubiquitin C (UbC) or an astrocyte-specific human glial fibrillary acidic protein (GFAP) promoter. The DNPs were injected intracerebrally into the denervated or intact striatum of young, middle-aged or aged rats, and glial cell line-derived neurotrophic factor (GDNF) transgene expression was subsequently quantified in brain tissue samples. The results of our studies confirmed our earlier finding that transgene expression was higher in the denervated striatum when compared to intact striatum for DNPs incorporating either promoter. In addition, we observed significantly higher transgene expression in the denervated striatum of old rats when compared to young rats following injections of both types of DNPs. Stereological analysis of GFAP+ cells in the striatum confirmed an increase of GFAP+ cells in the denervated striatum when compared to the intact striatum and also an age-related increase; importantly, increases in GFAP+ cells closely matched the increases in GDNF transgene levels. Thus neurodegeneration and aging may lay a foundation that is actually beneficial for this particular type of gene therapy while other gene therapy techniques that target neurons are actually targeting cells that are decreasing as the disease progresses. Copyright © 2014 IBRO. Published by
Meyer, P; Heidmann, I
1994-05-25
We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.
Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and
Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and
Design and testing of microfabricated surgical tools for large animal probe insertion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jorgensen, Shelly
Neural probes provide therapeutic stimulation for neuropsychiatric disorders or record neural activity to investigate the workings of the brain. Researchers utilize 6 mm long temporary silicon stiffeners attached with biodissolvable adhesive to insert flexible neural probes into rat brains, but increasing the probe length fivefold makes inserting large animal probes a significant challenge because of an increased potential for buckling. This study compared the insertion success rates of 6 mm and 30 mm long silicon stiffeners that were 80 μm wide and 30 μm thick, and ascertained the material thickness and modulus of elasticity that would provide successful insertion formore » a 30 mm probe. Using a microdrive, stiffeners were inserted into an agarose brain phantom at controlled insertion speeds while being video-recorded. Twenty-five percent of the 30 mm silicon stiffeners fully inserted at speeds approximately four times higher than the target rate of 0.13 mm/s, while 100 percent of the 6 mm silicon stiffeners inserted successfully at target speed. Critical buckling loads (P cr) were calculated for the 6 mm and 30 mm silicon stiffeners, and for 30 mm diamond and tungsten stiffeners, with thicknesses varying from 30-80 μm. Increasing the thickness of the material by 10 μm, 20 μm and 30 μm improved the P cr by 2.4, 4.7 and 8.2 times, respectively, independent of the material, and substituting diamond for silicon multiplied the buckling capacity by 5.0 times. Stiffeners made of silicon for large animal probe insertion are not strong enough to withstand buckling upon insertion without a significant increase in thickness. Replacing silicon with diamond and increasing the thickness of the stiffener to 50 μm would afford a stiffener with the same P cr capacity as the 6 mm silicon stiffener that had a 100 percent insertion success rate. Experiments should continue with diamond to determine a minimum thickness that will ensure successful insertions and provide an
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larbouret, Christel; Robert, Bruno; Linard, Christine
2007-11-15
Purpose: Tumor necrosis factor-{alpha} (TNF-{alpha}) enhances radiotherapy (RT) killing of tumor cells in vitro and in vivo. To overcome systemic side effects, we used a bispecific antibody (BsAb) directed against carcinoembryonic antigen (CEA) and TNF-{alpha} to target this cytokine in a CEA-expressing colon carcinoma. We report the evaluation of this strategy in immunocompetent CEA-transgenic mice. Methods and Materials: The murine CEA-transfected colon carcinoma MC-38 was used for all experiments. In vitro, clonogenic assays were performed after RT alone, TNF-{alpha} alone, and RT plus TNF-{alpha}. In vivo, the mice were randomly assigned to treatment groups: control, TNF-{alpha}, BsAb, BsAb plus TNF-{alpha},more » RT, RT plus TNF-{alpha}, and RT plus BsAb plus TNF-{alpha}. Measurements of endogenous TNF-{alpha} mRNA levels and evaluation of necrosis (histologic evaluation) were assessed per treatment group. Results: In vitro, combined RT plus TNF-{alpha} resulted in a significant decrease in the survival fraction at 2 Gy compared with RT alone (p < 0.00001). In vivo, we observed a complete response in 5 (50%) of 10, 2 (20%) of 10, 2 (18.2%) of 11, and 0 (0%) of 12 treated mice in the RT plus BsAb plus TNF-{alpha}, RT plus TNF-{alpha}, RT alone, and control groups, respectively. This difference was statistically significant when TNF-{alpha} was targeted with the BsAb (p = 0.03). The addition of exogenous TNF-{alpha} to RT significantly increased the endogenous TNF-{alpha} mRNA level, particularly when TNF-{alpha} was targeted with BsAb (p < 0.01). The percentages of necrotic area were significantly augmented in the RT plus BsAb plus TNF-{alpha} group. Conclusion: These results suggest that targeting TNF-{alpha} with the BsAb provokes RT curability in a CEA-expressing digestive tumor syngenic model and could be considered as a solid rationale for clinical trials.« less
Cidade, Luciana C; de Oliveira, Tahise M; Mendes, Amanda F S; Macedo, Amanda F; Floh, Eny I S; Gesteira, Abelmon S; Soares-Filho, Walter S; Costa, Marcio G C
2012-12-01
Abscisic acid (ABA) is an important regulator of plant responses to environmental stresses and an absolute requirement for stress tolerance. Recently, a third phytoene synthase (PSY3) gene paralog was identified in monocots and demonstrated to play a specialized role in stress-induced ABA formation, thus suggesting that the first committed step in carotenogenesis is a key limiting step in ABA biosynthesis. To examine whether the ectopic expression of PSY, other than PSY3, would similarly affect ABA level and stress tolerance, we have produced transgenic tobacco containing a fruit-specific PSY (CpPSY) of grapefruit (Citrus paradisi Macf.). The transgenic plants contained a single- or double-locus insertion and expressed CpPSY at varying transcript levels. In comparison with the wild-type plants, the CpPSY expressing transgenic plants showed a significant increase on root length and shoot biomass under PEG-, NaCl- and mannitol-induced osmotic stress. The enhanced stress tolerance of transgenic plants was correlated with the increased endogenous ABA level and expression of stress-responsive genes, which in turn was correlated with the CpPSY copy number and expression level in different transgenic lines. Collectively, these results provide further evidence that PSY is a key enzyme regulating ABA biosynthesis and that the altered expression of other PSYs in transgenic plants may provide a similar function to that of the monocot's PSY3 in ABA biosynthesis and stress tolerance. The results also pave the way for further use of CpPSY, as well as other PSYs, as potential candidate genes for engineering tolerance to drought and salt stress in crop plants.
Smolka, Anders; Li, Xue-Yuan; Heikelt, Catrin; Welander, Margareta; Zhu, Li-Hua
2010-12-01
Although cultivation of genetic modified (GM) annual crops has been steadily increasing in the recent 10 years, the commercial cultivation of GM fruit tree is still very limited and reports of field trials on GM fruit trees are rare. This is probably because development and evaluation of GM fruit trees require a long period of time due to long life cycles of trees. In this study, we report results from a field trial on three rolB transgenic dwarfing apple rootstocks of M26 and M9 together with non-transgenic controls grafted with five non-transgenic scion cultivars. We intended to investigate the effects of transgenic rootstock on non-transgenic scion cultivars under natural conditions as well as to evaluate the potential value of using the rolB gene to modify difficult-to-root rootstocks of fruit trees. The results showed that all rolB transgenic rootstocks significantly reduced vegetative growth including tree height regardless of scion cultivar, compared with the non-transgenic rootstocks. Flowering and fruiting were also decreased for cultivars grown on the transgenic rootstocks in most cases, but the fruit quality was not clearly affected by the transgenic rootstocks. Cutting experiment and RT-PCR analysis showed that the rolB gene was stably expressed under field conditions. PCR and RT-PCR analyses displayed that the rolB gene or its mRNA were not detectable in the scion cultivars, indicating no translocation of the transgene or its mRNA from rootstock to scion. Our results suggest that rolB modified rootstocks should be used in combination with vigorous scion cultivars in order to obtain sufficient vegetative growth and good yield. Alternatively, the rolB gene could be used to dwarf vigorous rootstocks of fruit trees or produce bonzai plants as it can significantly reduce the vegetative growth of plants.
Kelly, Colleen K; Bowler, Michael; Breden, Felix
2006-01-01
The potential effects of ‘escape’ of genetically modified material (transgenes) into natural communities is a major concern in their use. These effects may be limited in the first instance by limiting the proportion of transgene-carrying plants in the natural community. We previously presented an analytical model of the ecological processes governing the relative abundance and persistence of insect resistance (IR) transgenes in a natural community. In that paper, we illustrated the case in which the transgene is input into the community in a single season using data from oilseed rape (OSR) and its known herbivore, Plutella macropennis. We found that the transgene is unlikely to have a great impact on the natural community. Here, we extend the model for repeated input of crop pollen carrying the transgene. We show the model output, again using OSR, for continuous input of the transgene over 10 years, the projected commercial lifetime of a transgene without associated undesirable agronomic effects. Our results do not change our original conclusion that the IR transgene need not have a large impact on the natural community and our suggestions for assessing and mitigating any threat still stand. PMID:17148386
Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.
Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L
2012-08-01
Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (P<0.05) protein expression of NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) , 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P<0.05) the abnormalities in protein expressions of p47(phox) , gp91(phox) (but not p67(phox) ) and 4-HNE, but only slightly (P>0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in
Targeting NADPH Oxidase Decreases Oxidative Stress in the Transgenic Sickle Cell Mouse Penis
Musicki, Biljana; Liu, Tongyun; Sezen, Sena F.; Burnett, Arthur L.
2012-01-01
Introduction Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. Aims We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. Methods SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67phox, p47phox, and gp91phox), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Main Outcome Measures Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Results Relative to hemi mice, SCD increased (P < 0.05) protein expression of NADPH oxidase subunits p67phox, p47phox, and gp91phox, 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P < 0.05) the abnormalities in protein expressions of p47phox, gp91phox (but not p67phox) and 4-HNE, but only slightly (P > 0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. Conclusion NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a
While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...
Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin
2005-04-01
Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.
Kunstfeld, Rainer; Hawighorst, Thomas; Streit, Michael; Hong, Young-Kwon; Nguyen, Lynh; Brown, Lawrence F; Detmar, Michael
2014-05-01
We have previously reported stromal upregulation of the endogenous angiogenesis inhibitor thrombospondin-2 (TSP-2) during multistep carcinogenesis, and we found accelerated and enhanced skin angiogenesis and carcinogenesis in TSP-2 deficient mice. To investigate whether enhanced levels of TSP-2 might protect from skin cancer development. We established transgenic mice with targeted overexpression of TSP-2 in the skin and subjected hemizygous TSP-2 transgenic mice and their wild-type littermates to a chemical skin carcinogenesis regimen. TSP-2 transgenic mice showed a significantly delayed onset of tumor formation compared to wild-type mice, whereas the ratio of malignant conversion to squamous cell carcinomas was comparable in both genotypes. Computer-assisted morphometric analysis of blood vessels revealed pronounced tumor angiogenesis already in the early stages of carcinogenesis in wild type mice. TSP-2 overexpression significantly reduced tumor blood vessel density in transgenic mice but had no overt effect on LYVE-1 positive lymphatic vessels. The percentage of desmin surrounded, mature tumor-associated blood vessels and the degree of epithelial differentiation remained unaffected. The antiangiogenic effect of transgenic TSP-2 was accompanied by a significantly increased number of apoptotic tumor cells in transgenic mice. Our results demonstrate that enhanced levels of TSP-2 in the skin result in reduced susceptibility to chemically-induced skin carcinogenesis and identify TSP-2 as a new target for the prevention of skin cancer. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system
Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei
2017-01-01
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H+-pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6–81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome. PMID:28287154
Martínez, R; Juncal, J; Zaldívar, C; Arenal, A; Guillén, I; Morera, V; Carrillo, O; Estrada, M; Morales, A; Estrada, M P
2000-01-07
Growth hormone (GH) has been shown to have a profound impact on fish physiology and metabolism. However, detailed studies in transgenic fish have not been conducted. We have characterized the food conversion efficiency, protein profile, and biochemical correlates of growth rate in transgenic tilapia expressing the tilapia GH cDNA under the control of human cytomegalovirus regulatory sequences. Transgenic tilapia exhibited about 3.6-fold less food consumption than nontransgenic controls (P < 0.001). The food conversion efficiency was significantly (P < 0.05) higher (290%) in transgenic tilapia (2.3 +/- 0.4) than in the control group (0.8 +/- 0.2). Efficiency of growth, synthesis retention, anabolic stimulation, and average protein synthesis were higher in transgenic than in nontransgenic tilapia. Distinctive metabolic differences were found in transgenic juvenile tilapia. We had found differences in hepatic glucose, and in agreement with previous results we observed differences in the level of enzymatic activities in target organs. We conclude that GH-transgenic juvenile tilapia show altered physiological and metabolic conditions and are biologically more efficient. Copyright 2000 Academic Press.
[Advances of transgenic breeding in livestock].
Yu, Da-Wei; Zhu, Hua-Bin; DU, Wei-Hua
2011-05-01
Transgenic technology represents a revolutionary way to produce elite livestock breeds, allowing introduction of alien gene into livestock genome. Currently, pronuclear microinjection of DNA and somatic cell nuclear transfer are two popular methods used to make transgenic farm animals. Transgenic technology can be used in livestock breeding for improving disease resistance, carcass composition, lactational performance, wool production, growth rate, and reproductive performance, as well as reducing negative environmental impact. In addition to introduction of animal transgenic technologies, this review described the status and the future perspective of transgenic breeding in livestock.
Orzechowski, Krystyna L; Swain, Marla D; Robl, Martin G; Tinaza, Constante A; Swaim, Heidi L; Jones, Yolanda L; Myers, Michael J; Yancy, Haile F
2012-09-01
To develop in genetically engineered mice an alternative screening method for evaluation of P-glycoprotein substrate toxicosis in ivermectin-sensitive Collies. 14 wild-type C57BL/6J mice (controls) and 21 genetically engineered mice in which the abcb1a and abcb1b genes were disrupted and the mutated canine ABCB1 gene was inserted. Mice were allocated to receive 10 mg of ivermectin/kg via SC injection (n = 30) or a vehicle-only formulation of propylene glycol and glycerol formal (5). Each was observed for clinical signs of toxic effects from 0 to 7 hours following drug administration. After ivermectin administration, considerable differences were observed in drug sensitivity between the 2 types of mice. The genetically engineered mice with the mutated canine ABCB1 gene had signs of severe sensitivity to ivermectin, characterized by progressive lethargy, ataxia, and tremors, whereas the wild-type control mice developed no remarkable effects related to the ivermectin. The ivermectin sensitivity modeled in the transgenic mice closely resembled the lethargy, stupor, disorientation, and loss of coordination observed in ivermectin-sensitive Collies with the ABCB1-1Δ mutation. As such, the model has the potential to facilitate toxicity assessments of certain drugs for dogs that are P-glycoprotein substrates, and it may serve to reduce the use of dogs in avermectin derivative safety studies that are part of the new animal drug approval process.
Iwanowicz, Luke R.; Hung, Alice L.; Blazer, Vicki S.; Halpern, Marnie E.
2014-01-01
Background: Environmental endocrine disruptors (EEDs) are exogenous chemicals that mimic endogenous hormones such as estrogens. Previous studies using a zebrafish transgenic reporter demonstrated that the EEDs bisphenol A and genistein preferentially activate estrogen receptors (ERs) in the larval heart compared with the liver. However, it was not known whether the transgenic zebrafish reporter was sensitive enough to detect estrogens from environmental samples, whether environmental estrogens would exhibit tissue-specific effects similar to those of BPA and genistein, or why some compounds preferentially target receptors in the heart. Methods: We tested surface water samples using a transgenic zebrafish reporter with tandem estrogen response elements driving green fluorescent protein expression (5xERE:GFP). Reporter activation was colocalized with tissue-specific expression of ER genes by RNA in situ hybridization. Results: We observed selective patterns of ER activation in transgenic fish exposed to river water samples from the Mid-Atlantic United States, with several samples preferentially activating receptors in embryonic and larval heart valves. We discovered that tissue specificity in ER activation was due to differences in the expression of ER subtypes. ERα was expressed in developing heart valves but not in the liver, whereas ERβ2 had the opposite profile. Accordingly, subtype-specific ER agonists activated the reporter in either the heart valves or the liver. Conclusion: The use of 5xERE:GFP transgenic zebrafish revealed an unexpected tissue-specific difference in the response to environmentally relevant estrogenic compounds. Exposure to estrogenic EEDs in utero was associated with adverse health effects, with the potentially unanticipated consequence of targeting developing heart valves. Citation: Gorelick DA, Iwanowicz LR, Hung AL, Blazer VS, Halpern ME. 2014. Transgenic zebrafish reveal tissue-specific differences in estrogen signaling in response to
Bogani, Patrizia; Spiriti, Maria Michela; Lazzarano, Stefano; Arcangeli, Annarosa; Buiatti, Marcello; Minunni, Maria
2011-11-01
The World Anti-Doping Agency fears the use of gene doping to enhance athletic performances. Thus, a bioanalytical approach based on end point PCR for detecting markers' of transgenesis traceability was developed. A few sequences from two different vectors using an animal model were selected and traced in different tissues and at different times. In particular, enhanced green fluorescent protein gene and a construct-specific new marker were targeted in the analysis. To make the developed detection approach open to future routine doping analysis, matrices such as urine and tears as well blood were also tested. This study will have impact in evaluating the vector transgenes traceability for the detection of a gene doping event by non-invasive sampling.
Transgenic tomatoes expressing human beta-amyloid for use as a vaccine against Alzheimer's disease.
Youm, Jung Won; Jeon, Jae Heung; Kim, Hee; Kim, Young Ho; Ko, Kisung; Joung, Hyouk; Kim, Hyunsoon
2008-10-01
Human beta-amyloid (Abeta) is believed to be one of the main components of Alzheimer's disease, so reduction of Abeta is considered a key therapeutic target. Using Agrobacterium-mediated nuclear transformation, we generated transgenic tomatoes for Abeta with tandem repeats. Integration of the human Abeta gene into the tomato genome and its transcription were detected by PCR and Northern blot, respectively. Expression of the Abeta protein was confirmed by western blot and ELISA, and then the transgenic tomato line expressing the highest protein level was selected for vaccination. Mice immunized orally with total soluble extracts from the transgenic tomato plants elicited an immune response after receiving a booster. The results indicate that tomato plants may provide a useful system for the production of human Abeta antigen.
Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.
Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M
2015-02-18
Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gorelick, Daniel A; Iwanowicz, Luke R; Hung, Alice L; Blazer, Vicki S; Halpern, Marnie E
2014-04-01
Environmental endocrine disruptors (EEDs) are exogenous chemicals that mimic endogenous hormones such as estrogens. Previous studies using a zebrafish transgenic reporter demonstrated that the EEDs bisphenol A and genistein preferentially activate estrogen receptors (ERs) in the larval heart compared with the liver. However, it was not known whether the transgenic zebrafish reporter was sensitive enough to detect estrogens from environmental samples, whether environmental estrogens would exhibit tissue-specific effects similar to those of BPA and genistein, or why some compounds preferentially target receptors in the heart. We tested surface water samples using a transgenic zebrafish reporter with tandem estrogen response elements driving green fluorescent protein expression (5xERE:GFP). Reporter activation was colocalized with tissue-specific expression of ER genes by RNA in situ hybridization. We observed selective patterns of ER activation in transgenic fish exposed to river water samples from the Mid-Atlantic United States, with several samples preferentially activating receptors in embryonic and larval heart valves. We discovered that tissue specificity in ER activation was due to differences in the expression of ER subtypes. ERα was expressed in developing heart valves but not in the liver, whereas ERβ2 had the opposite profile. Accordingly, subtype-specific ER agonists activated the reporter in either the heart valves or the liver. The use of 5xERE:GFP transgenic zebrafish revealed an unexpected tissue-specific difference in the response to environmentally relevant estrogenic compounds. Exposure to estrogenic EEDs in utero was associated with adverse health effects, with the potentially unanticipated consequence of targeting developing heart valves.
Gorelick, Daniel A.; Iwanowicz, Luke R.; Hung, Alice L.; Blazer, Vicki; Halpern, Marnie E.
2014-01-01
Background: Environmental endocrine disruptors (EED) are exogenous chemicals that mimic endogenous hormones, such as estrogens. Previous studies using a zebrafish transgenic reporter demonstrated that the EEDs bisphenol A and genistein preferentially activate estrogen receptors (ER) in the larval heart compared to the liver. However, it was not known whether the transgenic zebrafish reporter was sensitive enough to detect estrogens from environmental samples, whether environmental estrogens would exhibit similar tissue-specific effects as BPA and genistein or why some compounds preferentially target receptors in the heart. Methods: We tested surface water samples using a transgenic zebrafish reporter with tandem estrogen response elements driving green fluorescent protein expression (5xERE:GFP). Reporter activation was colocalized with tissue-specific expression of estrogen receptor genes by RNA in situ hybridization. Results: Selective patterns of ER activation were observed in transgenic fish exposed to river water samples from the Mid-Atlantic United States, with several samples preferentially activating receptors in embryonic and larval heart valves. We discovered that tissue-specificity in ER activation is due to differences in the expression of estrogen receptor subtypes. ERα is expressed in developing heart valves but not in the liver, whereas ERβ2 has the opposite profile. Accordingly, subtype-specific ER agonists activate the reporter in either the heart valves or the liver. Conclusion: The use of 5xERE:GFP transgenic zebrafish has revealed an unexpected tissue-specific difference in the response to environmentally relevant estrogenic compounds. Exposure to estrogenic EEDs in utero is associated with adverse health effects, with the potentially unanticipated consequence of targeting developing heart valves.
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and
Liu, Yongbo; Liu, Fang; Wang, Chao; Quan, Zhanjun; Li, Junsheng
2016-09-15
The non-target effects of transgenic plants are issues of concern; however, their impacts in cultivated agricultural fields and adjacent natural aquatic ecosystems are poorly understood. We conducted field experiments during two growing seasons to determine the effects of cultivating Bacillus thuringiensis (Bt)-transgenic rice on the phytoplankton and zooplankton communities in a paddy field and an adjacent ditch. Bt toxin was detected in soil but not in water. Water quality was not significantly different between non-Bt and Bt rice fields, but varied among up-, mid- and downstream locations in the ditch. Cultivation of Bt-transgenic rice had no effects on zooplankton communities. Phytoplankton abundance and biodiversity were not significantly different between transgenic and non-transgenic rice fields in 2013; however, phytoplankton were more abundant in the transgenic rice field than in the non-transgenic rice field in 2014. Water quality and rice type explained 65.9% and 12.8% of this difference in 2014, respectively. Phytoplankton and zooplankton were more abundant in mid- and downstream, than upstream, locations in the ditch, an effect that we attribute to water quality differences. Thus, the release of Bt toxins into field water during the cultivation of transgenic crops had no direct negative effects on plankton community composition, but indirect effects that alter environmental conditions should be taken into account during the processes of management planning and policymaking. Copyright © 2016 Elsevier B.V. All rights reserved.
Głowacka, Katarzyna; Kromdijk, Johannes; Leonelli, Lauriebeth; Niyogi, Krishna K.; Clemente, Tom E.
2016-01-01
Abstract Stable transformation of plants is a powerful tool for hypothesis testing. A rapid and reliable evaluation method of the transgenic allele for copy number and homozygosity is vital in analysing these transformations. Here the suitability of Southern blot analysis, thermal asymmetric interlaced (TAIL‐)PCR, quantitative (q)PCR and digital droplet (dd)PCR to estimate T‐DNA copy number, locus complexity and homozygosity were compared in transgenic tobacco. Southern blot analysis and ddPCR on three generations of transgenic offspring with contrasting zygosity and copy number were entirely consistent, whereas TAIL‐PCR often underestimated copy number. qPCR deviated considerably from the Southern blot results and had lower precision and higher variability than ddPCR. Comparison of segregation analyses and ddPCR of T1 progeny from 26 T0 plants showed that at least 19% of the lines carried multiple T‐DNA insertions per locus, which can lead to unstable transgene expression. Segregation analyses failed to detect these multiple copies, presumably because of their close linkage. This shows the importance of routine T‐DNA copy number estimation. Based on our results, ddPCR is the most suitable method, because it is as reliable as Southern blot analysis yet much faster. A protocol for this application of ddPCR to large plant genomes is provided. PMID:26670088
Precision grid and hand motion for accurate needle insertion in brachytherapy
DOE Office of Scientific and Technical Information (OSTI.GOV)
McGill, Carl S.; Schwartz, Jonathon A.; Moore, Jason Z.
2011-08-15
Purpose: In prostate brachytherapy, a grid is used to guide a needle tip toward a preplanned location within the tissue. During insertion, the needle deflects en route resulting in target misplacement. In this paper, 18-gauge needle insertion experiments into phantom were performed to test effects of three parameters, which include the clearance between the grid hole and needle, the thickness of the grid, and the needle insertion speed. Measurement apparatus that consisted of two datum surfaces and digital depth gauge was developed to quantify needle deflections. Methods: The gauge repeatability and reproducibility (GR and R) test was performed on themore » measurement apparatus, and it proved to be capable of measuring a 2 mm tolerance from the target. Replicated experiments were performed on a 2{sup 3} factorial design (three parameters at two levels) and analysis included averages and standard deviation along with an analysis of variance (ANOVA) to find significant single and two-way interaction factors. Results: Results showed that grid with tight clearance hole and slow needle speed increased precision and accuracy of needle insertion. The tight grid was vital to enhance precision and accuracy of needle insertion for both slow and fast insertion speed; additionally, at slow speed the tight, thick grid improved needle precision and accuracy. Conclusions: In summary, the tight grid is important, regardless of speed. The grid design, which shows the capability to reduce the needle deflection in brachytherapy procedures, can potentially be implemented in the brachytherapy procedure.« less
Hackenberg, Michael; Shi, Bu-Jun; Gustafson, Perry; Langridge, Peter
2012-01-01
Transcription factors (TFs), microRNAs (miRNAs), small interfering RNAs (siRNAs) and other functional non-coding small RNAs (sRNAs) are important gene regulators. Comparison of sRNA expression profiles between transgenic barley over-expressing a drought tolerant TF (TaDREB3) and non-transgenic control barley revealed many group-specific sRNAs. In addition, 42% of the shared sRNAs were differentially expressed between the two groups (|log2| >1). Furthermore, TaDREB3-derived sRNAs were only detected in transgenic barley despite the existence of homologous genes in non-transgenic barley. These results demonstrate that the TF strongly affects the expression of sRNAs and siRNAs could in turn affect the TF stability. The TF also affects size distribution and abundance of sRNAs including miRNAs. About half of the sRNAs in each group were derived from chloroplast. A sRNA derived from tRNA-His(GUG) encoded by the chloroplast genome is the most abundant sRNA, accounting for 42.2% of the total sRNAs in transgenic barley and 28.9% in non-transgenic barley. This sRNA, which targets a gene (TC245676) involved in biological processes, was only present in barley leaves but not roots. 124 and 136 miRNAs were detected in transgenic and non-transgenic barley, respectively. miR156 was the most abundant miRNA and up-regulated in transgenic barley, while miR168 was the most abundant miRNA and up-regulated in non-transgenic barley. Eight out of 20 predicted novel miRNAs were differentially expressed between the two groups. All the predicted novel miRNA targets were validated using a degradome library. Our data provide an insight into the effect of TF on the expression of sRNAs in barley. PMID:22870277
Capodicasa, Cristina; Vairo, Donatella; Zabotina, Olga; McCartney, Lesley; Caprari, Claudio; Mattei, Benedetta; Manfredini, Cinzia; Aracri, Benedetto; Benen, Jacques; Knox, J Paul; De Lorenzo, Giulia; Cervone, Felice
2004-07-01
Pectins are a highly complex family of cell wall polysaccharides comprised of homogalacturonan (HGA), rhamnogalacturonan I and rhamnogalacturonan II. We have specifically modified HGA in both tobacco (Nicotiana tabacum) and Arabidopsis by expressing the endopolygalacturonase II of Aspergillus niger (AnPGII). Cell walls of transgenic tobacco plants showed a 25% reduction in GalUA content as compared with the wild type and a reduced content of deesterified HGA as detected by antibody labeling. Neutral sugars remained unchanged apart from a slight increase of Rha, Ara, and Gal. Both transgenic tobacco and Arabidopsis were dwarfed, indicating that unesterified HGA is a critical factor for plant cell growth. The dwarf phenotypes were associated with AnPGII activity as demonstrated by the observation that the mutant phenotype of tobacco was completely reverted by crossing the dwarfed plants with plants expressing PGIP2, a strong inhibitor of AnPGII. The mutant phenotype in Arabidopsis did not appear when transformation was performed with a gene encoding AnPGII inactivated by site directed mutagenesis.
Wang, Y; Smallwood, P M; Cowan, M; Blesh, D; Lawler, A; Nathans, J
1999-04-27
This study examines the mechanism of mutually exclusive expression of the human X-linked red and green visual pigment genes in their respective cone photoreceptors by asking whether this expression pattern can be produced in a mammal that normally carries only a single X-linked visual pigment gene. To address this question, we generated transgenic mice that carry a single copy of a minimal human X chromosome visual pigment gene array in which the red and green pigment gene transcription units were replaced, respectively, by alkaline phosphatase and beta-galactosidase reporters. As determined by histochemical staining, the reporters are expressed exclusively in cone photoreceptor cells. In 20 transgenic mice carrying any one of three independent transgene insertion events, an average of 63% of expressing cones have alkaline phosphatase activity, 10% have beta-galactosidase activity, and 27% have activity for both reporters. Thus, mutually exclusive expression of red and green pigment transgenes can be achieved in a large fraction of cones in a dichromat mammal, suggesting a facile evolutionary path for the development of trichromacy after visual pigment gene duplication. These observations are consistent with a model of visual pigment expression in which stochastic pairing occurs between a locus control region and either the red or the green pigment gene promotor.
Saha, Prasenjit; Majumder, Pralay; Dutta, Indrajit; Ray, Tui; Roy, S C; Das, Sampa
2006-05-01
Mannose binding Allium sativum leaf agglutinin (ASAL) has been shown to be antifeedant and insecticidal against sap-sucking insects. In the present investigation, ASAL coding sequence was expressed under the control of CaMV35S promoter in a chimeric gene cassette containing plant selection marker, hpt and gusA reporter gene of pCAMBIA1301 binary vector in an elite indica rice cv. IR64. Many fertile transgenic plants were generated using scutellar calli as initial explants through Agrobacterium-mediated transformation technology. GUS activity was observed in selected calli and in mature plants. Transformation frequency was calculated to be approximately 12.1%+/-0.351 (mean +/- SE). Southern blot analyses revealed the integration of ASAL gene into rice genome with a predominant single copy insertion. Transgene localization was detected on chromosomes of transformed plants using PRINS and C-PRINS techniques. Northern and western blot analyses determined the expression of transgene in transformed lines. ELISA analyses estimated ASAL expression up to 0.72 and 0.67% of total soluble protein in T0 and T1 plants, respectively. Survival and fecundity of brown planthopper and green leafhopper were reduced to 36% (P < 0.01), 32% (P < 0.05) and 40.5, 29.5% (P < 0.001), respectively, when tested on selected plants in comparison to control plants. Specific binding of expressed ASAL to receptor proteins of insect gut was analysed. Analysis of T1 progenies confirmed the inheritance of the transgenes. Thus, ASAL promises to be a potential component in insect resistance rice breeding programme.
Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M
2014-01-01
Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.
Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei
2017-01-01
RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3, a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA-HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing dsHaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera. Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls. PMID:28867769
Transgenic plants for enhanced biodegradation and phytoremediation of organic xenobiotics.
Abhilash, P C; Jamil, Sarah; Singh, Nandita
2009-01-01
Phytoremediation--the use of plants to clean up polluted soil and water resources--has received much attention in the last few years. Although plants have the inherent ability to detoxify xenobiotics, they generally lack the catabolic pathway for the complete degradation of these compounds compared to microorganisms. There are also concerns over the potential for the introduction of contaminants into the food chain. The question of how to dispose of plants that accumulate xenobiotics is also a serious concern. Hence the feasibility of phytoremediation as an approach to remediate environmental contamination is still somewhat in question. For these reasons, researchers have endeavored to engineer plants with genes that can bestow superior degradation abilities. A direct method for enhancing the efficacy of phytoremediation is to overexpress in plants the genes involved in metabolism, uptake, or transport of specific pollutants. Furthermore, the expression of suitable genes in root system enhances the rhizodegradation of highly recalcitrant compounds like PAHs, PCBs etc. Hence, the idea to amplify plant biodegradation of xenobiotics by genetic manipulation was developed, following a strategy similar to that used to develop transgenic crops. Genes from human, microbes, plants, and animals are being used successfully for this venture. The introduction of these genes can be readily achieved for many plant species using Agrobacterium tumefaciens-mediated plant transformation or direct DNA methods of gene transfer. One of the promising developments in transgenic technology is the insertion of multiple genes (for phase 1 metabolism (cytochrome P450s) and phase 2 metabolism (GSH, GT etc.) for the complete degradation of the xenobiotics within the plant system. In addition to the use of transgenic plants overexpressed with P450 and GST genes, various transgenic plants expressing bacterial genes can be used for the enhanced degradation and remediation of herbicides, explosives
Phytoremediation with transgenic trees.
Peuke, Andreas D; Rennenberg, Heinz
2005-01-01
In the present paper actual trends in the use of transgenic trees for phytoremediation of contaminated soils are reviewed. In this context a current field trial in which transgenic poplars with enhanced GSH synthesis and hence elevated capacity for phytochelatin production are compared with wildtype plants for the removal of heavy metals at different levels of contamination and under different climatic conditions. The studies are carried out with grey poplar (Populus tremula x P. alba), wildtype plants and plants overexpressing the gene for gamma-glutamylcysteine synthetase (gshI) from E. coli in the cytosol. The expression of this gene in poplar leads to two- to four-fold enhanced GSH concentrations in the leaves. In greenhouse experiments under controlled conditions these transgenic poplars showed a high potential for uptake and detoxification of heavy metals and pesticides. This capacity is evaluated in field experiments. Further aims of the project are to elucidate (a) the stability of the transgene under field conditions and (b) the possibility of horizontal gene transfer to microorganisms in the rhizosphere. The results will help to assess the biosafety risk of the use of transgenic poplar for phytoremediation of soils.
Tao, Chenyu; Yang, Yalan; Li, Xunbi; Zheng, Xinmin; Ren, Hongyan; Li, Kui; Zhou, Rong
2016-07-01
Genetically modified (GM) livestock have the potential to contribute to improving the environment and human health, with consumption of fewer resources and reduced waste production. However, the transgene process also poses risks. The safety assessment and control of transgenic animal products have drawn wide attention, and the relevant regulations and technology are being developed. Quick testing technology plays a significant role in on-site and customs sampling. Nowadays, loop-mediated isothermal amplification (LAMP) was widely applied in nucleic acid analysis because of its simplicity, rapidity, high efficiency and specificity. In this study, a specific, sensitive detection system for detecting sFAT-1 transgenic pigs was designed. A set of six primers including two loop primers was designed for the target sequence. The DNA samples were amplified in less than 1 h at the optimized temperature and detecting by both Nephelometer LA-320c and unaided eyes directly adding calcein. The detection limit of sFAT-1 LAMP was as low as 1.26 ng/μL. Furthermore, blind tests of transgenic and non-transgenic DNA samples were all correctly detected. Hence, the results in this study demonstrated that LAMP is a very useful tool for transgenic detection.
Cellular Localization of Wheat High Molecular Weight Glutenin Subunits in Transgenic Rice Grain
Jo, Yeong-Min; Cho, Kyoungwon; Lee, Hye-Jung; Lim, Sun-Hyung; Kim, Jin Sun; Kim, Young-Mi; Lee, Jong-Yeol
2017-01-01
Rice (Oryza sativa L.) is a primary global food cereal. However, when compared to wheat, rice has poor food processing qualities. Dough that is made from rice flour has low viscoelasticity because rice seed lacks storage proteins that are comparable to gluten protein from wheat. Thus, current research efforts aim to improve rice flour processing qualities through the transgenic expression of viscoelastic proteins in rice seeds. In this study, we characterized the transgenic expression of wheat glutenin subunits in rice seeds. The two genes 1Dx5_KK and 1Dy10_JK, which both encode wheat high-molecular-weight glutenin subunits that confer high dough elasticity, were cloned from Korean wheat cultivars KeumKang and JoKyung, respectively. These genes were inserted into binary vectors under the control of the rice endosperm-specific Glu-B1 promoter and were expressed in the high-amylose Korean rice cultivar Koami (Oryza sativa L.). Individual expression of both glutenin subunits was confirmed by SDS-PAGE and immunoblot analyses performed using T3 generation of transgenic rice seeds. The subcellular localization of 1Dx5_KK and 1Dy10_JK in the rice seed endosperm was confirmed by immunofluorescence analysis, indicating that the wheat glutenin subunits accumulate in protein body-II and novel protein body types in the rice seed. These results contribute to our understanding of engineered seed storage proteins in rice. PMID:29156580
Neuroanatomy and transgenic technologies
USDA-ARS?s Scientific Manuscript database
This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...
Yang, Xiao; Xia, Hui; Wang, Wei; Wang, Feng; Su, Jun; Snow, Allison A; Lu, Bao-Rong
2011-01-01
Gene flow from transgenic crops allows novel traits to spread to sexually compatible weeds. Traits such as resistance to insects may enhance the fitness of weeds, but few studies have tested for these effects under natural field conditions. We created F2 and F3 crop–weed hybrid lineages of genetically engineered rice (Oryza sativa) using lines with two transgene constructs, cowpea trypsin inhibitor (CpTI) and a Bt transgene linked to CpTI (Bt/CpTI). Experiments conducted in Fuzhou, China, demonstrated that CpTI alone did not significantly affect fecundity, although it reduced herbivory. In contrast, under certain conditions, Bt/CpTI conferred up to 79% less insect damage and 47% greater fecundity relative to nontransgenic controls, and a 44% increase in fecundity relative to the weedy parent. A small fitness cost was detected in F3 progeny with Bt/CpTI when grown under low insect pressure and direct competition with transgene-negative controls. We conclude that Bt/CpTI transgenes may introgress into co-occurring weedy rice populations and contribute to greater seed production when target insects are abundant. However, the net fitness benefits that are associated with Bt/CpTI could be ephemeral if insect pressure is lacking, for example, because of widespread planting of Bt cultivars that suppress target insect populations. PMID:25568014
Shiozawa, Seiji; Kawai, Kenji; Okada, Yohei; Tomioka, Ikuo; Maeda, Takuji; Kanda, Akifumi; Shinohara, Haruka; Suemizu, Hiroshi; James Okano, Hirotaka; Sotomaru, Yusuke; Sasaki, Erika; Okano, Hideyuki
2011-09-01
Nonhuman primate embryonic stem (ES) cells have vast promise for preclinical studies. Genetic modification in nonhuman primate ES cells is an essential technique for maximizing the potential of these cells. The common marmoset (Callithrix jacchus), a nonhuman primate, is expected to be a useful transgenic model for preclinical studies. However, genetic modification in common marmoset ES (cmES) cells has not yet been adequately developed. To establish efficient and stable genetic modifications in cmES cells, we inserted the enhanced green fluorescent protein (EGFP) gene with heterotypic lox sites into the β-actin (ACTB) locus of the cmES cells using gene targeting. The resulting knock-in ES cells expressed EGFP ubiquitously under the control of the endogenous ACTB promoter. Using inserted heterotypic lox sites, we demonstrated Cre recombinase-mediated cassette exchange (RMCE) and successfully established a monomeric red fluorescent protein (mRFP) knock-in cmES cell line. Further, a herpes simplex virus-thymidine kinase (HSV-tk) knock-in cmES cell line was established using RMCE. The growth of tumor cells originating from the cell line was significantly suppressed by the administration of ganciclovir. Therefore, the HSV-tk/ganciclovir system is promising as a safeguard for stem cell therapy. The stable and ubiquitous expression of EGFP before RMCE enables cell fate to be tracked when the cells are transplanted into an animal. Moreover, the creation of a transgene acceptor locus for site-specific transgenesis will be a powerful tool, similar to the ROSA26 locus in mice.
Wang, Wen Zhi; Yang, Ben Peng; Feng, Xiao Yan; Cao, Zheng Ying; Feng, Cui Lian; Wang, Jun Gang; Xiong, Guo Ru; Shen, Lin Bo; Zeng, Jun; Zhao, Ting Ting; Zhang, Shu Zhen
2017-01-01
Genetically modified crops which had been commercial applied extensively majorly are the insect resistance and herbicide tolerance events. In this study, the Bt insecticidal gene Cry1Ab, the glyphosate-tolerant gene EPSPS, and the selection marker gene PMI were combined into a single transferred DNA fragment and introduced into sugarcane by Agrobacterium-mediated transformation. Thirty-three resistant plantlets were obtained after selection using a PMI/mannose selection system. Thirty of these resistant plantlets were PCR positive for the three target genes. Southern blot assay revealed that the copy number of the integrated fragment in the transformed plantlets varied from 1 to 7. ELISA analysis showed that 23 of the 33 resistant plantlets expressed Cry1Ab and EPSPS protein. Five single-copy and ELISA-positive transgenic lines were tested under laboratory and field conditions to determine their resistance to insects and herbicides, and also evaluated their agronomic characteristics and industrial traits. Results showed that larvae fed with fodder mixture containing stem tissues from single-copy transgenic lines were weak and small, moreover, pupation and eclosion were delayed significantly during voluntary feeding bioassays. None of transgenic sugarcane was destroyed by cane borer while more than 30% of wild type sugarcane was destroyed by cane borer. For herbicide resistance, the transgenic plantlets grew healthy even when treated with up to 0.5% roundup while wild type plantlets would die off when treated with 0.1% roundup. Thus demonstrate that these transgenic lines showed strong insect resistance and glyphosate tolerance under both laboratory and field conditions. But in the field most of the transgenic plants were shorter and more slender than non-transformed control plants. So they presented poor agronomic characteristics and industrial traits than non-transformed control plants. Thus, a considerable number of embryogenic calli should be infected to obtain
Wang, Wen Zhi; Yang, Ben Peng; Feng, Xiao Yan; Cao, Zheng Ying; Feng, Cui Lian; Wang, Jun Gang; Xiong, Guo Ru; Shen, Lin Bo; Zeng, Jun; Zhao, Ting Ting; Zhang, Shu Zhen
2017-01-01
Genetically modified crops which had been commercial applied extensively majorly are the insect resistance and herbicide tolerance events. In this study, the Bt insecticidal gene Cry1Ab, the glyphosate-tolerant gene EPSPS, and the selection marker gene PMI were combined into a single transferred DNA fragment and introduced into sugarcane by Agrobacterium -mediated transformation. Thirty-three resistant plantlets were obtained after selection using a PMI/mannose selection system. Thirty of these resistant plantlets were PCR positive for the three target genes. Southern blot assay revealed that the copy number of the integrated fragment in the transformed plantlets varied from 1 to 7. ELISA analysis showed that 23 of the 33 resistant plantlets expressed Cry1Ab and EPSPS protein. Five single-copy and ELISA-positive transgenic lines were tested under laboratory and field conditions to determine their resistance to insects and herbicides, and also evaluated their agronomic characteristics and industrial traits. Results showed that larvae fed with fodder mixture containing stem tissues from single-copy transgenic lines were weak and small, moreover, pupation and eclosion were delayed significantly during voluntary feeding bioassays. None of transgenic sugarcane was destroyed by cane borer while more than 30% of wild type sugarcane was destroyed by cane borer. For herbicide resistance, the transgenic plantlets grew healthy even when treated with up to 0.5% roundup while wild type plantlets would die off when treated with 0.1% roundup. Thus demonstrate that these transgenic lines showed strong insect resistance and glyphosate tolerance under both laboratory and field conditions. But in the field most of the transgenic plants were shorter and more slender than non-transformed control plants. So they presented poor agronomic characteristics and industrial traits than non-transformed control plants. Thus, a considerable number of embryogenic calli should be infected to obtain
Walmsley, A M; Alvarez, M L; Jin, Y; Kirk, D D; Lee, S M; Pinkhasov, J; Rigano, M M; Arntzen, C J; Mason, H S
2003-06-01
Epitopes often require co-delivery with an adjuvant or targeting protein to enable recognition by the immune system. This paper reports the ability of transgenic tomato plants to express a fusion protein consisting of the B subunit of the Escherichia coli heat-labile enterotoxin (LTB) and an immunocontraceptive epitope. The fusion protein was found to assemble into pentamers, as evidenced by its ability to bind to gangliosides, and had an average expression level of 37.8 microg g(-1) in freeze-dried transgenic tissues. Processing of selected transgenic fruit resulted in a 16-fold increase in concentration of the antigen with minimal loss in detectable antigen. The species-specific nature of this epitope was shown by the inability of antibodies raised against non-target species to detect the LTB fusion protein. The immunocontraceptive ability of this vaccine will be tested in future pilot mice studies.
A Novel Soluble Peptide with pH-Responsive Membrane Insertion.
Nguyen, Vanessa P; Alves, Daiane S; Scott, Haden L; Davis, Forrest L; Barrera, Francisco N
2015-11-03
Several diseases, such as cancer, are characterized by acidification of the extracellular environment. Acidosis can be employed as a target to specifically direct therapies to the diseased tissue. We have used first principles to design an acidity-triggered rational membrane (ATRAM) peptide with high solubility in solution that is able to interact with lipid membranes in a pH-dependent fashion. Biophysical studies show that the ATRAM peptide binds to the surface of lipid membranes at pH 8.0. However, acidification leads to the peptide inserting into the lipid bilayer as a transmembrane α-helix. The insertion of ATRAM into membranes occurs at a moderately acidic pH (with a pK of 6.5), similar to the extracellular pH found in solid tumors. Studies with human cell lines showed a highly efficient pH-dependent membrane targeting, without causing toxicity. Here we show that it is possible to rationally design a soluble peptide that selectively targets cell membranes in acidic environments.
Forsberg, C W; Meidinger, R G; Ajakaiye, A; Murray, D; Fan, M Z; Mandell, I B; Phillips, J P
2014-10-01
A transgenic line of Yorkshire (YK) pigs named the Cassie (CA) line was produced with a low copy number phytase transgene inserted in the genome. The transgenic line efficiently digests P, Ca, and other major minerals of plant dietary origin. The objectives of this study were to 1) compare carcass and tissue nutrient composition and meat quality traits for third generation hemizygous CA line market BW finisher pigs (n = 24) with age-matched conventional YK finisher pigs (n = 24) and 2) examine effects of outbreeding with high-index conventional YK boars on modifying carcass leanness from the third to sixth generations in CA line finisher boars (n = 73) and gilts (n = 103). Cassie boars (n = 12) and CA gilts (n = 12) were fed diets without supplemental P and comparable numbers of age-matched YK boars and gilts fed diets containing supplement P were raised throughout the finisher phase. The pigs were slaughtered and then fabricated into commercial pork primals before meat composition and quality evaluation. Proximate and major micronutrient composition was determined on tissues including fat, kidney, lean, liver, and skin. The main difference observed was greater (P = 0.033) crude fat content in CA boar carcasses and increased (P < 0.04) leaf lard in both CA boars and gilts but no differences were observed (P = 0.895 and P = 0.223, respectively) in carcass backfat thickness as compared with YK pigs. There were no substantive differences in tissue composition, except for CA boar kidneys. Numerous changes in the mineral, fatty acid, and indispensable AA composition for CA boar kidneys were not apparent in CA gilts. These changes may point to adaptive physiological changes in the boar kidney necessary for homeostatic regulation of mineral retention related to phytase action rather than to insertion of the transgene. However, from a meat composition perspective, transgenic expression of phytase in the CA line of YK pigs had little overall effect on meat composition
App-assisted external ventricular drain insertion.
Eftekhar, Behzad
2016-09-01
The freehand technique for insertion of an external ventricular drain (EVD) is based on fixed anatomical landmarks and does not take individual variations into consideration. A patient-tailored approach based on augmented-reality techniques using devices such as smartphones can address this shortcoming. The Sina neurosurgical assist (Sina) is an Android mobile device application (app) that was designed and developed to be used as a simple intraoperative neurosurgical planning aid. It overlaps the patient's images from previously performed CT or MRI studies on the image seen through the device camera. The device is held by an assistant who aligns the images and provides information about the relative position of the target and EVD to the surgeon who is performing EVD insertion. This app can be used to provide guidance and continuous monitoring during EVD placement. The author describes the technique of Sina-assisted EVD insertion into the frontal horn of the lateral ventricle and reports on its clinical application in 5 cases as well as the results of ex vivo studies of ease of use and precision. The technique has potential for further development and use with other augmented-reality devices.
Transgenic mimicry of pathogen attack stimulates growth and secondary metabolite accumulation.
Chaudhuri, Kuntal; Das, Sudripta; Bandyopadhyay, Moumita; Zalar, Andreja; Kollmann, Albert; Jha, Sumita; Tepfer, David
2009-02-01
Plant secondary metabolites, including pharmaceuticals, flavorings and aromas, are often produced in response to stress. We used chemical inducers of the pathogen defense response (jasmonic acid, salicylate, killed fungi, oligosaccharides and the fungal elicitor protein, cryptogein) to increase metabolite and biomass production in transformed root cultures of the medicinal plant, Withania somnifera, and the weed, Convolvulus sepium. In an effort to genetically mimic the observed effects of cryptogein, we employed Agrobacterium rhizogenes to insert a synthetic gene encoding cryptogein into the roots of C. sepium, W. somnifera and Tylophora tanakae. This genetic transformation was associated with stimulation in both secondary metabolite production and growth in the first two species, and in growth in the third. In whole plants of Convolvulus arvensis and Arabidopsis thaliana, transformation with the cryptogein gene led, respectively, to increases in the calystegines and certain flavonoids. A similar transgenic mimicry of pathogen attack was previously employed to stimulate resistance to the pathogen and abiotic stress. In the present study of biochemical phenotype, we show that transgenic mimicry is correlated with increased secondary metabolite production in transformed root cultures and whole plants. We propose that natural transformation with genes encoding the production of microbial elicitors could influence interactions between plants and other organisms.
Xenopus tropicalis transgenic lines and their use in the study of embryonic induction.
Hirsch, Nicolas; Zimmerman, Lyle B; Gray, Jessica; Chae, Jeiwook; Curran, Kristen L; Fisher, Marilyn; Ogino, Hajime; Grainger, Robert M
2002-12-01
For over a century, amphibian embryos have been a source of significant insight into developmental mechanisms, including fundamental discoveries about the process of induction. The recently developed transgenesis for Xenopus offers new approaches to these poorly understood processes, particularly when undertaken in the quickly maturing species Xenopus tropicalis, which greatly facilitates establishment of permanent transgenic lines. Several X. tropicalis transgenic lines have now been generated, and experiments demonstrating the value of these lines to study induction in embryonic tissue recombinants and explants are presented here. A revised protocol for transgenesis in X. tropicalis resulting in a significant increase in the percentage of transgenic animals that reach adulthood is presented, as well as improvements in tadpole and froglet husbandry, which have facilitated the raising of large numbers of adults. Working transgenic populations have been rapidly expanded, and some transgenes have been bred to homozygosity. Established lines include those bearing the promoter regions of Pax-6, Otx-2, Rx, and EF1alpha coupled to fluorescent reporter genes. Multireporter lines combining, in a single animal, up to three gene promoters coupled to different fluorescent reporters have also been established. The value of X. tropicalis transgenic lines for the study of induction is demonstrated by showing activation of Pax-6 by noggin treatment of Pax-6/GFP transgenic animal caps, illustrating how reporter lines allow a rapid, in vivo assay for an inductive response. An experiment showing lens induction in gamma-crystallin/GFP transgenic lens ectoderm when it is recombined with mouse optic vesicle demonstrates conservation of inducing signals from amphibians and mammals. It also shows how the warmer culture temperatures tolerated by X. tropicalis embryos can be used in assays of factors produced by mammalian cells and tissues. The many applications of transgenic reporter
Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc
2005-04-20
Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.
Jones, Richard W; Perez, Frances G
2016-03-18
Expression of a gene encoding the family 1 cellulose binding domain protein CBD1, identified in the cellulosic cell wall of the potato late blight pathogen Phytophthora infestans, was tested in transgenic potato to determine if it had an influence on plant cell walls and resistance to late blight. Multiple regenerants of potato (cv. Bintje) were developed and selected for high expression of CBD 1 transcripts. Tests with detached leaflets showed no evidence of increased or decreased resistance to P. infestans, in comparison with the blight susceptible Bintje controls, however, changes in plant morphology were evident in CBD 1 transgenics. Plant height increases were evident, and most importantly, the ability to produce seed berries from a previously sterile cultivar. Immunolocalization of CBD 1 in seed berries revealed the presence throughout the tissue. While Bintje control plants are male and female sterile, CBD 1 transgenics were female fertile. Crosses made using pollen from the late blight resistant Sarpo Mira and transgenic CBD1 Bintje as the female parent demonstrated the ability to introgress P. infestans targeted resistance genes, as well as genes responsible for color and tuber shape, into Bintje germplasm. A family 1 cellulose-binding domain (CBD 1) encoding gene from the potato late blight pathogen P. infestans was used to develop transgenic Bintje potato plants. Transgenic plants became female fertile, allowing for a previously sterile cultivar to be used in breeding improvement. Selection for the absence of the CBD transgene in progeny should allow for immediate use of a genetically enhanced material. Potential for use in other Solanaceous crops is proposed.
Qiao, Wenjie; Zarzyńska-Nowak, Aleksandra; Nerva, Luca; Kuo, Yen-Wen; Falk, Bryce W
2018-04-28
RNA silencing is a conserved antiviral defense mechanism that has been used to develop robust resistance against plant virus infections. Previous efforts have been made to develop RNA silencing-mediated resistance to criniviruses, yet none have given immunity. In this study, transgenic Nicotiana benthamiana plants harboring a hairpin construct of the Lettuce infectious yellows virus (LIYV) RdRp sequence exhibited immunity to systemic LIYV infection. Deep-sequencing analysis was performed to characterize virus-derived siRNAs (vsiRNAs) generated upon systemic LIYV infection in non-transgenic N. benthamiana plants as well as transgene-derived siRNAs (t-siRNAs) derived from the immune transgenic plants before and after LIYV inoculation. Interestingly, a similar sequence distribution pattern was obtained with t-siRNAs and vsiRNAs mapped to the transgene region in both immune and susceptible plants except a significant increase of t-siRNAs of 24 nt in length, which was consistent with small RNA northern blot results that showed the abundance of t-siRNAs of 21-, 22-, and 24- nt in length. The accumulated 24-nt sequences haven't yet been reported in transgenic plants partially resistant to criniviruses, thus may indicate their correlation with crinivirus immunity. To further test this hypothesis, we developed transgenic melon (Cucumis melo) plants immune to systemic infection of another crinivirus, Cucurbit yellow stunting disorder virus (CYSDV). As predicted, the accumulation of 24-nt t-siRNAs was detected in transgenic melon plants by northern blot. Together with our findings and previous studies on crinivirus resistance, we propose that the accumulation of 24 nt t-siRNAs is associated with crinivirus immunity in transgenic plants. This article is protected by copyright. All rights reserved. © 2018 BSPP and John Wiley & Sons Ltd.
Bressan, Raul Bardini; Dewari, Pooran Singh; Kalantzaki, Maria; Gangoso, Ester; Matjusaitis, Mantas; Garcia-Diaz, Claudia; Blin, Carla; Grant, Vivien; Bulstrode, Harry; Gogolok, Sabine; Skarnes, William C.
2017-01-01
Mammalian neural stem cell (NSC) lines provide a tractable model for discovery across stem cell and developmental biology, regenerative medicine and neuroscience. They can be derived from foetal or adult germinal tissues and continuously propagated in vitro as adherent monolayers. NSCs are clonally expandable, genetically stable, and easily transfectable – experimental attributes compatible with targeted genetic manipulations. However, gene targeting, which is crucial for functional studies of embryonic stem cells, has not been exploited to date in NSC lines. Here, we deploy CRISPR/Cas9 technology to demonstrate a variety of sophisticated genetic modifications via gene targeting in both mouse and human NSC lines, including: (1) efficient targeted transgene insertion at safe harbour loci (Rosa26 and AAVS1); (2) biallelic knockout of neurodevelopmental transcription factor genes; (3) simple knock-in of epitope tags and fluorescent reporters (e.g. Sox2-V5 and Sox2-mCherry); and (4) engineering of glioma mutations (TP53 deletion; H3F3A point mutations). These resources and optimised methods enable facile and scalable genome editing in mammalian NSCs, providing significant new opportunities for functional genetic analysis. PMID:28096221
Transgenic cotton: from biotransformation methods to agricultural application.
Zhang, Baohong
2013-01-01
Transgenic cotton is among the first transgenic plants commercially adopted around the world. Since it was first introduced into the field in the middle of 1990s, transgenic cotton has been quickly adopted by cotton farmers in many developed and developing countries. Transgenic cotton has offered many important environmental, social, and economic benefits, including reduced usage of pesticides, indirect increase of yield, minimizing environmental pollution, and reducing labor and cost. Agrobacterium-mediated genetic transformation method is the major method for obtaining transgenic cotton. However, pollen tube pathway-mediated method is also used, particularly by scientists in China, to breed commercial transgenic cotton. Although transgenic cotton plants with disease-resistance, abiotic stress tolerance, and improved fiber quality have been developed in the past decades, insect-resistant and herbicide-tolerant cotton are the two dominant transgenic cottons in the transgenic cotton market.
Modeling Alzheimer’s disease in transgenic rats
2013-01-01
Alzheimer’s disease (AD) is the most common form of dementia. At the diagnostic stage, the AD brain is characterized by the accumulation of extracellular amyloid plaques, intracellular neurofibrillary tangles and neuronal loss. Despite the large variety of therapeutic approaches, this condition remains incurable, since at the time of clinical diagnosis, the brain has already suffered irreversible and extensive damage. In recent years, it has become evident that AD starts decades prior to its clinical presentation. In this regard, transgenic animal models can shed much light on the mechanisms underlying this “pre-clinical” stage, enabling the identification and validation of new therapeutic targets. This paper summarizes the formidable efforts to create models mimicking the various aspects of AD pathology in the rat. Transgenic rat models offer distinctive advantages over mice. Rats are physiologically, genetically and morphologically closer to humans. More importantly, the rat has a well-characterized, rich behavioral display. Consequently, rat models of AD should allow a more sophisticated and accurate assessment of the impact of pathology and novel therapeutics on cognitive outcomes. PMID:24161192
Sarkar, Tanmoy; Thankappan, Radhakrishnan; Kumar, Abhay; Mishra, Gyan P.; Dobaria, Jentilal R.
2016-01-01
Peanut, an important oilseed crop, is gaining priority for the development of drought tolerant genotypes in recent times, since the area under drought is constantly on the rise. To achieve this, one of the important strategies is to genetically engineer the ruling peanut varieties using transcription factor regulating the expression of several downstream, abiotic-stress responsive gene(s). In this study, eight independent transgenic peanut (cv. GG20) lines were developed using AtDREB1A gene, encoding for a transcription factor, through Agrobacterium-mediated genetic transformation. The transgene insertion was confirmed in (T0) using PCR and Dot-blot analysis, while copy-number(s) was ascertained using Southern-blot analysis. The inheritance of AtDREB1A gene in individual transgenic plants (T1 and T2) was confirmed using PCR. In homozygous transgenic plants (T2), under soil-moisture deficit stress, elevated level of AtDREB1A transgene expression was observed by RT-PCR assay. The transgenic plants at 45-d or reproductive growth stage showed tolerance to severe soil-moisture deficit stress. Physio-biochemical parameters such as proline content, osmotic potential, relative water content, electrolytic leakage, and total-chlorophyll content were found positively correlated with growth-related traits without any morphological abnormality, when compared to wild-type. qPCR analysis revealed consistent increase in expression of AtDREB1A gene under progressive soil-moisture deficit stress in two homozygous transgenic plants. The transgene expression showed significant correlation with improved physio-biochemical traits. The improvement of drought-stress tolerance in combination with improved growth-related traits is very essential criterion for a premium peanut cultivar like GG20, so that marginal farmers of India can incur the economic benefits during seasonal drought and water scarcity. PMID:27446163
Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B
2012-10-31
Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio. Copyright © 2012 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Possible non-target effects of transgenic cry1Ie gene maize exerts on natural enemy community biodiversity in the field is unresolved. In the present study, a 2-yr study of transgenic cry1Ie gene maize (Event IE09S034, Bt maize) and its near isoline (Zong 31, non-Bt maize) on natural enemy community...
No effect of Bt-transgenic rice litter on the meiobenthos community in field ditches.
Liu, Yongbo; Jiang, Wanxiang; Liang, Yuyong; Zhao, Caiyun; Li, Junsheng
2017-06-01
The non-target effect of Bacillus thuringiensis (Bt) toxins in aquatic ecosystems is crucial to improve the present assessment of Bt-transgenic plants, particularly where crops are cultivated near aquatic ecosystems. We conducted decomposition experiments during two growing seasons to determine the effects of Bt-transgenic rice litter with and without insecticide application on the meiobenthos communities in a field ditch. The community composition of meiobenthos colonised on leaf litter was not significantly different between Bt and non-Bt rice. The abundance of meiobenthos colonising leaves differed between insecticide application and control, and this insecticide effect interacted with rice type. No Bt toxin was detected in field ditch water. Leaf decomposition and nutrient content were comparable for both Bt and non-Bt rice with or without insecticide application. Bt-transgenic rice litter had no effect on the meiobenthos community composition in field ditches, but the chronic persistence of transgenic litter in nature needs to be taken into account at large scales in aquatic ecosystems. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Concealed Accessory Pathways with a Single Ventricular and Two Discrete Atrial Insertion Sites.
Kipp, Ryan T; Abu Sham'a, Raed; Hiroyuki, Ito; Han, Frederick T; Refaat, Marwan; Hsu, Jonathan C; Field, Michael E; Kopp, Douglas E; Marcus, Gregory M; Scheinman, Melvin M; Hoffmayer, Kurt S
2017-03-01
Atrioventricular reciprocating tachycardia (AVRT) utilizing a concealed accessory pathway is common. It is well appreciated that some patients may have multiple accessory pathways with separate atrial and ventricular insertion sites. We present three cases of AVRT utilizing concealed pathways with evidence that each utilizing a single ventricular insertion and two discrete atrial insertion sites. In case one, two discrete atrial insertion sites were mapped in two separate procedures, and only during the second ablation was the Kent potential identified. Ablation of the Kent potential at this site remote from the two atrial insertion sites resulted in the termination of the retrograde conduction in both pathways. Case two presented with supraventricular tachycardia (SVT) with alternating eccentric atrial activation patterns without alteration in the tachycardia cycle length. The two distinct atrial insertion sites during orthodromic AVRT and ventricular pacing were targeted and each of the two atrial insertion sites were successfully mapped and ablated. In case three, retrograde decremental conduction utilizing both atrial insertion sites was identified prior to ablation. After mapping and ablation of the first discrete atrial insertion site, tachycardia persisted utilizing the second atrial insertion site. Only after ablation of the second atrial insertion site was SVT noninducible, and VA conduction was no longer present. Concealed retrograde accessory pathways with discrete atrial insertion sites may have a common ventricular insertion site. Identification and ablation of the ventricular insertion site or the separate discrete atrial insertion sites result in successful treatment. © 2017 Wiley Periodicals, Inc.
Wang, Z-Y; Bell, J; Lehmann, D
2004-07-01
Russian wildrye (Psathyrostachys juncea (Fisch.) Nevski) is a cool-season forage species well adapted to semi-arid climates. We are interested in developing biotechnological methods to improve this monocot forage species. Single genotype-derived embryogenic suspension cultures were established from the Russian wildrye cultivar Bozoisky-Select, and were used as target cells for biolistic transformation. A chimeric hygromycin phosphotransferase gene (hph) was used as the selectable marker, and a chimeric beta-glucuronidase (gusA) gene was co-transformed with hph. Resistant calli were obtained from 29% of the bombarded dishes after selection with 200 mg/l hygromycin. Plants were regenerated from 45% of the hygromycin resistant calli. Thirty-six transgenic Russian wildrye plants were recovered after microprojectile bombardment of suspension cells and subsequent hygromycin selection. The transgenic nature of the regenerated plants was demonstrated by Southern hybridization analysis using undigested and digested genomic DNA samples. When a second gene (gusA) was co-transformed with hph, a reasonably high co-transformation frequency of 78% was observed. Transgenic expression of gusA was confirmed by GUS staining of shoot and leaf tissues. Fertile transgenic plants were obtained after two winters of vernalization under field conditions. This is the first report on the generation of transgenic plants in Russian wildrye.
Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.
Guttikonda, Satish K; Marri, Pradeep; Mammadov, Jafar; Ye, Liang; Soe, Khaing; Richey, Kimberly; Cruse, James; Zhuang, Meibao; Gao, Zhifang; Evans, Clive; Rounsley, Steve; Kumpatla, Siva P
2016-01-01
Demand for the commercial use of genetically modified (GM) crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS) technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.
Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun
2017-11-07
Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .
Schirmer, David; Grünewald, Thomas G. P.; Klar, Richard; Schmidt, Oxana; Wohlleber, Dirk; Rubío, Rebeca Alba; Uckert, Wolfgang; Thiel, Uwe; Bohne, Felix; Busch, Dirk H.; Krackhardt, Angela M.; Burdach, Stefan; Richter, Günther H. S.
2016-01-01
ABSTRACT Pediatric cancers, including Ewing sarcoma (ES), are only weakly immunogenic and the tumor-patients' immune system often is devoid of effector T cells for tumor elimination. Based on expression profiling technology, targetable tumor-associated antigens (TAA) are identified and exploited for engineered T-cell therapy. Here, the specific recognition and lytic potential of transgenic allo-restricted CD8+ T cells, directed against the ES-associated antigen 6-transmembrane epithelial antigen of the prostate 1 (STEAP1), was examined. Following repetitive STEAP1130 peptide-driven stimulations with HLA-A*02:01+ dendritic cells (DC), allo-restricted HLA-A*02:01− CD8+ T cells were sorted with HLA-A*02:01/peptide multimers and expanded by limiting dilution. After functional analysis of suitable T cell clones via ELISpot, flow cytometry and xCELLigence assay, T cell receptors' (TCR) α- and β-chains were identified, cloned into retroviral vectors, codon optimized, transfected into HLA-A*02:01− primary T cell populations and tested again for specificity and lytic capacity in vitro and in a Rag2−/−γc−/− mouse model. Initially generated transgenic T cells specifically recognized STEAP1130-pulsed or transfected cells in the context of HLA-A*02:01 with minimal cross-reactivity as determined by specific interferon-γ (IFNγ) release, lysed cells and inhibited growth of HLA-A*02:01+ ES lines more effectively than HLA-A*02:01− ES lines. In vivo tumor growth was inhibited more effectively with transgenic STEAP1130-specific T cells than with unspecific T cells. Our results identify TCRs capable of recognizing and inhibiting growth of STEAP1-expressing HLA-A*02:01+ ES cells in vitro and in vivo in a highly restricted manner. As STEAP1 is overexpressed in a wide variety of cancers, we anticipate these STEAP1-specific TCRs to be potentially useful for immunotherapy of other STEAP1-expressing tumors. PMID:27471654
Transgenic Expression of ZBP1 in Neurons Suppresses Cocaine-Associated Conditioning
ERIC Educational Resources Information Center
Lapidus, Kyle A. B.; Nwokafor, Chiso; Scott, Daniel; Baroni, Timothy E.; Tenenbaum, Scott A.; Hiroi, Noboru; Singer, Robert H.; Czaplinski, Kevin
2012-01-01
To directly address whether regulating mRNA localization can influence animal behavior, we created transgenic mice that conditionally express Zipcode Binding Protein 1 (ZBP1) in a subset of neurons in the brain. ZBP1 is an RNA-binding protein that regulates the localization, as well as translation and stability of target mRNAs in the cytoplasm. We…
Chervinsky, D S; Lam, D H; Melman, M P; Gross, K W; Aplan, P D
2001-09-01
SCL and LMO1 were both discovered by virtue of their activation by chromosomaltranslocation in patients with T-cell acute lymphoblastic leukemia (T-ALL). Overexpression of SCL and LMO1 in the thymus of transgenic mice leads to T-ALL at a young age. scid (severe combined immunodeficient) mice are unable to efficiently recombine antigen receptor genes and consequently display a developmental block at the CD4-CD8- to CD4+CD8+ transition. To test the hypothesis that this developmental block would protect SCL/LMO1 transgenic mice from developing T-ALL, we crossed the SCL and LMO1 transgenes onto a scid background. The age of onset for T-ALL in the SCL/LMO1/scid mice was significantly delayed (P < 0.001) compared with SCL/LMO1/wild-type mice. Intriguingly, all of the SCL/LMO1/scid malignancies displayed clonal, in-frame TCRbeta gene rearrangements. Taken together, these findings suggest that the "leaky" scid thymocyte that undergoes a productive TCRbeta gene rearrangement is susceptible to the oncogenic action of SCL and LMO1 and additionally suggests that TCRbeta gene rearrangements may be required for the oncogenic action of SCL and LMO1.
Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun
2017-09-01
Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.
Capodicasa, Cristina; Vairo, Donatella; Zabotina, Olga; McCartney, Lesley; Caprari, Claudio; Mattei, Benedetta; Manfredini, Cinzia; Aracri, Benedetto; Benen, Jacques; Knox, J. Paul; De Lorenzo, Giulia; Cervone, Felice
2004-01-01
Pectins are a highly complex family of cell wall polysaccharides comprised of homogalacturonan (HGA), rhamnogalacturonan I and rhamnogalacturonan II. We have specifically modified HGA in both tobacco (Nicotiana tabacum) and Arabidopsis by expressing the endopolygalacturonase II of Aspergillus niger (AnPGII). Cell walls of transgenic tobacco plants showed a 25% reduction in GalUA content as compared with the wild type and a reduced content of deesterified HGA as detected by antibody labeling. Neutral sugars remained unchanged apart from a slight increase of Rha, Ara, and Gal. Both transgenic tobacco and Arabidopsis were dwarfed, indicating that unesterified HGA is a critical factor for plant cell growth. The dwarf phenotypes were associated with AnPGII activity as demonstrated by the observation that the mutant phenotype of tobacco was completely reverted by crossing the dwarfed plants with plants expressing PGIP2, a strong inhibitor of AnPGII. The mutant phenotype in Arabidopsis did not appear when transformation was performed with a gene encoding AnPGII inactivated by site directed mutagenesis. PMID:15247378
Expression of Folate Pathway Genes in the Cartilage of Hoxd4 and Hoxc8 Transgenic Mice
Kruger, Claudia; Talmadge, Catherine; Kappen, Claudia
2014-01-01
BACKGROUND Hox transcription factors are well known for their role in skeletal patterning in vertebrates. They regulate gene expression during the development of cartilage, the precursor to mature bone. We previously reported that overexpression of the homeobox genes Hoxc8 and Hoxd4 results in severe cartilage defects, reduced proteoglycan content, accumulation of immature chondrocytes, and decreased maturation to hypertrophy. We have also shown that Hoxd4 transgenic mice whose diets were supplemented with folate had their skeletal development restored. Since folate is required for growth and differentiation of chondrocytes, we hypothesized that the beneficial effect of folate in Hoxd4 transgenic mice might indicate a local deficiency in folate utilization, possibly caused by deregulation of genes encoding folate transport proteins or folate metabolic enzymes. METHODS We assayed the prevalence of transcripts for 22 folate transport proteins and metabolizing enzymes, here collectively referred to as folate pathway genes. Quantitative real-time PCR was performed on cDNA samples derived from RNA isolated from primary chondrocytes of individual rib cartilages from Hoxd4 and Hoxc8 transgenic mice, respectively. RESULTS This study shows that the Hox transgenes produce overexpression of Hoxd4 and Hoxc8 in primary chondrocytes from perinatal transgenic mice. However, no differences were found in expression levels of the folate pathway genes in transgenic cells compared to littermate controls. CONCLUSIONS Our results provide evidence that folate pathway genes are only indirect targets of Hox transgene overexpression in our transgenic animals. These expression studies provide a baseline for future studies into the role of folate metabolism in chondrocyte differentiation. PMID:16586448
Advances in targeted genome editing.
Perez-Pinera, Pablo; Ousterout, David G; Gersbach, Charles A
2012-08-01
New technologies have recently emerged that enable targeted editing of genomes in diverse systems. This includes precise manipulation of gene sequences in their natural chromosomal context and addition of transgenes to specific genomic loci. This progress has been facilitated by advances in engineering targeted nucleases with programmable, site-specific DNA-binding domains, including zinc finger proteins and transcription activator-like effectors (TALEs). Recent improvements have enhanced nuclease performance, accelerated nuclease assembly, and lowered the cost of genome editing. These advances are driving new approaches to many areas of biotechnology, including biopharmaceutical production, agriculture, creation of transgenic organisms and cell lines, and studies of genome structure, regulation, and function. Genome editing is also being investigated in preclinical and clinical gene therapies for many diseases. Copyright © 2012 Elsevier Ltd. All rights reserved.
RNA detection using peptide-inserted Renilla luciferase.
Andou, Takashi; Endoh, Tamaki; Mie, Masayasu; Kobatake, Eiry
2009-01-01
A novel complementation system with short peptide-inserted-Renilla luciferase (PI-Rluc) and split-RNA probes was constructed for noninvasive RNA detection. The RNA binding peptides HIV-1 Rev and BIV Tat were used as inserted peptides. They display induced fit conformational changes upon binding to specific RNAs and trigger complementation or discomplementation of Rluc. Split-RNA probes were designed to reform the peptide binding site upon hybridization with arbitrarily selected target RNA. This set of recombinant protein and split-RNA probes enabled a high degree of sensitivity in RNA detection. In this study, we show that the Rluc system is comparable to Fluc, but that its detection limit for arbitrarily selected RNA (at least 100 pM) exceeds that of Fluc by approximately two orders of magnitude.
Experimental Attempts for Deep Insertion in Ultrasonically Forced Insertion Process
NASA Astrophysics Data System (ADS)
Ono, Satoshi; Aoyagi, Manabu; Tamura, Hideki; Takano, Takehiro
2011-07-01
In this paper, we describe two attempts of obtaining deep insertion in an ultrasonically forced insertion (USFI) process. One was to correct the inclination of an inserted rod by passively generated bending vibrations. The inclination causes a partial plastic deformation, which decreases the holding power of processing materials. Two types of horn with grooves for excitation of bending vibrations were examined. The other was to make differences in vibration velocity and the phase of a rod and a metal plate by damping the vibration of a metal plate by using a rubber sheet. As results, the attempts proposed in this study were confirmed to be effective to obtain a deep insertion.
Searleman, Adam C.; Iliuk, Anton B.; Collier, Timothy S.; Chodosh, Lewis A.; Tao, W. Andy; Bose, Ron
2014-01-01
Altered protein phosphorylation is a feature of many human cancers that can be targeted therapeutically. Phosphopeptide enrichment is a critical step for maximizing the depth of phosphoproteome coverage by MS, but remains challenging for tissue specimens because of their high complexity. We describe the first analysis of a tissue phosphoproteome using polymer-based metal ion affinity capture (PolyMAC), a nanopolymer that has excellent yield and specificity for phosphopeptide enrichment, on a transgenic mouse model of HER2-driven breast cancer. By combining phosphotyrosine immunoprecipitation with PolyMAC, 411 unique peptides with 139 phosphotyrosine, 45 phosphoserine, and 29 phosphothreonine sites were identified from five LC-MS/MS runs. Combining reverse phase liquid chromatography fractionation at pH 8.0 with PolyMAC identified 1571 unique peptides with 1279 phosphoserine, 213 phosphothreonine, and 21 phosphotyrosine sites from eight LC-MS/MS runs. Linear motif analysis indicated that many of the phosphosites correspond to well-known phosphorylation motifs. Analysis of the tyrosine phosphoproteome with the Drug Gene Interaction database uncovered a network of potential therapeutic targets centered on Src family kinases with inhibitors that are either FDA-approved or in clinical development. These results demonstrate that PolyMAC is well suited for phosphoproteomic analysis of tissue specimens. PMID:24723360
Ayella, Allan K; Trick, Harold N; Wang, Weiqun
2007-12-01
Lignans are phenylpropane dimers that are biosynthesized via the phenylpropanoid pathway, in which pinoresinol lariciresinol reductase (PLR) catalyzes the last steps of lignan production. Our previous studies demonstrated that the contents of lignans in various wheat cultivars were significantly associated with anti-tumor activities in APC(Min) mice. To enhance lignan biosynthesis, this study was conducted to transform wheat cultivars ('Bobwhite', 'Madison', and 'Fielder', respectively) with the Forsythia intermedia PLR gene under the regulatory control of maize ubiquitin promoter. Of 24 putative transgenic wheat lines, we successfully obtained 3 transformants with the inserted ubiquitin-PLR gene as screened by PCR. Southern blot analysis further demonstrated that different copies of the PLR gene up to 5 were carried out in their genomes. Furthermore, a real-time PCR indicated approximately 17% increase of PLR gene expression over the control in 2 of the 3 positive transformants at T(0) generation. The levels of secoisolariciresinol diglucoside, a prominent lignan in wheat as determined by HPLC-MS, were found to be 2.2-times higher in one of the three positive transgenic sub-lines at T(2 )than that in the wild-type (117.9 +/- 4.5 vs. 52.9 +/- 19.8 mug/g, p <0.005). To the best of our knowledge, this is the first study that elevated lignan levels in a transgenic wheat line has been successfully achieved through genetic engineering of over-expressed PLR gene. Although future studies are needed for a stably expression and more efficient transformants, the new wheat line with significantly higher SDG contents obtained from this study may have potential application in providing additive health benefits for cancer prevention.
High-fidelity Glucagon-CreER mouse line generated by CRISPR-Cas9 assisted gene targeting.
Ackermann, Amanda M; Zhang, Jia; Heller, Aryel; Briker, Anna; Kaestner, Klaus H
2017-03-01
α-cells are the second most prominent cell type in pancreatic islets and are responsible for producing glucagon to increase plasma glucose levels in times of fasting. α-cell dysfunction and inappropriate glucagon secretion occur in both type 1 and type 2 diabetes. Thus, there is growing interest in studying both normal function and pathophysiology of α-cells. However, tools to target gene ablation or activation specifically of α-cells have been limited, compared to those available for β-cells. Previous Glucagon-Cre and Glucagon-CreER transgenic mouse lines have suffered from transgene silencing, and the only available Glucagon-CreER "knock-in" mouse line results in glucagon haploinsufficiency, which can confound the interpretation of gene deletion analyses. Therefore, we sought to develop a Glucagon-CreER T2 mouse line that would maintain normal glucagon expression and would be less susceptible to transgene silencing. We utilized CRISPR-Cas9 technology to insert an IRES-CreER T2 sequence into the 3' UTR of the Glucagon ( Gcg ) locus in mouse embryonic stem cells (ESCs). Targeted ESC clones were then injected into mouse blastocysts to obtain Gcg-CreER T2 mice. Recombination efficiency in GCG + pancreatic α-cells and glucagon-like peptide 1 positive (GLP1 + ) enteroendocrine L-cells was measured in Gcg-CreER T2 ; Rosa26-LSL-YFP mice injected with tamoxifen during fetal development and adulthood. Tamoxifen injection of Gcg-CreER T2 ; Rosa26-LSL-YFP mice induced high recombination efficiency of the Rosa26-LSL-YFP locus in perinatal and adult α-cells (88% and 95%, respectively), as well as in first-wave fetal α-cells (36%) and adult enteroendocrine L-cells (33%). Mice homozygous for the Gcg-CreER T2 allele were phenotypically normal. We successfully derived a Gcg-CreER T2 mouse line that expresses CreER T2 in pancreatic α-cells and enteroendocrine L-cells without disrupting preproglucagon gene expression. These mice will be a useful tool for performing
Wang, Xianghong; Jiang, Daiming; Yang, Daichang
2015-01-01
The selection of homozygous lines is a crucial step in the characterization of newly generated transgenic plants. This is particularly time- and labor-consuming when transgenic stacking is required. Here, we report a fast and accurate method based on quantitative real-time PCR with a rice gene RBE4 as a reference gene for selection of homozygous lines when using multiple transgenic stacking in rice. Use of this method allowed can be used to determine the stacking of up to three transgenes within four generations. Selection accuracy reached 100 % for a single locus and 92.3 % for two loci. This method confers distinct advantages over current transgenic research methodologies, as it is more accurate, rapid, and reliable. Therefore, this protocol could be used to efficiently select homozygous plants and to expedite time- and labor-consuming processes normally required for multiple transgene stacking. This protocol was standardized for determination of multiple gene stacking in molecular breeding via marker-assisted selection.
NASA Astrophysics Data System (ADS)
Sharma, Ajay; Khoury-Christianson, Anastasia M.; White, Steven P.; Dhanjal, Nirpal K.; Huang, Wen; Paulhiac, Clara; Friedman, Eric J.; Manjula, Belur N.; Kumar, Ramesh
1994-09-01
Chemical synthesis of peptides, though feasible, is hindered by considerations of cost, purity, and efficiency of synthesizing longer chains. Here we describe a transgenic system for producing peptides of therapeutic interest as fusion proteins at low cost and high purity. Transgenic hemoglobin expression technology using the locus control region was employed to produce fusion hemoglobins in the erythrocytes of mice. The fusion hemoglobin contains the desired peptide as an extension at the C end of human α-globin. A protein cleavage site is inserted between the C end of the α-globin chain and the N-terminal residue of the desired peptide. The peptide is recovered after cleavage of the fusion protein with enzymes that recognize this cleavage signal as their substrate. Due to the selective compartmentalization of hemoglobin in the erythrocytes, purification of the fusion hemoglobin is easy and efficient. Because of its compact and highly ordered structure, the internal sites of hemoglobin are resistant to protease digestion and the desired peptide is efficiently released and recovered. The applicability of this approach was established by producing a 16-mer α-endorphin peptide and a 26-mer magainin peptide in transgenic mice. Transgenic animals and their progeny expressing these fusion proteins remain healthy, even when the fusion protein is expressed at >25% of the total hemoglobin in the erythrocytes. Additional applications and potential improvements of this methodology are discussed.
Human CD22 Inhibits Murine B Cell Receptor Activation in a Human CD22 Transgenic Mouse Model.
Bednar, Kyle J; Shanina, Elena; Ballet, Romain; Connors, Edward P; Duan, Shiteng; Juan, Joana; Arlian, Britni M; Kulis, Michael D; Butcher, Eugene C; Fung-Leung, Wai-Ping; Rao, Tadimeti S; Paulson, James C; Macauley, Matthew S
2017-11-01
CD22, a sialic acid-binding Ig-type lectin (Siglec) family member, is an inhibitory coreceptor of the BCR with established roles in health and disease. The restricted expression pattern of CD22 on B cells and most B cell lymphomas has made CD22 a therapeutic target for B cell-mediated diseases. Models to better understand how in vivo targeting of CD22 translates to human disease are needed. In this article, we report the development of a transgenic mouse expressing human CD22 (hCD22) in B cells and assess its ability to functionally substitute for murine CD22 (mCD22) for regulation of BCR signaling, Ab responses, homing, and tolerance. Expression of hCD22 on transgenic murine B cells is comparable to expression on human primary B cells, and it colocalizes with mCD22 on the cell surface. Murine B cells expressing only hCD22 have identical calcium (Ca 2+ ) flux responses to anti-IgM as mCD22-expressing wild-type B cells. Furthermore, hCD22 transgenic mice on an mCD22 -/- background have restored levels of marginal zone B cells and Ab responses compared with deficiencies observed in CD22 -/- mice. Consistent with these observations, hCD22 transgenic mice develop normal humoral responses in a peanut allergy oral sensitization model. Homing of B cells to Peyer's patches was partially rescued by expression of hCD22 compared with CD22 -/- B cells, although not to wild-type levels. Notably, Siglec-engaging antigenic liposomes formulated with an hCD22 ligand were shown to prevent B cell activation, increase cell death, and induce tolerance in vivo. This hCD22 transgenic mouse will be a valuable model for investigating the function of hCD22 and preclinical studies targeting hCD22. Copyright © 2017 by The American Association of Immunologists, Inc.
Sharma, Nirmala; Anderson, Maureen; Kumar, Arvind; Zhang, Yan; Giblin, E Michael; Abrams, Suzanne R; Zaharia, L Irina; Taylor, David C; Fobert, Pierre R
2008-12-19
Seed oil accumulates primarily as triacylglycerol (TAG). While the biochemical pathway for TAG biosynthesis is known, its regulation remains unclear. Previous research identified microsomal diacylglycerol acyltransferase 1 (DGAT1, EC 2.3.1.20) as controlling a rate-limiting step in the TAG biosynthesis pathway. Of note, overexpression of DGAT1 results in substantial increases in oil content and seed size. To further analyze the global consequences of manipulating DGAT1 levels during seed development, a concerted transcriptome and metabolome analysis of transgenic B. napus prototypes was performed. Using a targeted Brassica cDNA microarray, about 200 genes were differentially expressed in two independent transgenic lines analyzed. Interestingly, 24-33% of the targets showing significant changes have no matching gene in Arabidopsis although these represent only 5% of the targets on the microarray. Further analysis of some of these novel transcripts indicated that several are inducible by ABA in microspore-derived embryos. Of the 200 Arabidopsis genes implicated in lipid biology present on the microarray, 36 were found to be differentially regulated in DGAT transgenic lines. Furthermore, kinetic reverse transcriptase Polymerase Chain Reaction (k-PCR) analysis revealed up-regulation of genes encoding enzymes of the Kennedy pathway involved in assembly of TAGs. Hormone profiling indicated that levels of auxins and cytokinins varied between transgenic lines and untransformed controls, while differences in the pool sizes of ABA and catabolites were only observed at later stages of development. Our results indicate that the increased TAG accumulation observed in transgenic DGAT1 plants is associated with modest transcriptional and hormonal changes during seed development that are not limited to the TAG biosynthesis pathway. These might be associated with feedback or feed-forward effects due to altered levels of DGAT1 activity. The fact that a large fraction of significant
2013-01-01
Background Genetically engineered (GE) ringspot virus-resistant papaya cultivars ‘Rainbow’ and ‘SunUp’ have been grown in Hawai’i for over 10 years. In Hawai’i, the introduction of GE papayas into regions where non-GE cultivars are grown and where feral non-GE papayas exist have been accompanied with concerns associated with transgene flow. Of particular concern is the possibility of transgenic seeds being found in non-GE papaya fruits via cross-pollination. Development of high-throughput methods to reliably detect the adventitious presence of such transgenic material would benefit both the scientific and regulatory communities. Results We assessed the accuracy of using conventional qualitative polymerase chain reaction (PCR) as well as real-time PCR-based assays to quantify the presence of transgenic DNA from bulk samples of non-GE papaya seeds. In this study, an optimized method of extracting high quality DNA from dry seeds of papaya was standardized. A reliable, sensitive real-time PCR method for detecting and quantifying viral coat protein (cp) transgenes in bulk seed samples utilizing the endogenous papain gene is presented. Quantification range was from 0.01 to 100 ng/μl of GE-papaya DNA template with a detection limit as low as 0.01% (10 pg). To test this system, we simulated transgene flow using known quantities of GE and non-GE DNA and determined that 0.038% (38 pg) GE papaya DNA could be detected using real-time PCR. We also validated this system by extracting DNA from known ratios of GE seeds to non-GE seeds of papaya followed by real-time PCR detection and observed a reliable detection limit of 0.4%. Conclusions This method for the quick and sensitive detection of transgenes in bulked papaya seed lots using conventional as well as real-time PCR-based methods will benefit numerous stakeholders. In particular, this method could be utilized to screen selected fruits from maternal non-GE papaya trees in Hawai’i for the presence of transgenic
Nageswara-Rao, Madhugiri; Kwit, Charles; Agarwal, Sujata; Patton, Mariah T; Skeen, Jordan A; Yuan, Joshua S; Manshardt, Richard M; Stewart, C Neal
2013-09-01
Genetically engineered (GE) ringspot virus-resistant papaya cultivars 'Rainbow' and 'SunUp' have been grown in Hawai'i for over 10 years. In Hawai'i, the introduction of GE papayas into regions where non-GE cultivars are grown and where feral non-GE papayas exist have been accompanied with concerns associated with transgene flow. Of particular concern is the possibility of transgenic seeds being found in non-GE papaya fruits via cross-pollination. Development of high-throughput methods to reliably detect the adventitious presence of such transgenic material would benefit both the scientific and regulatory communities. We assessed the accuracy of using conventional qualitative polymerase chain reaction (PCR) as well as real-time PCR-based assays to quantify the presence of transgenic DNA from bulk samples of non-GE papaya seeds. In this study, an optimized method of extracting high quality DNA from dry seeds of papaya was standardized. A reliable, sensitive real-time PCR method for detecting and quantifying viral coat protein (cp) transgenes in bulk seed samples utilizing the endogenous papain gene is presented. Quantification range was from 0.01 to 100 ng/μl of GE-papaya DNA template with a detection limit as low as 0.01% (10 pg). To test this system, we simulated transgene flow using known quantities of GE and non-GE DNA and determined that 0.038% (38 pg) GE papaya DNA could be detected using real-time PCR. We also validated this system by extracting DNA from known ratios of GE seeds to non-GE seeds of papaya followed by real-time PCR detection and observed a reliable detection limit of 0.4%. This method for the quick and sensitive detection of transgenes in bulked papaya seed lots using conventional as well as real-time PCR-based methods will benefit numerous stakeholders. In particular, this method could be utilized to screen selected fruits from maternal non-GE papaya trees in Hawai'i for the presence of transgenic seed at typical regulatory threshold levels
Characterization of anti-CD20 monoclonal antibody produced by transgenic silkworms (Bombyx mori).
Tada, Minoru; Tatematsu, Ken-ichiro; Ishii-Watabe, Akiko; Harazono, Akira; Takakura, Daisuke; Hashii, Noritaka; Sezutsu, Hideki; Kawasaki, Nana
2015-01-01
In response to the successful use of monoclonal antibodies (mAbs) in the treatment of various diseases, systems for expressing recombinant mAbs using transgenic animals or plants have been widely developed. The silkworm (Bombyx mori) is a highly domesticated insect that has recently been used for the production of recombinant proteins. Because of their cost-effective breeding and relatively easy production scale-up, transgenic silkworms show great promise as a novel production system for mAbs. In this study, we established a transgenic silkworm stably expressing a human-mouse chimeric anti-CD20 mAb having the same amino acid sequence as rituximab, and compared its characteristics with rituximab produced by Chinese hamster ovary (CHO) cells (MabThera®). The anti-CD20 mAb produced in the transgenic silkworm showed a similar antigen-binding property, but stronger antibody-dependent cell-mediated cytotoxicity (ADCC) and weaker complement-dependent cytotoxicity (CDC) compared to MabThera. Post-translational modification analysis was performed by peptide mapping using liquid chromatography/mass spectrometry. There was a significant difference in the N-glycosylation profile between the CHO- and the silkworm-derived mAbs, but not in other post-translational modifications including oxidation and deamidation. The mass spectra of the N-glycosylated peptide revealed that the observed biological properties were attributable to the characteristic N-glycan structures of the anti-CD20 mAbs produced in the transgenic silkworms, i.e., the lack of the core-fucose and galactose at the non-reducing terminal. These results suggest that the transgenic silkworm may be a promising expression system for the tumor-targeting mAbs with higher ADCC activity.
Transgenic horticultural crops in Asia
USDA-ARS?s Scientific Manuscript database
Modern biotechnology applications, including genetic engineering, are a powerful tool to complement the conventional methods of crop improvement. Asia currently has three countries cultivating biotech/transgenic crops – China, India, and the Philippines, but only China commercially grows a transgen...
Aggressive behavior in transgenic animal models: A systematic review.
Jager, Amanda; Maas, Dorien A; Fricke, Kim; de Vries, Rob B; Poelmans, Geert; Glennon, Jeffrey C
2018-08-01
Aggressive behavior is often core or comorbid to psychiatric and neurodegenerative disorders. Transgenic animal models are commonly used to study the neurobiological mechanisms underlying aggressive phenotypes and have led to new insights into aggression. This systematic review critically evaluates the available literature on transgenic animal models tested for aggression with the resident-intruder test. By combining the available literature on this topic, we sought to highlight effective methods for laboratory aggression testing and provide recommendations for study design as well as aggression induction and measurement in rodents that are translational to humans, taking into consideration possible confounding factors. In addition, we built a molecular landscape of interactions between the proteins encoded by the aggression-linked genes from our systematic search. Some molecular pathways within this landscape overlap with psychiatric and neurodegenerative disorders and the landscapes point towards a number of putative (drug) targets for aggression that need to be validated in future studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Beck, Inken M; Sedlacek, Radislav
2015-02-01
The 12th Transgenic Technology meeting was held in Edinburgh on 6th-8th October 2014 and interest to participate in the meeting overcame all expectations. The TT2014 was the largest meeting ever with more than 540 scientists, technicians, and students from all over the world. The meeting had an excellent scientific program that brought information on the latest ground-breaking technologies for gene targeting and genome editing using programmable nucleases into the foreground. These presentations were well balanced with several highlights over viewing topics in embryonic stem cell research, embryogenesis, disease models, and animals in agriculture. Ample space was reserved also for short talks presenting technical development and for highlighting posters contributions. A highlight of the meeting was the award of the 10th International Society of Transgenic Technologies Prize to Janet Rossant for her outstanding contributions in the field of mouse embryogenesis.
Diversity of arthropod community in transgenic poplar-cotton ecosystems.
Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S
2015-12-02
Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.
Liu, Feng; Wang, Xiao-Dong; Zhao, Yi-Ying; Li, Yan-Jun; Liu, Yong-Chang; Sun, Jie
2015-01-01
Insect pests have caused noticeable economic losses in agriculture, and the heavy use of insecticide to control pests not only brings the threats of insecticide resistance but also causes the great pollution to foods and the environment. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been is currently developed for protection against insect pests. In this study, we used this technology to silence the arginine kinase (AK) gene of Helicoverpa armigera (HaAK), encoding a phosphotransferase that plays a critical role in cellular energy metabolism in invertebrate. Transgenic Arabidopsis plants producing HaAK dsRNA were generated by Agrobacterium-mediated transformation. The maximal mortality rate of 55% was reached when H. armigera first-instar larvae were fed with transgenic plant leaves for 3 days, which was dramatically higher than the 18% mortality recorded in the control group. Moreover, the ingestion of transgenic plants significantly retarded larval growth, and the transcript levels of HaAK were also knocked down by up to 52%. The feeding bioassays further indicated that the inhibition efficiency was correlated with the integrity and concentration of the produced HaAK dsRNA in transgenic plants. These results strongly show that the resistance to H. armigera was improved in transgenic Arabidopsis plants, suggesting that the RNAi targeting of AK has the potential for the control of insect pests. PMID:25552931
Type II fish antifreeze protein accumulation in transgenic tobacco does not confer frost resistance.
Kenward, K D; Brandle, J; McPherson, J; Davies, P L
1999-04-01
Type II fish antifreeze protein (AFP) is active in both freezing point depression and the inhibition of ice recrystallization. This extensively disulfide-bonded 14 kDa protein was targeted for accumulation in its pro- and mature forms in the cytosol and apoplast of transgenic tobacco plants. Type II AFP gene constructs under control of a duplicate cauliflower mosaic virus 35S promoter, both with and without a native plant transit peptide sequence, were introduced into tobacco by Agrobacterium tumefaciens-mediated transformation. AFP did not accumulate in the cytosol of transgenic plants, but active AFP was present as 2% the total protein present in the apoplast. Plant-produced AFP was the same size as mature Type II AFP isolated from fish, and was comparable to wild-type AFP in thermal hysteresis activity and its effect on ice crystal morphology. Field trials conducted in late summer on R1 generation transgenic plants showed similar AFP accumulation in plants under field conditions at levels suitable for large-scale production: but no difference in frost resistance was observed between transgenic and wild-type plants during the onset of early fall frosts.
Ramp, Kristina; Skiba, Martin; Karger, Axel; Mettenleiter, Thomas C; Römer-Oberdörfer, Angela
2011-02-01
Members of the order Mononegavirales express their genes in a transcription gradient from 3' to 5'. To assess how this impacts on expression of a foreign transgene, the haemagglutinin (HA) of highly pathogenic avian influenza virus (HPAIV) A/chicken/Vietnam/P41/05 (subtype H5N1) was inserted between the phosphoprotein (P) and matrix protein (M), M and fusion protein (F), or F and haemagglutinin-neuraminidase protein (HN) genes of attenuated Newcastle disease virus (NDV) Clone 30. In addition, the gene encoding the neuraminidase of HPAIV A/duck/Vietnam/TG24-01/05 (subtype H5N1) was inserted into the NDV genome either alone or in combination with the HA gene. All recombinants replicated well in embryonated chicken eggs. The expression levels of HA-specific mRNA and protein were quantified by Northern blot analysis and mass spectrometry, with good correlation. HA expression levels differed only moderately and were highest in the recombinant carrying the HA insertion between the F and HN genes of NDV.
Millwood, Reginald; Nageswara-Rao, Madhugiri; Ye, Rongjian; Terry-Emert, Ellie; Johnson, Chelsea R; Hanson, Micaha; Burris, Jason N; Kwit, Charles; Stewart, C Neal
2017-05-02
Switchgrass is C 4 perennial grass species that is being developed as a cellulosic bioenergy feedstock. It is wind-pollinated and considered to be an obligate outcrosser. Genetic engineering has been used to alter cell walls for more facile bioprocessing and biofuel yield. Gene flow from transgenic cultivars would likely be of regulatory concern. In this study we investigated pollen-mediated gene flow from transgenic to nontransgenic switchgrass in a 3-year field experiment performed in Oliver Springs, Tennessee, U.S.A. using a modified Nelder wheel design. The planted area (0.6 ha) contained sexually compatible pollen source and pollen receptor switchgrass plants. One hundred clonal switchgrass 'Alamo' plants transgenic for an orange-fluorescent protein (OFP) and hygromycin resistance were used as the pollen source; whole plants, including pollen, were orange-fluorescent. To assess pollen movement, pollen traps were placed at 10 m intervals from the pollen-source plot in the four cardinal directions extending to 20 m, 30 m, 30 m, and 100 m to the north, south, west, and east, respectively. To assess pollination rates, nontransgenic 'Alamo 2' switchgrass clones were planted in pairs adjacent to pollen traps. In the eastward direction there was a 98% decrease in OFP pollen grains from 10 to 100 m from the pollen-source plot (Poisson regression, F1,8 = 288.38, P < 0.0001). At the end of the second and third year, 1,820 F 1 seeds were collected from pollen recipient-plots of which 962 (52.9%) germinated and analyzed for their transgenic status. Transgenic progeny production detected in each pollen-recipient plot decreased with increased distance from the edge of the transgenic plot (Poisson regression, F1,15 = 12.98, P < 0.003). The frequency of transgenic progeny detected in the eastward plots (the direction of the prevailing wind) ranged from 79.2% at 10 m to 9.3% at 100 m. In these experiments we found transgenic pollen movement and hybridization rates to be
An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation.
Hu, Jianjun; Zhang, Jin; Chen, Xingling; Lv, Jinhui; Jia, Huixia; Zhao, Shutang; Lu, Mengzhu
2017-01-01
To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar) and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0%) compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture) after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations.
An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation
Chen, Xingling; Lv, Jinhui; Jia, Huixia; Zhao, Shutang; Lu, Mengzhu
2017-01-01
To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar) and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0%) compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture) after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations. PMID:28085955
Model-based assist feature insertion for sub-40nm memory device
NASA Astrophysics Data System (ADS)
Suh, Sungsoo; Lee, Suk-joo; Choi, Seong-woon; Lee, Sung-Woo; Park, Chan-hoon
2009-04-01
Many issues need to be resolved for a production-worthy model based assist feature insertion flow for single and double exposure patterning process to extend low k1 process at 193 nm immersion technology. Model based assist feature insertion is not trivial to implement either for single and double exposure patterning compared to rule based methods. As shown in Fig. 1, pixel based mask inversion technology in itself has difficulties in mask writing and inspection although it presents as one of key technology to extend single exposure for contact layer. Thus far, inversion technology is tried as a cooptimization of target mask to simultaneously generate optimized main and sub-resolution assists features for a desired process window. Alternatively, its technology can also be used to optimize for a target feature after an assist feature types are inserted in order to simplify the mask complexity. Simplification of inversion mask is one of major issue with applying inversion technology to device development even if a smaller mask feature can be fabricated since the mask writing time is also a major factor. As shown in Figure 2, mask writing time may be a limiting factor in determining whether or not an inversion solution is viable. It can be reasoned that increased number of shot counts relates to increase in margin for inversion methodology. On the other hand, there is a limit on how complex a mask can be in order to be production worthy. There is also source and mask co-optimization which influences the final mask patterns and assist feature sizes and positions for a given target. In this study, we will discuss assist feature insertion methods for sub 40-nm technology.
Isogenic transgenic homozygous fish induced by artificial parthenogenesis.
Nam, Y K; Cho, Y S; Kim, D S
2000-12-01
As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.
Li, X Y; Liu, F; Hu, Y F; Xia, M; Cheng, B J; Zhu, S W; Ma, Q
2015-12-21
The ectopic expression of cellulase in biomass can reduce the cost of biofuel conversion. This trait modification technique is highly beneficial for biofuel production. In this study, we isolated an endo-1,4-beta-glucanase gene (EGV) from Trichoderma reesei and inserted this gene downstream of a fragment encoding the signal peptide Apo-SP in a modified pCAMBIA1301 vector to obtain an Apo-SP and AsRed fusion protein. Transient expression of this fusion protein in onion epidermal cells showed that the Apo-SP signal was localized to the plastids. EGV transgenic rice plants that did not carry screening marker genes were obtained through overexpression of the pDTB double T-DNA vector. Western blotting showed that EGV was expressed in the dry straw of T0 generation transgenic rice plants and in fresh leaves of the T1 generation. More importantly, our results also showed that the peptide product of EGV in the transgenic plants folded correctly and was capable of digesting the cellulase substrate CMC. Additionally, cellulase activity remained stable in the straw that had been dried at room temperature for three months. This study presents an important technical approach for the development of transgenic rice straw that has stable cellulase activity and can be used for biofuel conversion.
Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System
ERIC Educational Resources Information Center
Szeberényi, József
2013-01-01
Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…
Gitzinger, Marc; Kemmer, Christian; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin
2009-06-30
Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida-mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies.
Gitzinger, Marc; Kemmer, Christian; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin
2009-01-01
Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida–mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies. PMID:19549857
Wang, Yan-yan; Chen, Ru-zhui; Zhu, Xiao-nani; Liu, Jing; Li, Zhi-hui; Liu, Xiu-juan; Li, Zhi-hui; Na, Xin; Liang, Shan-shan; Qiu, Guo-guang; Zhang, Wei; Wang, Hai; Wang, Xue-lan
2012-05-01
To establish homozygous transgenic mouse strain expressing human tau isoform with P301L mutation. Five transgenic mice expressing human tau isoform with P301L mutation were obtained by microinjection into male nuclei. Homozygote and hemizygote were identified by PCR and real-time fluorescent quantitative PCR. Ninety five homozygous transgenic mice were selected, and the results indicated that homozygous transgenic mice were superior to hemizygote in simulating the changes of biological characteristics. Exogenous gene tau is able to stably transmit to next generation and the combination of SYBR Green real-time fluorescent quantitative PCR with the traditional mating is a fast, reliable and economical way to screen homozygous and hemizygous transgenic mice.
Transgene flow: Facts, speculations and possible countermeasures
Ryffel, Gerhart U
2014-01-01
Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171
Copy number determination of genetically-modified hematopoietic stem cells.
Schuesler, Todd; Reeves, Lilith; Kalle, Christof von; Grassman, Elke
2009-01-01
Human gene transfer with gammaretroviral, murine leukemia virus (MLV) based vectors has been shown to effectively insert and express transgene sequences at a level of therapeutic benefit. However, there are numerous reports of disruption of the normal cellular processes caused by the viral insertion, even of replication deficient gammaretroviral vectors. Current gammaretroviral and lentiviral vectors do not control the site of insertion into the genome, hence, the possibility of disruption of the target cell genome. Risk related to viral insertions is linked to the number of insertions of the transgene into the cellular DNA, as has been demonstrated for replication competent and replication deficient retroviruses in experiments. At high number of insertions per cell, cell transformation due to vector induced activation of proto-oncogenes is more likely to occur, in particular since more than one transforming event is needed for oncogenesis. Thus, determination of the vector copy number in bulk transduced populations, individual colony forming units, and tissue from the recipient of the transduced cells is an increasingly important safety assay and has become a standard, though not straightforward assay, since the inception of quantitative PCR.
Staunstrup, Nicklas Heine; Stenderup, Karin; Mortensen, Sidsel; Primo, Maria Nascimento; Rosada, Cecilia; Steiniche, Torben; Liu, Ying; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Schrøder, Lisbeth Dahl; Svensson, Lars; Petersen, Thomas Kongstad; Callesen, Henrik; Bolund, Lars; Mikkelsen, Jacob Giehm
2017-07-01
Psoriasis is a complex human-specific disease characterized by perturbed keratinocyte proliferation and a pro-inflammatory environment in the skin. Porcine skin architecture and immunity are very similar to that in humans, rendering the pig a suitable animal model for studying the biology and treatment of psoriasis. Expression of integrins, which is normally confined to the basal layer of the epidermis, is maintained in suprabasal keratinocytes in psoriatic skin, modulating proliferation and differentiation as well as leukocyte infiltration. Here, we generated minipigs co-expressing integrins α2 and β1 in suprabasal epidermal layers. Integrin-transgenic minipigs born into the project displayed skin phenotypes that correlated with the number of inserted transgenes. Molecular analyses were in good concordance with histological observations of psoriatic hallmarks, including hypogranulosis and T-lymphocyte infiltration. These findings mark the first creation of minipigs with a psoriasiform phenotype resembling human psoriasis and demonstrate that integrin signaling plays a key role in psoriasis pathology. © 2017. Published by The Company of Biologists Ltd.
Staunstrup, Nicklas Heine; Stenderup, Karin; Mortensen, Sidsel; Primo, Maria Nascimento; Steiniche, Torben; Liu, Ying; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Schrøder, Lisbeth Dahl; Svensson, Lars; Petersen, Thomas Kongstad; Callesen, Henrik; Bolund, Lars
2017-01-01
ABSTRACT Psoriasis is a complex human-specific disease characterized by perturbed keratinocyte proliferation and a pro-inflammatory environment in the skin. Porcine skin architecture and immunity are very similar to that in humans, rendering the pig a suitable animal model for studying the biology and treatment of psoriasis. Expression of integrins, which is normally confined to the basal layer of the epidermis, is maintained in suprabasal keratinocytes in psoriatic skin, modulating proliferation and differentiation as well as leukocyte infiltration. Here, we generated minipigs co-expressing integrins α2 and β1 in suprabasal epidermal layers. Integrin-transgenic minipigs born into the project displayed skin phenotypes that correlated with the number of inserted transgenes. Molecular analyses were in good concordance with histological observations of psoriatic hallmarks, including hypogranulosis and T-lymphocyte infiltration. These findings mark the first creation of minipigs with a psoriasiform phenotype resembling human psoriasis and demonstrate that integrin signaling plays a key role in psoriasis pathology. PMID:28679670
Ananieva, Elitsa A; Van Horn, Cynthia G; Jones, Meghan R; Hutson, Susan M
2017-02-01
Unlike other amino acids, the branched-chain amino acids (BCAAs) largely bypass first-pass liver degradation due to a lack of hepatocyte expression of the mitochondrial branched-chain aminotransferase (BCATm). This sets up interorgan shuttling of BCAAs and liver-skeletal muscle cooperation in BCAA catabolism. To explore whether complete liver catabolism of BCAAs may impact BCAA shuttling in peripheral tissues, the BCATm gene was stably introduced into mouse liver. Two transgenic mouse lines with low and high hepatocyte expression of the BCATm transgene (LivTg-LE and LivTg-HE) were created and used to measure liver and plasma amino acid concentrations and determine whether the first two BCAA enzymatic steps in liver, skeletal muscle, heart and kidney were impacted. Expression of the hepatic BCATm transgene lowered the concentrations of hepatic BCAAs while enhancing the concentrations of some nonessential amino acids. Extrahepatic BCAA metabolic enzymes and plasma amino acids were largely unaffected, and no growth rate or body composition differences were observed in the transgenic animals as compared to wild-type mice. Feeding the transgenic animals a high-fat diet did not reverse the effect of the BCATm transgene on the hepatic BCAA catabolism, nor did the high-fat diet cause elevation in plasma BCAAs. However, the high-fat-diet-fed BCATm transgenic animals experienced attenuation in the mammalian target of rapamycin (mTOR) pathway in the liver and had impaired blood glucose tolerance. These results suggest that complete liver BCAA metabolism influences the regulation of glucose utilization during diet-induced obesity. Copyright © 2016 Elsevier Inc. All rights reserved.
Ananieva, Elitsa A.; Van Horn, Cynthia G.; Jones, Meghan R.; Hutson, Susan M.
2016-01-01
Unlike other amino acids, the branched chain amino acids (BCAAs) largely bypass first pass liver degradation due to a lack of hepatocyte expression of the mitochondrial branched chain aminotransferase (BCATm). This sets up interorgan shuttling of BCAAs and liver-skeletal muscle cooperation in BCAA catabolism. To explore whether complete liver catabolism of BCAAs may impact BCAA shuttling in peripheral tissues, the BCATm gene was stably introduced into mouse liver. Two transgenic mouse lines with low and high hepatocyte expression of the BCATm transgene (LivTg-LE and LivTg-HE) were created and used to measure liver and plasma amino acid concentrations and determine whether the first two BCAA enzymatic steps in liver, skeletal muscle, heart, and kidney were impacted. Expression of the hepatic BCATm transgene lowered the concentrations of hepatic BCAAs while enhancing the concentrations of some nonessential amino acids. Extrahepatic BCAA metabolic enzymes and plasma amino acids were largely unaffected and no growth rate or body composition differences were observed in the transgenic animals as compared to wild type (WT) mice. Feeding the transgenic animals a high fat diet did not reverse the effect of the BCATm transgene on the hepatic BCAA catabolism nor did the high fat diet cause elevation in plasma BCAAs. However, the high fat diet fed BCATm transgenic animals experienced attenuation in the mammalian target of rapamycin (mTOR) pathway in the liver and had impaired blood glucose tolerance. These results suggest that complete liver BCAA metabolism influences the regulation of glucose utilization during diet-induced obesity. PMID:27886623
Song, Shaozheng; Ge, Xin; Cheng, Yaobin; Lu, Rui; Zhang, Ting; Yu, Baoli; Ji, Xueqiao; Qi, Zhengqiang; Rong, Yao; Yuan, Yuguo; Cheng, Yong
2016-08-01
The human tissue-type plasminogen activator (tPA) is a key kinase of fibrinolysis that plays an important role in dissolving fibrin clots to promote thrombolysis. The recombinant human plasminogen activator (rhPA) has more thrombolytic advantages than the wild type tPA. To increase the half-life and thrombolytic activity of tPA, a mutant containing only the essential K2 fibrin-binding and P activating plasminogen domains of the wild type tPA was cloned. This fragment was then inserted into goat β-casein regulatory sequences. Then, a mammary gland-specific expression vector, PCL25/rhPA, was constructed, and the transgenic rabbits were generated. In this study, 18 live transgenic founders (12♀, 6♂) were generated using pronuclear microinjection. Six transgenic rabbits were obtained, and the expression levels of rhPA in the milk had a range of 15.2-630 µg/ml. A fibrin agarose plate assay of rhPA showed that it had strong thrombolytic bioactivity in vitro, and the highest specific activity was >360 (360 times more than that of alteplase). The results indicated that the rhPA containing only the K2 and P domains is efficiently expressed with higher thrombolytic bioactivity in the milk of transgenic rabbits. Our study also demonstrated a new method for the large-scale production of clinically relevant recombinant pharmaceutical proteins in the mammary glands of transgenic rabbits.
[Progress in transgenic fish techniques and application].
Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying
2011-05-01
Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.
Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen
2013-01-01
RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449
Generation of transgenic Hydra by embryo microinjection.
Juliano, Celina E; Lin, Haifan; Steele, Robert E
2014-09-11
As a member of the phylum Cnidaria, the sister group to all bilaterians, Hydra can shed light on fundamental biological processes shared among multicellular animals. Hydra is used as a model for the study of regeneration, pattern formation, and stem cells. However, research efforts have been hampered by lack of a reliable method for gene perturbations to study molecular function. The development of transgenic methods has revitalized the study of Hydra biology(1). Transgenic Hydra allow for the tracking of live cells, sorting to yield pure cell populations for biochemical analysis, manipulation of gene function by knockdown and over-expression, and analysis of promoter function. Plasmid DNA injected into early stage embryos randomly integrates into the genome early in development. This results in hatchlings that express transgenes in patches of tissue in one or more of the three lineages (ectodermal epithelial, endodermal epithelial, or interstitial). The success rate of obtaining a hatchling with transgenic tissue is between 10% and 20%. Asexual propagation of the transgenic hatchling is used to establish a uniformly transgenic line in a particular lineage. Generating transgenic Hydra is surprisingly simple and robust, and here we describe a protocol that can be easily implemented at low cost.
Transgenic plants with enhanced growth characteristics
Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.
2016-09-06
The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.
Transgenic plants with enhanced growth characteristics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.
The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of themore » double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.« less
Srinivasan, Rahul; Lu, Tsai-Yi; Chai, Hua; Xu, Ji; Huang, Ben S; Golshani, Peyman; Coppola, Giovanni; Khakh, Baljit S
2016-12-21
Astrocytes exist throughout the nervous system and are proposed to affect neural circuits and behavior. However, studying astrocytes has proven difficult because of the lack of tools permitting astrocyte-selective genetic manipulations. Here, we report the generation of Aldh1l1-Cre/ERT2 transgenic mice to selectively target astrocytes in vivo. We characterized Aldh1l1-Cre/ERT2 mice using imaging, immunohistochemistry, AAV-FLEX-GFP microinjections, and crosses to RiboTag, Ai95, and new Cre-dependent membrane-tethered Lck-GCaMP6f knockin mice that we also generated. Two to three weeks after tamoxifen induction, Aldh1l1-Cre/ERT2 selectively targeted essentially all adult (P80) brain astrocytes with no detectable neuronal contamination, resulting in expression of cytosolic and Lck-GCaMP6f, and permitting subcellular astrocyte calcium imaging during startle responses in vivo. Crosses with RiboTag mice allowed sequencing of actively translated mRNAs and determination of the adult cortical astrocyte transcriptome. Thus, we provide well-characterized, easy-to-use resources with which to selectively study astrocytes in situ and in vivo in multiple experimental scenarios. Copyright © 2016 Elsevier Inc. All rights reserved.
Study of pH (low) insertion peptides (pHLIPs) interaction with lipid bilayer of membrane
NASA Astrophysics Data System (ADS)
Weerakkody, Dhammika
The pH-dependent interactions of pHLIPsRTM (pH (Low) Insertion Peptides) with lipid bilayer of membrane provides an opportunity to study and address fundamental questions of protein folding/insertion into membrane and unfolding/exit, as well as develop novel approach to target acidic diseased tissue such as cancer, ischemic myocardium, infection and others. The main goal of the work presented here is to answer the following questions: - What is the molecular mechanism of spontaneous insertion and folding of a peptide in a lipid bilayer of membrane; - What is the molecular mechanism of unfolding and exit of a peptide from a lipid bilayer of membrane; - How polar cargo attached to a peptide's inserting end might affect the process of insertion into a lipid bilayer of membrane; How sequence variation will affect a peptide's interactions with a lipid bilayer of membrane (partitioning into bilayer at neutral and low pH; apparent pK of insertion) with the main goal to identify the best pHLIP variants for imaging and therapy of pathological states such as cancer and others. It has been demonstrated that pHLIP insertion into a membrane is associated with the protonation of Asp/Glu residues, which leads to an increase of hydrophobicity that triggers the folding and insertion of the peptide across a lipid bilayer. The insertion of the pHLIP is unidirectional and it is accompanied by the release of energy. Therefore, the energy of membrane associated-folding can be used to favor the movement of cell-impermeable polar cargo molecules across the hydrophobic membrane bilayer when they are attached to the inserting end of pHLIP. Both pH-targeting behavior and molecular translocation have been demonstrated in cultured cells and in vivo. Thus, there is an opportunity to develop a novel concept in drug delivery, which is based on the use of a monomeric, pH-sensitive peptide molecular transporter, to deliver agents that are significantly more polar than conventional drugs
Huang, Haijiao; Chen, Su; Li, Huiyu; Jiang, Jing
2015-09-01
Overexpression of BpAP1 could cause early flowering in birch. BpAP1 affected the expression of many flowering-related unigenes and diterpenoid biosynthesis in transgenic birch, and BpPI was a putative target gene of BpAP1. APETALA1 (AP1) is an MADS-box transcription factor that is involved in the flowering process in plants and has been a focus of genetic studies examining flower development. Here, we carried out transcriptome analysis of birch (Betula platyphylla Suk.), including BpAP1 overexpression lines, BpAP1 suppression lines, and non-transgenic line (NT). Compared with NT, we detected 8302 and 7813 differentially expressed unigenes in 35S::BpAP1 and 35S::BpAP1RNAi transgenic lines, respectively. Overexpression and suppression of BpAP1 in birch affected diterpenoid biosynthesis and altered expression of many flowering-related unigenes. Moreover, combining information from the RNA-seq database and the birch genome, we predicted downstream target genes of BpAP1. Among the 166 putative target genes of BpAP1, there was a positive correlation between BpAP1 and BpPI. These results provide references for further examining the relationship between BpAP1 and its target genes, and reveal that BpAP1 functions as a transcription regulator in birch.
Turbine vane segment and impingement insert configuration for fail-safe impingement insert retention
Burdgick, Steven Sebastian; Kellock, Iain Robertson
2003-05-13
An impingement insert sleeve is provided that is adapted to be disposed in a coolant cavity defined through a stator vane. The insert has a generally open inlet end and first and second pairs of diametrically opposed side walls, and at least one fail-safe tab defined at a longitudinal end of the insert for limiting radial displacement of the insert with respect to the stator vane.
Laughlin, Karen D; Power, Alison G; Snow, Allison A; Spencer, Lawrence J
2009-07-01
The development of crops genetically engineered for pathogen resistance has raised concerns that crop-to-wild gene flow could release wild or weedy relatives from regulation by the pathogens targeted by the transgenes that confer resistance. Investigation of these risks has also raised questions about the impact of gene flow from conventional crops into wild plant populations. Viruses in natural plant populations can play important roles in plant fecundity and competitive interactions. Here, we show that virus-resistance transgenes and conventional crop genes can increase fecundity of wild plants under virus pressure. We asked how gene flow from a cultivated squash (Cucurbita pepo) engineered for virus resistance would affect the fecundity of wild squash (C. pepo) in the presence and absence of virus pressure. A transgenic squash cultivar was crossed and backcrossed with wild C. pepo from Arkansas. Wild C. pepo, transgenic backcross plants, and non-transgenic backcross plants were compared in field plots in Ithaca, New York, USA. The second and third generations of backcrosses (BC2 and BC3) were used in 2002 and 2003, respectively. One-half of the plants were inoculated with zucchini yellow mosaic virus (ZYMV), and one-half of the plants were maintained as healthy controls. Virus pressure dramatically decreased the fecundity of wild C. pepo plants and non-transgenic backcross plants relative to transgenic backcross plants, which showed continued functioning of the virus-resistance transgene. In 2002, non-transgenic backcross fecundity was slightly higher than wild C. pepo fecundity under virus pressure, indicating a possible benefit of conventional crop alleles, but they did not differ in 2003 when fecundity was lower in both groups. We detected no fitness costs of the transgene in the absence of the virus. If viruses play a role in the population dynamics of wild C. pepo, we predict that gene flow from transgenic, virus-resistant squash and, to a much lesser
An interplanetary targeting and orbit insertion maneuver design technique
NASA Technical Reports Server (NTRS)
Hintz, G. R.
1980-01-01
The paper describes a tradeoff in selecting a planetary encounter aimpoint and a spacecraft propulsive maneuver strategy in the Pioneer Venus Orbiter Mission. The method uses parametric data spanning a region of acceptable targeting aimpoints in the delivery space and the geometric considerations. Real-time maneuver adjustments accounted for known attitude control errors, orbit determination updates, and late changes in a targeting specification.
NASA Technical Reports Server (NTRS)
Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.
2003-01-01
Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.
NASA Astrophysics Data System (ADS)
Williams, Ifor R.; Kupper, Thomas S.
1994-10-01
Keratinocytes at sites of cutaneous inflammation have increased expression of intercellular adhesion molecule 1 (ICAM-1), a cytokine-inducible adhesion molecule which binds the leukocyte integrins LFA-1 and Mac-1. Transgenic mice were prepared in which the expression of mouse ICAM-1 was targeted to basal keratinocytes by using the human K14 keratin promoter. The level of constitutive expression attained in the transgenic mice exceeded the peak level of ICAM-1 expression induced on nontransgenic mouse keratinocytes in vitro by optimal combinations of interferon γ and tumor necrosis factor α or in vivo by proinflammatory stimuli such as phorbol 12-myristate 13-acetate. In vitro adhesion assays demonstrated that cultured transgenic keratinocytes were superior to normal keratinocytes as a substrate for the LFA-1-dependent binding of mouse T cells, confirming that the transgene-encoded ICAM-1 was expressed in a functional form. However, the high level of constitutive ICAM-1 expression achieved on keratinocytes in vivo in these transgenic mice did not result in additional recruitment of CD45^+ leukocytes into transgenic epidermis, nor did it elicit dermal inflammation. Keratinocyte ICAM-1 expression also did not potentiate contact-hypersensitivity reactions to epicutaneous application of haptens. The absence of a spontaneous phenotype in these transgenic mice was not the result of increased levels of soluble ICAM-1, since serum levels of soluble ICAM-1 were equal in transgenic mice and controls. We conclude that elevated ICAM-1 expression on keratinocytes cannot act independently to influence leukocyte trafficking and elicit cutaneous inflammation.
Hrnkova, Miroslava; Zilka, Norbert; Minichova, Zuzana; Koson, Peter; Novak, Michal
2007-01-26
Human truncated tau protein is an active constituent of the neurofibrillary degeneration in sporadic Alzheimer's disease. We have shown that modified tau protein, when expressed as a transgene in rats, induced AD characteristic tau cascade consisting of tau hyperphosphorylation, formation of argyrophilic tangles and sarcosyl-insoluble tau complexes. These pathological changes led to the functional impairment characterized by a variety of neurobehavioural symptoms. In the present study we have focused on the behavioural alterations induced by transgenic expression of human truncated tau. Transgenic rats underwent a battery of behavioural tests involving cognitive- and sensorimotor-dependent tasks accompanied with neurological assessment at the age of 4.5, 6 and 9 months. Behavioural examination of these rats showed altered spatial navigation in Morris water maze resulting in less time spent in target quadrant (p<0.05) and fewer crossings over previous platform position (p<0.05) during probe trial. Spontaneous locomotor activity and anxiety in open field was not influenced by transgene expression. However beam walking test revealed that transgenic rats developed progressive sensorimotor disturbances related to the age of tested animals. The disturbances were most pronounced at the age of 9 months (p<0.01). Neurological alterations indicating impaired reflex responses were other added features of behavioural phenotype of this novel transgenic rat. These results allow us to suggest that neurodegeneration, caused by the non-mutated human truncated tau derived from sporadic human AD, result in the neuronal dysfunction consequently leading to the progressive neurobehavioural impairment.
Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N
2007-01-01
To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach
Teleoperated master-slave needle insertion.
Abolhassani, Niki; Patel, Rajni V
2009-12-01
Accuracy of needle tip placement and needle tracking in soft tissue are of particular importance in many medical procedures. In recent years, developing autonomous and teleoperated systems for needle insertion has become an active area of research. In this study, needle insertion was performed using a master-slave set-up with multi-degrees of freedom. The effect of force feedback on the accuracy of needle insertion was investigated. In addition, this study compared autonomous, teleoperated and semi-autonomous needle insertion. The results of this study show that incorporation of force feedback can improve teleoperated needle insertion. However, autonomous and semi-autonomous needle insertions, which use feedback from a deflection model, provide significantly better performance. Development of a haptic master-slave needle insertion system, which is capable of performing some autonomous tasks based on feedback from tissue deformation and needle deflection models, can improve the performance of autonomous robotics-based insertions as well as non-autonomous teleoperated manual insertions. Copyright (c) 2009 John Wiley & Sons, Ltd.
Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin
2016-01-01
Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.
Innate Immune Activation Can Trigger Experimental Spondyloarthritis in HLA-B27/Huβ2m Transgenic Rats
van Tok, Melissa N.; Satumtira, Nimman; Dorris, Martha; Pots, Desirée; Slobodin, Gleb; van de Sande, Marleen G.; Taurog, Joel D.; Baeten, Dominique L.; van Duivenvoorde, Leonie M.
2017-01-01
Spondyloarthritis (SpA) does not display the typical features of auto-immune disease. Despite the strong association with MHC class I, CD8+ T cells are not required for disease induction in the HLA-B27/Huβ2m transgenic rats. We used Lewis HLA-B27/Huβ2m transgenic rats [21-3 × 283-2]F1, HLA-B7/Huβ2m transgenic rats [120-4 × 283-2]F1, and wild-type rats to test our hypothesis that SpA may be primarily driven by the innate immune response. In vitro, splenocytes were stimulated with heat-inactivated Mycobacterium tuberculosis and cytokine expression and production was measured. In vivo, male and female rats were immunized with 30, 60, or 90 µg of heat-inactivated M. tuberculosis and clinically monitored for spondylitis and arthritis development. After validation of the model, we tested whether prophylactic and therapeutic TNF targeting affected spondylitis and arthritis. In vitro stimulation with heat-inactivated M. tuberculosis strongly induced gene expression of pro-inflammatory cytokines such as TNF, IL-6, IL-1α, and IL-1β, in the HLA-B27 transgenic rats compared with controls. In vivo immunization induced an increased spondylitis and arthritis incidence and an accelerated and synchronized onset of spondylitis and arthritis in HLA-B27 transgenic males and females. Moreover, immunization overcame the protective effect of orchiectomy. Prophylactic TNF targeting resulted in delayed spondylitis and arthritis development and reduced arthritis severity, whereas therapeutic TNF blockade did not affect spondylitis and arthritis severity. Collectively, these data indicate that innate immune activation plays a role in the initiation of HLA-B27-associated disease and allowed to establish a useful in vivo model to study the cellular and molecular mechanisms of disease initiation and progression. PMID:28824645
[A comparison study of hpt and bar as selection marker gene of transgenic rice].
Zhang, Chun-Yu; Li, Hong-Yu; Liu, Bin
2012-12-01
The decision of using selection marker is one of the key factors for success of plant genetic transformation and offspring screening. As two commonly used selection markers, hpt and bar genes are widely used in tissue culture-based rice transformation. To experimentally compare their performance, we investigated the efficiency of two transformation systems using Hygromycin and Bialaphos as the selection agents, respectively. The result indicated that the system using hpt gene as the selection marker saved 10 days and had double transformation efficiency and lower transgene copy number in comparison to the system using bar gene. Then, we assessed the feasibility of screening transgenic rice in the field by soaking the wild-type and transgenic seeds in a series of solutions containing step diluted hygromycin for two days. We targeted the suitable concentration for distinguishing the transgenic seeds from WT Kitaake seeds was 167 mg L(-1). However, the cost of screening by hygromycin is still much higher than that of Basta in field test. Therefore, this study experimentally demonstrated the advantages and disadvantages of the hpt and bar gene as the selection markers and thus provided a reference for choose of an appropriate selection marker according to the practical applications.
HZE particle radiation induces tissue-specific and p53-dependent mutagenesis in transgenic animals
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R.
2001-01-01
Transgenic animals, with the integrated target gene, provide a unique approach for measuring and characterizing mutations in any tissue of the animal. We are using the plasmid-based lacZ transgenic mice with different p53 genetic background to examine radiation-induced genetic damage resulting from exposure to heavy particle radiation. We measured lacZ mutation frequencies (MF) in the brain and spleen tissues at various times after exposing animals to an acute dose of 1 Gy of 1GeV/amu iron particles. MF in the spleen of p53+/+ animals increased up to 2.6-fold above spontaneous levels at 8 weeks post irradiation. In contrast, brain MF from the same animals increased 1.7-fold above controls in the same period. In the p53-/- animals, brain MF increased to 2.2-fold above spontaneous levels at 1 week after treatment, but returned to control levels thereafter. Radiation also induced alterations in the spectrum of mutants in both tissues, accompanied by changes in the frequency of mutants with deletions extending past the transgene into mouse genomic DNA. Our results indicate that the accumulation of transgene MF after radiation exposure is dependant on the tissue examined as well as the p53 genetic background of the animals.
Byrgazov, Konstantin; Lucini, Chantal Blanche; Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A; Hoermann, Gregor; Valent, Peter; Lion, Thomas
2016-11-22
Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance.
Berkowitsch, Bettina; Koenig, Margit; Haas, Oskar A.; Hoermann, Gregor; Valent, Peter; Lion, Thomas
2016-01-01
Point mutations in the ABL1 kinase domain are an important mechanism of resistance to tyrosine kinase inhibitors (TKI) in BCR-ABL1-positive and, as recently shown, BCR-ABL1-like leukemias. The cell line Ba/F3 lentivirally transduced with mutant BCR-ABL1 constructs is widely used for in vitro sensitivity testing and response prediction to tyrosine kinase inhibitors. The transposon-based Sleeping Beauty system presented offers several advantages over lentiviral transduction including the absence of biosafety issues, faster generation of transgenic cell lines, and greater efficacy in introducing large gene constructs. Nevertheless, both methods can mediate multiple insertions in the genome. Here we show that multiple BCR-ABL1 insertions result in elevated IC50 levels for individual TKIs, thus overestimating the actual resistance of mutant subclones. We have therefore established flow-sorting-based fractionation of BCR-ABL1-transformed Ba/F3 cells facilitating efficient enrichment of cells carrying single-site insertions, as demonstrated by FISH-analysis. Fractions of unselected Ba/F3 cells not only showed a greater number of BCR-ABL1 hybridization signals, but also revealed higher IC50 values for the TKIs tested. The data presented highlight the need to carefully select transfected cells by flow-sorting, and to control the insertion numbers by FISH and real-time PCR to permit unbiased in vitro testing of drug resistance. PMID:27801667
Development of RNAi Libraries for Target Validation and Therapeutics
2006-03-01
met using a hammerhead ribozyme transgene reduces in vitro invasion and migration in prostate cancer cells. Prostate, 60: 317-324, 2004. 49...Watkins, G., Mason, M.D., Jiang, W.G. (2004) Targeting the HGF/SF receptor c-met using a hammerhead ribozyme transgene reduces in vitro invasion...reduction of tumor growth (27). In addition, when c-met was knocked-down using ribozymes , cell invasion and metastasis were inhibited both in vitro
Optimization of Biofuel Production From Transgenic Microalgae
2013-02-27
AFRL-OSR-VA-TR-2013-0145 OPTIMIZATION OF BIOFUEL PRODUCTION FROM TRANSGENIC MICROALGAE Richard Sayre Donald Danforth...Technical 20080815 to 20120630 OPTIMIZATION OF BIOFUEL PRODUCTION FROM TRANSGENIC MICROALGAE FA9550-08-1-0451 Richard Sayre Donald Danforth Plant...BIOFUEL PRODUCTION FROM TRANSGENIC MICROALGAE Grant/Contract Number: FA9550-08-1-0451 Reporting Period: Final Report Abstract: We have compared the
The Direct Insertion of the ACL Carries More Load than the Indirect Insertion
Nawabi, Danyal H.; Tucker, Scott; Jones, Kristofer J.; Nguyen, Joseph; Wickiewicz, Thomas L.; Imhauser, Carl; Pearle, Andrew
2014-01-01
Objectives: Recent histological studies have shown that the ACL consists of two different structures: the direct and indirect insertions. The direct insertion is located along the lateral intercondylar ridge and the indirect insertion is ‘lower’ in the notch, adjacent to the posterior articular cartilage. The ‘lower’ position has become more popular for locating the femoral tunnel, as surgeons switch to the anteromedial (AM) portal drilling technique in order to place the graft in the region of the native footprint. However, a recent registry-based outcomes study has reported a 1.5 times higher graft failure rate for AM portal versus traditional transtibial techniques. The objective of this study was to investigate the load characteristics of the native ACL in the regions of the direct and indirect insertions. We hypothesized that the direct insertion would carry more load than the indirect insertion. Methods: Twelve cadaveric knees were mounted to a six degree of freedom robot equipped with a universal force-moment sensor. We simulated the Lachman and anterior drawer tests at 30oand 90o of flexion by applying a 134N anterior load, and the pivot shift test at 15o flexion by applying combined valgus (8Nm) and internal (4Nm) rotational moments. The kinematic pathway required to achieve these loading conditions was recorded for each intact knee. Using position control to repeat the loading paths, the robot recorded the loads for the ACL intact, ACL partially sectioned, and ACL completely sectioned states. Sectioning Protocol: The lateral intercondylar ridge and posterior articular margin was identified in each case. The 50% mark between this two areas was used to delineate the regions of the direct and indirect insertions (Fig. 1). Sectioning order was alternated between each cadaver. Footprint Digitization: The borders of the sectioned areas were digitized post-sectioning and mapped onto a computed tomography (CT) scan of each knee. The sectioning method was
Does Needle Rotation Improve Lesion Targeting?
Badaan, Shadi; Petrisor, Doru; Kim, Chunwoo; Mozer, Pierre; Mazilu, Dumitru; Gruionu, Lucian; Patriciu, Alex; Cleary, Kevin; Stoianovici, Dan
2011-01-01
Background Image-guided robots are manipulators that operate based on medical images. Perhaps the most common class of image-guided robots are robots for needle interventions. Typically, these robots actively position and/or orient a needle guide, but needle insertion is still done by the physician. While this arrangement may have safety advantages and keep the physician in control of needle insertion, actuated needle drivers can incorporate other useful features. Methods We first present a new needle driver that can actively insert and rotate a needle. With this device we investigate the use of needle rotation in controlled in-vitro experiments performed with a specially developed revolving needle driver. Results These experiments show that needle rotation can improve targeting and may reduce errors by as much as 70%. Conclusion The new needle driver provides a unique kinematic architecture that enables insertion with a compact mechanism. Perhaps the most interesting conclusion of the study is that lesions of soft tissue organs may not be perfectly targeted with a needle without using special techniques, either manually or with a robotic device. The results of this study show that needle rotation may be an effective method of reducing targeting errors. PMID:21360796
Inhibition of Malaria Infection in Transgenic Anopheline Mosquitoes Lacking Salivary Gland Cells
Kasashima, Katsumi; Sezutsu, Hideki; Matsuoka, Hiroyuki
2016-01-01
Malaria is an important global public health challenge, and is transmitted by anopheline mosquitoes during blood feeding. Mosquito vector control is one of the most effective methods to control malaria, and population replacement with genetically engineered mosquitoes to block its transmission is expected to become a new vector control strategy. The salivary glands are an effective target tissue for the expression of molecules that kill or inactivate malaria parasites. Moreover, salivary gland cells express a large number of molecules that facilitate blood feeding and parasite transmission to hosts. In the present study, we adapted a functional deficiency system in specific tissues by inducing cell death using the mouse Bcl-2-associated X protein (Bax) to the Asian malaria vector mosquito, Anopheles stephensi. We applied this technique to salivary gland cells, and produced a transgenic strain containing extremely low amounts of saliva. Although probing times for feeding on mice were longer in transgenic mosquitoes than in wild-type mosquitoes, transgenic mosquitoes still successfully ingested blood. Transgenic mosquitoes also exhibited a significant reduction in oocyst formation in the midgut in a rodent malaria model. These results indicate that mosquito saliva plays an important role in malaria infection in the midgut of anopheline mosquitoes. The dysfunction in the salivary glands enabled the inhibition of malaria transmission from hosts to mosquito midguts. Therefore, salivary components have potential in the development of new drugs or genetically engineered mosquitoes for malaria control. PMID:27598328
Hiraki, Takao; Kamegawa, Tetsushi; Matsuno, Takayuki; Sakurai, Jun; Kirita, Yasuzo; Matsuura, Ryutaro; Yamaguchi, Takuya; Sasaki, Takanori; Mitsuhashi, Toshiharu; Komaki, Toshiyuki; Masaoka, Yoshihisa; Matsui, Yusuke; Fujiwara, Hiroyasu; Iguchi, Toshihiro; Gobara, Hideo; Kanazawa, Susumu
2017-11-01
Purpose To evaluate the accuracy of the remote-controlled robotic computed tomography (CT)-guided needle insertion in phantom and animal experiments. Materials and Methods In a phantom experiment, 18 robotic and manual insertions each were performed with 19-gauge needles by using CT fluoroscopic guidance for the evaluation of the equivalence of accuracy of insertion between the two groups with a 1.0-mm margin. Needle insertion time, CT fluoroscopy time, and radiation exposure were compared by using the Student t test. The animal experiments were approved by the institutional animal care and use committee. In the animal experiment, five robotic insertions each were attempted toward targets in the liver, kidneys, lungs, and hip muscle of three swine by using 19-gauge or 17-gauge needles and by using conventional CT guidance. The feasibility, safety, and accuracy of robotic insertion were evaluated. Results The mean accuracies of robotic and manual insertion in phantoms were 1.6 and 1.4 mm, respectively. The 95% confidence interval of the mean difference was -0.3 to 0.6 mm. There were no significant differences in needle insertion time, CT fluoroscopy time, or radiation exposure to the phantom between the two methods. Effective dose to the physician during robotic insertion was always 0 μSv, while that during manual insertion was 5.7 μSv on average (P < .001). Robotic insertion was feasible in the animals, with an overall mean accuracy of 3.2 mm and three minor procedure-related complications. Conclusion Robotic insertion exhibited equivalent accuracy as manual insertion in phantoms, without radiation exposure to the physician. It was also found to be accurate in an in vivo procedure in animals. © RSNA, 2017 Online supplemental material is available for this article.
Li, Guoping; Feng, Hongqiang; Chen, Peiyu; Wu, Shaoying; Liu, Bing; Qiu, Feng
2010-08-01
Transgenic cotton has shown great promise for the control of target pest insects; however, frequent outbreaks of nontarget pest mirids has been recorded in recent years in northern China. To test the hypothesis that transgenic cotton contributes to nontarget pest outbreaks, we studied the impact of transgenic Bt cottons (both Bt and Bt + CpTI) on the fitness of nontarget pest Adelphocoris suturalis Jakovlev. No significant differences were detected between population densities of A. suturalis in unsprayed nontransgenic cottons and in unsprayed transgenic Bt cottons in 2007, 2008, and 2009. No difference in preferred oviposition site or egg production was detected between transgenic and nontransgenic cottons in both free choice and no choice tests. No difference in life table parameters was detected for A. suturalis between Bt cottons and nontransgenic cottons. All these results indicated that transgenic crops did not contribute to the nontarget pest outbreaks when being compared with their parental lines. The possible reasons for intensified pest status of A. suturalis, such as decrease of pesticide application, deficient natural enemies, and area-wide shift of cotton varieties, were discussed.
Fluorescent transgenic mice suitable for multi-color aggregation chimera studies.
Ohtsuka, Masato; Miura, Hiromi; Gurumurthy, Channabasavaiah B; Kimura, Minoru; Inoko, Hidetoshi; Yoshimura, Shinichi; Sato, Masahiro
2012-11-01
We recently reported a novel method of mouse transgenesis called Pronuclear Injection-based Targeted Transgenisis (PITT) using which a series of fluorescent transgenic (Tg) mice lines were generated. These lines, unlike those generated using conventional random integration methods, express the transgenes faithfully and reproducibly generation after generation. Because of this superior nature, these lines are ideal for the generation of multi-colored aggregation chimeras that can be used to study cell-cell interactions and lineage analyses in living embryos/organs, where the transgenes can be detected and the clonal origin of a given cell population easily traced by its distinct fluorescence. In this study, to verify if Tg fluorescent mice generated through PITT were suitable for such applications, we sought to generate chimeric blastocysts and chimeric-Tg mice by aggregating two- or three-colored 8-cell embryos. Our analyses using these models led to the following observations. First, we noticed that cell mixing was infrequent during the stages of morula to early blastocyst. Second, chimeric fetuses obtained after aggregation of the two-colored 8-cell embryos exhibited uniform cell mixing. And third, in the organs of adult chimeric mice, the mode of cell distribution could be either clonal or polyclonal, as previously pointed out by others. Implications of our novel and improved Tg-chimeric mice approach for clonal cell lineage and developmental studies are discussed.
Wu, Jirong; Yu, Mingzheng; Xu, Jianhong; Du, Juan; Ji, Fang; Dong, Fei; Li, Xinhai; Shi, Jianrong
2014-01-01
The transgenic wheat line N12-1 containing the WYMV-Nib8 gene was obtained previously through particle bombardment, and it can effectively control the wheat yellow mosaic virus (WYMV) disease transmitted by Polymyxa graminis at turngreen stage. Due to insertion of an exogenous gene, the transcriptome of wheat may be altered and affect root exudates. Thus, it is important to investigate the potential environmental risk of transgenic wheat before commercial release because of potential undesirable ecological side effects. Our 2-year study at two different experimental locations was performed to analyze the impact of transgenic wheat N12-1 on bacterial and fungal community diversity in rhizosphere soil using polymerase chain reaction-denaturing gel gradient electrophoresis (PCR-DGGE) at four growth stages (seeding stage, turngreen stage, grain-filling stage, and maturing stage). We also explored the activities of urease, sucrase and dehydrogenase in rhizosphere soil. The results showed that there was little difference in bacterial and fungal community diversity in rhizosphere soil between N12-1 and its recipient Y158 by comparing Shannon's, Simpson's diversity index and evenness (except at one or two growth stages). Regarding enzyme activity, only one significant difference was found during the maturing stage at Xinxiang in 2011 for dehydrogenase. Significant growth stage variation was observed during 2 years at two experimental locations for both soil microbial community diversity and enzyme activity. Analysis of bands from the gel for fungal community diversity showed that the majority of fungi were uncultured. The results of this study suggested that virus-resistant transgenic wheat had no adverse impact on microbial community diversity and enzyme activity in rhizosphere soil during 2 continuous years at two different experimental locations. This study provides a theoretical basis for environmental impact monitoring of transgenic wheat when the introduced gene is
IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON
When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...
Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla
2015-05-01
Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.
Immune selection of tumor cells in TCR β-chain transgenic mice.
Silaeva, Yulia Yu; Grinenko, Tatyana S; Vagida, Murad S; Kalinina, Anastasia A; Khromykh, Ludmila M; Kazansky, Dmitry B
2014-10-01
The concept of immunological surveillance implies that immunogenic variants of tumor cells arising in the organism can be recognized by the immune system. Tumor progression is provided by somatic evolution of tumor cells under the pressure of the immune system. The loss of MHC Class I molecules on the surface of tumor cells is one of the most known outcomes of immune selection. This study developed a model of immune selection based on the immune response of TCR 1d1 single β-chain transgenic B10.D2(R101) (K(d)I(d)D(b)) mice to allogeneic EL4 (H-2(b)) thymoma cells. In wild-type B10.D2(R101) mice, immunization with EL4 cells induced a vigorous CTL response targeted to the H-2K(b) molecule and results in full rejection of the tumor cells. In contrast, transgenic mice developed a compromised proliferative response in mixed-lymphocyte response assays and were unable to reject transplanted allogeneic EL4 cells. During the immune response to EL4 cells, CD8(+) T-lymphocytes with endogenous β-chains accumulated predominantly in the spleen of transgenic mice and only a small part of the T-lymphocytes expressing transgenic β-chains became CD8(+)CD44(+)CD62L(-) effectors. Then, instead of a full elimination of tumor cells as in wild-type mice, a reproducible prolonged equilibrium phase and subsequent escape was observed in transgenic mice that resulted in death of 90% of the mice in 40-60 days after grafting. Prolonged exposure of tumor cells to the pressure of the immune system in transgenic mice in vivo resulted in a stable loss of H-2K(b) molecules on the EL4 cell surface. Genetic manipulation of the T-lymphocyte repertoire was sufficient to reproduce the classic pattern of interactions between tumor cells and the immune system, usually observed in reliable syngeneic models of anti-tumor immunity. This newly-developed model could be used in further studies of immunoregulatory circuits common for transplantational and anti-tumor immune responses.
Strapasson, Priscila; Pinto-Zevallos, Delia M; Da Silva Gomes, Sandra M; Zarbin, Paulo H G
2016-08-01
Transgenic soybean plants (RR) engineered to express resistance to glyphosate harbor a variant of the enzyme EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) involved in the shikimic acid pathway, the biosynthetic route of three aromatic amino acids: phenylalanine, tyrosine, and tryptophan. The insertion of the variant enzyme CP4 EPSPS confers resistance to glyphosate. During the process of genetic engineering, unintended secondary effects are likely to occur. In the present study, we quantified volatile organic compounds (VOCs) emitted constitutively or induced in response to herbivory by the soybean looper Chrysodeixis includens in transgenic soybean and its isogenic (untransformed) line. Since herbivore-induced plant volatiles (HIPVs) are known to play a role in the recruitment of natural enemies, we assessed whether changes in VOC profiles alter the foraging behavior of the generalist endoparasitic larval parasitoid, Meteorus rubens in the transgenic line. Additionally, we assessed whether there was a difference in plant quality by measuring the weight gain of the soybean looper. In response to herbivory, several VOCs were induced in both the conventional and the transgenic line; however, larger quantities of a few compounds were emitted by transgenic plants. Meteorus rubens females were able to discriminate between the odors of undamaged and C. includens-damaged plants in both lines, but preferred the odors emitted by herbivore-damaged transgenic plants over those emitted by herbivore-damaged conventional soybean plants. No differences were observed in the weight gain of the soybean looper. Our results suggest that VOC-mediated tritrophic interactions in this model system are not negatively affected. However, as the preference of the wasps shifted towards damaged transgenic plants, the results also suggest that genetic modification affects that tritrophic interactions in multiple ways in this model system.
Mikus, Tomás; Poplstein, Martin; Sedláková, Jirina; Landa, Vladimír; Jeníkova, Gabriela; Trefil, Pavel; Lidický, Jan; Malý, Petr
2004-10-01
Production of recombinant human erythropoietin (rhEPO) for therapeutic purposes relies on its expression in selected clones of transfected mammalian cells. Alternatively, this glycoprotein can be produced by targeted secretion into the body fluid of transgenic mammals. Here, we report on the generation of a transgenic rabbits producing rhEPO in the lactating mammary gland. Transgenic individuals are viable, fertile and transmit the rhEPO gene to the offspring. Northern blot data indicated that the expression of the transgene in the mammary gland is controlled by whey acidic protien (WAP) regulatory sequences during the period of lactation. While the hybridization with total RNA revealed the expression only in the lactating mammary gland, the highly sensitive combinatory approach using RT-PCR/hybridization technique detected a minor ectopic expression. The level of rhEPO secretion in the founder female, measured in the period of lactation, varied in the range of 60-178 and 60-162 mIU/ml in the milk and blood plasma, respectively. Biological activity of the milk rhEPO was confirmed by a standard [3H]-thymidine incorporation test. Thus, we describe the model of a rhEPO-transgenic rabbit, valuable for studies of rhEPO glycosylation and function, which can be useful for the development of transgenic approaches designed for the preparation of recombinant proteins by alternative biopharmaceutical production.
Ulrich, Julia; Dao, Van Anh; Majumdar, Upalparna; Schmitt-Engel, Christian; Schwirz, Jonas; Schultheis, Dorothea; Ströhlein, Nadi; Troelenberg, Nicole; Grossmann, Daniela; Richter, Tobias; Dönitz, Jürgen; Gerischer, Lizzy; Leboulle, Gérard; Vilcinskas, Andreas; Stanke, Mario; Bucher, Gregor
2015-09-03
Insect pest control is challenged by insecticide resistance and negative impact on ecology and health. One promising pest specific alternative is the generation of transgenic plants, which express double stranded RNAs targeting essential genes of a pest species. Upon feeding, the dsRNA induces gene silencing in the pest resulting in its death. However, the identification of efficient RNAi target genes remains a major challenge as genomic tools and breeding capacity is limited in most pest insects impeding whole-animal-high-throughput-screening. We use the red flour beetle Tribolium castaneum as a screening platform in order to identify the most efficient RNAi target genes. From about 5,000 randomly screened genes of the iBeetle RNAi screen we identify 11 novel and highly efficient RNAi targets. Our data allowed us to determine GO term combinations that are predictive for efficient RNAi target genes with proteasomal genes being most predictive. Finally, we show that RNAi target genes do not appear to act synergistically and that protein sequence conservation does not correlate with the number of potential off target sites. Our results will aid the identification of RNAi target genes in many pest species by providing a manageable number of excellent candidate genes to be tested and the proteasome as prime target. Further, the identified GO term combinations will help to identify efficient target genes from organ specific transcriptomes. Our off target analysis is relevant for the sequence selection used in transgenic plants.
[Effect of transgenic insect-resistant rice on biodiversity].
Zhang, Lei; Zhu, Zhen
2011-05-01
Rice is the most important food crops in maintaining food security in China. The loss of China's annual rice production caused by pests is over ten million tons. Present studies showed that the transgenic insect-resistant rice can substantially reduce the application amount of chemical pesticides. In the case of no pesticide use, the pest density in transgenic rice field is significantly lower than that in non-transgenic field, and the neutral insects and natural enemies of pests increased significantly, indicating that the ecological environment and biodiversity toward the positive direction. The gene flow frequency from transgenic rice is dramatically reduced with the distance increases, reaching less than 0.01% at the distance of 6.2 m. Application of transgenic insect-resistant rice in China has an important significance for ensuring food security, maintaining sustainable agricultural development, and protecting the ecological environment and biodiversity. This review summarized the research progress in transgenic insect-resistant rice and its effect on biodiversity. The research directions and development trends of crop pest controlling in future are discussed. These help to promote better use of transgenic insect-resistant rice.
Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie
2016-05-11
Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.
Zhang, H X; Hodson, J N; Williams, J P; Blumwald, E
2001-10-23
Transgenic Brassica napus plants overexpressing AtNHX1, a vacuolar Na(+)/H(+) antiport from Arabidopsis thaliana, were able to grow, flower, and produce seeds in the presence of 200 mM sodium chloride. Although the transgenic plants grown in high salinity accumulated sodium up to 6% of their dry weight, growth of the these plants was only marginally affected by the high salt concentration. Moreover, seed yields and the seed oil quality were not affected by the high salinity of the soil. Our results demonstrate the potential use of these transgenic plants for agricultural use in saline soils. Our findings, showing that the modification of a single trait significantly improved the salinity tolerance of this crop plant, suggest that with a combination of breeding and transgenic plants it could be possible to produce salt-tolerant crops with far fewer target traits than had been anticipated.
Transgenic miR156 switchgrass in the field: growth, recalcitrance and rust susceptibility
Baxter, Holly L.; Mazarei, Mitra; Dumitrache, Alexandru; ...
2017-04-24
Sustainable utilization of lignocellulosic perennial grass feedstocks will be enabled by high biomass production and optimized cell wall chemistry for efficient conversion into biofuels. MicroRNAs are regulatory elements that modulate the expression of genes involved in various biological functions in plants, including growth and development. In greenhouse studies, overexpressing a microRNA (miR156) gene in switchgrass had dramatic effects on plant architecture and flowering, which appeared to be driven by transgene expression levels. High expressing lines were extremely dwarfed, whereas low and moderate-expressing lines had higher biomass yields, improved sugar release and delayed flowering. Four lines with moderate or low miR156more » overexpression from the prior greenhouse study were selected for a field experiment to assess the relationship between miR156 expression and biomass production over three years. We also analysed important bioenergy feedstock traits such as flowering, disease resistance, cell wall chemistry and biofuel production. Phenotypes of the transgenic lines were inconsistent between the greenhouse and the field as well as among different field growing seasons. One low expressing transgenic line consistently produced more biomass (25%–56%) than the control across all three seasons, which translated to the production of 30% more biofuel per plant during the final season. The other three transgenic lines produced less biomass than the control by the final season, and the two lines with moderate expression levels also exhibited altered disease susceptibilities. Results of this study emphasize the importance of performing multiyear field studies for plants with altered regulatory transgenes that target plant growth and development.« less
2010-01-01
Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC) 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species. PMID:20184756
Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.
2013-01-01
In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS), a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS) transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production. PMID:24278301
Transgenic miR156 switchgrass in the field: growth, recalcitrance and rust susceptibility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baxter, Holly L.; Mazarei, Mitra; Dumitrache, Alexandru
Sustainable utilization of lignocellulosic perennial grass feedstocks will be enabled by high biomass production and optimized cell wall chemistry for efficient conversion into biofuels. MicroRNAs are regulatory elements that modulate the expression of genes involved in various biological functions in plants, including growth and development. In greenhouse studies, overexpressing a microRNA (miR156) gene in switchgrass had dramatic effects on plant architecture and flowering, which appeared to be driven by transgene expression levels. High expressing lines were extremely dwarfed, whereas low and moderate-expressing lines had higher biomass yields, improved sugar release and delayed flowering. Four lines with moderate or low miR156more » overexpression from the prior greenhouse study were selected for a field experiment to assess the relationship between miR156 expression and biomass production over three years. We also analysed important bioenergy feedstock traits such as flowering, disease resistance, cell wall chemistry and biofuel production. Phenotypes of the transgenic lines were inconsistent between the greenhouse and the field as well as among different field growing seasons. One low expressing transgenic line consistently produced more biomass (25%–56%) than the control across all three seasons, which translated to the production of 30% more biofuel per plant during the final season. The other three transgenic lines produced less biomass than the control by the final season, and the two lines with moderate expression levels also exhibited altered disease susceptibilities. Results of this study emphasize the importance of performing multiyear field studies for plants with altered regulatory transgenes that target plant growth and development.« less
Dutta, Debashis; Niwas, Ram; Gopal, Madhuban
2012-11-01
Thiacloprid is a systemic neonicotinoid. The study hypothesized that difference may be seen in the rate of dissipation of thiacloprid when applied on non-transgenic and transgenic cabbage. Thiacloprid was estimated by HPLC. Half life of thiacloprid in transgenic as well as in normal cabbage ranged between 12.3-13.1 days in two doses of application. Under field condition, after 15 days, 59.2% and 54.3% dissipation was recorded at lower and higher rates of application in transgenic cabbage, where as the insecticide dissipated 57.5% and 59.1% for single dose and double dose application, respectively in non-transgenic cabbage. The study establishes that there is no significant difference in dissipation of a systemic pesticide in transgenic versus non-transgenic cabbage. Decontamination of thiacloprid contaminated cabbage was carried out by different chemical treatments. The application of 0.5% NaHCO(3) (an edible alkali) may be recommended for decontamination. Thiacloprid residues in the day-3 field samples of cabbage could be reduced below Japanese MRL (1.0 mg kg(-1)) by treating with 0.5% NaHCO(3) solution for 1 h.
Cheng, Qiuqiong; Inaba, Yuka; Lu, Peipei; Xu, Meishu; He, Jinhan; Zhao, Yueshui; Guo, Grace L.; Kuruba, Ramalinga; de la Vega, Rona; Evans, Rhobert W.; Li, Song
2015-01-01
The nuclear receptor farnesoid X receptor (FXR) (nuclear receptor subfamily 1, group H, member 4, or NR1H4) is highly expressed in the liver and intestine. Previous reports have suggested beneficial functions of FXR in the homeostasis of bile acids, lipids, and glucose, as well as in promoting liver regeneration and inhibiting carcinogenesis. To investigate the effect of chronic FXR activation in vivo, we generated transgenic mice that conditionally and tissue specifically express the activated form of FXR in the liver and intestine. Unexpectedly, the transgenic mice showed several intriguing phenotypes, including partial neonatal lethality, growth retardation, and spontaneous liver toxicity. The transgenic mice also displayed heightened sensitivity to a high-cholesterol diet-induced hepatotoxicity but resistance to the gallstone formation. The phenotypes were transgene specific, because they were abolished upon treatment with doxycycline to silence the transgene expression. The perinatal toxicity, which can be rescued by a maternal vitamin supplement, may have resulted from vitamin deficiency due to low biliary bile acid output as a consequence of inhibition of bile acid formation. Our results also suggested that the fibroblast growth factor-inducible immediate-early response protein 14 (Fn14), a member of the proinflammatory TNF family, is a FXR-responsive gene. However, the contribution of Fn14 induction in the perinatal toxic phenotype of the transgenic mice remains to be defined. Because FXR is being explored as a therapeutic target, our results suggested that a chronic activation of this nuclear receptor may have an unintended side effect especially during the perinatal stage. PMID:25719402
Chaban, Inna; Khaliluev, Marat; Baranova, Ekaterina; Kononenko, Neonila; Dolgov, Sergey; Smirnova, Elena
2018-04-21
Parthenocarpy and fruit malformations are common among independent transgenic tomato lines, expressing genes encoding different pathogenesis-related (PR) protein and antimicrobal peptides. Abnormal phenotype developed independently of the expression and type of target genes, but distinctive features during flower and fruit development were detected in each transgenic line. We analyzed the morphology, anatomy, and cytoembryology of abnormal flowers and fruits from these transgenic tomato lines and compared them with flowers and fruits of wild tomatoes, line YaLF used for transformation, and transgenic plants with normal phenotype. We confirmed that the main cause of abnormal flower and fruit development was the alterations of determinate growth of generative meristem. These alterations triggered different types of anomalous growth, affecting the number of growing ectopic shoots and formation of new flowers. Investigation of the ovule ontogenesis did not show anomalies in embryo sac development, but fertilization did not occur and embryo sac degenerated. Nevertheless, the ovule continued to differentiate due to proliferation of endothelium cells. The latter substituted embryo sac and formed pseudoembryonic tissue. This process imitated embryogenesis and stimulated ovary growth, leading to the development of parthenocarpic fruit. We demonstrated that failed fertilization occurred due to defective male gametophyte formation, which was manifested in blocked division of the nucleus in the microspore and arrest of vegetative and generative cell formation. Maturing pollen grains were overgrown microspores, not competent for fertilization but capable to induce proliferation of endothelium and development of parthenocarpic ovary. Thus, our study provided new data on the structural transformations of reproductive organs during development of parthenocarpic fruits in transgenic tomato.
Hosseini, Seyed H; Kohler, James J; Haase, Chad P; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William
2007-03-01
Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-gamma. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity.
[Review of transgenic crop breeding in China].
Huang, Dafang
2015-06-01
The development history and fundamental experience of transgenic crops (Genetically modified crops) breeding in China for near 30 years were reviewed. It was illustrated that a scientific research, development and industrialization system of transgenic crops including gene discovery, transformation, variety breeding, commercialization, application and biosafety assessment has been initially established which was few in number in the world. The research innovative capacity of transgenic cotton, rice and corn has been lifted. The research features as well as relative advantages have been initially formed. The problems and challenges of transgenic crop development were discussed. In addition, three suggestions of promoting commercialization, speeding up implementation of the Major National Project of GM Crops, and enhancing science communication were made.
Airway-Specific Inducible Transgene Expression Using Aerosolized Doxycycline
Tata, Purushothama Rao; Pardo-Saganta, Ana; Prabhu, Mythili; Vinarsky, Vladimir; Law, Brandon M.; Fontaine, Benjamin A.; Tager, Andrew M.
2013-01-01
Tissue-specific transgene expression using tetracycline (tet)-regulated promoter/operator elements has been used to revolutionize our understanding of cellular and molecular processes. However, because most tet-regulated mouse strains use promoters of genes expressed in multiple tissues, to achieve exclusive expression in an organ of interest is often impossible. Indeed, in the extreme case, unwanted transgene expression in other organ systems causes lethality and precludes the study of the transgene in the actual organ of interest. Here, we describe a novel approach to activating tet-inducible transgene expression solely in the airway by administering aerosolized doxycycline. By optimizing the dose and duration of aerosolized doxycycline exposure in mice possessing a ubiquitously expressed Rosa26 promoter–driven reverse tet-controlled transcriptional activator (rtTA) element, we induce transgene expression exclusively in the airways. We detect no changes in the cellular composition or proliferative behavior of airway cells. We used this newly developed method to achieve airway basal stem cell–specific transgene expression using a cytokeratin 5 (also known as keratin 5)–driven rtTA driver line to induce Notch pathway activation. We observed a more robust mucous metaplasia phenotype than in mice receiving doxycycline systemically. In addition, unwanted phenotypes outside of the lung that were evident when doxycycline was received systemically were now absent. Thus, our approach allows for rapid and efficient airway-specific transgene expression. After the careful strain by strain titration of the dose and timing of doxycycline inhalation, a suite of preexisting transgenic mice can now be used to study airway biology specifically in cases where transient transgene expression is sufficient to induce a phenotype. PMID:23848320
Schmidt, Kerstin; Schmidtke, Jörg; Mast, Yvonne; Waldvogel, Eva; Wohlleben, Wolfgang; Klemke, Friederike; Lockau, Wolfgang; Hausmann, Tina; Hühns, Maja; Broer, Inge
2017-08-01
Potatoes are a promising system for industrial production of the biopolymer cyanophycin as a second compound in addition to starch. To assess the efficiency in the field, we analysed the stability of the system, specifically its sensitivity to environmental factors. Field and greenhouse trials with transgenic potatoes (two independent events) were carried out for three years. The influence of environmental factors was measured and target compounds in the transgenic plants (cyanophycin, amino acids) were analysed for differences to control plants. Furthermore, non-target parameters (starch content, number, weight and size of tubers) were analysed for equivalence with control plants. The huge amount of data received was handled using modern statistical approaches to model the correlation between influencing environmental factors (year of cultivation, nitrogen fertilization, origin of plants, greenhouse or field cultivation) and key components (starch, amino acids, cyanophycin) and agronomic characteristics. General linear models were used for modelling, and standard effect sizes were applied to compare conventional and genetically modified plants. Altogether, the field trials prove that significant cyanophycin production is possible without reduction of starch content. Non-target compound composition seems to be equivalent under varying environmental conditions. Additionally, a quick test to measure cyanophycin content gives similar results compared to the extensive enzymatic test. This work facilitates the commercial cultivation of cyanophycin potatoes.
CRISPR-mediated TCR replacement generates superior anticancer transgenic T cells.
Legut, Mateusz; Dolton, Garry; Mian, Afsar Ali; Ottmann, Oliver G; Sewell, Andrew K
2018-01-18
Adoptive transfer of T cells genetically modified to express a cancer-specific T-cell receptor (TCR) has shown significant therapeutic potential for both hematological and solid tumors. However, a major issue of transducing T cells with a transgenic TCR is the preexisting expression of TCRs in the recipient cells. These endogenous TCRs compete with the transgenic TCR for surface expression and allow mixed dimer formation. Mixed dimers, formed by mispairing between the endogenous and transgenic TCRs, may harbor autoreactive specificities. To circumvent these problems, we designed a system where the endogenous TCR-β is knocked out from the recipient cells using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein-9 (Cas9) technology, simultaneously with transduction with a cancer-reactive receptor of choice. This TCR replacement strategy resulted in markedly increased surface expression of transgenic αβ and γδ TCRs, which in turn translated to a stronger, and more polyfunctional, response of engineered T cells to their target cancer cell lines. Additionally, the TCR-plus-CRISPR-modified T cells were up to a thousandfold more sensitive to antigen than standard TCR-transduced T cells or conventional model proxy systems used for studying TCR activity. Finally, transduction with a pan-cancer-reactive γδ TCR used in conjunction with CRISPR/Cas9 knockout of the endogenous αβ TCR resulted in more efficient redirection of CD4 + and CD8 + T cells against a panel of established blood cancers and primary, patient-derived B-cell acute lymphoblastic leukemia blasts compared with standard TCR transfer. Our results suggest that TCR transfer combined with genome editing could lead to new, improved generations of cancer immunotherapies. © 2018 by The American Society of Hematology.
USDA-ARS?s Scientific Manuscript database
Field experiments were conducted to evaluate the populations of minute pirate bug [Orius insidiosus (Say)] using visual, sticky cards, and destructive sampling techniques in transgenic and non-transgenic maize in three locations in Nebraska (Mead, Clay Center, and Concord), United States of America,...
Han, Lanzhi; Liu, Peilei; Wu, Kongming; Peng, Yufa; Wang, Feng
2008-10-01
Genetically modified insect-resistant rice lines containing the cry1Ac gene from Bacillus thuringiensis (Bt) or the CpTI (cowpea trypsin inhibitor) gene developed for the management of lepidopterous pests are highly resistant to the major target pests, Chilo suppressalis (Walker), Cnaphalocrocis medinalis (Guenée), and Scirpophaga incertulas (Walker), in the main rice-growing areas of China. However, the effects of these transgenic lines on Sesamia inferens (Walker), an important lepidopterous rice pest, are currently unknown. Because different insect species have varying susceptibility to Bt insecticidal proteins that may affect population dynamics, research into the effects of these transgenic rice lines on the population dynamics of S. inferens was conducted in Fuzhou, southern China, in 2005 and 2006. The results of laboratory, field cage, and field plot experiments show that S. inferens has comparatively high susceptibility to the transgenic line during the early growing season, with significant differences observed in larval density and infestation levels between transgenic and control lines. Because of a decrease in Cry1Ac levels in the plant as it ages, the transgenic line provided only a low potential for population suppression late in the growing season. There is a correlation between the changing expression of Cry1Ac and the impact of transgenic rice on the population dynamics of S. inferens during the season. These results indicate that S. inferens may become a major pest in fields of prospective commercially released transgenic rice, and more attention should be paid to developing an effective alternative management strategy.
Establishment and characterization of CAG/EGFP transgenic rabbit line.
Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu
2007-02-01
Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.
Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit.
Zhang, H X; Blumwald, E
2001-08-01
Transgenic tomato plants overexpressing a vacuolar Na+/H+ antiport were able to grow, flower, and produce fruit in the presence of 200 mM sodium chloride. Although the leaves accumulated high sodium concentrations, the tomato fruit displayed very low sodium content. Contrary to the notion that multiple traits introduced by breeding into crop plants are needed to obtain salt-tolerant plants, the modification of a single trait significantly improved the salinity tolerance of this crop plant. These results demonstrate that with a combination of breeding and transgenic plants it could be possible to produce salt-tolerant crops with far fewer target traits than had been anticipated. The accumulation of sodium in the leaves and not in the fruit demonstrates the utility of such a modification in preserving the quality of the fruit.
Artificial parthenogenesis and control of voltinism to manage transgenic populations in Bombyx mori.
Grenier, Anne-Marie; Da Rocha, Martine; Jalabert, Audrey; Royer, Corinne; Mauchamp, Bernard; Chavancy, Gérard
2004-08-01
In order to improve the management of transformed populations in a routine application of transgenesis technology in Bombyx mori, we modified its mode of reproduction and its voltinism. On one hand, after a stable integration of the gene of interest by transgenesis, it is preferable to maintain this gene in an identical genomic context through successive generations. This can be obtained by artificial parthenogenetic reproduction (ameiotic parthenogenesis) giving isogenic females identical to their transformed mother. On the other hand, it is essential to obtain continuous generations (polyvoltinism) after microinjection, in order to screen positive transgenic insects and study genetics and insertion of the transgene. Thereafter, it is more convenient to store these populations, as diapause eggs before their use in biotechnology application. We obtained such polyvoltine parthenoclones, first by selection for a parthenogenetic character in polyvoltine races, and second, by selection for a polyvoltine character in a parthenogenetic, but diapausing clone of B. mori. As diapause was directly under the control of diapause hormone (DH), we also tested direct injection of DH in female pupae of polyvoltine strains, as well as anti-DH antibody treatment to eliminate diapause in univoltine strains. We discussed the advantages and limitations of these methods and proved the feasibility in obtaining polyvoltine parthenoclones and determining the voltinism in B. mori. These methods would permit us to improve the management of populations used in transgenesis technology.
Multiple effects of genetic background on variegated transgene expression in mice.
Opsahl, Margaret L; McClenaghan, Margaret; Springbett, Anthea; Reid, Sarah; Lathe, Richard; Colman, Alan; Whitelaw, C Bruce A
2002-01-01
BLG/7 transgenic mice express an ovine beta-lactoglobulin transgene during lactation. Unusually, transgene expression levels in milk differ between siblings. This variable expression is due to variegated transgene expression in the mammary gland and is reminiscent of position-effect variegation. The BLG/7 line was created and maintained on a mixed CBA x C57BL/6 background. We have investigated the effect on transgene expression of backcrossing for 13 generations into these backgrounds. Variable transgene expression was observed in all populations examined, confirming that it is an inherent property of the transgene array at its site of integration. There were also strain-specific effects on transgene expression that appear to be independent of the inherent variegation. The transgene, compared to endogenous milk protein genes, is specifically susceptible to inbreeding depression. Outcrossing restored transgene expression levels to that of the parental population; thus suppression was not inherited. Finally, no generation-dependent decrease in mean expression levels was observed in the parental population. Thus, although the BLG/7 transgene is expressed in a variegated manner, there was no generation-associated accumulated silencing of transgene expression. PMID:11901126
Multiple effects of genetic background on variegated transgene expression in mice.
Opsahl, Margaret L; McClenaghan, Margaret; Springbett, Anthea; Reid, Sarah; Lathe, Richard; Colman, Alan; Whitelaw, C Bruce A
2002-03-01
BLG/7 transgenic mice express an ovine beta-lactoglobulin transgene during lactation. Unusually, transgene expression levels in milk differ between siblings. This variable expression is due to variegated transgene expression in the mammary gland and is reminiscent of position-effect variegation. The BLG/7 line was created and maintained on a mixed CBA x C57BL/6 background. We have investigated the effect on transgene expression of backcrossing for 13 generations into these backgrounds. Variable transgene expression was observed in all populations examined, confirming that it is an inherent property of the transgene array at its site of integration. There were also strain-specific effects on transgene expression that appear to be independent of the inherent variegation. The transgene, compared to endogenous milk protein genes, is specifically susceptible to inbreeding depression. Outcrossing restored transgene expression levels to that of the parental population; thus suppression was not inherited. Finally, no generation-dependent decrease in mean expression levels was observed in the parental population. Thus, although the BLG/7 transgene is expressed in a variegated manner, there was no generation-associated accumulated silencing of transgene expression.
Production of transgenic pigs over-expressing the antiviral gene Mx1.
Yan, Quanmei; Yang, Huaqiang; Yang, Dongshan; Zhao, Bentian; Ouyang, Zhen; Liu, Zhaoming; Fan, Nana; Ouyang, Hongsheng; Gu, Weiwang; Lai, Liangxue
2014-01-01
The myxovirus resistance gene (Mx1) has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT) to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15-25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV). Indirect immunofluorescence assay (IFA) revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.
Tool Removes Coil-Spring Thread Inserts
NASA Technical Reports Server (NTRS)
Collins, Gerald J., Jr.; Swenson, Gary J.; Mcclellan, J. Scott
1991-01-01
Tool removes coil-spring thread inserts from threaded holes. Threads into hole, pries insert loose, grips insert, then pulls insert to thread it out of hole. Effects essentially reverse of insertion process to ease removal and avoid further damage to threaded inner surface of hole.
Structural requirements of oleosin domains for subcellular targeting to the oil body.
van Rooijen, G J; Moloney, M M
1995-01-01
We have investigated the protein domains responsible for the correct subcellular targeting of plant seed oleosins. We have attempted to study this targeting in vivo using "tagged" oleosins in transgenic plants. Different constructs were prepared lacking gene sequences encoding one of three structural domains of natural oleosins. Each was fused in frame to the Escherichia coli uid A gene encoding beta-glucuronidase (GUS). These constructs were introduced into Brassica napus using Agrobacterium-mediated transformation. GUS activity was measured in washed oil bodies and in the soluble protein fraction of the transgenic seeds. It was found that complete Arabidopsis oleosin-GUS fusions undergo correct subcellular targeting in transgenic Brassica seeds. Removal of the C-terminal domain of the Arabidopsis oleosin comprising the last 48 amino acids had no effect on overall subcellular targeting. In contrast, loss of the first 47 amino acids (N terminus) or amino acids 48 to 113 (which make up a lipophilic core) resulted in impaired targeting of the fusion protein to the oil bodies and greatly reduced accumulation of the fusion protein. Northern blotting revealed that this reduction is not due to differences in mRNA accumulation. Results from these measurements indicated that both the N-terminal and central oleosin domain are important for targeting to the oil body and show that there is a direct correlation between the inability to target to the oil body and protein stability. PMID:8539295
Next-generation transgenic cotton: pyramiding RNAi and Bt counters insect resistance.
Ni, Mi; Ma, Wei; Wang, Xiaofang; Gao, Meijing; Dai, Yan; Wei, Xiaoli; Zhang, Lei; Peng, Yonggang; Chen, Shuyuan; Ding, Lingyun; Tian, Yue; Li, Jie; Wang, Haiping; Wang, Xiaolin; Xu, Guowang; Guo, Wangzhen; Yang, Yihua; Wu, Yidong; Heuberger, Shannon; Tabashnik, Bruce E; Zhang, Tianzhen; Zhu, Zhen
2017-09-01
Transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) are extensively cultivated worldwide. To counter rapidly increasing pest resistance to crops that produce single Bt toxins, transgenic plant 'pyramids' producing two or more Bt toxins that kill the same pest have been widely adopted. However, cross-resistance and antagonism between Bt toxins limit the sustainability of this approach. Here we describe development and testing of the first pyramids of cotton combining protection from a Bt toxin and RNA interference (RNAi). We developed two types of transgenic cotton plants producing double-stranded RNA (dsRNA) from the global lepidopteran pest Helicoverpa armigera designed to interfere with its metabolism of juvenile hormone (JH). We focused on suppression of JH acid methyltransferase (JHAMT), which is crucial for JH synthesis, and JH-binding protein (JHBP), which transports JH to organs. In 2015 and 2016, we tested larvae from a Bt-resistant strain and a related susceptible strain of H. armigera on seven types of cotton: two controls, Bt cotton, two types of RNAi cotton (targeting JHAMT or JHBP) and two pyramids (Bt cotton plus each type of RNAi). Both types of RNAi cotton were effective against Bt-resistant insects. Bt cotton and RNAi acted independently against the susceptible strain. In computer simulations of conditions in northern China, where millions of farmers grow Bt cotton as well as abundant non-transgenic host plants of H. armigera, pyramided cotton combining a Bt toxin and RNAi substantially delayed resistance relative to using Bt cotton alone. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Conrad, Claudius; Hüsemann, Yves; Niess, Hanno; von Luettichau, Irene; Huss, Ralf; Bauer, Christian; Jauch, Karl-Walter; Klein, Christoph A; Bruns, Christiane; Nelson, Peter J
2011-03-01
To specifically target tumor angiogenesis by linking transgene expression of engineered mesenchymal stem cells to angiopoietin-1-induced differentiation. Mesenchymal stem cells (MSCs) have been used to deliver therapeutic genes into solid tumors. These strategies rely on their homing mechanisms only to deliver the therapeutic agent. We engineered murine MSC to express reporter genes or therapeutic genes under the selective control of the Tie2 promoter/enhancer. This approach uses the differentiative potential of MSCs induced by the tumor microenvironment to drive therapeutic gene expression only in the context of angiogenesis. When injected into the peripheral circulation of mice with either, orthotopic pancreatic or spontaneous breast cancer, the engineered MSCs were actively recruited to growing tumor vasculature and induced the selective expression of either reporter red florescent protein or suicide genes [herpes simplex virus-thymidine kinase (TK) gene] when the adoptively transferred MSC developed endothelial-like characteristics. The TK gene product in combination with the prodrug ganciclovir (GCV) produces a potent toxin, which affects replicative cells. The homing of engineered MSC with selective induction of TK in concert with GCV resulted in a toxic tumor-specific environment. The efficacy of this approach was demonstrated by significant reduction in primary tumor growth and prolongation of life in both tumor models. This "Trojan Horse" combined stem cell/gene therapy represents a novel treatment strategy for tailored therapy of solid tumors.
The fate of fusion Cry1Ab/1Ac proteins from Bt-transgenic rice in soil and water.
Liu, Yongbo; Li, Junsheng; Luo, Zunlan; Wang, Huaru; Liu, Fang
2016-02-01
Toxin proteins form transgenic crops entering into the environment are likely affect non-target organisms. To investigate the entry route and fate of fusion Cry1Ab/1Ac proteins from transgenic rice expressing insecticide toxins from Bacillus thuringiensis (Bt) in soil and water, we conducted greenhouse and field experiments in 2013 and 2014. Cry1Ab/1Ac proteins from Bt-transgenic rice in soil was found within a horizontal range of 25cm, where most of plant roots distributed. Concentration of Cry1Ab/1Ac proteins was lower in water than in soil in the greenhouse experiment, and no Cry1Ab/1Ac protein was detected in field water. Cry1Ab/1Ac concentration from rice straws was higher in ditch water than in distilled water due to the existence of aquatic organisms in ditch water. Bt proteins from transgenic crops enter into soil ecosystems mainly through root exudates and into aquatic ecosystems through plant residues, which determines Bt fate in the environment. Copyright © 2015 Elsevier Inc. All rights reserved.
Pan, Li; Zhang, Yongguang; Wang, Yonglu; Wang, Baoqin; Wang, Wenxiu; Fang, Yuzhen; Jiang, Shoutian; Lv, Jianliang; Wang, Wei; Sun, Yuan; Xie, Qingge
2008-01-15
The expression of recombinant antigens in transgenic plants is increasingly used as an alternative method of producing experimental immunogens. In this report, we describe the production of transgenic tomato plants that express the structural polyprotein, P1-2A, and protease, 3C, from foot-and-mouth disease (FMDV). P1-2A3C was inserted into the plant binary vector, pBin438, and transformed into tomato plants using Agrobacterium tumefaciens strain, GV3101. The presence of P1-2A3C was confirmed by PCR, transcription was verified by RT-PCR, and recombinant protein expression was confirmed by sandwich-ELISA and Western blot analyses. Guinea pigs immunized intramuscularly with foliar extracts from P1-2A3C-transgenic tomato plants were found to develop a virus-specific antibody response against FMDV. Vaccinated guinea pigs were fully protected against a challenge infection, while guinea pigs injected with untransformed plant extracts failed to elicit an antibody response and were not protected against challenge. These results demonstrate that transgenic tomato plants expressing the FMDV structural polyprotein, P1-2A, and the protease, 3C, can be used as a source of recombinant antigen for vaccine production.
Suttiprapa, Sutas; Rinaldi, Gabriel; Brindley, Paul J.
2011-01-01
Vesicular stomatitis virus glycoprotein (VSVG) pseudotyped murine leukemia virus (MLV) virions can transduce schistosomes, leading to chromosomal integration of reporter transgenes. To develop VSVG-MLV for functional genomics in schistosomes, the influence of the chicken β-globin cHS4 element, a prototypic chromatin insulator, on transgene expression was examined. Plasmid pLNHX encoding the MLV 5′- and 3′-Long Terminal Repeats (LTRs) flanking the neomycin phosphotransferase gene (neo) was modified to include, within the U3 region of the 3′-LTR, active components of cHS4 insulator, the 250 bp core fused to the 400 bp 3′-region. Cultured larvae of Schistosoma mansoni were transduced with virions from producer cells transfected with control or cHS4-bearing plasmids. Schistosomules transduced with cHS4 virions expressed two to 20 times higher levels of neo than controls, while carrying comparable numbers of integrated proviral transgenes. The findings not only demonstrated that cHS4 was active in schistosomes but also they represent the first report of activity of cHS4 in any Lophotrochozoan species, which has significant implications for evolutionary conservation of heterochromatin regulation. The findings advance prospects for transgenesis in functional genomics of the schistosome genome to discover intervention targets because they provide the means to enhance and extend transgene activity including for vector based RNA interference. PMID:21918820
ChR2 transgenic animals in peripheral sensory system: Sensing light as various sensations.
Ji, Zhi-Gang; Wang, Hongxia
2016-04-01
Since the introduction of Channelrhodopsin-2 (ChR2) to neuroscience, optogenetics technology was developed, making it possible to activate specific neurons or circuits with spatial and temporal precision. Various ChR2 transgenic animal models have been generated and are playing important roles in revealing the mechanisms of neural activities, mapping neural circuits, controlling the behaviors of animals as well as exploring new strategy for treating the neurological diseases in both central and peripheral nervous system. An animal including humans senses environments through Aristotle's five senses (sight, hearing, smell, taste and touch). Usually, each sense is associated with a kind of sensory organ (eyes, ears, nose, tongue and skin). Is it possible that one could hear light, smell light, taste light and touch light? When ChR2 is targeted to different peripheral sensory neurons by viral vectors or generating ChR2 transgenic animals, the animals can sense the light as various sensations such as hearing, touch, pain, smell and taste. In this review, we focus on ChR2 transgenic animals in the peripheral nervous system. Firstly the working principle of ChR2 as an optogenetic actuator is simply described. Then the current transgenic animal lines where ChR2 was expressed in peripheral sensory neurons are presented and the findings obtained by these animal models are reviewed. Copyright © 2016 Elsevier Inc. All rights reserved.
Transgenic bovine as bioreactors: Challenges and perspectives
Monzani, Paulo S.; Adona, Paulo R.; Ohashi, Otávio M.; Meirelles, Flávio V.; Wheeler, Matthew B.
2016-01-01
ABSTRACT The use of recombinant proteins has increased in diverse commercial sectors. Various systems for protein production have been used for the optimization of production and functional protein expression. The mammary gland is considered to be a very interesting system for the production of recombinant proteins due to its high level of expression and its ability to perform post-translational modifications. Cows produce large quantities of milk over a long period of lactation, and therefore this species is an important candidate for recombinant protein expression in milk. However, transgenic cows are more difficult to generate due to the inefficiency of transgenic methodologies, the long periods for transgene detection, recombinant protein expression and the fact that only a single calf is obtained at the end of each pregnancy. An increase in efficiency for transgenic methodologies for cattle is a big challenge to overcome. Promising methodologies have been proposed that can help to overcome this obstacle, enabling the use of transgenic cattle as bioreactors for protein production in milk for industry. PMID:27166649
How To Produce and Characterize Transgenic Plants.
ERIC Educational Resources Information Center
Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark
2002-01-01
Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)
Computerized planning of prostate cryosurgery using variable cryoprobe insertion depth.
Rossi, Michael R; Tanaka, Daigo; Shimada, Kenji; Rabin, Yoed
2010-02-01
The current study presents a computerized planning scheme for prostate cryosurgery using a variable insertion depth strategy. This study is a part of an ongoing effort to develop computerized tools for cryosurgery. Based on typical clinical practices, previous automated planning schemes have required that all cryoprobes be aligned at a single insertion depth. The current study investigates the benefit of removing this constraint, in comparison with results based on uniform insertion depth planning as well as the so-called "pullback procedure". Planning is based on the so-called "bubble-packing method", and its quality is evaluated with bioheat transfer simulations. This study is based on five 3D prostate models, reconstructed from ultrasound imaging, and cryoprobe active length in the range of 15-35 mm. The variable insertion depth technique is found to consistently provide superior results when compared to the other placement methods. Furthermore, it is shown that both the optimal active length and the optimal number of cryoprobes vary among prostate models, based on the size and shape of the target region. Due to its low computational cost, the new scheme can be used to determine the optimal cryoprobe layout for a given prostate model in real time. Copyright 2008 Elsevier Inc. All rights reserved.
M13 procoat protein insertion into YidC and SecYEG proteoliposomes and liposomes.
Stiegler, Natalie; Dalbey, Ross E; Kuhn, Andreas
2011-02-25
M13 procoat protein was one of the first model proteins used to study bacterial membrane protein insertion. It contains a signal peptide of 23 amino acid residues and is not membrane targeted by the signal recognition particle. The translocation of its periplasmic domain is independent of the preprotein translocase (SecAYEG) but requires electrochemical membrane potential and the membrane insertase YidC of Escherichia coli. We show here that YidC is sufficient for efficient membrane insertion of the purified M13 procoat protein into energized YidC proteoliposomes. When no membrane potential is applied, the insertion is substantially reduced. Only in the presence of YidC, membrane insertion occurs if bilayer integrity is preserved and membrane potential is stable for more than 20 min. A mutant of the M13 procoat protein, H5EE, with two additional negatively charged residues in the periplasmic domain inserted into YidC proteoliposomes and SecYEG proteoliposomes with equal efficiencies. We conclude that the protein can use both the YidC-only pathway and the Sec pathway. This poses the questions of how procoat H5EE is inserted in vivo and how insertion pathways are selected in the cell. Copyright © 2011 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Wang, Feng; Wang, Riyuan; Wang, Yuancheng; Zhao, Ping; Xia, Qingyou
2015-11-01
With an increasing clinical demand for functional therapeutic proteins every year, there is an increasing requirement for the massive production of bioactive recombinant human acidic fibroblast growth factor (r-haFGF). In this present study, we delicately explore a strategy for the mass production of r-haFGF protein with biological activity in the transgenic silkworm cocoons. The sequence-optimized haFGF was inserted into an enhanced sericin-1 expression system to generate the original transgenic silkworm strain, which was then further crossed with a PIG jumpstarter strain to achieve the remobilization of the expression cassette to a “safe harbor” locus in the genome for the efficient expression of r-haFGF. In consequence, the expression of r-haFGF protein in the mutant line achieved a 5.6-fold increase compared to the original strain. The high content of r-haFGF facilitated its purification and large-scald yields. Furthermore, the r-haFGF protein bioactively promoted the growth, proliferation and migration of NIH/3T3 cells, suggesting the r-haFGF protein possessed native mitogenic activity and the potential for wound healing. These results show that the silk gland of silkworm could be an efficient bioreactor strategy for recombinant production of bioactive haFGF in silkworm cocoons.
Sun, Xiao; Yan, Miao-Jun; Zhang, Aijun; Wang, Man-Qun
2015-10-01
Rough rice grains are often stored for extended periods before they are used or consumed. However, during storage, the rough rice is vulnerable to insect infestation, resulting in significant economic loss. Previous studies have shown that volatiles cues, physical characteristics, and taste chemicals on the grains could be the important key behavior factors for storage insect pests to locate the hosts and select oviposition sites. It is also well known that the transgenic Bt rough rice line T1C-19, which expresses a cry1C(⁎) gene has a high resistance to Lepidoptera pests. However, there were no evidences to show the consequences of host preference for non-target insect pests after growing Bt transgenic rice. In this study, the potential key factors of Bt rough rice were investigated for their impacts on the behaviors of non-target pest lesser grain borer Rhyzopertha dominica, the main weevil pest of grain and its parasitic wasps Anisopteromalus calandrae, the natural enemy of the beetle. Both electronic nose and electronic tongue analyses showed that the parameters of Bt rough rice were analogous to those of the non-Bt rough rice. The volatile profiles of Bt and non-Bt rough rice examined by gas chromatographic mass spectrometry (GC-MS) were similar. For most volatile compounds, there were no significantly quantitative differences in compound quantities between Bt and non-Bt rough rice. The densities of sclereids and trichomes on the rough rice husk surface were statistically equal in Bt and non-Bt rough rice. The non-target pest, R. dominica, and its parasitoid wasp, A. calandrae, were attracted to both rough rice and could not distinguish the transgenic T1C-19 from the isogenic rough rice. These results demonstrated that Bt rough rice has no negative impacts on the host preference behaviors of non-target stored product pest R. dominica and its parasitoid A. calandrae. Copyright © 2015 Elsevier Inc. All rights reserved.
Ramalingam, Sivaprakash; London, Viktoriya; Kandavelou, Karthikeyan; Cebotaru, Liudmila; Guggino, William; Civin, Curt; Chandrasegaran, Srinivasan
2013-02-15
Zinc finger nucleases (ZFNs) have become powerful tools to deliver a targeted double-strand break at a pre-determined chromosomal locus in order to insert an exogenous transgene by homology-directed repair. ZFN-mediated gene targeting was used to generate both single-allele chemokine (C-C motif) receptor 5 (CCR5)-modified human induced pluripotent stem cells (hiPSCs) and biallele CCR5-modified hiPSCs from human lung fibroblasts (IMR90 cells) and human primary cord blood mononuclear cells (CBMNCs) by site-specific insertion of stem cell transcription factor genes flanked by LoxP sites into the endogenous CCR5 locus. The Oct4 and Sox2 reprogramming factors, in combination with valproic acid, induced reprogramming of human lung fibroblasts to form CCR5-modified hiPSCs, while 5 factors, Oct4/Sox2/Klf4/Lin28/Nanog, induced reprogramming of CBMNCs. Subsequent Cre recombinase treatment of the CCR5-modified IMR90 hiPSCs resulted in the removal of the Oct4 and Sox2 transgenes. Further genetic engineering of the single-allele CCR5-modified IMR90 hiPSCs was achieved by site-specific addition of the large CFTR transcription unit to the remaining CCR5 wild-type allele, using CCR5-specific ZFNs and a donor construct containing tdTomato and CFTR transgenes flanked by CCR5 homology arms. CFTR was expressed efficiently from the endogenous CCR5 locus of the CCR5-modified tdTomato/CFTR hiPSCs. These results suggest that it might be feasible to use ZFN-evoked strategies to (1) generate precisely targeted genetically well-defined patient-specific hiPSCs, and (2) then to reshape their function by targeted addition and expression of therapeutic genes from the CCR5 chromosomal locus for autologous cell-based transgene-correction therapy to treat various recessive monogenic human diseases in the future.
Melander, Margareta; Kamnert, Iréne; Happstadius, Ingrid; Liljeroth, Erland; Bryngelsson, Tomas
2006-09-01
A double-gene construct with one chitinase and one beta-1,3-glucanase gene from barley, both driven by enhanced 35S promoters, was transformed into oilseed rape. From six primary transformants expressing both transgenes 10 doubled haploid lines were produced and studied for five generations. The number of inserted copies for both the genes was determined by Southern blotting and real-time PCR with full agreement between the two methods. When copy numbers were analysed in different generations, discrepancies were found, indicating that at least part of the inserted sequences were lost in one of the alleles of some doubled haploids. Chitinase and beta-1,3-glucanase expression was analysed by Western blotting in all five doubled haploid generations. Despite that both the genes were present on the same T-DNA and directed by the same promoter their expression pattern between generations was different. The beta-1,3-glucanase was expressed at high and stable levels in all generations, while the chitinase displayed lower expression that varied between generations. The transgenic plants did not show any major impact on fungal resistance when assayed in greenhouse, although purified beta-1,3-glucanase and chitinase caused retardment of fungal growth in vitro.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
ERIC Educational Resources Information Center
Jaenisch, Rudolf
1988-01-01
Describes three methods and their advantages and disadvantages for introducing genes into animals. Discusses the predictability and tissue-specificity of the injected genes. Outlines the applications of transgenic technology for studying gene expression, the early stages of mammalian development, mutations, and the molecular nature of chromosomes.…
Utrophin Up-Regulation by an Artificial Transcription Factor in Transgenic Mice
Mattei, Elisabetta; Corbi, Nicoletta; Di Certo, Maria Grazia; Strimpakos, Georgios; Severini, Cinzia; Onori, Annalisa; Desantis, Agata; Libri, Valentina; Buontempo, Serena; Floridi, Aristide; Fanciulli, Maurizio; Baban, Dilair; Davies, Kay E.; Passananti, Claudio
2007-01-01
Duchenne Muscular Dystrophy (DMD) is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter “A”. Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP) demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics. PMID:17712422
Heritage, John
2005-01-01
So far, no compelling scientific evidence has been found to suggest that the consumption of transgenic or genetically modified (GM) plants by animals or humans is more likely to cause harm than is the consumption of their conventional counterparts. Despite this lack of scientific evidence, the economic prospects for GM plants are probably limited in the short term and there is public opposition to the technology. Now is a good time to address several issues concerning GM plants, including the potential for transgenes to migrate from GM plants to gut microbes or to animal or human tissues, the consequences of consuming GM crops, either as fresh plants or as silage, and the problems caused by current legislation on GM labelling and beyond.
Zhou, Man; Li, Dayong; Li, Zhigang; Hu, Qian; Yang, Chunhua; Zhu, Lihuang; Luo, Hong
2013-01-01
MicroRNA319 (miR319) is one of the first characterized and conserved microRNA families in plants and has been demonstrated to target TCP (for TEOSINTE BRANCHED/CYCLOIDEA/PROLIFERATING CELL FACTORS [PCF]) genes encoding plant-specific transcription factors. MiR319 expression is regulated by environmental stimuli, suggesting its involvement in plant stress response, although experimental evidence is lacking and the underlying mechanism remains elusive. This study investigates the role that miR319 plays in the plant response to abiotic stress using transgenic creeping bentgrass (Agrostis stolonifera) overexpressing a rice (Oryza sativa) miR319 gene, Osa-miR319a. We found that transgenic plants overexpressing Osa-miR319a displayed morphological changes and exhibited enhanced drought and salt tolerance associated with increased leaf wax content and water retention but reduced sodium uptake. Gene expression analysis indicated that at least four putative miR319 target genes, AsPCF5, AsPCF6, AsPCF8, and AsTCP14, and a homolog of the rice NAC domain gene AsNAC60 were down-regulated in transgenic plants. Our results demonstrate that miR319 controls plant responses to drought and salinity stress. The enhanced abiotic stress tolerance in transgenic plants is related to significant down-regulation of miR319 target genes, implying their potential for use in the development of novel molecular strategies to genetically engineer crop species for enhanced resistance to environmental stress. PMID:23292790
Wang, Lin; Li, Qing-Tian; Lei, Qiong; Feng, Chao; Zheng, Xiaodong; Zhou, Fangfang; Li, Lingzi; Liu, Xuan; Wang, Zhi; Kong, Jin
2017-12-19
Water deficit severely reduces apple growth and production, is detrimental to fruit quality and size. This problem is exacerbated as global warming is implicated in producing more severe drought stress. Thus water-efficiency has becomes the major target for apple breeding. A desired apple tree can absorb and transport water efficiently, which not only confers improved drought tolerance, but also guarantees fruit size for higher income returns. Aquaporins, as water channels, control water transportation across membranes and can regulate water flow by changing their amount and activity. The exploration of molecular mechanism of water efficiency and the gene wealth will pave a way for molecular breeding of drought tolerant apple tree. In the current study, we screened out a drought inducible aquaporin gene MdPIP1;3, which specifically enhanced its expression during fruit expansion in 'Fuji' apple (Malus domestica Borkh. cv. Red Fuji). It localized on plasma membranes and belonged to PIP1 subfamily. The tolerance to drought stress enhanced in transgenic tomato plants ectopically expressing MdPIP1;3, showing that the rate of losing water in isolated transgenic leaves was slower than wild type, and stomata of transgenic plants closed sensitively to respond to drought compared with wild type. Besides, length and diameter of transgenic tomato fruits increased faster than wild type, and in final, fruit sizes and fresh weights of transgenic tomatoes were bigger than wild type. Specially, in cell levels, fruit cell size from transgenic tomatoes was larger than wild type, showing that cell number per mm 2 in transgenic fruits was less than wild type. Altogether, ectopically expressing MdPIP1;3 enhanced drought tolerance of transgenic tomatoes partially via reduced water loss controlled by stomata closure in leaves. In addition, the transgenic tomato fruits are larger and heavier with larger cells via more efficient water transportation across membranes. Our research will
Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang
2018-01-01
Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton cultivars
Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang
2018-04-12
Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton
Su, Xiaohua; Chu, Yanguang; Li, Huan; Hou, Yingjie; Zhang, Bingyu; Huang, Qinjun; Hu, Zanmin; Huang, Rongfeng; Tian, Yingchuan
2011-01-01
Commercial and non-commercial plants face a variety of environmental stressors that often cannot be controlled. In this study, transgenic hybrid poplar (Populus × euramericana ‘Guariento’) harboring five effector genes (vgb, SacB, JERF36, BtCry3A and OC-I) were subjected to drought, salinity, waterlogging and insect stressors in greenhouse or laboratory conditions. Field trials were also conducted to investigate long-term effects of transgenic trees on insects and salt tolerance in the transformants. In greenhouse studies, two transgenic lines D5-20 and D5-21 showed improved growth, as evidenced by greater height and basal diameter increments and total biomass relative to the control plants after drought or salt stress treatments. The improved tolerance to drought and salt was primarily attributed to greater instantaneous water use efficiency (WUEi) in the transgenic trees. The chlorophyll concentrations tended to be higher in the transgenic lines under drought or saline conditions. Transformed trees in drought conditions accumulated more fructan and proline and had increased Fv/Fm ratios (maximum quantum yield of photosystem II) under waterlogging stress. Insect-feeding assays in the laboratory revealed a higher total mortality rate and lower exuviation index of leaf beetle [Plagiodera versicolora (Laicharting)] larvae fed with D5-21 leaves, suggesting enhanced insect resistance in the transgenic poplar. In field trials, the dominance of targeted insects on 2-year-old D5-21 transgenic trees was substantially lower than that of the controls, indicating enhanced resistance to Coleoptera. The average height and DBH (diameter at breast height) of 2.5-year-old transgenic trees growing in naturally saline soil were 3.80% and 4.12% greater than those of the control trees, but these increases were not significant. These results suggested that multiple stress-resistance properties in important crop tree species could be simultaneously improved, although additional
Chen, Ming; Sun, Liying; Wu, Hongya; Chen, Jiong; Ma, Youzhi; Zhang, Xiaoxiang; Du, Lipu; Cheng, Shunhe; Zhang, Boqiao; Ye, Xingguo; Pang, Junlan; Zhang, Xinmei; Li, Liancheng; Andika, Ida B; Chen, Jianping; Xu, Huijun
2014-05-01
Wheat yellow mosaic virus (WYMV) has spread rapidly and causes serious yield losses in the major wheat-growing areas in China. Because it is vectored by the fungus-like organism Polymyxa graminis that survives for long periods in soil, it is difficult to eliminate by conventional crop management or fungicides. There is also only limited resistance in commercial cultivars. In this research, fourteen independent transgenic events were obtained by co-transformation with the antisense NIb8 gene (the NIb replicase of WYMV) and a selectable gene bar. Four original transgenic lines (N12, N13, N14 and N15) and an offspring line (N12-1) showed high and durable resistance to WYMV in the field. Four resistant lines were shown to have segregated and only contain NIb8 (without bar) by PCR and herbicide resistance testing in the later generations. Line N12-1 showed broad-spectrum resistance to WYMV isolates from different sites in China. After growing in the infested soil, WYMV could not be detected by tissue printing and Western blot assays of transgenic wheat. The grain yield of transgenic wheat was about 10% greater than the wild-type susceptible control. Northern blot and small RNA deep sequencing analyses showed that there was no accumulation of small interfering RNAs targeting the NIb8 gene in transgenic wheat plants, suggesting that transgene RNA silencing, a common mechanism of virus-derived disease resistance, is not involved in the process of WYMV resistance. This durable and broad-spectrum resistance to WYMV in transgenic wheat will be useful for alleviating the damage caused by WYMV. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Software-implemented fault insertion: An FTMP example
NASA Technical Reports Server (NTRS)
Czeck, Edward W.; Siewiorek, Daniel P.; Segall, Zary Z.
1987-01-01
This report presents a model for fault insertion through software; describes its implementation on a fault-tolerant computer, FTMP; presents a summary of fault detection, identification, and reconfiguration data collected with software-implemented fault insertion; and compares the results to hardware fault insertion data. Experimental results show detection time to be a function of time of insertion and system workload. For the fault detection time, there is no correlation between software-inserted faults and hardware-inserted faults; this is because hardware-inserted faults must manifest as errors before detection, whereas software-inserted faults immediately exercise the error detection mechanisms. In summary, the software-implemented fault insertion is able to be used as an evaluation technique for the fault-handling capabilities of a system in fault detection, identification and recovery. Although the software-inserted faults do not map directly to hardware-inserted faults, experiments show software-implemented fault insertion is capable of emulating hardware fault insertion, with greater ease and automation.
Choi, Kimyung; Shim, Joohyun; Ko, Nayoung; Eom, Heejong; Kim, Jiho; Lee, Jeong-Woong; Jin, Dong-Il; Kim, Hyunil
2017-04-01
Production of transgenic pigs for use as xenotransplant donors is a solution to the severe shortage of human organs for transplantation. The first barrier to successful xenotransplantation is hyperacute rejection, a rapid, massive humoral immune response directed against the pig carbohydrate GGTA1 epitope. Platelet activation, adherence, and clumping, all major features of thrombotic microangiopathy, are inevitable results of immune-mediated transplant rejection. Human CD39 rapidly hydrolyzes ATP and ADP to AMP; AMP is hydrolyzed by ecto-5'-nucleotidase (CD73) to adenosine, an anti-thrombotic and cardiovascular protective mediator. In this study, we developed a vector-based strategy for ablation of GGTA1 function and concurrent expression of human CD39 (hCD39). An hCD39 expression cassette was constructed to target exon 4 of GGTA1. We established heterozygous GGTA1 knock-out cell lines expressing hCD39 from pig ear fibroblasts for somatic cell nuclear transfer (SCNT). We also described production of heterozygous GGTA1 knock-out piglets expressing hCD39 and analyzed expression and function of the transgene. Human CD39 was expressed in heart, kidney and aorta. Human CD39 knock-in heterozygous ear fibroblast from transgenic cloned pigs, but not in non-transgenic pig's cells. Expression of GGTA1 gene was lower in the knock-in heterozygous ear fibroblast from transgenic pigs compared to the non-transgenic pig's cell. The peripheral blood mononuclear cells (PBMC) from the transgenic pigs were more resistant to lysis by pooled complement-preserved normal human serum than that from wild type (WT) pig. Accordingly, GGTA1 mutated piglets expressing hCD39 will provide a new organ source for xenotransplantation research.
Berman-Booty, Lisa D.; Thomas-Ahner, Jennifer M.; Bolon, Brad; Oglesbee, Michael J.; Clinton, Steven K.; Kulp, Samuel K.; Chen, Ching-Shih; La Perle, Krista
2014-01-01
Male transgenic adenocarcinoma of the mouse prostate (TRAMP) mice are frequently used in prostate cancer research because their prostates consistently develop a series of pre-neoplastic and neoplastic lesions. Disease progression in TRAMP mouse prostates culminates in metastatic, poorly differentiated carcinomas with neuroendocrine features. The androgen dependence of the rat probasin promoter largely limits transgene expression to the prostatic epithelium. However, extra-prostatic transgene-positive lesions have been described in TRAMP mice, including renal tubulo-acinar carcinomas, neuroendocrine carcinomas of the urethra, and phyllodes-like tumors of the seminal vesicle. Here we describe the histologic and immunohistochemical features of two novel extra-prostatic lesions in TRAMP mice: primary anaplastic tumors of uncertain cell origin in the midbrain, and poorly differentiated adenocarcinomas of the submandibular salivary gland. These newly characterized tumors apparently result from transgene expression in extra-prostatic locations rather than representing metastatic prostate neoplasms because lesions were identified in both male and female mice as well as in male TRAMP mice without histologically apparent prostate tumors. In this paper we also calculate the incidences of the urethral carcinomas and renal tubulo-acinar carcinomas, further elucidate the biological behavior of the urethral carcinomas, and demonstrate the critical importance of complete necropsies even when evaluating presumably well characterized phenotypes in genetically engineered mice. PMID:24742627
Berman-Booty, Lisa D; Thomas-Ahner, Jennifer M; Bolon, Brad; Oglesbee, Michael J; Clinton, Steven K; Kulp, Samuel K; Chen, Ching-Shih; La Perle, Krista M D
2015-02-01
Male transgenic adenocarcinoma of the mouse prostate (TRAMP) mice are frequently used in prostate cancer research because their prostates consistently develop a series of preneoplastic and neoplastic lesions. Disease progression in TRAMP mouse prostates culminates in metastatic, poorly differentiated carcinomas with neuroendocrine features. The androgen dependence of the rat probasin promoter largely limits transgene expression to the prostatic epithelium. However, extra-prostatic transgene-positive lesions have been described in TRAMP mice, including renal tubuloacinar carcinomas, neuroendocrine carcinomas of the urethra, and phyllodes-like tumors of the seminal vesicle. Here, we describe the histologic and immunohistochemical features of 2 novel extra-prostatic lesions in TRAMP mice: primary anaplastic tumors of uncertain cell origin in the midbrain and poorly differentiated adenocarcinomas of the submandibular salivary gland. These newly characterized tumors apparently result from transgene expression in extra-prostatic locations rather than representing metastatic prostate neoplasms because lesions were identified in both male and female mice and in male TRAMP mice without histologically apparent prostate tumors. In this article, we also calculate the incidences of the urethral carcinomas and renal tubuloacinar carcinomas, further elucidate the biological behavior of the urethral carcinomas, and demonstrate the critical importance of complete necropsies even when evaluating presumably well characterized phenotypes in genetically engineered mice. © 2014 by The Author(s).
McManus, Meagan J; Murphy, Michael P; Franklin, James L
2011-11-02
Considerable evidence suggests that mitochondrial dysfunction and oxidative stress contribute to the progression of Alzheimer's disease (AD). We examined the ability of the novel mitochondria-targeted antioxidant MitoQ (mitoquinone mesylate: [10-(4,5-dimethoxy-2-methyl-3,6-dioxo-1,4-cycloheexadienl-yl) decyl triphenylphosphonium methanesulfonate]) to prevent AD-like pathology in mouse cortical neurons in cell culture and in a triple transgenic mouse model of AD (3xTg-AD). MitoQ attenuated β-amyloid (Aβ)-induced neurotoxicity in cortical neurons and also prevented increased production of reactive species and loss of mitochondrial membrane potential (Δψ(m)) in them. To determine whether the mitochondrial protection conferred by MitoQ was sufficient to prevent the emergence of AD-like neuropathology in vivo, we treated young female 3xTg-AD mice with MitoQ for 5 months and analyzed the effect on the progression of AD-like pathologies. Our results show that MitoQ prevented cognitive decline in these mice as well as oxidative stress, Aβ accumulation, astrogliosis, synaptic loss, and caspase activation in their brains. The work presented herein suggests a central role for mitochondria in neurodegeneration and provides evidence supporting the use of mitochondria-targeted therapeutics in diseases involving oxidative stress and metabolic failure, namely AD.
USDA-ARS?s Scientific Manuscript database
Insect-resistant transgenic Bt cotton has, in general, increased yield and reduced insecticide use in cotton production by successfully managing target pests. In the southeast US, Bt cotton provides effective control of Helicpverpa zea and Heliothis virescens [Lepidoptera: Noctuidae]. However Bt c...
Masanga, Joel Okoyo; Matheka, Jonathan Mutie; Omer, Rasha Adam; Ommeh, Sheila Cecily; Monda, Ethel Oranga; Alakonya, Amos Emitati
2015-08-01
We report success of host-induced gene silencing in downregulation of aflatoxin biosynthesis in Aspergillus flavus infecting maize transformed with a hairpin construct targeting transcription factor aflR. Infestation of crops by aflatoxin-producing fungi results in economic losses as well as negative human and animal health effects. Currently, the control strategies against aflatoxin accumulation are not effective to the small holder farming systems in Africa and this has led to widespread aflatoxin exposure especially in rural populations of sub-Saharan Africa that rely on maize as a staple food crop. A recent strategy called host-induced gene silencing holds great potential for developing aflatoxin-resistant plant germplasm for the African context where farmers are unable to make further investments other than access to the germplasm. We transformed maize with a hairpin construct targeting the aflatoxin biosynthesis transcription factor aflR. The developed transgenic maize were challenged with an aflatoxigenic Aspergillus flavus strain from Eastern Kenya, a region endemic to aflatoxin outbreaks. Our results indicated that aflR was downregulated in A. flavus colonizing transgenic maize. Further, maize kernels from transgenic plants accumulated significantly lower levels of aflatoxins (14-fold) than those from wild type plants. Interestingly, we observed that our silencing cassette caused stunting and reduced kernel placement in the transgenic maize. This could have been due to "off-target" silencing of unintended genes in transformed plants by aflR siRNAs. Overall, this work indicates that host-induced gene silencing has potential in developing aflatoxin-resistant germplasm.
Determining the transgene containment level provided by chloroplast transformation.
Ruf, Stephanie; Karcher, Daniel; Bock, Ralph
2007-04-24
Plastids (chloroplasts) are maternally inherited in most crops. Maternal inheritance excludes plastid genes and transgenes from pollen transmission. Therefore, plastid transformation is considered a superb tool for ensuring transgene containment and improving the biosafety of transgenic plants. Here, we have assessed the strictness of maternal inheritance and the extent to which plastid transformation technology confers an increase in transgene confinement. We describe an experimental system facilitating stringent selection for occasional paternal plastid transmission. In a large screen, we detected low-level paternal inheritance of transgenic plastids in tobacco. Whereas the frequency of transmission into the cotyledons of F(1) seedlings was approximately 1.58 x 10(-5) (on 100% cross-fertilization), transmission into the shoot apical meristem was significantly lower (2.86 x 10(-6)). Our data demonstrate that plastid transformation provides an effective tool to increase the biosafety of transgenic plants. However, in cases where pollen transmission must be prevented altogether, stacking with other containment methods will be necessary to eliminate the residual outcrossing risk.
Hook, Vivian Y. H.; Kindy, Mark; Reinheckel, Thomas; Peters, Christoph; Hook, Gregory
2009-01-01
Neurotoxic β-amyloid (Aβ) peptides participate in Alzheimer’s disease (AD); therefore, reduction of Aβ generated from APP may provide a therapeutic approach for AD. Gene knockout studies in transgenic mice producing human Aβ may identify targets for reducing Aβ. This study shows that knockout of the cathepsin B gene in mice expressing human wild-type APP (hAPPwt) results in substantial decrease of Aβ40 and Aβ42 by 67% in brain, and decreases levels of the C-terminal β-secretase fragment (CTFβ) derived from APP. In contrast, knockout of cathepsin B in mice expressing hAPP with the rare Swedish (Swe) and Indiana (Ind) mutations had no effect on Aβ. The difference in reduction of Aβ in hAPPwt mice, but not in hAPPSwe/Ind mice, shows that the transgenic model can affect cathepsin B gene knockout results. Since most AD patients express hAPPwt, these data validate cathepsin B as a target for development of inhibitors to lower Aβ in AD. PMID:19501042
Hook, Vivian Y H; Kindy, Mark; Reinheckel, Thomas; Peters, Christoph; Hook, Gregory
2009-08-21
Neurotoxic beta-amyloid (Abeta) peptides participate in Alzheimer's disease (AD); therefore, reduction of Abeta generated from APP may provide a therapeutic approach for AD. Gene knockout studies in transgenic mice producing human Abeta may identify targets for reducing Abeta. This study shows that knockout of the cathepsin B gene in mice expressing human wild-type APP (hAPPwt) results in substantial decreases in brain Abeta40 and Abeta42 by 67% and decreases in levels of the C-terminal beta-secretase fragment (CTFbeta) derived from APP. In contrast, knockout of cathepsin B in mice expressing hAPP with the rare Swedish (Swe) and Indiana (Ind) mutations had no effect on Abeta. The difference in reduction of Abeta in hAPPwt mice, but not in hAPPSwe/Ind mice, shows that the transgenic model can affect cathepsin B gene knockout results. Since most AD patients express hAPPwt, these data validate cathepsin B as a target for development of inhibitors to lower Abeta in AD.