Palmitoylation of Sindbis Virus TF Protein Regulates Its Plasma Membrane Localization and Subsequent Incorporation into Virions.

PubMed

Ramsey, Jolene; Renzi, Emily C; Arnold, Randy J; Trinidad, Jonathan C; Mukhopadhyay, Suchetana

2017-02-01

Palmitoylation is a reversible, posttranslational modification that helps target proteins to cellular membranes. The alphavirus small membrane proteins 6K and TF have been reported to be palmitoylated and to positively regulate budding. 6K and TF are isoforms that are identical in their N termini but unique in their C termini due to a -1 ribosomal frameshift during translation. In this study, we used cysteine (Cys) mutants to test differential palmitoylation of the Sindbis virus 6K and TF proteins. We modularly mutated the five Cys residues in the identical N termini of 6K and TF, the four additional Cys residues in TF's unique C terminus, or all nine Cys residues in TF. Using these mutants, we determined that TF palmitoylation occurs primarily in the N terminus. In contrast, 6K is not palmitoylated, even on these shared residues. In the C-terminal Cys mutant, TF protein levels increase both in the cell and in the released virion compared to the wild type. In viruses with the N-terminal Cys residues mutated, TF is much less efficiently localized to the plasma membrane, and it is not incorporated into the virion. The three Cys mutants have minor defects in cell culture growth but a high incidence of abnormal particle morphologies compared to the wild-type virus as determined by transmission electron microscopy. We propose a model where the C terminus of TF modulates the palmitoylation of TF at the N terminus, and palmitoylated TF is preferentially trafficked to the plasma membrane for virus budding. Alphaviruses are a reemerging viral cause of arthritogenic disease. Recently, the small 6K and TF proteins of alphaviruses were shown to contribute to virulence in vivo Nevertheless, a clear understanding of the molecular mechanisms by which either protein acts to promote virus infection is missing. The TF protein is a component of budded virions, and optimal levels of TF correlate positively with wild-type-like particle morphology. In this study, we show that the

Synergistic Roles of Antibody and Interferon in Noncytolytic Clearance of Sindbis Virus from Different Regions of the Central Nervous System▿

PubMed Central

Burdeinick-Kerr, Rebeca; Wind, Jennifer; Griffin, Diane E.

2007-01-01

Sindbis virus (SINV) is an alphavirus that causes infection of neurons and encephalomyelitis in adult immunocompetent mice. Recovery can occur without apparent neurological damage. To better define the factors facilitating noncytolytic clearance of SINV in different regions of the central nervous system (CNS) and the roles of innate and adaptive immune responses at different times during infection, we have characterized SINV infection and clearance in the brain, brain stem, and spinal cords of severe combined immunodeficiency (SCID) and C57BL/6 (wild-type [WT]) mice and mice deficient in beta interferon (IFN-β) (BKO), antibody (μMT), IFN-γ (GKO), IFN-γ receptor (GRKO), and both antibody and IFN-γ (μMT/GKO). WT mice cleared infectious virus by day 8, while SCID mice had persistent virus replication at all sites. For 3 days after infection, BKO mice had higher titers at all sites than WT mice, despite similar IFN-α production, but cleared virus similarly. GKO and GRKO mice cleared infectious virus from all sites by days 8 to 10 and, like WT mice, displayed transient reactivation at 12 to 22 days. μMT mice did not clear virus from the brain, and clearance from the brain stem and lumbar spinal cord was delayed, followed by reactivation. Eighty-one days after infection, μMT/GKO mice had not cleared virus from any site, but titers were lower than for SCID mice. These studies show that IFN-β is independently important for early control of CNS virus replication, that antiviral antibody is critical for clearance from the brain, and that both antibody and IFN-γ contribute to prevention of reactivation after initial clearance. PMID:17376910

Sindbis virus glycoproteins are abnormally glycosylated in Chinese hamster ovary cells deprived of glucose.

PubMed

Davidson, S K; Hunt, L A

1985-07-01

We have previously demonstrated that Sindbis virus infection of Chinese hamster ovary (CHO) cells altered the protein glycosylation machinery of the cell, so that both normal, full-size (nine mannose-containing) oligosaccharides and abnormal, "truncated' (five mannose-containing) oligosaccharides are transferred from lipid-linked precursors to newly synthesized viral membrane glycoproteins. In the present studies, we have examined the precursor oligosaccharides on viral glycoproteins that were pulse-labelled with [3H]mannose in the presence or absence of glucose, since glucose starvation of uninfected CHO cells has been reported to induce synthesis of truncated precursor oligosaccharides. Pulse-labelling in the absence of glucose led to a greater than 10-fold increase in the relative amount of the truncated precursor oligosaccharides being transferred to the newly synthesized viral glycoproteins and to an apparent underglycosylation of some precursor viral polypeptides, with some asparaginyl sites not acquiring covalently linked oligosaccharides. The mature virion glycoproteins from CHO cells which were pulse-labelled in the absence of glucose and then 'chased' in the presence of glucose contained proportionately more unusual Man3GlcNAc2-size oligosaccharides. These small neutral-type oligosaccharides were apparently not as good a substrate for further processing into complex acidic-type oligosaccharides as the normal Man5GlcNAc2 intermediate that results from the full-size precursor oligosaccharides.

A Single Mutation in the E2 Glycoprotein Important for Neurovirulence Influences Binding of Sindbis Virus to Neuroblastoma Cells

PubMed Central

Lee, Peiyu; Knight, Ronald; Smit, Jolanda M.; Wilschut, Jan; Griffin, Diane E.

2002-01-01

The amino acid at position 55 of the E2 glycoprotein (E255) of Sindbis virus (SV) is a critical determinant of SV neurovirulence in mice. Recombinant virus strain TE (E255 = histidine) differs only at this position from virus strain 633 (E255= glutamine), yet TE is considerably more neurovirulent than 633. TE replicates better than 633 in a neuroblastoma cell line (N18), but similarly in BHK cells. Immunofluorescence staining showed that most N18 cells were infected by TE at a multiplicity of infection (MOI) of 50 to 500 and by 633 only at an MOI of 5,000, while both viruses infected essentially 100% of BHK cells at an MOI of 5. When exposed to pH 5, TE and 633 viruses fused to similar extents with liposomes derived from BHK or N18 cell lipids, but fusion with N18-derived liposomes was less extensive (15 to 20%) than fusion with BHK-derived liposomes (∼50%). Binding of TE and 633 to N18, but not BHK, cells was dependent on the medium used for virus binding. Differences between TE and 633 binding to N18 cells were evident in Dulbecco's modified Eagle medium (DMEM), but not in RPMI. In DMEM, the binding efficiency of 633 decreased significantly as the pH was raised from 6.5 to 8.0, while that of TE did not change. The same pattern was observed with RPMI when the ionic strength of RPMI was increased to that of DMEM. TE bound better to heparin-Sepharose than 633, but this difference was not pH dependent. Growth of N18 and BHK cells in sodium chlorate to eliminate all sulfation decreased virus-cell binding, suggesting the involvement of sulfated molecules on the cell surface. Taken together, the presence of glutamine at E255 impairs SV binding to neural cells under conditions characteristic of interstitial fluid. We conclude that mutation to histidine participates in or stabilizes the interaction between the virus and the surface of neural cells, contributing to greater neurovirulence. PMID:12021363

Development of an Electrochemical Paper-Based Analytical Device for Trace Detection of Virus Particles.

PubMed

Channon, Robert B; Yang, Yuanyuan; Feibelman, Kristen M; Geiss, Brian J; Dandy, David S; Henry, Charles S

2018-06-19

Viral pathogens are a serious health threat around the world, particularly in resource limited settings, where current sensing approaches are often insufficient and slow, compounding the spread and burden of these pathogens. Here, we describe a label-free, point-of-care approach toward detection of virus particles, based on a microfluidic paper-based analytical device with integrated microwire Au electrodes. The device is initially characterized through capturing of streptavidin modified nanoparticles by biotin-modified microwires. An order of magnitude improvement in detection limits is achieved through use of a microfluidic device over a classical static paper-based device, due to enhanced mass transport and capturing of particles on the modified electrodes. Electrochemical impedance spectroscopy detection of West Nile virus particles was carried out using antibody functionalized Au microwires, achieving a detection limit of 10.2 particles in 50 μL of cell culture media. No increase in signal is found on addition of an excess of a nonspecific target (Sindbis). This detection motif is significantly cheaper (∼$1 per test) and faster (∼30 min) than current methods, while achieving the desired selectivity and sensitivity. This sensing motif represents a general platform for trace detection of a wide range of biological pathogens.

Microbiota activates IMD pathway and limits Sindbis infection in Aedes aegypti.

PubMed

Barletta, Ana Beatriz Ferreira; Nascimento-Silva, Maria Clara L; Talyuli, Octávio A C; Oliveira, José Henrique M; Pereira, Luiza Oliveira Ramos; Oliveira, Pedro L; Sorgine, Marcos Henrique F

2017-02-23

Aedes aegypti is the main vector of important arboviruses such as dengue, Zika and chikungunya. During infections mosquitoes can activate the immune pathways Toll, IMD and JAK/STAT to limit pathogen replication. Here, we evaluate the immune response profile of Ae. aegypti against Sindbis virus (SINV). We analyzed gene expression of components of Toll, IMD and JAK/STAT pathways and showed that a blood meal and virus infection upregulated aaREL2 in a microbiota-dependent fashion, since this induction was prevented by antibiotic. The presence of the microbiota activates IMD and impaired the replication of SINV in the midgut. Constitutive activation of the IMD pathway, by Caspar depletion, leads to a decrease in microbiota levels and an increase in SINV loads. Together, these results suggest that a blood meal is able to activate innate immune pathways, through a nutrient induced growth of microbiota, leading to upregulation of aaREL2 and IMD activation. Microbiota levels seemed to have a reciprocal interaction, where the proliferation of the microbiota activates IMD pathway that in turn controls bacterial levels, allowing SINV replication in Ae. aegypti mosquitoes. The activation of the IMD pathway seems to have an indirect effect in SINV levels that is induced by the microbiota.

Nucleic acid-based vaccines targeting respiratory syncytial virus: Delivering the goods.

PubMed

Smith, Trevor R F; Schultheis, Katherine; Broderick, Kate E

2017-11-02

Respiratory syncytial virus (RSV) is a massive medical burden on a global scale. Infants, children and the elderly represent the vulnerable populations. Currently there is no approved vaccine to protect against the disease. Vaccine development has been hindered by several factors including vaccine enhanced disease (VED) associated with formalin-inactivated RSV vaccines, inability of target populations to raise protective immune responses after vaccination or natural viral infection, and a lack of consensus concerning the most appropriate virus-associated target antigen. However, with recent advances in the molecular understanding of the virus, and design of highly characterized vaccines with enhanced immunogenicity there is new belief a RSV vaccine is possible. One promising approach is nucleic acid-based vaccinology. Both DNA and mRNA RSV vaccines are showing promising results in clinically relevant animal models, supporting their transition into humans. Here we will discuss this strategy to target RSV, and the ongoing studies to advance the nucleic acid vaccine platform as a viable option to protect vulnerable populations from this important disease.

Morphogenesis of Dengue Virus: Molecular Biology and Molecular Organization of Proteins.

DTIC Science & Technology

1981-02-01

envelope and near the virion surface. The divalent cations probably act to stabilize viral envelope proteins, as recently found for feline leukemia ... Virus Sindbis virus (SV) and Semliki Forest Virus (SFV) are arthopod-borne alDhaviruses of the toqavirus family. Both viruses contain a nucleocaosid...AU-AIZ9 b"J MORPHOGENESIS OF DENGUE VIRUS : MOLECULAR BIO0OGY AND MOLECULAR ORGANIZATION OFPROENS(U CALIORNIAUNIV DAVIS DEPT 0F BACTERIOLO0Y J S

Efficient replication, and evolution of Sindbis virus genomes with non-canonical 3'A/U-rich elements (NC3ARE) in neonatal mice.

PubMed

James, Frederick D; Hietala, Katie A; Eldar, Dganit; Guess, Tiffany E; Cone, Cecil; Mundell, Nathan A; Mundall, Nathan; Barnett, Joey V; Raju, Ramaswamy

2007-12-01

Sindbis virus (SIN) is a mosquito-transmitted animal RNA virus. We previously reported that SIN genomes lacking a canonical 19 nt 3'CSE undergo novel repair processes in BHK cells to generate a library of stable atypical SIN genomes with non-canonical 3'A/U-rich elements (NC3AREs) adjacent to the 3' poly(A) tail [1]. To determine the stability and evolutionary pressures on the SIN genomes with NC3AREs to regain a 3'CSE, five representative SIN isolates and a wild type SIN were tested in newborn mice. The key findings of this study are: (a) all six SIN isolates, including those that have extensive NC3AREs in the 3'NTRs, replicate well and produce high titer viremia in newborn mice; (b) 7-9 successive passages of these isolates in newborn mice produced comparable levels of viremia; (c) while all isolates produced only small-sized plaques during primary infection in animals, both small- and large-sized plaques were generated in all other passages; (d) polymerase stuttering occurs on select 3' oligo(U) motifs to add more U residues within the NC3AREs; (e) the S3-8 isolate with an internal UAUUU motif in the 3'poly(A) tail maintains this element even after 9 passages in animals; (f) despite differences in 3'NTRs and variable tissue distribution, all SIN isolates appear to produce similar tissue pathology in infected animals. Competition experiments with wt SIN and atypical SIN isolates in BHK cells show dominance of wt SIN. As shown for BHK cells in culture, the 3'CSE of the SIN genome is not required for virus replication and genome stability in live animals. Since the NC3AREs of atypical SIN genomes are not specific to SIN replicases, alternate RNA motifs of alphavirus genome must confer specificity in template selection. These studies fulfill the need to confirm the long-term viability of atypical SIN genomes in newborn mice and offer a basis for exploring the use of atypical SIN genomes in biotechnology.

Targeted entry of enveloped viruses: measles and herpes simplex virus I.

PubMed

Navaratnarajah, Chanakha K; Miest, Tanner S; Carfi, Andrea; Cattaneo, Roberto

2012-02-01

We compare the receptor-based mechanisms that a small RNA virus and a larger DNA virus have evolved to drive the fusion of viral and cellular membranes. Both systems rely on tight control over triggering the concerted refolding of a trimeric fusion protein. While measles virus entry depends on a receptor-binding protein and a fusion protein only, the herpes simplex virus (HSV) is more complex and requires four viral proteins. Nevertheless, in both viruses a receptor-binding protein is required for triggering the membrane fusion process. Moreover, specificity domains can be appended to these receptor-binding proteins to target virus entry to cells expressing a designated receptor. We discuss how principles established with measles and HSV can be applied to targeting other enveloped viruses, and alternatively how retargeted envelopes can be fitted on foreign capsids. Copyright © 2011 Elsevier B.V. All rights reserved.

Virus-Based Cancer Therapeutics for Targeted Photodynamic Therapy.

PubMed

Cao, Binrui; Xu, Hong; Yang, Mingying; Mao, Chuanbin

2018-01-01

Cancer photodynamic therapy (PDT) involves the absorption of light by photosensitizers (PSs) to generate cytotoxic singlet oxygen for killing cancer cells. The success of this method is usually limited by the lack of selective accumulation of the PS at cancer cells. Bioengineered viruses with cancer cell-targeting peptides fused on their surfaces are great drug carriers that can guide the PS to cancer cells for targeted cancer treatment. Here, we use cell-targeting fd bacteriophages (phages) as an example to describe how to chemically conjugate PSs (e.g., pyropheophorbide-a (PPa)) onto a phage particle to achieve targeted PDT.

Engineered Lentivector Targeting of Dendritic Cells for In Vivo Immunization

PubMed Central

Yang, Lili; Yang, Haiguang; Rideout, Kendra; Cho, Taehoon; Joo, Kye il; Ziegler, Leslie; Elliot, Abigail; Walls, Anthony; Yu, Dongzi; Baltimore, David; Wang, Pin

2008-01-01

We report a method of inducing antigen production in dendritic cells (DCs) by in vivo targeting with lentiviral vectors that specifically bind to the DC surface protein, DC-SIGN. To target the DCs, the lentivector was enveloped with a viral glycoprotein from Sindbis virus, engineered to be DC-SIGN-specific. In vitro, this lentivector specifically transduced DCs and induced DC maturation. A remarkable frequency (up to 12%) of ovalbumin (OVA)-specific CD8+ T cells and a significant antibody response were observed 2 weeks following injection of a targeted lentiviral vector encoding an OVA transgene into naïve mice. These mice were solidly protected against the growth of the OVA-expressing E.G7 tumor and this methodology could even induce regression of an established tumor. Thus, lentiviral vectors targeting DCs provide a simple method of producing effective immunity and may provide an alternative route for immunization with protein antigens. PMID:18297056

Subgenomic Reporter RNA System for Detection of Alphavirus Infection in Mosquitoes

PubMed Central

Steel, J. Jordan; Franz, Alexander W. E.; Sanchez-Vargas, Irma; Olson, Ken E.; Geiss, Brian J.

2013-01-01

Current methods for detecting real-time alphavirus (Family Togaviridae) infection in mosquitoes require the use of recombinant viruses engineered to express a visibly detectable reporter protein. These altered viruses expressing fluorescent proteins, usually from a duplicated viral subgenomic reporter, are effective at marking infection but tend to be attenuated due to the modification of the genome. Additionally, field strains of viruses cannot be visualized using this approach unless infectious clones can be developed to insert a reporter protein. To circumvent these issues, we have developed an insect cell-based system for detecting wild-type sindbis virus infection that uses a virus inducible promoter to express a fluorescent reporter gene only upon active virus infection. We have developed an insect expression system that produces sindbis virus minigenomes containing a subgenomic promoter sequence, which produces a translatable RNA species only when infectious virus is present and providing viral replication proteins. This subgenomic reporter RNA system is able to detect wild-type Sindbis infection in cultured mosquito cells. The detection system is relatively species specific and only detects closely related viruses, but can detect low levels of alphavirus specific replication early during infection. A chikungunya virus detection system was also developed that specifically detects chikungunya virus infection. Transgenic Aedes aegypti mosquito families were established that constitutively express the sindbis virus reporter RNA and were found to only express fluorescent proteins during virus infection. This virus inducible reporter system demonstrates a novel approach for detecting non-recombinant virus infection in mosquito cell culture and in live transgenic mosquitoes. PMID:24367703

Structure-based drug discovery for combating influenza virus by targeting the PA-PB1 interaction.

PubMed

Watanabe, Ken; Ishikawa, Takeshi; Otaki, Hiroki; Mizuta, Satoshi; Hamada, Tsuyoshi; Nakagaki, Takehiro; Ishibashi, Daisuke; Urata, Shuzo; Yasuda, Jiro; Tanaka, Yoshimasa; Nishida, Noriyuki

2017-08-25

Influenza virus infections are serious public health concerns throughout the world. The development of compounds with novel mechanisms of action is urgently required due to the emergence of viruses with resistance to the currently-approved anti-influenza viral drugs. We performed in silico screening using a structure-based drug discovery algorithm called Nagasaki University Docking Engine (NUDE), which is optimised for a GPU-based supercomputer (DEstination for Gpu Intensive MAchine; DEGIMA), by targeting influenza viral PA protein. The compounds selected by NUDE were tested for anti-influenza virus activity using a cell-based assay. The most potent compound, designated as PA-49, is a medium-sized quinolinone derivative bearing a tetrazole moiety, and it inhibited the replication of influenza virus A/WSN/33 at a half maximal inhibitory concentration of 0.47 μM. PA-49 has the ability to bind PA and its anti-influenza activity was promising against various influenza strains, including a clinical isolate of A(H1N1)pdm09 and type B viruses. The docking simulation suggested that PA-49 interrupts the PA-PB1 interface where important amino acids are mostly conserved in the virus strains tested, suggesting the strain independent utility. Because our NUDE/DEGIMA system is rapid and efficient, it may help effective drug discovery against the influenza virus and other emerging viruses.

Viruses, Artificial Viruses and Virus-Based Structures for Biomedical Applications.

PubMed

van Rijn, Patrick; Schirhagl, Romana

2016-06-01

Nanobiomaterials such as virus particles and artificial virus particles offer tremendous opportunities to develop new biomedical applications such as drug- or gene-delivery, imaging and sensing but also improve understanding of biological mechanisms. Recent advances within the field of virus-based systems give insights in how to mimic viral structures and virus assembly processes as well as understanding biodistribution, cell/tissue targeting, controlled and triggered disassembly or release and circulation times. All these factors are of high importance for virus-based functional systems. This review illustrates advances in mimicking and enhancing or controlling these aspects to a high degree toward delivery and imaging applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Serial femtosecond X-ray diffraction of enveloped virus microcrystals

DOE PAGES

Lawrence, Robert M.; Conrad, Chelsie E.; Zatsepin, Nadia A.; ...

2015-08-20

Serial femtosecond crystallography (SFX) using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ~700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ~40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is a pertinent step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.

Active vaccination with vaccinia virus A33 protects mice against lethal vaccinia and ectromelia viruses but not against cowpoxvirus; elucidation of the specific adaptive immune response.

PubMed

Paran, Nir; Lustig, Shlomo; Zvi, Anat; Erez, Noam; Israely, Tomer; Melamed, Sharon; Politi, Boaz; Ben-Nathan, David; Schneider, Paula; Lachmi, Batel; Israeli, Ofir; Stein, Dana; Levin, Reuven; Olshevsky, Udy

2013-07-10

Vaccinia virus protein A33 (A33VACV) plays an important role in protection against orthopoxviruses, and hence is included in experimental multi-subunit smallpox vaccines. In this study we show that single-dose vaccination with recombinant Sindbis virus expressing A33VACV, is sufficient to protect mice against lethal challenge with vaccinia virus WR (VACV-WR) and ectromelia virus (ECTV) but not against cowpox virus (CPXV), a closely related orthopoxvirus. Moreover, a subunit vaccine based on the cowpox virus A33 ortholog (A33CPXV) failed to protect against cowpox and only partially protected mice against VACV-WR challenge. We mapped regions of sequence variation between A33VACV and A33CPXVand analyzed the role of such variations in protection. We identified a single protective region located between residues 104-120 that harbors a putative H-2Kd T cell epitope as well as a B cell epitope - a target for the neutralizing antibody MAb-1G10 that blocks spreading of extracellular virions. Both epitopes in A33CPXV are mutated and predicted to be non-functional. Whereas vaccination with A33VACV did not induce in-vivo CTL activity to the predicted epitope, inhibition of virus spread in-vitro, and protection from lethal VACV challenge pointed to the B cell epitope highlighting the critical role of residue L118 and of adjacent compensatory residues in protection. This epitope's critical role in protection, as well as its modifications within the orthopoxvirus genus should be taken in context with the failure of A33 to protect against CPXV as demonstrated here. These findings should be considered when developing new subunit vaccines and monoclonal antibody based therapeutics against orthopoxviruses, especially variola virus, the etiologic agent of smallpox.

Active vaccination with vaccinia virus A33 protects mice against lethal vaccinia and ectromelia viruses but not against cowpoxvirus; elucidation of the specific adaptive immune response

PubMed Central

2013-01-01

Vaccinia virus protein A33 (A33VACV) plays an important role in protection against orthopoxviruses, and hence is included in experimental multi-subunit smallpox vaccines. In this study we show that single-dose vaccination with recombinant Sindbis virus expressing A33VACV, is sufficient to protect mice against lethal challenge with vaccinia virus WR (VACV-WR) and ectromelia virus (ECTV) but not against cowpox virus (CPXV), a closely related orthopoxvirus. Moreover, a subunit vaccine based on the cowpox virus A33 ortholog (A33CPXV) failed to protect against cowpox and only partially protected mice against VACV-WR challenge. We mapped regions of sequence variation between A33VACV and A33CPXVand analyzed the role of such variations in protection. We identified a single protective region located between residues 104–120 that harbors a putative H-2Kd T cell epitope as well as a B cell epitope - a target for the neutralizing antibody MAb-1G10 that blocks spreading of extracellular virions. Both epitopes in A33CPXV are mutated and predicted to be non-functional. Whereas vaccination with A33VACV did not induce in-vivo CTL activity to the predicted epitope, inhibition of virus spread in-vitro, and protection from lethal VACV challenge pointed to the B cell epitope highlighting the critical role of residue L118 and of adjacent compensatory residues in protection. This epitope’s critical role in protection, as well as its modifications within the orthopoxvirus genus should be taken in context with the failure of A33 to protect against CPXV as demonstrated here. These findings should be considered when developing new subunit vaccines and monoclonal antibody based therapeutics against orthopoxviruses, especially variola virus, the etiologic agent of smallpox. PMID:23842430

Antiviral activity of lauryl gallate against animal viruses.

PubMed

Hurtado, Carolina; Bustos, Maria Jose; Sabina, Prado; Nogal, Maria Luisa; Granja, Aitor G; González, Maria Eugenia; Gónzalez-Porqué, Pedro; Revilla, Yolanda; Carrascosa, Angel L

2008-01-01

Antiviral compounds are needed in the control of many animal and human diseases. We analysed the effect of the antitumoural drug lauryl gallate on the infectivity of the African swine fever virus among other DNA (herpes simplex and vaccinia) and RNA (influenza, porcine transmissible gastroenteritis and Sindbis) viruses, paying attention to its effect on the viability of the corresponding host cells. Viral production was strongly inhibited in different cell lines at non-toxic concentrations of the drug (1-10 microM), reducing the titres 3->5 log units depending on the multiplicity of infection. In our model system (African swine fever virus in Vero cells), the addition of the drug 1 h before virus adsorption completely abolished virus productivity in a one-step growth virus cycle. Interestingly, no inhibitory effect was observed when lauryl gallate was added after 5-8 h post-infection. Both cellular and viral DNA synthesis and late viral transcription were inhibited by the drug; however, the early viral protein synthesis and the virus-mediated increase of p53 remained unaffected. Activation of the apoptotic effector caspase-3 was not detected after lauryl gallate treatment of Vero cells. Furthermore, the presence of the drug abrogated the activation of this protease induced by the virus infection. Lauryl gallate is a powerful antiviral agent against several pathogens of clinical and veterinary importance. The overall results indicate that a cellular factor or function might be the target of the antiviral action of alkyl gallates.

Inhibition of host protein synthesis by Sindbis virus: correlation with viral RNA replication and release of nuclear proteins to the cytoplasm.

PubMed

Sanz, Miguel A; García-Moreno, Manuel; Carrasco, Luis

2015-04-01

Infection of mammalian cells by Sindbis virus (SINV) profoundly blocks cellular mRNA translation. Experimental evidence points to viral non-structural proteins (nsPs), in particular nsP2, as the mediator of this inhibition. However, individual expression of nsP1, nsP2, nsP3 or nsP1-4 does not block cellular protein synthesis in BHK cells. Trans-complementation of a defective SINV replicon lacking most of the coding region for nsPs by the co-expression of nsP1-4 propitiates viral RNA replication at low levels, and inhibition of cellular translation is not observed. Exit of nuclear proteins including T-cell intracellular antigen and polypyrimidine tract-binding protein is clearly detected in SINV-infected cells, but not upon the expression of nsPs, even when the defective replicon was complemented. Analysis of a SINV variant with a point mutation in nsP2, exhibiting defects in the shut-off of host protein synthesis, indicates that both viral RNA replication and the release of nuclear proteins to the cytoplasm are greatly inhibited. Furthermore, nucleoside analogues that inhibit cellular and viral RNA synthesis impede the blockade of host mRNA translation, in addition to the release of nuclear proteins. Prevention of the shut-off of host mRNA translation by nucleoside analogues is not due to the inhibition of eIF2α phosphorylation, as this prevention is also observed in PKR(-/-) mouse embryonic fibroblasts that do not phosphorylate eIF2α after SINV infection. Collectively, our observations are consistent with the concept that for the inhibition of cellular protein synthesis to occur, viral RNA replication must take place at control levels, leading to the release of nuclear proteins to the cytoplasm. © 2014 John Wiley & Sons Ltd.

Emerging role of lipid droplets in Aedes aegypti immune response against bacteria and Dengue virus

PubMed Central

Barletta, Ana Beatriz Ferreira; Alves, Liliane Rosa; Nascimento Silva, Maria Clara L.; Sim, Shuzhen; Dimopoulos, George; Liechocki, Sally; Maya-Monteiro, Clarissa M.; Sorgine, Marcos H. Ferreira

2016-01-01

In mammals, lipid droplets (LDs) are ubiquitous organelles that modulate immune and inflammatory responses through the production of lipid mediators. In insects, it is unknown whether LDs play any role during the development of immune responses. We show that Aedes aegypti Aag2 cells – an immune responsive cell lineage – accumulates LDs when challenged with Enterobacter cloacae, Sindbis, and Dengue viruses. Microarray analysis of Aag2 challenged with E.cloacae or infected with Dengue virus revealed high transcripts levels of genes associated with lipid storage and LDs biogenesis, correlating with the increased LDs numbers in those conditions. Similarly, in mosquitoes, LDs accumulate in midgut cells in response to Serratia marcescens and Sindbis virus or when the native microbiota proliferates, following a blood meal. Also, constitutive activation of Toll and IMD pathways by knocking-down their respective negative modulators (Cactus and Caspar) increases LDs numbers in the midgut. Our results show for the first time an infection-induced LDs accumulation in response to both bacterial and viral infections in Ae. Aegypti, and we propose a role for LDs in mosquito immunity. These findings open new venues for further studies in insect immune responses associated with lipid metabolism. PMID:26887863

Serological Evidence of Dengue Fever Among Refugees, Hargeysa, Somalia

DTIC Science & Technology

1989-01-01

fever, Sindbis, Chikungunya, yellow HISTORY OF THE DISEASE IN THE fever, and Zika viruses . However, antibody reac- DAM CAMP tive to dengue 2 virus was...fever, Crimean-Congo hemorrhagic fever, Sindbis, Chikungunya, yellow fever, and Zika viruses . However, antibody reactive to dengue 2 virus was detected... ZIKA ) viruses . Further testing of sera for evidence of dengue S Barbera S , MOGAISCIO . viral infection was done by the enzyme immunoassay " (EIA

Molecular Studies of Alphavirus Immunogenicity

DTIC Science & Technology

1992-12-03

RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

Dephosphorylation of HuR Protein during Alphavirus Infection Is Associated with HuR Relocalization to the Cytoplasm*

PubMed Central

Dickson, Alexa M.; Anderson, John R.; Barnhart, Michael D.; Sokoloski, Kevin J.; Oko, Lauren; Opyrchal, Mateusz; Galanis, Evanthia; Wilusz, Carol J.; Morrison, Thomas E.; Wilusz, Jeffrey

2012-01-01

We have demonstrated previously that the cellular HuR protein binds U-rich elements in the 3′ untranslated region (UTR) of Sindbis virus RNA and relocalizes from the nucleus to the cytoplasm upon Sindbis virus infection in 293T cells. In this study, we show that two alphaviruses, Ross River virus and Chikungunya virus, lack the conserved high-affinity U-rich HuR binding element in their 3′ UTRs but still maintain the ability to interact with HuR with nanomolar affinities through alternative binding elements. The relocalization of HuR protein occurs during Sindbis infection of multiple mammalian cell types as well as during infections with three other alphaviruses. Interestingly, the relocalization of HuR is not a general cellular reaction to viral infection, as HuR protein remained largely nuclear during infections with dengue and measles virus. Relocalization of HuR in a Sindbis infection required viral gene expression, was independent of the presence of a high-affinity U-rich HuR binding site in the 3′ UTR of the virus, and was associated with an alteration in the phosphorylation state of HuR. Sindbis virus-induced HuR relocalization was mechanistically distinct from the movement of HuR observed during a cellular stress response, as there was no accumulation of caspase-mediated HuR cleavage products. Collectively, these data indicate that virus-induced HuR relocalization to the cytoplasm is specific to alphavirus infections and is associated with distinct posttranslational modifications of this RNA-binding protein. PMID:22915590

A Model of Superinfection of Virus-Infected Zebrafish Larvae: Increased Susceptibility to Bacteria Associated With Neutrophil Death

PubMed Central

Boucontet, Laurent; Passoni, Gabriella; Thiry, Valéry; Maggi, Ludovico; Herbomel, Philippe; Levraud, Jean-Pierre; Colucci-Guyon, Emma

2018-01-01

Enhanced susceptibility to bacterial infection in the days following an acute virus infection such as flu is a major clinical problem. Mouse models have provided major advances in understanding viral-bacterial superinfections, yet interactions of the anti-viral and anti-bacterial responses remain elusive. Here, we have exploited the transparency of zebrafish to study how viral infections can pave the way for bacterial co-infections. We have set up a zebrafish model of sequential viral and bacterial infection, using sublethal doses of Sindbis virus and Shigella flexneri bacteria. This virus induces a strong type I interferons (IFN) response, while the bacterium induces a strong IL1β and TNFα-mediated inflammatory response. We found that virus-infected zebrafish larvae showed an increased susceptibility to bacterial infection. This resulted in the death with concomitant higher bacterial burden of the co-infected fish compared to the ones infected with bacteria only. By contrast, infecting with bacteria first and virus second did not lead to increased mortality or microbial burden. By high-resolution live imaging, we showed that neutrophil survival was impaired in Sindbis-then-Shigella co-infected fish. The two types of cytokine responses were strongly induced in co-infected fish. In addition to type I IFN, expression of the anti-inflammatory cytokine IL10 was induced by viral infection before bacterial superinfection. Collectively, these observations suggest the zebrafish larva as a useful animal model to address mechanisms underlying increased bacterial susceptibility upon viral infection. PMID:29881380

Epitope-based peptide vaccine design and target site depiction against Ebola viruses: an immunoinformatics study.

PubMed

Khan, M A; Hossain, M U; Rakib-Uz-Zaman, S M; Morshed, M N

2015-07-01

Ebola viruses (EBOVs) have been identified as an emerging threat in recent year as it causes severe haemorrhagic fever in human. Epitope-based vaccine design for EBOVs remains a top priority because a mere progress has been made in this regard. Another reason is the lack of antiviral drug and licensed vaccine although there is a severe outbreak in Central Africa. In this study, we aimed to design an epitope-based vaccine that can trigger a significant immune response as well as to prognosticate inhibitor that can bind with potential drug target sites using various immunoinformatics and docking simulation tools. The capacity to induce both humoral and cell-mediated immunity by T cell and B cell was checked for the selected protein. The peptide region spanning 9 amino acids from 42 to 50 and the sequence TLASIGTAF were found as the most potential B and T cell epitopes, respectively. This peptide could interact with 12 HLAs and showed high population coverage up to 80.99%. Using molecular docking, the epitope was further appraised for binding against HLA molecules to verify the binding cleft interaction. In addition with this, the allergenicity of the epitopes was also evaluated. In the post-therapeutic strategy, docking study of predicted 3D structure identified suitable therapeutic inhibitor against targeted protein. However, this computational epitope-based peptide vaccine designing and target site prediction against EBOVs open up a new horizon which may be the prospective way in Ebola viruses research; the results require validation by in vitro and in vivo experiments. © 2015 John Wiley & Sons Ltd.

Venezuelan equine encephalitis virus entry mechanism requires late endosome formation and resists cell membrane cholesterol depletion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolokoltsov, Andrey A.; Fleming, Elisa H.; Davey, Robert A.

2006-04-10

Virus envelope proteins determine receptor utilization and host range. The choice of receptor not only permits specific targeting of cells that express it, but also directs the virus into specific endosomal trafficking pathways. Disrupting trafficking can result in loss of virus infectivity due to redirection of virions to non-productive pathways. Identification of the pathway or pathways used by a virus is, thus, important in understanding virus pathogenesis mechanisms and for developing new treatment strategies. Most of our understanding of alphavirus entry has focused on the Old World alphaviruses, such as Sindbis and Semliki Forest virus. In comparison, very little ismore » known about the entry route taken by more pathogenic New World alphaviruses. Here, we use a novel contents mixing assay to identify the cellular requirements for entry of a New World alphavirus, Venezuelan equine encephalitis virus (VEEV). Expression of dominant negative forms of key endosomal trafficking genes shows that VEEV must access clathrin-dependent endocytic vesicles for membrane fusion to occur. Unexpectedly, the exit point is different from Old World alphaviruses that leave from early endosomes. Instead, VEEV also requires functional late endosomes. Furthermore, unlike the Old World viruses, VEEV entry is insensitive to cholesterol sequestration from cell membranes and may reflect a need to access an endocytic compartment that lacks cholesterol. This indicates fundamental differences in the entry route taken by VEEV compared to Old World alphaviruses.« less

DARPin-targeting of Measles Virus: Unique Bispecificity, Effective Oncolysis, and Enhanced Safety

PubMed Central

Friedrich, Katrin; Hanauer, Jan RH; Prüfer, Steffen; Münch, Robert C; Völker, Iris; Filippis, Christodoulos; Jost, Christian; Hanschmann, Kay-Martin; Cattaneo, Roberto; Peng, Kah-Whye; Plückthun, Andreas; Buchholz, Christian J; Cichutek, Klaus; Mühlebach, Michael D

2013-01-01

Oncolytic virotherapy is an emerging treatment modality that uses replication-competent viruses to destroy cancers. Many naturally occurring viruses have a preferential, although nonexclusive, tropism for tumors and tumor cells. In addition, specific targeting of cancer cells can be achieved at the virus entry level. We optimized retargeting of cell entry by elongating the measles virus attachment protein with designed ankyrin repeat proteins (DARPins), while simultaneously ablating entry through the natural receptors. DARPin-targeted viruses were strongly attenuated in off-target tissue, thereby enhancing safety, but completely eliminated tumor xenografts. Taking advantage of the unique properties of DARPins of being fused without generating folding problems, we generated a virus simultaneous targeting two different tumor markers. The bispecific virus retained the original oncolytic efficacy, while providing proof of concept for a strategy to counteract issues of resistance development. Thus, DARPin-targeting opens new prospects for the development of personalized, targeted therapeutics. PMID:23380817

Structure-Based Drug Design Targeting a Subunit Interaction of Influenza Virus RNA Polymerase

NASA Astrophysics Data System (ADS)

Sugiyama, Kanako; Obayashi, Eiji; Yoshida, Hisashi; Park, Sam-Yong

Influenza A virus is a major human and animal pathogen with the potential to cause catastrophic loss of life. Influenza virus reproduces rapidly, mutates frequently, and occasionally crosses species barriers. The recent emergence of swine-origin influenza H1N1 and avian influenza related to highly pathogenic forms of the human virus has highlighted the urgent need for new effective treatments. Here, we describe two crystal structures of complexes made by fragments of PA and PB1, and PB1 and PB2. These novel interfaces are surprisingly small, yet they play a crucial role in regulating the 250 kDa polymerase complex, and are completely conserved among swine, avian and human influenza viruses. Given their importance to viral replication and strict conservation, the PA/PB1 and PB1/PB2 interfaces appear to be promising targets for novel anti-influenza drugs of use against all strains of influenza A virus. It is hoped that the structures presented here will assist the search for such compounds.

Recognition of dual targets by a molecular beacon-based sensor: subtyping of influenza A virus.

PubMed

Lee, Chun-Ching; Liao, Yu-Chieh; Lai, Yu-Hsuan; Lee, Chang-Chun David; Chuang, Min-Chieh

2015-01-01

A molecular beacon (MB)-based sensor to offer a decisive answer in combination with information originated from dual-target inputs is designed. The system harnesses an assistant strand and thermodynamically favored designation of unpaired nucleotides (UNs) to process the binary targets in "AND-gate" format and report fluorescence in "off-on" mechanism via a formation of a DNA four-way junction (4WJ). By manipulating composition of the UNs, the dynamic fluorescence difference between the binary targets-coexisting circumstance and any other scenario was maximized. Characteristic equilibrium constant (K), change of entropy (ΔS), and association rate constant (k) between the association ("on") and dissociation ("off") states of the 4WJ were evaluated to understand unfolding behavior of MB in connection to its sensing capability. Favorable MB and UNs were furthermore designed toward analysis of genuine genetic sequences of hemagglutinin (HA) and neuraminidase (NA) in an influenza A H5N2 isolate. The MB-based sensor was demonstrated to yield a linear calibration range from 1.2 to 240 nM and detection limit of 120 pM. Furthermore, high-fidelity subtyping of influenza virus was implemented in a sample of unpurified amplicons. The strategy opens an alternative avenue of MB-based sensors for dual targets toward applications in clinical diagnosis.

Target virus log10 reduction values determined for two reclaimed wastewater irrigation scenarios in Japan based on tolerable annual disease burden.

PubMed

Ito, Toshihiro; Kitajima, Masaaki; Kato, Tsuyoshi; Ishii, Satoshi; Segawa, Takahiro; Okabe, Satoshi; Sano, Daisuke

2017-11-15

Multiple-barriers are widely employed for managing microbial risks in water reuse, in which different types of wastewater treatment units (biological treatment, disinfection, etc.) and health protection measures (use of personal protective gear, vegetable washing, etc.) are combined to achieve a performance target value of log 10 reduction (LR) of viruses. The LR virus target value needs to be calculated based on the data obtained from monitoring the viruses of concern and the water reuse scheme in the context of the countries/regions where water reuse is implemented. In this study, we calculated the virus LR target values under two exposure scenarios for reclaimed wastewater irrigation in Japan, using the concentrations of indigenous viruses in untreated wastewater and a defined tolerable annual disease burden (10 -4 or 10 -6 disability-adjusted life years per person per year (DALY pppy )). Three genogroups of norovirus (norovirus genogroup I (NoV GI), geogroup II (NoV GII), and genogroup IV (NoV GIV)) in untreated wastewater were quantified as model viruses using reverse transcription-microfluidic quantitative PCR, and only NoV GII was present in quantifiable concentration. The probabilistic distribution of NoV GII concentration in untreated wastewater was then estimated from its concentration dataset, and used to calculate the LR target values of NoV GII for wastewater treatment. When an accidental ingestion of reclaimed wastewater by Japanese farmers was assumed, the NoV GII LR target values corresponding to the tolerable annual disease burden of 10 -6 DALY pppy were 3.2, 4.4, and 5.7 at 95, 99, and 99.9%tile, respectively. These percentile values, defined as "reliability," represent the cumulative probability of NoV GII concentration distribution in untreated wastewater below the corresponding tolerable annual disease burden after wastewater reclamation. An approximate 1-log 10 difference of LR target values was observed between 10 -4 and 10 -6 DALY pppy

Generation and characterization of monoclonal antibodies against Rift Valley fever virus nucleoprotein.

PubMed

Fafetine, J M; Domingos, A; Antunes, S; Esteves, A; Paweska, J T; Coetzer, J A W; Rutten, V P M G; Neves, L

2013-11-01

Due to the unpredictable and explosive nature of Rift Valley fever (RVF) outbreaks, rapid and accurate diagnostic assays for low-resource settings are urgently needed. To improve existing diagnostic assays, monoclonal antibodies (MAbs) specific for the nucleocapsid protein of RVF virus (RVFV) were produced and characterized. Four IgG2a MAbs showed specific binding to denatured nucleocapsid protein, both from a recombinant source and from inactivated RVFV, in Western blot analysis and in an enzyme-linked immunosorbent assay (ELISA). Cross-reactivity with genetically related and non-related arboviruses including Bunyamwera and Calovo viruses (Bunyaviridae family), West Nile and Dengue-2 viruses (Flaviviridae family), and Sindbis and Chikungunya viruses (Togaviridae family) was not detected. These MAbs represent a useful tool for the development of rapid diagnostic assays for early recognition of RVF. © 2013 Blackwell Verlag GmbH.

Discovery of host-targeted covalent inhibitors of dengue virus

PubMed Central

de Wispelaere, Mélissanne; Carocci, Margot; Liang, Yanke; Liu, Qingsong; Sun, Eileen; Vetter, Michael L.; Wang, Jinhua; Gray, Nathanael S.; Yang, Priscilla L.

2017-01-01

We report here on an approach targeting the host reactive cysteinome to identify inhibitors of host factors required for the infectious cycle of Flaviviruses and other viruses. We used two parallel cellular phenotypic screens to identify a series of covalent inhibitors, exemplified by QL-XII-47, that are active against dengue virus. We show that the compounds effectively block viral protein expression and that this inhibition is associated with repression of downstream processes of the infectious cycle, and thus significantly contributes to the potent antiviral activity of these compounds. We demonstrate that QL-XII-47’s antiviral activity requires selective, covalent modification of a host target by showing that the compound's antiviral activity is recapitulated when cells are preincubated with QL-XII-47 and then washed prior to viral infection and by showing that QL-XII-47R, a non-reactive analog, lacks antiviral activity at concentrations more than 20-fold higher than QL-XII-47's IC90. QL-XII-47’s inhibition of Zika virus, West Nile virus, hepatitis C virus, and poliovirus further suggests that it acts via a target mediating inhibition of these other medically relevant viruses. These results demonstrate the utility of screens targeting the host reactive cysteinome for rapid identification of compounds with potent antiviral activity. PMID:28034743

Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

USDA-ARS?s Scientific Manuscript database

An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

Identification of small molecule inhibitors of the Chikungunya virus nsP1 RNA capping enzyme.

PubMed

Feibelman, Kristen M; Fuller, Benjamin P; Li, Linfeng; LaBarbera, Daniel V; Geiss, Brian J

2018-06-01

Chikungunya virus (CHIKV) is an arthropod-borne alphavirus. Alphaviruses are positive strand RNA viruses that require a 5' cap structure to direct translation of the viral polyprotein and prevent degradation of the viral RNA genome by host cell nucleases. Formation of the 5' RNA cap is orchestrated by the viral protein nsP1, which binds GTP and provides the N-7 methyltransferase and guanylyltransferase activities that are necessary for cap formation. Viruses with aberrant nsP1 activity are unable to replicate effectively suggesting that nsP1 is a promising target for antiviral drug discovery. Given the absence of commercially available antiviral therapies for CHIKV, it is imperative to identify compounds that could be developed as potential therapeutics. This study details a high-throughput screen of 3051 compounds from libraries containing FDA-approved drugs, natural products, and known bioactives against CHIKV nsP1 using a fluorescence polarization-based GTP competition assay. Several small molecule hits from this screen were able to compete with GTP for the CHIKV nsP1 GTP binding site at low molar concentrations. Compounds were also evaluated with an orthogonal assay that measured the ability of nsP1 to perform the guanylation step of the capping reaction in the presence of inhibitor. In addition, live virus assays with CHIKV and closely related alphavirus, Sindbis virus, were used in conjunction with cell toxicity assays to determine the antiviral activity of compounds in cell culture. The naturally derived compound lobaric acid was found to inhibit CHIKV nsP1 GTP binding and guanylation as well as attenuate viral growth in vitro at both 24 hpi and 48 hpi in hamster BHK21 and human Huh 7 cell lines. These data indicate that development of lobaric acid and further exploration of CHIKV nsP1 as a drug target may aid in the progress of anti-alphaviral drug development strategies. Copyright © 2018. Published by Elsevier B.V.

Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters

PubMed Central

Baseler, Laura; Scott, Dana P.; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz

2016-01-01

Background Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M) or Bangladesh (NiV-B). Methodology/Principal Findings Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi). Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi. Conclusions/Significance Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central

Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

PubMed

Baseler, Laura; Scott, Dana P; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

2016-11-01

Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M) or Bangladesh (NiV-B). Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi). Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi. Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jamieson,K.; Wu, J.; Hubbard, S.

The human laminin receptor (LamR) interacts with many ligands, including laminin, prions, Sindbis virus, and the polyphenol (-)-epigallocatechin-3-gallate (EGCG), and has been implicated in a number of diseases. LamR is overexpressed on tumor cells, and targeting LamR elicits anti-cancer effects. Here, we report the crystal structure of human LamR, which provides insights into its function and should facilitate the design of novel therapeutics targeting LamR.

Antiviral activity of lanatoside C against dengue virus infection.

PubMed

Cheung, Yan Yi; Chen, Karen Caiyun; Chen, Huixin; Seng, Eng Khuan; Chu, Justin Jang Hann

2014-11-01

Dengue infection poses a serious threat globally due to its recent rapid spread and rise in incidence. Currently, there is no approved vaccine or effective antiviral drug for dengue virus infection. In response to the urgent need for the development of an effective antiviral for dengue virus, the US Drug Collection library was screened in this study to identify compounds with anti-dengue activities. Lanatoside C, an FDA approved cardiac glycoside was identified as a candidate anti-dengue compound. Our data revealed that lanatoside C has an IC50 of 0.19μM for dengue virus infection in HuH-7 cells. Dose-dependent reduction in dengue viral RNA and viral proteins synthesis were also observed upon treatment with increasing concentrations of lanatoside C. Time of addition study indicated that lanatoside C inhibits the early processes of the dengue virus replication cycle. Furthermore, lanatoside C can effectively inhibit all four serotypes of dengue virus, flavivirus Kunjin, alphavirus Chikungunya and Sindbis virus as well as the human enterovirus 71. These findings suggest that lanatoside C possesses broad spectrum antiviral activity against several groups of positive-sense RNA viruses. Copyright © 2014 Elsevier B.V. All rights reserved.

Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

PubMed Central

van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

2014-01-01

The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus

PubMed Central

Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

2015-01-01

The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function. PMID:25333630

Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus.

PubMed

Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

2015-09-01

The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function.

Development of novel entry inhibitors targeting emerging viruses

PubMed Central

Zhou, Yanchen; Simmons, Graham

2013-01-01

Emerging viral diseases pose a unique risk to public health, and thus there is a need to develop therapies. A current focus of funding agencies, and hence research, is the development of broad-spectrum antivirals, and in particular, those targeting common cellular pathways. The scope of this article is to review screening strategies and recent advances in this area, with a particular emphasis on antivirals targeting the step of viral entry for emerging lipid-enveloped viruses such as Ebola virus and SARS-coronavirus. PMID:23199399

In Vitro Assembly of Alphavirus Cores by Using Nucleocapsid Protein Expressed in Escherichia coli

PubMed Central

Tellinghuisen, Timothy L.; Hamburger, Agnes E.; Fisher, Bonnie R.; Ostendorp, Ralf; Kuhn, Richard J.

1999-01-01

The production of the alphavirus virion is a multistep event requiring the assembly of the nucleocapsid core in the cytoplasm and the maturation of the glycoproteins in the endoplasmic reticulum and the Golgi apparatus. These components associate during the budding process to produce the mature virion. The nucleocapsid proteins of Sindbis virus and Ross River virus have been produced in a T7-based Escherichia coli expression system and purified. In the presence of single-stranded but not double-stranded nucleic acid, the proteins oligomerize in vitro into core-like particles which resemble the native viral nucleocapsid cores. Despite their similarities, Sindbis virus and Ross River virus capsid proteins do not form mixed core-like particles. Truncated forms of the Sindbis capsid protein were used to establish amino acid requirements for assembly. A capsid protein starting at residue 19 [CP(19–264)] was fully competent for in vitro assembly, whereas proteins with further N-terminal truncations could not support assembly. However, a capsid protein starting at residue 32 or 81 was able to incorporate into particles in the presence of CP(19–264) or could inhibit assembly if its molar ratio relative to CP(19–264) was greater than 1:1. This system provides a basis for the molecular dissection of alphavirus core assembly. PMID:10364277

The influenza virus NS1 protein as a therapeutic target.

PubMed

Engel, Daniel A

2013-09-01

Nonstructural protein 1 (NS1) of influenza A virus plays a central role in virus replication and blockade of the host innate immune response, and is therefore being considered as a potential therapeutic target. The primary function of NS1 is to dampen the host interferon (IFN) response through several distinct molecular mechanisms that are triggered by interactions with dsRNA or specific cellular proteins. Sequestration of dsRNA by NS1 results in inhibition of the 2'-5' oligoadenylate synthetase/RNase L antiviral pathway, and also inhibition of dsRNA-dependent signaling required for new IFN production. Binding of NS1 to the E3 ubiquitin ligase TRIM25 prevents activation of RIG-I signaling and subsequent IFN induction. Cellular RNA processing is also targeted by NS1, through recognition of cleavage and polyadenylation specificity factor 30 (CPSF30), leading to inhibition of IFN-β mRNA processing as well as that of other cellular mRNAs. In addition NS1 binds to and inhibits cellular protein kinase R (PKR), thus blocking an important arm of the IFN system. Many additional proteins have been reported to interact with NS1, either directly or indirectly, which may serve its anti-IFN and additional functions, including the regulation of viral and host gene expression, signaling pathways and viral pathogenesis. Many of these interactions are potential targets for small-molecule intervention. Structural, biochemical and functional studies have resulted in hypotheses for drug discovery approaches that are beginning to bear experimental fruit, such as targeting the dsRNA-NS1 interaction, which could lead to restoration of innate immune function and inhibition of virus replication. This review describes biochemical, cell-based and nucleic acid-based approaches to identifying NS1 antagonists. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

The influenza virus NS1 protein as a therapeutic target

PubMed Central

Engel, Daniel A.

2015-01-01

Nonstructural protein 1 (NS1) of influenza A virus plays a central role in virus replication and blockade of the host innate immune response, and is therefore being considered as a potential therapeutic target. The primary function of NS1 is to dampen the host interferon (IFN) response through several distinct molecular mechanisms that are triggered by interactions with dsRNA or specific cellular proteins. Sequestration of dsRNA by NS1 results in inhibition of the 2’-5’ oligoadenylate synthetase/RNase L antiviral pathway, and also inhibition of dsRNA-dependent signaling required for new IFN production. Binding of NS1 to the E3 ubiquitin ligase TRIM25 prevents activation of RIG-I signaling and subsequent IFN induction. Cellular RNA processing is also targeted by NS1, through recognition of cleavage and polyadenylation specificity factor 30 (CPSF30), leading to inhibition of IFN- mRNA processing as well as that of other cellular mRNAs. In addition NS1 binds to and inhibits cellular protein kinase R (PKR), thus blocking an important arm of the IFN system. Many additional proteins have been reported to interact with NS1, either directly or indirectly, which may serve its anti-IFN and additional functions, including the regulation of viral and host gene expression, signaling pathways and viral pathogenesis. Many of these interactions are potential targets for small-molecule intervention. Structural, biochemical and functional studies have resulted in hypotheses for drug discovery approaches that are beginning to bear experimental fruit, such as targeting the dsRNA-NS1 interaction, which could lead to restoration of innate immune function and inhibition of virus replication. This review describes biochemical, cell-based and nucleic acid-based approaches to identifying NS1 antagonists. PMID:23796981

Human Parainfluenza Virus-3 can be Targeted by Rapidly ex vivo Expanded T-Lymphocytes

PubMed Central

McLaughlin, Lauren P.; Lang, Haili; Williams, Elizabeth; Wright, Kaylor E.; Powell, Allison; Cruz, Conrad R; Colberg-Poley, Anamaris M.; Barese, Cecilia; Hanley, Patrick J.; Bollard, Catherine M.; Keller, Michael D.

2016-01-01

Background Human Parainfluenza virus-3 (HPIV) is a common cause of respiratory infection in immunocompromised patients, and presently has no effective therapies. Virus-specific T-cell therapy has been successful for the treatment or prevention of viral infections in immunocompromised patients, but requires determination of T-cell antigens on targeted viruses. Methods HPIV3-specific T cells were expanded from peripheral blood of healthy donors using a rapid generation protocol targeting four HPIV3 proteins. Immunophenotyping was performed by flow cytometry. Viral specificity was determined by IFN-γ ELISpot, intracellular cytokine staining, and cytokine measurements from culture supernatants by Luminex assay. Cytotoxic activity was tested by 51Cr release and CD107a mobilization assays. Virus-specific T-cells targeting 6 viruses were then produced by rapid protocol, and the phenotype of HPIV3-specific T-cells was determined by immunomagnetic sorting for IFN-γ producing cells. Results HPIV3-specific T cells were expanded from 13 healthy donors. HPIV3-specific T-cells showed a CD4+ predominance (mean CD4:CD8 ratio 2.89), and demonstrated specificity for multiple HPIV3 antigens. The expanded T-cells were polyfunctional based on cytokine production, but only had a minor cytotoxic component. T cells targeting six viruses in a single product similarly showed HPIV3 specificity, with a predominant effector memory phenotype (CD3+/CD45RA-/CCR7-) in responder cells. Discussion HPIV3-specific T cells can be produced using a rapid ex vivo protocol from healthy donors and are predominantly CD4+ T-cells with Th1 activity. HPIV3 epitopes can also be successfully targeted alongside multiple other viral epitopes in production of 6-virus T-cells, without loss of HPIV3 specificity. These products may be clinically beneficial to combat HPIV3 infections by adoptive T-cell therapy in immune compromised patients. PMID:27692559

Targeting Dengue Virus NS-3 Helicase by Ligand based Pharmacophore Modeling and Structure based Virtual Screening

NASA Astrophysics Data System (ADS)

Halim, Sobia A.; Khan, Shanza; Khan, Ajmal; Wadood, Abdul; Mabood, Fazal; Hussain, Javid; Al-Harrasi, Ahmed

2017-10-01

Dengue fever is an emerging public health concern, with several million viral infections occur annually, for which no effective therapy currently exist. Non-structural protein 3 (NS-3) Helicase encoded by the dengue virus (DENV) is considered as a potential drug target to design new and effective drugs against dengue. Helicase is involved in unwinding of dengue RNA. This study was conducted to design new NS-3 Helicase inhibitor by in silico ligand- and structure based approaches. Initially ligand-based pharmacophore model was generated that was used to screen a set of 1201474 compounds collected from ZINC Database. The compounds matched with the pharmacophore model were docked into the active site of NS-3 helicase. Based on docking scores and binding interactions, twenty five compounds are suggested to be potential inhibitors of NS3 Helicase. The pharmacokinetic properties of these hits were predicted. The selected hits revealed acceptable ADMET properties. This study identified potential inhibitors of NS-3 Helicase in silico, and can be helpful in the treatment of Dengue.

Specific elimination of CD133+ tumor cells with targeted oncolytic measles virus.

PubMed

Bach, Patricia; Abel, Tobias; Hoffmann, Christopher; Gal, Zoltan; Braun, Gundula; Voelker, Iris; Ball, Claudia R; Johnston, Ian C D; Lauer, Ulrich M; Herold-Mende, Christel; Mühlebach, Michael D; Glimm, Hanno; Buchholz, Christian J

2013-01-15

Tumor-initiating cells (TIC) are critical yet evasive targets for the development of more effective antitumoral strategies. The cell surface marker CD133 is frequently used to identify TICs of various tumor entities, including hepatocellular cancer and glioblastoma. Here, we describe oncolytic measles viruses (MV) retargeted to CD133. The viruses, termed MV-141.7 and MV-AC133, infected and selectively lysed CD133(+) tumor cells. Both viruses exerted strong antitumoral effects on human hepatocellular carcinoma growing subcutaneously or multifocally in the peritoneal cavity of nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice. Notably, the CD133-targeted viruses were more effective in prolonging survival than the parental MV-NSe, which is currently assessed as oncolytic agent in clinical trials. Interestingly, target receptor overexpression or increased spreading kinetics through tumor cells were excluded as being causative for the enhanced oncolytic activity of CD133-targeted viruses. MV-141.7 was also effective in mouse models of orthotopic glioma tumor spheres and primary colon cancer. Our results indicate that CD133-targeted measles viruses selectively eliminate CD133(+) cells from tumor tissue, offering a key tool for research in tumor biology and cancer therapy.

Targeting RNA–Protein Interactions within the Human Immunodeficiency Virus Type 1 Lifecycle

PubMed Central

2013-01-01

RNA–protein interactions are vital throughout the HIV-1 life cycle for the successful production of infectious virus particles. One such essential RNA–protein interaction occurs between the full-length genomic viral RNA and the major structural protein of the virus. The initial interaction is between the Gag polyprotein and the viral RNA packaging signal (psi or Ψ), a highly conserved RNA structural element within the 5′-UTR of the HIV-1 genome, which has gained attention as a potential therapeutic target. Here, we report the application of a target-based assay to identify small molecules, which modulate the interaction between Gag and Ψ. We then demonstrate that one such molecule exhibits potent inhibitory activity in a viral replication assay. The mode of binding of the lead molecules to the RNA target was characterized by 1H NMR spectroscopy. PMID:24358934

The efficient packaging of Venezuelan equine encephalitis virus-specific RNAs into viral particles is determined by nsP1–3 synthesis

PubMed Central

Volkova, Eugenia; Gorchakov, Rodion; Frolov, Ilya

2008-01-01

Alphaviruses are regarded as attractive systems for expression of heterologous genes and development of recombinant vaccines. Venezuelan equine encephalitis virus (VEE)-based vectors are particularly promising because of their specificity to lymphoid tissues and strong resistance to interferon. To improve understanding of the VEE genome packaging and optimize application of this virus as a vector, we analyzed in more detail the mechanism of packaging of the VEE-specific RNAs. The presence of the RNAs in the VEE particles during serial passaging in tissue culture was found to depend not only on the presence of packaging signal(s), but also on the ability of these RNAs to express in cis nsP1, nsP2 and nsP3 in the form of a P123 precursor. Packaging of VEE genomes into infectious virions was also found to be more efficient compared to that of Sindbis virus, in spite of lower levels of RNA replication and structural protein production. PMID:16239019

Two White Spot Syndrome Virus MicroRNAs Target the Dorsal Gene To Promote Virus Infection in Marsupenaeus japonicus Shrimp

PubMed Central

Ren, Qian; Huang, Xin; Cui, Yalei; Sun, Jiejie; Wang, Wen

2017-01-01

ABSTRACT In eukaryotes, microRNAs (miRNAs) serve as regulators of many biological processes, including virus infection. An miRNA can generally target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs has not yet been extensively explored during virus infection. This study found that the Spaztle (Spz)-Toll-Dorsal-antilipopolysaccharide factor (ALF) signaling pathway plays a very important role in antiviral immunity against invasion of white spot syndrome virus (WSSV) in shrimp (Marsupenaeus japonicus). Dorsal, the central gene in the Toll pathway, was targeted by two viral miRNAs (WSSV-miR-N13 and WSSV-miR-N23) during WSSV infection. The regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo, leading to virus infection. Our study contributes novel insights into the viral miRNA-mediated Toll signaling pathway during the virus-host interaction. IMPORTANCE An miRNA can target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs during virus infection has not yet been extensively explored. The results of this study indicated that the shrimp Dorsal gene, the central gene in the Toll pathway, was targeted by two viral miRNAs during infection with white spot syndrome virus. Regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo, leading to virus infection. Our study provides new insight into the viral miRNA-mediated Toll signaling pathway in virus-host interactions. PMID:28179524

Glutamine antagonist-mediated immune suppression decreases pathology but delays virus clearance in mice during nonfatal alphavirus encephalomyelitis.

PubMed

Baxter, Victoria K; Glowinski, Rebecca; Braxton, Alicia M; Potter, Michelle C; Slusher, Barbara S; Griffin, Diane E

2017-08-01

Infection of weanling C57BL/6 mice with the TE strain of Sindbis virus (SINV) causes nonfatal encephalomyelitis associated with hippocampal-based memory impairment that is partially prevented by treatment with 6-diazo-5-oxo-l-norleucine (DON), a glutamine antagonist (Potter et al., J Neurovirol 21:159, 2015). To determine the mechanism(s) of protection, lymph node and central nervous system (CNS) tissues from SINV-infected mice treated daily for 1 week with low (0.3mg/kg) or high (0.6mg/kg) dose DON were examined. DON treatment suppressed lymphocyte proliferation in cervical lymph nodes resulting in reduced CNS immune cell infiltration, inflammation, and cell death compared to untreated SINV-infected mice. Production of SINV-specific antibody and interferon-gamma were also impaired by DON treatment with a delay in virus clearance. Cessation of treatment allowed activation of the antiviral immune response and viral clearance, but revived CNS pathology, demonstrating the ability of the immune response to mediate both CNS damage and virus clearance. Copyright © 2017 Elsevier Inc. All rights reserved.

Enhanced lysis by bispecific oncolytic measles viruses simultaneously using HER2/neu or EpCAM as target receptors

PubMed Central

Hanauer, Jan RH; Gottschlich, Lisa; Riehl, Dennis; Rusch, Tillmann; Koch, Vivian; Friedrich, Katrin; Hutzler, Stefan; Prüfer, Steffen; Friedel, Thorsten; Hanschmann, Kay-Martin; Münch, Robert C; Jost, Christian; Plückthun, Andreas; Cichutek, Klaus; Buchholz, Christian J; Mühlebach, Michael D

2016-01-01

To target oncolytic measles viruses (MV) to tumors, we exploit the binding specificity of designed ankyrin repeat proteins (DARPins). These DARPin-MVs have high tumor selectivity while maintaining excellent oncolytic potency. Stability, small size, and efficacy of DARPins allowed the generation of MVs simultaneously targeted to tumor marker HER2/neu and cancer stem cell (CSC) marker EpCAM. For optimization, the linker connecting both DARPins was varied in flexibility and length. Flexibility had no impact on fusion helper activity whereas length had. MVs with bispecific MV-H are genetically stable and revealed the desired double-target specificity. In vitro, the cytolytic activity of bispecific MVs was superior or comparable to mono-targeted viruses depending on the target cells. In vivo, therapeutic efficacy of the bispecific viruses was validated in an orthotopic ovarian carcinoma model revealing an effective reduction of tumor mass. Finally, the power of bispecific targeting was demonstrated on cocultures of different tumor cells thereby mimicking tumor heterogeneity in vitro, more closely reflecting real tumors. Here, bispecific excelled monospecific viruses in efficacy. DARPin-based targeting domains thus allow the generation of efficacious oncolytic viruses with double specificity, with the potential to handle intratumoral variation of antigen expression and to simultaneously target CSCs and the bulk tumor mass. PMID:27119117

NF-κB as a target for oncogenic viruses

PubMed Central

Sun, Shao-Cong; Cesarman, Ethel

2013-01-01

NF-κB is a pivotal transcription factor that controls cell survival and proliferation in diverse physiological processes. The activity of NF-κB is tightly controlled through its cytoplasmic sequestration by specific inhibitors, IκBs. Various cellular stimuli induce the activation of an IκB kinase (IKK), which phosphorylates IκBs and triggers their proteasomal degradation, causing nuclear translocation of activated NF-κB. Under normal conditions, the activation of NF-κB occurs transiently, thus ensuring rapid but temporary induction of target genes. Deregulated NF-κB activation contributes to the development of various diseases, including cancers and immunological disorders. Accumulated studies demonstrate that the NF-κB signaling pathway is a target of several human oncogenic viruses, including the human T-cell leukemia virus type 1 (HTLV1), the Kaposi sarcoma-associated herpesvirus (KSHV), and the Epstein bar virus (EBV). These viruses encode specific oncoproteins that target different signaling components of the NF-κB pathway, leading to persistent activation of NF-κB. This chapter will discuss the molecular mechanisms by which NF-κB is activated by the viral oncoproteins. PMID:20845110

Assessment of Dengue virus helicase and methyltransferase as targets for fragment-based drug discovery.

PubMed

Coutard, Bruno; Decroly, Etienne; Li, Changqing; Sharff, Andrew; Lescar, Julien; Bricogne, Gérard; Barral, Karine

2014-06-01

Seasonal and pandemic flaviviruses continue to be leading global health concerns. With the view to help drug discovery against Dengue virus (DENV), a fragment-based experimental approach was applied to identify small molecule ligands targeting two main components of the flavivirus replication complex: the NS3 helicase (Hel) and the NS5 mRNA methyltransferase (MTase) domains. A library of 500 drug-like fragments was first screened by thermal-shift assay (TSA) leading to the identification of 36 and 32 fragment hits binding Hel and MTase from DENV, respectively. In a second stage, we set up a fragment-based X-ray crystallographic screening (FBS-X) in order to provide both validated fragment hits and structural binding information. No fragment hit was confirmed for DENV Hel. In contrast, a total of seven fragments were identified as DENV MTase binders and structures of MTase-fragment hit complexes were solved at resolution at least 2.0Å or better. All fragment hits identified contain either a five- or six-membered aromatic ring or both, and three novel binding sites were located on the MTase. To further characterize the fragment hits identified by TSA and FBS-X, we performed enzymatic assays to assess their inhibition effect on the N7- and 2'-O-MTase enzymatic activities: five of these fragment hits inhibit at least one of the two activities with IC50 ranging from 180μM to 9mM. This work validates the FBS-X strategy for identifying new anti-flaviviral hits targeting MTase, while Hel might not be an amenable target for fragment-based drug discovery (FBDD). This approach proved to be a fast and efficient screening method for FBDD target validation and discovery of starting hits for the development of higher affinity molecules that bind to novel allosteric sites. Copyright © 2014 Elsevier B.V. All rights reserved.

Ebola virus. Two-pore channels control Ebola virus host cell entry and are drug targets for disease treatment.

PubMed

Sakurai, Yasuteru; Kolokoltsov, Andrey A; Chen, Cheng-Chang; Tidwell, Michael W; Bauta, William E; Klugbauer, Norbert; Grimm, Christian; Wahl-Schott, Christian; Biel, Martin; Davey, Robert A

2015-02-27

Ebola virus causes sporadic outbreaks of lethal hemorrhagic fever in humans, but there is no currently approved therapy. Cells take up Ebola virus by macropinocytosis, followed by trafficking through endosomal vesicles. However, few factors controlling endosomal virus movement are known. Here we find that Ebola virus entry into host cells requires the endosomal calcium channels called two-pore channels (TPCs). Disrupting TPC function by gene knockout, small interfering RNAs, or small-molecule inhibitors halted virus trafficking and prevented infection. Tetrandrine, the most potent small molecule that we tested, inhibited infection of human macrophages, the primary target of Ebola virus in vivo, and also showed therapeutic efficacy in mice. Therefore, TPC proteins play a key role in Ebola virus infection and may be effective targets for antiviral therapy. Copyright © 2015, American Association for the Advancement of Science.

In vivo therapeutic potential of Dicer-hunting siRNAs targeting infectious hepatitis C virus.

PubMed

Watanabe, Tsunamasa; Hatakeyama, Hiroto; Matsuda-Yasui, Chiho; Sato, Yusuke; Sudoh, Masayuki; Takagi, Asako; Hirata, Yuichi; Ohtsuki, Takahiro; Arai, Masaaki; Inoue, Kazuaki; Harashima, Hideyoshi; Kohara, Michinori

2014-04-23

The development of RNA interference (RNAi)-based therapy faces two major obstacles: selecting small interfering RNA (siRNA) sequences with strong activity, and identifying a carrier that allows efficient delivery to target organs. Additionally, conservative region at nucleotide level must be targeted for RNAi in applying to virus because hepatitis C virus (HCV) could escape from therapeutic pressure with genome mutations. In vitro preparation of Dicer-generated siRNAs targeting a conserved, highly ordered HCV 5' untranslated region are capable of inducing strong RNAi activity. By dissecting the 5'-end of an RNAi-mediated cleavage site in the HCV genome, we identified potent siRNA sequences, which we designate as Dicer-hunting siRNAs (dh-siRNAs). Furthermore, formulation of the dh-siRNAs in an optimized multifunctional envelope-type nano device inhibited ongoing infectious HCV replication in human hepatocytes in vivo. Our efforts using both identification of optimal siRNA sequences and delivery to human hepatocytes suggest therapeutic potential of siRNA for a virus.

Two White Spot Syndrome Virus MicroRNAs Target the Dorsal Gene To Promote Virus Infection in Marsupenaeus japonicus Shrimp.

PubMed

Ren, Qian; Huang, Xin; Cui, Yalei; Sun, Jiejie; Wang, Wen; Zhang, Xiaobo

2017-04-15

In eukaryotes, microRNAs (miRNAs) serve as regulators of many biological processes, including virus infection. An miRNA can generally target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs has not yet been extensively explored during virus infection. This study found that the Spaztle (Spz)-Toll-Dorsal-antilipopolysaccharide factor (ALF) signaling pathway plays a very important role in antiviral immunity against invasion of white spot syndrome virus (WSSV) in shrimp ( Marsupenaeus japonicus ). Dorsal , the central gene in the Toll pathway, was targeted by two viral miRNAs (WSSV-miR-N13 and WSSV-miR-N23) during WSSV infection. The regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo , leading to virus infection. Our study contributes novel insights into the viral miRNA-mediated Toll signaling pathway during the virus-host interaction. IMPORTANCE An miRNA can target diverse genes during virus-host interactions. However, the regulation of gene expression by multiple miRNAs during virus infection has not yet been extensively explored. The results of this study indicated that the shrimp Dorsal gene, the central gene in the Toll pathway, was targeted by two viral miRNAs during infection with white spot syndrome virus. Regulation of Dorsal expression by viral miRNAs suppressed the Spz-Toll-Dorsal-ALF signaling pathway in shrimp in vivo , leading to virus infection. Our study provides new insight into the viral miRNA-mediated Toll signaling pathway in virus-host interactions. Copyright © 2017 American Society for Microbiology.

Targeting CTCF to Control Virus Gene Expression: A Common Theme amongst Diverse DNA Viruses.

PubMed

Pentland, Ieisha; Parish, Joanna L

2015-07-06

All viruses target host cell factors for successful life cycle completion. Transcriptional control of DNA viruses by host cell factors is important in the temporal and spatial regulation of virus gene expression. Many of these factors are recruited to enhance virus gene expression and thereby increase virus production, but host cell factors can also restrict virus gene expression and productivity of infection. CCCTC binding factor (CTCF) is a host cell DNA binding protein important for the regulation of genomic chromatin boundaries, transcriptional control and enhancer element usage. CTCF also functions in RNA polymerase II regulation and in doing so can influence co-transcriptional splicing events. Several DNA viruses, including Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV) and human papillomavirus (HPV) utilize CTCF to control virus gene expression and many studies have highlighted a role for CTCF in the persistence of these diverse oncogenic viruses. CTCF can both enhance and repress virus gene expression and in some cases CTCF increases the complexity of alternatively spliced transcripts. This review article will discuss the function of CTCF in the life cycle of DNA viruses in the context of known host cell CTCF functions.

Amiodarone affects Ebola virus binding and entry into target cells.

PubMed

Salata, Cristiano; Munegato, Denis; Martelli, Francesco; Parolin, Cristina; Calistri, Arianna; Baritussio, Aldo; Palù, Giorgio

2018-03-02

Ebola Virus Disease is one of the most lethal transmissible infections characterized by a high fatality rate. Several research studies have aimed to identify effective antiviral agents. Amiodarone, a drug used for the treatment of arrhythmias, has been shown to inhibit filovirus infection in vitro by acting at the early step of the viral replication cycle. Here we demonstrate that amiodarone reduces virus binding to target cells and slows down the progression of the viral particles along the endocytic pathway. Overall our data support the notion that amiodarone interferes with Ebola virus infection by affecting cellular pathways/targets involved in the viral entry process.

Construction and applications of yellow fever virus replicons.

PubMed

Jones, Christopher T; Patkar, Chinmay G; Kuhn, Richard J

2005-01-20

Subgenomic replicons of yellow fever virus (YFV) were constructed to allow expression of heterologous reporter genes in a replication-dependent manner. Expression of the antibiotic resistance gene neomycin phosphotransferase II (Neo) from one of these YFV replicons allowed selection of a stable population of cells (BHK-REP cells) in which the YFV replicon persistently replicated. BHK-REP cells were successfully used to trans-complement replication-defective YFV replicons harboring large internal deletions within either the NS1 or NS3 proteins. Although replicons with large deletions in either NS1 or NS3 were trans-complemented in BHK-REP, replicons that contained deletions of NS3 were trans-complemented at lower levels. In addition, replicons that retained the N-terminal protease domain of NS3 in cis were trans-complemented with higher efficiency than replicons in which both the protease and helicase domains of NS3 were deleted. To study packaging of YFV replicons, Sindbis replicons were constructed that expressed the YFV structural proteins in trans. Using these Sindbis replicons, both replication-competent and trans-complemented, replication-defective YFV replicons could be packaged into pseudo-infectious particles (PIPs). Although these results eliminate a potential role of either NS1 or full-length NS3 in cis for packaging and assembly of the flavivirus virion, they do not preclude the possibility that these proteins may act in trans during these processes.

Virus-encoded chemokine receptors--putative novel antiviral drug targets.

PubMed

Rosenkilde, Mette M

2005-01-01

Large DNA viruses, in particular herpes- and poxviruses, have evolved proteins that serve as mimics or decoys for endogenous proteins in the host. The chemokines and their receptors serve key functions in both innate and adaptive immunity through control of leukocyte trafficking, and have as such a paramount role in the antiviral immune responses. It is therefore not surprising that viruses have found ways to exploit and subvert the chemokine system by means of molecular mimicry. By ancient acts of molecular piracy and by induction and suppression of endogenous genes, viruses have utilized chemokines and their receptors to serve a variety of roles in viral life-cycle. This review focuses on the pharmacology of virus-encoded chemokine receptors, yet also the family of virus-encoded chemokines and chemokine-binding proteins will be touched upon. Key properties of the virus-encoded receptors, compared to their closest endogenous homologs, are interactions with a wider range of chemokines, which can act as agonists, antagonists and inverse agonists, and the exploitation of many signal transduction pathways. High constitutive activity is another key property of some--but not all--of these receptors. The chemokine receptors belong to the superfamily of G-protein coupled 7TM receptors that per se are excellent drug targets. At present, non-peptide antagonists have been developed against many chemokine receptors. The potentials of the virus-encoded chemokine receptors as drug targets--ie. as novel antiviral strategies--will be highlighted here together with the potentials of the virus-encoded chemokines and chemokine-binding proteins as novel anti-inflammatory biopharmaceutical strategies.

Virus-based nanoparticles as platform technologies for modern vaccines

PubMed Central

Lee, Karin L.; Twyman, Richard M.; Fiering, Steven

2017-01-01

Nanoscale engineering is revolutionizing the development of vaccines and immunotherapies. Viruses have played a key role in this field because they can function as prefabricated nanoscaffolds with unique properties that are easy to modify. Viruses are immunogenic through multiple pathways, and antigens displayed naturally or by engineering on the surface can be used to create vaccines against the cognate virus, other pathogens, specific molecules or cellular targets such as tumors. This review focuses on the development of virus-based nanoparticle systems as vaccines indicated for the prevention or treatment of infectious diseases, chronic diseases, cancer, and addiction. PMID:26782096

Location of a major antigenic site involved in Ross River virus neutralization.

PubMed

Vrati, S; Fernon, C A; Dalgarno, L; Weir, R C

1988-02-01

The location of a major antigenic domain involved in the neutralization of an alphavirus, Ross River virus, has been defined in terms of its position in the amino acid sequence of the E2 glycoprotein. The domain encompasses three topographically close epitopes which were identified using three E2-specific neutralizing monoclonal antibodies in competitive binding assays. Nucleotide sequencing of the structural protein genes of monoclonal antibody-selected antigenic variants showed that for each variant there was a single nucleotide change in the E2 gene leading to a nonconservative amino acid substitution in E2. Changes were at positions 216, 234, and 246-251 in the amino acid sequence. The epitopes are in a region of E2 which, though not strongly conserved as to sequence among Ross River virus, Semliki Forest virus, and Sindbis virus, is conserved in its hydropathy profile among the three alphaviruses. The epitopes lie between two asparagine-linked glycosylation sites (residues 200 and 262) in E2. They are conserved as to position between the mouse virulent T48 strain and the mouse avirulent NB5092 strain.

A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gumpper, Ryan H.; Li, Weike; Castañeda, Carlos H.

Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, wasmore » found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCENegative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth

A Polyamide Inhibits Replication of Vesicular Stomatitis Virus by Targeting RNA in the Nucleocapsid.

PubMed

Gumpper, Ryan H; Li, Weike; Castañeda, Carlos H; Scuderi, M José; Bashkin, James K; Luo, Ming

2018-04-15

Polyamides have been shown to bind double-stranded DNA by complementing the curvature of the minor groove and forming various hydrogen bonds with DNA. Several polyamide molecules have been found to have potent antiviral activities against papillomavirus, a double-stranded DNA virus. By analogy, we reason that polyamides may also interact with the structured RNA bound in the nucleocapsid of a negative-strand RNA virus. Vesicular stomatitis virus (VSV) was selected as a prototype virus to test this possibility since its genomic RNA encapsidated in the nucleocapsid forms a structure resembling one strand of an A-form RNA duplex. One polyamide molecule, UMSL1011, was found to inhibit infection of VSV. To confirm that the polyamide targeted the nucleocapsid, a nucleocapsid-like particle (NLP) was incubated with UMSL1011. The encapsidated RNA in the polyamide-treated NLP was protected from thermo-release and digestion by RNase A. UMSL1011 also inhibits viral RNA synthesis in the intracellular activity assay for the viral RNA-dependent RNA polymerase. The crystal structure revealed that UMSL1011 binds the structured RNA in the nucleocapsid. The conclusion of our studies is that the RNA in the nucleocapsid is a viable antiviral target of polyamides. Since the RNA structure in the nucleocapsid is similar in all negative-strand RNA viruses, polyamides may be optimized to target the specific RNA genome of a negative-strand RNA virus, such as respiratory syncytial virus and Ebola virus. IMPORTANCE Negative-strand RNA viruses (NSVs) include several life-threatening pathogens, such as rabies virus, respiratory syncytial virus, and Ebola virus. There are no effective antiviral drugs against these viruses. Polyamides offer an exceptional opportunity because they may be optimized to target each NSV. Our studies on vesicular stomatitis virus, an NSV, demonstrated that a polyamide molecule could specifically target the viral RNA in the nucleocapsid and inhibit viral growth. The

Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses.

PubMed

Holm, Christian K; Rahbek, Stine H; Gad, Hans Henrik; Bak, Rasmus O; Jakobsen, Martin R; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K; Sun, Chenglong; Thomsen, Martin K; Laustsen, Anders; Nielsen, Camilla G; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R

2016-02-19

Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV.

Virus-mimetic polyplex particles for systemic and inflammation-specific targeted delivery of large genetic contents.

PubMed

Kang, S; Lu, K; Leelawattanachai, J; Hu, X; Park, S; Park, T; Min, I M; Jin, M M

2013-11-01

Systemic and target-specific delivery of large genetic contents has been difficult to achieve. Although viruses effortlessly deliver kilobase-long genome into cells, its clinical use has been hindered by serious safety concerns and the mismatch between native tropisms and desired targets. Nonviral vectors, in contrast, are limited by low gene transfer efficiency and inherent cytotoxicity. Here we devised virus-mimetic polyplex particles (VMPs) based on electrostatic self-assembly among polyanionic peptide (PAP), cationic polymer polyethyleneimine (PEI) and nucleic acids. We fused PAP to the engineered ligand-binding domain of integrin αLβ2 to target intercellular adhesion molecule-1 (ICAM-1), an inducible marker of inflammation. Fully assembled VMPs packaged large genetic contents, bound specifically to target molecules, elicited receptor-mediated endocytosis and escaped endosomal pathway, resembling intracellular delivery processes of viruses. Unlike conventional PEI-mediated transfection, molecular interaction-dependent gene delivery of VMPs was unaffected by the presence of serum and achieved higher efficiency without toxicity. By targeting overexpressed ICAM-1, VMPs delivered genes specifically to inflamed endothelial cells and macrophages both in vitro and in vivo. Simplicity and versatility of the platform and inflammation-specific delivery may open up opportunities for multifaceted gene therapy that can be translated into the clinic and treat a broad range of debilitating immune and inflammatory diseases.

A new comprehensive method for detection of livestock-related pathogenic viruses using a target enrichment system.

PubMed

Oba, Mami; Tsuchiaka, Shinobu; Omatsu, Tsutomu; Katayama, Yukie; Otomaru, Konosuke; Hirata, Teppei; Aoki, Hiroshi; Murata, Yoshiteru; Makino, Shinji; Nagai, Makoto; Mizutani, Tetsuya

2018-01-08

We tested usefulness of a target enrichment system SureSelect, a comprehensive viral nucleic acid detection method, for rapid identification of viral pathogens in feces samples of cattle, pigs and goats. This system enriches nucleic acids of target viruses in clinical/field samples by using a library of biotinylated RNAs with sequences complementary to the target viruses. The enriched nucleic acids are amplified by PCR and subjected to next generation sequencing to identify the target viruses. In many samples, SureSelect target enrichment method increased efficiencies for detection of the viruses listed in the biotinylated RNA library. Furthermore, this method enabled us to determine nearly full-length genome sequence of porcine parainfluenza virus 1 and greatly increased Breadth, a value indicating the ratio of the mapping consensus length in the reference genome, in pig samples. Our data showed usefulness of SureSelect target enrichment system for comprehensive analysis of genomic information of various viruses in field samples. Copyright © 2017 Elsevier Inc. All rights reserved.

Virtual screening of the inhibitors targeting at the viral protein 40 of Ebola virus.

PubMed

Karthick, V; Nagasundaram, N; Doss, C George Priya; Chakraborty, Chiranjib; Siva, R; Lu, Aiping; Zhang, Ge; Zhu, Hailong

2016-02-17

The Ebola virus is highly pathogenic and destructive to humans and other primates. The Ebola virus encodes viral protein 40 (VP40), which is highly expressed and regulates the assembly and release of viral particles in the host cell. Because VP40 plays a prominent role in the life cycle of the Ebola virus, it is considered as a key target for antiviral treatment. However, there is currently no FDA-approved drug for treating Ebola virus infection, resulting in an urgent need to develop effective antiviral inhibitors that display good safety profiles in a short duration. This study aimed to screen the effective lead candidate against Ebola infection. First, the lead molecules were filtered based on the docking score. Second, Lipinski rule of five and the other drug likeliness properties are predicted to assess the safety profile of the lead candidates. Finally, molecular dynamics simulations was performed to validate the lead compound. Our results revealed that emodin-8-beta-D-glucoside from the Traditional Chinese Medicine Database (TCMD) represents an active lead candidate that targets the Ebola virus by inhibiting the activity of VP40, and displays good pharmacokinetic properties. This report will considerably assist in the development of the competitive and robust antiviral agents against Ebola infection.

Distribution of mosquitoes and mosquito-borne arboviruses in Yunnan Province near the China-Myanmar-Laos border.

PubMed

Wang, Jinglin; Zhang, Hailin; Sun, Xiaohong; Fu, Shihong; Wang, Huanqin; Feng, Yun; Wang, Huanyu; Tang, Qing; Liang, Guo-Dong

2011-05-01

Economic development and increased tourism in the southern region of Yunnan Province in China, adjacent to several countries in Southeast Asia, has increased the likelihood of import and export of vectors and vector-borne diseases. We report the results of surveillance of mosquitoes and mosquito-borne arboviruses along the border of China-Myanmar-Laos in 2005 and 2006, and information associating several arboviruses with infections and possibly disease in local human populations. Seventeen mosquito species representing four genera were obtained, and 14 strains of mosquito-borne viruses representing six viruses in five genera were isolated from Culex tritaeniorhynchus. In addition, IgM against Japanese encephalitis virus, Sindbis virus, Yunnan orbivirus and novel Banna virus was detected in acute-phase serum samples obtained from hospitalized patients with fever and encephalitis near the areas where the viruses were isolated. This investigation suggests that Japanese encephalitis virus, Sindbis virus, and lesser-known arboviruses circulate and may be infecting humans in the China-Myanmar-Laos border region.

Disposal of Hospital Wastes Containing Pathogenic Organisms

DTIC Science & Technology

1979-09-01

virus African swine fever virus Besnoitia besnoiti Borna disease virus Bovine infectious petechial fever virus Camel pox virus Ephemeral fever virus...Sindbis virus Tensaw virus Turlock virus Vaccinia virus Varicella virus Vole rickettsia Yellow fever virus, 17D vaccinL strain 163 Class 3 AlastruLn...Rickettsia - all species except Vole rickettsia when used for transmission or animal inoculation experiments Vesicular stomatitis virus Yellow fever virus

Host DNA Synthesis-Suppressing Factor in Culture Fluid of Tissue Cultures Infected with Measles Virus

PubMed Central

Minagawa, Tomonori; Nakaya, Chikako; Iida, Hiroo

1974-01-01

Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated component which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virus as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither UV-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. PMID:4207526

BeeDoctor, a Versatile MLPA-Based Diagnostic Tool for Screening Bee Viruses

PubMed Central

De Smet, Lina; Ravoet, Jorgen; de Miranda, Joachim R.; Wenseleers, Tom; Mueller, Matthias Y.; Moritz, Robin F. A.; de Graaf, Dirk C.

2012-01-01

The long-term decline of managed honeybee hives in the world has drawn significant attention to the scientific community and bee-keeping industry. A high pathogen load is believed to play a crucial role in this phenomenon, with the bee viruses being key players. Most of the currently characterized honeybee viruses (around twenty) are positive stranded RNA viruses. Techniques based on RNA signatures are widely used to determine the viral load in honeybee colonies. High throughput screening for viral loads necessitates the development of a multiplex polymerase chain reaction approach in which different viruses can be targeted simultaneously. A new multiparameter assay, called “BeeDoctor”, was developed based on multiplex-ligation probe dependent amplification (MLPA) technology. This assay detects 10 honeybee viruses in one reaction. “BeeDoctor” is also able to screen selectively for either the positive strand of the targeted RNA bee viruses or the negative strand, which is indicative for active viral replication. Due to its sensitivity and specificity, the MLPA assay is a useful tool for rapid diagnosis, pathogen characterization, and epidemiology of viruses in honeybee populations. “BeeDoctor” was used for screening 363 samples from apiaries located throughout Flanders; the northern half of Belgium. Using the “BeeDoctor”, virus infections were detected in almost eighty percent of the colonies, with deformed wing virus by far the most frequently detected virus and multiple virus infections were found in 26 percent of the colonies. PMID:23144717

BeeDoctor, a versatile MLPA-based diagnostic tool for screening bee viruses.

PubMed

De Smet, Lina; Ravoet, Jorgen; de Miranda, Joachim R; Wenseleers, Tom; Mueller, Matthias Y; Moritz, Robin F A; de Graaf, Dirk C

2012-01-01

The long-term decline of managed honeybee hives in the world has drawn significant attention to the scientific community and bee-keeping industry. A high pathogen load is believed to play a crucial role in this phenomenon, with the bee viruses being key players. Most of the currently characterized honeybee viruses (around twenty) are positive stranded RNA viruses. Techniques based on RNA signatures are widely used to determine the viral load in honeybee colonies. High throughput screening for viral loads necessitates the development of a multiplex polymerase chain reaction approach in which different viruses can be targeted simultaneously. A new multiparameter assay, called "BeeDoctor", was developed based on multiplex-ligation probe dependent amplification (MLPA) technology. This assay detects 10 honeybee viruses in one reaction. "BeeDoctor" is also able to screen selectively for either the positive strand of the targeted RNA bee viruses or the negative strand, which is indicative for active viral replication. Due to its sensitivity and specificity, the MLPA assay is a useful tool for rapid diagnosis, pathogen characterization, and epidemiology of viruses in honeybee populations. "BeeDoctor" was used for screening 363 samples from apiaries located throughout Flanders; the northern half of Belgium. Using the "BeeDoctor", virus infections were detected in almost eighty percent of the colonies, with deformed wing virus by far the most frequently detected virus and multiple virus infections were found in 26 percent of the colonies.

Rate of novel host invasion affects adaptability of evolving RNA virus lineages.

PubMed

Morley, Valerie J; Mendiola, Sandra Y; Turner, Paul E

2015-08-22

Although differing rates of environmental turnover should be consequential for the dynamics of adaptive change, this idea has been rarely examined outside of theory. In particular, the importance of RNA viruses in disease emergence warrants experiments testing how differing rates of novel host invasion may impact the ability of viruses to adaptively shift onto a novel host. To test whether the rate of environmental turnover influences adaptation, we experimentally evolved 144 Sindbis virus lineages in replicated tissue-culture environments, which transitioned from being dominated by a permissive host cell type to a novel host cell type. The rate at which the novel host 'invaded' the environment varied by treatment. The fitness (growth rate) of evolved virus populations was measured on each host type, and molecular substitutions were mapped via whole genome consensus sequencing. Results showed that virus populations more consistently reached high fitness levels on the novel host when the novel host 'invaded' the environment more gradually, and gradual invasion resulted in less variable genomic outcomes. Moreover, virus populations that experienced a rapid shift onto the novel host converged upon different genotypes than populations that experienced a gradual shift onto the novel host, suggesting a strong effect of historical contingency. © 2015 The Author(s).

Hepatocyte-targeted RNAi Therapeutics for the Treatment of Chronic Hepatitis B Virus Infection

PubMed Central

Wooddell, Christine I; Rozema, David B; Hossbach, Markus; John, Matthias; Hamilton, Holly L; Chu, Qili; Hegge, Julia O; Klein, Jason J; Wakefield, Darren H; Oropeza, Claudia E; Deckert, Jochen; Roehl, Ingo; Jahn-Hofmann, Kerstin; Hadwiger, Philipp; Vornlocher, Hans-Peter; McLachlan, Alan; Lewis, David L

2013-01-01

RNA interference (RNAi)-based therapeutics have the potential to treat chronic hepatitis B virus (HBV) infection in a fundamentally different manner than current therapies. Using RNAi, it is possible to knock down expression of viral RNAs including the pregenomic RNA from which the replicative intermediates are derived, thus reducing viral load, and the viral proteins that result in disease and impact the immune system's ability to eliminate the virus. We previously described the use of polymer-based Dynamic PolyConjugate (DPC) for the targeted delivery of siRNAs to hepatocytes. Here, we first show in proof-of-concept studies that simple coinjection of a hepatocyte-targeted, N-acetylgalactosamine-conjugated melittin-like peptide (NAG-MLP) with a liver-tropic cholesterol-conjugated siRNA (chol-siRNA) targeting coagulation factor VII (F7) results in efficient F7 knockdown in mice and nonhuman primates without changes in clinical chemistry or induction of cytokines. Using transient and transgenic mouse models of HBV infection, we show that a single coinjection of NAG-MLP with potent chol-siRNAs targeting conserved HBV sequences resulted in multilog repression of viral RNA, proteins, and viral DNA with long duration of effect. These results suggest that coinjection of NAG-MLP and chol-siHBVs holds great promise as a new therapeutic for patients chronically infected with HBV. PMID:23439496

New Kids on the Block: RNA-Based Influenza Virus Vaccines.

PubMed

Scorza, Francesco Berlanda; Pardi, Norbert

2018-04-01

RNA-based immunization strategies have emerged as promising alternatives to conventional vaccine approaches. A substantial body of published work demonstrates that RNA vaccines can elicit potent, protective immune responses against various pathogens. Consonant with its huge impact on public health, influenza virus is one of the best studied targets of RNA vaccine research. Currently licensed influenza vaccines show variable levels of protection against seasonal influenza virus strains but are inadequate against drifted and pandemic viruses. In recent years, several types of RNA vaccines demonstrated efficacy against influenza virus infections in preclinical models. Additionally, comparative studies demonstrated the superiority of some RNA vaccines over the currently used inactivated influenza virus vaccines in animal models. Based on these promising preclinical results, clinical trials have been initiated and should provide valuable information about the translatability of the impressive preclinical data to humans. This review briefly describes RNA-based vaccination strategies, summarizes published preclinical and clinical data, highlights the roadblocks that need to be overcome for clinical applications, discusses the landscape of industrial development, and shares the authors' personal perspectives about the future of RNA-based influenza virus vaccines.

Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice.

PubMed

Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F

2017-10-01

Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

Host DNA synthesis-suppressing factor in culture fluid of tissue cultures infected with measles virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minagawa, T.; Nakaya, C.; Iida, H.

1974-05-01

Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated componentnent which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virusmore » as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither uv-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. (auth)« less

Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

PubMed

Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

2018-01-05

Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

PHOSPHOLIPID COMPONENTS OF SINDBIS VIRUS,

DTIC Science & Technology

values. In addition to sphingomyelin, phosphatidyl choline , and phosphatidyl ethanolamine, other phospholipids were tentatively identified as phosphatidyl... inositol , phosphatidyl serine, phosphatidyl glycerol, and diphosphatidyl glycerol. Gas chromatographic analysis of the total fatty acids from

Striking similarities in amino acid sequence among nonstructural proteins encoded by RNA viruses that have dissimilar genomic organization.

PubMed Central

Haseloff, J; Goelet, P; Zimmern, D; Ahlquist, P; Dasgupta, R; Kaesberg, P

1984-01-01

The plant viruses alfalfa mosaic virus (AMV) and brome mosaic virus (BMV) each divide their genetic information among three RNAs while tobacco mosaic virus (TMV) contains a single genomic RNA. Amino acid sequence comparisons suggest that the single proteins encoded by AMV RNA 1 and BMV RNA 1 and by AMV RNA 2 and BMV RNA 2 are related to the NH2-terminal two-thirds and the COOH-terminal one-third, respectively, of the largest protein encoded by TMV. Separating these two domains in the TMV RNA sequence is an amber termination codon, whose partial suppression allows translation of the downstream domain. Many of the residues that the TMV read-through domain and the segmented plant viruses have in common are also conserved in a read-through domain found in the nonstructural polyprotein of the animal alphaviruses Sindbis and Middelburg. We suggest that, despite substantial differences in gene organization and expression, all of these viruses use related proteins for common functions in RNA replication. Reassortment of functional modules of coding and regulatory sequence from preexisting viral or cellular sources, perhaps via RNA recombination, may be an important mechanism in RNA virus evolution. PMID:6611550

Sensitivity of Small RNA-Based Detection of Plant Viruses.

PubMed

Santala, Johanna; Valkonen, Jari P T

2018-01-01

Plants recognize unrelated viruses by the antiviral defense system called RNA interference (RNAi). RNAi processes double-stranded viral RNA into small RNAs (sRNAs) of 21-24 nucleotides, the reassembly of which into longer strands in silico allows virus identification by comparison with the sequences available in databases. The aim of this study was to compare the virus detection sensitivity of sRNA-based virus diagnosis with the established virus species-specific polymerase chain reaction (PCR) approach. Viruses propagated in tobacco plants included three engineered, infectious clones of Potato virus A (PVA), each carrying a different marker gene, and an infectious clone of Potato virus Y (PVY). Total RNA (containing sRNA) was isolated and subjected to reverse-transcription real-time PCR (RT-RT-PCR) and sRNA deep-sequencing at different concentrations. RNA extracted from various crop plants was included in the reactions to normalize RNA concentrations. Targeted detection of selected viruses showed a similar threshold for the sRNA and reverse-transcription quantitative PCR (RT-qPCR) analyses. The detection limit for PVY and PVA by RT-qPCR in this study was 3 and 1.5 fg of viral RNA, respectively, in 50 ng of total RNA per PCR reaction. When knowledge was available about the viruses likely present in the samples, sRNA-based virus detection was 10 times more sensitive than RT-RT-PCR. The advantage of sRNA analysis is the detection of all tested viruses without the need for virus-specific primers or probes.

Membrane organization of virus and target cell plays a role in HIV entry.

PubMed

Dumas, Fabrice; Preira, Pascal; Salomé, Laurence

2014-12-01

The initial steps of the Human Immunodeficiency Virus (HIV) replication cycle play a crucial role that arbitrates viral tropism and infection efficiency. Before the release of its genome into the host cell cytoplasm, viruses operate a complex sequence of events that take place at the plasma membrane of the target cell. The first step is the binding of the HIV protein envelope (Env) to the cellular receptor CD4. This triggers conformational changes of the gp120 viral protein that allow its interaction with a co-receptor that can be either CCR5 or CXCR4, defining the tropism of the virus entering the cell. This sequential interaction finally drives the fusion of the viral and host cell membrane or to the endocytosis of the viruses. Here, we discuss how the membrane composition and organization of both the virus and the target cell can affect these steps and thus influence the capability of the viruses to infect cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Chemical genetics-based development of small molecules targeting hepatitis C virus.

PubMed

Jin, Guanghai; Lee, Jisu; Lee, Kyeong

2017-09-01

Hepatitis C virus (HCV) infection is a major worldwide problem that has emerged as one of the most significant diseases affecting humans. There are currently no vaccines or efficient therapies without side effects, despite today's advanced medical technology. Currently, the common therapy for most patients (i.e. genotype 1) is combination of HCV-specific direct-acting antivirals (DAAs). Up to 2011, the standard of care (SOC) was a combination of peg-IFNα with ribavirin (RBV). After approval of NS3/4A protease inhibitor, SOC was peg-IFNα and RBV with either the first-generation DAAs boceprevir or telaprevir. In the past several years, various novel small molecules have been discovered and some of them (i.e., HCV polymerase, protease, helicase and entry inhibitors) have undergone clinical trials. Between 2013 and 2016, the second-generation DAA drugs simeprevir, asunaprevir, daclatasvir, dasabuvir, sofosbuvir, and elbasvir were approved, as well as the combinational drugs Harvoni ® , Zepatier ® , Technivie ® , and Epclusa ® . A number of reviews have been recently published describing the structure-activity relationship (SAR) in the development of HCV inhibitors and outlining current therapeutic approaches to hepatitis C infection. Target identification involves studying a drug's mechanism of action (MOA), and a variety of target identification methods have been developed in the past few years. Chemical biology has emerged as a powerful tool for studying biological processes using small molecules. The use of chemical genetic methods is a valuable strategy for studying the molecular mechanisms of the viral lifecycle and screening for anti-viral agents. Two general screening approaches have been employed: forward and reverse chemical genetics. This review reveals information on the small molecules in HCV drug discovery by using chemical genetics for targeting the HCV protein and describes successful examples of targets identified with these methods.

Effect of humoral immunity on HIV-1 dynamics with virus-to-target and infected-to-target infections

NASA Astrophysics Data System (ADS)

Elaiw, A. M.; Raezah, A. A.; Alofi, A. S.

2016-08-01

We consider an HIV-1 dynamics model by incorporating (i) two routes of infection via, respectively, binding of a virus to a receptor on the surface of a target cell to start genetic reactions (virus-to-target infection), and the direct transmission from infected cells to uninfected cells through the concept of virological synapse in vivo (infected-to-target infection); (ii) two types of distributed-time delays to describe the time between the virus or infected cell contacts an uninfected CD4+ T cell and the emission of new active viruses; (iii) humoral immune response, where the HIV-1 particles are attacked by the antibodies that are produced from the B lymphocytes. The existence and stability of all steady states are completely established by two bifurcation parameters, R 0 (the basic reproduction number) and R 1 (the viral reproduction number at the chronic-infection steady state without humoral immune response). By constructing Lyapunov functionals and using LaSalle's invariance principle, we have proven that, if R 0 ≤ 1 , then the infection-free steady state is globally asymptotically stable, if R 1 ≤ 1 < R 0 , then the chronic-infection steady state without humoral immune response is globally asymptotically stable, and if R 1 > 1 , then the chronic-infection steady state with humoral immune response is globally asymptotically stable. We have performed numerical simulations to confirm our theoretical results.

Detection and analysis of protein ISGylation.

PubMed

Takeuchi, Tomoharu; Yokosawa, Hideyoshi

2008-01-01

ISG15 is a ubiquitin-like modifi er that is conjugated to target proteins by a sequential reaction catalyzed by E1/E2/E3 enzymes (protein ISGylation). ISG15 and protein ISGylation are upregulated by interferon stimuli. ISG15 functions as an antiviral protein against Sindbis virus and HIV-1, but the molecular mechanism remains unknown. Here we describe in detail methods for detecting and analyzing protein ISGylation. The methods consist of plasmid transfection and affi nity purifi cation of ISGylated proteins. In addition, we describe a method for detecting ISGylation of a target protein, Ubc13.

Identification of Hepatitis C Virus Inhibitors Targeting Different Aspects of Infection Using a Cell-Based Assay

PubMed Central

Yu, Xuemei; Sainz, Bruno; Petukhov, Pavel A.

2012-01-01

With 2 to 3% of the worldwide population chronically infected, hepatitis C virus (HCV) infection continues to be a major health care burden. Unfortunately, current interferon-based treatment options are not effective in all patients and are associated with significant side effects. Consequently, there is an ongoing need to identify and develop new anti-HCV therapies. Toward this goal, we previously developed a cell-based HCV infection assay for antiviral compound screening based on a low-multiplicity-of-infection approach that uniquely allows for the identification of antiviral compounds that target cell culture-derived HCV (HCVcc) at any step of the viral infection cycle. Using this assay, here we report the screening of the NCI Diversity Set II library, containing 1,974 synthesized chemical compounds, and the identification of compounds with specific anti-HCV activity. In combination with toxicity counterscreening, we identified 30 hits from the compound library, 13 of which showed reproducible and dose-dependent inhibition of HCV with mean therapeutic indices (50% cytotoxic concentration [CC50]/50% effective concentration [EC50]) of greater than 6. Using HCV pseudotype and replicon systems of multiple HCV genotypes, as well as infectious HCVcc-based assembly and secretion analysis, we determined that different compounds within this group of candidate inhibitors target different steps of viral infection. The compounds identified not only will serve as biological probes to study and further dissect the biology of viral infection but also should facilitate the development of new anti-HCV therapeutic treatments. PMID:22948883

Chimeric L2-Based Virus-Like Particle (VLP) Vaccines Targeting Cutaneous Human Papillomaviruses (HPV).

PubMed

Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil; Kirnbauer, Reinhard

2017-01-01

Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17-36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous HPV

Chimeric L2-Based Virus-Like Particle (VLP) Vaccines Targeting Cutaneous Human Papillomaviruses (HPV)

PubMed Central

Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil

2017-01-01

Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17–36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous

A perspective on targeting non-structural proteins to combat neglected tropical diseases: Dengue, West Nile and Chikungunya viruses.

PubMed

Bhakat, Soumendranath; Karubiu, Wilson; Jayaprakash, Venkatesan; Soliman, Mahmoud E S

2014-11-24

Neglected tropical diseases are major causes of fatality in poverty stricken regions across Africa, Asia and some part of America. The combined potential health risk associated with arthropod-borne viruses (arboviruses); Dengue virus (DENV), West Nile Virus (WNV) and Chikungunya Virus (CHIKV) is immense. These arboviruses are either emerging or re-emerging in many regions with recent documented outbreaks in the United States. Despite several recent evidences of emergence, currently there are no approved drugs or vaccines available to counter these diseases. Non-structural proteins encoded by these RNA viruses are essential for their replication and maturation and thus may offer ideal targets for developing antiviral drugs. In recent years, several protease inhibitors have been sourced from plant extract, synthesis, computer aided drug design and high throughput screening as well as through drug reposition based approaches to target the non-structural proteins. The protease inhibitors have shown different levels of inhibition and may thus provide template to develop selective and potent drugs against these devastating arboviruses. This review seeks to shed light on the design and development of antiviral drugs against DENV, WNV and CHIKV to date. To the best of our knowledge, this review provides the first comprehensive update on the development of protease inhibitors targeting non-structural proteins of three most devastating arboviruses, DENV, WNV and CHIKV. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

All-atom molecular dynamics of virus capsids as drug targets

DOE PAGES

Perilla, Juan R.; Hadden, Jodi A.; Goh, Boon Chong; ...

2016-04-29

Virus capsids are protein shells that package the viral genome. Although their morphology and biological functions can vary markedly, capsids often play critical roles in regulating viral infection pathways. A detailed knowledge of virus capsids, including their dynamic structure, interactions with cellular factors, and the specific roles that they play in the replication cycle, is imperative for the development of antiviral therapeutics. The following Perspective introduces an emerging area of computational biology that focuses on the dynamics of virus capsids and capsid–protein assemblies, with particular emphasis on the effects of small-molecule drug binding on capsid structure, stability, and allosteric pathways.more » When performed at chemical detail, molecular dynamics simulations can reveal subtle changes in virus capsids induced by drug molecules a fraction of their size. Finally, the current challenges of performing all-atom capsid–drug simulations are discussed, along with an outlook on the applicability of virus capsid simulations to reveal novel drug targets.« less

All-atom molecular dynamics of virus capsids as drug targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perilla, Juan R.; Hadden, Jodi A.; Goh, Boon Chong

Virus capsids are protein shells that package the viral genome. Although their morphology and biological functions can vary markedly, capsids often play critical roles in regulating viral infection pathways. A detailed knowledge of virus capsids, including their dynamic structure, interactions with cellular factors, and the specific roles that they play in the replication cycle, is imperative for the development of antiviral therapeutics. The following Perspective introduces an emerging area of computational biology that focuses on the dynamics of virus capsids and capsid–protein assemblies, with particular emphasis on the effects of small-molecule drug binding on capsid structure, stability, and allosteric pathways.more » When performed at chemical detail, molecular dynamics simulations can reveal subtle changes in virus capsids induced by drug molecules a fraction of their size. Finally, the current challenges of performing all-atom capsid–drug simulations are discussed, along with an outlook on the applicability of virus capsid simulations to reveal novel drug targets.« less

Targets of small interfering RNA restriction during human immunodeficiency virus type 1 replication.

PubMed

Gao, Yong; Lobritz, Michael A; Roth, Justin; Abreha, Measho; Nelson, Kenneth N; Nankya, Immaculate; Moore-Dudley, Dawn M; Abraha, Awet; Gerson, Stanton L; Arts, Eric J

2008-03-01

Small interfering RNAs (siRNAs) have been shown to effectively inhibit human immunodeficiency virus type 1 (HIV-1) replication in vitro. The mechanism(s) for this inhibition is poorly understood, as siRNAs may interact with multiple HIV-1 RNA species during different steps of the retroviral life cycle. To define susceptible HIV-1 RNA species, siRNAs were first designed to specifically inhibit two divergent primary HIV-1 isolates via env and gag gene targets. A self-inactivating lentiviral vector harboring these target sequences confirmed that siRNA cannot degrade incoming genomic RNA. Disruption of the incoming core structure by rhesus macaque TRIM5alpha did, however, provide siRNA-RNA-induced silencing complex access to HIV-1 genomic RNA and promoted degradation. In the absence of accelerated core disruption, only newly transcribed HIV-1 mRNA in the cytoplasm is sensitive to siRNA degradation. Inhibitors of HIV-1 mRNA nuclear export, such as leptomycin B and camptothecin, blocked siRNA restriction. All HIV-1 RNA regions and transcripts found 5' of the target sequence, including multiply spliced HIV-1 RNA, were degraded by unidirectional 3'-to-5' siRNA amplification and spreading. In contrast, HIV-1 RNA 3' of the target sequence was not susceptible to siRNA. Even in the presence of siRNA, full-length HIV-1 RNA is still encapsidated into newly assembled viruses. These findings suggest that siRNA can target only a relatively "naked" cytoplasmic HIV-1 RNA despite the involvement of viral RNA at nearly every step in the retroviral life cycle. Protection of HIV-1 RNA within the core following virus entry, during encapsidation/virus assembly, or within the nucleus may reflect virus evolution in response to siRNA, TRIM5alpha, or other host restriction factors.

An M2e-based synthetic peptide vaccine for influenza A virus confers heterosubtypic protection from lethal virus challenge.

PubMed

Ma, Ji-Hong; Yang, Fu-Ru; Yu, Hai; Zhou, Yan-Jun; Li, Guo-Xin; Huang, Meng; Wen, Feng; Tong, Guangzhi

2013-07-09

Vaccination is considered as the most effective preventive method to control influenza. The hallmark of influenza virus is the remarkable variability of its major surface glycoproteins, HA and NA, which allows the virus to evade existing anti-influenza immunity in the target population. So it is necessary to develop a novel vaccine to control animal influenza virus. Also we know that the ectodomain of influenza matrix protein 2 (M2e) is highly conserved in animal influenza A viruses, so a vaccine based on the M2e could avoid several drawbacks of the traditional vaccines. In this study we designed a novel tetra-branched multiple antigenic peptide (MAP) based vaccine, which was constructed by fusing four copies of M2e to one copy of foreign T helper (Th) cell epitope, and then investigated its immune responses. Our results show that the M2e-MAP induced strong M2e-specific IgG antibody,which responses following 2 doses immunization in the presence of Freunds' adjuvant. M2e-MAP vaccination limited viral replication substantially. Also it could attenuate histopathological damage in the lungs of challenged mice and counteracted weight loss. M2e-MAP-based vaccine protected immunized mice against the lethal challenge with PR8 virus. Based on these findings, M2e-MAP-based vaccine seemed to provide useful information for the research of M2e-based influenza vaccine. Also it show huge potential to study vaccines for other similarly viruses.

Endosomal NOX2 oxidase exacerbates virus pathogenicity and is a target for antiviral therapy.

PubMed

To, Eunice E; Vlahos, Ross; Luong, Raymond; Halls, Michelle L; Reading, Patrick C; King, Paul T; Chan, Christopher; Drummond, Grant R; Sobey, Christopher G; Broughton, Brad R S; Starkey, Malcolm R; van der Sluis, Renee; Lewin, Sharon R; Bozinovski, Steven; O'Neill, Luke A J; Quach, Tim; Porter, Christopher J H; Brooks, Doug A; O'Leary, John J; Selemidis, Stavros

2017-07-12

The imminent threat of viral epidemics and pandemics dictates a need for therapeutic approaches that target viral pathology irrespective of the infecting strain. Reactive oxygen species are ancient processes that protect plants, fungi and animals against invading pathogens including bacteria. However, in mammals reactive oxygen species production paradoxically promotes virus pathogenicity by mechanisms not yet defined. Here we identify that the primary enzymatic source of reactive oxygen species, NOX2 oxidase, is activated by single stranded RNA and DNA viruses in endocytic compartments resulting in endosomal hydrogen peroxide generation, which suppresses antiviral and humoral signaling networks via modification of a unique, highly conserved cysteine residue (Cys98) on Toll-like receptor-7. Accordingly, targeted inhibition of endosomal reactive oxygen species production abrogates influenza A virus pathogenicity. We conclude that endosomal reactive oxygen species promote fundamental molecular mechanisms of viral pathogenicity, and the specific targeting of this pathogenic process with endosomal-targeted reactive oxygen species inhibitors has implications for the treatment of viral disease.Production of reactive oxygen species is an ancient antimicrobial mechanism, but its role in antiviral defense in mammals is unclear. Here, To et al. show that virus infection activates endosomal NOX2 oxidase and restricts TLR7 signaling, and that an endosomal NOX2 inhibitor decreases viral pathogenicity.

Structure of the recombinant alphavirus Western equine encephalitis virus revealed by cryoelectron microscopy.

PubMed

Sherman, Michael B; Weaver, Scott C

2010-10-01

Western equine encephalitis virus (WEEV; Togaviridae, Alphavirus) is an enveloped RNA virus that is typically transmitted to vertebrate hosts by infected mosquitoes. WEEV is an important cause of viral encephalitis in humans and horses in the Americas, and infection results in a range of disease, from mild flu-like illnesses to encephalitis, coma, and death. In addition to spreading via mosquito vectors, human WEEV infections can potentially occur directly via aerosol transmission. Due to its aerosol infectivity and virulence, WEEV is thus classified as a biological safety level 3 (BSL-3) agent. Because of its highly infectious nature and containment requirements, it has not been possible to investigate WEEV's structure or assembly mechanism using standard structural biology techniques. Thus, to image WEEV and other BSL-3 agents, we have constructed a first-of-its-kind BSL-3 cryoelectron microscopy (cryoEM) containment facility. cryoEM images of WEEV were used to determine the first three-dimensional structure of this important human pathogen. The overall organization of WEEV is similar to those of other alphaviruses, consistent with the high sequence similarity among alphavirus structural proteins. Surprisingly, the nucleocapsid of WEEV, a New World virus, is more similar to the Old World alphavirus Sindbis virus than to other New World alphaviruses.

Pseudorabies virus glycoprotein gIII is a major target antigen for murine and swine virus-specific cytotoxic T lymphocytes.

PubMed Central

Zuckermann, F A; Zsak, L; Mettenleiter, T C; Ben-Porat, T

1990-01-01

Pseudorabies virus (PrV) is the etiological agent of Aujeszky's disease, a disease that causes heavy economic losses in the swine industry. A rational approach to the generation of an effective vaccine against this virus requires an understanding of the immune response induced by it and of the role of the various viral antigens in inducing such a response. We have constructed mutants of PrV [strain PrV (Ka)] that differ from each other only in expression of the viral nonessential glycoproteins gI, gp63, gX, and gIII (i.e., are otherwise isogenic). These mutants were used to ascertain the importance of each of the nonessential glycoproteins in eliciting a PrV-specific cytotoxic T-lymphocyte (CTL) response in mice and pigs. Immunization of DBA/2 mice and pigs with a thymidine kinase-deficient (TK-) mutant of PrV elicits the formation of cytotoxic cells that specifically lyse syngeneic infected target cells. These PrV-specific cytolytic cells have the phenotype of major histocompatibility complex class I antigen-restricted CTLs. The relative number of CTLs specific for glycoproteins gI, gp63, gX, and gIII induced in mice vaccinated with a TK- mutant of PrV was ascertained by comparing their levels of cytotoxicity against syngeneic cells infected with either wild-type virus or gI-/gp63-, gX-, or gIII- virus deletion mutants. The PrV-specific CLTs were significantly less effective in lysing gIII(-)-infected targets than in lysing gI-/gp63-, gX-, or wild-type-infected targets. The in vitro secondary CTL response of lymphocytes obtained from either mice or pigs 6 or more weeks after immunization with a TK- mutant of PrV was also tested. Lymphocytes obtained from these animals were cultured with different glycoprotein-deficient mutants of PrV, and their cytolytic activities against wild-type-infected targets were ascertained. The importance of each of the nonessential viral glycoproteins in eliciting CTLs was assessed from the effectiveness of each of the virus mutants to

Cost effectiveness of a targeted age-based West Nile virus vaccination program.

PubMed

Shankar, Manjunath B; Staples, J Erin; Meltzer, Martin I; Fischer, Marc

2017-05-25

West Nile virus (WNV) is the leading cause of domestically-acquired arboviral disease in the United States. Several WNV vaccines are in various stages of development. We estimate the cost-effectiveness of WNV vaccination programs targeting groups at increased risk for severe WNV disease. We used a mathematical model to estimate costs and health outcomes of vaccination with WNV vaccine compared to no vaccination among seven cohorts, spaced at 10year intervals from ages 10 to 70years, each followed until 90-years-old. U.S. surveillance data were used to estimate WNV neuroinvasive disease incidence. Data for WNV seroprevalence, acute and long-term care costs of WNV disease patients, quality-adjusted life-years (QALYs), and vaccine characteristics were obtained from published reports. We assumed vaccine efficacy to either last lifelong or for 10years with booster doses given every 10years. There was a statistically significant difference in cost-effectiveness ratios across cohorts in both models and all outcomes assessed (Kruskal-Wallis test p<0.0001). The 60-year-cohort had a mean cost per neuroinvasive disease case prevented of $664,000 and disability averted of $1,421,000 in lifelong model and $882,000 and $1,887,000, respectively in 10-year immunity model; these costs were statistically significantly lower than costs for other cohorts (p<0.0001). Vaccinating 70-year-olds had the lowest cost per death averted in both models at around $4.7 million (95%CI $2-$8 million). Cost per disease case averted was lowest among 40- and 50-year-old cohorts and cost per QALY saved lowest among 60-year cohorts in lifelong immunity model. The models were most sensitive to disease incidence, vaccine cost, and proportion of persons developing disease among infected. Age-based WNV vaccination program targeting those at higher risk for severe disease is more cost-effective than universal vaccination. Annual variation in WNV disease incidence, QALY weights, and vaccine costs impact the

Flaviviridae virus nonstructural proteins 5 and 5A mediate viral immune evasion and are promising targets in drug development.

PubMed

Chen, Shun; Yang, Chao; Zhang, Wei; Mahalingam, Suresh; Wang, Mingshu; Cheng, Anchun

2018-05-06

Infections with viruses in the Flaviviridae family have a vast global and economic impact because of the high morbidity and mortality. The pathogenesis of Flaviviridae infections is very complex and not fully understood because these viruses can inhibit multiple immune pathways including the complement system, NK cells, and IFN induction and signalling pathways. The non-structural (NS) 5 and 5A proteins of Flaviviridae viruses are highly conserved and play an important role in resisting host immunity through various evasion mechanisms. This review summarizes the strategies used by the NS5 and 5A proteins of Flaviviridae viruses for evading the innate immune response by inhibiting pattern recognition receptor (PRR) signalling pathways (TLR/MyD88, IRF7), suppressing interferon (IFN) signalling pathways (IFN-γRs, STAT1, STAT2), and impairing the function of IFN-stimulated genes (ISGs) (e.g. protein kinase R [PKR], oligoadenylate synthase [OAS]). All of these immune evasion mechanisms depend on the interaction of NS5 or NS5A with cellular proteins, such as MyD88 and IRF7, IFN-αRs, IFN-γRs, STAT1, STAT2, PKR and OAS. NS5 is the most attractive target for the discovery of broad spectrum compounds against Flaviviridae virus infection. The methyltransferase (MTase) and RNA-dependent RNA polymerase (RdRp) activities of NS5 are the main therapeutic targets for antiviral drugs against Flaviviridae virus infection. Based on our site mapping, the sites involved in immune evasion provide some potential and promising targets for further novel antiviral therapeutics. Copyright © 2018 Elsevier Inc. All rights reserved.

Interface of physics and biology: engineering virus-based nanoparticles for biophotonics.

PubMed

Wen, Amy M; Infusino, Melissa; De Luca, Antonio; Kernan, Daniel L; Czapar, Anna E; Strangi, Giuseppe; Steinmetz, Nicole F

2015-01-21

Virus-based nanoparticles (VNPs) have been used for a wide range of applications, spanning basic materials science and translational medicine. Their propensity to self-assemble into precise structures that offer a three-dimensional scaffold for functionalization has led to their use as optical contrast agents and related biophotonics applications. A number of fluorescently labeled platforms have been developed and their utility in optical imaging demonstrated, yet their optical properties have not been investigated in detail. In this study, two VNPs of varying architectures were compared side-by-side to determine the impact of dye density, dye localization, conjugation chemistry, and microenvironment on the optical properties of the probes. Dyes were attached to icosahedral cowpea mosaic virus (CPMV) and rod-shaped tobacco mosaic virus (TMV) through a range of chemistries to target particular side chains displayed at specific locations around the virus. The fluorescence intensity and lifetime of the particles were determined, first using photochemical experiments on the benchtop, and second in imaging experiments using tissue culture experiments. The virus-based optical probes were found to be extraordinarily robust under ultrashort, pulsed laser light conditions with a significant amount of excitation energy, maintaining structural and chemical stability. The most effective fluorescence output was achieved through dye placement at optimized densities coupled to the exterior surface avoiding conjugated ring systems. Lifetime measurements indicate that fluorescence output depends not only on spacing the fluorophores, but also on dimer stacking and configurational changes leading to radiationless relaxation-and these processes are related to the conjugation chemistry and nanoparticle shape. For biological applications, the particles were also examined in tissue culture, from which it was found that the optical properties differed from those found on the benchtop due

Eilat virus host range restriction is present at multiple levels of the virus life cycle.

PubMed

Nasar, Farooq; Gorchakov, Rodion V; Tesh, Robert B; Weaver, Scott C

2015-01-15

Most alphaviruses are mosquito-borne and exhibit a broad host range, infecting many different vertebrates, including birds, rodents, equids, humans, and nonhuman primates. This ability of most alphaviruses to infect arthropods and vertebrates is essential for their maintenance in nature. Recently, a new alphavirus, Eilat virus (EILV), was described, and in contrast to all other mosquito-borne viruses, it is unable to replicate in vertebrate cell lines. Investigations into the nature of its host range restriction showed the inability of genomic EILV RNA to replicate in vertebrate cells. Here, we investigated whether the EILV host range restriction is present at the entry level and further explored the viral factors responsible for the lack of genomic RNA replication. Utilizing Sindbis virus (SINV) and EILV chimeras, we show that the EILV vertebrate host range restriction is also manifested at the entry level. Furthermore, the EILV RNA replication restriction is independent of the 3' untranslated genome region (UTR). Complementation experiments with SINV suggested that RNA replication is restricted by the inability of the EILV nonstructural proteins to form functional replicative complexes. These data demonstrate that the EILV host range restriction is multigenic, involving at least one gene from both nonstructural protein (nsP) and structural protein (sP) open reading frames (ORFs). As EILV groups phylogenetically within the mosquito-borne virus clade of pathogenic alphaviruses, our findings have important evolutionary implications for arboviruses. Our work explores the nature of host range restriction of the first "mosquito-only alphavirus," EILV. EILV is related to pathogenic mosquito-borne viruses (Eastern equine encephalitis virus [EEEV], Western equine encephalitis virus [WEEV], Venezuelan equine encephalitis virus [VEEV], and Chikungunya virus [CHIKV]) that cause severe disease in humans. Our data demonstrate that EILV is restricted both at entry and genomic

Viperin Restricts Zika Virus and Tick-Borne Encephalitis Virus Replication by Targeting NS3 for Proteasomal Degradation.

PubMed

Panayiotou, Christakis; Lindqvist, Richard; Kurhade, Chaitanya; Vonderstein, Kirstin; Pasto, Jenny; Edlund, Karin; Upadhyay, Arunkumar S; Överby, Anna K

2018-04-01

Flaviviruses are arthropod-borne viruses that constitute a major global health problem, with millions of human infections annually. Their pathogenesis ranges from mild illness to severe manifestations such as hemorrhagic fever and fatal encephalitis. Type I interferons (IFNs) are induced in response to viral infection and stimulate the expression of interferon-stimulated genes (ISGs), including that encoding viperin (virus-inhibitory protein, endoplasmic reticulum associated, IFN inducible), which shows antiviral activity against a broad spectrum of viruses, including several flaviviruses. Here we describe a novel antiviral mechanism employed by viperin against two prominent flaviviruses, tick-borne encephalitis virus (TBEV) and Zika virus (ZIKV). Viperin was found to interact and colocalize with the structural proteins premembrane (prM) and envelope (E) of TBEV, as well as with nonstructural (NS) proteins NS2A, NS2B, and NS3. Interestingly, viperin expression reduced the NS3 protein level, and the stability of the other interacting viral proteins, but only in the presence of NS3. We also found that although viperin interacted with NS3 of mosquito-borne flaviviruses (ZIKV, Japanese encephalitis virus, and yellow fever virus), only ZIKV was sensitive to the antiviral effect of viperin. This sensitivity correlated with viperin's ability to induce proteasome-dependent degradation of NS3. ZIKV and TBEV replication was rescued completely when NS3 was overexpressed, suggesting that the viral NS3 is the specific target of viperin. In summary, we present here a novel antiviral mechanism of viperin that is selective for specific viruses in the genus Flavivirus , affording the possible availability of new drug targets that can be used for therapeutic intervention. IMPORTANCE Flaviviruses are a group of enveloped RNA viruses that cause severe diseases in humans and animals worldwide, but no antiviral treatment is yet available. Viperin, a host protein produced in response to

Recombinant vesicular stomatitis virus-based vaccines against Ebola and Marburg virus infections.

PubMed

Geisbert, Thomas W; Feldmann, Heinz

2011-11-01

The filoviruses, Marburg virus and Ebola virus, cause severe hemorrhagic fever with a high mortality rate in humans and nonhuman primates. Among the most-promising filovirus vaccines under development is a system based on recombinant vesicular stomatitis virus (rVSV) that expresses a single filovirus glycoprotein (GP) in place of the VSV glycoprotein (G). Importantly, a single injection of blended rVSV-based filovirus vaccines was shown to completely protect nonhuman primates against Marburg virus and 3 different species of Ebola virus. These rVSV-based vaccines have also shown utility when administered as a postexposure treatment against filovirus infections, and a rVSV-based Ebola virus vaccine was recently used to treat a potential laboratory exposure. Here, we review the history of rVSV-based vaccines and pivotal animal studies showing their utility in combating Ebola and Marburg virus infections.

Recombinant adeno-associated virus targets passenger gene expression to cones in primate retina

NASA Astrophysics Data System (ADS)

Mancuso, Katherine; Hendrickson, Anita E.; Connor, Thomas B., Jr.; Mauck, Matthew C.; Kinsella, James J.; Hauswirth, William W.; Neitz, Jay; Neitz, Maureen

2007-05-01

Recombinant adeno-associated virus (rAAV) is a promising vector for gene therapy of photoreceptor-based diseases. Previous studies have demonstrated that rAAV serotypes 2 and 5 can transduce both rod and cone photoreceptors in rodents and dogs, and it can target rods, but not cones in primates. Here we report that using a human cone-specific enhancer and promoter to regulate expression of a green fluorescent protein (GFP) reporter gene in an rAAV-5 vector successfully targeted expression of the reporter gene to primate cones, and the time course of GFP expression was able to be monitored in a living animal using the RetCam II digital imaging system.

MicroRNA-Based Attenuation of Influenza Virus across Susceptible Hosts.

PubMed

Waring, Barbara M; Sjaastad, Louisa E; Fiege, Jessica K; Fay, Elizabeth J; Reyes, Ismarc; Moriarity, Branden; Langlois, Ryan A

2018-01-15

Influenza A virus drives significant morbidity and mortality in humans and livestock. Annual circulation of the virus in livestock and waterfowl contributes to severe economic disruption and increases the risk of zoonotic transmission of novel strains into the human population, where there is no preexisting immunity. Seasonal vaccinations in humans help prevent infection and can reduce symptoms when infection does occur. However, current vaccination regimens available for livestock are limited in part due to safety concerns regarding reassortment/recombination with circulating strains. Therefore, inactivated vaccines are used instead of the more immunostimulatory live attenuated vaccines. MicroRNAs (miRNAs) have been used previously to generate attenuated influenza A viruses for use as a vaccine. Here, we systematically targeted individual influenza gene mRNAs using the same miRNA to determine the segment(s) that yields maximal attenuation potential. This analysis demonstrated that targeting of NP mRNA most efficiently ablates replication. We further increased the plasticity of miRNA-mediated attenuation of influenza A virus by exploiting a miRNA, miR-21, that is ubiquitously expressed across influenza-susceptible hosts. In order to construct this targeted virus, we used CRISPR/Cas9 to eliminate the universally expressed miR-21 from MDCK cells. miR-21-targeted viruses were attenuated in human, mouse, canine, and avian cells and drove protective immunity in mice. This strategy has the potential to enhance the safety of live attenuated vaccines in humans and zoonotic reservoirs. IMPORTANCE Influenza A virus circulates annually in both avian and human populations, causing significant morbidity, mortality, and economic burden. High incidence of zoonotic infections greatly increases the potential for transmission to humans, where no preexisting immunity or vaccine exists. There is a critical need for new vaccine strategies to combat emerging influenza outbreaks. Micro

RNase L targets distinct sites in influenza A virus RNAs.

PubMed

Cooper, Daphne A; Banerjee, Shuvojit; Chakrabarti, Arindam; García-Sastre, Adolfo; Hesselberth, Jay R; Silverman, Robert H; Barton, David J

2015-03-01

Influenza A virus (IAV) infections are influenced by type 1 interferon-mediated antiviral defenses and by viral countermeasures to these defenses. When IAV NS1 protein is disabled, RNase L restricts virus replication; however, the RNAs targeted for cleavage by RNase L under these conditions have not been defined. In this study, we used deep-sequencing methods to identify RNase L cleavage sites within host and viral RNAs from IAV PR8ΔNS1-infected A549 cells. Short hairpin RNA knockdown of RNase L allowed us to distinguish between RNase L-dependent and RNase L-independent cleavage sites. RNase L-dependent cleavage sites were evident at discrete locations in IAV RNA segments (both positive and negative strands). Cleavage in PB2, PB1, and PA genomic RNAs suggests that viral RNPs are susceptible to cleavage by RNase L. Prominent amounts of cleavage mapped to specific regions within IAV RNAs, including some areas of increased synonymous-site conservation. Among cellular RNAs, RNase L-dependent cleavage was most frequent at precise locations in rRNAs. Our data show that RNase L targets specific sites in both host and viral RNAs to restrict influenza virus replication when NS1 protein is disabled. RNase L is a critical component of interferon-regulated and double-stranded-RNA-activated antiviral host responses. We sought to determine how RNase L exerts its antiviral activity during influenza virus infection. We enhanced the antiviral activity of RNase L by disabling a viral protein, NS1, that inhibits the activation of RNase L. Then, using deep-sequencing methods, we identified the host and viral RNAs targeted by RNase L. We found that RNase L cleaved viral RNAs and rRNAs at very precise locations. The direct cleavage of IAV RNAs by RNase L highlights an intimate battle between viral RNAs and an antiviral endonuclease. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Virus-Based MicroRNA Silencing in Plants1[C][W][OPEN

PubMed Central

Sha, Aihua; Zhao, Jinping; Yin, Kangquan; Tang, Yang; Wang, Yan; Wei, Xiang; Hong, Yiguo; Liu, Yule

2014-01-01

MicroRNAs (miRNAs) play pivotal roles in various biological processes across kingdoms. Many plant miRNAs have been experimentally identified or predicted by bioinformatics mining of small RNA databases. However, the functions of these miRNAs remain largely unknown due to the lack of effective genetic tools. Here, we report a virus-based microRNA silencing (VbMS) system that can be used for functional analysis of plant miRNAs. VbMS is performed through tobacco rattle virus-based expression of miRNA target mimics to silence endogenous miRNAs. VbMS of either miR172 or miR165/166 caused developmental defects in Nicotiana benthamiana. VbMS of miR319 reduced the complexity of tomato (Solanum lycopersicum) compound leaves. These results demonstrate that tobacco rattle virus-based VbMS is a powerful tool to silence endogenous miRNAs and to dissect their functions in different plant species. PMID:24296072

5-(Perylen-3-yl)Ethynyl-arabino-Uridine (aUY11), an Arabino-Based Rigid Amphipathic Fusion Inhibitor, Targets Virion Envelope Lipids To Inhibit Fusion of Influenza Virus, Hepatitis C Virus, and Other Enveloped Viruses

PubMed Central

Colpitts, Che C.; Ustinov, Alexey V.; Epand, Raquel F.; Epand, Richard M.; Korshun, Vladimir A.

2013-01-01

Entry of enveloped viruses requires fusion of viral and cellular membranes. Fusion requires the formation of an intermediate stalk structure, in which only the outer leaflets are fused. The stalk structure, in turn, requires the lipid bilayer of the envelope to bend into negative curvature. This process is inhibited by enrichment in the outer leaflet of lipids with larger polar headgroups, which favor positive curvature. Accordingly, phospholipids with such shape inhibit viral fusion. We previously identified a compound, 5-(perylen-3-yl)ethynyl-2′-deoxy-uridine (dUY11), with overall shape and amphipathicity similar to those of these phospholipids. dUY11 inhibited the formation of the negative curvature necessary for stalk formation and the fusion of a model enveloped virus, vesicular stomatitis virus (VSV). We proposed that dUY11 acted by biophysical mechanisms as a result of its shape and amphipathicity. To test this model, we have now characterized the mechanisms against influenza virus and HCV of 5-(perylen-3-yl)ethynyl-arabino-uridine (aUY11), which has shape and amphipathicity similar to those of dUY11 but contains an arabino-nucleoside. aUY11 interacted with envelope lipids to inhibit the infectivity of influenza virus, hepatitis C virus (HCV), herpes simplex virus 1 and 2 (HSV-1/2), and other enveloped viruses. It specifically inhibited the fusion of influenza virus, HCV, VSV, and even protein-free liposomes to cells. Furthermore, aUY11 inhibited the formation of negative curvature in model lipid bilayers. In summary, the arabino-derived aUY11 and the deoxy-derived dUY11 act by the same antiviral mechanisms against several enveloped but otherwise unrelated viruses. Therefore, chemically unrelated compounds of appropriate shape and amphipathicity target virion envelope lipids to inhibit formation of the negative curvature required for fusion, inhibiting infectivity by biophysical, not biochemical, mechanisms. PMID:23283943

Mouse superkiller‐2‐like helicase DDX60 is dispensable for type I IFN induction and immunity to multiple viruses

PubMed Central

Goubau, Delphine; van der Veen, Annemarthe G.; Chakravarty, Probir; Lin, Rongtuan; Rogers, Neil; Rehwinkel, Jan; Deddouche, Safia; Rosewell, Ian; Hiscott, John

2015-01-01

Abstract IFN‐α/β allow cells to fight virus infection by inducing the expression of many genes that encode effectors of antiviral defense. One of these, the Ski2‐like DExH‐box helicase DDX60, was recently implicated in resistance of human cells to hepatitis C virus, as well as in induction of IFN‐α/β by retinoic acid inducible gene 1‐like receptors (RLRs) that detect the presence of RNA viruses in a cell‐intrinsic manner. Here, we sought to investigate the role of DDX60 in IFN‐α/β induction and in resistance to virus infection. Analysis of fibroblasts and myeloid cells from Ddx60‐deficient mice revealed no impairment in IFN‐α/β production in response to RLR agonists, RNA viruses, or other stimuli. Moreover, overexpression of DDX60 did not potentiate IFN induction and DDX60 did not interact with RLRs or capture RLR agonists from virally infected cells. We also failed to identify any impairment in Ddx60‐deficient murine cells or mice in resistance to infection with influenza A virus, encephalomyocarditis virus, Sindbis virus, vaccinia virus, or herpes simplex virus‐1. These results put in question the reported role of DDX60 as a broad‐acting positive regulator of RLR responses and hint at the possibility that it may function as a restriction factor highly specific for a particular virus or class of viruses. PMID:26457795

Virus-Based Nanoparticles as Versatile Nanomachines

PubMed Central

Koudelka, Kristopher J.; Pitek, Andrzej S.; Manchester, Marianne; Steinmetz, Nicole F.

2016-01-01

Nanoscale engineering is revolutionizing the way we prevent, detect, and treat diseases. Viruses have played a special role in these developments because they can function as prefabricated nanoscaffolds that have unique properties and are easily modified. The interiors of virus particles can encapsulate and protect sensitive compounds, while the exteriors can be altered to display large and small molecules in precisely defined arrays. These properties of viruses, along with their innate biocompatibility, have led to their development as actively targeted drug delivery systems that expand on and improve current pharmaceutical options. Viruses are naturally immunogenic, and antigens displayed on their surface have been used to create vaccines against pathogens and to break self-tolerance to initiate an immune response to dysfunctional proteins. Densely and specifically aligned imaging agents on viruses have allowed for high-resolution and noninvasive visualization tools to detect and treat diseases earlier than previously possible. These and future applications of viruses have created an exciting new field within the disciplines of both nanotechnology and medicine. PMID:26958921

Targeting Hidden Reservoirs of the AIDS Virus for Eradication | FNLCR Staging

Cancer.gov

Frederick National Lab scientists have developed a faster, more accurate way of pinpointing minute pockets of the AIDS virus that can hide out in infected tissue, thus exposing these remnants as targets for more definitive treatment of the infection.

Characterizing Functional Domains for TIM-Mediated Enveloped Virus Entry

PubMed Central

Moller-Tank, Sven; Albritton, Lorraine M.; Rennert, Paul D.

2014-01-01

ABSTRACT T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members were recently identified as phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance entry of Ebola virus (EBOV) and other viruses by binding PtdSer on the viral envelope, concentrating virus on the cell surface, and promoting subsequent internalization. The PtdSer-binding activity of the immunoglobulin-like variable (IgV) domain is essential for both virus binding and internalization by TIM-1. However, TIM-3, whose IgV domain also binds PtdSer, does not effectively enhance virus entry, indicating that other domains of TIM proteins are functionally important. Here, we investigate the domains supporting enhancement of enveloped virus entry, thereby defining the features necessary for a functional PVEER. Using a variety of chimeras and deletion mutants, we found that in addition to a functional PtdSer-binding domain PVEERs require a stalk domain of sufficient length, containing sequences that promote an extended structure. Neither the cytoplasmic nor the transmembrane domain of TIM-1 is essential for enhancing virus entry, provided the protein is still plasma membrane bound. Based on these defined characteristics, we generated a mimic lacking TIM sequences and composed of annexin V, the mucin-like domain of α-dystroglycan, and a glycophosphatidylinositol anchor that functioned as a PVEER to enhance transduction of virions displaying Ebola, Chikungunya, Ross River, or Sindbis virus glycoproteins. This identification of the key features necessary for PtdSer-mediated enhancement of virus entry provides a basis for more effective recognition of unknown PVEERs. IMPORTANCE T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members are recently identified phosphatidylserine (PtdSer)-mediated virus entry-enhancing receptors (PVEERs). These proteins enhance virus entry by binding the phospholipid, PtdSer, present on the viral

Development of a sensitive and quantitative diagnostic assay for fish nervous necrosis virus based on two-target real-time PCR.

PubMed

Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L

2005-10-31

The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.

Surveillance theory applied to virus detection: a case for targeted discovery

USGS Publications Warehouse

Bogich, Tiffany L.; Anthony, Simon J.; Nichols, James D.

2013-01-01

Virus detection and mathematical modeling have gone through rapid developments in the past decade. Both offer new insights into the epidemiology of infectious disease and characterization of future risk; however, modeling has not yet been applied to designing the best surveillance strategies for viral and pathogen discovery. We review recent developments and propose methods to integrate viral and pathogen discovery and mathematical modeling through optimal surveillance theory, arguing for a more targeted approach to novel virus detection guided by the principles of adaptive management and structured decision-making.

Inactivation of viruses by pasteurization at 60 °C for 10 h with and without 40% glucose as stabilizer during a new manufacturing process of α2-Macroglobulin from Cohn Fraction IV.

PubMed

Huangfu, Chaoji; Ma, Yuyuan; Jia, Junting; Lv, Maomin; Zhu, Fengxuan; Ma, Xiaowei; Zhao, Xiong; Zhang, Jingang

2017-03-01

Pasteurization is regularly used to inactivate viruses for the safety of plasma derivatives. Influence of pasteurization at 60 °C for 10 h on α2-Macroglobulin activity and virus inactivation were studied. With 40% sugar as stabilizers more than 70% α2-Macroglobulin activity was reserved after pasteurization compared with 20% in control. Glucose presented a better activity protection effect than sucrose and maltose. By pasteurization without stabilizer the virus titers of pseudorabies virus, Sindbis virus, porcine parvovirus and encephalomyocarditis virus were reduced more than 5.88 log 10 , 7.50 log 10 , 4.88 log 10 , and 5.63 log 10 respectively within 2 h. By pasteurization with 40% glucose vesicular stomatitis virus was inactivated more than 5.88 log 10 within 1 h. Only 2.71 log 10 reduction was achieved for encephalomyocarditis virus after 10 h. 40% glucose protected α2-M activity and viruses simultaneously from pasteurization. Other viral inactivation methods need to be incorporated to ensure viral safety of this manufacturing process of α2-Macroglobulin. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Mouse superkiller-2-like helicase DDX60 is dispensable for type I IFN induction and immunity to multiple viruses.

PubMed

Goubau, Delphine; van der Veen, Annemarthe G; Chakravarty, Probir; Lin, Rongtuan; Rogers, Neil; Rehwinkel, Jan; Deddouche, Safia; Rosewell, Ian; Hiscott, John; Reis E Sousa, Caetano

2015-12-01

IFN-α/β allow cells to fight virus infection by inducing the expression of many genes that encode effectors of antiviral defense. One of these, the Ski2-like DExH-box helicase DDX60, was recently implicated in resistance of human cells to hepatitis C virus, as well as in induction of IFN-α/β by retinoic acid inducible gene 1-like receptors (RLRs) that detect the presence of RNA viruses in a cell-intrinsic manner. Here, we sought to investigate the role of DDX60 in IFN-α/β induction and in resistance to virus infection. Analysis of fibroblasts and myeloid cells from Ddx60-deficient mice revealed no impairment in IFN-α/β production in response to RLR agonists, RNA viruses, or other stimuli. Moreover, overexpression of DDX60 did not potentiate IFN induction and DDX60 did not interact with RLRs or capture RLR agonists from virally infected cells. We also failed to identify any impairment in Ddx60-deficient murine cells or mice in resistance to infection with influenza A virus, encephalomyocarditis virus, Sindbis virus, vaccinia virus, or herpes simplex virus-1. These results put in question the reported role of DDX60 as a broad-acting positive regulator of RLR responses and hint at the possibility that it may function as a restriction factor highly specific for a particular virus or class of viruses. © 2015 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

Enhancing the Oncolytic Activity of CD133-Targeted Measles Virus: Receptor Extension or Chimerism with Vesicular Stomatitis Virus Are Most Effective

PubMed Central

Kleinlützum, Dina; Hanauer, Julia D. S.; Muik, Alexander; Hanschmann, Kay-Martin; Kays, Sarah-Katharina; Ayala-Breton, Camilo; Peng, Kah-Whye; Mühlebach, Michael D.; Abel, Tobias; Buchholz, Christian J.

2017-01-01

Therapy resistance and tumor recurrence are often linked to a small refractory and highly tumorigenic subpopulation of neoplastic cells, known as cancer stem cells (CSCs). A putative marker of CSCs is CD133 (prominin-1). We have previously described a CD133-targeted oncolytic measles virus (MV-CD133) as a promising approach to specifically eliminate CD133-positive tumor cells. Selectivity was introduced at the level of cell entry by an engineered MV hemagglutinin (H). The H protein was blinded for its native receptors and displayed a CD133-specific single-chain antibody fragment (scFv) as targeting domain. Interestingly, MV-CD133 was more active in killing CD133-positive tumors than the unmodified MV-NSe despite being highly selective for its target cells. To further enhance the antitumoral activity of MV-CD133, we here pursued arming technologies, receptor extension, and chimeras between MV-CD133 and vesicular stomatitis virus (VSV). All newly generated viruses including VSV-CD133 were highly selective in eliminating CD133-positive cells. MV-CD46/CD133 killed in addition CD133-negative cells being positive for the MV receptors. In an orthotopic glioma model, MV-CD46/CD133 and MVSCD-CD133, which encodes the super cytosine deaminase, were most effective. Notably, VSV-CD133 caused fatal neurotoxicity in this tumor model. Use of CD133 as receptor could be excluded as being causative. In a subcutaneous tumor model of hepatocellular cancer, VSV-CD133 revealed the most potent oncolytic activity and also significantly prolonged survival of the mice when injected intravenously. Compared to MV-CD133, VSV-CD133 infected a more than 104-fold larger area of the tumor within the same time period. Our data not only suggest new concepts and approaches toward enhancing the oncolytic activity of CD133-targeted oncolytic viruses but also raise awareness about careful toxicity testing of novel virus types. PMID:28695108

Functional requirements of the yellow fever virus capsid protein.

PubMed

Patkar, Chinmay G; Jones, Christopher T; Chang, Yu-hsuan; Warrier, Ranjit; Kuhn, Richard J

2007-06-01

Although it is known that the flavivirus capsid protein is essential for genome packaging and formation of infectious particles, the minimal requirements of the dimeric capsid protein for virus assembly/disassembly have not been characterized. By use of a trans-packaging system that involved packaging a yellow fever virus (YFV) replicon into pseudo-infectious particles by supplying the YFV structural proteins using a Sindbis virus helper construct, the functional elements within the YFV capsid protein (YFC) were characterized. Various N- and C-terminal truncations, internal deletions, and point mutations of YFC were analyzed for their ability to package the YFV replicon. Consistent with previous reports on the tick-borne encephalitis virus capsid protein, YFC demonstrates remarkable functional flexibility. Nearly 40 residues of YFC could be removed from the N terminus while the ability to package replicon RNA was retained. Additionally, YFC containing a deletion of approximately 27 residues of the C terminus, including a complete deletion of C-terminal helix 4, was functional. Internal deletions encompassing the internal hydrophobic sequence in YFC were, in general, tolerated to a lesser extent. Site-directed mutagenesis of helix 4 residues predicted to be involved in intermonomeric interactions were also analyzed, and although single mutations did not affect packaging, a YFC with the double mutation of leucine 81 and valine 88 was nonfunctional. The effects of mutations in YFC on the viability of YFV infection were also analyzed, and these results were similar to those obtained using the replicon packaging system, thus underscoring the flexibility of YFC with respect to the requirements for its functioning.

Armored long non-coding RNA MEG3 targeting EGFR based on recombinant MS2 bacteriophage virus-like particles against hepatocellular carcinoma.

PubMed

Chang, Le; Wang, Guojing; Jia, Tingting; Zhang, Lei; Li, Yulong; Han, Yanxi; Zhang, Kuo; Lin, Guigao; Zhang, Rui; Li, Jinming; Wang, Lunan

2016-04-26

Hepatocellular carcinoma (HCC) is one of the most frequently diagnosed cancers worldwide. However, the treatment of patients with HCC is particularly challenging. Long non-coding RNA maternally expressed gene 3 (MEG3) has been identified as a potential suppressor of several types of tumors, but the delivery of long RNA remains problematic, limiting its applications. In the present study, we designed a novel delivery system based on MS2 virus-like particles (VLPs) crosslinked with GE11 polypeptide. This vector was found to be fast, effective and safe for the targeted delivery of lncRNA MEG3 RNA to the epidermal growth factor receptor (EGFR)-positive HCC cell lines without the activation of EGFR downstream pathways, and significantly attenuated both in vitro and in vivo tumor cell growth. Our study also revealed that the targeted delivery was mainly dependent on clathrin-mediated endocytosis and MEG3 RNA suppresses tumor growth mainly via increasing the expression of p53 and its downstream gene GDF15, but decreasing the expression of MDM2. Thus, this vector is promising as a novel delivery system and may facilitate a new approach to lncRNA based cancer therapy.

Inhibition of Embryonic Genes to Control Colorectal Cancer Metastasis

DTIC Science & Technology

2012-09-01

smaller dynamic range and the slides are more sensitive to the vagaries of hydrolysis caused by prolonged transport during a heat wave earlier this...Sindbis virus, vesicular stomatitis virus, or avian sarcoma/leukosis virus. Retrovirology 2010, 7:3, 2010. 12. Goyvaerts C, De Groeve K, Dingemans J, et...NA934V, GE Healthcare). Protein loading was normalized against β-Tubulin. Immunofluorescence Assay De -identified formalin-fixed paraffin embedded

Elucidation of the Ebola virus VP24 cellular interactome and disruption of virus biology through targeted inhibition of host-cell protein function.

PubMed

García-Dorival, Isabel; Wu, Weining; Dowall, Stuart; Armstrong, Stuart; Touzelet, Olivier; Wastling, Jonathan; Barr, John N; Matthews, David; Carroll, Miles; Hewson, Roger; Hiscox, Julian A

2014-11-07

Viral pathogenesis in the infected cell is a balance between antiviral responses and subversion of host-cell processes. Many viral proteins specifically interact with host-cell proteins to promote virus biology. Understanding these interactions can lead to knowledge gains about infection and provide potential targets for antiviral therapy. One such virus is Ebola, which has profound consequences for human health and causes viral hemorrhagic fever where case fatality rates can approach 90%. The Ebola virus VP24 protein plays a critical role in the evasion of the host immune response and is likely to interact with multiple cellular proteins. To map these interactions and better understand the potential functions of VP24, label-free quantitative proteomics was used to identify cellular proteins that had a high probability of forming the VP24 cellular interactome. Several known interactions were confirmed, thus placing confidence in the technique, but new interactions were also discovered including one with ATP1A1, which is involved in osmoregulation and cell signaling. Disrupting the activity of ATP1A1 in Ebola-virus-infected cells with a small molecule inhibitor resulted in a decrease in progeny virus, thus illustrating how quantitative proteomics can be used to identify potential therapeutic targets.

Dengue Virus Subverts Host Innate Immunity by Targeting Adaptor Protein MAVS

PubMed Central

He, Zhenjian; Zhu, Xun; Wen, Weitao; Yuan, Jie; Hu, Yiwen; Chen, Jiahui; An, Shu; Dong, Xinhuai; Lin, Cuiji; Yu, Jianchen; Wu, Jueheng; Yang, Yi; Cai, Junchao; Li, Jun

2016-01-01

ABSTRACT Dengue virus (DENV) is the most common mosquito-borne virus infecting humans and is currently a serious global health challenge. To establish infection in its host cells, DENV must subvert the production and/or antiviral effects of interferon (IFN). The aim of this study was to understand the mechanisms by which DENV suppresses IFN production. We determined that DENV NS4A interacts with mitochondrial antiviral signaling protein (MAVS), which was previously found to activate NF-κB and IFN regulatory factor 3 (IRF3), thus inducing type I IFN in the mitochondrion-associated endoplasmic reticulum membranes (MAMs). We further demonstrated that NS4A is associated with the N-terminal CARD-like (CL) domain and the C-terminal transmembrane (TM) domain of MAVS. This association prevented the binding of MAVS to RIG-I, resulting in the repression of RIG-I-induced IRF3 activation and, consequently, the abrogation of IFN production. Collectively, our findings illustrate a new molecular mechanism by which DENV evades the host immune system and suggest new targets for anti-DENV strategies. IMPORTANCE Type I interferon (IFN) constitutes the first line of host defense against invading viruses. To successfully establish infection, dengue virus (DENV) must counteract either the production or the function of IFN. The mechanism by which DENV suppresses IFN production is poorly understood and characterized. In this study, we demonstrate that the DENV NS4A protein plays an important role in suppressing interferon production through binding MAVS and disrupting the RIG-I–MAVS interaction in mitochondrion-associated endoplasmic reticulum membranes (MAMs). Our study reveals that MAVS is a novel host target of NS4A and provides a molecular mechanism for DENV evasion of the host innate immune response. These findings have important implications for understanding the pathogenesis of DENV and may provide new insights into using NS4A as a therapeutic and/or prevention target. PMID

Zika Virus Protease: An Antiviral Drug Target.

PubMed

Kang, CongBao; Keller, Thomas H; Luo, Dahai

2017-10-01

The recent outbreak of Zika virus (ZIKV) infection has caused global concern due to its link to severe damage to the brain development of foetuses and neuronal complications in adult patients. A worldwide research effort has been undertaken to identify effective and safe treatment and vaccination options. Among the proposed viral and host components, the viral NS2B-NS3 protease represents an attractive drug target due to its essential role in the virus life cycle. Here, we outline recent progress in studies on the Zika protease. Biochemical, biophysical, and structural studies on different protease constructs provide new insight into the structure and activity of the protease. The unlinked construct displays higher enzymatic activity and better mimics the native state of the enzyme and therefore is better suited for drug discovery. Furthermore, the structure of the free enzyme adopts a closed conformation and a preformed active site. The availability of a lead fragment hit and peptide inhibitors, as well as the attainability of soakable crystals, suggest that the unlinked construct is a promising tool for drug discovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

Inhibitor designing, virtual screening, and docking studies for methyltransferase: A potential target against dengue virus

PubMed Central

Singh, Jagbir; Kumar, Mahesh; Mansuri, Rani; Sahoo, Ganesh Chandra; Deep, Aakash

2016-01-01

Aim: Aim of this work was to design and identify some S-adenosyl-L-homocysteine (SAH) analogs as inhibitors of S-adenosyl-L-methionine-dependent methyltransferase (MTase) protein using computational approaches. Introduction: According to the current scenario the dengue has been a global burden. The people are being killed by dengue virus in an abundant number. Despite of lot of research being going on dengue worldwide, there is no single drug which can kill its virus. This creates an urge for new drug target identification and designing. MTase has been reported as an effective target against dengue virus as it catalyzes an essential step in methylation and capping of viral RNA for viral replication. Materials and Methods: The crystal structure of MTase in complex with SAH was used for designing new analogs of SAH. SAH analogs designed were analyzed on the basis of docking, ADMET, and toxicity analysis done using Discovery Studio 3.5. Results: Seventeen analogs found noncarcinogenic, nonmutagenic, as well as good ADMET properties and good drug-like profile. Conclusion: These SAH analogs, inhibitors of MTase may act as drugs against dengue virus. Further synthesis and biological testing against dengue virus is under observation. PMID:27413346

Virus-Mimetic Fusogenic Exosomes for Direct Delivery of Integral Membrane Proteins to Target Cell Membranes.

PubMed

Yang, Yoosoo; Hong, Yeonsun; Nam, Gi-Hoon; Chung, Jin Hwa; Koh, Eunee; Kim, In-San

2017-04-01

An efficient system for direct delivery of integral membrane proteins is successfully developed using a new biocompatible exosome-based platform. Fusogenic exosomes harboring viral fusogen, vascular stomatitis virus (VSV)-G protein, can fuse with and modify plasma membranes in a process called "membrane editing." This can facilitate the transfer of biologically active membrane proteins into the target cell membranes both in vitro and in vivo. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Discrete virus infection model of hepatitis B virus.

PubMed

Zhang, Pengfei; Min, Lequan; Pian, Jianwei

2015-01-01

In 1996 Nowak and his colleagues proposed a differential equation virus infection model, which has been widely applied in the study for the dynamics of hepatitis B virus (HBV) infection. Biological dynamics may be described more practically by discrete events rather than continuous ones. Using discrete systems to describe biological dynamics should be reasonable. Based on one revised Nowak et al's virus infection model, this study introduces a discrete virus infection model (DVIM). Two equilibriums of this model, E1 and E2, represents infection free and infection persistent, respectively. Similar to the case of the basic virus infection model, this study deduces a basic virus reproductive number R0 independing on the number of total cells of an infected target organ. A proposed theorem proves that if the basic virus reproductive number R0<1 then the virus free equilibrium E1 is locally stable. The DVIM is more reasonable than an abstract discrete susceptible-infected-recovered model (SIRS) whose basic virus reproductive number R0 is relevant to the number of total cells of the infected target organ. As an application, this study models the clinic HBV DNA data of a patient who was accepted via anti-HBV infection therapy with drug lamivudine. The results show that the numerical simulation is good in agreement with the clinic data.

A heterotypic bystander effect for tumor cell killing after adeno-associated virus/phage-mediated, vascular-targeted suicide gene transfer.

PubMed

Trepel, Martin; Stoneham, Charlotte A; Eleftherohorinou, Hariklia; Mazarakis, Nicholas D; Pasqualini, Renata; Arap, Wadih; Hajitou, Amin

2009-08-01

Suicide gene transfer is the most commonly used cytotoxic approach in cancer gene therapy; however, a successful suicide gene therapy depends on the generation of efficient targeted systemic gene delivery vectors. We recently reported that selective systemic delivery of suicide genes such as herpes simplex virus thymidine kinase (HSVtk) to tumor endothelial cells through a novel targeted adeno-associated virus/phage vector leads to suppression of tumor growth. This marked effect has been postulated to result primarily from the death of cancer cells by hypoxia following the targeted disruption of tumor blood vessels. Here, we investigated whether an additional mechanism of action is involved. We show that there is a heterotypic "bystander" effect between endothelial cells expressing the HSVtk suicide gene and tumor cells. Treatment of cocultures of HSVtk-transduced endothelial cells and non-HSVtk-transduced tumor cells with ganciclovir results in the death of both endothelial and tumor cells. Blocking of this effect by 18alpha-glycyrrhetinic acid indicates that gap junctions between endothelial and tumor cells are largely responsible for this phenomenon. Moreover, the observed bystander killing is mediated by connexins 43 and 26, which are expressed in endothelial and tumor cell types. Finally, this heterotypic bystander effect is accompanied by a suppression of tumor growth in vivo that is independent of primary gene transfer into host-derived tumor vascular endothelium. These findings add an alternative nonmutually exclusive and potentially synergistic cytotoxic mechanism to cancer gene therapy based on targeted adeno-associated virus/phage and further support the promising role of nonmalignant tumor stromal cells as therapeutic targets.

Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration

PubMed Central

De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.

2014-01-01

ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411

Oncolytic Adenoviruses Targeted to Human Papilloma Virus-Positive Head and Neck Squamous Cell Carcinomas

PubMed Central

LaRocca, Christopher J.; Han, Joohee; Oliveira, Amanda R.; Davydova, Julia; Herzberg, Mark; Gopalakrishnan, Rajaram; Yamamoto, Masato

2016-01-01

Objectives In recent years, the incidence of Human Papilloma Virus (HPV)-positive head and neck squamous cell carcinomas (HNSCC) has markedly increased. Our aim was to design a novel therapeutic agent through the use of conditionally replicative adenoviruses (CRAds) that are targeted to the HPV E6 and E7 oncoproteins. Methods Each adenovirus included small deletion(s) in the E1a region of the genome (Δ24 or CB016) intended to allow for selective replication in HPV-positive cells. In vitro assays were performed to analyze the transduction efficiency of the vectors and the cell viability following viral infection. Then, the UPCI SCC 090 cell line (HPV-positive) was used to establish subcutaneous tumors in the flanks of nude mice. The tumors were then treated with either one dose of the virus or four doses (injected every fourth day). Results The transduction analysis with luciferase-expressing viruses demonstrated that the 5/3 fiber modification maximized virus infectivity. In vitro, both viruses (5/3Δ24 and 5/3CB016) demonstrated profound oncolytic effects. The 5/3CB016 virus was selective for only HPV-positive HNSCC cells, whereas the 5/3Δ24 virus killed HNSCC cells regardless of HPV status. In vivo, single injections of both viruses demonstrated anti-tumor effects until only 6–8 days following viral inoculation. However, after four viral injections, there was statistically significant reduction in tumor growth when compared to the control group (p<0.05). Conclusion CRAds targeted to HPV-positive HNSCCs demonstrated excellent in vitro and in vivo therapeutic effects, and they have the potential to be clinically translated as a novel treatment modality for this emerging disease. PMID:27086483

The Mechanism of Synchronous Precise Regulation of Two Shrimp White Spot Syndrome Virus Targets by a Viral MicroRNA

PubMed Central

He, Yaodong; Ma, Tiantian; Zhang, Xiaobo

2017-01-01

MicroRNAs (miRNAs), important factors in animal innate immunity, suppress the expressions of their target genes by binding to target mRNA’s 3′ untranslated regions (3′UTRs). However, the mechanism of synchronous regulation of multiple targets by a single miRNA remains unclear. In this study, the interaction between a white spot syndrome virus (WSSV) miRNA (WSSV-miR-N32) and its two viral targets (wsv459 and wsv322) was characterized in WSSV-infected shrimp. The outcomes indicated that WSSV-encoded miRNA (WSSV-miR-N32) significantly inhibited virus infection by simultaneously targeting wsv459 and wsv322. The silencing of wsv459 or wsv322 by siRNA led to significant decrease of WSSV copies in shrimp, showing that the two viral genes were required for WSSV infection. WSSV-miR-N32 could mediate 5′–3′ exonucleolytic digestion of its target mRNAs, which stopped at the sites of target mRNA 3′UTRs close to the sequence complementary to the miRNA seed sequence. The complementary bases (to the target mRNA sequence) of a miRNA 9th–18th non-seed sequence were essential for the miRNA targeting. Therefore, our findings presented novel insights into the mechanism of miRNA-mediated suppression of target gene expressions, which would be helpful for understanding the roles of miRNAs in innate immunity of invertebrate. PMID:29230209

The Hepatitis B Virus Ribonuclease H as a Drug Target

PubMed Central

Tavis, John E.; Lomonosova, Elena

2015-01-01

Chronic hepatitis B virus (HBV) infection is a leading cause of hepatitis, liver failure, and hepatocellular carcinoma. An outstanding vaccine is available; however the number of infections remains high. Current anti-HBV treatments with interferon α and nucleos(t)ide analogs clear the infection in only a small minority of patients, and either induce serious side-effects or are of very long duration. HBV is a small, enveloped DNA virus that replicates by reverse transcription via an RNA intermediate. The HBV ribonuclease H (RNaseH) is essential for viral replication, but it has not been exploited as a drug target. Recent low-throughput screening of compound classes with anti-Human Immunodeficiency Virus RNaseH activity led to identification of HBV RNaseH inhibitors in three different chemical families that block HBV replication. These inhibitors are promising candidates for development into new anti-HBV drugs. The RNaseH inhibitors may help improve treatment efficacy enough to clear the virus from the liver when used in combination with existing anti-HBV drugs and/or with other novel inhibitors under development. This article forms part of a symposium in Antiviral Research on “An unfinished story: from the discovery of the Australia antigen to the development of new curative therapies for hepatitis B.” PMID:25862291

Short interfering RNAs targeting a vampire-bat related rabies virus phosphoprotein mRNA.

PubMed

Ono, Ekaterina Alexandrovna Durymanova; Taniwaki, Sueli Akemi; Brandão, Paulo

The aim of this study was to assess the in vitro and in vivo effects of short-interfering RNAs (siRNAs) against rabies virus phosphoprotein (P) mRNA in a post-infection treatment for rabies as an extension of a previous report (Braz J Microbiol. 2013 Nov 15;44(3):879-82). To this end, rabies virus strain RABV-4005 (related to the Desmodus rotundus vampire bat) were used to inoculate BHK-21 cells and mice, and the transfection with each of the siRNAs was made with Lipofectamine-2000™. In vitro results showed that siRNA 360 was able to inhibit the replication of strain RABV-4005 with a 1log decrease in virus titter and 5.16-fold reduction in P mRNA, 24h post-inoculation when compared to non-treated cells. In vivo, siRNA 360 was able to induce partial protection, but with no significant difference when compared to non-treated mice. These results indicate that, despite the need for improvement for in vivo applications, P mRNA might be a target for an RNAi-based treatment for rabies. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Cellular Immune Responses against Simian T-Lymphotropic Virus Type 1 Target Tax in Infected Baboons

PubMed Central

Castro, Iris; Giret, Teresa M.; Magnani, Diogo M.; Maxwell, Helen S.; Umland, Oliver; Perry, Jessica K.; Pecotte, Jerilyn K.; Brasky, Kathleen M.; Barber, Glen N.; Desrosiers, Ronald C.

2016-01-01

ABSTRACT There are currently 5 million to 10 million human T-lymphotropic virus type 1 (HTLV-1)-infected people, and many of them will develop severe complications resulting from this infection. A vaccine is urgently needed in areas where HTLV-1 is endemic. Many vaccines are best tested in nonhuman primate animal models. As a first step in designing an effective HTLV-1 vaccine, we defined the CD8+ and CD4+ T cell response against simian T-lymphotropic virus type 1 (STLV-1), a virus closely related to HTLV-1, in olive baboons (Papio anubis). Consistent with persistent antigenic exposure, we observed that STLV-1-specific CD8+ T cells displayed an effector memory phenotype and usually expressed CD107a, gamma interferon (IFN-γ), and tumor necrosis factor alpha (TNF-α). To assess the viral targets of the cellular immune response in STLV-1-infected animals, we used intracellular cytokine staining to detect responses against overlapping peptides covering the entire STLV-1 proteome. Our results show that, similarly to humans, the baboon CD8+ T cell response narrowly targeted the Tax protein. Our findings suggest that the STLV-1-infected baboon model may recapitulate some of the important aspects of the human response against HTLV-1 and could be an important tool for the development of immune-based therapy and prophylaxis. IMPORTANCE HTLV-1 infection can lead to many different and often fatal conditions. A vaccine deployed in areas of high prevalence might reduce the incidence of HTLV-1-induced disease. Unfortunately, there are very few animal models of HTLV-1 infection useful for testing vaccine approaches. Here we describe cellular immune responses in baboons against a closely related virus, STLV-1. We show for the first time that the immune response against STLV-1 in naturally infected baboons is largely directed against the Tax protein. Similar findings in humans and the sequence similarity between the human and baboon viruses suggest that the STLV-1-infected baboon

On revealing the gene targets of Ebola virus microRNAs involved in the human skin microbiome.

PubMed

Hsu, Pei-Chun; Chiou, Bin-Hao; Huang, Chun-Ming

2018-01-01

Ebola virus, a negative-sense single-stranded RNA virus, causes severe viral hemorrhagic fever and has a high mortality rate. Histopathological and immunopathological analyses of Ebola virus have revealed that histopathological changes in skin tissue are associated with various degrees of endothelial cell swelling and necrosis. The interactions of microbes within or on a host are a crucial for the skin immune shield. The discovery of microRNAs (miRNAs) in Ebola virus implies that immune escape, endothelial cell rupture, and tissue dissolution during Ebola virus infection are a result of the effects of Ebola virus miRNAs. Keratinocytes obtained from normal skin can attach and spread through expression of the thrombospondin family of proteins, playing a role in initiation of cell-mediated immune responses in the skin. Several miRNAs have been shown to bind the 3' untranslated region of thrombospondin mRNA, thereby controlling its stability and translational activity. In this study, we discovered short RNA sequences that may act as miRNAs from Propionibacterium acnes using a practical workflow of bioinformatics methods. Subsequently, we deciphered the common target gene. These RNA sequences tended to bind to the same thrombospondin protein, THSD4, emphasizing the potential importance of the synergistic binding of miRNAs from Ebola virus, Propionibacterium acnes , and humans to the target. These results provide important insights into the molecular mechanisms of thrombospondin proteins and miRNAs in Ebola virus infection.

Prospects for nucleic acid-based therapeutics against hepatitis C virus.

PubMed

Lee, Chang Ho; Kim, Ji Hyun; Lee, Seong-Wook

2013-12-21

In this review, we discuss recent advances in nucleic acid-based therapeutic technologies that target hepatitis C virus (HCV) infection. Because the HCV genome is present exclusively in RNA form during replication, various nucleic acid-based therapeutic approaches targeting the HCV genome, such as ribozymes, aptamers, siRNAs, and antisense oligonucleotides, have been suggested as potential tools against HCV. Nucleic acids are potentially immunogenic and typically require a delivery tool to be utilized as therapeutics. These limitations have hampered the clinical development of nucleic acid-based therapeutics. However, despite these limitations, nucleic acid-based therapeutics has clinical value due to their great specificity, easy and large-scale synthesis with chemical methods, and pharmaceutical flexibility. Moreover, nucleic acid therapeutics are expected to broaden the range of targetable molecules essential for the HCV replication cycle, and therefore they may prove to be more effective than existing therapeutics, such as interferon-α and ribavirin combination therapy. This review focuses on the current status and future prospects of ribozymes, aptamers, siRNAs, and antisense oligonucleotides as therapeutic reagents against HCV.

Investigation of the role of GBF1 in the replication of positive-sense single-stranded RNA viruses.

PubMed

Ferlin, Juliette; Farhat, Rayan; Belouzard, Sandrine; Cocquerel, Laurence; Bertin, Antoine; Hober, Didier; Dubuisson, Jean; Rouillé, Yves

2018-06-20

GBF1 has emerged as a host factor required for the replication of positive-sense single-stranded RNA viruses of different families, but its mechanism of action is still unknown. GBF1 is a guanine nucleotide exchange factor for Arf family members. Recently, we identified Arf4 and Arf5 (class II Arfs) as host factors required for the replication of hepatitis C virus (HCV), a GBF1-dependent virus. To assess whether a GBF1/class II Arf pathway is conserved among positive-sense single-stranded RNA viruses, we investigated yellow fever virus (YFV), Sindbis virus (SINV), coxsackievirus B4 (CVB4) and human coronavirus 229E (HCoV-229E). We found that GBF1 is involved in the replication of these viruses. However, using siRNA or CRISPR-Cas9 technologies, it was seen that the depletion of Arf1, Arf3, Arf4 or Arf5 had no impact on viral replication. In contrast, the depletion of Arf pairs suggested that class II Arfs could be involved in HCoV-229E, YFV and SINV infection, as for HCV, but not in CVB4 infection. In addition, another Arf pair, Arf1 and Arf4, appears to be essential for YFV and SINV infection, but not for infection by other viruses. Finally, CVB4 infection was not inhibited by any combination of Arf depletion. We conclude that the mechanism of action of GBF1 in viral replication appears not to be conserved, and that a subset of positive-sense single-stranded RNA viruses from different families might require class II Arfs for their replication.

Hydrogel based QCM aptasensor for detection of avian influenza virus.

PubMed

Wang, Ronghui; Li, Yanbin

2013-04-15

The objective of this study was to develop a quartz crystal microbalance (QCM) aptasensor based on ssDNA crosslinked polymeric hydrogel for rapid, sensitive and specific detection of avian influenza virus (AIV) H5N1. A selected aptamer with high affinity and specificity against AIV H5N1 surface protein was used, and hybridization between the aptamer and ssDNA formed the crosslinker in the polymer hydrogel. The aptamer hydrogel was immobilized on the gold surface of QCM sensor using a self-assembled monolayer method. The hydrogel remained in the state of shrink if no H5N1 virus was present in the sample because of the crosslinking between the aptamer and ssDNA in the polymer network. When it exposed to target virus, the binding reaction between the aptamer and H5N1 virus caused the dissolution of the linkage between the aptamer and ssDNA, resulting in the abrupt swelling of the hydrogel. The swollen hydrogel was monitored by the QCM sensor in terms of decreased frequency. Three polymeric hydrogels with different ratio (100:1 hydrogel I, 10:1 hydrogel II, 1:1 hydrogel III) of acrylamide and the aptamer monomer were synthesized, respectively, and then were used as the QCM sensor coating material. The results showed that the developed hydrogel QCM aptasensor was capable of detecting target H5N1 virus, and among the three developed aptamer hydrogels, hydrogel III coated QCM aptasensor achieved the highest sensitivity with the detection limit of 0.0128 HAU (HA unit). The total detection time from sampling to detection was only 30 min. In comparison with the anti-H5 antibody coated QCM immunosensor, the hydrogel QCM aptasensor lowered the detection limit and reduced the detection time. Copyright © 2012 Elsevier B.V. All rights reserved.

Computational 3D structures of drug-targeting proteins in the 2009-H1N1 influenza A virus

NASA Astrophysics Data System (ADS)

Du, Qi-Shi; Wang, Shu-Qing; Huang, Ri-Bo; Chou, Kuo-Chen

2010-01-01

The neuraminidase (NA) and M2 proton channel of influenza virus are the drug-targeting proteins, based on which several drugs were developed. However these once powerful drugs encountered drug-resistant problem to the H5N1 and H1N1 flu. To address this problem, the computational 3D structures of NA and M2 proteins of 2009-H1N1 influenza virus were built using the molecular modeling technique and computational chemistry method. Based on the models the structure features of NA and M2 proteins were analyzed, the docking structures of drug-protein complexes were computed, and the residue mutations were annotated. The results may help to solve the drug-resistant problem and stimulate designing more effective drugs against 2009-H1N1 influenza pandemic.

Novel Chemokine-Based Immunotoxins for Potent and Selective Targeting of Cytomegalovirus Infected Cells

PubMed Central

Spiess, Katja; Jeppesen, Mads G.; Malmgaard-Clausen, Mikkel; Krzywkowski, Karen

2017-01-01

Immunotoxins as antiviral therapeutics are largely unexplored but have promising prospective due to their high selectivity potential and their unparalleled efficiency. One recent example targeted the virus-encoded G protein-coupled receptor US28 as a strategy for specific and efficient treatment of human cytomegalovirus (HCMV) infections. US28 is expressed on virus-infected cells and scavenge chemokines by rapid internalization. The chemokine-based fusion-toxin protein (FTP) consisted of a variant (F49A) of CX3CL1 specifically targeting US28 linked to the catalytic domain of Pseudomonas exotoxin A (PE). Here, we systematically seek to improve F49A-FTP by modifications in its three structural domains; we generated variants with (1) altered chemokine sequence (K14A, F49L, and F49E), (2) shortened and elongated linker region, and (3) modified toxin domain. Only F49L-FTP displayed higher selectivity in its binding to US28 versus CX3CR1, the endogenous receptor for CX3CL1, but this was not matched by a more selective killing of US28-expressing cells. A longer linker and different toxin variants decreased US28 affinity and selective killing. Thereby, F49A-FTP represents the best candidate for HCMV treatment. Many viruses encode internalizing receptors suggesting that not only HCMV but also, for instance, Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus may be targeted by FTPs. PMID:28251165

Novel Chemokine-Based Immunotoxins for Potent and Selective Targeting of Cytomegalovirus Infected Cells.

PubMed

Spiess, Katja; Jeppesen, Mads G; Malmgaard-Clausen, Mikkel; Krzywkowski, Karen; Kledal, Thomas N; Rosenkilde, Mette M

2017-01-01

Immunotoxins as antiviral therapeutics are largely unexplored but have promising prospective due to their high selectivity potential and their unparalleled efficiency. One recent example targeted the virus-encoded G protein-coupled receptor US28 as a strategy for specific and efficient treatment of human cytomegalovirus (HCMV) infections. US28 is expressed on virus-infected cells and scavenge chemokines by rapid internalization. The chemokine-based fusion-toxin protein (FTP) consisted of a variant (F49A) of CX 3 CL1 specifically targeting US28 linked to the catalytic domain of Pseudomonas exotoxin A (PE). Here, we systematically seek to improve F49A-FTP by modifications in its three structural domains; we generated variants with (1) altered chemokine sequence (K14A, F49L, and F49E), (2) shortened and elongated linker region, and (3) modified toxin domain. Only F49L-FTP displayed higher selectivity in its binding to US28 versus CX 3 CR1, the endogenous receptor for CX 3 CL1, but this was not matched by a more selective killing of US28-expressing cells. A longer linker and different toxin variants decreased US28 affinity and selective killing. Thereby, F49A-FTP represents the best candidate for HCMV treatment. Many viruses encode internalizing receptors suggesting that not only HCMV but also, for instance, Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus may be targeted by FTPs.

Broadly neutralizing antibodies from human survivors target a conserved site in the Ebola virus glycoprotein HR2-MPER region.

PubMed

Flyak, Andrew I; Kuzmina, Natalia; Murin, Charles D; Bryan, Christopher; Davidson, Edgar; Gilchuk, Pavlo; Gulka, Christopher P; Ilinykh, Philipp A; Shen, Xiaoli; Huang, Kai; Ramanathan, Palaniappan; Turner, Hannah; Fusco, Marnie L; Lampley, Rebecca; Kose, Nurgun; King, Hannah; Sapparapu, Gopal; Doranz, Benjamin J; Ksiazek, Thomas G; Wright, David W; Saphire, Erica Ollmann; Ward, Andrew B; Bukreyev, Alexander; Crowe, James E

2018-05-07

Ebola virus (EBOV) in humans causes a severe illness with high mortality rates. Several strategies have been developed in the past to treat EBOV infection, including the antibody cocktail ZMapp, which has been shown to be effective in nonhuman primate models of infection 1 and has been used under compassionate-treatment protocols in humans 2 . ZMapp is a mixture of three chimerized murine monoclonal antibodies (mAbs) 3-6 that target EBOV-specific epitopes on the surface glycoprotein 7,8 . However, ZMapp mAbs do not neutralize other species from the genus Ebolavirus, such as Bundibugyo virus (BDBV), Reston virus (RESTV) or Sudan virus (SUDV). Here, we describe three naturally occurring human cross-neutralizing mAbs, from BDBV survivors, that target an antigenic site in the canonical heptad repeat 2 (HR2) region near the membrane-proximal external region (MPER) of the glycoprotein. The identification of a conserved neutralizing antigenic site in the glycoprotein suggests that these mAbs could be used to design universal antibody therapeutics against diverse ebolavirus species. Furthermore, we found that immunization with a peptide comprising the HR2-MPER antigenic site elicits neutralizing antibodies in rabbits. Structural features determined by conserved residues in the antigenic site described here could inform an epitope-based vaccine design against infection caused by diverse ebolavirus species.

Inhibition of dengue virus replication by a class of small-molecule compounds that antagonize dopamine receptor d4 and downstream mitogen-activated protein kinase signaling.

PubMed

Smith, Jessica L; Stein, David A; Shum, David; Fischer, Matthew A; Radu, Constantin; Bhinder, Bhavneet; Djaballah, Hakim; Nelson, Jay A; Früh, Klaus; Hirsch, Alec J

2014-05-01

Dengue viruses (DENV) are endemic pathogens of tropical and subtropical regions that cause significant morbidity and mortality worldwide. To date, no vaccines or antiviral therapeutics have been approved for combating DENV-associated disease. In this paper, we describe a class of tricyclic small-molecule compounds-dihydrodibenzothiepines (DHBTs), identified through high-throughput screening-with potent inhibitory activity against DENV serotype 2. SKI-417616, a highly active representative of this class, displayed activity against all four serotypes of DENV, as well as against a related flavivirus, West Nile virus (WNV), and an alphavirus, Sindbis virus (SINV). This compound was characterized to determine its mechanism of antiviral activity. Investigation of the stage of the viral life cycle affected revealed that an early event in the life cycle is inhibited. Due to the structural similarity of the DHBTs to known antagonists of the dopamine and serotonin receptors, we explored the roles of two of these receptors, serotonin receptor 2A (5HTR2A) and the D4 dopamine receptor (DRD4), in DENV infection. Antagonism of DRD4 and subsequent downstream phosphorylation of epidermal growth factor receptor (EGFR)-related kinase (ERK) were found to impact DENV infection negatively, and blockade of signaling through this network was confirmed as the mechanism of anti-DENV activity for this class of compounds. The dengue viruses are mosquito-borne, reemerging human pathogens that are the etiological agents of a spectrum of febrile diseases. Currently, there are no approved therapeutic treatments for dengue-associated disease, nor is there a vaccine. This study identifies a small molecule, SKI-417616, with potent anti-dengue virus activity. Further analysis revealed that SKI-417616 acts through antagonism of the host cell dopamine D4 receptor and subsequent repression of the ERK phosphorylation pathway. These results suggest that SKI-417616, or other compounds targeting the same

Selective autophagy limits cauliflower mosaic virus infection by NBR1-mediated targeting of viral capsid protein and particles

PubMed Central

Hafrén, Anders; Macia, Jean-Luc; Love, Andrew J.; Milner, Joel J.; Drucker, Martin; Hofius, Daniel

2017-01-01

Autophagy plays a paramount role in mammalian antiviral immunity including direct targeting of viruses and their individual components, and many viruses have evolved measures to antagonize or even exploit autophagy mechanisms for the benefit of infection. In plants, however, the functions of autophagy in host immunity and viral pathogenesis are poorly understood. In this study, we have identified both anti- and proviral roles of autophagy in the compatible interaction of cauliflower mosaic virus (CaMV), a double-stranded DNA pararetrovirus, with the model plant Arabidopsis thaliana. We show that the autophagy cargo receptor NEIGHBOR OF BRCA1 (NBR1) targets nonassembled and virus particle-forming capsid proteins to mediate their autophagy-dependent degradation, thereby restricting the establishment of CaMV infection. Intriguingly, the CaMV-induced virus factory inclusions seem to protect against autophagic destruction by sequestering capsid proteins and coordinating particle assembly and storage. In addition, we found that virus-triggered autophagy prevents extensive senescence and tissue death of infected plants in a largely NBR1-independent manner. This survival function significantly extends the timespan of virus production, thereby increasing the chances for virus particle acquisition by aphid vectors and CaMV transmission. Together, our results provide evidence for the integration of selective autophagy into plant immunity against viruses and reveal potential viral strategies to evade and adapt autophagic processes for successful pathogenesis. PMID:28223514

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

2012-01-06

Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

The Npro product of classical swine fever virus and bovine viral diarrhea virus uses a conserved mechanism to target interferon regulatory factor-3.

PubMed

Seago, Julian; Hilton, Louise; Reid, Elizabeth; Doceul, Virginie; Jeyatheesan, Janan; Moganeradj, Kartykayan; McCauley, John; Charleston, Bryan; Goodbourn, Stephen

2007-11-01

Classical swine fever virus (CSFV) is a member of the genus Pestivirus in the family Flaviviridae. The N(pro) product of CSFV targets the host's innate immune response and can prevent the production of type I interferon (IFN). The mechanism by which CSFV orchestrates this inhibition was investigated and it is shown that, like the related pestivirus bovine viral diarrhea virus (BVDV), this involves the N(pro) protein targeting interferon regulatory factor-3 (IRF-3) for degradation by proteasomes and thus preventing IRF-3 from activating transcription from the IFN-beta promoter. Like BVDV, the steady-state levels of IRF-3 mRNA are not reduced markedly by CSFV infection or N(pro) overexpression. Moreover, IFN-alpha stimulation of CSFV-infected cells induces the antiviral protein MxA, indicating that, as in BVDV-infected cells, the JAK/STAT pathway is not targeted for inhibition.

Identification and Molecular Characterization of the Chloroplast Targeting Domain of Turnip yellow mosaic virus Replication Proteins

PubMed Central

Moriceau, Lucille; Jomat, Lucile; Bressanelli, Stéphane; Alcaide-Loridan, Catherine; Jupin, Isabelle

2017-01-01

Turnip yellow mosaic virus (TYMV) is a positive-strand RNA virus infecting plants. The TYMV 140K replication protein is a key organizer of viral replication complex (VRC) assembly, being responsible for recruitment of the viral polymerase and for targeting the VRCs to the chloroplast envelope where viral replication takes place. However, the structural requirements determining the subcellular localization and membrane association of this essential viral protein have not yet been defined. In this study, we investigated determinants for the in vivo chloroplast targeting of the TYMV 140K replication protein. Subcellular localization studies of deletion mutants identified a 41-residue internal sequence as the chloroplast targeting domain (CTD) of TYMV 140K; this sequence is sufficient to target GFP to the chloroplast envelope. The CTD appears to be located in the C-terminal extension of the methyltransferase domain—a region shared by 140K and its mature cleavage product 98K, which behaves as an integral membrane protein during infection. We predicted the CTD to fold into two amphipathic α-helices—a folding that was confirmed in vitro by circular dichroism spectroscopy analyses of a synthetic peptide. The importance for subcellular localization of the integrity of these amphipathic helices, and the function of 140K/98K, was demonstrated by performing amino acid substitutions that affected chloroplast targeting, membrane association and viral replication. These results establish a short internal α-helical peptide as an unusual signal for targeting proteins to the chloroplast envelope membrane, and provide new insights into membrane targeting of viral replication proteins—a universal feature of positive-strand RNA viruses. PMID:29312393

Cell-Mediated Immunity to Target the Persistent Human Immunodeficiency Virus Reservoir

PubMed Central

Montaner, Luis J.

2017-01-01

Abstract Effective clearance of virally infected cells requires the sequential activity of innate and adaptive immunity effectors. In human immunodeficiency virus (HIV) infection, naturally induced cell-mediated immune responses rarely eradicate infection. However, optimized immune responses could potentially be leveraged in HIV cure efforts if epitope escape and lack of sustained effector memory responses were to be addressed. Here we review leading HIV cure strategies that harness cell-mediated control against HIV in stably suppressed antiretroviral-treated subjects. We focus on strategies that may maximize target recognition and eradication by the sequential activation of a reconstituted immune system, together with delivery of optimal T-cell responses that can eliminate the reservoir and serve as means to maintain control of HIV spread in the absence of antiretroviral therapy (ART). As evidenced by the evolution of ART, we argue that a combination of immune-based strategies will be a superior path to cell-mediated HIV control and eradication. Available data from several human pilot trials already identify target strategies that may maximize antiviral pressure by joining innate and engineered T cell responses toward testing for sustained HIV remission and/or cure. PMID:28520969

Direct-acting Antivirals and Host-targeting Agents against the Hepatitis A Virus

PubMed Central

Kanda, Tatsuo; Nakamoto, Shingo; Wu, Shuang; Nakamura, Masato; Jiang, Xia; Haga, Yuki; Sasaki, Reina; Yokosuka, Osamu

2015-01-01

Hepatitis A virus (HAV) infection is a major cause of acute hepatitis and occasionally leads to acute liver failure in both developing and developed countries. Although effective vaccines for HAV are available, the development of new antivirals against HAV may be important for the control of HAV infection in developed countries where no universal vaccination program against HAV exists, such as Japan. There are two forms of antiviral agents against HAV: direct-acting antivirals (DAAs) and host-targeting agents (HTAs). Studies using small interfering ribonucleic acid (siRNA) have suggested that the HAV internal ribosomal entry site (IRES) is an attractive target for the control of HAV replication and infection. Among the HTAs, amantadine and interferon-lambda 1 (IL-29) inhibit HAV IRES-mediated translation and HAV replication. Janus kinase (JAK) inhibitors inhibit La protein expression, HAV IRES activity, and HAV replication. Based on this review, both DAAs and HTAs may be needed to control effectively HAV infection, and their use should continue to be explored. PMID:26623267

Distribution of O-Acetylated Sialic Acids among Target Host Tissues for Influenza Virus

PubMed Central

Barnard, Karen N.; Ossiboff, Robert J.; Khedri, Zahra; Feng, Kurtis H.; Yu, Hai; Chen, Xi; Varki, Ajit

2017-01-01

ABSTRACT Sialic acids (Sias) are important glycans displayed on the cells and tissues of many different animals and are frequent targets for binding and modification by pathogens, including influenza viruses. Influenza virus hemagglutinins bind Sias during the infection of their normal hosts, while the encoded neuraminidases and/or esterases remove or modify the Sia to allow virion release or to prevent rebinding. Sias naturally occur in a variety of modified forms, and modified Sias can alter influenza virus host tropisms through their altered interactions with the viral glycoproteins. However, the distribution of modified Sia forms and their effects on pathogen-host interactions are still poorly understood. Here we used probes developed from viral Sia-binding proteins to detect O-acetylated (4-O-acetyl, 9-O-acetyl, and 7,9-O-acetyl) Sias displayed on the tissues of some natural or experimental hosts for influenza viruses. These modified Sias showed highly variable displays between the hosts and tissues examined. The 9-O-acetyl (and 7,9-) modified Sia forms were found on cells and tissues of many hosts, including mice, humans, ferrets, guinea pigs, pigs, horses, dogs, as well as in those of ducks and embryonated chicken egg tissues and membranes, although in variable amounts. The 4-O-acetyl Sias were found in the respiratory tissues of fewer animals, being primarily displayed in the horse and guinea pig, but were not detected in humans or pigs. The results suggest that these Sia variants may influence virus tropisms by altering and selecting their cell interactions. IMPORTANCE Sialic acids (Sias) are key glycans that control or modulate many normal cell and tissue functions while also interacting with a variety of pathogens, including many different viruses. Sias are naturally displayed in a variety of different forms, with modifications at several positions that can alter their functional interactions with pathogens. In addition, Sias are often modified or

An N-targeting real-time PCR strategy for the accurate detection of spring viremia of carp virus.

PubMed

Shao, Ling; Xiao, Yu; He, Zhengkan; Gao, Longying

2016-03-01

Spring viremia of carp virus (SVCV) is a highly pathogenic agent of several economically important Cyprinidae fish species. Currently, there are no effective vaccines or drugs for this virus, and prevention of the disease mostly relies on prompt diagnosis. Previously, nested RT-PCR and RT-qPCR detection methods based on the glycoprotein gene G have been developed. However, the high genetic diversity of the G gene seriously limits the reliability of those methods. Compared with the G gene, phylogenetic analyses indicate that the nucleoprotein gene N is more conserved. Furthermore, studies in other members of the Rhabdoviridae family reveals that their gene transcription level follows the order N>P>M>G>L, indicating that an N gene based RT-PCR should have higher sensitivity. Therefore, two pairs of primers and two corresponding probes targeting the conserved regions of the N gene were designed. RT-qPCR assays demonstrated all primers and probes could detect phylogenetically distant isolates specifically and efficiently. Moreover, in artificially infected fish, the detected copy numbers of the N gene were much higher than those of the G gene in all tissues, and both the N and G gene copy numbers were highest in the kidney and spleen. Testing in 1100 farm-raised fish also showed that the N-targeting strategy was more reliable than the G-targeting methods. The method developed in this study provides a reliable tool for the rapid diagnosis of SVCV. Copyright © 2015 Elsevier B.V. All rights reserved.

A virus-based biocatalyst

NASA Astrophysics Data System (ADS)

Carette, Noëlle; Engelkamp, Hans; Akpa, Eric; Pierre, Sebastien J.; Cameron, Neil R.; Christianen, Peter C. M.; Maan, Jan C.; Thies, Jens C.; Weberskirch, Ralf; Rowan, Alan E.; Nolte, Roeland J. M.; Michon, Thierry; van Hest, Jan C. M.

2007-04-01

Virus particles are probably the most precisely defined nanometre-sized objects that can be formed by protein self-assembly. Although their natural function is the storage and transport of genetic material, they have more recently been applied as scaffolds for mineralization and as containers for the encapsulation of inorganic compounds. The reproductive power of viruses has been used to develop versatile analytical methods, such as phage display, for the selection and identification of (bio)active compounds. To date, the combined use of self-assembly and reproduction has not been used for the construction of catalytic systems. Here we describe a self-assembled system based on a plant virus that has its coat protein genetically modified to provide it with a lipase enzyme. Using single-object and bulk catalytic studies, we prove that the virus-anchored lipase molecules are catalytically active. This anchored biocatalyst, unlike man-made supported catalysts, has the capability to reproduce itself in vivo, generating many independent catalytically active copies.

Thymic Dendritic Cells Are Primary Targets for the Oncogenic Virus SL3-3

PubMed Central

Uittenbogaart, Christel H.; Law, Wendy; Leenen, Pieter J. M.; Bristol, Gregory; van Ewijk, Willem; Hays, Esther F.

1998-01-01

The murine retrovirus SL3-3 causes malignant transformation of thymocytes and thymic lymphoma in mice of the AKR and NFS strains when they are inoculated neonatally. The objective of the present study was to identify the primary target cells for the virus in the thymuses of these mice. Immunohistochemical studies of the thymus after neonatal inoculation of the SL3-3 virus showed that cells expressing the viral envelope glycoprotein (gp70+ cells) were first seen at 2 weeks of age. These virus-expressing cells were found in the cortex and at the corticomedullary junction in both mouse strains. The gp70+ cells had the morphology and immunophenotype of dendritic cells. They lacked macrophage-specific antigens. Cell separation studies showed that bright gp70+ cells were detected in a fraction enriched for dendritic cells. At 3 weeks of age, macrophages also expressed gp70. At that time, both gp70+ dendritic cells and macrophages were found at the corticomedullary junction and in foci in the thymic cortex. At no time during this 3-week period was the virus expressed in cortical and medullary epithelial cells or in thymic lymphoid cells. Infectious cell center assays indicated that cells expressing infectious virus were present in small numbers at 2 weeks after inoculation but increased at 5 weeks of age by several orders of magnitude, indicating virus spread to the thymic lymphoid cells. Thus, at 2 weeks after neonatal inoculation of SL3-3, thymic dendritic cells are the first cells to express the virus. At 3 weeks of age, macrophages also express the virus. In subsequent weeks, the virus spreads to the thymocytes. This pathway of virus expression in the thymus allows the inevitable provirus integration in a thymocyte that results in a clonal lymphoma. PMID:9811752

Mitochondrial damage elicits a TCDD-inducible poly(ADP-ribose) polymerase-mediated antiviral response

PubMed Central

Kozaki, Tatsuya; Komano, Jun; Kanbayashi, Daiki; Takahama, Michihiro; Misawa, Takuma; Satoh, Takashi; Takeuchi, Osamu; Kawai, Taro; Shimizu, Shigeomi; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya

2017-01-01

The innate immune system senses RNA viruses by pattern recognition receptors (PRRs) and protects the host from virus infection. PRRs mediate the production of immune modulatory factors and direct the elimination of RNA viruses. Here, we show a unique PRR that mediates antiviral response. Tetrachlorodibenzo-p-dioxin (TCDD)-inducible poly(ADP ribose) polymerase (TIPARP), a Cysteine3 Histidine (CCCH)-type zinc finger-containing protein, binds to Sindbis virus (SINV) RNA via its zinc finger domain and recruits an exosome to induce viral RNA degradation. TIPARP typically localizes in the nucleus, but it accumulates in the cytoplasm after SINV infection, allowing targeting of cytoplasmic SINV RNA. Redistribution of TIPARP is induced by reactive oxygen species (ROS)-dependent oxidization of the nuclear pore that affects cytoplasmic-nuclear transport. BCL2-associated X protein (BAX) and BCL2 antagonist/killer 1 (BAK1), B-cell leukemia/lymphoma 2 (BCL2) family members, mediate mitochondrial damage to generate ROS after SINV infection. Thus, TIPARP is a viral RNA-sensing PRR that mediates antiviral responses triggered by BAX- and BAK1-dependent mitochondrial damage. PMID:28213497

Discovery and early development of AVI-7537 and AVI-7288 for the treatment of Ebola virus and Marburg virus infections.

PubMed

Iversen, Patrick L; Warren, Travis K; Wells, Jay B; Garza, Nicole L; Mourich, Dan V; Welch, Lisa S; Panchal, Rekha G; Bavari, Sina

2012-11-06

There are no currently approved treatments for filovirus infections. In this study we report the discovery process which led to the development of antisense Phosphorodiamidate Morpholino Oligomers (PMOs) AVI-6002 (composed of AVI-7357 and AVI-7539) and AVI-6003 (composed of AVI-7287 and AVI-7288) targeting Ebola virus and Marburg virus respectively. The discovery process involved identification of optimal transcript binding sites for PMO based RNA-therapeutics followed by screening for effective viral gene target in mouse and guinea pig models utilizing adapted viral isolates. An evolution of chemical modifications were tested, beginning with simple Phosphorodiamidate Morpholino Oligomers (PMO) transitioning to cell penetrating peptide conjugated PMOs (PPMO) and ending with PMOplus containing a limited number of positively charged linkages in the PMO structure. The initial lead compounds were combinations of two agents targeting separate genes. In the final analysis, a single agent for treatment of each virus was selected, AVI-7537 targeting the VP24 gene of Ebola virus and AVI-7288 targeting NP of Marburg virus, and are now progressing into late stage clinical development as the optimal therapeutic candidates.

Chemovirotherapy for head and neck squamous cell carcinoma with EGFR-targeted and CD/UPRT-armed oncolytic measles virus.

PubMed

Zaoui, K; Bossow, S; Grossardt, C; Leber, M F; Springfeld, C; Plinkert, P K; Kalle, C von; Ungerechts, G

2012-03-01

First-line treatment of recurrent and/or refractory head and neck squamous cell carcinoma (HNSCC) is based on platinum, 5-fluorouracil (5-FU) and the monoclonal antiEGFR antibody cetuximab. However, in most cases this chemoimmunotherapy does not cure the disease, and more than 50% of HNSCC patients are dying because of local recurrence of the tumors. In the majority of cases, HNSCC overexpress the epidermal growth factor receptor (EGFR), and its presence is associated with a poor outcome. In this study, we engineered an EGFR-targeted oncolytic measles virus (MV), armed with the bifunctional enzyme cytosine deaminase/uracil phosphoribosyltransferase (CD/UPRT). CD/UPRT converts 5-fluorocytosine (5-FC) into the chemotherapeutic 5-FU, a mainstay of HNSCC chemotherapy. This virus efficiently replicates in and lyses primary HNSCC cells in vitro. Arming with CD/UPRT mediates efficient prodrug activation with high bystander killing of non-infected tumor cells. In mice bearing primary HNSCC xenografts, intratumoral administration of MV-antiEGFR resulted in statistically significant tumor growth delay and prolongation of survival. Importantly, combination with 5-FC is superior to virus-only treatment leading to significant tumor growth inhibition. Thus, chemovirotherapy with EGFR-targeted and CD/UPRT-armed MV is highly efficacious in preclinical settings with direct translational implications for a planned Phase I clinical trial of MV for locoregional treatment of HNSCC.

Liver toxicity of chemotherapy and targeted therapy for breast cancer patients with hepatitis virus infection.

PubMed

Liu, Yu; Li, Zhan-Yi; Li, Xi; Wang, Jia-Ni; Huang, Qun-Ai; Huang, Yong

2017-10-01

Chemotherapy has greatly improved the prognosis of breast cancer patients. However, it may also result in undesirable side effects such as hepatitis virus reactivation. Little information is available on the liver toxicity of chemotherapy and targeted therapy for breast cancer patients with hepatitis virus (HBV/HCV) infection. We performed a retrospective survey of 835 patients diagnosed with breast cancer between January 2010 and December 2015 at our institution. All patients had been screened for HBV/HCV infection at the time of breast cancer diagnosis. We retrospectively investigated the toxicity of chemotherapy and the changes in HBV/HCV load based on a medical record review. 52 patients with positive anti-HBV antibody test and 21 patients with positive anti-HCV antibody tests received chemotherapy. 762 patients without HBV and HCV infection served as the control group. The morbidity of liver toxicity and disruptions in chemotherapy attributable to liver toxicity were not significantly different among control group, HBV group and HCV groups (27.7% vs 34.6% vs 42.9%, P = 0.189 and 5.0% vs 9.6% vs 9.5%, P = 0.173, respectively). No patients presented with HBV/HCV reactivation. Breast cancer patients with HCV can be treated with chemotherapy and targeted therapy with trastuzumab. Breast cancer patients with HBV who accept antiviral therapy can be treated with chemotherapy and targeted therapy with trastuzumab and patients can benefit from prophylactic antiviral therapy before chemotherapy. However, a multidisciplinary cooperation and closely monitoring liver function during the course of chemotherapy may benefit patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of retrovirus-based reporter viruses pseudotyped with the precursor membrane and envelope glycoproteins of four serotypes of dengue viruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, H.-P.; Hsieh, S.-C.; King, C.-C.

In this study, we successfully established retrovirus-based reporter viruses pseudotyped with the precursor membrane and envelope (PrM/E) proteins of each of the four serotypes of dengue viruses, which caused the most important arboviral diseases in this century. Co-sedimentation of the dengue E protein and HIV-1 core proteins by sucrose gradient analysis of the pseudotype reporter virus of dengue virus type 2, D2(HIVluc), and detection of HIV-1 core proteins by immunoprecipitation with anti-E monoclonal antibody suggested that dengue viral proteins were incorporated into the pseudotype viral particles. The infectivity in target cells, as assessed by the luciferase activity, can be inhibitedmore » by the lysosomotropic agents, suggesting a pH-dependent mechanism of entry. Amino acid substitutions of the leucine at position 107, a critical residue at the fusion loop of E protein, with lysine resulted in severe impairment in infectivity, suggesting that entry of the pseudotype reporter virus is mediated through the fusogenic properties of E protein. With more and more dengue viral sequences available from different outbreaks worldwide, this sensitive and convenient tool has the potential to facilitate molecular characterization of the PrM/E proteins of dengue field isolates.« less

Detection of Sendai virus receptor, the ganglioside GDla, in target tissue (mouse lung)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Markwell, M.A.K.; Sato, E.

1986-05-01

Previously the authors had shown that the gangliosides GDla, GTlb, and GQlb derived from brain function as receptors for the paramyxovirus Sendai virus by their ability to induce infection when incubated with receptor-deficient cells. Analyses of MDBK, HeLa, and MDCK cells in culture demonstrated that these putative receptors were present in host cells in the quantities required for infection. The primary site of infection for Sendai virus in the whole animal is the respiratory tract, culminating in the lung. Therefore, the ganglioside content of this target organ was analyzed to determine the endogenous receptor population available to Sendai virus. Themore » total ganglioside fraction of lung was resolved into individual species by HPTLC. Gangliosides of the gangliotetraose series were identified by the specific binding of /sup 125/I-labeled tetanus and cholera toxins before and after exposure with sialidase. In this manner one of the major resorcinol-positive bands was identified as GDla. Evidence of the more complex ganglioside receptors for Sendai virus was also seen.« less

Dynamic Nucleolar Targeting of Dengue Virus Polymerase NS5 in Response to Extracellular pH

PubMed Central

Fraser, Johanna E.; Rawlinson, Stephen M.; Heaton, Steven M.

2016-01-01

ABSTRACT The nucleolar subcompartment of the nucleus is increasingly recognized as an important target of RNA viruses. Here we document for the first time the ability of dengue virus (DENV) polymerase, nonstructural protein 5 (NS5), to accumulate within the nucleolus of infected cells and to target green fluorescent protein (GFP) to the nucleolus of live transfected cells. Intriguingly, NS5 exchange between the nucleus and nucleolus is dynamically modulated by extracellular pH, responding rapidly and reversibly to pH change, in contrast to GFP alone or other nucleolar and non-nucleolar targeted protein controls. The minimal pH-sensitive nucleolar targeting region (pHNTR), sufficient to target GFP to the nucleolus in a pH-sensitive fashion, was mapped to NS5 residues 1 to 244, with mutation of key hydrophobic residues, Leu-165, Leu-167, and Val-168, abolishing pHNTR function in NS5-transfected cells, and severely attenuating DENV growth in infected cells. This is the first report of a viral protein whose nucleolar targeting ability is rapidly modulated by extracellular stimuli, suggesting that DENV has the ability to detect and respond dynamically to the extracellular environment. IMPORTANCE Infections by dengue virus (DENV) threaten 40% of the world's population yet there is no approved vaccine or antiviral therapeutic to treat infections. Understanding the molecular details that govern effective viral replication is key for the development of novel antiviral strategies. Here, we describe for the first time dynamic trafficking of DENV nonstructural protein 5 (NS5) to the subnuclear compartment, the nucleolus. We demonstrate that NS5's targeting to the nucleolus occurs in response to acidic pH, identify the key amino acid residues within NS5 that are responsible, and demonstrate that their mutation severely impairs production of infectious DENV. Overall, this study identifies a unique subcellular trafficking event and suggests that DENV is able to detect and respond

Single-Domain Antibodies Targeting Neuraminidase Protect against an H5N1 Influenza Virus Challenge

PubMed Central

Cardoso, Francisco Miguel; Ibañez, Lorena Itatí; Van den Hoecke, Silvie; De Baets, Sarah; Smet, Anouk; Roose, Kenny; Schepens, Bert; Descamps, Francis J.; Fiers, Walter; Muyldermans, Serge

2014-01-01

ABSTRACT Influenza virus neuraminidase (NA) is an interesting target of small-molecule antiviral drugs. We isolated a set of H5N1 NA-specific single-domain antibodies (N1-VHHm) and evaluated their in vitro and in vivo antiviral potential. Two of them inhibited the NA activity and in vitro replication of clade 1 and 2 H5N1 viruses. We then generated bivalent derivatives of N1-VHHm by two methods. First, we made N1-VHHb by genetically joining two N1-VHHm moieties with a flexible linker. Second, bivalent N1-VHH-Fc proteins were obtained by genetic fusion of the N1-VHHm moiety with the crystallizable region of mouse IgG2a (Fc). The in vitro antiviral potency against H5N1 of both bivalent N1-VHHb formats was 30- to 240-fold higher than that of their monovalent counterparts, with 50% inhibitory concentrations in the low nanomolar range. Moreover, single-dose prophylactic treatment with bivalent N1-VHHb or N1-VHH-Fc protected BALB/c mice against a lethal challenge with H5N1 virus, including an oseltamivir-resistant H5N1 variant. Surprisingly, an N1-VHH-Fc fusion without in vitro NA-inhibitory or antiviral activity also protected mice against an H5N1 challenge. Virus escape selection experiments indicated that one amino acid residue close to the catalytic site is required for N1-VHHm binding. We conclude that single-domain antibodies directed against influenza virus NA protect against H5N1 virus infection, and when engineered with a conventional Fc domain, they can do so in the absence of detectable NA-inhibitory activity. IMPORTANCE Highly pathogenic H5N1 viruses are a zoonotic threat. Outbreaks of avian influenza caused by these viruses occur in many parts of the world and are associated with tremendous economic loss, and these viruses can cause very severe disease in humans. In such cases, small-molecule inhibitors of the viral NA are among the few treatment options for patients. However, treatment with such drugs often results in the emergence of resistant viruses

A VLP-based vaccine targeting domain III of the West Nile virus E protein protects from lethal infection in mice.

PubMed

Spohn, Gunther; Jennings, Gary T; Martina, Byron Ee; Keller, Iris; Beck, Markus; Pumpens, Paul; Osterhaus, Albert Dme; Bachmann, Martin F

2010-07-06

Since its first appearance in the USA in 1999, West Nile virus (WNV) has spread in the Western hemisphere and continues to represent an important public health concern. In the absence of effective treatment, there is a medical need for the development of a safe and efficient vaccine. Live attenuated WNV vaccines have shown promise in preclinical and clinical studies but might carry inherent risks due to the possibility of reversion to more virulent forms. Subunit vaccines based on the large envelope (E) glycoprotein of WNV have therefore been explored as an alternative approach. Although these vaccines were shown to protect from disease in animal models, multiple injections and/or strong adjuvants were required to reach efficacy, underscoring the need for more immunogenic, yet safe DIII-based vaccines. We produced a conjugate vaccine against WNV consisting of recombinantly expressed domain III (DIII) of the E glycoprotein chemically cross-linked to virus-like particles derived from the recently discovered bacteriophage AP205. In contrast to isolated DIII protein, which required three administrations to induce detectable antibody titers in mice, high titers of DIII-specific antibodies were induced after a single injection of the conjugate vaccine. These antibodies were able to neutralize the virus in vitro and provided partial protection from a challenge with a lethal dose of WNV. Three injections of the vaccine induced high titers of virus-neutralizing antibodies, and completely protected mice from WNV infection. The immunogenicity of DIII can be strongly enhanced by conjugation to virus-like particles of the bacteriophage AP205. The superior immunogenicity of the conjugate vaccine with respect to other DIII-based subunit vaccines, its anticipated favourable safety profile and low production costs highlight its potential as an efficacious and cost-effective prophylaxis against WNV.

Virus like particle-based vaccines against emerging infectious disease viruses.

PubMed

Liu, Jinliang; Dai, Shiyu; Wang, Manli; Hu, Zhihong; Wang, Hualin; Deng, Fei

2016-08-01

Emerging infectious diseases are major threats to human health. Most severe viral disease outbreaks occur in developing regions where health conditions are poor. With increased international travel and business, the possibility of eventually transmitting infectious viruses between different countries is increasing. The most effective approach in preventing viral diseases is vaccination. However, vaccines are not currently available for numerous viral diseases. Virus-like particles (VLPs) are engineered vaccine candidates that have been studied for decades. VLPs are constructed by viral protein expression in various expression systems that promote the selfassembly of proteins into structures resembling virus particles. VLPs have antigenicity similar to that of the native virus, but are non-infectious as they lack key viral genetic material. VLP vaccines have attracted considerable research interest because they offer several advantages over traditional vaccines. Studies have shown that VLP vaccines can stimulate both humoral and cellular immune responses, which may offer effective antiviral protection. Here we review recent developments with VLP-based vaccines for several highly virulent emerging or re-emerging infectious diseases. The infectious agents discussed include RNA viruses from different virus families, such as the Arenaviridae, Bunyaviridae, Caliciviridae, Coronaviridae, Filoviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, and Togaviridae families.

Engineering Molecular Immunity Against Plant Viruses.

PubMed

Zaidi, Syed Shan-E-Ali; Tashkandi, Manal; Mahfouz, Magdy M

2017-01-01

Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections. © 2017 Elsevier Inc. All rights reserved.

Engineering adeno-associated virus 2 vectors for targeted gene delivery to atherosclerotic lesions.

PubMed

White, K; Büning, H; Kritz, A; Janicki, H; McVey, J; Perabo, L; Murphy, G; Odenthal, M; Work, L M; Hallek, M; Nicklin, S A; Baker, A H

2008-03-01

Targeted delivery of biological agents to atherosclerotic plaques may provide a novel treatment and/or useful tool for imaging of atherosclerosis in vivo. However, there are no known viral vectors that possess the desired tropism. Two plaque-targeting peptides, CAPGPSKSC (CAP) and CNHRYMQMC (CNH) were inserted into the capsid of adeno-associated virus 2 (AAV2) to assess vector retargeting. AAV2-CNH produced significantly higher levels of transduction than unmodified AAV2 in human, murine and rat endothelial cells, whereas transduction of nontarget HeLa cells was unaltered. Transduction studies and surface plasmon resonance suggest that AAV2-CNH uses membrane type 1 matrix metalloproteinase as a surface receptor. AAV2-CAP only produced higher levels of transduction in rat endothelial cells, possibly because the virus was found to be affected by proteasomal degradation. In vivo substantially higher levels of both peptide-modified AAV2 vectors was detected in the brachiocephalic artery (site of advanced atherosclerotic plaques) and aorta, whereas reduced levels were detected in all other organs examined. These results suggest that in the AAV2 platform the peptides are exposed on the capsid surface in a way that enables efficient receptor binding and so creates effective atherosclerotic plaque targeted vectors.

Novel cyclo-peptides inhibit Ebola pseudotyped virus entry by targeting primed GP protein.

PubMed

Li, Quanjie; Ma, Ling; Yi, Dongrong; Wang, Han; Wang, Jing; Zhang, Yongxin; Guo, Ying; Li, Xiaoyu; Zhou, Jinming; Shi, Yi; Gao, George F; Cen, Shan

2018-07-01

Ebola virus (EBOV) causes fatal hemorrhagic fever with high death rates in human. Currently, there are no available clinically-approved prophylactic or therapeutic treatments. The recently solved crystal structure of cleavage-primed EBOV glycoprotein (GPcl) in complex with the C domain of endosomal protein Niemann-Pick C1 (NPC1) provides a new target for the development of EBOV entry inhibitors. In this work, a computational approach using docking and molecular dynamic simulations is carried out for the rational design of peptide inhibitors. A novel cyclo-peptide (Pep-3.3) was identified to target at the late stage of EBOV entry and exhibit specific inhibitory activity against EBOV-GP pseudotyped viruses, with 50% inhibitory concentration (IC50) of 5.1 μM. In vitro binding assay and molecular simulations revealed that Pep-3.3 binds to GPcl with a KD value of 69.7 μM, through interacting with predicted residues in the hydrophobic binding pocket of GPcl. Mutation of predicted residues T83 caused resistance to Pep-3.3 inhibition in viral infectivity, providing preliminary support for the model of the peptide binding to GPcl. This study demonstrates the feasibility of inhibiting EBOV entry by targeting GPcl with peptides. Copyright © 2018 Elsevier B.V. All rights reserved.

Cell-Mediated Immunity to Target the Persistent Human Immunodeficiency Virus Reservoir.

PubMed

Riley, James L; Montaner, Luis J

2017-03-15

Effective clearance of virally infected cells requires the sequential activity of innate and adaptive immunity effectors. In human immunodeficiency virus (HIV) infection, naturally induced cell-mediated immune responses rarely eradicate infection. However, optimized immune responses could potentially be leveraged in HIV cure efforts if epitope escape and lack of sustained effector memory responses were to be addressed. Here we review leading HIV cure strategies that harness cell-mediated control against HIV in stably suppressed antiretroviral-treated subjects. We focus on strategies that may maximize target recognition and eradication by the sequential activation of a reconstituted immune system, together with delivery of optimal T-cell responses that can eliminate the reservoir and serve as means to maintain control of HIV spread in the absence of antiretroviral therapy (ART). As evidenced by the evolution of ART, we argue that a combination of immune-based strategies will be a superior path to cell-mediated HIV control and eradication. Available data from several human pilot trials already identify target strategies that may maximize antiviral pressure by joining innate and engineered T cell responses toward testing for sustained HIV remission and/or cure. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Discovery and Early Development of AVI-7537 and AVI-7288 for the Treatment of Ebola Virus and Marburg Virus Infections

PubMed Central

Iversen, Patrick L.; Warren, Travis K.; Wells, Jay B.; Garza, Nicole L.; Mourich, Dan V.; Welch, Lisa S.; Panchal, Rekha G.; Bavari, Sina

2012-01-01

There are no currently approved treatments for filovirus infections. In this study we report the discovery process which led to the development of antisense Phosphorodiamidate Morpholino Oligomers (PMOs) AVI-6002 (composed of AVI-7357 and AVI-7539) and AVI-6003 (composed of AVI-7287 and AVI-7288) targeting Ebola virus and Marburg virus respectively. The discovery process involved identification of optimal transcript binding sites for PMO based RNA-therapeutics followed by screening for effective viral gene target in mouse and guinea pig models utilizing adapted viral isolates. An evolution of chemical modifications were tested, beginning with simple Phosphorodiamidate Morpholino Oligomers (PMO) transitioning to cell penetrating peptide conjugated PMOs (PPMO) and ending with PMOplus containing a limited number of positively charged linkages in the PMO structure. The initial lead compounds were combinations of two agents targeting separate genes. In the final analysis, a single agent for treatment of each virus was selected, AVI-7537 targeting the VP24 gene of Ebola virus and AVI-7288 targeting NP of Marburg virus, and are now progressing into late stage clinical development as the optimal therapeutic candidates. PMID:23202506

Molecular cloning, overproduction, purification, and biochemical characterization of the p39 nsp2 protease domains encoded by three alphaviruses

PubMed Central

Zhang, Di; Tözsér, József; Waugh, David S.

2009-01-01

Alphaviruses cause serious diseases that pose a potential health threat to both humans and livestock. The nonstructural protein 2 (nsp2) encoded by alphaviruses is a multifunctional enzyme that is essential for viral replication and maturation. Its 39-kDa C-terminal domain (nsp2pro) is a cysteine protease that is responsible for cleaving a viral polyprotein at three sites to generate nonstructural proteins 1, 2, 3 and 4. In the present study, we evaluated nsp2pro domains from the following three sources as reagents for site-specific cleavage of fusion proteins: Venezuelan Equine Encephalitis Virus (VEEV), Semliki Forest Virus (SFV) and Sindbis Virus (SIN). All three alphavirus proteases cleaved model fusion protein substrates with high specificity but they were much less efficient enzymes than potyviral proteases from tobacco etch virus (TEV) and tobacco vein mottling virus (TVMV). Oligopeptide substrates were also cleaved with very low efficiency by the alphavirus proteases. We conclude that, in general, alphavirus nsp2pro proteases are not very useful tools for the removal of affinity tags from recombinant proteins although they do remain promising therapeutic targets for the treatment of a variety of diseases. PMID:19013248

EBNA1: Oncogenic Activity, Immune Evasion and Biochemical Functions Provide Targets for Novel Therapeutic Strategies against Epstein-Barr Virus- Associated Cancers

PubMed Central

Wilson, Joanna B.; Manet, Evelyne; Fahraeus, Robin

2018-01-01

The presence of the Epstein-Barr virus (EBV)-encoded nuclear antigen-1 (EBNA1) protein in all EBV-carrying tumours constitutes a marker that distinguishes the virus-associated cancer cells from normal cells and thereby offers opportunities for targeted therapeutic intervention. EBNA1 is essential for viral genome maintenance and also for controlling viral gene expression and without EBNA1, the virus cannot persist. EBNA1 itself has been linked to cell transformation but the underlying mechanism of its oncogenic activity has been unclear. However, recent data are starting to shed light on its growth-promoting pathways, suggesting that targeting EBNA1 can have a direct growth suppressing effect. In order to carry out its tasks, EBNA1 interacts with cellular factors and these interactions are potential therapeutic targets, where the aim would be to cripple the virus and thereby rid the tumour cells of any oncogenic activity related to the virus. Another strategy to target EBNA1 is to interfere with its expression. Controlling the rate of EBNA1 synthesis is critical for the virus to maintain a sufficient level to support viral functions, while at the same time, restricting expression is equally important to prevent the immune system from detecting and destroying EBNA1-positive cells. To achieve this balance EBNA1 has evolved a unique repeat sequence of glycines and alanines that controls its own rate of mRNA translation. As the underlying molecular mechanisms for how this repeat suppresses its own rate of synthesis in cis are starting to be better understood, new therapeutic strategies are emerging that aim to modulate the translation of the EBNA1 mRNA. If translation is induced, it could increase the amount of EBNA1-derived antigenic peptides that are presented to the major histocompatibility (MHC) class I pathway and thus, make EBV-carrying cancers better targets for the immune system. If translation is further suppressed, this would provide another means to cripple

Isolated limb perfusion with melphalan, tumour necrosis factor-alpha and oncolytic vaccinia virus improves tumour targeting and prolongs survival in a rat model of advanced extremity sarcoma.

PubMed

Pencavel, Tim D; Wilkinson, Michelle J; Mansfield, David C; Khan, Aadil A; Seth, Rohit; Karapanagiotou, Eleni M; Roulstone, Victoria; Aguilar, Richard J; Chen, Nanhai G; Szalay, Aladar A; Hayes, Andrew J; Harrington, Kevin J

2015-02-15

Isolated limb perfusion (ILP) is a treatment for advanced extremity sarcoma and in-transit melanoma. Advancing this procedure by investigating the addition of novel agents, such as cancer-selective oncolytic viruses, may improve both the therapeutic efficacy of ILP and the tumour-targeted delivery of oncolytic virotherapy. Standard in vitro assays were used to characterise single agent and combinatorial activities of melphalan, tumour necrosis factor-alpha (TNF-α) and Lister strain vaccinia virus (GLV-1h68) against BN175 rat sarcoma cells. An orthotopic model of advanced extremity sarcoma was used to evaluate survival of animals after ILP with combinations of TNF-α, melphalan and GLV-1h68. We investigated the efficiency of viral tumour delivery by ILP compared to intravenous therapy, the locoregional and systemic biodistribution of virus after ILP, and the effect of mode of administration on antibody response. The combination of melphalan and GLV-1h68 was synergistic in vitro. The addition of virus to standard ILP regimens was well tolerated and demonstrated superior tumour targeting compared to intravenous administration. Triple therapy (melphalan/TNF-α/GLV-1h68) resulted in increased tumour growth delay and enhanced survival compared to other treatment regimens. Live virus was recovered in large amounts from perfused regions, but in smaller amounts from systemic organs. The addition of oncolytic vaccinia virus to existing TNF-α/melphalan-based ILP strategies results in survival advantage in an immunocompetent rat model of advanced extremity sarcoma. Virus administered by ILP has superior tumour targeting compared to intravenous delivery. Further evaluation and clinical translation of this approach is warranted. © 2014 UICC.

Animal Viruses Probe dataset (AVPDS) for microarray-based diagnosis and identification of viruses.

PubMed

Yadav, Brijesh S; Pokhriyal, Mayank; Vasishtha, Dinesh P; Sharma, Bhaskar

2014-03-01

AVPDS (Animal Viruses Probe dataset) is a dataset of virus-specific and conserve oligonucleotides for identification and diagnosis of viruses infecting animals. The current dataset contain 20,619 virus specific probes for 833 viruses and their subtypes and 3,988 conserved probes for 146 viral genera. Dataset of virus specific probe has been divided into two fields namely virus name and probe sequence. Similarly conserved probes for virus genera table have genus, and subgroup within genus name and probe sequence. The subgroup within genus is artificially divided subgroups with no taxonomic significance and contains probes which identifies viruses in that specific subgroup of the genus. Using this dataset we have successfully diagnosed the first case of Newcastle disease virus in sheep and reported a mixed infection of Bovine viral diarrhea and Bovine herpesvirus in cattle. These dataset also contains probes which cross reacts across species experimentally though computationally they meet specifications. These probes have been marked. We hope that this dataset will be useful in microarray-based detection of viruses. The dataset can be accessed through the link https://dl.dropboxusercontent.com/u/94060831/avpds/HOME.html.

Host and viral RNA-binding proteins involved in membrane targeting, replication and intercellular movement of plant RNA virus genomes

PubMed Central

Hyodo, Kiwamu; Kaido, Masanori; Okuno, Tetsuro

2014-01-01

Many plant viruses have positive-strand RNA [(+)RNA] as their genome. Therefore, it is not surprising that RNA-binding proteins (RBPs) play important roles during (+)RNA virus infection in host plants. Increasing evidence demonstrates that viral and host RBPs play critical roles in multiple steps of the viral life cycle, including translation and replication of viral genomic RNAs, and their intra- and intercellular movement. Although studies focusing on the RNA-binding activities of viral and host proteins, and their associations with membrane targeting, and intercellular movement of viral genomes have been limited to a few viruses, these studies have provided important insights into the molecular mechanisms underlying the replication and movement of viral genomic RNAs. In this review, we briefly overview the currently defined roles of viral and host RBPs whose RNA-binding activity have been confirmed experimentally in association with their membrane targeting, and intercellular movement of plant RNA virus genomes. PMID:25071804

Glycoprotein Targeted Therapeutics: A New Era of Anti-Herpes Simplex Virus-1 Therapeutics

PubMed Central

Antoine, Thessicar; Park, Paul J.; Shukla, Deepak

2013-01-01

Herpes simplex virus type-1 (HSV-1) is among the most common human pathogens worldwide. Its entry into host cells is an intricate process that relies heavily on the ability of the viral glycoproteins to bind host cellular proteins and to efficiently mediate fusion of the virus envelope with the cell membrane. Acquisition of HSV-1 results in a lifelong latent infection. Due to the cycles of reactivation from a latent state, much emphasis has been placed on the management of infection through the use of DNA synthesis inhibitors. However, new methods are needed to provide more effective treatment at earlier phases of the viral infection and to prevent the development of drug resistance by the virus. This review outlines the infection process and the common therapeutics currently used against the fundamental stages of HSV-1 replication and fusion. The remainder of this article will focus on a new approach for HSV-1 infection control and management, the concept of glycoprotein-receptor targeting. PMID:23440920

Influenza A Virus Hemagglutinin and Neuraminidase Mutually Accelerate Their Apical Targeting through Clustering of Lipid Rafts

PubMed Central

Ohkura, Takashi; Momose, Fumitaka; Ichikawa, Reiko; Takeuchi, Kaoru

2014-01-01

ABSTRACT In polarized epithelial cells, influenza A virus hemagglutinin (HA) and neuraminidase (NA) are intrinsically associated with lipid rafts and target the apical plasma membrane for viral assembly and budding. Previous studies have indicated that the transmembrane domain (TMD) and cytoplasmic tail (CT) of HA and NA are required for association with lipid rafts, but the raft dependencies of their apical targeting are controversial. Here, we show that coexpression of HA with NA accelerated their apical targeting through accumulation in lipid rafts. HA was targeted to the apical plasma membrane even when expressed alone, but the kinetics was much slower than that of HA in infected cells. Coexpression experiments revealed that apical targeting of HA and NA was accelerated by their coexpression. The apical targeting of HA was also accelerated by coexpression with M1 but not M2. The mutations in the outer leaflet of the TMD and the deletion of the CT in HA and NA that reduced their association with lipid rafts abolished the acceleration of their apical transport, indicating that the lipid raft association is essential for efficient apical trafficking of HA and NA. An in situ proximity ligation assay (PLA) revealed that HA and NA were accumulated and clustered in the cytoplasmic compartments only when both were associated with lipid rafts. Analysis with mutant viruses containing nonraft HA/NA confirmed these findings. We further analyzed lipid raft markers by in situ PLA and suggest a possible mechanism of the accelerated apical transport of HA and NA via clustering of lipid rafts. IMPORTANCE Lipid rafts serve as sites for viral entry, particle assembly, and budding, leading to efficient viral replication. The influenza A virus utilizes lipid rafts for apical plasma membrane targeting and particle budding. The hemagglutinin (HA) and neuraminidase (NA) of influenza virus, key players for particle assembly, contain determinants for apical sorting and lipid raft

[C-terminal lysosome targeting domain of CD63 modifies cellular localization of rabies virus glycoprotein].

PubMed

Starodubova, E S; Kuzmenko, Y V; Latanova, A A; Preobrazhenskaya, O V; Karpov, V L

2017-01-01

The glycoprotein of rabies virus is the central antigen elicited the immune response to infection; therefore, the majority of developing anti-rabies vaccines are based on this protein. In order to increase the efficacy of DNA immunogen encoding rabies virus glycoprotein, the construction of chimeric protein with the CD63 domain has been proposed. The CD63 is a transmembrane protein localized on the cell surface and in lysosomes. The lysosome targeting motif GYEVM is located at its C-terminus. We used the domain that bears this motif (c-CD63) to generate chimeric glycoprotein in order to relocalize it into lysosomes. Here, it was shown that, in cells transfected with plasmid that encodes glycoprotein with c-CD63 motif at the C-terminus, the chimeric protein was predominantly observed in lysosomes and at the cell membrane where the unmodified glycoprotein is localized in the endoplasmic reticulum and at the cell surface. We suppose that current modification of the glycoprotein may improve the immunogenicity of anti-rabies DNA vaccines due to more efficient antibody production.

Protective Efficacy of the Conserved NP, PB1, and M1 Proteins as Immunogens in DNA- and Vaccinia Virus-Based Universal Influenza A Virus Vaccines in Mice

PubMed Central

Wang, Wenling; Li, Renqing; Deng, Yao; Lu, Ning; Chen, Hong; Meng, Xin; Wang, Wen; Wang, Xiuping; Yan, Kexia; Qi, Xiangrong; Zhang, Xiangmin; Xin, Wei; Lu, Zhenhua; Li, Xueren; Bian, Tao; Gao, Yingying; Tan, Wenjie

2015-01-01

The conventional hemagglutinin (HA)- and neuraminidase (NA)-based influenza vaccines need to be updated most years and are ineffective if the glycoprotein HA of the vaccine strains is a mismatch with that of the epidemic strain. Universal vaccines targeting conserved viral components might provide cross-protection and thus complement and improve conventional vaccines. In this study, we generated DNA plasmids and recombinant vaccinia viruses expressing the conserved proteins nucleoprotein (NP), polymerase basic 1 (PB1), and matrix 1 (M1) from influenza virus strain A/Beijing/30/95 (H3N2). BALB/c mice were immunized intramuscularly with a single vaccine based on NP, PB1, or M1 alone or a combination vaccine based on all three antigens and were then challenged with lethal doses of the heterologous influenza virus strain A/PR/8/34 (H1N1). Vaccines based on NP, PB1, and M1 provided complete or partial protection against challenge with 1.7 50% lethal dose (LD50) of PR8 in mice. Of the three antigens, NP-based vaccines induced protection against 5 LD50 and 10 LD50 and thus exhibited the greatest protective effect. Universal influenza vaccines based on the combination of NP, PB1, and M1 induced a strong immune response and thus might be an alternative approach to addressing future influenza virus pandemics. PMID:25834017

A web-based resource for designing therapeutics against Ebola Virus.

PubMed

Dhanda, Sandeep Kumar; Chaudhary, Kumardeep; Gupta, Sudheer; Brahmachari, Samir Kumar; Raghava, Gajendra P S

2016-04-26

In this study, we describe a web-based resource, developed for assisting the scientific community in designing an effective therapeutics against the Ebola virus. Firstly, we predicted and identified experimentally validated epitopes in each of the antigens/proteins of the five known ebolaviruses. Secondly, we generated all the possible overlapping 9mer peptides from the proteins of ebolaviruses. Thirdly, conserved peptides across all the five ebolaviruses (four human pathogenic species) with no identical sequence in the human proteome, based on 1000 Genomes project, were identified. Finally, we identified peptide or epitope-based vaccine candidates that could activate both the B- and T-cell arms of the immune system. In addition, we also identified efficacious siRNAs against the mRNA transcriptome (absent in human transcriptome) of all the five ebolaviruses. It was observed that three species can potentially be targeted by a single siRNA (19mer) and 75 siRNAs can potentially target at least two species. A web server, EbolaVCR, has been developed that incorporates all the above information and useful computational tools (http://crdd.osdd.net/oscadd/ebola/).

A web-based resource for designing therapeutics against Ebola Virus

NASA Astrophysics Data System (ADS)

Dhanda, Sandeep Kumar; Chaudhary, Kumardeep; Gupta, Sudheer; Brahmachari, Samir Kumar; Raghava, Gajendra P. S.

2016-04-01

In this study, we describe a web-based resource, developed for assisting the scientific community in designing an effective therapeutics against the Ebola virus. Firstly, we predicted and identified experimentally validated epitopes in each of the antigens/proteins of the five known ebolaviruses. Secondly, we generated all the possible overlapping 9mer peptides from the proteins of ebolaviruses. Thirdly, conserved peptides across all the five ebolaviruses (four human pathogenic species) with no identical sequence in the human proteome, based on 1000 Genomes project, were identified. Finally, we identified peptide or epitope-based vaccine candidates that could activate both the B- and T-cell arms of the immune system. In addition, we also identified efficacious siRNAs against the mRNA transcriptome (absent in human transcriptome) of all the five ebolaviruses. It was observed that three species can potentially be targeted by a single siRNA (19mer) and 75 siRNAs can potentially target at least two species. A web server, EbolaVCR, has been developed that incorporates all the above information and useful computational tools (http://crdd.osdd.net/oscadd/ebola/).

Discovery and targeted LC-MS/MS of purified polerovirus reveals differences in the virus-host interactome associated with altered aphid transmission.

PubMed

Cilia, Michelle; Peter, Kari A; Bereman, Michael S; Howe, Kevin; Fish, Tara; Smith, Dawn; Gildow, Fredrick; MacCoss, Michael J; Thannhauser, Theodore W; Gray, Stewart M

2012-01-01

Circulative transmission of viruses in the Luteoviridae, such as cereal yellow dwarf virus (CYDV), requires a series of precisely orchestrated interactions between virus, plant, and aphid proteins. Natural selection has favored these viruses to be retained in the phloem to facilitate acquisition and transmission by aphids. We show that treatment of infected oat tissue homogenate with sodium sulfite reduces transmission of the purified virus by aphids. Transmission electron microscopy data indicated no gross change in virion morphology due to treatments. However, treated virions were not acquired by aphids through the hindgut epithelial cells and were not transmitted when injected directly into the hemocoel. Analysis of virus preparations using nanoflow liquid chromatography coupled to tandem mass spectrometry revealed a number of host plant proteins co-purifying with viruses, some of which were lost following sodium sulfite treatment. Using targeted mass spectrometry, we show data suggesting that several of the virus-associated host plant proteins accumulated to higher levels in aphids that were fed on CYDV-infected plants compared to healthy plants. We propose two hypotheses to explain these observations, and these are not mutually exclusive: (a) that sodium sulfite treatment disrupts critical virion-host protein interactions required for aphid transmission, or (b) that host infection with CYDV modulates phloem protein expression in a way that is favorable for virus uptake by aphids. Importantly, the genes coding for the plant proteins associated with virus may be examined as targets in breeding cereal crops for new modes of virus resistance that disrupt phloem-virus or aphid-virus interactions.

Discovery and Targeted LC-MS/MS of Purified Polerovirus Reveals Differences in the Virus-Host Interactome Associated with Altered Aphid Transmission

PubMed Central

Howe, Kevin; Fish, Tara; Smith, Dawn; Gildow, Fredrick; MacCoss, Michael J.; Thannhauser, Theodore W.; Gray, Stewart M.

2012-01-01

Circulative transmission of viruses in the Luteoviridae, such as cereal yellow dwarf virus (CYDV), requires a series of precisely orchestrated interactions between virus, plant, and aphid proteins. Natural selection has favored these viruses to be retained in the phloem to facilitate acquisition and transmission by aphids. We show that treatment of infected oat tissue homogenate with sodium sulfite reduces transmission of the purified virus by aphids. Transmission electron microscopy data indicated no gross change in virion morphology due to treatments. However, treated virions were not acquired by aphids through the hindgut epithelial cells and were not transmitted when injected directly into the hemocoel. Analysis of virus preparations using nanoflow liquid chromatography coupled to tandem mass spectrometry revealed a number of host plant proteins co-purifying with viruses, some of which were lost following sodium sulfite treatment. Using targeted mass spectrometry, we show data suggesting that several of the virus-associated host plant proteins accumulated to higher levels in aphids that were fed on CYDV-infected plants compared to healthy plants. We propose two hypotheses to explain these observations, and these are not mutually exclusive: (a) that sodium sulfite treatment disrupts critical virion-host protein interactions required for aphid transmission, or (b) that host infection with CYDV modulates phloem protein expression in a way that is favorable for virus uptake by aphids. Importantly, the genes coding for the plant proteins associated with virus may be examined as targets in breeding cereal crops for new modes of virus resistance that disrupt phloem-virus or aphid-virus interactions. PMID:23118947

Sequence- and Interactome-Based Prediction of Viral Protein Hotspots Targeting Host Proteins: A Case Study for HIV Nef

PubMed Central

Sarmady, Mahdi; Dampier, William; Tozeren, Aydin

2011-01-01

Virus proteins alter protein pathways of the host toward the synthesis of viral particles by breaking and making edges via binding to host proteins. In this study, we developed a computational approach to predict viral sequence hotspots for binding to host proteins based on sequences of viral and host proteins and literature-curated virus-host protein interactome data. We use a motif discovery algorithm repeatedly on collections of sequences of viral proteins and immediate binding partners of their host targets and choose only those motifs that are conserved on viral sequences and highly statistically enriched among binding partners of virus protein targeted host proteins. Our results match experimental data on binding sites of Nef to host proteins such as MAPK1, VAV1, LCK, HCK, HLA-A, CD4, FYN, and GNB2L1 with high statistical significance but is a poor predictor of Nef binding sites on highly flexible, hoop-like regions. Predicted hotspots recapture CD8 cell epitopes of HIV Nef highlighting their importance in modulating virus-host interactions. Host proteins potentially targeted or outcompeted by Nef appear crowding the T cell receptor, natural killer cell mediated cytotoxicity, and neurotrophin signaling pathways. Scanning of HIV Nef motifs on multiple alignments of hepatitis C protein NS5A produces results consistent with literature, indicating the potential value of the hotspot discovery in advancing our understanding of virus-host crosstalk. PMID:21738584

Targeting Hidden Reservoirs of the AIDS Virus for Eradication | Frederick National Laboratory for Cancer Research

Cancer.gov

Frederick National Lab scientists have developed a faster, more accurate way of pinpointing minute pockets of the AIDS virus that can hide out in infected tissue, thus exposing these remnants as targets for more definitive treatment of the infection.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

PubMed

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Replication of Many Human Viruses Is Refractory to Inhibition by Endogenous Cellular MicroRNAs

PubMed Central

Bogerd, Hal P.; Skalsky, Rebecca L.; Kennedy, Edward M.; Furuse, Yuki; Whisnant, Adam W.; Flores, Omar; Schultz, Kimberly L. W.; Putnam, Nicole; Barrows, Nicholas J.; Sherry, Barbara; Scholle, Frank; Garcia-Blanco, Mariano A.; Griffin, Diane E.

2014-01-01

ABSTRACT The issue of whether viruses are subject to restriction by endogenous microRNAs (miRNAs) and/or by virus-induced small interfering RNAs (siRNAs) in infected human somatic cells has been controversial. Here, we address this question in two ways. First, using deep sequencing, we demonstrate that infection of human cells by the RNA virus dengue virus (DENV) or West Nile virus (WNV) does not result in the production of any virus-derived siRNAs or viral miRNAs. Second, to more globally assess the potential of small regulatory RNAs to inhibit virus replication, we used gene editing to derive human cell lines that lack a functional Dicer enzyme and that therefore are unable to produce miRNAs or siRNAs. Infection of these cells with a wide range of viruses, including DENV, WNV, yellow fever virus, Sindbis virus, Venezuelan equine encephalitis virus, measles virus, influenza A virus, reovirus, vesicular stomatitis virus, human immunodeficiency virus type 1, or herpes simplex virus 1 (HSV-1), failed to reveal any enhancement in the replication of any of these viruses, although HSV-1, which encodes at least eight Dicer-dependent viral miRNAs, did replicate somewhat more slowly in the absence of Dicer. We conclude that most, and perhaps all, human viruses have evolved to be resistant to inhibition by endogenous human miRNAs during productive replication and that dependence on a cellular miRNA, as seen with hepatitis C virus, is rare. How viruses have evolved to avoid inhibition by endogenous cellular miRNAs, which are generally highly conserved during metazoan evolution, remains to be determined. IMPORTANCE Eukaryotic cells express a wide range of small regulatory RNAs, including miRNAs, that have the potential to inhibit the expression of mRNAs that show sequence complementarity. Indeed, previous work has suggested that endogenous miRNAs have the potential to inhibit viral gene expression and replication. Here, we demonstrate that the replication of a wide range of

Mutagenesis of the La Crosse Virus glycoprotein supports a role for Gc (1066-1087) as the fusion peptide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plassmeyer, Matthew L.; Graduate Group Molecular and Cell Biology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-6058; Soldan, Samantha S.

The La Crosse Virus (LACV) M segment encodes two glycoproteins (Gn and Gc), and plays a critical role in the neuropathogenesis of LACV infection as the primary determinant of neuroinvasion. A recent study from our group demonstrated that the region comprising the membrane proximal two-thirds of Gc, amino acids 860-1442, is critical in mediating LACV fusion and entry. Furthermore, computational analysis identified structural similarities between a portion of this region, amino acids 970-1350, and the E1 fusion protein of two alphaviruses: Sindbis virus and Semliki Forrest virus (SFV). Within the region 970-1350, a 22-amino-acid hydrophobic segment (1066-1087) is predicted tomore » correlate structurally with the fusion peptides of class II fusion proteins. We performed site-directed mutagenesis of key amino acids in this 22-amino acid segment and determined the functional consequences of these mutations on fusion and entry. Several mutations within this hydrophobic domain affected glycoprotein expression to some extent, but all mutations either shifted the pH threshold of fusion below that of the wild-type protein, reduced fusion efficiency, or abrogated cell-to-cell fusion and pseudotype entry altogether. These results, coupled with the aforementioned computational modeling, suggest that the LACV Gc functions as a class II fusion protein and support a role for the region Gc 1066-1087 as a fusion peptide.« less

Potent influenza A virus entry inhibitors targeting a conserved region of hemagglutinin.

PubMed

Lin, Dongguo; Luo, Yinzhu; Yang, Guang; Li, Fangfang; Xie, Xiangkun; Chen, Daiwei; He, Lifang; Wang, Jingyu; Ye, Chunfeng; Lu, Shengsheng; Lv, Lin; Liu, Shuwen; He, Jian

2017-11-15

Influenza A viruses (IAVs) induce acute respiratory disease and cause significant morbidity and mortality throughout the world. With the emergence of drug-resistant viral strains, new and effective anti-IAV drugs with different modes of action are urgently needed. In this study, by conjugating cholesterol to the N-terminus of the short peptide KKWK, a lipopeptide named S-KKWK was created. The anti-IAV test indicated that S-KKWK and its derivatives displayed potent antiviral activities against a broad variety of influenza A viral strains including oseltamivir-resistant strains and clinically relevant isolates with IC 50 values ranging from 0.7 to 3.0µM. An extensive mechanistic study showed that these peptides functioned as viral "entry blockers" by inhibiting the conformational rearrangements of HA2 subunit, thereby interrupting the fusion of virus-host cell membranes. Significantly, a computer-aided docking simulation and protein sequence alignment identified conserved residues in the stem region of HA2 as the possible binding site of S-KKWK, which may be employed as a potential drug target for designing anti-IAVs with a broad-spectrum of activity. By targeting this region, a potent anti-IAV agent was subsequently created. In addition, the anti-IAV activity of S-KKWK was assessed by experiments with influenza A virus-infected mice, in which S-KKWK reduced the mortality of infected animals and extended survival time significantly. Overall, in addition to providing a strategy for designing broad-spectrum anti-IAV agents, these results indicate that S-KKWK and its derivatives are prospective candidates for potent antivirals. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of TRIM27 as a novel degradation target of herpes simplex virus 1 ICP0.

PubMed

Conwell, Sara E; White, Anne E; Harper, J Wade; Knipe, David M

2015-01-01

The herpes simplex virus 1 (HSV-1) immediate early protein ICP0 performs many functions during infection, including transactivation of viral gene expression, suppression of innate immune responses, and modification and eviction of histones from viral chromatin. Although these functions of ICP0 have been characterized, the detailed mechanisms underlying ICP0's complex role during infection warrant further investigation. We thus undertook an unbiased proteomic approach to identifying viral and cellular proteins that interact with ICP0 in the infected cell. Cellular candidates resulting from our analysis included the ubiquitin-specific protease USP7, the transcriptional repressor TRIM27, DNA repair proteins NBN and MRE11A, regulators of apoptosis, including BIRC6, and the proteasome. We also identified two HSV-1 early proteins involved in nucleotide metabolism, UL39 and UL50, as novel candidate interactors of ICP0. Because TRIM27 was the most statistically significant cellular candidate, we investigated the relationship between TRIM27 and ICP0. We observed rapid, ICP0-dependent loss of TRIM27 during HSV-1 infection. TRIM27 protein levels were restored by disrupting the RING domain of ICP0 or by inhibiting the proteasome, arguing that TRIM27 is a novel degradation target of ICP0. A mutant ICP0 lacking E3 ligase activity interacted with endogenous TRIM27 during infection as demonstrated by reciprocal coimmunoprecipitation and supported by immunofluorescence data. Surprisingly, ICP0-null mutant virus yields decreased upon TRIM27 depletion, arguing that TRIM27 has a positive effect on infection despite being targeted for degradation. These results illustrate a complex interaction between TRIM27 and viral infection with potential positive or negative effects of TRIM27 on HSV under different infection conditions. During productive infection, a virus must simultaneously redirect multiple cellular pathways to replicate itself while evading detection by the host's defenses. To

Molecular docking based screening of compounds against VP40 from Ebola virus.

PubMed

M Alam El-Din, Hanaa; A Loutfy, Samah; Fathy, Nasra; H Elberry, Mostafa; M Mayla, Ahmed; Kassem, Sara; Naqvi, Asif

2016-01-01

Ebola virus causes severe and often fatal hemorrhagic fevers in humans. The 2014 Ebola epidemic affected multiple countries. The virus matrix protein (VP40) plays a central role in virus assembly and budding. Since there is no FDA-approved vaccine or medicine against Ebola viral infection, discovering new compounds with different binding patterns against it is required. Therefore, we aim to identify small molecules that target the Arg 134 RNA binding and active site of VP40 protein. 1800 molecules were retrieved from PubChem compound database based on Structure Similarity and Conformers of pyrimidine-2, 4-dione. Molecular docking approach using Lamarckian Genetic Algorithm was carried out to find the potent inhibitors for VP40 based on calculated ligand-protein pairwise interaction energies. The grid maps representing the protein were calculated using auto grid and grid size was set to 60*60*60 points with grid spacing of 0.375 Ǻ. Ten independent docking runs were carried out for each ligand and results were clustered according to the 1.0 Ǻ RMSD criteria. The post-docking analysis showed that binding energies ranged from -8.87 to 0.6 Kcal/mol. We report 7 molecules, which showed promising ADMET results, LD-50, as well as H-bond interaction in the binding pocket. The small molecules discovered could act as potential inhibitors for VP40 and could interfere with virus assembly and budding process.

Molecular docking based screening of compounds against VP40 from Ebola virus

PubMed Central

M Alam El-Din, Hanaa; A. Loutfy, Samah; Fathy, Nasra; H Elberry, Mostafa; M Mayla, Ahmed; Kassem, Sara; Naqvi, Asif

2016-01-01

Ebola virus causes severe and often fatal hemorrhagic fevers in humans. The 2014 Ebola epidemic affected multiple countries. The virus matrix protein (VP40) plays a central role in virus assembly and budding. Since there is no FDA-approved vaccine or medicine against Ebola viral infection, discovering new compounds with different binding patterns against it is required. Therefore, we aim to identify small molecules that target the Arg 134 RNA binding and active site of VP40 protein. 1800 molecules were retrieved from PubChem compound database based on Structure Similarity and Conformers of pyrimidine-2, 4-dione. Molecular docking approach using Lamarckian Genetic Algorithm was carried out to find the potent inhibitors for VP40 based on calculated ligand-protein pairwise interaction energies. The grid maps representing the protein were calculated using auto grid and grid size was set to 60*60*60 points with grid spacing of 0.375 Ǻ. Ten independent docking runs were carried out for each ligand and results were clustered according to the 1.0 Ǻ RMSD criteria. The post-docking analysis showed that binding energies ranged from -8.87 to 0.6 Kcal/mol. We report 7 molecules, which showed promising ADMET results, LD-50, as well as H-bond interaction in the binding pocket. The small molecules discovered could act as potential inhibitors for VP40 and could interfere with virus assembly and budding process. PMID:28149054

Detection of Waterborne Viruses Using High Affinity Molecularly Imprinted Polymers.

PubMed

Altintas, Zeynep; Gittens, Micah; Guerreiro, Antonio; Thompson, Katy-Anne; Walker, Jimmy; Piletsky, Sergey; Tothill, Ibtisam E

2015-07-07

Molecularly imprinted polymers (MIPs) are artificial receptor ligands which can recognize and specifically bind to a target molecule. They are more resistant to chemical and biological damage and inactivation than antibodies. Therefore, target specific-MIP nanoparticles are aimed to develop and implemented to biosensors for the detection of biological toxic agents such as viruses, bacteria, and fungi toxins that cause many diseases and death due to the environmental contamination. For the first time, a molecularly imprinted polymer (MIP) targeting the bacteriophage MS2 as the template was investigated using a novel solid-phase synthesis method to obtain the artificial affinity ligand for the detection and removal of waterborne viruses through optical-based sensors. A high affinity between the artificial ligand and the target was found, and a regenerative MIP-based virus detection assay was successfully developed using a new surface plasmon resonance (SPR)-biosensor which provides an alternative technology for the specific detection and removal of waterborne viruses that lead to high disease and death rates all over the world.

Breast cancer vaccines delivered by dendritic cell-targeted lentivectors induce potent antitumor immune responses and protect mice from mammary tumor growth.

PubMed

Bryson, Paul D; Han, Xiaolu; Truong, Norman; Wang, Pin

2017-10-13

Breast cancer immunotherapy is a potent treatment option, with antibody therapies such as trastuzumab increasing 2-year survival rates by 50%. However, active immunotherapy through vaccination has generally been clinically ineffective. One potential means of improving vaccine therapy is by delivering breast cancer antigens to dendritic cells (DCs) for enhanced antigen presentation. To accomplish this in vivo, we pseudotyped lentiviral vector (LV) vaccines with a modified Sindbis Virus glycoprotein so that they could deliver genes encoding the breast cancer antigen alpha-lactalbumin (Lalba) or erb-b2 receptor tyrosine kinase 2 (ERBB2 or HER2) directly to resident DCs. We hypothesized that utilizing these DC-targeting lentiviral vectors asa breast cancer vaccine could lead to an improved immune response against self-antigens found in breast cancer tumors. Indeed, single injections of the vaccine vectors were able to amplify antigen-specific CD8T cells 4-6-fold over naïve mice, similar to the best published vaccine regimens. Immunization of these mice completely inhibited tumor growth in a foreign antigen environment (LV-ERBB2 in wildtype mice), and it reduced the rate of tumor growth in a self-antigen environment (LV-Lalba in wildtype or LV-ERBB2 in MMTV-huHER2 transgenic). These results show that a single injection with targeted lentiviral vectors can be an effective immunotherapy for breast cancer. Furthermore, they could be combined with other immunotherapeutic regimens to improve outcomes for patients with breast cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

PubMed Central

Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

2008-01-01

RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

PubMed

Bender, Ruben R; Muth, Anke; Schneider, Irene C; Friedel, Thorsten; Hartmann, Jessica; Plückthun, Andreas; Maisner, Andrea; Buchholz, Christian J

2016-06-01

Receptor-targeted lentiviral vectors (LVs) can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV) glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance). Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV) glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4) was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

Targeting Membrane-Bound Viral RNA Synthesis Reveals Potent Inhibition of Diverse Coronaviruses Including the Middle East Respiratory Syndrome Virus

PubMed Central

Bergström, Tomas; Kann, Nina; Adamiak, Beata; Hannoun, Charles; Kindler, Eveline; Jónsdóttir, Hulda R.; Muth, Doreen; Kint, Joeri; Forlenza, Maria; Müller, Marcel A.; Drosten, Christian; Thiel, Volker; Trybala, Edward

2014-01-01

Coronaviruses raise serious concerns as emerging zoonotic viruses without specific antiviral drugs available. Here we screened a collection of 16671 diverse compounds for anti-human coronavirus 229E activity and identified an inhibitor, designated K22, that specifically targets membrane-bound coronaviral RNA synthesis. K22 exerts most potent antiviral activity after virus entry during an early step of the viral life cycle. Specifically, the formation of double membrane vesicles (DMVs), a hallmark of coronavirus replication, was greatly impaired upon K22 treatment accompanied by near-complete inhibition of viral RNA synthesis. K22-resistant viruses contained substitutions in non-structural protein 6 (nsp6), a membrane-spanning integral component of the viral replication complex implicated in DMV formation, corroborating that K22 targets membrane bound viral RNA synthesis. Besides K22 resistance, the nsp6 mutants induced a reduced number of DMVs, displayed decreased specific infectivity, while RNA synthesis was not affected. Importantly, K22 inhibits a broad range of coronaviruses, including Middle East respiratory syndrome coronavirus (MERS–CoV), and efficient inhibition was achieved in primary human epithelia cultures representing the entry port of human coronavirus infection. Collectively, this study proposes an evolutionary conserved step in the life cycle of positive-stranded RNA viruses, the recruitment of cellular membranes for viral replication, as vulnerable and, most importantly, druggable target for antiviral intervention. We expect this mode of action to serve as a paradigm for the development of potent antiviral drugs to combat many animal and human virus infections. PMID:24874215

Aryl-substituted aminobenzimidazoles targeting the hepatitis C virus internal ribosome entry site

PubMed Central

Ding, Kejia; Wang, Annie; Boerneke, Mark A.; Dibrov, Sergey M.; Hermann, Thomas

2014-01-01

We describe the exploration of N1-aryl-substituted benzimidazoles as ligands for the hepatitis C virus (HCV) internal ribosome entry site (IRES) RNA. The design of the compounds was guided by the co-crystal structure of a benzimidazole viral translation inhibitor in complex with the RNA target. Structure-binding activity relationships of aryl-substituted benzimidazole ligands were established that were consistent with the crystal structure of the translation inhibitor complex. PMID:24856063

Proteomic Analysis of Virus-Host Interactions in an Infectious Context Using Recombinant Viruses*

PubMed Central

Komarova, Anastassia V.; Combredet, Chantal; Meyniel-Schicklin, Laurène; Chapelle, Manuel; Caignard, Grégory; Camadro, Jean-Michel; Lotteau, Vincent; Vidalain, Pierre-Olivier; Tangy, Frédéric

2011-01-01

RNA viruses exhibit small-sized genomes encoding few proteins, but still establish complex networks of interactions with host cell components to achieve replication and spreading. Ideally, these virus-host protein interactions should be mapped directly in infected cell culture, but such a high standard is often difficult to reach when using conventional approaches. We thus developed a new strategy based on recombinant viruses expressing tagged viral proteins to capture both direct and indirect physical binding partners during infection. As a proof of concept, we engineered a recombinant measles virus (MV) expressing one of its virulence factors, the MV-V protein, with a One-STrEP amino-terminal tag. This allowed virus-host protein complex analysis directly from infected cells by combining modified tandem affinity chromatography and mass spectrometry analysis. Using this approach, we established a prosperous list of 245 cellular proteins interacting either directly or indirectly with MV-V, and including four of the nine already known partners of this viral factor. These interactions were highly specific of MV-V because they were not recovered when the nucleoprotein MV-N, instead of MV-V, was tagged. Besides key components of the antiviral response, cellular proteins from mitochondria, ribosomes, endoplasmic reticulum, protein phosphatase 2A, and histone deacetylase complex were identified for the first time as prominent targets of MV-V and the critical role of the later protein family in MV replication was addressed. Most interestingly, MV-V showed some preferential attachment to essential proteins in the human interactome network, as assessed by centrality and interconnectivity measures. Furthermore, the list of MV-V interactors also showed a massive enrichment for well-known targets of other viruses. Altogether, this clearly supports our approach based on reverse genetics of viruses combined with high-throughput proteomics to probe the interaction network that

Virus Capsids as Targeted Nanoscale Delivery Vessels of Photoactive Compounds for Site-Specific Photodynamic Therapy

NASA Astrophysics Data System (ADS)

Cohen, Brian A.

The research presented in this work details the use of a viral capsid as an addressable delivery vessel of photoactive compounds for use in photodynamic therapy. Photodynamic therapy is a treatment that involves the interaction of light with a photosensitizing molecule to create singlet oxygen, a reactive oxygen species. Overproduction of singlet oxygen in cells can cause oxidative damage leading to cytotoxicity and eventually cell death. Challenges with the current generation of FDA-approved photosensitizers for photodynamic therapy primarily stem from their lack of tissue specificity. This work describes the packaging of photoactive cationic porphyrins inside the MS2 bacteriophage capsid, followed by external modification of the capsid with cancer cell-targeting G-quadruplex DNA aptamers to generate a tumor-specific photosensitizing agent. First, a cationic porphyrin is loaded into the capsids via nucleotide-driven packaging, a process that involves charge interaction between the porphyrin and the RNA inside the capsid. Results show that over 250 porphyrin molecules associate with the RNA within each MS2 capsid. Removal of RNA from the capsid severely inhibits the packaging of the cationic porphyrins. Porphyrin-virus constructs were then shown to photogenerate singlet oxygen, and cytotoxicity in non-targeted photodynamic treatment experiments. Next, each porphyrin-loaded capsid is externally modified with approximately 60 targeting DNA aptamers by employing a heterobifunctional crosslinking agent. The targeting aptamer is known to bind the protein nucleolin, a ubiquitous protein that is overexpressed on the cell surface by many cancer cell types. MCF-7 human breast carcinoma cells and MCF-10A human mammary epithelial cells were selected as an in vitro model for breast cancer and normal tissue, respectively. Fluorescently tagged virus-aptamer constructs are shown to selectively target MCF-7 cells versus MCF-10A cells. Finally, results are shown in which porphyrin-virus

Chimeric rabies viruses for trans-species comparison of lyssavirus glycoprotein ectodomain functions in virus replication and pathogenesis.

PubMed

Genz, Berit; Nolden, Tobias; Negatsch, Alexandra; Teifke, Jens-Peter; Conzelmann, Karl-Klaus; Finke, Stefan

2012-01-01

The glycoprotein G of lyssaviruses is the major determinant of virus pathogenicity and serves as a target for immunological responses to virus infections. However, assessment of the exact contribution of lyssavirus G proteins to observed differences in the pathogenicity of lyssavirus species is challenging, since the direct comparison of natural lyssaviruses does not allow specific ascription to individual virus proteins or domains. Here we describe the generation and characterization of recombinant rabies viruses (RABV) that express chimeric G proteins comprising of a RABV cytoplasma domain fused to transmembrane and ectodomain G sequences of a virulent RABV (challenge virus standard; CVS-11) or two European bat lyssaviruses (EBLV- and EBLV-2). These "envelope-switched" recombinant viruses were recovered from cDNAs. Similar growth kinetics and protein expression in neuroblastoma cell cultures and successful targeting of primary neurons showed that the chimeric G proteins were able to replace the authentic G protein in a RABV based virus vector. Inoculation of six week old CD-1 mice by the intracranial (i. c.) route of infection further demonstrated that all recombinant viruses were able to spread in the brain and to induce disease. The "envelope-switched" RABV therefore represent an important tool to further investigate the influence of lyssavirus ectodomains on virus tropism, and pathogenicity.

Design of virus-based nanomaterials for medicine, biotechnology, and energy

PubMed Central

Wen, Amy M.; Steinmetz, Nicole F.

2016-01-01

Virus-based nanomaterials are versatile materials that naturally self-assemble and have relevance for a broad range of applications including medicine, biotechnology, and energy. This review provides an overview of recent developments in “chemical virology.” Viruses, as materials, provide unique nanoscale scaffolds that have relevance in chemical biology and nanotechnology, with diverse areas of applications. Some fundamental advantages of viruses, compared to synthetically programmed materials, include the highly precise spatial arrangement of their subunits into a diverse array of shapes and sizes and many available avenues for easy and reproducible modification. Here, we will first survey the broad distribution of viruses and various methods for producing virus-based nanoparticles, as well as engineering principles used to impart new functionalities. We will then examine the broad range of applications and implications of virus-based materials, focusing on the medical, biotechnology, and energy sectors. We anticipate that this field will continue to evolve and grow, with exciting new possibilities stemming from advancements in the rational design of virus-based nanomaterials. PMID:27152673

Identification of broad-spectrum antiviral compounds and assessment of the druggability of their target for efficacy against respiratory syncytial virus (RSV)

PubMed Central

Bonavia, Aurelio; Franti, Michael; Pusateri Keaney, Erin; Kuhen, Kelli; Seepersaud, Mohindra; Radetich, Branko; Shao, Jian; Honda, Ayako; Dewhurst, Janetta; Balabanis, Kara; Monroe, James; Wolff, Karen; Osborne, Colin; Lanieri, Leanne; Hoffmaster, Keith; Amin, Jakal; Markovits, Judit; Broome, Michelle; Skuba, Elizabeth; Cornella-Taracido, Ivan; Joberty, Gerard; Bouwmeester, Tewis; Hamann, Lawrence; Tallarico, John A.; Tommasi, Ruben; Compton, Teresa; Bushell, Simon M.

2011-01-01

The search for novel therapeutic interventions for viral disease is a challenging pursuit, hallmarked by the paucity of antiviral agents currently prescribed. Targeting of viral proteins has the inextricable challenge of rise of resistance. Safe and effective vaccines are not possible for many viral pathogens. New approaches are required to address the unmet medical need in this area. We undertook a cell-based high-throughput screen to identify leads for development of drugs to treat respiratory syncytial virus (RSV), a serious pediatric pathogen. We identified compounds that are potent (nanomolar) inhibitors of RSV in vitro in HEp-2 cells and in primary human bronchial epithelial cells and were shown to act postentry. Interestingly, two scaffolds exhibited broad-spectrum activity among multiple RNA viruses. Using the chemical matter as a probe, we identified the targets and identified a common cellular pathway: the de novo pyrimidine biosynthesis pathway. Both targets were validated in vitro and showed no significant cell cytotoxicity except for activity against proliferative B- and T-type lymphoid cells. Corollary to this finding was to understand the consequences of inhibition of the target to the host. An in vivo assessment for antiviral efficacy failed to demonstrate reduced viral load, but revealed microscopic changes and a trend toward reduced pyrimidine pools and findings in histopathology. We present here a discovery program that includes screen, target identification, validation, and druggability that can be broadly applied to identify and interrogate other host factors for antiviral effect starting from chemical matter of unknown target/mechanism of action. PMID:21502533

Identification of broad-spectrum antiviral compounds and assessment of the druggability of their target for efficacy against respiratory syncytial virus (RSV).

PubMed

Bonavia, Aurelio; Franti, Michael; Pusateri Keaney, Erin; Kuhen, Kelli; Seepersaud, Mohindra; Radetich, Branko; Shao, Jian; Honda, Ayako; Dewhurst, Janetta; Balabanis, Kara; Monroe, James; Wolff, Karen; Osborne, Colin; Lanieri, Leanne; Hoffmaster, Keith; Amin, Jakal; Markovits, Judit; Broome, Michelle; Skuba, Elizabeth; Cornella-Taracido, Ivan; Joberty, Gerard; Bouwmeester, Tewis; Hamann, Lawrence; Tallarico, John A; Tommasi, Ruben; Compton, Teresa; Bushell, Simon M

2011-04-26

The search for novel therapeutic interventions for viral disease is a challenging pursuit, hallmarked by the paucity of antiviral agents currently prescribed. Targeting of viral proteins has the inextricable challenge of rise of resistance. Safe and effective vaccines are not possible for many viral pathogens. New approaches are required to address the unmet medical need in this area. We undertook a cell-based high-throughput screen to identify leads for development of drugs to treat respiratory syncytial virus (RSV), a serious pediatric pathogen. We identified compounds that are potent (nanomolar) inhibitors of RSV in vitro in HEp-2 cells and in primary human bronchial epithelial cells and were shown to act postentry. Interestingly, two scaffolds exhibited broad-spectrum activity among multiple RNA viruses. Using the chemical matter as a probe, we identified the targets and identified a common cellular pathway: the de novo pyrimidine biosynthesis pathway. Both targets were validated in vitro and showed no significant cell cytotoxicity except for activity against proliferative B- and T-type lymphoid cells. Corollary to this finding was to understand the consequences of inhibition of the target to the host. An in vivo assessment for antiviral efficacy failed to demonstrate reduced viral load, but revealed microscopic changes and a trend toward reduced pyrimidine pools and findings in histopathology. We present here a discovery program that includes screen, target identification, validation, and druggability that can be broadly applied to identify and interrogate other host factors for antiviral effect starting from chemical matter of unknown target/mechanism of action.

Protective Efficacy of the Conserved NP, PB1, and M1 Proteins as Immunogens in DNA- and Vaccinia Virus-Based Universal Influenza A Virus Vaccines in Mice.

PubMed

Wang, Wenling; Li, Renqing; Deng, Yao; Lu, Ning; Chen, Hong; Meng, Xin; Wang, Wen; Wang, Xiuping; Yan, Kexia; Qi, Xiangrong; Zhang, Xiangmin; Xin, Wei; Lu, Zhenhua; Li, Xueren; Bian, Tao; Gao, Yingying; Tan, Wenjie; Ruan, Li

2015-06-01

The conventional hemagglutinin (HA)- and neuraminidase (NA)-based influenza vaccines need to be updated most years and are ineffective if the glycoprotein HA of the vaccine strains is a mismatch with that of the epidemic strain. Universal vaccines targeting conserved viral components might provide cross-protection and thus complement and improve conventional vaccines. In this study, we generated DNA plasmids and recombinant vaccinia viruses expressing the conserved proteins nucleoprotein (NP), polymerase basic 1 (PB1), and matrix 1 (M1) from influenza virus strain A/Beijing/30/95 (H3N2). BALB/c mice were immunized intramuscularly with a single vaccine based on NP, PB1, or M1 alone or a combination vaccine based on all three antigens and were then challenged with lethal doses of the heterologous influenza virus strain A/PR/8/34 (H1N1). Vaccines based on NP, PB1, and M1 provided complete or partial protection against challenge with 1.7 50% lethal dose (LD50) of PR8 in mice. Of the three antigens, NP-based vaccines induced protection against 5 LD50 and 10 LD50 and thus exhibited the greatest protective effect. Universal influenza vaccines based on the combination of NP, PB1, and M1 induced a strong immune response and thus might be an alternative approach to addressing future influenza virus pandemics. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Lassa-Vesicular Stomatitis Chimeric Virus Safely Destroys Brain Tumors

PubMed Central

Wollmann, Guido; Drokhlyansky, Eugene; Davis, John N.; Cepko, Connie

2015-01-01

ABSTRACT High-grade tumors in the brain are among the deadliest of cancers. Here, we took a promising oncolytic virus, vesicular stomatitis virus (VSV), and tested the hypothesis that the neurotoxicity associated with the virus could be eliminated without blocking its oncolytic potential in the brain by replacing the neurotropic VSV glycoprotein with the glycoprotein from one of five different viruses, including Ebola virus, Marburg virus, lymphocytic choriomeningitis virus (LCMV), rabies virus, and Lassa virus. Based on in vitro infections of normal and tumor cells, we selected two viruses to test in vivo. Wild-type VSV was lethal when injected directly into the brain. In contrast, a novel chimeric virus (VSV-LASV-GPC) containing genes from both the Lassa virus glycoprotein precursor (GPC) and VSV showed no adverse actions within or outside the brain and targeted and completely destroyed brain cancer, including high-grade glioblastoma and melanoma, even in metastatic cancer models. When mice had two brain tumors, intratumoral VSV-LASV-GPC injection in one tumor (glioma or melanoma) led to complete tumor destruction; importantly, the virus moved contralaterally within the brain to selectively infect the second noninjected tumor. A chimeric virus combining VSV genes with the gene coding for the Ebola virus glycoprotein was safe in the brain and also selectively targeted brain tumors but was substantially less effective in destroying brain tumors and prolonging survival of tumor-bearing mice. A tropism for multiple cancer types combined with an exquisite tumor specificity opens a new door to widespread application of VSV-LASV-GPC as a safe and efficacious oncolytic chimeric virus within the brain. IMPORTANCE Many viruses have been tested for their ability to target and kill cancer cells. Vesicular stomatitis virus (VSV) has shown substantial promise, but a key problem is that if it enters the brain, it can generate adverse neurologic consequences, including death. We

NADPH oxidases as novel pharmacologic targets against influenza A virus infection.

PubMed

Vlahos, Ross; Selemidis, Stavros

2014-12-01

Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

Structure-Based Design of Hepatitis C Virus Vaccines That Elicit Neutralizing Antibody Responses to a Conserved Epitope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pierce, Brian G.; Boucher, Elisabeth N.; Piepenbrink, Kurt H.

Despite recent advances in therapeutic options, hepatitis C virus (HCV) remains a severe global disease burden, and a vaccine can substantially reduce its incidence. Due to its extremely high sequence variability, HCV can readily escape the immune response; thus, an effective vaccine must target conserved, functionally important epitopes. Using the structure of a broadly neutralizing antibody in complex with a conserved linear epitope from the HCV E2 envelope glycoprotein (residues 412 to 423; epitope I), we performed structure-based design of immunogens to induce antibody responses to this epitope. This resulted in epitope-based immunogens based on a cyclic defensin protein, asmore » well as a bivalent immunogen with two copies of the epitope on the E2 surface. We solved the X-ray structure of a cyclic immunogen in complex with the HCV1 antibody and confirmed preservation of the epitope conformation and the HCV1 interface. Mice vaccinated with our designed immunogens produced robust antibody responses to epitope I, and their serum could neutralize HCV. Notably, the cyclic designs induced greater epitope-specific responses and neutralization than the native peptide epitope. Beyond successfully designing several novel HCV immunogens, this study demonstrates the principle that neutralizing anti-HCV antibodies can be induced by epitope-based, engineered vaccines and provides the basis for further efforts in structure-based design of HCV vaccines. IMPORTANCEHepatitis C virus is a leading cause of liver disease and liver cancer, with approximately 3% of the world's population infected. To combat this virus, an effective vaccine would have distinct advantages over current therapeutic options, yet experimental vaccines have not been successful to date, due in part to the virus's high sequence variability leading to immune escape. In this study, we rationally designed several vaccine immunogens based on the structure of a conserved epitope that is the target of broadly

Targeted induction of interferon-λ in humanized chimeric mouse liver abrogates hepatotropic virus infection.

PubMed

Nakagawa, Shin-ichiro; Hirata, Yuichi; Kameyama, Takeshi; Tokunaga, Yuko; Nishito, Yasumasa; Hirabayashi, Kazuko; Yano, Junichi; Ochiya, Takahiro; Tateno, Chise; Tanaka, Yasuhito; Mizokami, Masashi; Tsukiyama-Kohara, Kyoko; Inoue, Kazuaki; Yoshiba, Makoto; Takaoka, Akinori; Kohara, Michinori

2013-01-01

The interferon (IFN) system plays a critical role in innate antiviral response. We presume that targeted induction of IFN in human liver shows robust antiviral effects on hepatitis C virus (HCV) and hepatitis B virus (HBV). This study used chimeric mice harboring humanized livers and infected with HCV or HBV. This mouse model permitted simultaneous analysis of immune responses by human and mouse hepatocytes in the same liver and exploration of the mechanism of antiviral effect against these viruses. Targeted expression of IFN was induced by treating the animals with a complex comprising a hepatotropic cationic liposome and a synthetic double-stranded RNA analog, pIC (LIC-pIC). Viral replication, IFN gene expression, IFN protein production, and IFN antiviral activity were analyzed (for type I, II and III IFNs) in the livers and sera of these humanized chimeric mice. Following treatment with LIC-pIC, the humanized livers of chimeric mice exhibited increased expression (at the mRNA and protein level) of human IFN-λs, resulting in strong antiviral effect on HBV and HCV. Similar increases were not seen for human IFN-α or IFN-β in these animals. Strong induction of IFN-λs by LIC-pIC occurred only in human hepatocytes, and not in mouse hepatocytes nor in human cell lines derived from other (non-hepatic) tissues. LIC-pIC-induced IFN-λ production was mediated by the immune sensor adaptor molecules mitochondrial antiviral signaling protein (MAVS) and Toll/IL-1R domain-containing adaptor molecule-1 (TICAM-1), suggesting dual recognition of LIC-pIC by both sensor adaptor pathways. These findings demonstrate that the expression and function of various IFNs differ depending on the animal species and tissues under investigation. Chimeric mice harboring humanized livers demonstrate that IFN-λs play an important role in the defense against human hepatic virus infection.

Serum albumin 'camouflage' of plant virus based nanoparticles prevents their antibody recognition and enhances pharmacokinetics.

PubMed

Pitek, Andrzej S; Jameson, Slater A; Veliz, Frank A; Shukla, Sourabh; Steinmetz, Nicole F

2016-05-01

Plant virus-based nanoparticles (VNPs) are a novel class of nanocarriers with unique potential for biomedical applications. VNPs have many advantageous properties such as ease of manufacture and high degree of quality control. Their biocompatibility and biodegradability make them an attractive alternative to synthetic nanoparticles (NPs). Nevertheless, as with synthetic NPs, to be successful in drug delivery or imaging, the carriers need to overcome several biological barriers including innate immune recognition. Plasma opsonization can tag (V)NPs for clearance by the mononuclear phagocyte system (MPS), resulting in shortened circulation half lives and non-specific sequestration in non-targeted organs. PEG coatings have been traditionally used to 'shield' nanocarriers from immune surveillance. However, due to broad use of PEG in cosmetics and other industries, the prevalence of anti-PEG antibodies has been reported, which may limit the utility of PEGylation in nanomedicine. Alternative strategies are needed to tailor the in vivo properties of (plant virus-based) nanocarriers. We demonstrate the use of serum albumin (SA) as a viable alternative. SA conjugation to tobacco mosaic virus (TMV)-based nanocarriers results in a 'camouflage' effect more effective than PEG coatings. SA-'camouflaged' TMV particles exhibit decreased antibody recognition, as well as enhanced pharmacokinetics in a Balb/C mouse model. Therefore, SA-coatings may provide an alternative and improved coating technique to yield (plant virus-based) NPs with improved in vivo properties enhancing drug delivery and molecular imaging. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Emerging viral diseases in Europe].

PubMed

Löbermann, M; Gürtler, L G; Eichler-Löbermann, B; Reisinger, E C

2012-04-01

Emergence of viral agents in Europe is influenced by various factors. Climatic changes influencing possible vectors, insufficient vaccination, and travel of man and goods are among the most important reasons to explain these changes. Fever and arthralgia are the leading symptoms in infection with Dengue, Sindbis, or Chikungunya virus. In contrast, tick-born encephalitis (TBE), Toscana, or West Nile virus infections mainly lead to meningo-encephalitis. In Europe, hemorrhagic fever is caused by Crimean Congo and Hanta virus. Protective vaccines are available for emerging viral agents like TBE, influenza and measles. © Georg Thieme Verlag KG Stuttgart · New York.

Design of virus-based nanomaterials for medicine, biotechnology, and energy.

PubMed

Wen, Amy M; Steinmetz, Nicole F

2016-07-25

This review provides an overview of recent developments in "chemical virology." Viruses, as materials, provide unique nanoscale scaffolds that have relevance in chemical biology and nanotechnology, with diverse areas of applications. Some fundamental advantages of viruses, compared to synthetically programmed materials, include the highly precise spatial arrangement of their subunits into a diverse array of shapes and sizes and many available avenues for easy and reproducible modification. Here, we will first survey the broad distribution of viruses and various methods for producing virus-based nanoparticles, as well as engineering principles used to impart new functionalities. We will then examine the broad range of applications and implications of virus-based materials, focusing on the medical, biotechnology, and energy sectors. We anticipate that this field will continue to evolve and grow, with exciting new possibilities stemming from advancements in the rational design of virus-based nanomaterials.

Rabies Virus Envelope Glycoprotein Targets Lentiviral Vectors to the Axonal Retrograde Pathway in Motor Neurons*

PubMed Central

Hislop, James N.; Islam, Tarin A.; Eleftheriadou, Ioanna; Carpentier, David C. J.; Trabalza, Antonio; Parkinson, Michael; Schiavo, Giampietro; Mazarakis, Nicholas D.

2014-01-01

Rabies pseudotyped lentiviral vectors have great potential in gene therapy, not least because of their ability to transduce neurons following their distal axonal application. However, very little is known about the molecular processes that underlie their retrograde transport and cell transduction. Using multiple labeling techniques and confocal microscopy, we demonstrated that pseudotyping with rabies virus envelope glycoprotein (RV-G) enabled the axonal retrograde transport of two distinct subtypes of lentiviral vector in motor neuron cultures. Analysis of this process revealed that these vectors trafficked through Rab5-positive endosomes and accumulated within a non-acidic Rab7 compartment. RV-G pseudotyped vectors were co-transported with both the tetanus neurotoxin-binding fragment and the membrane proteins thought to mediate rabies virus endocytosis (neural cell adhesion molecule, nicotinic acetylcholine receptor, and p75 neurotrophin receptor), thus demonstrating that pseudotyping with RV-G targets lentiviral vectors for transport along the same pathway exploited by several toxins and viruses. Using motor neurons cultured in compartmentalized chambers, we demonstrated that axonal retrograde transport of these vectors was rapid and efficient; however, it was not able to transduce the targeted neurons efficiently, suggesting that impairment in processes occurring after arrival of the viral vector in the soma is responsible for the low transduction efficiency seen in vivo, which suggests a novel area for improvement of gene therapy vectors. PMID:24753246

Nonstructural proteins nsP3 and nsP4 of Ross River and O'Nyong-nyong viruses: sequence and comparison with those of other alphaviruses.

PubMed

Strauss, E G; Levinson, R; Rice, C M; Dalrymple, J; Strauss, J H

1988-05-01

We have sequenced the nsP3 and nsP4 region of two alphaviruses, Ross River virus and O'Nyong-nyong virus, in order to examine these viruses for the presence or absence of an opal termination codon present between nsP3 and nsP4 in many alphaviruses. We found that Ross River virus possesses an in-phase opal termination codon between nsP3 and nsP4, whereas in O'Nyong-nyong virus this termination codon is replaced by an arginine codon. Previous studies have shown that two other alphaviruses, Sindbis virus and Middelburg virus, possess an opal termination codon separating nsP3 and nsP4 [E.G. Strauss, C.M. Rice, and J.H. Strauss (1983), Proc. Natl. Acad. Sci. USA 80, 5271-5275], whereas Semliki Forest virus possesses an arginine codon in lieu of the opal codon [K. Takkinen (1986), Nucleic Acids Res. 14, 5667-5682]. Thus, of the five alphaviruses examined to date, three possess the opal codon and two do not. Production of nsP4 requires readthrough of the opal codon in those alphaviruses that possess this termination codon and the function of the termination codon may be to regulate the amount of nsP4 produced. It is an open question then as to whether alphaviruses with no termination codon use other mechanisms to regulate the activity of this gene. The nsP4s of these five alphaviruses are highly conserved, sharing 71-76% amino acid sequence similarity, and all five contain the Gly-Asp-Asp motif found in many RNA virus replicases. The nsP3s are somewhat less conserved, sharing 52-73% amino acid sequence similarity throughout most of the protein, but each possesses a nonconserved C-terminal domain of 134 to 246 amino acids of unknown function.

Fate-Regulating Circuits in Viruses: From Discovery to New Therapy Targets

PubMed Central

Pai, Anand; Weinberger, Leor S.

2018-01-01

Current antivirals effectively target diverse viruses at various stages of their viral lifecycles. Nevertheless, curative therapy has remained elusive for important pathogens (e.g., HIV-1 and herpesviruses), in large part due to viral latency and the evolution of resistance to existing therapies. Here, we review the discovery of viral ‘master’ circuits: virus-encoded auto-regulatory gene networks that can autonomously control viral expression programs (i.e., between active, latent, and abortive fates). These circuits offer a potential new class of antivirals that could lead to intrinsic combination-antiviral therapies within a single molecule—evolutionary escape from such circuit ‘disruptors’ would require simultaneous evolution of both the cis regulatory element (e.g., the DNA-binding site) and the trans element (e.g., the transcription factor) for the circuit’s function to be recapitulated. We review the architectures of these fate-regulating master circuits in HIV-1 and the human herpesvirus cytomegalovirus (CMV) along with potential circuit-disruption strategies that may ultimately enable escape-resistant antiviral therapies. PMID:28800289

A DNA microarray-based assay to detect dual infection with two dengue virus serotypes.

PubMed

Díaz-Badillo, Alvaro; Muñoz, María de Lourdes; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G; Martínez-Muñoz, Jorge P; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-04-25

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

PubMed Central

Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-01-01

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

Recombinant Vesicular Stomatitis Virus–Based Vaccines Against Ebola and Marburg Virus Infections

PubMed Central

Feldmann, Heinz

2011-01-01

The filoviruses, Marburg virus and Ebola virus, cause severe hemorrhagic fever with a high mortality rate in humans and nonhuman primates. Among the most-promising filovirus vaccines under development is a system based on recombinant vesicular stomatitis virus (rVSV) that expresses a single filovirus glycoprotein (GP) in place of the VSV glycoprotein (G). Importantly, a single injection of blended rVSV-based filovirus vaccines was shown to completely protect nonhuman primates against Marburg virus and 3 different species of Ebola virus. These rVSV-based vaccines have also shown utility when administered as a postexposure treatment against filovirus infections, and a rVSV-based Ebola virus vaccine was recently used to treat a potential laboratory exposure. Here, we review the history of rVSV-based vaccines and pivotal animal studies showing their utility in combating Ebola and Marburg virus infections. PMID:21987744

Glycosylation of dengue virus glycoproteins and their interactions with carbohydrate receptors: possible targets for antiviral therapy.

PubMed

Idris, Fakhriedzwan; Muharram, Siti Hanna; Diah, Suwarni

2016-07-01

Dengue virus, an RNA virus belonging to the genus Flavivirus, affects 50 million individuals annually, and approximately 500,000-1,000,000 of these infections lead to dengue hemorrhagic fever or dengue shock syndrome. With no licensed vaccine or specific antiviral treatments available to prevent dengue infection, dengue is considered a major public health problem in subtropical and tropical regions. The virus, like other enveloped viruses, uses the host's cellular enzymes to synthesize its structural (C, E, and prM/M) and nonstructural proteins (NS1-5) and, subsequently, to glycosylate these proteins to produce complete and functional glycoproteins. The structural glycoproteins, specifically the E protein, are known to interact with the host's carbohydrate receptors through the viral proteins' N-glycosylation sites and thus mediate the viral invasion of cells. This review focuses on the involvement of dengue glycoproteins in the course of infection and the virus' exploitation of the host's glycans, especially the interactions between host receptors and carbohydrate moieties. We also discuss the recent developments in antiviral therapies that target these processes and interactions, focusing specifically on the use of carbohydrate-binding agents derived from plants, commonly known as lectins, to inhibit the progression of infection.

Interferon-alpha/beta deficiency greatly exacerbates arthritogenic disease in mice infected with wild-type chikungunya virus but not with the cell culture-adapted live-attenuated 181/25 vaccine candidate

PubMed Central

Gardner, Christina L.; Burke, Crystal W.; Higgs, Stephen T.; Klimstra, William B.; Ryman, Kate D.

2012-01-01

In humans, chikungunya virus (CHIKV) infection causes fever, rash, and acute and persisting polyarthalgia/arthritis associated with joint swelling. We report a new CHIKV disease model in adult mice that distinguishes the wild-type CHIKV-LR strain from the live-attenuated vaccine strain (CHIKV-181/25). Although eight-week old normal mice inoculated in the hind footpad developed no hind limb swelling with either virus, CHIKV-LR replicated in musculoskeletal tissues and caused detectable inflammation. In mice deficient in STAT1-dependent interferon (IFN) responses, CHIKV-LR caused significant swelling of the inoculated and contralateral limbs and dramatic inflammatory lesions, while CHIKV-181/25 vaccine and another arthritogenic alphavirus, Sindbis, failed to induce swelling. IFN responses suppressed CHIKV-LR and CHIKV-181/25 replication equally in dendritic cells in vitro whereas macrophages were refractory to infection independently of STAT1-mediated IFN responses. Glycosaminoglycan (GAG) binding may be a CHIKV vaccine attenuation mechanism as CHIKV-LR infectivity was not dependent upon GAG, while CHIKV-181/25 was highly dependent. PMID:22305131

Towards an HIV cure based on targeted killing of infected cells: different approaches against acute versus chronic infection.

PubMed

Dey, Barna; Berger, Edward A

2015-05-01

Current regimens of combination antiretroviral therapy (cART) offer effective control of HIV infection, with maintenance of immune health and near-normal life expectancy. What will it take to progress beyond the status quo, whereby infectious virus can be eradicated (a 'sterilizing cure') or fully controlled without the need for ongoing cART (a 'functional cure')? On the basis of therapeutic advances in the cancer field, we propose that targeted cytotoxic therapy to kill HIV-infected cells represents a logical complement to cART for achieving an HIV cure. This concept is based on the fact that cART effectively blocks replication of the virus, but does not eliminate cells that are already infected; targeted cytotoxic therapy would contribute precisely this missing component. We suggest that different modalities are suited for curing primary acute versus established chronic infection. For acute infection, relatively short-acting potent agents such as recombinant immunotoxins might prove sufficient for HIV eradication, whereas for chronic infection, a long-lasting (lifelong?) modality is required to maintain full virus control, as might be achieved with genetically modified autologous T cells. We present perspectives for complementing cART with targeted cytotoxic therapy, whereby HIV infection is either eradicated or fully controlled, thereby eliminating the need for lifelong cART.

Porcine aminopeptidase N mediated polarized infection by porcine epidemic diarrhea virus in target cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cong, Yingying; Li, Xiaoxue; Bai, Yunyun

Infection of polarized intestinal epithelial cells by porcine epidemic diarrhea virus (PEDV) was characterized. Indirect immunofluorescence assay, real-time PCR, and transmission electron microscopy confirmed PEDV can be successfully propagated in immortalized swine small intestine epithelial cells (IECs). Infection involved porcine aminpeptidase N (pAPN), a reported cellular receptor for PEDV, transient expression of pAPN and siRNA targeted pAPN increased and decreased the infectivity of PEDV in IECs, respectively. Subsequently, polarized entry into and release from both Vero E6 and IECs was analyzed. PEDV entry into polarized cells and pAPN grown on membrane inserts occurs via apical membrane. The progeny virus releasedmore » into the medium was also quantified which demonstrated that PEDV is preferentially released from the apical membrane. Collectively, our data demonstrate that pAPN, the cellular receptor for PEDV, mediates polarized PEDV infection. These results imply the possibility that PEDV infection may proceed by lateral spread of virus in intestinal epithelial cells. - Highlights: • PEDV infection of polarized intestinal epithelial cells (IECs) was characterized. • Porcine aminpeptidase N (pAPN) facilitated PEDV infection in IECs. • PEDV entry into and release from polarized cell via its apical membrane. • PEDV infection may proceed by lateral spread of virus in IECs.« less

Unique Safety Issues Associated with Virus Vectored Vaccines: Potential for and Theoretical Consequences of Recombination with Wild Type Virus Strains

PubMed Central

Condit, Richard C.; Williamson, Anna-Lise; Sheets, Rebecca; Seligman, Stephen J.; Monath, Thomas P.; Excler, Jean-Louis; Gurwith, Marc; Bok, Karin; Robertson, James S.; Kim, Denny; Hendry, Michael; Singh, Vidisha; Mac, Lisa M.; Chen, Robert T.

2016-01-01

In 2003 and 2013, the World Health Organization convened informal consultations on characterization and quality aspects of vaccines based on live virus vectors. In the resulting reports, one of several issues raised for future study was the potential for recombination of virus-vectored vaccines with wild type pathogenic virus strains. This paper presents an assessment of this issue formulated by the Brighton Collaboration. To provide an appropriate context for understanding the potential for recombination of virus-vectored vaccines, we review briefly the current status of virus vectored vaccines, mechanisms of recombination between viruses, experience with recombination involving live attenuated vaccines in the field, and concerns raised previously in the literature regarding recombination of virus-vectored vaccines with wild type virus strains. We then present a discussion of the major variables that could influence recombination between a virus-vectored vaccine and circulating wild type virus and the consequences of such recombination, including intrinsic recombination properties of the parent virus used as a vector; sequence relatedness of vector and wild virus; virus host range, pathogenesis and transmission; replication competency of vector in target host; mechanism of vector attenuation; additional factors potentially affecting virulence; and circulation of multiple recombinant vectors in the same target population. Finally, we present some guiding principles for vector design and testing intended to anticipate and mitigate the potential for and consequences of recombination of virus-vectored vaccines with wild type pathogenic virus strains. PMID:27346303

Specific Retrograde Transduction of Spinal Motor Neurons Using Lentiviral Vectors Targeted to Presynaptic NMJ Receptors

PubMed Central

Eleftheriadou, I; Trabalza, A; Ellison, SM; Gharun, K; Mazarakis, ND

2014-01-01

To understand how receptors are involved in neuronal trafficking and to be able to utilize them for specific targeting via the peripheral route would be of great benefit. Here, we describe the generation of novel lentiviral vectors with tropism to motor neurons that were made by coexpressing onto the lentiviral surface a fusogenic glycoprotein (mutated sindbis G) and an antibody against a cell-surface receptor (Thy1.1, p75NTR, or coxsackievirus and adenovirus receptor) on the presynaptic terminal of the neuromuscular junction. These vectors exhibit binding specificity and efficient transduction of receptor positive cell lines and primary motor neurons in vitro. Targeting of each of these receptors conferred to these vectors the capability of being transported retrogradely from the axonal tip, leading to transduction of motor neurons in vitro in compartmented microfluidic cultures. In vivo delivery of coxsackievirus and adenovirus receptor-targeted vectors in leg muscles of mice resulted in predicted patterns of motor neuron labeling in lumbar spinal cord. This opens up the clinical potential of these vectors for minimally invasive administration of central nervous system-targeted therapeutics in motor neuron diseases. PMID:24670531

Molecular Targeted Viral Nanoparticles as Tools for Imaging Cancer

PubMed Central

Cho, C.F.; Sourabh, S.; Simpson, E.J.; Steinmetz, N.F.; Luyt, L.G.; Lewis, J.D.

2015-01-01

Viral nanoparticles (VNPs) are a novel class of bionanomaterials that harness the natural biocompatibility of viruses for the development of therapeutics, vaccines, and imaging tools. The plant virus, cowpea mosaic virus (CPMV), has been successfully engineered to create novel cancer-targeted imaging agents by incorporating fluorescent dyes, polyethylene glycol (PEG) polymers, and targeting moieties. Using straightforward conjugation strategies, VNPs with high selectivity for cancer-specific molecular targets can be synthesized for in vivo imaging of tumors. Here we describe the synthesis and purification of CPMV-based VNPs, the functionalization of these VNPs using click chemistry, and their use for imaging xenograft tumors in animal models. VNPs decorated with fluorescent dyes, PEG, and targeting ligands can be synthesized in one day, and imaging studies can be performed over hours, days, or weeks, depending on the application. PMID:24243252

TRIM25 Is Required for the Antiviral Activity of Zinc Finger Antiviral Protein

PubMed Central

Zheng, Xiaojiao; Wang, Xinlu; Tu, Fan; Wang, Qin; Fan, Zusen

2017-01-01

ABSTRACT Zinc finger antiviral protein (ZAP) is a host factor that specifically inhibits the replication of certain viruses by binding to viral mRNAs and repressing the translation and/or promoting the degradation of target mRNA. In addition, ZAP regulates the expression of certain cellular genes. Here, we report that tripartite motif-containing protein 25 (TRIM25), a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 abolished ZAP's antiviral activity. The E3 ligase activity of TRIM25 is required for this regulation. TRIM25 mediated ZAP ubiquitination, but the ubiquitination of ZAP itself did not seem to be required for its antiviral activity. Downregulation of endogenous ubiquitin or overexpression of the deubiquitinase OTUB1 impaired ZAP's activity. We provide evidence indicating that TRIM25 modulates the target RNA binding activity of ZAP. These results uncover a mechanism by which the antiviral activity of ZAP is regulated. IMPORTANCE ZAP is a host antiviral factor that specifically inhibits the replication of certain viruses, including HIV-1, Sindbis virus, and Ebola virus. ZAP binds directly to target mRNA, and it represses the translation and promotes the degradation of target mRNA. While the mechanisms by which ZAP posttranscriptionally inhibits target RNA expression have been extensively studied, how its antiviral activity is regulated is not very clear. Here, we report that TRIM25, a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 remarkably abolished ZAP's activity. TRIM25 is required for ZAP optimal binding to target mRNA. These results help us to better understand how the antiviral activity of ZAP is regulated. PMID:28202764

TRIM25 Is Required for the Antiviral Activity of Zinc Finger Antiviral Protein.

PubMed

Zheng, Xiaojiao; Wang, Xinlu; Tu, Fan; Wang, Qin; Fan, Zusen; Gao, Guangxia

2017-05-01

Zinc finger antiviral protein (ZAP) is a host factor that specifically inhibits the replication of certain viruses by binding to viral mRNAs and repressing the translation and/or promoting the degradation of target mRNA. In addition, ZAP regulates the expression of certain cellular genes. Here, we report that tripartite motif-containing protein 25 (TRIM25), a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 abolished ZAP's antiviral activity. The E3 ligase activity of TRIM25 is required for this regulation. TRIM25 mediated ZAP ubiquitination, but the ubiquitination of ZAP itself did not seem to be required for its antiviral activity. Downregulation of endogenous ubiquitin or overexpression of the deubiquitinase OTUB1 impaired ZAP's activity. We provide evidence indicating that TRIM25 modulates the target RNA binding activity of ZAP. These results uncover a mechanism by which the antiviral activity of ZAP is regulated. IMPORTANCE ZAP is a host antiviral factor that specifically inhibits the replication of certain viruses, including HIV-1, Sindbis virus, and Ebola virus. ZAP binds directly to target mRNA, and it represses the translation and promotes the degradation of target mRNA. While the mechanisms by which ZAP posttranscriptionally inhibits target RNA expression have been extensively studied, how its antiviral activity is regulated is not very clear. Here, we report that TRIM25, a ubiquitin E3 ligase, is required for the antiviral activity of ZAP. Downregulation of endogenous TRIM25 remarkably abolished ZAP's activity. TRIM25 is required for ZAP optimal binding to target mRNA. These results help us to better understand how the antiviral activity of ZAP is regulated. Copyright © 2017 American Society for Microbiology.

Genome characterization of Sugarcane Yellow Leaf Virus with special reference to RNAi based molecular breeding.

PubMed

Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen

2018-05-04

Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.

Individual mediodorsal thalamic neurons project to multiple areas of the rat prefrontal cortex: A single neuron-tracing study using virus vectors.

PubMed

Kuramoto, Eriko; Pan, Shixiu; Furuta, Takahiro; Tanaka, Yasuhiro R; Iwai, Haruki; Yamanaka, Atsushi; Ohno, Sachi; Kaneko, Takeshi; Goto, Tetsuya; Hioki, Hiroyuki

2017-01-01

The prefrontal cortex has an important role in a variety of cognitive and executive processes, and is generally defined by its reciprocal connections with the mediodorsal thalamic nucleus (MD). The rat MD is mainly subdivided into three segments, the medial (MDm), central (MDc), and lateral (MDl) divisions, on the basis of the cytoarchitecture and chemoarchitecture. The MD segments are known to topographically project to multiple prefrontal areas at the population level: the MDm mainly to the prelimbic, infralimbic, and agranular insular areas; the MDc to the orbital and agranular insular areas; and the MDl to the prelimbic and anterior cingulate areas. However, it is unknown whether individual MD neurons project to single or multiple prefrontal cortical areas. In the present study, we visualized individual MD neurons with Sindbis virus vectors, and reconstructed whole structures of MD neurons. While the main cortical projection targets of MDm, MDc, and MDl neurons were generally consistent with those of previous results, it was found that individual MD neurons sent their axon fibers to multiple prefrontal areas, and displayed various projection patterns in the target areas. Furthermore, the axons of single MD neurons were not homogeneously spread, but were rather distributed to form patchy axon arbors approximately 1 mm in diameter. The multiple-area projections and patchy axon arbors of single MD neurons might be able to coactivate cortical neuron groups in distant prefrontal areas simultaneously. Furthermore, considerable heterogeneity of the projection patterns is likely, to recruit the different sets of cortical neurons, and thus contributes to a variety of prefrontal functions. J. Comp. Neurol. 525:166-185, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Cyclooxygenase-2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents.

PubMed

Lin, Chun-Kuang; Tseng, Chin-Kai; Wu, Yu-Hsuan; Liaw, Chih-Chuang; Lin, Chun-Yu; Huang, Chung-Hao; Chen, Yen-Hsu; Lee, Jin-Ching

2017-03-20

Cyclooxygenase-2 (COX-2) is one of the important mediators of inflammation in response to viral infection, and it contributes to viral replication, for example, cytomegalovirus or hepatitis C virus replication. The role of COX-2 in dengue virus (DENV) replication remains unclear. In the present study, we observed an increased level of COX-2 in patients with dengue fever compared with healthy donors. Consistent with the clinical data, an elevated level of COX-2 expression was also observed in DENV-infected ICR suckling mice. Using cell-based experiments, we revealed that DENV-2 infection significantly induced COX-2 expression and prostaglandin E 2 (PGE 2 ) production in human hepatoma Huh-7 cells. The exogenous expression of COX-2 or PGE 2 treatment dose-dependently enhanced DENV-2 replication. In contrast, COX-2 gene silencing and catalytic inhibition sufficiently suppressed DENV-2 replication. In an ICR suckling mouse model, we identified that the COX-2 inhibitor NS398 protected mice from succumbing to life-threatening DENV-2 infection. By using COX-2 promoter-based analysis and specific inhibitors against signaling molecules, we identified that NF-κB and MAPK/JNK are critical factors for DENV-2-induced COX-2 expression and viral replication. Altogether, our results reveal that COX-2 is an important factor for DENV replication and can serve as a potential target for developing therapeutic agents against DENV infection.

A new class of dual-targeted antivirals: monophosphorylated acyclovir prodrug derivatives suppress both human immunodeficiency virus type 1 and herpes simplex virus type 2.

PubMed

Vanpouille, Christophe; Lisco, Andrea; Derudas, Marco; Saba, Elisa; Grivel, Jean-Charles; Brichacek, Beda; Scrimieri, Francesca; Schinazi, Raymond; Schols, Dominique; McGuigan, Christopher; Balzarini, Jan; Margolis, Leonid

2010-02-15

Human immunodeficiency virus type 1 (HIV-1) and herpes simplex virus type 2 (HSV-2) are responsible for 2 intersecting epidemics in which the disease caused by 1 virus facilitates the transmission of and pathogenesis by the other. Therefore, suppression of one virus infection will affect the other. Acyclovir, a common antiherpetic drug, was shown to directly suppress both viruses in coinfected tissues. However, both antiviral activities of acyclovir are dependent on phosphorylation by the nucleoside kinase activity of coinfecting human herpesviruses. We developed acyclovir ProTides, monophosphorylated acyclovir with the phosphate group masked by lipophilic groups to allow efficient cellular uptake, and investigated their antiviral potential in cell lines and in human tissues ex vivo. Acyclovir ProTides suppressed both HIV-1 and HSV-2 at median effective concentrations in the submicromolar range in ex vivo lymphoid and cervicovaginal human tissues and at 3-12 micromol/L in CD4(+) T cells. Acyclovir ProTides retained activity against acyclovir-resistant HSV-2. Acyclovir ProTides represent a new class of antivirals that suppress both HIV-1 and HSV-2 by directly and independently blocking the key replicative enzymes of both viruses. Further optimization of such compounds may lead to double-targeted antivirals that can prevent viral transmission and treat the 2 synergistic diseases caused by HIV-1 and HSV-2. To our knowledge, the acyclovir ProTides described here represent the first example of acyclic nucleoside monophosphate prodrugs being active against HIV-1.

High content image-based screening of a protease inhibitor library reveals compounds broadly active against Rift Valley fever virus and other highly pathogenic RNA viruses.

PubMed

Mudhasani, Rajini; Kota, Krishna P; Retterer, Cary; Tran, Julie P; Whitehouse, Chris A; Bavari, Sina

2014-08-01

High content image-based screening was developed as an approach to test a protease inhibitor small molecule library for antiviral activity against Rift Valley fever virus (RVFV) and to determine their mechanism of action. RVFV is the causative agent of severe disease of humans and animals throughout Africa and the Arabian Peninsula. Of the 849 compounds screened, 34 compounds exhibited ≥ 50% inhibition against RVFV. All of the hit compounds could be classified into 4 distinct groups based on their unique chemical backbone. Some of the compounds also showed broad antiviral activity against several highly pathogenic RNA viruses including Ebola, Marburg, Venezuela equine encephalitis, and Lassa viruses. Four hit compounds (C795-0925, D011-2120, F694-1532 and G202-0362), which were most active against RVFV and showed broad-spectrum antiviral activity, were selected for further evaluation for their cytotoxicity, dose response profile, and mode of action using classical virological methods and high-content imaging analysis. Time-of-addition assays in RVFV infections suggested that D011-2120 and G202-0362 targeted virus egress, while C795-0925 and F694-1532 inhibited virus replication. We showed that D011-2120 exhibited its antiviral effects by blocking microtubule polymerization, thereby disrupting the Golgi complex and inhibiting viral trafficking to the plasma membrane during virus egress. While G202-0362 also affected virus egress, it appears to do so by a different mechanism, namely by blocking virus budding from the trans Golgi. F694-1532 inhibited viral replication, but also appeared to inhibit overall cellular gene expression. However, G202-0362 and C795-0925 did not alter any of the morphological features that we examined and thus may prove to be good candidates for antiviral drug development. Overall this work demonstrates that high-content image analysis can be used to screen chemical libraries for new antivirals and to determine their mechanism of action and

High Content Image-Based Screening of a Protease Inhibitor Library Reveals Compounds Broadly Active against Rift Valley Fever Virus and Other Highly Pathogenic RNA Viruses

PubMed Central

Mudhasani, Rajini; Kota, Krishna P.; Retterer, Cary; Tran, Julie P.; Whitehouse, Chris A.; Bavari, Sina

2014-01-01

High content image-based screening was developed as an approach to test a protease inhibitor small molecule library for antiviral activity against Rift Valley fever virus (RVFV) and to determine their mechanism of action. RVFV is the causative agent of severe disease of humans and animals throughout Africa and the Arabian Peninsula. Of the 849 compounds screened, 34 compounds exhibited ≥50% inhibition against RVFV. All of the hit compounds could be classified into 4 distinct groups based on their unique chemical backbone. Some of the compounds also showed broad antiviral activity against several highly pathogenic RNA viruses including Ebola, Marburg, Venezuela equine encephalitis, and Lassa viruses. Four hit compounds (C795-0925, D011-2120, F694-1532 and G202-0362), which were most active against RVFV and showed broad-spectrum antiviral activity, were selected for further evaluation for their cytotoxicity, dose response profile, and mode of action using classical virological methods and high-content imaging analysis. Time-of-addition assays in RVFV infections suggested that D011-2120 and G202-0362 targeted virus egress, while C795-0925 and F694-1532 inhibited virus replication. We showed that D011-2120 exhibited its antiviral effects by blocking microtubule polymerization, thereby disrupting the Golgi complex and inhibiting viral trafficking to the plasma membrane during virus egress. While G202-0362 also affected virus egress, it appears to do so by a different mechanism, namely by blocking virus budding from the trans Golgi. F694-1532 inhibited viral replication, but also appeared to inhibit overall cellular gene expression. However, G202-0362 and C795-0925 did not alter any of the morphological features that we examined and thus may prove to be good candidates for antiviral drug development. Overall this work demonstrates that high-content image analysis can be used to screen chemical libraries for new antivirals and to determine their mechanism of action and

The crystal structure of Zika virus NS5 reveals conserved drug targets.

PubMed

Duan, Wenqian; Song, Hao; Wang, Haiyuan; Chai, Yan; Su, Chao; Qi, Jianxun; Shi, Yi; Gao, George F

2017-04-03

Zika virus (ZIKV) has emerged as major health concern, as ZIKV infection has been shown to be associated with microcephaly, severe neurological disease and possibly male sterility. As the largest protein component within the ZIKV replication complex, NS5 plays key roles in the life cycle and survival of the virus through its N-terminal methyltransferase (MTase) and C-terminal RNA-dependent RNA polymerase (RdRp) domains. Here, we present the crystal structures of ZIKV NS5 MTase in complex with an RNA cap analogue ( m7 GpppA) and the free NS5 RdRp. We have identified the conserved features of ZIKV NS5 MTase and RdRp structures that could lead to development of current antiviral inhibitors being used against flaviviruses, including dengue virus and West Nile virus, to treat ZIKV infection. These results should inform and accelerate the structure-based design of antiviral compounds against ZIKV. © 2017 The Authors.

Boron nitride nanotube-based biosensing of various bacterium/viruses: continuum modelling-based simulation approach.

PubMed

Panchal, Mitesh B; Upadhyay, Sanjay H

2014-09-01

In this study, the feasibility of single walled boron nitride nanotube (SWBNNT)-based biosensors has been ensured considering the continuum modelling-based simulation approach, for mass-based detection of various bacterium/viruses. Various types of bacterium or viruses have been taken into consideration at the free-end of the cantilevered configuration of the SWBNNT, as a biosensor. Resonant frequency shift-based analysis has been performed with the adsorption of various bacterium/viruses considered as additional mass to the SWBNNT-based sensor system. The continuum mechanics-based analytical approach, considering effective wall thickness has been considered to validate the finite element method (FEM)-based simulation results, based on continuum volume-based modelling of the SWBNNT. As a systematic analysis approach, the FEM-based simulation results are found in excellent agreement with the analytical results, to analyse the SWBNNTs for their wide range of applications such as nanoresonators, biosensors, gas-sensors, transducers and so on. The obtained results suggest that by using the SWBNNT of smaller size the sensitivity of the sensor system can be enhanced and detection of the bacterium/virus having mass of 4.28 × 10⁻²⁴ kg can be effectively performed.

Ebola virus: A gap in drug design and discovery - experimental and computational perspective.

PubMed

Balmith, Marissa; Faya, Mbuso; Soliman, Mahmoud E S

2017-03-01

The Ebola virus, formally known as the Ebola hemorrhagic fever, is an acute viral syndrome causing sporadic outbreaks that have ravaged West Africa. Due to its extreme virulence and highly transmissible nature, Ebola has been classified as a category A bioweapon organism. Only recently have vaccine or drug regimens for the Ebola virus been developed, including Zmapp and peptides. In addition, existing drugs which have been repurposed toward anti-Ebola virus activity have been re-examined and are seen to be promising candidates toward combating Ebola. Drug development involving computational tools has been widely employed toward target-based drug design. Screening large libraries have greatly stimulated research toward effective anti-Ebola virus drug regimens. Current emphasis has been placed on the investigation of host proteins and druggable viral targets. There is a huge gap in the literature regarding guidelines in the discovery of Ebola virus inhibitors, which may be due to the lack of information on the Ebola drug targets, binding sites, and mechanism of action of the virus. This review focuses on Ebola virus inhibitors, drugs which could be repurposed to combat the Ebola virus, computational methods which study drug-target interactions as well as providing further insight into the mode of action of the Ebola virus. © 2016 John Wiley & Sons A/S.

The Anti-Human Immunodeficiency Virus Drug Tenofovir, a Reverse Transcriptase Inhibitor, Also Targets the Herpes Simplex Virus DNA Polymerase.

PubMed

Andrei, Graciela; Gillemot, Sarah; Topalis, Dimitrios; Snoeck, Robert

2018-02-14

Genital herpes is an important cofactor for acquisition of human immunodeficiency virus (HIV) infection, and effective prophylaxis is a helpful strategy to halt both HIV and herpes simplex virus (HSV) transmission. The antiretroviral agent tenofovir, formulated as a vaginal microbicide gel, was shown to reduce the risk of HIV and HSV type 2 (HSV-2) acquisition. HSV type 1 (HSV-1) and HSV-2 mutants were selected for resistance to tenofovir and PMEO-DAPy (6-phosphonylmethoxyethoxy-2,4-diaminopyrimidine, an acyclic nucleoside phosphonate with dual anti-HSV and anti-HIV activity) by stepwise dose escalation. Several plaque-purified viruses were characterized phenotypically (drug resistance profiling) and genotypically (sequencing of the viral DNA polymerase gene). Tenofovir resistant and PMEO-DAPy-resistant viruses harbored specific amino acid substitutions associated with resistance not only to tenofovir and PMEO-DAPy but also to acyclovir and foscarnet. These amino acid changes (A719V, S724N, and L802F [HSV-1] and M789T and A724V [HSV-2]) were also found in clinical isolates recovered from patients refractory to acyclovir and/or foscarnet therapy or in laboratory-derived strains. A total of 10 (HSV-1) and 18 (HSV-2) well-characterized DNA polymerase mutants had decreased susceptibility to tenofovir and PMEO-DAPy. Tenofovir and PMEO-DAPy target the HSV DNA polymerase, and clinical isolates with DNA polymerase mutations emerging under acyclovir and/or foscarnet therapy showed cross-resistance to tenofovir and PMEO-DAPy. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Rabies virus envelope glycoprotein targets lentiviral vectors to the axonal retrograde pathway in motor neurons.

PubMed

Hislop, James N; Islam, Tarin A; Eleftheriadou, Ioanna; Carpentier, David C J; Trabalza, Antonio; Parkinson, Michael; Schiavo, Giampietro; Mazarakis, Nicholas D

2014-06-06

Rabies pseudotyped lentiviral vectors have great potential in gene therapy, not least because of their ability to transduce neurons following their distal axonal application. However, very little is known about the molecular processes that underlie their retrograde transport and cell transduction. Using multiple labeling techniques and confocal microscopy, we demonstrated that pseudotyping with rabies virus envelope glycoprotein (RV-G) enabled the axonal retrograde transport of two distinct subtypes of lentiviral vector in motor neuron cultures. Analysis of this process revealed that these vectors trafficked through Rab5-positive endosomes and accumulated within a non-acidic Rab7 compartment. RV-G pseudotyped vectors were co-transported with both the tetanus neurotoxin-binding fragment and the membrane proteins thought to mediate rabies virus endocytosis (neural cell adhesion molecule, nicotinic acetylcholine receptor, and p75 neurotrophin receptor), thus demonstrating that pseudotyping with RV-G targets lentiviral vectors for transport along the same pathway exploited by several toxins and viruses. Using motor neurons cultured in compartmentalized chambers, we demonstrated that axonal retrograde transport of these vectors was rapid and efficient; however, it was not able to transduce the targeted neurons efficiently, suggesting that impairment in processes occurring after arrival of the viral vector in the soma is responsible for the low transduction efficiency seen in vivo, which suggests a novel area for improvement of gene therapy vectors. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Targeted Induction of Interferon-λ in Humanized Chimeric Mouse Liver Abrogates Hepatotropic Virus Infection

PubMed Central

Kameyama, Takeshi; Tokunaga, Yuko; Nishito, Yasumasa; Hirabayashi, Kazuko; Yano, Junichi; Ochiya, Takahiro; Tateno, Chise; Tanaka, Yasuhito; Mizokami, Masashi; Tsukiyama-Kohara, Kyoko; Inoue, Kazuaki; Yoshiba, Makoto; Takaoka, Akinori; Kohara, Michinori

2013-01-01

Background & Aims The interferon (IFN) system plays a critical role in innate antiviral response. We presume that targeted induction of IFN in human liver shows robust antiviral effects on hepatitis C virus (HCV) and hepatitis B virus (HBV). Methods This study used chimeric mice harboring humanized livers and infected with HCV or HBV. This mouse model permitted simultaneous analysis of immune responses by human and mouse hepatocytes in the same liver and exploration of the mechanism of antiviral effect against these viruses. Targeted expression of IFN was induced by treating the animals with a complex comprising a hepatotropic cationic liposome and a synthetic double-stranded RNA analog, pIC (LIC-pIC). Viral replication, IFN gene expression, IFN protein production, and IFN antiviral activity were analyzed (for type I, II and III IFNs) in the livers and sera of these humanized chimeric mice. Results Following treatment with LIC-pIC, the humanized livers of chimeric mice exhibited increased expression (at the mRNA and protein level) of human IFN-λs, resulting in strong antiviral effect on HBV and HCV. Similar increases were not seen for human IFN-α or IFN-β in these animals. Strong induction of IFN-λs by LIC-pIC occurred only in human hepatocytes, and not in mouse hepatocytes nor in human cell lines derived from other (non-hepatic) tissues. LIC-pIC-induced IFN-λ production was mediated by the immune sensor adaptor molecules mitochondrial antiviral signaling protein (MAVS) and Toll/IL-1R domain-containing adaptor molecule-1 (TICAM-1), suggesting dual recognition of LIC-pIC by both sensor adaptor pathways. Conclusions These findings demonstrate that the expression and function of various IFNs differ depending on the animal species and tissues under investigation. Chimeric mice harboring humanized livers demonstrate that IFN-λs play an important role in the defense against human hepatic virus infection. PMID:23555725

Inactivation of the small GTP binding protein Rho induces multinucleate cell formation and apoptosis in murine T lymphoma EL4.

PubMed

Moorman, J P; Bobak, D A; Hahn, C S

1996-06-01

The small G-protein Rho regulates the actin microfilament-dependent cytoskeleton. Exoenzyme C3 of Clostridium botulinum ADP-ribosylates Rho at Asn41, a modification that functionally inactivates Rho. Using a Sindbis virus-based transient gene expression system, we studied the role of Rho in murine EL4 T lymphoma cells. We generated a double subgenomic infectious Sindbis virus (dsSIN:C3) recombinant which expressed C3 in >95% of EL4 cells. This intracellular C3 resulted in modification and inactivation of virtually all endogenous Rho. dsSIN:C3 infection led to the formation of multinucleate cells, likely by inhibiting the actin microfilament-dependent step of cytokinesis. Intriguingly, in spite of the inhibition of cytokinesis, karyokinesis continued, with the result that cells containing a nuclear DNA content as high as 16N (eight nuclei) were observed. In addition, dsSIN:C3-mediated inactivation of Rho was a potent activator of apoptosis in EL4 cells. To discern whether the formation of multinucleate cells was responsible for the activation of apoptosis, 5-fluorouracil (5-FUra) was used to induce cell cycle arrest. As expected, EL4 cells treated with 5-FUra were prevented from forming multinucleate cells upon infection with dsSIN:C3. dsSIN:C3 infection, however, still caused marked apoptosis in 5-FUra-treated cells, indicating that this activation of apoptosis was independent of multinucleate cell formation.

Development of a macrophage-targeting and phagocytosis-inducing bio-nanocapsule-based nanocarrier for drug delivery.

PubMed

Li, Hao; Tatematsu, Kenji; Somiya, Masaharu; Iijima, Masumi; Kuroda, Shun'ichi

2018-06-01

Macrophage hyperfunction or dysfunction is tightly associated with various diseases, such as osteoporosis, inflammatory disorder, and cancers. However, nearly all conventional drug delivery system (DDS) nanocarriers utilize endocytosis for entering target cells; thus, the development of macrophage-targeting and phagocytosis-inducing DDS nanocarriers for treating these diseases is required. In this study, we developed a hepatitis B virus (HBV) envelope L particle (i.e., bio-nanocapsule (BNC)) outwardly displaying a tandem form of protein G-derived IgG Fc-binding domain and protein L-derived IgG Fab-binding domain (GL-BNC). When conjugated with the macrophage-targeting ligand, mouse IgG2a (mIgG2a), the GL-BNC itself, and the liposome-fused GL-BNC (i.e., GL-virosome) spontaneously initiated aggregation by bridging between the Fc-binding domain and Fab-binding domain with mIgG2a. The aggregates were efficiently taken up by macrophages, whereas this was inhibited by latrunculin B, a phagocytosis-specific inhibitor. The mIgG2a-GL-virosome containing doxorubicin exhibited higher cytotoxicity toward macrophages than conventional liposomes and other BNC-based virosomes. Thus, GL-BNCs and GL-virosomes may constitute promising macrophage-targeting and phagocytosis-inducing DDS nanocarriers. We have developed a novel macrophage-targeting and phagocytosis-inducing bio-nanocapsule (BNC)-based nanocarrier named GL-BNC, which comprises a hepatitis B virus envelope L particle outwardly displaying protein G-derived IgG Fc- and protein L-derived IgG Fab-binding domains in tandem. The GL-BNC alone or liposome-fused form (GL-virosomes) could spontaneously aggregate when conjugated with macrophage-targeting IgGs, inducing phagocytosis by the interaction between IgG Fc of aggregates and FcγR on phagocytes. Thereby these aggregates were efficiently taken up by macrophages. GL-virosomes containing doxorubicin exhibited higher cytotoxicity towards macrophages than ZZ-virosomes and

A single phosphorodiamidate morpholino oligomer targeting VP24 protects rhesus monkeys against lethal Ebola virus infection.

PubMed

Warren, Travis K; Whitehouse, Chris A; Wells, Jay; Welch, Lisa; Heald, Alison E; Charleston, Jay S; Sazani, Pete; Reid, St Patrick; Iversen, Patrick L; Bavari, Sina

2015-02-10

Ebola viruses (EBOV) cause severe disease in humans and nonhuman primates with high mortality rates and continue to emerge in new geographic locations, including several countries in West Africa, the site of a large ongoing outbreak. Phosphorodiamidate morpholino oligomers (PMOs) are synthetic antisense molecules that are able to target mRNAs in a sequence-specific fashion and suppress translation through steric hindrance. We previously showed that the use of PMOs targeting a combination of VP35 and VP24 protected rhesus monkeys from lethal EBOV infection. Surprisingly, the present study revealed that a PMOplus compound targeting VP24 alone was sufficient to confer protection from lethal EBOV infection but that a PMOplus targeting VP35 alone resulted in no protection. This study further substantiates recent data demonstrating that VP24 may be a key virulence factor encoded by EBOV and suggests that VP24 is a promising target for the development of effective anti-EBOV countermeasures. Several West African countries are currently being ravaged by an outbreak of Ebola virus (EBOV) that has become a major epidemic affecting not only these African countries but also Europe and the United States. A better understanding of the mechanism of virulence of EBOV is important for the development of effective treatments, as no licensed treatments or vaccines for EBOV disease are currently available. This study of phosphorodiamidate morpholino oligomers (PMOs) targeting the mRNAs of two different EBOV proteins, alone and in combination, demonstrated that targeting a single protein was effective at conferring a significant survival benefit in an EBOV lethal primate model. Future development of PMOs with efficacy against EBOV will be simplified if only one PMO is required instead of a combination, particularly in terms of regulatory approval. Copyright © 2015 Warren et al.

Identification of chikungunya virus nsP2 protease inhibitors using structure-base approaches.

PubMed

Nguyen, Phuong T V; Yu, Haibo; Keller, Paul A

2015-04-01

The nsP2 protease of chikungunya virus (CHIKV) is one of the essential components of viral replication and it plays a crucial role in the cleavage of polyprotein precursors for the viral replication process. Therefore, it is gaining attention as a potential drug design target against CHIKV. Based on the recently determined crystal structure of the nsP2 protease of CHIKV, this study identified potential inhibitors of the virus using structure-based approaches with a combination of molecular docking, virtual screening and molecular dynamics (MD) simulations. The top hit compounds from database searching, using the NCI Diversity Set II, with targeting at five potential binding sites of the nsP2 protease, were identified by blind dockings and focused dockings. These complexes were then subjected to MD simulations to investigate the stability and flexibility of the complexes and to gain a more detailed insight into the interactions between the compounds and the enzyme. The hydrogen bonds and hydrophobic contacts were characterized for the complexes. Through structural alignment, the catalytic residues Cys1013 and His1083 were identified in the N-terminal region of the nsP2 protease. The absolute binding free energies were estimated by the linear interaction energy approach and compared with the binding affinities predicted with docking. The results provide valuable information for the development of inhibitors for CHIKV. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

Structure-based drug design for envelope protein E2 uncovers a new class of bovine viral diarrhea inhibitors that block virus entry.

PubMed

Pascual, María José; Merwaiss, Fernando; Leal, Emilse; Quintana, María Eugenia; Capozzo, Alejandra V; Cavasotto, Claudio N; Bollini, Mariela; Alvarez, Diego E

2018-01-01

Antiviral targeting of virus envelope proteins is an effective strategy for therapeutic intervention of viral infections. Here, we took a computer-guided approach with the aim of identifying new antivirals against the envelope protein E2 of bovine viral diarrhea virus (BVDV). BVDV is an enveloped virus with an RNA genome responsible for major economic losses of the cattle industry worldwide. Based on the crystal structure of the envelope protein E2, we defined a binding site at the interface of the two most distal domains from the virus membrane and pursued a hierarchical docking-based virtual screening search to identify small-molecule ligands of E2. Phenyl thiophene carboxamide derivative 12 (PTC12) emerged as a specific inhibitor of BVDV replication from in vitro antiviral activity screening of candidate molecules, displaying an IC 50 of 0.30 μM against the reference NADL strain of the virus. Using reverse genetics we constructed a recombinant BVDV expressing GFP that served as a sensitive reporter for the study of the mechanism of action of antiviral compounds. Time of drug addition assays showed that PTC12 inhibited an early step of infection. The mechanism of action was further dissected to find that the compound specifically acted at the internalization step of virus entry. Interestingly, we demonstrated that similar to PTC12, the benzimidazole derivative 03 (BI03) selected in the virtual screen also inhibited internalization of BVDV. Furthermore, docking analysis of PTC12 and BI03 into the binding site revealed common interactions with amino acid residues in E2 suggesting that both compounds could share the same molecular target. In conclusion, starting from a targeted design strategy of antivirals against E2 we identified PTC12 as a potent inhibitor of BVDV entry. The compound can be valuable in the design of antiviral strategies in combination with already well-characterized polymerase inhibitors of BVDV. Copyright © 2017 Elsevier B.V. All rights

Vector Competence of New Zealand Mosquitoes for Selected Arboviruses

PubMed Central

Kramer, Laura D.; Chin, Pam; Cane, Rachel P.; Kauffman, Elizabeth B.; Mackereth, Graham

2011-01-01

New Zealand (NZ) historically has been free of arboviral activity with the exception of Whataroa virus (Togaviridae: Alphavirus), which is established in bird populations and is transmitted by local mosquitoes. This naive situation is threatened by global warming, invasive mosquitoes, and tourism. To determine the threat of selected medically important arboviruses to NZ, vector competence assays were conducted using field collected endemic and introduced mosquito species. Four alphaviruses (Togaviridae): Barmah Forest virus, Chikungunya virus, Ross River virus, and Sindbis virus, and five flaviviruses (Flaviviridae): Dengue virus 2, Japanese encephalitis virus, Murray Valley encephalitis virus, West Nile virus, and Yellow fever virus were evaluated. Results indicate some NZ mosquito species are highly competent vectors of selected arboviruses, particularly alphaviruses, and may pose a threat were one of these arboviruses introduced at a time when the vector was prevalent and the climatic conditions favorable for virus transmission. PMID:21734146

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

Immunogenicity of ORFV-based vectors expressing the rabies virus glycoprotein in livestock species.

PubMed

Martins, Mathias; Joshi, Lok R; Rodrigues, Fernando S; Anziliero, Deniz; Frandoloso, Rafael; Kutish, Gerald F; Rock, Daniel L; Weiblen, Rudi; Flores, Eduardo F; Diel, Diego G

2017-11-01

The parapoxvirus Orf virus (ORFV) encodes several immunomodulatory proteins (IMPs) that modulate host-innate and pro-inflammatory responses and has been proposed as a vaccine delivery vector for use in animal species. Here we describe the construction and characterization of two recombinant ORFV vectors expressing the rabies virus (RABV) glycoprotein (G). The RABV-G gene was inserted in the ORFV024 or ORFV121 gene loci, which encode for IMPs that are unique to parapoxviruses and inhibit activation of the NF-κB signaling pathway. The immunogenicity of the resultant recombinant viruses (ORFV ∆024 RABV-G or ORFV ∆121 RABV-G, respectively) was evaluated in pigs and cattle. Immunization of the target species with ORFV ∆024 RABV-G and ORFV ∆121 RABV-G elicited robust neutralizing antibody responses against RABV. Notably, neutralizing antibody titers induced in ORFV ∆121 RABV-G-immunized pigs and cattle were significantly higher than those detected in ORFV ∆024 RABV-G-immunized animals, indicating a higher immunogenicity of ORFV Δ121 -based vectors in these animal species. Copyright © 2017 Elsevier Inc. All rights reserved.

Oncolytic herpes simplex virus-based strategies: toward a breakthrough in glioblastoma therapy

PubMed Central

Ning, Jianfang; Wakimoto, Hiroaki

2014-01-01

Oncolytic viruses (OV) are a class of antitumor agents that selectively kill tumor cells while sparing normal cells. Oncolytic herpes simplex virus (oHSV) has been investigated in clinical trials for patients with the malignant brain tumor glioblastoma for more than a decade. These clinical studies have shown the safety of oHSV administration to the human brain, however, therapeutic efficacy of oHSV as a single treatment remains unsatisfactory. Factors that could hamper the anti-glioblastoma efficacy of oHSV include: attenuated potency of oHSV due to deletion or mutation of viral genes involved in virulence, restricting viral replication and spread within the tumor; suboptimal oHSV delivery associated with intratumoral injection; virus infection-induced inflammatory and cellular immune responses which could inhibit oHSV replication and promote its clearance; lack of effective incorporation of oHSV into standard-of-care, and poor knowledge about the ability of oHSV to target glioblastoma stem cells (GSCs). In an attempt to address these issues, recent research efforts have been directed at: (1) design of new engineered viruses to enhance potency, (2) better understanding of the role of the cellular immunity elicited by oHSV infection of tumors, (3) combinatorial strategies with different antitumor agents with a mechanistic rationale, (4) “armed” viruses expressing therapeutic transgenes, (5) use of GSC-derived models in oHSV evaluation, and (6) combinations of these. In this review, we will describe the current status of oHSV clinical trials for glioblastoma, and discuss recent research advances and future directions toward successful oHSV-based therapy of glioblastoma. PMID:24999342

The processivity factor complex of feline herpes virus-1 is a new drug target.

PubMed

Zhukovskaya, Natalia L; Guan, Hancheng; Saw, Yih Ling; Nuth, Manunya; Ricciardi, Robert P

2015-03-01

Feline herpes virus-1 (FHV-1) is ubiquitous in the cat population and is a major cause of blindness for which antiviral drugs, including acyclovir, are not completely effective. Recurrent infections, due to reactivation of latent FHV-1 residing in the trigeminal ganglia, can lead to epithelial keratitis and stromal keratitis and eventually loss of sight. This has prompted the medical need for an antiviral drug that will specifically inhibit FHV-1 infection. A new antiviral target is the DNA polymerase and its associated processivity factor, which forms a complex that is essential for extended DNA strand synthesis. In this study we have cloned and expressed the FHV-1 DNA polymerase (f-UL30) and processivity factor (f-UL42) and demonstrated that both proteins are required to completely synthesize the 7249 nucleotide full-length DNA from the M13 primed-DNA template in vitro. Significantly, a known inhibitor of human herpes simplex virus-1 (HSV-1) processivity complex was shown to inhibit FHV-1 processive DNA synthesis in vitro and block infection of cells. This validates using f-UL42/f-UL30 as a new antiviral drug target to treat feline ocular herpes infection. Copyright © 2015 Elsevier B.V. All rights reserved.

Viral RNA Intermediates as Targets for Detection and Discovery of Novel and Emerging Mosquito-Borne Viruses

PubMed Central

Yam, Alice Wei Yee; Colmant, Agathe M. G.; McLean, Breeanna J.; Prow, Natalie A.; Watterson, Daniel; Hall-Mendelin, Sonja; Warrilow, David; Ng, Mah-Lee; Khromykh, Alexander A.; Hall, Roy A.

2015-01-01

Mosquito-borne viruses encompass a range of virus families, comprising a number of significant human pathogens (e.g., dengue viruses, West Nile virus, Chikungunya virus). Virulent strains of these viruses are continually evolving and expanding their geographic range, thus rapid and sensitive screening assays are required to detect emerging viruses and monitor their prevalence and spread in mosquito populations. Double-stranded RNA (dsRNA) is produced during the replication of many of these viruses as either an intermediate in RNA replication (e.g., flaviviruses, togaviruses) or the double-stranded RNA genome (e.g., reoviruses). Detection and discovery of novel viruses from field and clinical samples usually relies on recognition of antigens or nucleotide sequences conserved within a virus genus or family. However, due to the wide antigenic and genetic variation within and between viral families, many novel or divergent species can be overlooked by these approaches. We have developed two monoclonal antibodies (mAbs) which show co-localised staining with proteins involved in viral RNA replication in immunofluorescence assay (IFA), suggesting specific reactivity to viral dsRNA. By assessing binding against a panel of synthetic dsRNA molecules, we have shown that these mAbs recognise dsRNA greater than 30 base pairs in length in a sequence-independent manner. IFA and enzyme-linked immunosorbent assay (ELISA) were employed to demonstrate detection of a panel of RNA viruses from several families, in a range of cell types. These mAbs, termed monoclonal antibodies to viral RNA intermediates in cells (MAVRIC), have now been incorporated into a high-throughput, economical ELISA-based screening system for the detection and discovery of viruses from mosquito populations. Our results have demonstrated that this simple system enables the efficient detection and isolation of a range of known and novel viruses in cells inoculated with field-caught mosquito samples, and represents

Collection of Viable Aerosolized Influenza Virus and Other Respiratory Viruses in a Student Health Care Center through Water-Based Condensation Growth

PubMed Central

Pan, Maohua; Bonny, Tania S.; Loeb, Julia; Jiang, Xiao; Eiguren-Fernandez, Arantzazu; Hering, Susanne; Fan, Z. Hugh; Wu, Chang-Yu

2017-01-01

ABSTRACT The dynamics and significance of aerosol transmission of respiratory viruses are still controversial, for the major reasons that virus aerosols are inefficiently collected by commonly used air samplers and that the collected viruses are inactivated by the collection method. Without knowledge of virus viability, infection risk analyses lack accuracy. This pilot study was performed to (i) determine whether infectious (viable) respiratory viruses in aerosols could be collected from air in a real world environment by the viable virus aerosol sampler (VIVAS), (ii) compare and contrast the efficacy of the standard bioaerosol sampler, the BioSampler, with that of the VIVAS for the collection of airborne viruses in a real world environment, and (iii) gain insights for the use of the VIVAS for respiratory virus sampling. The VIVAS operates via a water vapor condensation process to enlarge aerosolized virus particles to facilitate their capture. A variety of viable human respiratory viruses, including influenza A H1N1 and H3N2 viruses and influenza B viruses, were collected by the VIVAS located at least 2 m from seated patients, during a late-onset 2016 influenza virus outbreak. Whereas the BioSampler when operated following our optimized parameters also collected virus aerosols, it was nevertheless overall less successful based on a lower frequency of virus isolation in most cases. This side-by-side comparison highlights some limitations of past studies based on impingement-based sampling, which may have generated false-negative results due to either poor collection efficiency and/or virus inactivation due to the collection process. IMPORTANCE The significance of virus aerosols in the natural transmission of respiratory diseases has been a contentious issue, primarily because it is difficult to collect or sample virus aerosols using currently available air sampling devices. We tested a new air sampler based on water vapor condensation for efficient sampling of

A manual and an automatic TERS based virus discrimination

NASA Astrophysics Data System (ADS)

Olschewski, Konstanze; Kämmer, Evelyn; Stöckel, Stephan; Bocklitz, Thomas; Deckert-Gaudig, Tanja; Zell, Roland; Cialla-May, Dana; Weber, Karina; Deckert, Volker; Popp, Jürgen

2015-02-01

Rapid techniques for virus identification are more relevant today than ever. Conventional virus detection and identification strategies generally rest upon various microbiological methods and genomic approaches, which are not suited for the analysis of single virus particles. In contrast, the highly sensitive spectroscopic technique tip-enhanced Raman spectroscopy (TERS) allows the characterisation of biological nano-structures like virions on a single-particle level. In this study, the feasibility of TERS in combination with chemometrics to discriminate two pathogenic viruses, Varicella-zoster virus (VZV) and Porcine teschovirus (PTV), was investigated. In a first step, chemometric methods transformed the spectral data in such a way that a rapid visual discrimination of the two examined viruses was enabled. In a further step, these methods were utilised to perform an automatic quality rating of the measured spectra. Spectra that passed this test were eventually used to calculate a classification model, through which a successful discrimination of the two viral species based on TERS spectra of single virus particles was also realised with a classification accuracy of 91%.Rapid techniques for virus identification are more relevant today than ever. Conventional virus detection and identification strategies generally rest upon various microbiological methods and genomic approaches, which are not suited for the analysis of single virus particles. In contrast, the highly sensitive spectroscopic technique tip-enhanced Raman spectroscopy (TERS) allows the characterisation of biological nano-structures like virions on a single-particle level. In this study, the feasibility of TERS in combination with chemometrics to discriminate two pathogenic viruses, Varicella-zoster virus (VZV) and Porcine teschovirus (PTV), was investigated. In a first step, chemometric methods transformed the spectral data in such a way that a rapid visual discrimination of the two examined viruses

Ovarian Tumor (OTU)-domain Containing Viral Proteases Evade Ubiquitin- and ISG15-dependent Innate Immune Responses

PubMed Central

Frias-Staheli, Natalia; Giannakopoulos, Nadia V.; Kikkert, Marjolein; Taylor, Shannon L.; Bridgen, Anne; Paragas, Jason J.; Richt, Juergen A.; Rowland, Raymond R.; Schmaljohn, Connie S.; Lenschow, Deborah J.; Snijder, Eric J.; García-Sastre, Adolfo; Virgin, Herbert Whiting

2007-01-01

Summary Ubiquitin (Ub) and interferon stimulated gene product 15 (ISG15) reversibly conjugate to proteins via a conserved LRLRGG C-terminal motif, mediating important innate antiviral responses. The ovarian tumor (OTU) domain represents a superfamily of predicted proteases found in eukaryotic, bacterial and viral proteins, some of which have Ub-deconjugating activity. We show that the OTU domain-containing proteases of nairoviruses and arteriviruses hydrolyze Ub and ISG15 from cellular target proteins. This broad activity contrasts with the target specificity of known mammalian OTU domain-containing proteins. The biological significance of this activity of viral OTU domain-containing proteases was evidenced by their capacity to inhibit NF-κB dependent signaling and to antagonize the antiviral effects of ISG15 during Sindbis virus infection in vivo. The deconjugating activity of viral OTU proteases represents a novel viral immune evasion mechanism that inhibits Ub-and ISG15-dependent antiviral pathways. PMID:18078692

Single-particle fusion of influenza viruses reveals complex interactions with target membranes

NASA Astrophysics Data System (ADS)

van der Borg, Guus; Braddock, Scarlett; Blijleven, Jelle S.; van Oijen, Antoine M.; Roos, Wouter H.

2018-05-01

The first step in infection of influenza A virus is contact with the host cell membrane, with which it later fuses. The composition of the target bilayer exerts a complex influence on both fusion efficiency and time. Here, an in vitro, single-particle approach is used to study this effect. Using total internal reflection fluorescence (TIRF) microscopy and a microfluidic flow cell, the hemifusion of single virions is visualized. Hemifusion efficiency and kinetics are studied while altering target bilayer cholesterol content and sialic-acid donor. Cholesterol ratios tested were 0%, 10%, 20%, and 40%. Sialic-acid donors GD1a and GYPA were used. Both cholesterol ratio and sialic-acid donors proved to have a significant effect on hemifusion efficiency. Furthermore, comparison between GD1a and GYPA conditions shows that the cholesterol dependence of the hemifusion time is severely affected by the sialic-acid donor. Only GD1a shows a clear increasing trend in hemifusion efficiency and time with increasing cholesterol concentration of the target bilayer with maximum rates for GD1A and 40% cholesterol. Overall our results show that sialic acid donor and target bilayer composition should be carefully chosen, depending on the desired hemifusion time and efficiency in the experiment.

Inhibition of Dengue Virus Entry into Target Cells Using Synthetic Antiviral Peptides

PubMed Central

Alhoot, Mohammed Abdelfatah; Rathinam, Alwin Kumar; Wang, Seok Mui; Manikam, Rishya; Sekaran, Shamala Devi

2013-01-01

Despite the importance of DENV as a human pathogen, there is no specific treatment or protective vaccine. Successful entry into the host cells is necessary for establishing the infection. Recently, the virus entry step has become an attractive therapeutic strategy because it represents a barrier to suppress the onset of the infection. Four putative antiviral peptides were designed to target domain III of DENV-2 E protein using BioMoDroid algorithm. Two peptides showed significant inhibition of DENV when simultaneously incubated as shown by plaque formation assay, RT-qPCR, and Western blot analysis. Both DET4 and DET2 showed significant inhibition of virus entry (84.6% and 40.6% respectively) using micromolar concentrations. Furthermore, the TEM images showed that the inhibitory peptides caused structural abnormalities and alteration of the arrangement of the viral E protein, which interferes with virus binding and entry. Inhibition of DENV entry during the initial stages of infection can potentially reduce the viremia in infected humans resulting in prevention of the progression of dengue fever to the severe life-threatening infection, reduce the infected vector numbers, and thus break the transmission cycle. Moreover these peptides though designed against the conserved region in DENV-2 would have the potential to be active against all the serotypes of dengue and might be considered as Hits to begin designing and developing of more potent analogous peptides that could constitute as promising therapeutic agents for attenuating dengue infection. PMID:23630436

Quantitative multi-target RNA profiling in Epstein-Barr virus infected tumor cells.

PubMed

Greijer, A E; Ramayanti, O; Verkuijlen, S A W M; Novalić, Z; Juwana, H; Middeldorp, J M

2017-03-01

Epstein-Barr virus (EBV) is etiologically linked to multiple acute, chronic and malignant diseases. Detection of EBV-RNA transcripts in tissues or biofluids besides EBV-DNA can help in diagnosing EBV related syndromes. Sensitive EBV transcription profiling yields new insights on its pathogenic role and may be useful for monitoring virus targeted therapy. Here we describe a multi-gene quantitative RT-PCR profiling method that simultaneously detects a broad spectrum (n=16) of crucial latent and lytic EBV transcripts. These transcripts include (but are not restricted to), EBNA1, EBNA2, LMP1, LMP2, BARTs, EBER1, BARF1 and ZEBRA, Rta, BGLF4 (PK), BXLF1 (TK) and BFRF3 (VCAp18) all of which have been implicated in EBV-driven oncogenesis and viral replication. With this method we determine the amount of RNA copies per infected (tumor) cell in bulk populations of various origin. While we confirm the expected RNA profiles within classic EBV latency programs, this sensitive quantitative approach revealed the presence of rare cells undergoing lytic replication. Inducing lytic replication in EBV tumor cells supports apoptosis and is considered as therapeutic approach to treat EBV-driven malignancies. This sensitive multi-primed quantitative RT-PCR approach can provide broader understanding of transcriptional activity in latent and lytic EBV infection and is suitable for monitoring virus-specific therapy responses in patients with EBV associated cancers. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Collection of Viable Aerosolized Influenza Virus and Other Respiratory Viruses in a Student Health Care Center through Water-Based Condensation Growth.

PubMed

Pan, Maohua; Bonny, Tania S; Loeb, Julia; Jiang, Xiao; Lednicky, John A; Eiguren-Fernandez, Arantzazu; Hering, Susanne; Fan, Z Hugh; Wu, Chang-Yu

2017-01-01

The dynamics and significance of aerosol transmission of respiratory viruses are still controversial, for the major reasons that virus aerosols are inefficiently collected by commonly used air samplers and that the collected viruses are inactivated by the collection method. Without knowledge of virus viability, infection risk analyses lack accuracy. This pilot study was performed to (i) determine whether infectious (viable) respiratory viruses in aerosols could be collected from air in a real world environment by the vi able v irus a erosol s ampler (VIVAS), (ii) compare and contrast the efficacy of the standard bioaerosol sampler, the BioSampler, with that of the VIVAS for the collection of airborne viruses in a real world environment, and (iii) gain insights for the use of the VIVAS for respiratory virus sampling. The VIVAS operates via a water vapor condensation process to enlarge aerosolized virus particles to facilitate their capture. A variety of viable human respiratory viruses, including influenza A H1N1 and H3N2 viruses and influenza B viruses, were collected by the VIVAS located at least 2 m from seated patients, during a late-onset 2016 influenza virus outbreak. Whereas the BioSampler when operated following our optimized parameters also collected virus aerosols, it was nevertheless overall less successful based on a lower frequency of virus isolation in most cases. This side-by-side comparison highlights some limitations of past studies based on impingement-based sampling, which may have generated false-negative results due to either poor collection efficiency and/or virus inactivation due to the collection process. IMPORTANCE The significance of virus aerosols in the natural transmission of respiratory diseases has been a contentious issue, primarily because it is difficult to collect or sample virus aerosols using currently available air sampling devices. We tested a new air sampler based on water vapor condensation for efficient sampling of viable

Targeting of a Nuclease to Murine Leukemia Virus Capsids Inhibits Viral Multiplication

NASA Astrophysics Data System (ADS)

Natsoulis, Georges; Seshaiah, Partha; Federspiel, Mark J.; Rein, Alan; Hughes, Stephen H.; Boeke, Jef D.

1995-01-01

Capsid-targeted viral inactivation is an antiviral strategy in which toxic fusion proteins are targeted to virions, where they inhibit viral multiplication by destroying viral components. These fusion proteins consist of a virion structural protein moiety and an enzymatic moiety such as a nuclease. Such fusion proteins can severely inhibit transposition of yeast retrotransposon Ty1, an element whose transposition mechanistically resembles retroviral multiplication. We demonstrate that expression of a murine retrovirus capsid-staphylococcal nuclease fusion protein inhibits multiplication of the corresponding murine leukemia virus by 30- to 100-fold. Staphylococcal nuclease is apparently inactive intracellularly and hence nontoxic to the host cell, but it is active extracellularly because of its requirement for high concentrations of Ca2+ ions. Virions assembled in and shed from cells expressing the fusion protein contain very small amounts of intact viral RNA, as would be predicted for nuclease-mediated inhibition of viral multiplication.

Enhancing emotional-based target prediction

NASA Astrophysics Data System (ADS)

Gosnell, Michael; Woodley, Robert

2008-04-01

This work extends existing agent-based target movement prediction to include key ideas of behavioral inertia, steady states, and catastrophic change from existing psychological, sociological, and mathematical work. Existing target prediction work inherently assumes a single steady state for target behavior, and attempts to classify behavior based on a single emotional state set. The enhanced, emotional-based target prediction maintains up to three distinct steady states, or typical behaviors, based on a target's operating conditions and observed behaviors. Each steady state has an associated behavioral inertia, similar to the standard deviation of behaviors within that state. The enhanced prediction framework also allows steady state transitions through catastrophic change and individual steady states could be used in an offline analysis with additional modeling efforts to better predict anticipated target reactions.

Cyclooxygenase‐2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents

PubMed Central

Lin, Chun-Kuang; Tseng, Chin-Kai; Wu, Yu-Hsuan; Liaw, Chih-Chuang; Lin, Chun-Yu; Huang, Chung-Hao; Chen, Yen-Hsu; Lee, Jin-Ching

2017-01-01

Cyclooxygenase-2 (COX-2) is one of the important mediators of inflammation in response to viral infection, and it contributes to viral replication, for example, cytomegalovirus or hepatitis C virus replication. The role of COX-2 in dengue virus (DENV) replication remains unclear. In the present study, we observed an increased level of COX-2 in patients with dengue fever compared with healthy donors. Consistent with the clinical data, an elevated level of COX-2 expression was also observed in DENV-infected ICR suckling mice. Using cell-based experiments, we revealed that DENV-2 infection significantly induced COX-2 expression and prostaglandin E2 (PGE2) production in human hepatoma Huh-7 cells. The exogenous expression of COX-2 or PGE2 treatment dose-dependently enhanced DENV-2 replication. In contrast, COX-2 gene silencing and catalytic inhibition sufficiently suppressed DENV-2 replication. In an ICR suckling mouse model, we identified that the COX-2 inhibitor NS398 protected mice from succumbing to life-threatening DENV-2 infection. By using COX-2 promoter-based analysis and specific inhibitors against signaling molecules, we identified that NF-κB and MAPK/JNK are critical factors for DENV-2-induced COX-2 expression and viral replication. Altogether, our results reveal that COX-2 is an important factor for DENV replication and can serve as a potential target for developing therapeutic agents against DENV infection. PMID:28317866

Evaluating perspectives for PRRS virus elimination from pig dense areas with a risk factor based herd index.

PubMed

Fahrion, A S; Beilage, E grosse; Nathues, H; Dürr, S; Doherr, M G

2014-06-01

Porcine reproductive and respiratory syndrome virus (PRRSV) is wide-spread in pig populations globally. In many regions of Europe with intensive pig production and high herd densities, the virus is endemic and can cause disease and production losses. This fuels discussion about the feasibility and sustainability of virus elimination from larger geographic regions. The implementation of a program aiming at virus elimination for areas with high pig density is unprecedented and its potential success is unknown. The objective of this work was to approach pig population data with a simple method that could support assessing the feasibility of a sustainable regional PRRSV elimination. Based on known risk factors such as pig herd structure and neighborhood conditions, an index characterizing individual herds' potential for endemic virus circulation and reinfection was designed. This index was subsequently used to compare data of all pig herds in two regions with different pig- and herd-densities in Lower Saxony (North-West Germany) where PRRSV is endemic. Distribution of the indexed herds was displayed using GIS. Clusters of high herd index densities forming potential risk hot spots were identified which could represent key target areas for surveillance and biosecurity measures under a control program aimed at virus elimination. In an additional step, for the study region with the higher pig density (2463 pigs/km(2) farmland), the potential distribution of PRRSV-free and non-free herds during the implementation of a national control program aiming at national virus elimination was modeled. Complex herd and trade network structures suggest that PRRSV elimination in regions with intensive pig farming like that of middle Europe would have to involve legal regulation and be accompanied by important trade and animal movement restrictions. The proposed methodology of risk index mapping could be adapted to areas varying in size, herd structure and density. Interpreted in the

The genomic underpinnings of eukaryotic virus taxonomy: creating a sequence-based framework for family-level virus classification.

PubMed

Aiewsakun, Pakorn; Simmonds, Peter

2018-02-20

The International Committee on Taxonomy of Viruses (ICTV) classifies viruses into families, genera and species and provides a regulated system for their nomenclature that is universally used in virus descriptions. Virus taxonomic assignments have traditionally been based upon virus phenotypic properties such as host range, virion morphology and replication mechanisms, particularly at family level. However, gene sequence comparisons provide a clearer guide to their evolutionary relationships and provide the only information that may guide the incorporation of viruses detected in environmental (metagenomic) studies that lack any phenotypic data. The current study sought to determine whether the existing virus taxonomy could be reproduced by examination of genetic relationships through the extraction of protein-coding gene signatures and genome organisational features. We found large-scale consistency between genetic relationships and taxonomic assignments for viruses of all genome configurations and genome sizes. The analysis pipeline that we have called 'Genome Relationships Applied to Virus Taxonomy' (GRAViTy) was highly effective at reproducing the current assignments of viruses at family level as well as inter-family groupings into orders. Its ability to correctly differentiate assigned viruses from unassigned viruses, and classify them into the correct taxonomic group, was evaluated by threefold cross-validation technique. This predicted family membership of eukaryotic viruses with close to 100% accuracy and specificity potentially enabling the algorithm to predict assignments for the vast corpus of metagenomic sequences consistently with ICTV taxonomy rules. In an evaluation run of GRAViTy, over one half (460/921) of (near)-complete genome sequences from several large published metagenomic eukaryotic virus datasets were assigned to 127 novel family-level groupings. If corroborated by other analysis methods, these would potentially more than double the number of

Characterization of recombinant yellow fever-dengue vaccine viruses with human monoclonal antibodies targeting key conformational epitopes.

PubMed

Lecouturier, Valerie; Berry, Catherine; Saulnier, Aure; Naville, Sophie; Manin, Catherine; Girerd-Chambaz, Yves; Crowe, James E; Jackson, Nicholas; Guy, Bruno

2018-04-26

The recombinant yellow fever-17D-dengue virus, live, attenuated, tetravalent dengue vaccine (CYD-TDV) is licensed in several dengue-endemic countries. Although the vaccine provides protection against dengue, the level of protection differs by serotype and warrants further investigation. We characterized the antigenic properties of each vaccine virus serotype using highly neutralizing human monoclonal antibodies (hmAbs) that bind quaternary structure-dependent epitopes. Specifically, we monitored the binding of dengue virus-1 (DENV-1; 1F4), DENV-2 (2D22) or DENV-3 (5J7) serotype-specific or DENV-1-4 cross-reactive (1C19) hmAbs to the four chimeric yellow fever-dengue vaccine viruses (CYD-1-4) included in phase III vaccine formulations using a range of biochemical and functional assays (dot blot, ELISA, surface plasmon resonance and plaque reduction neutralization assays). In addition, we used the "classic" live, attenuated DENV-2 vaccine serotype, immature CYD-2 viruses and DENV-2 virus-like particles as control antigens for anti-serotype-2 reactivity. The CYD vaccine serotypes were recognized by each hmAbs with the expected specificity, moreover, surface plasmon resonance indicated a high functional affinity interaction with the CYD serotypes. In addition, the hmAbs provided similar protection against CYD and wild-type dengue viruses in the in vitro neutralization assay. Overall, these findings demonstrate that the four CYD viruses used in clinical trials display key conformational and functional epitopes targeted by serotype-specific and/or cross-reactive neutralizing human antibodies. More specifically, we showed that CYD-2 displays serotype- specific epitopes present only on the mature virus. This indicates that the CYD-TDV has the ability to elicit antibody specificities which are similar to those induced by the wild type DENV. Future investigations will be needed to address the nature of CYD-TDV-induced responses after vaccine administration, and how these

Rates of spontaneous mutation among RNA viruses.

PubMed Central

Drake, J W

1993-01-01

Simple methods are presented to estimate rates of spontaneous mutation from mutant frequencies and population parameters in RNA viruses. Published mutant frequencies yield a wide range of mutation rates per genome per replication, mainly because mutational targets have usually been small and, thus, poor samples of the mutability of the average base. Nevertheless, there is a clear central tendency for lytic RNA viruses (bacteriophage Q beta, poliomyelitis, vesicular stomatitis, and influenza A) to display rates of spontaneous mutation of approximately 1 per genome per replication. This rate is some 300-fold higher than previously reported for DNA-based microbes. Lytic RNA viruses thus mutate at a rate close to the maximum value compatible with viability. Retroviruses (spleen necrosis, murine leukemia, Rous sarcoma), however, mutate at an average rate about an order of magnitude lower than lytic RNA viruses. PMID:8387212

Closing the door on flaviviruses: entry as a target for antiviral drug design.

PubMed

Perera, Rushika; Khaliq, Mansoora; Kuhn, Richard J

2008-10-01

With the emergence and rapid spread of West Nile virus in the United States since 1999, and the 50-100 million infections per year caused by dengue virus globally, the threat of flaviviruses as re-emerging human pathogens has become a reality. To support the efforts that are currently being pursued to develop effective vaccines against these viruses, researchers are also actively pursuing the development of small molecule compounds that target various aspects of the virus life cycle. Recent advances in the structural characterization of the flaviviruses have provided a strong foundation towards these efforts. These studies have provided the pseudo-atomic structures of virions from several members of the genus as well as atomic resolution structures of several viral proteins. Most importantly, these studies have highlighted specific structural rearrangements that occur within the virion that are necessary for the virus to complete its life cycle. These rearrangements occur when the virus must transition from immature, to mature, to fusion-active states and rely heavily on the conformational flexibility of the envelope (E) protein that forms the outer glycoprotein shell of the virus. Analysis of these conformational changes can suggest promising targets for structure-based antiviral design. For instance, by targeting the flexibility of the E protein, it might be possible to inhibit required rearrangements of this protein and trap the virus in a specific state. This would interfere with a productive flaviviral infection. This review presents a structural perspective of the flavivirus life cycle and focuses on the role of the E protein as an opportune target for structure-based antiviral drug design.

Virus inactivation studies using ion beams, electron and gamma irradiation

NASA Astrophysics Data System (ADS)

Smolko, Eduardo E.; Lombardo, Jorge H.

2005-07-01

Known methods of virus inactivation are based on the chemical action of some substances such as acetylethylenimine, betapropiolactone, glycidalaldehyde, formaldehyde, etc. In such a process, the viral suspension should be kept at room or higher temperatures for 24-48 h. Under these conditions, physical and chemical agents act to degrade the virus antigenic proteins. On the contrary with ionizing radiations at low temperatures, the treatment does not cause such degradation allowing the study of different viral functions. In this work, particle (α, d and ß) and γ irradiations were used for partial and total inactivation of Foot and Mouth Disease Virus (FMDV), Rauscher Leukemia Virus (RLV) and Herpes Simplex Virus (HSV). Obtention of the D37 dose from survival curves and the application of the target theory, permitted the determination of molecular weight of the nucleic acid genomes, EBR values and useful information for vaccine preparation. For RLV virus, a two target model of the RNA genome was deduced in accordance with biological information while from data from the literature and our own work on the structure of the scrapie prion, considering the molecular weight obtained by application of the theory, a new model for prion replication is presented, based on a trimer molecule.

Resistance to Two Heterologous Neurotropic Oncolytic Viruses, Semliki Forest Virus and Vaccinia Virus, in Experimental Glioma

PubMed Central

Le Boeuf, Fabrice; Lemay, Chantal; De Silva, Naomi; Diallo, Jean-Simon; Cox, Julie; Becker, Michelle; Choi, Youngmin; Ananth, Abhirami; Sellers, Clara; Breton, Sophie; Roy, Dominic; Falls, Theresa; Brun, Jan; Hemminki, Akseli; Hinkkanen, Ari; Bell, John C.

2013-01-01

Attenuated Semliki Forest virus (SFV) may be suitable for targeting malignant glioma due to its natural neurotropism, but its replication in brain tumor cells may be restricted by innate antiviral defenses. We attempted to facilitate SFV replication in glioma cells by combining it with vaccinia virus, which is capable of antagonizing such defenses. Surprisingly, we found parenchymal mouse brain tumors to be refractory to both viruses. Also, vaccinia virus appears to be sensitive to SFV-induced antiviral interference. PMID:23221568

Single-dose live-attenuated vesicular stomatitis virus-based vaccine protects African green monkeys from Nipah virus disease.

PubMed

Prescott, Joseph; DeBuysscher, Blair L; Feldmann, Friederike; Gardner, Donald J; Haddock, Elaine; Martellaro, Cynthia; Scott, Dana; Feldmann, Heinz

2015-06-04

Nipah virus is a zoonotic paramyxovirus that causes severe respiratory and/or encephalitic disease in humans, often resulting in death. It is transmitted from pteropus fruit bats, which serve as the natural reservoir of the virus, and outbreaks occur on an almost annual basis in Bangladesh or India. Outbreaks are small and sporadic, and several cases of human-to-human transmission have been documented as an important feature of the epidemiology of Nipah virus disease. There are no approved countermeasures to combat infection and medical intervention is supportive. We recently generated a recombinant replication-competent vesicular stomatitis virus-based vaccine that encodes a Nipah virus glycoprotein as an antigen and is highly efficacious in the hamster model of Nipah virus disease. Herein, we show that this vaccine protects African green monkeys, a well-characterized model of Nipah virus disease, from disease one month after a single intramuscular administration of the vaccine. Vaccination resulted in a rapid and strong virus-specific immune response which inhibited virus shedding and replication. This vaccine platform provides a rapid means to afford protection from Nipah virus in an outbreak situation. Published by Elsevier Ltd.

Single-dose Live-attenuated Vesicular Stomatitis Virus-based Vaccine Protects African Green Monkeys from Nipah Virus Disease

PubMed Central

Prescott, Joseph; DeBuysscher, Blair L.; Feldmann, Friederike; Gardner, Donald J.; Haddock, Elaine; Martellaro, Cynthia; Scott, Dana; Feldmann, Heinz

2015-01-01

Nipah virus is a zoonotic paramyxovirus that causes severe respiratory and/or encephalitic disease in humans, often resulting in death. It is transmitted from pteropus fruit bats, which serve as the natural reservoir of the virus, and outbreaks occur on an almost annual basis in Bangladesh or India. Outbreaks are small and sporadic, and several cases of human-to-human transmission have been documented as an important feature of the epidemiology of Nipah virus disease. There are no approved countermeasures to combat infection and medical intervention is supportive. We recently generated a recombinant replication-competent vesicular stomatitis virus-based vaccine that encodes a Nipah virus glycoprotein as an antigen and is highly efficacious in the hamster model of Nipah virus disease. Herein, we show that this vaccine protects African green monkeys, a well-characterized model of Nipah virus disease, from disease one month after a single intramuscular administration of the vaccine. Vaccination resulted in a rapid and strong virus-specific immune response which inhibited virus shedding and replication. This vaccine platform provides a rapid means to afford protection from Nipah virus in an outbreak situation. PMID:25865472

Interleukin-10 Modulation of Virus Clearance and Disease in Mice with Alphaviral Encephalomyelitis.

PubMed

Martin, Nina M; Griffin, Diane E

2018-03-15

Alphaviruses are an important cause of mosquito-borne outbreaks of arthritis, rash, and encephalomyelitis. Previous studies in mice with a virulent strain (neuroadapted SINV [NSV]) of the alphavirus Sindbis virus (SINV) identified a role for Th17 cells and regulation by interleukin-10 (IL-10) in the pathogenesis of fatal encephalomyelitis (K. A. Kulcsar, V. K. Baxter, I. P. Greene, and D. E. Griffin, Proc Natl Acad Sci U S A 111:16053-16058, 2014, https://doi.org/10.1073/pnas.1418966111). To determine the role of virus virulence in generation of immune responses, we analyzed the modulatory effects of IL-10 on disease severity, virus clearance, and the CD4 + T cell response to infection with a recombinant strain of SINV of intermediate virulence (TE12). The absence of IL-10 during TE12 infection led to longer morbidity, more weight loss, higher mortality, and slower viral clearance than in wild-type mice. More severe disease and impaired virus clearance in IL-10 -/- mice were associated with more Th1 cells, fewer Th2 cells, innate lymphoid type 2 cells, regulatory cells, and B cells, and delayed production of antiviral antibody in the central nervous system (CNS) without an effect on Th17 cells. Therefore, IL-10 deficiency led to more severe disease in TE12-infected mice by increasing Th1 cells and by hampering development of the local B cell responses necessary for rapid production of antiviral antibody and virus clearance from the CNS. In addition, the shift from Th17 to Th1 responses with decreased virus virulence indicates that the effects of IL-10 deficiency on immunopathologic responses in the CNS during alphavirus infection are influenced by virus strain. IMPORTANCE Alphaviruses cause mosquito-borne outbreaks of encephalomyelitis, but determinants of outcome are incompletely understood. We analyzed the effects of the anti-inflammatory cytokine IL-10 on disease severity and virus clearance after infection with an alphavirus strain of intermediate virulence

New vaccines against influenza virus

PubMed Central

Lee, Young-Tae; Kim, Ki-Hye; Ko, Eun-Ju; Lee, Yu-Na; Kim, Min-Chul; Kwon, Young-Man; Tang, Yinghua; Cho, Min-Kyoung; Lee, Youn-Jeong

2014-01-01

Vaccination is one of the most effective and cost-benefit interventions that prevent the mortality and reduce morbidity from infectious pathogens. However, the licensed influenza vaccine induces strain-specific immunity and must be updated annually based on predicted strains that will circulate in the upcoming season. Influenza virus still causes significant health problems worldwide due to the low vaccine efficacy from unexpected outbreaks of next epidemic strains or the emergence of pandemic viruses. Current influenza vaccines are based on immunity to the hemagglutinin antigen that is highly variable among different influenza viruses circulating in humans and animals. Several scientific advances have been endeavored to develop universal vaccines that will induce broad protection. Universal vaccines have been focused on regions of viral proteins that are highly conserved across different virus subtypes. The strategies of universal vaccines include the matrix 2 protein, the hemagglutinin HA2 stalk domain, and T cell-based multivalent antigens. Supplemented and/or adjuvanted vaccination in combination with universal target antigenic vaccines would have much promise. This review summarizes encouraging scientific advances in the field with a focus on novel vaccine designs. PMID:24427759

A virus resonance light scattering sensor based on mussel-inspired molecularly imprinted polymers for high sensitive and high selective detection of Hepatitis A Virus.

PubMed

Yang, Bin; Gong, Hang; Chen, Chunyan; Chen, Xiaoming; Cai, Changqun

2017-01-15

We described a novel resonance light scattering (RLS) sensor for the specific recognition of trace quantities of Hepatitis A Virus (HAV); the sensor was based on a mussel-inspired hepatitis molecularly imprinted polymer. As a recognition element, polydopamine (PDA)-coated totivirus-imprinted polymer was introduced on the surface of SiO 2 nanoparticles (virus-imprinted SiO 2 @PDA NPs) using an efficient one-step synthesis method. The target virus was selectively captured by the imprinted polymer films, thereby increasing the RLS intensity. A simple fluorescence spectrophotometer was employed to measure the changes in the intensity. The enhanced RLS intensity (∆I RLS ) was proportional to the concentration of HAV in the range of 0.04-6.0nmol∙L -1 , with a low limit of detection of 8.6pmol∙L -1 . The selectivity study confirmed that the resultant HAV-imprinted SiO 2 @PDA NPs possessed high selectivity for HAV. The sensor was successfully applied for the direct detection of additional HAV from a 20,000-fold dilution of human serum. The proposed strategy is simple, eco-friendly, highly selective, and sensitive. Copyright © 2016 Elsevier B.V. All rights reserved.

Antibody quality and protection from lethal Ebola virus challenge in nonhuman primates immunized with rabies virus based bivalent vaccine.

PubMed

Blaney, Joseph E; Marzi, Andrea; Willet, Mallory; Papaneri, Amy B; Wirblich, Christoph; Feldmann, Friederike; Holbrook, Michael; Jahrling, Peter; Feldmann, Heinz; Schnell, Matthias J

2013-01-01

We have previously described the generation of a novel Ebola virus (EBOV) vaccine platform based on (a) replication-competent rabies virus (RABV), (b) replication-deficient RABV, or (c) chemically inactivated RABV expressing EBOV glycoprotein (GP). Mouse studies demonstrated safety, immunogenicity, and protective efficacy of these live or inactivated RABV/EBOV vaccines. Here, we evaluated these vaccines in nonhuman primates. Our results indicate that all three vaccines do induce potent immune responses against both RABV and EBOV, while the protection of immunized animals against EBOV was largely dependent on the quality of humoral immune response against EBOV GP. We also determined if the induced antibodies against EBOV GP differ in their target, affinity, or the isotype. Our results show that IgG1-biased humoral responses as well as high levels of GP-specific antibodies were beneficial for the control of EBOV infection after immunization. These results further support the concept that a successful EBOV vaccine needs to induce strong antibodies against EBOV. We also showed that a dual vaccine against RABV and filoviruses is achievable; therefore addressing concerns for the marketability of this urgently needed vaccine.

Host Translation Shutoff Mediated by Non-structural Protein 2 is a Critical Factor in the Antiviral State Resistance of Venezuelan Equine Encephalitis Virus

PubMed Central

Bhalla, Nishank; Sun, Chengqun; Lam, L. K. Metthew; Gardner, Christina L.; Ryman, Kate D.; Klimstra, William B.

2016-01-01

Most previous studies of interferon-alpha/beta (IFN-α/β) response antagonism by alphaviruses have focused upon interruption of IFN-α/β induction and/or receptor signaling cascades. Infection of mice with Venezuelan equine encephalitis alphavirus (VEEV) or Sindbis virus (SINV) induces serum IFN-α/β, that elicits a systemic antiviral state in uninfected cells successfully controlling SINV but not VEEV replication. Furthermore, VEEV replication is more resistant than that of SINV to a pre-existing antiviral state in vitro. While host macromolecular shutoff is proposed as a major antagonist of IFN-α/β induction, the underlying mechanisms of alphavirus resistance to a pre-existing antiviral state are not fully defined, nor is the mechanism for the greater resistance of VEEV. Here, we have separated viral transcription and translation shutoff with multiple alphaviruses, identified the viral proteins that induce each activity, and demonstrated that VEEV nonstructural protein 2-induced translation shutoff is likely a critical factor in enhanced antiviral state resistance of this alphavirus. PMID:27318152

Chikungunya Virus Vaccines: Viral Vector-Based Approaches.

PubMed

Ramsauer, Katrin; Tangy, Frédéric

2016-12-15

In 2013, a major chikungunya virus (CHIKV) epidemic reached the Americas. In the past 2 years, >1.7 million people have been infected. In light of the current epidemic, with millions of people in North and South America at risk, efforts to rapidly develop effective vaccines have increased. Here, we focus on CHIKV vaccines that use viral-vector technologies. This group of vaccine candidates shares an ability to potently induce humoral and cellular immune responses by use of highly attenuated and safe vaccine backbones. So far, well-described vectors such as modified vaccinia virus Ankara, complex adenovirus, vesicular stomatitis virus, alphavirus-based chimeras, and measles vaccine Schwarz strain (MV/Schw) have been described as potential vaccines. We summarize here the recent data on these experimental vaccines, with a focus on the preclinical and clinical activities on the MV/Schw-based candidate, which is the first CHIKV-vectored vaccine that has completed a clinical trial. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Recurrent Targeted Genes of Hepatitis B Virus in the Liver Cancer Genomes Identified by a Next-Generation Sequencing–Based Approach

PubMed Central

Ding, Dong; Lou, Xiaoyan; Hua, Dasong; Yu, Wei; Li, Lisha; Wang, Jun; Gao, Feng; Zhao, Na; Ren, Guoping; Li, Lanjuan; Lin, Biaoyang

2012-01-01

Integration of the viral DNA into host chromosomes was found in most of the hepatitis B virus (HBV)–related hepatocellular carcinomas (HCCs). Here we devised a massive anchored parallel sequencing (MAPS) method using next-generation sequencing to isolate and sequence HBV integrants. Applying MAPS to 40 pairs of HBV–related HCC tissues (cancer and adjacent tissues), we identified 296 HBV integration events corresponding to 286 unique integration sites (UISs) with precise HBV–Human DNA junctions. HBV integration favored chromosome 17 and preferentially integrated into human transcript units. HBV targeted genes were enriched in GO terms: cAMP metabolic processes, T cell differentiation and activation, TGF beta receptor pathway, ncRNA catabolic process, and dsRNA fragmentation and cellular response to dsRNA. The HBV targeted genes include 7 genes (PTPRJ, CNTN6, IL12B, MYOM1, FNDC3B, LRFN2, FN1) containing IPR003961 (Fibronectin, type III domain), 7 genes (NRG3, MASP2, NELL1, LRP1B, ADAM21, NRXN1, FN1) containing IPR013032 (EGF-like region, conserved site), and three genes (PDE7A, PDE4B, PDE11A) containing IPR002073 (3′, 5′-cyclic-nucleotide phosphodiesterase). Enriched pathways include hsa04512 (ECM-receptor interaction), hsa04510 (Focal adhesion), and hsa04012 (ErbB signaling pathway). Fewer integration events were found in cancers compared to cancer-adjacent tissues, suggesting a clonal expansion model in HCC development. Finally, we identified 8 genes that were recurrent target genes by HBV integration including fibronectin 1 (FN1) and telomerase reverse transcriptase (TERT1), two known recurrent target genes, and additional novel target genes such as SMAD family member 5 (SMAD5), phosphatase and actin regulator 4 (PHACTR4), and RNA binding protein fox-1 homolog (C. elegans) 1 (RBFOX1). Integrating analysis with recently published whole-genome sequencing analysis, we identified 14 additional recurrent HBV target genes, greatly expanding the HBV recurrent

A Novel Antiviral Target Structure Involved in the RNA Binding, Dimerization, and Nuclear Export Functions of the Influenza A Virus Nucleoprotein

PubMed Central

Yamada, Kazunori; Kondoh, Yasumitsu; Hikono, Hirokazu; Osada, Hiroyuki; Tomii, Kentaro; Saito, Takehiko; Aida, Yoko

2015-01-01

Developing antiviral therapies for influenza A virus (IAV) infection is an ongoing process because of the rapid rate of antigenic mutation and the emergence of drug-resistant viruses. The ideal strategy is to develop drugs that target well-conserved, functionally restricted, and unique surface structures without affecting host cell function. We recently identified the antiviral compound, RK424, by screening a library of 50,000 compounds using cell-based infection assays. RK424 showed potent antiviral activity against many different subtypes of IAV in vitro and partially protected mice from a lethal dose of A/WSN/1933 (H1N1) virus in vivo. Here, we show that RK424 inhibits viral ribonucleoprotein complex (vRNP) activity, causing the viral nucleoprotein (NP) to accumulate in the cell nucleus. In silico docking analysis revealed that RK424 bound to a small pocket in the viral NP. This pocket was surrounded by three functionally important domains: the RNA binding groove, the NP dimer interface, and nuclear export signal (NES) 3, indicating that it may be involved in the RNA binding, oligomerization, and nuclear export functions of NP. The accuracy of this binding model was confirmed in a NP-RK424 binding assay incorporating photo-cross-linked RK424 affinity beads and in a plaque assay evaluating the structure-activity relationship of RK424. Surface plasmon resonance (SPR) and pull-down assays showed that RK424 inhibited both the NP-RNA and NP-NP interactions, whereas size exclusion chromatography showed that RK424 disrupted viral RNA-induced NP oligomerization. In addition, in vitro nuclear export assays confirmed that RK424 inhibited nuclear export of NP. The amino acid residues comprising the NP pocket play a crucial role in viral replication and are highly conserved in more than 7,000 NP sequences from avian, human, and swine influenza viruses. Furthermore, we found that the NP pocket has a surface structure different from that of the pocket in host molecules. Taken

An identical miRNA of the human JC and BK polyoma viruses targets the stress-induced ligand ULBP3 to escape immune elimination.

PubMed

Bauman, Yoav; Nachmani, Daphna; Vitenshtein, Alon; Tsukerman, Pinchas; Drayman, Nir; Stern-Ginossar, Noam; Lankry, Dikla; Gruda, Raizy; Mandelboim, Ofer

2011-02-17

The human polyoma viruses JCV and BKV establish asymptomatic persistent infection in 65%-90% of humans but can cause severe illness under immunosuppressive conditions. The mechanisms by which these viruses evade immune recognition are unknown. Here we show that a viral miRNA identical in sequence between JCV and BKV targets the stress-induced ligand ULBP3, which is a protein recognized by the killer receptor NKG2D. Consequently, viral miRNA-mediated ULBP3 downregulation results in reduced NKG2D-mediated killing of virus-infected cells by natural killer (NK) cells. Importantly, when the activity of the viral miRNA was inhibited during infection, NK cells killed the infected cells more efficiently. Because NKG2D is also expressed by various T cell subsets, we propose that JCV and BKV use an identical miRNA that targets ULBP3 to escape detection by both the innate and adaptive immune systems, explaining how these viruses remain latent without being eliminated by the immune system. Copyright © 2011 Elsevier Inc. All rights reserved.

Targeted transport of nanocarriers into brain for theranosis with rabies virus glycoprotein-derived peptide.

PubMed

Fu, Chen; Xiang, Yonggang; Li, Xiaorong; Fu, Ailing

2018-06-01

For successful theranosis of brain diseases, limited access of therapeutic molecules across blood-brain barrier (BBB) needs be overcome in brain delivery. Currently, peptide derivatives of rabies virus glycoprotein (RVG) have been exploited as delivery ligands to transport nanocarriers across BBB and specifically into the brain. The targeting peptides usually conjugate to the nanocarrier surface, and the cargoes, including siRNA, miRNA, DNA, proteins and small molecular chemicals, are complexed or encapsulated in the nanocarriers. The peptide ligand of the RVG-modified nanocarriers introduces the conjugated targeted-delivery into the brain, and the cargoes are involved in disease theranosis. The peptide-modified nanocarriers have been applied to diagnose and treat various brain diseases, such as glioma, Alzheimer's disease, ischemic injury, protein misfolding diseases etc. Since the targeting delivery system has displayed good biocompatibility and desirable therapeutic effect, it will raise a potential application in treating brain diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

New target tissue for food-borne virus detection in oysters.

PubMed

Wang, D; Wu, Q; Yao, L; Wei, M; Kou, X; Zhang, J

2008-11-01

To evaluate the different tissues of naturally contaminated oyster for food-borne virus detection. The different tissues of 136 field oyster samples were analysed for norovirus (NV), hepatitis A virus (HAV) and rotavirus (RV) by reverse transcription (RT)-PCR and were confirmed by sequencing. These viruses were detected in 20 samples (14.71%), showing positivity for NV (1.47%), HAV (5.15%) and RV (8.82%). Furthermore, among different tissues, the highest positive rate of the food-borne viruses was found in the gills (14.71%), followed by the stomach (13.97%) and the digestive diverticula (13.24%). The food-borne viruses were detected in the gills, stomach, digestive diverticula and the cilia of the mantle. In addition, the results showed that the gills are one of the appropriate tissues for viral detection in oysters by nucleic acid assay. This is the first paper to report on the presence of food-borne viruses in the gills and the cilia of the mantle of naturally contaminated oysters. The research team hopes that the results of the study will be of help in sampling the appropriate tissues for the detection of food-borne viruses in commercial oysters.

An Ebola virus-centered knowledge base

PubMed Central

Kamdar, Maulik R.; Dumontier, Michel

2015-01-01

Ebola virus (EBOV), of the family Filoviridae viruses, is a NIAID category A, lethal human pathogen. It is responsible for causing Ebola virus disease (EVD) that is a severe hemorrhagic fever and has a cumulative death rate of 41% in the ongoing epidemic in West Africa. There is an ever-increasing need to consolidate and make available all the knowledge that we possess on EBOV, even if it is conflicting or incomplete. This would enable biomedical researchers to understand the molecular mechanisms underlying this disease and help develop tools for efficient diagnosis and effective treatment. In this article, we present our approach for the development of an Ebola virus-centered Knowledge Base (Ebola-KB) using Linked Data and Semantic Web Technologies. We retrieve and aggregate knowledge from several open data sources, web services and biomedical ontologies. This knowledge is transformed to RDF, linked to the Bio2RDF datasets and made available through a SPARQL 1.1 Endpoint. Ebola-KB can also be explored using an interactive Dashboard visualizing the different perspectives of this integrated knowledge. We showcase how different competency questions, asked by domain users researching the druggability of EBOV, can be formulated as SPARQL Queries or answered using the Ebola-KB Dashboard. Database URL: http://ebola.semanticscience.org. PMID:26055098

An Ebola virus-centered knowledge base.

PubMed

Kamdar, Maulik R; Dumontier, Michel

2015-01-01

Ebola virus (EBOV), of the family Filoviridae viruses, is a NIAID category A, lethal human pathogen. It is responsible for causing Ebola virus disease (EVD) that is a severe hemorrhagic fever and has a cumulative death rate of 41% in the ongoing epidemic in West Africa. There is an ever-increasing need to consolidate and make available all the knowledge that we possess on EBOV, even if it is conflicting or incomplete. This would enable biomedical researchers to understand the molecular mechanisms underlying this disease and help develop tools for efficient diagnosis and effective treatment. In this article, we present our approach for the development of an Ebola virus-centered Knowledge Base (Ebola-KB) using Linked Data and Semantic Web Technologies. We retrieve and aggregate knowledge from several open data sources, web services and biomedical ontologies. This knowledge is transformed to RDF, linked to the Bio2RDF datasets and made available through a SPARQL 1.1 Endpoint. Ebola-KB can also be explored using an interactive Dashboard visualizing the different perspectives of this integrated knowledge. We showcase how different competency questions, asked by domain users researching the druggability of EBOV, can be formulated as SPARQL Queries or answered using the Ebola-KB Dashboard. © The Author(s) 2015. Published by Oxford University Press.

Generation of T-cell receptors targeting a genetically stable and immunodominant cytotoxic T-lymphocyte epitope within hepatitis C virus non-structural protein 3.

PubMed

Pasetto, Anna; Frelin, Lars; Brass, Anette; Yasmeen, Anila; Koh, Sarene; Lohmann, Volker; Bartenschlager, Ralf; Magalhaes, Isabelle; Maeurer, Markus; Sällberg, Matti; Chen, Margaret

2012-02-01

Hepatitis C virus (HCV) is a major cause of severe liver disease, and one major contributing factor is thought to involve a dysfunction of virus-specific T-cells. T-cell receptor (TCR) gene therapy with HCV-specific TCRs would increase the number of effector T-cells to promote virus clearance. We therefore took advantage of HLA-A2 transgenic mice to generate multiple TCR candidates against HCV using DNA vaccination followed by generation of stable T-cell-BW (T-BW) tumour hybrid cells. Using this approach, large numbers of non-structural protein 3 (NS3)-specific functional T-BW hybrids can be generated efficiently. These predominantly target the genetically stable HCV genotype 1 NS3(1073-1081) CTL epitope, frequently associated with clearance of HCV in humans. These T-BW hybrid clones recognized the NS3(1073) peptide with a high avidity. The hybridoma effectively recognized virus variants and targeted cells with low HLA-A2 expression, which has not been reported previously. Importantly, high-avidity murine TCRs effectively redirected human non-HCV-specific T-lymphocytes to recognize human hepatoma cells with HCV RNA replication driven by a subgenomic HCV replicon. Taken together, TCR candidates with a range of functional avidities, which can be used to study immune recognition of HCV-positive targets, have been generated. This has implications for TCR-related immunotherapy against HCV.

Biology of cloned cytotoxic T lymphocytes specific for lymphocytic choriomeningitis virus: clearance of virus and in vitro properties.

PubMed

Anderson, J; Byrne, J A; Schreiber, R; Patterson, S; Oldstone, M B

1985-02-01

We have generated lymphocytic choriomeningitis virus-specific, H-2-restricted cytotoxic thymus-derived lymphocyte (CTL) clones. By using these reagents in several in vitro assays with infected target cells, we show that CTLs by themselves prevent the release of infectious virus into culture fluids and significantly lower the titers of infectious virus previously produced. This ability of cloned CTLs is not influenced by monensin. However, monensin does abrogate the ability of CTLs from spleens of mice primed 6 to 8 days previously with virus to kill virus-infected syngeneic targets. When tested for the participation of lymphokines in this system, the CTLs proliferate when reacted with syngeneic lymphocytic choriomeningitis virus-infected macrophages but fail to make interleukin-2. These CTLs make gamma interferon when reacted with syngeneic virus-infected targets. However, the production of interferon does not directly correlate with CTL-mediated killing. The number of H-2K and D molecules expressed on the target cell surface is not altered during the course of lymphocytic choriomeningitis virus infection. Electron microscopy shows finger-like projections of the CTL clone thrust into the infected cell and lesions bearing an internal diameter of approximately 15 nm in those membranes, illustrating the lytic process.

A pepper mottle virus-based vector enables systemic expression of endoglucanase D in non-transgenic plants.

PubMed

Song, Eun Gyeong; Ryu, Ki Hyun

2017-12-01

Plant-virus-based expression vectors have been used as an alternative to the creation of transgenic plants. Using a virus-based vector, we investigated the feasibility of producing the endoglucanase D (EngD) from Clostridium cellulovorans in Nicotiana benthamiana. This protein has endoglucanase, xylanase, and exoglucanase activities and may be of value for cellulose digestion in the generation of biofuels from plant biomass. The EngD gene was cloned between the nuclear inclusion b (NIb)- and coat protein (CP)-encoding sequences of pSP6PepMoV-Vb1. In vitro transcripts derived from the clone (pSP6PepMoV-Vb1/EngD) were infectious in N. benthamiana but caused milder symptoms than wild-type PepMoV-Vb1. RT-PCR amplification of total RNA from non-inoculated upper leaves infected with PepMoV-Vb1/EngD produced the target band for the CP, partial NIb and EngD-CP regions of PepMoV-V1/EngD, in addition to nonspecific bands. Western blot analysis showed the CP target bands of PepMoV-Vb1/EngD as well as non-target bands. EngD enzymatic activity in infected plants was detected using a glucose assay. The plant leaves showed increased senescence compared with healthy and PepMoV-Vb1-infected plants. Our study suggests the feasibility of using a viral vector for systemic infection of plants for expression of heterologous engD for the purpose of digesting a cellulose substrate in plant cells for biomass production.

Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

PubMed

Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

2016-02-23

The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.

Structure-based discovery of pyrazolobenzothiazine derivatives as inhibitors of hepatitis C virus replication

PubMed Central

Barreca, Maria Letizia; Manfroni, Giuseppe; Leyssen, Pieter; Winquist, Johan; Kaushik-Basu, Neerja; Paeshuyse, Jan; Krishnan, Ramalingam; Iraci, Nunzio; Sabatini, Stefano; Tabarrini, Oriana; Basu, Amartya; Danielson, U. Helena; Neyts, Johan; Cecchetti, Violetta

2013-01-01

The NS5B RNA-dependent RNA polymerase is an attractive target for the development of novel and selective inhibitors of hepatitis C virus replication. In order to identify novel structural hits as anti-HCV agents, we performed structure-based virtual screening of our in-house library followed by rational drug design, organic synthesis and biological testing. These studies led to the identification of pyrazolobenzothiazine scaffold as a suitable template for obtaining novel anti-HCV agents targeting the NS5B polymerase. The best compound of this series was the meta-fluoro-N-1-phenyl pyrazolobenzothiazine derivative 4a, which exhibited an EC50= 3.6 µM, EC90= 25.6 µM and CC50 > 180 µM in the Huh 9–13 replicon system, thus providing a good starting point for further hit evolution. PMID:23409936

[Orthopoxvirus genes for kelch-like proteins. III. Construction of mousepox (ectromelia) virus variants with targeted gene deletions].

PubMed

Kochneva, G V; Kolosova, I V; Lupan, T A; Sivolobova, G F; Iudin, P V; Grazhdantseva, A A; Riabchikova, E I; Kandrina, N Iu; Shchelkunov, S N

2009-01-01

Mousepox (ectromelia) virus genome contains four genes encoding for kelch-like proteins EVM018, EVM027, EVM150 and EVM167. A complete set of insertion plasmids was constructed to allow the production of recombinant ectromelia viruses with targeted deletions of one to four genes of kelch family both individually (single mutants) and in different combinations (double, triple and quadruple mutants). It was shown that deletion of any of the three genes EVMO18, EVM027 or EVM167 resulted in reduction of 50% lethal dose (LD50) by five and more orders in outbred white mice infected intraperitoneally. Deletion of mousepox kelch-gene EVM150 did not influence the virus virulence. Two or more kelch-genes deletion also resulted in high level of attenuation, which could evidently be due to the lack of three genes EVM167, EVM018 and/or EVM027 identified as virulence factors. The local inflammatory process on the model of intradermal injection of mouse ear pinnae (vasodilatation level, hyperemia, cutaneous edema, arterial thrombosis) was significantly more intensive for wild type virus and virulent mutant deltaEVM150 in comparison with avirulent mutant AEVM167.

Development of a broad-spectrum antiviral with activity against Ebola virus.

PubMed

Aman, M Javad; Kinch, Michael S; Warfield, Kelly; Warren, Travis; Yunus, Abdul; Enterlein, Sven; Stavale, Eric; Wang, Peifang; Chang, Shaojing; Tang, Qingsong; Porter, Kevin; Goldblatt, Michael; Bavari, Sina

2009-09-01

We report herein the identification of a small molecule therapeutic, FGI-106, which displays potent and broad-spectrum inhibition of lethal viral hemorrhagic fevers pathogens, including Ebola, Rift Valley and Dengue Fever viruses, in cell-based assays. Using mouse models of Ebola virus, we further demonstrate that FGI-106 can protect animals from an otherwise lethal infection when used either in a prophylactic or therapeutic setting. A single treatment, administered 1 day after infection, is sufficient to protect animals from lethal Ebola virus challenge. Cell-based assays also identified inhibitory activity against divergent virus families, which supports a hypothesis that FGI-106 interferes with a common pathway utilized by different viruses. These findings suggest FGI-106 may provide an opportunity for targeting viral diseases.

Predicting the host of influenza viruses based on the word vector.

PubMed

Xu, Beibei; Tan, Zhiying; Li, Kenli; Jiang, Taijiao; Peng, Yousong

2017-01-01

Newly emerging influenza viruses continue to threaten public health. A rapid determination of the host range of newly discovered influenza viruses would assist in early assessment of their risk. Here, we attempted to predict the host of influenza viruses using the Support Vector Machine (SVM) classifier based on the word vector, a new representation and feature extraction method for biological sequences. The results show that the length of the word within the word vector, the sequence type (DNA or protein) and the species from which the sequences were derived for generating the word vector all influence the performance of models in predicting the host of influenza viruses. In nearly all cases, the models built on the surface proteins hemagglutinin (HA) and neuraminidase (NA) (or their genes) produced better results than internal influenza proteins (or their genes). The best performance was achieved when the model was built on the HA gene based on word vectors (words of three-letters long) generated from DNA sequences of the influenza virus. This results in accuracies of 99.7% for avian, 96.9% for human and 90.6% for swine influenza viruses. Compared to the method of sequence homology best-hit searches using the Basic Local Alignment Search Tool (BLAST), the word vector-based models still need further improvements in predicting the host of influenza A viruses.

Discovery of Influenza A Virus Sequence Pairs and Their Combinations for Simultaneous Heterosubtypic Targeting that Hedge against Antiviral Resistance

PubMed Central

Lin, Jing; Pramono, Zacharias Aloysius Dwi; Maurer-Stroh, Sebastian

2016-01-01

The multiple circulating human influenza A virus subtypes coupled with the perpetual genomic mutations and segment reassortment events challenge the development of effective therapeutics. The capacity to drug most RNAs motivates the investigation on viral RNA targets. 123,060 segment sequences from 35,938 strains of the most prevalent subtypes also infecting humans–H1N1, 2009 pandemic H1N1, H3N2, H5N1 and H7N9, were used to identify 1,183 conserved RNA target sequences (≥15-mer) in the internal segments. 100% theoretical coverage in simultaneous heterosubtypic targeting is achieved by pairing specific sequences from the same segment (“Duals”) or from two segments (“Doubles”); 1,662 Duals and 28,463 Doubles identified. By combining specific Duals and/or Doubles to form a target graph wherein an edge connecting two vertices (target sequences) represents a Dual or Double, it is possible to hedge against antiviral resistance besides maintaining 100% heterosubtypic coverage. To evaluate the hedging potential, we define the hedge-factor as the minimum number of resistant target sequences that will render the graph to become resistant i.e. eliminate all the edges therein; a target sequence or a graph is considered resistant when it cannot achieve 100% heterosubtypic coverage. In an n-vertices graph (n ≥ 3), the hedge-factor is maximal (= n– 1) when it is a complete graph i.e. every distinct pair in a graph is either a Dual or Double. Computational analyses uncover an extensive number of complete graphs of different sizes. Monte Carlo simulations show that the mutation counts and time elapsed for a target graph to become resistant increase with the hedge-factor. Incidentally, target sequences which were reported to reduce virus titre in experiments are included in our target graphs. The identity of target sequence pairs for heterosubtypic targeting and their combinations for hedging antiviral resistance are useful toolkits to construct target graphs for

Identification of a broad-spectrum inhibitor of virus RNA synthesis: validation of a prototype virus-based approach

PubMed Central

Filone, Claire Marie; Hodges, Erin N.; Honeyman, Brian; Bushkin, G. Guy; Boyd, Karla; Platt, Andrew; Ni, Feng; Strom, Kyle; Hensley, Lisa; Snyder, John K.; Connor, John H.

2013-01-01

There are no approved therapeutics for the most deadly nonsegmented negative-strand (NNS) RNA viruses, including Ebola (EBOV). To identify new chemical scaffolds for development of broad-spectrum antivirals, we undertook a prototype-based lead identification screen. Using the prototype NNS virus, vesicular stomatitis virus (VSV), multiple inhibitory compounds were identified. Three compounds were investigated for broad-spectrum activity, and inhibited EBOV infection. The most potent, CMLDBU3402, was selected for further study. CMLDBU3402 did not show significant activity against segmented negative-strand RNA viruses suggesting proscribed broad-spectrum activity. Mechanistic analysis indicated that CMLDBU3402 blocked VSV viral RNA synthesis and inhibited EBOV RNA transcription, demonstrating a consistent mechanism of action against genetically distinct viruses. The identification of this chemical backbone as a broad-spectrum inhibitor of viral RNA synthesis offers significant potential for the development of new therapies for highly pathogenic viruses. PMID:23521799

Genome-wide prediction of vaccine targets for human herpes simplex viruses using Vaxign reverse vaccinology

PubMed Central

2013-01-01

Herpes simplex virus (HSV) types 1 and 2 (HSV-1 and HSV-2) are the most common infectious agents of humans. No safe and effective HSV vaccines have been licensed. Reverse vaccinology is an emerging and revolutionary vaccine development strategy that starts with the prediction of vaccine targets by informatics analysis of genome sequences. Vaxign (http://www.violinet.org/vaxign) is the first web-based vaccine design program based on reverse vaccinology. In this study, we used Vaxign to analyze 52 herpesvirus genomes, including 3 HSV-1 genomes, one HSV-2 genome, 8 other human herpesvirus genomes, and 40 non-human herpesvirus genomes. The HSV-1 strain 17 genome that contains 77 proteins was used as the seed genome. These 77 proteins are conserved in two other HSV-1 strains (strain F and strain H129). Two envelope glycoproteins gJ and gG do not have orthologs in HSV-2 or 8 other human herpesviruses. Seven HSV-1 proteins (including gJ and gG) do not have orthologs in all 40 non-human herpesviruses. Nineteen proteins are conserved in all human herpesviruses, including capsid scaffold protein UL26.5 (NP_044628.1). As the only HSV-1 protein predicted to be an adhesin, UL26.5 is a promising vaccine target. The MHC Class I and II epitopes were predicted by the Vaxign Vaxitop prediction program and IEDB prediction programs recently installed and incorporated in Vaxign. Our comparative analysis found that the two programs identified largely the same top epitopes but also some positive results predicted from one program might not be positive from another program. Overall, our Vaxign computational prediction provides many promising candidates for rational HSV vaccine development. The method is generic and can also be used to predict other viral vaccine targets. PMID:23514126

In Silico Analysis of Epitope-Based Vaccine Candidates against Hepatitis B Virus Polymerase Protein

PubMed Central

Zheng, Juzeng; Lin, Xianfan; Wang, Xiuyan; Zheng, Liyu; Lan, Songsong; Jin, Sisi; Ou, Zhanfan; Wu, Jinming

2017-01-01

Hepatitis B virus (HBV) infection has persisted as a major public health problem due to the lack of an effective treatment for those chronically infected. Therapeutic vaccination holds promise, and targeting HBV polymerase is pivotal for viral eradication. In this research, a computational approach was employed to predict suitable HBV polymerase targeting multi-peptides for vaccine candidate selection. We then performed in-depth computational analysis to evaluate the predicted epitopes’ immunogenicity, conservation, population coverage, and toxicity. Lastly, molecular docking and MHC-peptide complex stabilization assay were utilized to determine the binding energy and affinity of epitopes to the HLA-A0201 molecule. Criteria-based analysis provided four predicted epitopes, RVTGGVFLV, VSIPWTHKV, YMDDVVLGA and HLYSHPIIL. Assay results indicated the lowest binding energy and high affinity to the HLA-A0201 molecule for epitopes VSIPWTHKV and YMDDVVLGA and epitopes RVTGGVFLV and VSIPWTHKV, respectively. Regions 307 to 320 and 377 to 387 were considered to have the highest probability to be involved in B cell epitopes. The T cell and B cell epitopes identified in this study are promising targets for an epitope-focused, peptide-based HBV vaccine, and provide insight into HBV-induced immune response. PMID:28509875

Development of a HIV-1 Virus Detection System Based on Nanotechnology.

PubMed

Lee, Jin-Ho; Oh, Byung-Keun; Choi, Jeong-Woo

2015-04-27

Development of a sensitive and selective detection system for pathogenic viral agents is essential for medical healthcare from diagnostics to therapeutics. However, conventional detection systems are time consuming, resource-intensive and tedious to perform. Hence, the demand for sensitive and selective detection system for virus are highly increasing. To attain this aim, different aspects and techniques have been applied to develop virus sensor with improved sensitivity and selectivity. Here, among those aspects and techniques, this article reviews HIV virus particle detection systems incorporated with nanotechnology to enhance the sensitivity. This review mainly focused on four different detection system including vertically configured electrical detection based on scanning tunneling microscopy (STM), electrochemical detection based on direct electron transfer in virus, optical detection system based on localized surface plasmon resonance (LSPR) and surface enhanced Raman spectroscopy (SERS) using plasmonic nanoparticle.

Antibody-mediated protection against mucosal simian-human immunodeficiency virus challenge of macaques immunized with alphavirus replicon particles and boosted with trimeric envelope glycoprotein in MF59 adjuvant.

PubMed

Barnett, Susan W; Burke, Brian; Sun, Yide; Kan, Elaine; Legg, Harold; Lian, Ying; Bost, Kristen; Zhou, Fengmin; Goodsell, Amanda; Zur Megede, Jan; Polo, John; Donnelly, John; Ulmer, Jeffrey; Otten, Gillis R; Miller, Christopher J; Vajdy, Michael; Srivastava, Indresh K

2010-06-01

We have previously shown that rhesus macaques were partially protected against high-dose intravenous challenge with simian-human immunodeficiency virus SHIV(SF162P4) following sequential immunization with alphavirus replicon particles (VRP) of a chimeric recombinant VEE/SIN alphavirus (derived from Venezuelan equine encephalitis virus [VEE] and the Sindbis virus [SIN]) encoding human immunodeficiency virus type 1 HIV-1(SF162) gp140DeltaV2 envelope (Env) and trimeric Env protein in MF59 adjuvant (R. Xu, I. K. Srivastava, C. E. Greer, I. Zarkikh, Z. Kraft, L. Kuller, J. M. Polo, S. W. Barnett, and L. Stamatatos, AIDS Res. Hum. Retroviruses 22:1022-1030, 2006). The protection did not require T-cell immune responses directed toward simian immunodeficiency virus (SIV) Gag. We extend those findings here to demonstrate antibody-mediated protection against mucosal challenge in macaques using prime-boost regimens incorporating both intramuscular and mucosal routes of delivery. The macaques in the vaccination groups were primed with VRP and then boosted with Env protein in MF59 adjuvant, or they were given VRP intramuscular immunizations alone and then challenged with SHIV(SF162P4) (intrarectal challenge). The results demonstrated that these vaccines were able to effectively protect the macaques to different degrees against subsequent mucosal SHIV challenge, but most noteworthy, all macaques that received the intramuscular VRP prime plus Env protein boost were completely protected. A statistically significant association was observed between the titer of virus neutralizing and binding antibodies as well as the avidity of anti-Env antibodies measured prechallenge and protection from infection. These results highlight the merit of the alphavirus replicon vector prime plus Env protein boost vaccine approach for the induction of protective antibody responses and are of particular relevance to advancing our understanding of the potential correlates of immune protection against

Insertion of targeting domains into the envelope glycoprotein of Moloney murine leukemia virus (MoMLV)-based vectors modulates the route of mCAT-1-mediated viral entry.

PubMed

Viejo-Borbolla, A; Pizzato, M; Blair, E D; Schulz, T F

2005-03-01

Several groups have inserted targeting domains into the envelope glycoprotein (Env) of Moloney murine leukemia virus (MoMLV) in an attempt to produce targeted retroviral vectors for human gene therapy. While binding of these modified Envs to the target molecule expressed on the surface of human cells was observed, specific high-titer infection of human cells expressing the target molecule was not achieved. Here we investigate the initial steps in the entry process of targeted MoMLV vectors both in murine and human cells expressing the MoMLV receptor, the mouse cationic amino acid transporter-1 (mCAT-1). We show that insertion of a small ligand targeted to E-selectin and of a single chain antibody (scFv) targeted to folate-binding protein (FBP) into the N-terminus of MoMLV Env results in the reduction of the infectivity and the kinetics of entry of the MoMLV vectors. The use of soluble receptor-binding domain (sRBD), bafilomycin A1 (BafA1) and methyl-beta-cyclodextrin (MbetaC) increase the infectivity of the MoMLV vectors targeted to FBP (MoMLV-FBP) suggesting that the scFv targeted to FBP increases the threshold for fusion and might re-route entry of the targeted MoMLV-FBP vector towards an endocytic, non-productive pathway.

Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis.

PubMed

Cheng, Feixiong; Murray, James L; Zhao, Junfei; Sheng, Jinsong; Zhao, Zhongming; Rubin, Donald H

2016-09-01

Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.

Host-Targeting Agents to Prevent and Cure Hepatitis C Virus Infection.

PubMed

Zeisel, Mirjam B; Crouchet, Emilie; Baumert, Thomas F; Schuster, Catherine

2015-11-02

Chronic hepatitis C virus (HCV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC) which are leading indications of liver transplantation (LT). To date, there is no vaccine to prevent HCV infection and LT is invariably followed by infection of the liver graft. Within the past years, direct-acting antivirals (DAAs) have had a major impact on the management of chronic hepatitis C, which has become a curable disease in the majority of DAA-treated patients. In contrast to DAAs that target viral proteins, host-targeting agents (HTAs) interfere with cellular factors involved in the viral life cycle. By acting through a complementary mechanism of action and by exhibiting a generally higher barrier to resistance, HTAs offer a prospective option to prevent and treat viral resistance. Indeed, given their complementary mechanism of action, HTAs and DAAs can act in a synergistic manner to reduce viral loads. This review summarizes the different classes of HTAs against HCV infection that are in preclinical or clinical development and highlights their potential to prevent HCV infection, e.g., following LT, and to tailor combination treatments to cure chronic HCV infection.

Novel vaccines against influenza viruses

PubMed Central

Kang, Sang-Moo; Song, Jae-Min; Compans, Richard W.

2011-01-01

Killed and live attenuated influenza virus vaccines are effective in preventing and curbing the spread of influenza epidemics when the strains present in the vaccines are closely matched with the predicted epidemic strains. These vaccines are primarily targeted to induce immunity to the variable major target antigen, hemagglutinin (HA) of influenza virus. However, current vaccines are not effective in preventing the emergence of new pandemic or highly virulent viruses. New approaches are being investigated to develop universal influenza virus vaccines as well as to apply more effective vaccine delivery methods. Conserved vaccine targets including the influenza M2 ion channel protein and HA stalk domains are being developed using recombinant technologies to improve the level of cross protection. In addition, recent studies provide evidence that vaccine supplements can provide avenues to further improve current vaccination. PMID:21968298

A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus.

PubMed

Wang, Jianchang; Wang, Jinfeng; Geng, Yunyun; Yuan, Wanzhe

2017-10-01

A recombinase polymerase amplification (RPA)-based method was developed for rapid and specific detection of African swine fever virus (ASFV), the etiologic agent of African swine fever, a devastating disease of swine. Primers and the exo probe targeting the conserved region of the P72 gene of ASFV were designed and the reaction was run on the Genie III scanner device. Using recombinant plasmid DNA containing the P72 gene as template, we showed that the amplified product could be detected in less than 10 min and that the detection limit was 10 2 copies DNA/reaction [same detection limit as real-time polymerase chain reaction (PCR)]. The RPA assay did not cross-detect CSFV, PCV-2, PRV, PRRSV, or FMDV, common viruses seen in pigs. Tests of recombinant plasmid-spiked serum samples revealed that RPA and real-time PCR had the same diagnostic rate. The RPA assay, which is simple, cost-effective, and fast, is a promising alternative to real-time PCR for ASFV detection.

A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus

PubMed Central

Wang, Jianchang; Wang, Jinfeng; Geng, Yunyun; Yuan, Wanzhe

2017-01-01

A recombinase polymerase amplification (RPA)-based method was developed for rapid and specific detection of African swine fever virus (ASFV), the etiologic agent of African swine fever, a devastating disease of swine. Primers and the exo probe targeting the conserved region of the P72 gene of ASFV were designed and the reaction was run on the Genie III scanner device. Using recombinant plasmid DNA containing the P72 gene as template, we showed that the amplified product could be detected in less than 10 min and that the detection limit was 102 copies DNA/reaction [same detection limit as real-time polymerase chain reaction (PCR)]. The RPA assay did not cross-detect CSFV, PCV-2, PRV, PRRSV, or FMDV, common viruses seen in pigs. Tests of recombinant plasmid-spiked serum samples revealed that RPA and real-time PCR had the same diagnostic rate. The RPA assay, which is simple, cost-effective, and fast, is a promising alternative to real-time PCR for ASFV detection. PMID:29081590

The Epstein-Barr virus miR-BHRF1-1 targets RNF4 during productive infection to promote the accumulation of SUMO conjugates and the release of infectious virus.

PubMed

Li, Jinlin; Callegari, Simone; Masucci, Maria G

2017-04-01

Post-translational modification by the Small Ubiquitin-like Modifier (SUMO) regulates a variety of cellular functions, and is hijacked by viruses to remodel the host cell during latent and productive infection. Here we have monitored the activity of the SUMO conjugation machinery in cells productively infected with Epstein-Barr virus (EBV). We found that SUMO2/3 conjugates accumulate during the late phase of the productive virus cycle, and identified several viral proteins as bone fide SUMOylation substrates. Analysis of the mechanism involved in the accumulation of SUMOylated proteins revealed upregulation of several components of the SUMO-conjugation machinery and post-transcriptional downregulation of the SUMO-targeted ubiquitin ligase RNF4. The latter effect was mediated by selective inhibition of RNF4 protein expression by the viral miR-BHRF1-1. Reconstitution of RNF4 in cells expressing an inducible miR-BHRF1-1 sponge or a miR-BHRF1-1 resistant RNF4 was associated with reduced levels of early and late viral proteins and impaired virus release. These findings illustrate a novel strategy for viral interference with the SUMO pathway, and identify the EBV miR-BHRF1-1 and the cellular RNF4 as regulators of the productive virus cycle.

The Epstein-Barr virus miR-BHRF1-1 targets RNF4 during productive infection to promote the accumulation of SUMO conjugates and the release of infectious virus

PubMed Central

Li, Jinlin; Callegari, Simone

2017-01-01

Post-translational modification by the Small Ubiquitin-like Modifier (SUMO) regulates a variety of cellular functions, and is hijacked by viruses to remodel the host cell during latent and productive infection. Here we have monitored the activity of the SUMO conjugation machinery in cells productively infected with Epstein-Barr virus (EBV). We found that SUMO2/3 conjugates accumulate during the late phase of the productive virus cycle, and identified several viral proteins as bone fide SUMOylation substrates. Analysis of the mechanism involved in the accumulation of SUMOylated proteins revealed upregulation of several components of the SUMO-conjugation machinery and post-transcriptional downregulation of the SUMO-targeted ubiquitin ligase RNF4. The latter effect was mediated by selective inhibition of RNF4 protein expression by the viral miR-BHRF1-1. Reconstitution of RNF4 in cells expressing an inducible miR-BHRF1-1 sponge or a miR-BHRF1-1 resistant RNF4 was associated with reduced levels of early and late viral proteins and impaired virus release. These findings illustrate a novel strategy for viral interference with the SUMO pathway, and identify the EBV miR-BHRF1-1 and the cellular RNF4 as regulators of the productive virus cycle. PMID:28414785

Small molecules targeting viral RNA.

PubMed

Hermann, Thomas

2016-11-01

Highly conserved noncoding RNA (ncRNA) elements in viral genomes and transcripts offer new opportunities to expand the repertoire of drug targets for the development of antiinfective therapy. Ligands binding to ncRNA architectures are able to affect interactions, structural stability or conformational changes and thereby block processes essential for viral replication. Proof of concept for targeting functional RNA by small molecule inhibitors has been demonstrated for multiple viruses with RNA genomes. Strategies to identify antiviral compounds as inhibitors of ncRNA are increasingly emphasizing consideration of drug-like properties of candidate molecules emerging from screening and ligand design. Recent efforts of antiviral lead discovery for RNA targets have provided drug-like small molecules that inhibit viral replication and include inhibitors of human immunodeficiency virus (HIV), hepatitis C virus (HCV), severe respiratory syndrome coronavirus (SARS CoV), and influenza A virus. While target selectivity remains a challenge for the discovery of useful RNA-binding compounds, a better understanding is emerging of properties that define RNA targets amenable for inhibition by small molecule ligands. Insight from successful approaches of targeting viral ncRNA in HIV, HCV, SARS CoV, and influenza A will provide a basis for the future exploration of RNA targets for therapeutic intervention in other viral pathogens which create urgent, unmet medical needs. Viruses for which targeting ncRNA components in the genome or transcripts may be promising include insect-borne flaviviruses (Dengue, Zika, and West Nile) and filoviruses (Ebola and Marburg). WIREs RNA 2016, 7:726-743. doi: 10.1002/wrna.1373 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods†

PubMed Central

Jean, Julie; D'Souza, Doris H.; Jaykus, Lee-Ann

2004-01-01

Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10−1 reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 100 to 102 reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods. PMID:15528524

Multiplex nucleic acid sequence-based amplification for simultaneous detection of several enteric viruses in model ready-to-eat foods.

PubMed

Jean, Julie; D'Souza, Doris H; Jaykus, Lee-Ann

2004-11-01

Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10(-1) reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 10(0) to 10(2) reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods.

Nonstructural Protein NSs of Schmallenberg Virus Is Targeted to the Nucleolus and Induces Nucleolar Disorganization

PubMed Central

Gouzil, Julie; Fablet, Aurore; Lara, Estelle; Caignard, Grégory; Cochet, Marielle; Kundlacz, Cindy; Palmarini, Massimo; Varela, Mariana; Breard, Emmanuel; Sailleau, Corinne; Viarouge, Cyril; Coulpier, Muriel; Zientara, Stéphan

2016-01-01

ABSTRACT Schmallenberg virus (SBV) was discovered in Germany in late 2011 and then spread rapidly to many European countries. SBV is an orthobunyavirus that causes abortion and congenital abnormalities in ruminants. A virus-encoded nonstructural protein, termed NSs, is a major virulence factor of SBV, and it is known to promote the degradation of Rpb1, a subunit of the RNA polymerase II (Pol II) complex, and therefore hampers global cellular transcription. In this study, we found that NSs is mainly localized in the nucleus of infected cells and specifically appears to target the nucleolus through a nucleolar localization signal (NoLS) localized between residues 33 and 51 of the protein. NSs colocalizes with nucleolar markers such as B23 (nucleophosmin) and fibrillarin. We observed that in SBV-infected cells, B23 undergoes a nucleolus-to-nucleoplasm redistribution, evocative of virus-induced nucleolar disruption. In contrast, the nucleolar pattern of B23 was unchanged upon infection with an SBV recombinant mutant with NSs lacking the NoLS motif (SBVΔNoLS). Interestingly, unlike wild-type SBV, the inhibitory activity of SBVΔNoLS toward RNA Pol II transcription is impaired. Overall, our results suggest that a putative link exists between NSs-induced nucleolar disruption and its inhibitory function on cellular transcription, which consequently precludes the cellular antiviral response and/or induces cell death. IMPORTANCE Schmallenberg virus (SBV) is an emerging arbovirus of ruminants that spread in Europe between 2011 and 2013. SBV induces fetal abnormalities during gestation, with the central nervous system being one of the most affected organs. The virus-encoded NSs protein acts as a virulence factor by impairing host cell transcription. Here, we show that NSs contains a nucleolar localization signal (NoLS) and induces disorganization of the nucleolus. The NoLS motif in the SBV NSs is absolutely necessary for virus-induced inhibition of cellular transcription. To

Nonstructural Protein NSs of Schmallenberg Virus Is Targeted to the Nucleolus and Induces Nucleolar Disorganization.

PubMed

Gouzil, Julie; Fablet, Aurore; Lara, Estelle; Caignard, Grégory; Cochet, Marielle; Kundlacz, Cindy; Palmarini, Massimo; Varela, Mariana; Breard, Emmanuel; Sailleau, Corinne; Viarouge, Cyril; Coulpier, Muriel; Zientara, Stéphan; Vitour, Damien

2017-01-01

Schmallenberg virus (SBV) was discovered in Germany in late 2011 and then spread rapidly to many European countries. SBV is an orthobunyavirus that causes abortion and congenital abnormalities in ruminants. A virus-encoded nonstructural protein, termed NSs, is a major virulence factor of SBV, and it is known to promote the degradation of Rpb1, a subunit of the RNA polymerase II (Pol II) complex, and therefore hampers global cellular transcription. In this study, we found that NSs is mainly localized in the nucleus of infected cells and specifically appears to target the nucleolus through a nucleolar localization signal (NoLS) localized between residues 33 and 51 of the protein. NSs colocalizes with nucleolar markers such as B23 (nucleophosmin) and fibrillarin. We observed that in SBV-infected cells, B23 undergoes a nucleolus-to-nucleoplasm redistribution, evocative of virus-induced nucleolar disruption. In contrast, the nucleolar pattern of B23 was unchanged upon infection with an SBV recombinant mutant with NSs lacking the NoLS motif (SBVΔNoLS). Interestingly, unlike wild-type SBV, the inhibitory activity of SBVΔNoLS toward RNA Pol II transcription is impaired. Overall, our results suggest that a putative link exists between NSs-induced nucleolar disruption and its inhibitory function on cellular transcription, which consequently precludes the cellular antiviral response and/or induces cell death. Schmallenberg virus (SBV) is an emerging arbovirus of ruminants that spread in Europe between 2011 and 2013. SBV induces fetal abnormalities during gestation, with the central nervous system being one of the most affected organs. The virus-encoded NSs protein acts as a virulence factor by impairing host cell transcription. Here, we show that NSs contains a nucleolar localization signal (NoLS) and induces disorganization of the nucleolus. The NoLS motif in the SBV NSs is absolutely necessary for virus-induced inhibition of cellular transcription. To our knowledge, this

Phenotype Variation in Human Immunodeficiency virus Type 1 Transmission and Disease Progression

PubMed Central

Cavarelli, Mariangela; Scarlatti, Gabriella

2009-01-01

Human immunodeficiency virus type I (HIV-1) infects target cells through interaction with the CD4 molecule and chemokine receptors, mainly CCR5 and CXCR4. Viral isolates can be phenotypically classified based on the co-receptor they utilize to infect target cells. Thus, R5 and X4 virus use respectively CCR5 and CXCR4, whereas R5X4 virus can use either CCR5 or CXCR4. This review describes the central role played by co-receptor expression and usage for HIV-1 cell tropism, transmission and pathogenesis. We discuss various hypotheses proposed to explain the preferential transmission of R5 viruses and the mechanisms driving the change of HIV-1 co-receptor usage in the course of infection. Recent insights in the intrinsic variability of R5 viruses and their role in influencing disease progression in both adults and children are also discussed. PMID:19893208

Phenotype variation in human immunodeficiency virus type 1 transmission and disease progression.

PubMed

Cavarelli, Mariangela; Scarlatti, Gabriella

2009-01-01

Human immunodeficiency virus type I (HIV-1) infects target cells through interaction with the CD4 molecule and chemokine receptors, mainly CCR5 and CXCR4. Viral isolates can be phenotypically classified based on the co-receptor they utilize to infect target cells. Thus, R5 and X4 virus use respectively CCR5 and CXCR4, whereas R5X4 virus can use either CCR5 or CXCR4. This review describes the central role played by co-receptor expression and usage for HIV-1 cell tropism, transmission and pathogenesis. We discuss various hypotheses proposed to explain the preferential transmission of R5 viruses and the mechanisms driving the change of HIV-1 co-receptor usage in the course of infection. Recent insights in the intrinsic variability of R5 viruses and their role in influencing disease progression in both adults and children are also discussed.

MicroRNAs responding to southern rice black-streaked dwarf virus infection and their target genes associated with symptom development in rice.

PubMed

Xu, Donglin; Mou, Guiping; Wang, Kang; Zhou, Guohui

2014-09-22

Southern rice black-streaked dwarf virus (SRBSDV) is a recently emerged rice virus that has spread across Asia. This devastating virus causes rice plants to produce a variety of symptoms during different growth stages. MicroRNAs (miRNAs) comprise a large group of 21-24-nt RNA molecules that are important regulators of plant development processes and stress responses. In this study, we used microarray profiling to investigate rice miRNAs responding to SRBSDV infection at 3, 9, 15, and 20 days post-inoculation (dpi). Expression levels of 56 miRNAs were altered in SRBSDV-infected rice plants, with these changes classified into eight different regulation patterns according to their temporal expression dynamics. Fourteen miRNAs belonging to six families (miR164, R396, R530, R1846, R1858, and R2097) were significantly regulated at 20 dpi. We used RT-qPCR to search for expression level correlations between members of these families and their putative targets at 3, 9, and 15 dpi. Some members of the miR164, R396, R530, and R1846 families were found to be positively or negatively correlated with their respective targets during 3-15 days after SRBSDV infection, whereas in more cases the rice miRNAs were not in correlation with their targets along the post-inoculation period, suggesting that some additional factors may be involved in rice miRNA-target interactions. The reported functions of rice genes targeted by the miR164, R396, R530, R1846, and R1858 families indicated that these genes are associated with symptom development. These results provide insights into miRNA-mediated SRBSDV-rice interactions. Copyright © 2014 Elsevier B.V. All rights reserved.

What motivates use of community-based human immunodeficiency virus testing in rural South Africa?

PubMed Central

Upadhya, Devesh; Moll, Anthony P; Brooks, Ralph P; Friedland, Gerald; Shenoi, Sheela V

2016-01-01

Despite substantial progress in implementing human immunodeficiency virus testing, challenges remain in achieving widespread uptake particularly in rural resource-limited settings. We sought to understand motivations for human immunodeficiency virus testing in a community-based human immunodeficiency virus testing programme in rural South Africa. We conducted a questionnaire survey in participants undergoing voluntary human immunodeficiency virus testing within an ongoing community-based integrated human immunodeficiency virus/TB intensive case finding programme at congregate rural settings. Participants responded to a six-item non-mutually exclusive motivations survey which included the topics of feeling ill, recent HV exposure, risky lifestyle, illness in a family member, and pregnancy. Among 2068 respondents completing the survey, 1393 (67.4%) were women, median age was 40 years (IQR 19–56), and 1235 (59.7%) were first time testers. Among all testers, 142 (6.9%) were human immunodeficiency virus-positive with median CD4 count 346 (IQR 218–542). Community-based testing for human immunodeficiency virus is acceptable and meets the needs of community members in rural South Africa. Motivations for human immunodeficiency virus testing at the community level are complex and differ according to gender, age, site of community testing, and human immunodeficiency virus status. These differences can be utilised to improve the focus and yield of community-based human immunodeficiency virus screening. PMID:26134323

Targeting host calpain proteases decreases influenza A virus infection.

PubMed

Blanc, Fany; Furio, Laetitia; Moisy, Dorothée; Yen, Hui-Ling; Chignard, Michel; Letavernier, Emmanuel; Naffakh, Nadia; Mok, Chris Ka Pun; Si-Tahar, Mustapha

2016-04-01

Influenza A viruses (IAV) trigger contagious acute respiratory diseases. A better understanding of the molecular mechanisms of IAV pathogenesis and host immune responses is required for the development of more efficient treatments of severe influenza. Calpains are intracellular proteases that participate in diverse cellular responses, including inflammation. Here, we used in vitro and in vivo approaches to investigate the role of calpain signaling in IAV pathogenesis. Calpain expression and activity were found altered in IAV-infected bronchial epithelial cells. With the use of small-interfering RNA (siRNA) gene silencing, specific synthetic inhibitors of calpains, and mice overexpressing calpastatin, we found that calpain inhibition dampens IAV replication and IAV-triggered secretion of proinflammatory mediators and leukocyte infiltration. Remarkably, calpain inhibition has a protective impact in IAV infection, since it significantly reduced mortality of mice challenged not only by seasonal H3N2- but also by hypervirulent H5N1 IAV strains. Hence, our study suggests that calpains are promising therapeutic targets for treating IAV acute pneumonia. Copyright © 2016 the American Physiological Society.

Influenza vaccines based on virus-like particles

PubMed Central

Kang, Sang-Moo; Song, Jae-Min; Quan, Fu-Shi; Compans, Richard W.

2009-01-01

The simultaneous expression of structural proteins of virus can produce virus-like particles (VLPs) by a self-assembly process in a viral life cycle even in the absence of genomic material. Taking an advantage of structural and morphological similarities of VLPs to native virions, VLPs have been suggested as a promising platform for new viral vaccines. In the light of a pandemic threat, influenza VLPs have been recently developed as a new generation of non-egg based cell culture-derived vaccine candidates against influenza infection. Animals vaccinated with VLPs containing hemagglutinin (HA) or HA and neuraminidase (NA) were protected from morbidity and mortality resulting from lethal influenza infections. Influenza VLPs serve as an excellent model system of an enveloped virus for understanding the properties of VLPs in inducing protective immunity. In this review, we briefly describe the characteristics of influenza VLPs assembled with a lipid bilayer containing glycoproteins, and summarize the current progress on influenza VLPs as an alternative vaccine candidate against seasonal as well as pandemic influenza viruses. In addition, the protective immune correlates induced by vaccination with influenza VLPs are discussed. PMID:19374929

Plant Viruses as Nanoparticle-Based Vaccines and Adjuvants.

PubMed

Lebel, Marie-Ève; Chartrand, Karine; Leclerc, Denis; Lamarre, Alain

2015-08-05

Vaccines are considered one of the greatest medical achievements in the battle against infectious diseases. However, the intractability of various diseases such as hepatitis C, HIV/AIDS, malaria, tuberculosis, and cancer poses persistent hurdles given that traditional vaccine-development methods have proven to be ineffective; as such, these challenges have driven the emergence of novel vaccine design approaches. In this regard, much effort has been put into the development of new safe adjuvants and vaccine platforms. Of particular interest, the utilization of plant virus-like nanoparticles and recombinant plant viruses has gained increasing significance as an effective tool in the development of novel vaccines against infectious diseases and cancer. The present review summarizes recent advances in the use of plant viruses as nanoparticle-based vaccines and adjuvants and their mechanism of action. Harnessing plant-virus immunogenic properties will enable the design of novel, safe, and efficacious prophylactic and therapeutic vaccines against disease.

Rational Engineering and Characterization of an mAb that Neutralizes Zika Virus by Targeting a Mutationally Constrained Quaternary Epitope.

PubMed

Tharakaraman, Kannan; Watanabe, Satoru; Chan, Kuan Rong; Huan, Jia; Subramanian, Vidya; Chionh, Yok Hian; Raguram, Aditya; Quinlan, Devin; McBee, Megan; Ong, Eugenia Z; Gan, Esther S; Tan, Hwee Cheng; Tyagi, Anu; Bhushan, Shashi; Lescar, Julien; Vasudevan, Subhash G; Ooi, Eng Eong; Sasisekharan, Ram

2018-05-09

Following the recent emergence of Zika virus (ZIKV), many murine and human neutralizing anti-ZIKV antibodies have been reported. Given the risk of virus escape mutants, engineering antibodies that target mutationally constrained epitopes with therapeutically relevant potencies can be valuable for combating future outbreaks. Here, we applied computational methods to engineer an antibody, ZAb_FLEP, that targets a highly networked and therefore mutationally constrained surface formed by the envelope protein dimer. ZAb_FLEP neutralized a breadth of ZIKV strains and protected mice in distinct in vivo models, including resolving vertical transmission and fetal mortality in infected pregnant mice. Serial passaging of ZIKV in the presence of ZAb_FLEP failed to generate viral escape mutants, suggesting that its epitope is indeed mutationally constrained. A single-particle cryo-EM reconstruction of the Fab-ZIKV complex validated the structural model and revealed insights into ZAb_FLEP's neutralization mechanism. ZAb_FLEP has potential as a therapeutic in future outbreaks. Copyright © 2018. Published by Elsevier Inc.

Discovery of novel dengue virus entry inhibitors via a structure-based approach.

PubMed

Leal, Emilse S; Aucar, M Gabriela; Gebhard, Leopoldo G; Iglesias, Nestor G; Pascual, María J; Casal, Juan J; Gamarnik, Andrea V; Cavasotto, Claudio N; Bollini, Mariela

2017-08-15

Dengue is a mosquito-borne virus that has become a major public health concern worldwide in recent years. However, the current treatment for dengue disease is only supportive therapy, and no specific antivirals are available to control the infections. Therefore, the need for safe and effective antiviral drugs against this virus is of utmost importance. Entry of the dengue virus (DENV) into a host cell is mediated by its major envelope protein, E. The crystal structure of the E protein reveals a hydrophobic pocket occupied by the detergent n-octyl-β-d-glucoside (β-OG) lying at a hinge region between domains I and II, which is important for the low-pH-triggered conformational rearrangement required for fusion. Thus, the E protein is an attractive target for the development of antiviral agents. In this work, we performed prospective docking-based virtual screening to identify small molecules that likely bind to the β-OG binding site. Twenty-three structurally different compounds were identified and two of them had an EC 50 value in the low micromolar range. In particular, compound 2 (EC 50 =3.1μM) showed marked antiviral activity with a good therapeutic index. Molecular dynamics simulations were used in an attempt to characterize the interaction of 2 with protein E, thus paving the way for future ligand optimization endeavors. These studies highlight the possibility of using a new class of DENV inhibitors against dengue. Copyright © 2017 Elsevier Ltd. All rights reserved.

Use of superparamagnetic beads for the isolation of a peptide with specificity to cymbidium mosaic virus.

PubMed

Ooi, Diana Jia Miin; Dzulkurnain, Adriya; Othman, Rofina Yasmin; Lim, Saw Hoon; Harikrishna, Jennifer Ann

2006-09-01

A modified method for the rapid isolation of specific ligands to whole virus particles is described. Biopanning against cymbidium mosaic virus was carried out with a commercial 12-mer random peptide display library. A solution phase panning method was devised using streptavidin-coated superparamagnetic beads. The solution based panning method was more efficient than conventional immobilized target panning when using whole viral particles of cymbidium mosaic virus as a target. Enzyme-linked immunosorbent assay of cymbidium mosaic virus-binding peptides isolated from the library identified seven peptides with affinity for cymbidium mosaic virus and one peptide which was specific to cymbidium mosaic virus and had no significant binding to odontoglossum ringspot virus. This method should have broad application for the screening of whole viral particles towards the rapid development of diagnostic reagents without the requirement for cloning and expression of single antigens.

Mechanisms of Cross-protection by Influenza Virus M2-based Vaccines.

PubMed

Lee, Yu-Na; Kim, Min-Chul; Lee, Young-Tae; Kim, Yu-Jin; Kang, Sang-Moo

2015-10-01

Current influenza virus vaccines are based on strain-specific surface glycoprotein hemagglutinin (HA) antigens and effective only when the predicted vaccine strains and circulating viruses are well-matched. The current strategy of influenza vaccination does not prevent the pandemic outbreaks and protection efficacy is reduced or ineffective if mutant strains emerge. It is of high priority to develop effective vaccines and vaccination strategies conferring a broad range of cross protection. The extracellular domain of M2 (M2e) is highly conserved among human influenza A viruses and has been utilized to develop new vaccines inducing cross protection against different subtypes of influenza A virus. However, immune mechanisms of cross protection by M2e-based vaccines still remain to be fully elucidated. Here, we review immune correlates and mechanisms conferring cross protection by M2e-based vaccines. Molecular and cellular immune components that are known to be involved in M2 immune-mediated protection include antibodies, B cells, T cells, alveolar macrophages, Fc receptors, complements, and natural killer cells. Better understanding of protective mechanisms by immune responses induced by M2e vaccination will help facilitate development of broadly cross protective vaccines against influenza A virus.

CRISPR/Cas13a targeting of RNA virus in plants.

PubMed

Chaudhary, Kulbhushan

2018-05-19

This approach is quite promising to control plant viral diseases and create synthetic networks to better understand the structure/function relationship in RNA and proteins. Plant viruses are obligate intracellular parasites which causes enormous losses in crop yield worldwide. These viruses replicate into infected cells by highjacking host cellular machinery. Over the last two decades, diverse approaches such as conventional breeding, transgenic approach and gene silencing strategies have been used to control RNA viruses, but escaped due to high rate of mutation. Recently, a novel CRISPR enzyme, called Cas13a, has been used engineered to confer RNA viruses resistance in plants. Here, we summarize the recent breakthrough of CRISPR/Cas13a and its applications in RNA biology.

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.

PubMed

Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F

2018-04-03

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Targeted Elimination of Peroxisomes During Viral Infection: Lessons from HIV and Other Viruses.

PubMed

Wong, Cheung Pang; Xu, Zaikun; Power, Christopher; Hobman, Tom C

2018-05-01

Peroxisomes are membrane-bound organelles that are best known for their roles in lipid metabolism. Mounting evidence indicates that they are also important nodes for antiviral signaling. While research over the past few decades has revealed effective viral strategies to block antiviral signalling pathways from the plasma membrane, mitochondria and/or the nucleus, until recently, very little was known about how viruses interfere with peroxisome-based antiviral signaling. In this essay, we review how viruses use a variety of strategies to interfere with peroxisome biogenesis, a phenomenon that has implications for evasion of the host immune system as well as pathogenesis.

Development of CRISPR/Cas9 mediated virus resistance in agriculturally important crops.

PubMed

Khatodia, Surender; Bhatotia, Kirti; Tuteja, Narendra

2017-05-04

Clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR associated nuclease 9 (Cas9) system of targeted genome editing has already revolutionized the plant science research. This is a RNA guided programmable endonuclease based system composed of 2 components, the Cas9 nuclease and an engineered guide RNA targeting any DNA sequence of the form N20-NGG for novel genome editing applications. The CRISPR/Cas9 technology of targeted genome editing has been recently applied for imparting virus resistance in plants. The robustness, wide adaptability, and easy engineering of this system has proved its potential as an antiviral tool for plants. Novel DNA free genome editing by using the preassembled Cas9/gRNA ribonucleoprotein complex for development of virus resistance in any plant species have been prospected for the future. Also, in this review we have discussed the reports of CRISPR/Cas9 mediated virus resistance strategy against geminiviruses by targeting the viral genome and transgene free strategy against RNA viruses by targeting the host plant factors. In conclusion, CRISPR/Cas9 technology will provide a more durable and broad spectrum viral resistance in agriculturally important crops which will eventually lead to public acceptance and commercialization in the near future.

Construction of target-specific virus-like particles for the delivery of algicidal compounds to harmful algae.

PubMed

Kang, Beom Sik; Eom, Chi-Yong; Kim, Wonduck; Kim, Pyoung Il; Ju, Sun Yi; Ryu, Jaewon; Han, Gui Hwan; Oh, Jeong-Il; Cho, Hoon; Baek, Seung Ho; Kim, Gueeda; Kim, Minju; Hyun, Jaekyung; Jin, EonSeon; Kim, Si Wouk

2015-04-01

Harmful algal blooms (HABs) can lead to substantial socio-economic losses and extensive damage to aquatic ecosystems, drinking water sources and human health. Common algicidal techniques, including ozonation, ultrasonic treatment and dispersion of algae-killing chemicals, are unsatisfactory both economically and ecologically. This study therefore presents a novel alternative strategy for the efficient control of deleterious algae via the use of host-specific virus-like particles (VLPs) combined with chemically synthesized algicidal compounds. The capsid protein of HcRNAV34, a single-stranded RNA virus that infects the toxic dinoflagellate, Heterocapsa circularisquama, was expressed in and purified from Escherichia coli and then self-assembled into VLPs in vitro. Next, the algicidal compound, thiazolidinedione 49 (TD49), was encapsidated into HcRNAV34 VLPs for specific delivery to H. circularisquama. Consequently, HcRNAV34 VLPs demonstrated the same host selectivity as naturally occurring HcRNAV34 virions, while TD49-encapsidated VLPs showed a more potent target-specific algicidal effect than TD49 alone. These results indicate that target-specific VLPs for the delivery of cytotoxic compounds to nuisance algae might provide a safe, environmentally friendly approach for the management of HABs in aquatic ecosystems. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

A respiratory syncytial virus (RSV) vaccine based on parainfluenza virus 5 (PIV5)

PubMed Central

Phan, Shannon I.; Chen, Zhenhai; Xu, Pei; Li, Zhuo; Gao, Xiudan; Foster, Stephanie L.; Teng, Michael N.; Tripp, Ralph A.; Sakamoto, Kaori; He, Biao

2014-01-01

Human respiratory syncytial virus (RSV) is a leading cause of severe respiratory disease and hospitalizations in infants and young children. It also causes significant morbidity and mortality in elderly and immune compromised individuals. No licensed vaccine currently exists. Parainfluenza virus 5 (PIV5) is a paramyxovirus that causes no known human illness and has been used as a platform for vector-based vaccine development. To evaluate the efficacy of PIV5 as a RSV vaccine vector, we generated two recombinant PIV5 viruses - one expressing the fusion (F) protein and the other expressing the attachment glycoprotein (G) of RSV strain A2 (RSV A2). The vaccine strains were used separately for single-dose vaccinations in BALB/c mice. The results showed that both vaccines induced RSV antigen-specific antibody responses, with IgG2a/IgG1 ratios similar to those seen in wild-type RSV A2 infection. After challenging the vaccinated mice with RSV A2, histopathology of lung sections showed that the vaccines did not exacerbate lung lesions relative to RSV A2-immunized mice. Importantly, both F and G vaccines induced protective immunity. Therefore, PIV5 presents an attractive platform for vector-based vaccines against RSV infection. PMID:24717150

Durability of a vesicular stomatitis virus-based marburg virus vaccine in nonhuman primates.

PubMed

Mire, Chad E; Geisbert, Joan B; Agans, Krystle N; Satterfield, Benjamin A; Versteeg, Krista M; Fritz, Elizabeth A; Feldmann, Heinz; Hensley, Lisa E; Geisbert, Thomas W

2014-01-01

The filoviruses, Marburg virus (MARV) and Ebola virus, causes severe hemorrhagic fever with high mortality in humans and nonhuman primates. A promising filovirus vaccine under development is based on a recombinant vesicular stomatitis virus (rVSV) that expresses individual filovirus glycoproteins (GPs) in place of the VSV glycoprotein (G). These vaccines have shown 100% efficacy against filovirus infection in nonhuman primates when challenge occurs 28-35 days after a single injection immunization. Here, we examined the ability of a rVSV MARV-GP vaccine to provide protection when challenge occurs more than a year after vaccination. Cynomolgus macaques were immunized with rVSV-MARV-GP and challenged with MARV approximately 14 months after vaccination. Immunization resulted in the vaccine cohort of six animals having anti-MARV GP IgG throughout the pre-challenge period. Following MARV challenge none of the vaccinated animals showed any signs of clinical disease or viremia and all were completely protected from MARV infection. Two unvaccinated control animals exhibited signs consistent with MARV infection and both succumbed. Importantly, these data are the first to show 100% protective efficacy against any high dose filovirus challenge beyond 8 weeks after final vaccination. These findings demonstrate the durability of VSV-based filovirus vaccines.

Oral Delivery of Probiotics Expressing Dendritic Cell-Targeting Peptide Fused with Porcine Epidemic Diarrhea Virus COE Antigen: A Promising Vaccine Strategy against PEDV.

PubMed

Wang, Xiaona; Wang, Li; Huang, Xuewei; Ma, Sunting; Yu, Meiling; Shi, Wen; Qiao, Xinyuan; Tang, Lijie; Xu, Yigang; Li, Yijing

2017-10-25

Porcine epidemic diarrhea virus (PEDV), an enteric coronavirus, is the causative agent of porcine epidemic diarrhea (PED) that damages intestinal epithelial cells and results in severe diarrhea and dehydration in neonatal suckling pigs with up to 100% mortality. The oral vaccine route is reported as a promising approach for inducing protective immunity against PEDV invasion. Furthermore, dendritic cells (DCs), professional antigen-presenting cells, link humoral and cellular immune responses for homeostasis of the intestinal immune environment. In this study, in order to explore an efficient oral vaccine against PEDV infection, a mucosal DC-targeting oral vaccine was developed using Lactobacillus casei to deliver the DC-targeting peptide (DCpep) fused with the PEDV core neutralizing epitope (COE) antigen. This probiotic vaccine could efficiently elicit secretory immunoglobulin A (SIgA)-based mucosal and immunoglobulin G (IgG)-based humoral immune responses via oral vaccination in vivo. Significant differences ( p < 0.05) in the immune response levels were observed between probiotics expressing the COE-DCpep fusion protein and COE antigen alone, suggesting better immune efficiency of the probiotics vaccine expressing the DC-targeting peptide fused with PEDV COE antigen. This mucosal DC-targeting oral vaccine delivery effectively enhances vaccine antigen delivery efficiency, providing a useful strategy to induce efficient immune responses against PEDV infection.

3β-Hydroxysterol Δ24-Reductase on the Surface of Hepatitis C Virus-Related Hepatocellular Carcinoma Cells Can Be a Target for Molecular Targeting Therapy

PubMed Central

Saito, Makoto; Takano, Takashi; Nishimura, Tomohiro; Kohara, Michinori; Tsukiyama-Kohara, Kyoko

2015-01-01

In our previous study, we demonstrated that 3β-hydroxysterol Δ24-reductase (DHCR24) was overexpressed in hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC), and that its expression was induced by HCV. Using a monoclonal antibody against DHCR24 (2-152a MAb), we found that DHCR24 was specifically expressed on the surface of HCC cell lines. Based on these findings, we aimed to establish a novel targeting strategy using 2-152a MAb to treat HCV-related HCC. In the present study, we examined the antitumor activity of 2-152a MAb. In the presence of complement, HCC-derived HuH-7 cells were killed by treatment with 2-152a MAb, which was mediated by complement-dependent cytotoxicity (CDC). In addition, the antigen recognition domain of 2-152a MAb was responsible for the unique anti-HCV activity. These findings demonstrate the feasibility of using 2-152a MAb for antibody therapy against HCV-related HCC. In addition, surface DHCR24 on HCC cells exhibited a functional property, agonist-induced internalization. We showed that 2-152a MAb-mediated binding of a cytotoxic agent (a saponin-conjugated secondary antibody) to surface DHCR24 led to significant cytotoxicity. This suggests that surface DHCR24 on HCC cells can function as a carrier for internalization. Therefore, surface DHCR24 could be a valuable target for HCV-related HCC therapy, and 2-152a MAb appears to be useful for this targeted therapy. PMID:25875901

Ebola virus vaccine: benefit and risks of adenovirus-based vectors.

PubMed

Mennechet, Franck J D; Tran, Thi Thu Phuong; Eichholz, Karsten; van de Perre, Philippe; Kremer, Eric J

2015-01-01

In 2014, an outbreak of Ebola virus spread rapidly in West Africa. The epidemic killed more than 10,000 people and resulted in transmissions outside the endemic countries. WHO hopes for effective vaccines by the end of 2015. Numerous vaccine candidates have been proposed, and several are currently being evaluated in humans. Among the vaccine candidates are vectors derived from adenovirus (Ad). Despite previous encouraging preclinical and Phase I/II trials, Ad vectors used in three Phase II trials targeting HIV were prematurely interrupted because of the lack of demonstrated efficacy. The vaccine was not only ineffective but also led to a higher rate of HIV acquisition. In this context, the authors discuss the potential benefits, risks and impact of using Ad-derived vaccines to control Ebola virus disease.

Novel Small Molecule Entry Inhibitors of Ebola Virus

PubMed Central

Basu, Arnab; Mills, Debra M.; Mitchell, Daniel; Ndungo, Esther; Williams, John D.; Herbert, Andrew S.; Dye, John M.; Moir, Donald T.; Chandran, Kartik; Patterson, Jean L.; Rong, Lijun; Bowlin, Terry L.

2015-01-01

Background. The current Ebola virus (EBOV) outbreak has highlighted the troubling absence of available antivirals or vaccines to treat infected patients and stop the spread of EBOV. The EBOV glycoprotein (GP) plays critical roles in the early stage of virus infection, including receptor binding and membrane fusion, making it a potential target for the development of anti-EBOV drugs. We report the identification of 2 novel EBOV inhibitors targeting viral entry. Methods. To identify small molecule inhibitors of EBOV entry, we carried out a cell-based high-throughput screening using human immunodeficiency virus–based pseudotyped viruses expressing EBOV-GP. Two compounds were identified, and mechanism-of-action studies were performed using immunoflourescence, AlphaLISA, and enzymatic assays for cathepsin B inhibition. Results. We report the identification of 2 novel entry inhibitors. These inhibitors (1) inhibit EBOV infection (50% inhibitory concentration, approximately 0.28 and approximately 10 µmol/L) at a late stage of entry, (2) induce Niemann-Pick C phenotype, and (3) inhibit GP–Niemann-Pick C1 (NPC1) protein interaction. Conclusions. We have identified 2 novel EBOV inhibitors, MBX2254 and MBX2270, that can serve as starting points for the development of an anti-EBOV therapeutic agent. Our findings also highlight the importance of NPC1-GP interaction in EBOV entry and the attractiveness of NPC1 as an antifiloviral therapeutic target. PMID:26206510

Towards Personalized Medicine Mediated by in Vitro Virus-Based Interactome Approaches

PubMed Central

Ohashi, Hiroyuki; Miyamoto-Sato, Etsuko

2014-01-01

We have developed a simple in vitro virus (IVV) selection system based on cell-free co-translation, using a highly stable and efficient mRNA display method. The IVV system is applicable to the high-throughput and comprehensive analysis of proteins and protein–ligand interactions. Huge amounts of genomic sequence data have been generated over the last decade. The accumulated genetic alterations and the interactome networks identified within cells represent a universal feature of a disease, and knowledge of these aspects can help to determine the optimal therapy for the disease. The concept of the “integrome” has been developed as a means of integrating large amounts of data. We have developed an interactome analysis method aimed at providing individually-targeted health care. We also consider future prospects for this system. PMID:24756093

Antibody Pressure by a Human Monoclonal Antibody Targeting the 2009 Pandemic H1N1 Virus Hemagglutinin Drives the Emergence of a Virus with Increased Virulence in Mice

PubMed Central

O’Donnell, Christopher D.; Vogel, Leatrice; Wright, Amber; Das, Suman R.; Wrammert, Jens; Li, Gui-Mei; McCausland, Megan; Zheng, Nai-Ying; Yewdell, Jonathan W.; Ahmed, Rafi; Wilson, Patrick C.; Subbarao, Kanta

2012-01-01

ABSTRACT In 2009, a novel H1N1 influenza A virus (2009 pH1N1) emerged and caused a pandemic. A human monoclonal antibody (hMAb; EM4C04), highly specific for the 2009 pH1N1 virus hemagglutinin (HA), was isolated from a severely ill 2009 pH1N1 virus-infected patient. We postulated that under immune pressure with EM4C04, the 2009 pH1N1 virus would undergo antigenic drift and mutate at sites that would identify the antibody binding site. To do so, we infected MDCK cells in the presence of EM4C04 and generated 11 escape mutants, displaying 7 distinct amino acid substitutions in the HA. Six substitutions greatly reduced MAb binding (K123N, D131E, K133T, G134S, K157N, and G158E). Residues 131, 133, and 134 are contiguous with residues 157 and 158 in the globular domain structure and contribute to a novel pH1N1 antibody epitope. One mutation near the receptor binding site, S186P, increased the binding affinity of the HA to the receptor. 186P and 131E are present in the highly virulent 1918 virus HA and were recently identified as virulence determinants in a mouse-passaged pH1N1 virus. We found that pH1N1 escape variants expressing these substitutions enhanced replication and lethality in mice compared to wild-type 2009 pH1N1 virus. The increased virulence of these viruses was associated with an increased affinity for α2,3 sialic acid receptors. Our study demonstrates that antibody pressure by an hMAb targeting a novel epitope in the Sa region of 2009 pH1N1 HA is able to inadvertently drive the development of a more virulent virus with altered receptor binding properties. This broadens our understanding of antigenic drift. PMID:22647789

Biomimetic virus-based colourimetric sensors.

PubMed

Oh, Jin-Woo; Chung, Woo-Jae; Heo, Kwang; Jin, Hyo-Eon; Lee, Byung Yang; Wang, Eddie; Zueger, Chris; Wong, Winnie; Meyer, Joel; Kim, Chuntae; Lee, So-Young; Kim, Won-Geun; Zemla, Marcin; Auer, Manfred; Hexemer, Alexander; Lee, Seung-Wuk

2014-01-01

Many materials in nature change colours in response to stimuli, making them attractive for use as sensor platform. However, both natural materials and their synthetic analogues lack selectivity towards specific chemicals, and introducing such selectivity remains a challenge. Here we report the self-assembly of genetically engineered viruses (M13 phage) into target-specific, colourimetric biosensors. The sensors are composed of phage-bundle nanostructures and exhibit viewing-angle independent colour, similar to collagen structures in turkey skin. On exposure to various volatile organic chemicals, the structures rapidly swell and undergo distinct colour changes. Furthermore, sensors composed of phage displaying trinitrotoluene (TNT)-binding peptide motifs identified from a phage display selectively distinguish TNT down to 300 p.p.b. over similarly structured chemicals. Our tunable, colourimetric sensors can be useful for the detection of a variety of harmful toxicants and pathogens to protect human health and national security.

Biomimetic virus-based colourimetric sensors

NASA Astrophysics Data System (ADS)

Oh, Jin-Woo; Chung, Woo-Jae; Heo, Kwang; Jin, Hyo-Eon; Lee, Byung Yang; Wang, Eddie; Zueger, Chris; Wong, Winnie; Meyer, Joel; Kim, Chuntae; Lee, So-Young; Kim, Won-Geun; Zemla, Marcin; Auer, Manfred; Hexemer, Alexander; Lee, Seung-Wuk

2014-01-01

Many materials in nature change colours in response to stimuli, making them attractive for use as sensor platform. However, both natural materials and their synthetic analogues lack selectivity towards specific chemicals, and introducing such selectivity remains a challenge. Here we report the self-assembly of genetically engineered viruses (M13 phage) into target-specific, colourimetric biosensors. The sensors are composed of phage-bundle nanostructures and exhibit viewing-angle independent colour, similar to collagen structures in turkey skin. On exposure to various volatile organic chemicals, the structures rapidly swell and undergo distinct colour changes. Furthermore, sensors composed of phage displaying trinitrotoluene (TNT)-binding peptide motifs identified from a phage display selectively distinguish TNT down to 300 p.p.b. over similarly structured chemicals. Our tunable, colourimetric sensors can be useful for the detection of a variety of harmful toxicants and pathogens to protect human health and national security.

Sus scrofa miR-204 and miR-4331 Negatively Regulate Swine H1N1/2009 Influenza A Virus Replication by Targeting Viral HA and NS, Respectively.

PubMed

Zhang, Shishuo; Wang, Ruifang; Su, Huijuan; Wang, Biaoxiong; Sizhu, Suolang; Lei, Zhixin; Jin, Meilin; Chen, Huanchun; Cao, Jiyue; Zhou, Hongbo

2017-04-03

The prevalence of swine pandemic H1N1/2009 influenza A virus (SIV-H1N1/2009) in pigs has the potential to generate novel reassortant viruses, posing a great threat to human health. Cellular microRNAs (miRNAs) have been proven as promising small molecules for regulating influenza A virus replication by directly targeting viral genomic RNA. In this study, we predicted potential Sus scrofa (ssc-, swine) miRNAs targeting the genomic RNA of SIV-H1N1/2009 by RegRNA 2.0, and identified ssc-miR-204 and ssc-miR-4331 to target viral HA and NS respectively through dual-luciferase reporter assays. The messenger RNA (mRNA) levels of viral HA and NS were significantly suppressed when newborn pig trachea (NPTr) cells respectively overexpressed ssc-miR-204 and ssc-miR-4331 and were infected with SIV-H1N1/2009, whereas the suppression effect could be restored when respectively decreasing endogenous ssc-miR-204 and ssc-miR-4331 with inhibitors. Because of the importance of viral HA and NS in the life cycle of influenza A virus, ssc-miR-204 and ssc-miR-4331 exhibited an inhibition effect on SIV-H1N1/2009 replication. The antiviral effect was sequence-specific of SIV-H1N1/2009, for the target sites in HA and NS of H5N1 or H9N2 influenza A virus were not conserved. Furthermore, SIV-H1N1/2009 infection reversely downregulated the expression of ssc-miR-204 and ssc-miR-4331, which might facilitate the virus replication in the host. In summary, this work will provide us some important clues for controlling the prevalence of SIV-H1N1/2009 in pig populations.

West Nile Virus NS1 Antagonizes Interferon Beta Production by Targeting RIG-I and MDA5.

PubMed

Zhang, Hong-Lei; Ye, Han-Qing; Liu, Si-Qing; Deng, Cheng-Lin; Li, Xiao-Dan; Shi, Pei-Yong; Zhang, Bo

2017-09-15

West Nile virus (WNV) is a mosquito-borne flavivirus that causes epidemics of encephalitis and viscerotropic disease worldwide. This virus has spread rapidly and has posed a significant public health threat since the outbreak in New York City in 1999. The interferon (IFN)-mediated antiviral response represents an important component of virus-host interactions and plays an essential role in regulating viral replication. Previous studies have suggested that multifunctional nonstructural proteins encoded by flaviviruses antagonize the host IFN response via various means in order to establish efficient viral replication. In this study, we demonstrated that the nonstructural protein 1 (NS1) of WNV antagonizes IFN-β production, most likely through suppression of retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) activation. In a dual-luciferase reporter assay, WNV NS1 significantly inhibited the activation of the IFN-β promoter after Sendai virus infection or poly(I·C) treatment. NS1 also suppressed the activation of the IFN-β promoter when it was stimulated by interferon regulatory factor 3 (IRF3)/5D or its upstream molecules in the RLR signaling pathway. Furthermore, NS1 blocked the phosphorylation and nuclear translocation of IRF3 upon stimulation by various inducers. Mechanistically, WNV NS1 targets RIG-I and melanoma differentiation-associated gene 5 (MDA5) by interacting with them and subsequently causing their degradation by the proteasome. Furthermore, WNV NS1 inhibits the K63-linked polyubiquitination of RIG-I, thereby inhibiting the activation of downstream sensors in the RLR signaling pathway. Taken together, our results reveal a novel mechanism by which WNV NS1 interferes with the host antiviral response. IMPORTANCE WNV Nile virus (WNV) has received increased attention since its introduction to the United States. However, the pathogenesis of this virus is poorly understood. This study demonstrated that the nonstructural protein 1 (NS1) of WNV

Cyclosporin A inhibits the propagation of influenza virus by interfering with a late event in the virus life cycle.

PubMed

Hamamoto, Itsuki; Harazaki, Kazuhiro; Inase, Naohiko; Takaku, Hiroshi; Tashiro, Masato; Yamamoto, Norio

2013-01-01

Influenza is a global public health problem that causes a serious respiratory disease. Influenza virus frequently undergoes amino acid substitutions, which result in the emergence of drug-resistant viruses. To control influenza viruses that are resistant to currently available drugs, it is essential to develop new antiviral drugs with a novel molecular target. Here, we report that cyclosporin A (CsA) inhibits the propagation of influenza virus in A549 cells by interfering with a late event in the virus life cycle. CsA did not affect adsorption, internalization, viral RNA replication, or synthesis of viral proteins in A549 cells, but inhibited the step(s) after viral protein synthesis, such as assembly or budding. In addition, siRNA-mediated knockdown of the expression of the major CsA targets, namely cyclophilin A (CypA), cyclophilin B (CypB), and P-glycoprotein (Pgp), did not inhibit influenza virus propagation. These results suggest that CsA inhibits virus propagation by mechanism(s) independent of the inhibition of the function of CypA, CypB, and Pgp. CsA may target an unknown molecule that works as a positive regulator in the propagation of influenza virus. Our findings would contribute to the development of a novel anti-influenza virus therapy and clarification of the regulatory mechanism of influenza virus multiplication.

M13 Virus based detection of Bacterial Infections in Living Hosts

PubMed Central

Bardhan, Neelkanth M.; Ghosh, Debadyuti; Belcher, Angela M.

2014-01-01

We report a first method for using M13 bacteriophage as a multifunctional scaffold for optically imaging bacterial infections in vivo. We demonstrate that M13 virus conjugated with hundreds of dye molecules (M13-Dye) can target and distinguish pathogenic infections of F-pili expressing and F-negative strains of E. coli. Further, in order to tune this M13-Dye complex suitable for targeting other strains of bacteria, we have used a 1-step reaction for creating an anti-bacterial antibody-M13-Dye probe. As an example, we show anti-S.aureus-M13-Dye able to target and image infections of S. aureus in living hosts, with a 3.7x increase in fluorescence over background. PMID:23576418

Feature-based RNN target recognition

NASA Astrophysics Data System (ADS)

Bakircioglu, Hakan; Gelenbe, Erol

1998-09-01

Detection and recognition of target signatures in sensory data obtained by synthetic aperture radar (SAR), forward- looking infrared, or laser radar, have received considerable attention in the literature. In this paper, we propose a feature based target classification methodology to detect and classify targets in cluttered SAR images, that makes use of selective signature data from sensory data, together with a neural network technique which uses a set of trained networks based on the Random Neural Network (RNN) model (Gelenbe 89, 90, 91, 93) which is trained to act as a matched filter. We propose and investigate radial features of target shapes that are invariant to rotation, translation, and scale, to characterize target and clutter signatures. These features are then used to train a set of learning RNNs which can be used to detect targets within clutter with high accuracy, and to classify the targets or man-made objects from natural clutter. Experimental data from SAR imagery is used to illustrate and validate the proposed method, and to calculate Receiver Operating Characteristics which illustrate the performance of the proposed algorithm.

Off-target model based OPC

NASA Astrophysics Data System (ADS)

Lu, Mark; Liang, Curtis; King, Dion; Melvin, Lawrence S., III

2005-11-01

Model-based Optical Proximity correction has become an indispensable tool for achieving wafer pattern to design fidelity at current manufacturing process nodes. Most model-based OPC is performed considering the nominal process condition, with limited consideration of through process manufacturing robustness. This study examines the use of off-target process models - models that represent non-nominal process states such as would occur with a dose or focus variation - to understands and manipulate the final pattern correction to a more process robust configuration. The study will first examine and validate the process of generating an off-target model, then examine the quality of the off-target model. Once the off-target model is proven, it will be used to demonstrate methods of generating process robust corrections. The concepts are demonstrated using a 0.13 μm logic gate process. Preliminary indications show success in both off-target model production and process robust corrections. With these off-target models as tools, mask production cycle times can be reduced.

Plasmonics-Based Detection of Virus Using Sialic Acid Functionalized Gold Nanoparticles.

PubMed

Lee, Changwon; Wang, Peng; Gaston, Marsha A; Weiss, Alison A; Zhang, Peng

2017-01-01

Biosensor for the detection of virus was developed by utilizing plasmonic peak shift phenomenon of the gold nanoparticles and viral infection mechanism of hemagglutinin on virus and sialic acid on animal cells. The plasmonic peak of the colloidal gold nanoparticles changes with the aggregation of the particles due to the plasmonic interaction between nearby particles and the color of the colloidal nanoparticle solution changes from wine red to purple. Sialic acid reduced and stabilized colloidal gold nanoparticle aggregation is induced by the addition of viral particles in the solution due to the hemagglutinin-sialic acid interaction. In this work, sialic acid reduced and stabilized gold nanoparticles (d = 20.1 ± 1.8 nm) were synthesized by a simple one-pot, green method without chemically modifying sialic acid. The gold nanoparticles showed target-specific aggregation with viral particles via hemagglutinin-sialic acid binding. A linear correlation was observed between the change in optical density and dilution of chemically inactivated influenza B virus species. The detection limit of the virus dilution (hemagglutinination assay titer, 512) was shown to be 0.156 vol% and the upper limit of the linearity can be extended with the use of more sialic acid-gold nanoparticles.

Study on the Mechanisms of Active Compounds in Traditional Chinese Medicine for the Treatment of Influenza Virus by Virtual Screening.

PubMed

Ai, Haixin; Wu, Xuewei; Qi, Mengyuan; Zhang, Li; Hu, Huan; Zhao, Qi; Zhao, Jian; Liu, Hongsheng

2018-06-01

In recent years, new strains of influenza virus such as H7N9, H10N8, H5N6 and H5N8 had continued to emerge. There was an urgent need for discovery of new anti-influenza virus drugs as well as accurate and efficient large-scale inhibitor screening methods. In this study, we focused on six influenza virus proteins that could be anti-influenza drug targets, including neuraminidase (NA), hemagglutinin (HA), matrix protein 1 (M1), M2 proton channel (M2), nucleoprotein (NP) and non-structural protein 1 (NS1). Structure-based molecular docking was utilized to identify potential inhibitors for these drug targets from 13144 compounds in the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform. The results showed that 56 compounds could inhibit more than two drug targets simultaneously. Further, we utilized reverse docking to study the interaction of these compounds with host targets. Finally, the 22 compound inhibitors could stably bind to host targets with high binding free energy. The results showed that the Chinese herbal medicines had a multi-target effect, which could directly inhibit influenza virus by the target viral protein and indirectly inhibit virus by the human target protein. This method was of great value for large-scale virtual screening of new anti-influenza virus compounds.

Attenuated Salmonella choleraesuis-mediated RNAi targeted to conserved regions against foot-and-mouth disease virus in guinea pigs and swine.

PubMed

Cong, Wei; Jin, Hong; Jiang, Chengda; Yan, Weiyao; Liu, Mingqiu; Chen, Jiulian; Zuo, Xiaoping; Zheng, Zhaoxin

2010-01-01

In this study, specific sequences within three genes (3D, VP4 and 2B) of the foot-and-mouth disease virus (FMDV) genome were determined to be effective RNAi targets. These sequences are highly conserved among different serotype viruses based on sequence analysis. Small interfering RNA (siRNA)-expressing plasmids (p3D-NT19, p3D-NT56, pVP4-NT19, pVP4-NT65 and p2B-NT25) were constructed to express siRNA targeting 3D, VP4 and 2B, respectively. The antiviral potential of these siRNA for various FMDV isolates was investigated in baby hamster kidney (BHK-21) cells and suckling mice. The results show that these siRNA inhibited virus yield 10- to 300-fold for different FMDV isolates of serotype O and serotype Asia I at 48 h post infection in BHK-21 cells compared to control cells. In suckling mice, p3D-NT56 and p2B-NT25 delayed the death of mice. Twenty percent to 40% of the animals that received a single siRNA dose survived 5 days post infection with serotype O or serotype Asia I. We used an attenuated Salmonella choleraesuis (C500) vaccine strain, to carry the plasmid that expresses siRNA directed against the polymerase gene 3D (p3D-NT56) of FMDV. We used guinea pigs to evaluate the inhibitory effects of recombinant S. cho (p3D-NT56/S. cho) on FMDV infection. The results show that 80% of guinea pigs inoculated with 10(9) CFU of p3D-NT56/S. cho and challenged 36 h later with 50 ID(50) of homologous FMDV were protected. We also measured the antiviral activity of p3D-NT56/S. cho in swine. The results indicate that 100% of the animals treated with 5 x 10(9) CFU of p3D-NT56/S. cho were protected in 9 days. INRA, EDP Sciences, 2010.

Attenuated Salmonella choleraesuis-mediated RNAi targeted to conserved regions against foot-and-mouth disease virus in guinea pigs and swine

PubMed Central

Cong, Wei; Jin, Hong; Jiang, Chengda; Yan, Weiyao; Liu, Mingqiu; Chen, Jiulian; Zuo, Xiaoping; Zheng, Zhaoxin

2010-01-01

In this study, specific sequences within three genes (3D, VP4 and 2B) of the foot-and-mouth disease virus (FMDV) genome were determined to be effective RNAi targets. These sequences are highly conserved among different serotype viruses based on sequence analysis. Small interfering RNA (siRNA)-expressing plasmids (p3D-NT19, p3D-NT56, pVP4-NT19, pVP4-NT65 and p2B-NT25) were constructed to express siRNA targeting 3D, VP4 and 2B, respectively. The antiviral potential of these siRNA for various FMDV isolates was investigated in baby hamster kidney (BHK-21) cells and suckling mice. The results show that these siRNA inhibited virus yield 10- to 300-fold for different FMDV isolates of serotype O and serotype Asia I at 48 h post infection in BHK-21 cells compared to control cells. In suckling mice, p3D-NT56 and p2B-NT25 delayed the death of mice. Twenty percent to 40% of the animals that received a single siRNA dose survived 5 days post infection with serotype O or serotype Asia I. We used an attenuated Salmonella choleraesuis (C500) vaccine strain, to carry the plasmid that expresses siRNA directed against the polymerase gene 3D (p3D-NT56) of FMDV. We used guinea pigs to evaluate the inhibitory effects of recombinant S. cho (p3D-NT56/S. cho) on FMDV infection. The results show that 80% of guinea pigs inoculated with 109 CFU of p3D-NT56/S. cho and challenged 36 h later with 50 ID50 of homologous FMDV were protected. We also measured the antiviral activity of p3D-NT56/S. cho in swine. The results indicate that 100% of the animals treated with 5 × 109 CFU of p3D-NT56/S. cho were protected in 9 days. PMID:20167192

Analysis of base and codon usage by rubella virus.

PubMed

Zhou, Yumei; Chen, Xianfeng; Ushijima, Hiroshi; Frey, Teryl K

2012-05-01

Rubella virus (RUBV), a small, plus-strand RNA virus that is an important human pathogen, has the unique feature that the GC content of its genome (70%) is the highest (by 20%) among RNA viruses. To determine the effect of this GC content on genomic evolution, base and codon usage were analyzed across viruses from eight diverse genotypes of RUBV. Despite differences in frequency of codon use, the favored codons in the RUBV genome matched those in the human genome for 18 of the 20 amino acids, indicating adaptation to the host. Although usage patterns were conserved in corresponding genes in the diverse genotypes, within-genome comparison revealed that both base and codon usages varied regionally, particularly in the hypervariable region (HVR) of the P150 replicase gene. While directional mutation pressure was predominant in determining base and codon usage within most of the genome (with the strongest tendency being towards C's at third codon positions), natural selection was predominant in the HVR region. The GC content of this region was the highest in the genome (>80%), and it was not clear if selection at the nucleotide level accompanied selection at the amino acid level. Dinucleotide frequency analysis of the RUBV genome revealed that TpA usage was lower than expected, similar to mammalian genes; however, CpG usage was not suppressed, and TpG usage was not enhanced, as is the case in mammalian genes.

Species specific inhibition of viral replication using dicer substrate siRNAs (DsiRNAs) targeting the viral nucleoprotein of the fish pathogenic rhabdovirus viral hemorrhagic septicemia virus (VHSV).

PubMed

Bohle, Harry; Lorenzen, Niels; Schyth, Brian Dall

2011-06-01

Gene knock down by the use of small interfering RNAs (siRNAs) is widely used as a method for reducing the expression of specific genes in eukaryotic cells via the RNA interference pathway. But, the effectivity of siRNA induced gene knock down in cells from fish has in several studies been questioned and the specificity seems to be a general problem in cells originating from both lower and higher vertebrates. Here we show that we are able to reduce the level of viral gene expression and replication specifically in fish cells in vitro. We do so by using 27/25-mer DsiRNAs acting as substrates for dicer for the generation of siRNAs targeting the nucleoprotein N gene of viral hemorrhagic septicemia virus (VHSV). This rhabdovirus infects salmonid fish and is responsible for large yearly losses in aquaculture production. Specificity of the DsiRNA is assured in two ways: first, by using the conventional method of testing a control DsiRNA which should not target the gene of interest. Second, by assuring that replication of a heterologous virus of the same genus as the target virus was not inhibited by the DsiRNA. Target controls are, as we have previously highlighted, essential for verification of the specificity of siRNA-induced interference with virus multiplication, but they are still not in general use. Copyright © 2011 Elsevier B.V. All rights reserved.

Modified Vaccinia Virus Ankara Preferentially Targets Antigen Presenting Cells In Vitro, Ex Vivo and In Vivo.

PubMed

Altenburg, Arwen F; van de Sandt, Carolien E; Li, Bobby W S; MacLoughlin, Ronan J; Fouchier, Ron A M; van Amerongen, Geert; Volz, Asisa; Hendriks, Rudi W; de Swart, Rik L; Sutter, Gerd; Rimmelzwaan, Guus F; de Vries, Rory D

2017-08-17

Modified Vaccinia virus Ankara (MVA) is a promising vaccine vector with an excellent safety profile. However, despite extensive pre-clinical and clinical testing, surprisingly little is known about the cellular tropism of MVA, especially in relevant animal species. Here, we performed in vitro, ex vivo and in vivo experiments with recombinant MVA expressing green fluorescent protein (rMVA-GFP). In both human peripheral blood mononuclear cells and mouse lung explants, rMVA-GFP predominantly infected antigen presenting cells. Subsequent in vivo experiments performed in mice, ferrets and non-human primates indicated that preferential targeting of dendritic cells and alveolar macrophages was observed after respiratory administration, although subtle differences were observed between the respective animal species. Following intramuscular injection, rMVA-GFP was detected in interdigitating cells between myocytes, but also in myocytes themselves. These data are important in advancing our understanding of the basis for the immunogenicity of MVA-based vaccines and aid rational vaccine design and delivery strategies.

Peri-exposure protection against Nipah virus disease using a single-dose recombinant vesicular stomatitis virus-based vaccine

PubMed Central

DeBuysscher, Blair L; Scott, Dana; Thomas, Tina; Feldmann, Heinz; Prescott, Joseph

2016-01-01

Nipah virus is a zoonotic paramyxovirus that causes severe disease in humans and animals. Due to almost yearly outbreaks in Bangladesh, and a large outbreak in Malaysia that lead to the shutdown of swine export, Nipah virus is both a threat to public health and the economy. Infection is associated with respiratory distress, encephalitis and human-to-human transmission, resulting in high case fatality rates during outbreaks. This study aims to address the amount of time needed until protection from a recombinant vesicular stomatitis virus-based vaccine candidate expressing the Nipah virus glycoprotein (G), which we have previously shown to protect hamsters and non-human primates when administered 28 days before challenge. We found that a single-dose vaccination, when administered 1 day before challenge, reduced viral load, limited pathology and fully protected hamsters from Nipah virus infection. The vaccine was even partially protective when administered at early time points following challenge with Nipah virus. These data indicate that a single administration of this vaccine to high-risk individuals, such as family members and health-care workers of infected patients, could be protective and useful for reducing human-to-human transmission and curbing an outbreak. PMID:28706736

Peri-exposure protection against Nipah virus disease using a single-dose recombinant vesicular stomatitis virus-based vaccine.

PubMed

DeBuysscher, Blair L; Scott, Dana; Thomas, Tina; Feldmann, Heinz; Prescott, Joseph

2016-01-01

Nipah virus is a zoonotic paramyxovirus that causes severe disease in humans and animals. Due to almost yearly outbreaks in Bangladesh, and a large outbreak in Malaysia that lead to the shutdown of swine export, Nipah virus is both a threat to public health and the economy. Infection is associated with respiratory distress, encephalitis and human-to-human transmission, resulting in high case fatality rates during outbreaks. This study aims to address the amount of time needed until protection from a recombinant vesicular stomatitis virus-based vaccine candidate expressing the Nipah virus glycoprotein (G), which we have previously shown to protect hamsters and non-human primates when administered 28 days before challenge. We found that a single-dose vaccination, when administered 1 day before challenge, reduced viral load, limited pathology and fully protected hamsters from Nipah virus infection. The vaccine was even partially protective when administered at early time points following challenge with Nipah virus. These data indicate that a single administration of this vaccine to high-risk individuals, such as family members and health-care workers of infected patients, could be protective and useful for reducing human-to-human transmission and curbing an outbreak.

MEK/ERK activation plays a decisive role in yellow fever virus replication: implication as an antiviral therapeutic target.

PubMed

Albarnaz, Jonas D; De Oliveira, Leonardo C; Torres, Alice A; Palhares, Rafael M; Casteluber, Marisa C; Rodrigues, Claudiney M; Cardozo, Pablo L; De Souza, Aryádina M R; Pacca, Carolina C; Ferreira, Paulo C P; Kroon, Erna G; Nogueira, Maurício L; Bonjardim, Cláudio A

2014-11-01

Exploiting the inhibition of host signaling pathways aiming for discovery of potential antiflaviviral compounds is clearly a beneficial strategy for the control of life-threatening diseases caused by flaviviruses. Here we describe the antiviral activity of the MEK1/2 inhibitor U0126 against Yellow fever virus 17D vaccine strain (YFV-17D). Infection of VERO cells with YFV-17D stimulates ERK1/2 phosphorylation early during infection. Pharmacological inhibition of MEK1/2 through U0126 treatment of VERO cells blockades not only the YFV-stimulated ERK1/2 phosphorylation, but also inhibits YFV replication by ∼99%. U0126 was also effective against dengue virus (DENV-2 and -3) and Saint-Louis encephalitis virus (SLEV). Levels of NS4AB, as detected by immunofluorescence, are diminished upon treatment with the inhibitor, as well as the characteristic endoplasmic reticulum membrane invagination stimulated during the infection. Though not protective, treatment of YFV-infected, adult BALB/c mice with U0126 resulted in significant reduction of virus titers in brains. Collectively, our data suggest the potential targeting of the MEK1/2 kinase as a therapeutic tool against diseases caused by flaviviruses such as yellow fever, adverse events associated with yellow fever vaccination and dengue. Copyright © 2014 Elsevier B.V. All rights reserved.

Potent peptidic fusion inhibitors of influenza virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kadam, Rameshwar U.; Juraszek, Jarek; Brandenburg, Boerries

Influenza therapeutics with new targets and mechanisms of action are urgently needed to combat potential pandemics, emerging viruses, and constantly mutating strains in circulation. We report here on the design and structural characterization of potent peptidic inhibitors of influenza hemagglutinin. The peptide design was based on complementarity-determining region loops of human broadly neutralizing antibodies against the hemagglutinin (FI6v3 and CR9114). The optimized peptides exhibit nanomolar affinity and neutralization against influenza A group 1 viruses, including the 2009 H1N1 pandemic and avian H5N1 strains. The peptide inhibitors bind to the highly conserved stem epitope and block the low pH–induced conformational rearrangementsmore » associated with membrane fusion. These peptidic compounds and their advantageous biological properties should accelerate the development of new small molecule– and peptide-based therapeutics against influenza virus.« less

Real-time PCR to identify variola virus or other human pathogenic orthopox viruses.

PubMed

Scaramozzino, Natale; Ferrier-Rembert, Audrey; Favier, Anne-Laure; Rothlisberger, Corinne; Richard, Stéphane; Crance, Jean-Marc; Meyer, Hermann; Garin, Daniel

2007-04-01

Variola virus (family Poxviridae, genus Orthopoxvirus) and the closely related cowpox, vaccinia, and monkeypox viruses can infect humans. Efforts are mounting to replenish the smallpox vaccine stocks, optimize diagnostic methods for poxviruses, and develop new antivirals against smallpox, because it is feared that variola virus might be used as a weapon of bioterrorism. We developed an assay for the detection of variola virus DNA. The assay is based on TaqMan chemistry targeting the 14-kD protein gene. For the 1st stage of the assay we used genus consensus primers and a mixture of 2 probes (14-kD POX and 14-kD VAR) spanning the 14-kD protein-encoding gene for detection of all human pathogenic orthopoxviruses. We then tested positive samples with the specific orthopoxvirus-specific probe 14-kD POX to identify monkeypox, cowpox, and vaccinia viruses and with the 14-kD VAR probe to identify variola viruses. The assay was established on 4 different PCR cycler platforms. It was assessed in a study with 85 different orthopoxvirus species and strains that included variola, camelpox, cowpox, monkeypox, and vaccinia viruses at concentrations ranging from 100 ng/L to 1 microg/L. The assay detected as little as 0.05 fg of DNA, corresponding to 25 copies of DNA, and enabled differentiation of variola virus from the other orthopoxviruses. This real-time PCR assay provides a rapid method for the early detection and differentiation of smallpox and other human pathogenic orthopoxvirus infections.

Interaction of Human Enteric Viruses with Microbial Compounds: Implication for Virus Persistence and Disinfection Treatments.

PubMed

Waldman, Prunelle; Meseguer, Alba; Lucas, Françoise; Moulin, Laurent; Wurtzer, Sébastien

2017-12-05

Although the interaction between phages and bacteria has already been well described, it only recently emerged that human viruses also interact with bacteria in the mammalian gut. We studied whether this interaction could occur in tap water and thus confer enteric viruses protection against temperature and the classical disinfection treatments used in drinking water production. We demonstrated that the addition of lipopolysaccharide or peptidoglycan of bacterial origin to enterovirus provides thermal protection through stabilization of the viral capsid. This interaction plays a role when viruses are exposed to disinfection that targets the capsid, but less so when the virus genome is directly targeted. The interaction seems to be serotype-specific, suggesting that the capsid protein sequence could be important. The protection is linked to a direct association between viral particles and bacterial compounds as observed by microscopy. These results show that bacterial compounds present in the environment can affect virus inactivation.

Comprehensive viral enrichment enables sensitive respiratory virus genomic identification and analysis by next generation sequencing.

PubMed

O'Flaherty, Brigid M; Li, Yan; Tao, Ying; Paden, Clinton R; Queen, Krista; Zhang, Jing; Dinwiddie, Darrell L; Gross, Stephen M; Schroth, Gary P; Tong, Suxiang

2018-06-01

Next generation sequencing (NGS) technologies have revolutionized the genomics field and are becoming more commonplace for identification of human infectious diseases. However, due to the low abundance of viral nucleic acids (NAs) in relation to host, viral identification using direct NGS technologies often lacks sufficient sensitivity. Here, we describe an approach based on two complementary enrichment strategies that significantly improves the sensitivity of NGS-based virus identification. To start, we developed two sets of DNA probes to enrich virus NAs associated with respiratory diseases. The first set of probes spans the genomes, allowing for identification of known viruses and full genome sequencing, while the second set targets regions conserved among viral families or genera, providing the ability to detect both known and potentially novel members of those virus groups. Efficiency of enrichment was assessed by NGS testing reference virus and clinical samples with known infection. We show significant improvement in viral identification using enriched NGS compared to unenriched NGS. Without enrichment, we observed an average of 0.3% targeted viral reads per sample. However, after enrichment, 50%-99% of the reads per sample were the targeted viral reads for both the reference isolates and clinical specimens using both probe sets. Importantly, dramatic improvements on genome coverage were also observed following virus-specific probe enrichment. The methods described here provide improved sensitivity for virus identification by NGS, allowing for a more comprehensive analysis of disease etiology. © 2018 O'Flaherty et al.; Published by Cold Spring Harbor Laboratory Press.

Insights from investigating the interactions of adamantane-based drugs with the M2 proton channel from the H1N1 swine virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Jing-Fang; Wei, Dong-Qing, E-mail: dqwei@gordonlifescience.org; Gordon Life Science Institute, 13784 Torrey Del Mar Drive, San Diego, CA 92130

The M2 proton channel is one of indispensable components for the influenza A virus that plays a vital role in its life cycle and hence is an important target for drug design against the virus. In view of this, the three-dimensional structure of the H1N1-M2 channel was developed based on the primary sequence taken from a patient recently infected by the H1N1 (swine flu) virus. With an explicit water-membrane environment, molecular docking studies were performed for amantadine and rimantadine, the two commercial drugs generally used to treat influenza A infection. It was found that their binding affinity to the H1N1-M2more » channel is significantly lower than that to the H5N1-M2 channel, fully consistent with the recent report that the H1N1 swine virus was resistant to the two drugs. The findings and the relevant analysis reported here might provide useful structural insights for developing effective drugs against the new swine flu virus.« less

Insights from investigating the interactions of adamantane-based drugs with the M2 proton channel from the H1N1 swine virus.

PubMed

Wang, Jing-Fang; Wei, Dong-Qing; Chou, Kuo-Chen

2009-10-16

The M2 proton channel is one of indispensable components for the influenza A virus that plays a vital role in its life cycle and hence is an important target for drug design against the virus. In view of this, the three-dimensional structure of the H1N1-M2 channel was developed based on the primary sequence taken from a patient recently infected by the H1N1 (swine flu) virus. With an explicit water-membrane environment, molecular docking studies were performed for amantadine and rimantadine, the two commercial drugs generally used to treat influenza A infection. It was found that their binding affinity to the H1N1-M2 channel is significantly lower than that to the H5N1-M2 channel, fully consistent with the recent report that the H1N1 swine virus was resistant to the two drugs. The findings and the relevant analysis reported here might provide useful structural insights for developing effective drugs against the new swine flu virus.

Nucleoprotein-based indirect enzyme-linked immunosorbent assay (indirect ELISA) for detecting antibodies specific to Ebola virus and Marbug virus.

PubMed

Huang, Yi; Zhu, Youjie; Yang, Mengshi; Zhang, Zhenqing; Song, Donglin; Yuan, Zhiming

2014-12-01

Full-length nucleoproteins from Ebola and Marburg viruses were expressed as His-tagged recombinant proteins in Escherichia coli and nucleoprotein-based enzyme-linked immunosorbent assays (ELISAs) were established for the detection of antibodies specific to Ebola and Marburg viruses. The ELISAs were evaluated by testing antisera collected from rabbit immunized with Ebola and Marburg virus nucleoproteins. Although little cross-reactivity of antibodies was observed in anti-Ebola virus nucleoprotein rabbit antisera, the highest reactions to immunoglobulin G (IgG) were uniformly detected against the nucleoprotein antigens of homologous viruses. We further evaluated the ELISA's ability to detect antibodies to Ebola and Marburg viruses using human sera samples collected from individuals passing through the Guangdong port of entry. With a threshold set at the mean plus three standard deviations of average optical densities of sera tested, the ELISA systems using these two recombinant nucleoproteins have good sensitivity and specificity. These results demonstrate the usefulness of ELISA for diagnostics as well as ecological and serosurvey studies of Ebola and Marburg virus infection.

Identification of agents effective against multiple toxins and viruses by host-oriented cell targeting.

PubMed

Zilbermintz, Leeor; Leonardi, William; Jeong, Sun-Young; Sjodt, Megan; McComb, Ryan; Ho, Chi-Lee C; Retterer, Cary; Gharaibeh, Dima; Zamani, Rouzbeh; Soloveva, Veronica; Bavari, Sina; Levitin, Anastasia; West, Joel; Bradley, Kenneth A; Clubb, Robert T; Cohen, Stanley N; Gupta, Vivek; Martchenko, Mikhail

2015-08-27

A longstanding and still-increasing threat to the effective treatment of infectious diseases is resistance to antimicrobial countermeasures. Potentially, the targeting of host proteins and pathways essential for the detrimental effects of pathogens offers an approach that may discover broad-spectrum anti-pathogen countermeasures and circumvent the effects of pathogen mutations leading to resistance. Here we report implementation of a strategy for discovering broad-spectrum host-oriented therapies against multiple pathogenic agents by multiplex screening of drugs for protection against the detrimental effects of multiple pathogens, identification of host cell pathways inhibited by the drug, and screening for effects of the agent on other pathogens exploiting the same pathway. We show that a clinically used antimalarial drug, Amodiaquine, discovered by this strategy, protects host cells against infection by multiple toxins and viruses by inhibiting host cathepsin B. Our results reveal the practicality of discovering broadly acting anti-pathogen countermeasures that target host proteins exploited by pathogens.

A targeted mutation within the feline leukemia virus (FeLV) envelope protein immunosuppressive domain to improve a canarypox virus-vectored FeLV vaccine.

PubMed

Schlecht-Louf, Géraldine; Mangeney, Marianne; El-Garch, Hanane; Lacombe, Valérie; Poulet, Hervé; Heidmann, Thierry

2014-01-01

We previously delineated a highly conserved immunosuppressive (IS) domain within murine and primate retroviral envelope proteins that is critical for virus propagation in vivo. The envelope-mediated immunosuppression was assessed by the ability of the proteins, when expressed by allogeneic tumor cells normally rejected by engrafted mice, to allow these cells to escape, at least transiently, immune rejection. Using this approach, we identified key residues whose mutation (i) specifically abolishes immunosuppressive activity without affecting the "mechanical" function of the envelope protein and (ii) significantly enhances humoral and cellular immune responses elicited against the virus. The objective of this work was to study the immunosuppressive activity of the envelope protein (p15E) of feline leukemia virus (FeLV) and evaluate the effect of its abolition on the efficacy of a vaccine against FeLV. Here we demonstrate that the FeLV envelope protein is immunosuppressive in vivo and that this immunosuppressive activity can be "switched off" by targeted mutation of a specific amino acid. As a result of the introduction of the mutated envelope sequence into a previously well characterized canarypox virus-vectored vaccine (ALVAC-FeLV), the frequency of vaccine-induced FeLV-specific gamma interferon (IFN-γ)-producing cells was increased, whereas conversely, the frequency of vaccine-induced FeLV-specific interleukin-10 (IL-10)-producing cells was reduced. This shift in the IFN-γ/IL-10 response was associated with a higher efficacy of ALVAC-FeLV against FeLV infection. This study demonstrates that FeLV p15E is immunosuppressive in vivo, that the immunosuppressive domain of p15E can modulate the FeLV-specific immune response, and that the efficacy of FeLV vaccines can be enhanced by inhibiting the immunosuppressive activity of the IS domain through an appropriate mutation.

M13 virus based detection of bacterial infections in living hosts.

PubMed

Bardhan, Neelkanth M; Ghosh, Debadyuti; Belcher, Angela M

2014-08-01

We report a first method for using M13 bacteriophage as a multifunctional scaffold for optically imaging bacterial infections in vivo. We demonstrate that M13 virus conjugated with hundreds of dye molecules (M13-Dye) can target and distinguish pathogenic infections of F-pili expressing and F-negative strains of E. coli. Further, in order to tune this M13-Dye complex suitable for targeting other strains of bacteria, we have used a 1-step reaction for creating an anti-bacterial antibody-M13-Dye probe. As an example, we show anti-S. aureus-M13-Dye able to target and image infections of S. aureus in living hosts, with a 3.7× increase in fluorescence over background. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Target attribute-based false alarm rejection in small infrared target detection

NASA Astrophysics Data System (ADS)

Kim, Sungho

2012-11-01

Infrared search and track is an important research area in military applications. Although there are a lot of works on small infrared target detection methods, we cannot apply them in real field due to high false alarm rate caused by clutters. This paper presents a novel target attribute extraction and machine learning-based target discrimination method. Eight kinds of target features are extracted and analyzed statistically. Learning-based classifiers such as SVM and Adaboost are developed and compared with conventional classifiers for real infrared images. In addition, the generalization capability is also inspected for various infrared clutters.

An Epstein-Barr Virus MicroRNA Blocks Interleukin-1 (IL-1) Signaling by Targeting IL-1 Receptor 1.

PubMed

Skinner, Camille M; Ivanov, Nikita S; Barr, Sarah A; Chen, Yan; Skalsky, Rebecca L

2017-11-01

Epstein-Barr virus (EBV) encodes >44 viral microRNAs (miRNAs) that are differentially expressed throughout infection, can be detected in Epstein-Barr virus (EBV)-positive tumors, and manipulate several biological processes, including cell proliferation, apoptosis, and immune responses. Here, we show that EBV BHRF1-2 miRNAs block NF-κB activation following treatment with proinflammatory cytokines, specifically interleukin-1β (IL-1β). Analysis of EBV PAR-CLIP miRNA targetome data sets combined with pathway analysis revealed multiple BHRF1-2 miRNA targets involved in interleukin signaling pathways. By further analyzing changes in cellular gene expression patterns, we identified the IL-1 receptor 1 (IL1R1) as a direct target of miR-BHRF1-2-5p. Targeting the IL1R1 3' untranslated region (UTR) by EBV miR-BHRF1-2-5p was confirmed using 3'-UTR luciferase reporter assays and Western blot assays. Manipulation of EBV BHRF1-2 miRNA activity in latently infected B cells altered steady-state cytokine levels and disrupted IL-1β responsiveness. These studies demonstrate functionally relevant BHRF1-2 miRNA interactions during EBV infection, which is an important step in understanding their roles in pathogenesis. IMPORTANCE IL-1 signaling plays an important role in inflammation and early activation of host innate immune responses following virus infection. Here, we demonstrate that a viral miRNA downregulates the IL-1 receptor 1 during EBV infection, which consequently alters the responsiveness of cells to IL-1 stimuli and changes the cytokine expression levels within infected cell populations. We postulate that this viral miRNA activity not only disrupts IL-1 autocrine and paracrine signaling loops that can alert effector cells to sites of infection but also provides a survival advantage by dampening excessive inflammation that may be detrimental to the infected cell. Copyright © 2017 American Society for Microbiology.

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special

Artificial Virus as Trump-card to Resolve Exigencies in Targeted Gene Delivery.