Clinical usefulness of metabolic risk factors to identify young asymptomatic women adults with subclinical atherosclerosis: A cross-sectional study.

PubMed

Qin, Guangming; Chen, Zhihao; Su, Weiwei; Geng, Xiaoge; Chen, Xiaojun; Xu, Xiang; Pan, Wensheng

2017-03-01

Interventions of cardiovascular disease should be implemented in early ages. But most studies were performed in middle aged or elderly adults because of the low prevalence in young, especially for women. We investigate the association between metabolic risk factors and subclinical atherosclerosis in young asymptomatic women adults, using carotid intima-media thickness (CIMT) as a marker of the atherosclerotic process.We performed a cross-sectional study of 950 Chinese young asymptomatic women adults (37.28 ± 5.16 years) who underwent a routine health screening examination. Triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), total cholesterol (TC), fasting blood glucose (FBG), homocysteine (HCY), gamma glutamyltransferase (GGT), uric acid, and CIMT were measured.Out of 950 subjects, 16 (1.7%) were detected with increased CIMT. Significant differences existed in the indicators including age, body mass index (BMI), TC, TG, LDL-C, LDL-C/HDL-C, non-HDL-C, and TC/HDL-C. Although TG, LDL-C, non-HDL-C, TC/HDL-C, and TG/HDL-C were the significant indicators when adjusted for age only, age, LDL-C/HDL-C, FBG, and GGT were the only independent relative indicators of increased CMIT that entered the multivariate model. The area under receiver operating characteristic curve for a linear combination of age, LDL-C/HDL-C, FBG, and GGT was 0.809 (95% confidence interval = 0.712-0.906), superior to any of the variables taken alone (age, AUC = 0.707; FBG, AUC = 0.710; LDL-C/HDL-C, AUC = 0.695; GGT, AUC = 0.648).The combined assessment of age, LDL-C/HDL-C, FBG, and GGT contributes to an early detection for subclinical atherosclerosis, providing guidance to clinicians for women's early interventions of latent cardiovascular disease. Neither of the above four individual indicators is qualified alone.

Relationship of the triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio to the remainder of the lipid profile: The Very Large Database of Lipids-4 (VLDL-4) study.

PubMed

Quispe, Renato; Manalac, Raoul J; Faridi, Kamil F; Blaha, Michael J; Toth, Peter P; Kulkarni, Krishnaji R; Nasir, Khurram; Virani, Salim S; Banach, Maciej; Blumenthal, Roger S; Martin, Seth S; Jones, Steven R

2015-09-01

High levels of the triglycerides to high-density lipoprotein cholesterol (TG/HDL-C) ratio are associated with obesity, metabolic syndrome, and insulin resistance. We evaluated variability in the remaining lipid profile, especially remnant lipoprotein particle cholesterol (RLP-C) and its components (very low-density lipoprotein cholesterol subfraction 3 and intermediate-density lipoprotein cholesterol), with variability in the TG/HDL-C ratio in a very large study cohort representative of the general U.S. We examined data from 1,350,908 US individuals who were clinically referred for lipoprotein cholesterol ultracentrifugation (Atherotech, Birmingham, AL) from 2009 to 2011. Demographic information other than age and sex was not available. Changes to the remaining lipid profile across percentiles of the TG/HDL-C ratio were quantified, as well as by three TG/HDL-C cut-off points previously proposed in the literature: 2.5 (male) and 2 (female), 3.75 (male) and 3 (female), and 3.5 (male and female). The mean age of our study population was 58.7 years, and 48% were men. The median TG/HDL-C ratio was 2.2. Across increasing TG/HDL-C ratios, we found steadily increasing levels of RLP-C, non-HDL-C and LDL density. Among the lipid parameters studied, RLP-C and LDL density had the highest relative increase when comparing individuals with elevated TG/HDL-C levels to those with lower TG/HDL-C levels using established cut-off points. Approximately 47% of TG/HDL-C ratio variance was attributable to RLP-C. In the present analysis, a higher TG/HDL-C ratio was associated with an increasingly atherogenic lipid phenotype, characterized by higher RLP-C along with higher non-HDL-C and LDL density. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

[Effect of blood lipid on the change of brachial-ankle pulse wave velocity among prehypertensive population].

PubMed

Wang, Lin; Shuai, Ping; Liu, Yuping; Cheng, Youfu; Yang, Hua; Li, Tingxin; Gong, Lirong; Ren, Jiaojiao; Wang, Hongjia

2014-09-01

To explore the effect of blood lipid and lipoprotein ratios on the change of brachial-ankle pulse wave velocity (baPWV) among prehypertensive subjects. 11 611 subjects with normal blood pressure (BP) were divided into two groups, which was one with optimal blood pressure (BP<120/80 mmHg) and the other with prehypertension (BP:120-139/80-89 mmHg). Height, weight, baPWV, fasting blood-glucose, TC, TG, LDL-C and HDL-C were detected. The abnormal rate of baPWV in prehypertension group was obviously higher than that in the optimal blood pressure group. For optimal blood pressure group, the abnormality of TG, TC, LDL-C, TC/HDL-C as well as LDL-C/HDL-C, caused the increase of baPWV significantly (P < 0.001). For prehypertensive group, the abnormality of TC and LDL-C caused the significant increase of baPWV (P < 0.001). Results from logistic regression analysis showed that except for age, BMI and fasting blood-glucose, TC/HDL-C increasing was the independent risk factor in optimal blood pressure group, while TG increasing was for the prehypertension group. With different normal BP level, both abnormality of blood lipid and lipoprotein ratio were the independent risk factors for baPWV increasing.

Assessment of the relationship between lipid parameters and obesity indices in non-diabetic obese patients: a preliminary report.

PubMed

Stępień, Anna; Stępień, Mariusz; Wlazeł, Rafał N; Paradowski, Marek; Banach, Maciej; Rysz, Jacek

2014-12-16

The aim of this cross-sectional study was to examine the relationship between obesity and lipid markers. We divided 66 non-diabetic adult obese patients (mean age: 55.8±11.6 years) into 3 groups according to body mass index (BMI). All patients were measured for waist circumference (WC), hip circumference (HC), body mass index (BMI), waist-to-hip ratio (WHR), waist-to-height ratio (WHtR), body adiposity index (BAI), and visceral adiposity index (VAI). Serum levels of total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG) were determined, and lipid indices TC/HDL, LDL/HDL, and TG/HDL were also estimated. TC and LDL-C in Group III were lower than in Group I (5.0±1.0 vs. 6.0±1.0 mmol/L, and 2.9±0.9 vs. 3.8±1.2 mmol/L; p<0.05 for both). Negative correlations were found between: BMI and TC, LDL, and HDL (r=-0.291; r=-0.310, r=-0.240, respectively); and WC, WHR, VAI, and HDL (r=-0.371, r=-0.296, r=-0.376, respectively). Positive correlations were found between WC, WHR, and TG/HDL (r=0.279, r=0.244, respectively) and between VAI and: TC (r=0.327), TG (r=0.885), TC/HDL (r=0.618), LDL/HDL (r=0.480), and TG/HDL (r=0.927). Obesity is associated with lipid disturbances, especially with HDL-C reduction, in obese non-diabetic patients. VAI is strongly related to lipid profile and thus may be the most valuable obesity index in obese patients with dyslipidemias.

Effects of the C161T polymorphism in the gene of peroxisome proliferators activated receptor γ on changes of plasma lipid and apolipoprotein ratios induced by a high carbohydrate diet in a healthy Chinese Han young population.

PubMed

Fan, Mei; Gong, Ren Rong; Lin, Jia; Jiang, Zhe; Li, Yuan Hao; Zhang, Rong Rong; Fang, Ding Zhi

2014-01-01

Changes in the ratios of plasma lipids and apolipoproteins may be associated with diets and the C161T polymorphism in the gene of peroxisome proliferators activated receptor gamma (PPARgamma). As a result, this study was to investigate the effects of this polymorphism on changes of the ratios induced by a high-carbohydrate (high-CHO) diet. After a washout diet of 54% carbohydrate for 7 days, 56 healthy young adults (22.89 +/- 1.80 years old) were given the high-CHO diet of 70% carbohydrate for 6 days. Height, weight, waist circumference (WC), glucose, triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), apolipoprotein (apo) AI, and apoB100 at baseline and before and after the high-CHO diet were measured. Body mass index (BMI), TG/HDL-C, log (TG/HDL-C), TC/HDL-C, LDL-C/HDL-C, and apoB100/apoAI were calculated. PPARgamma C161T was detected by a PCR-RFLP method. The relationship between the polymorphism and the ratios were analyzed. The female T carriers had higher BMI and WC than the female CC homozygotes at baseline and before and after the diet, higher glucose, TG/HDL-C and log (TG/HDL-C) before the diet. In males, when compared to the T carriers, the CC homozygotes had higher TG/HDL-C, log (TG/HDL-C) and apoB100/apoAI at baseline and before and after the diet, higher glucose at baseline, higher LDL-C/HDL-C and TC/HDL-C before and after the diet. Compared with those before the high-CHO diet, TC/HDL-C and LDL-C/HDL-C decreased after the diet regardless of gender and the genotypes. Decreased BMI and WC were observed in the male CC homozygotes but only decreased BMI in the female T carriers. Notably, decreased apoB100/apoAI was observed in the male T carriers, while elevated TG/HDL-C and log (TG/HDL-C) in the female CC homozygotes, and reduced glucose in the female T carriers. The results suggest that the interplay of gender, the PPARgamma C161T polymorphism and the high-CHO diet can

Hypolipidemic Effect of Tomato Juice in Hamsters in High Cholesterol Diet-Induced Hyperlipidemia

PubMed Central

Lee, Li-Chen; Wei, Li; Huang, Wen-Ching; Hsu, Yi-Ju; Chen, Yi-Ming; Huang, Chi-Chang

2015-01-01

Tomato is a globally famous food and contains several phytonutrients including lycopene, β-carotene, anthocyanin, and flavonoids. The increased temperature used to produce tomato juice, ketchup, tomato paste and canned tomato enhances the bioactive composition. We aimed to verify the beneficial effects of processed tomato juice from Kagome Ltd. (KOT) on hypolipidemic action in hamsters with hyperlipidemia induced by a 0.2% cholesterol and 10% lard diet (i.e., high-cholesterol diet (HCD)). Male Golden Syrian hamsters were randomly divided into two groups for treatment: normal (n = 8), standard diet (control); and experimental (n = 32), HCD. The 32 hamsters were further divided into four groups (n = 8 per group) to receive vehicle or KOT by oral gavage at 2787, 5573, or 13,934 mg/kg/day for six weeks, designated the HCD-1X, -2X and -5X groups, respectively. The efficacy and safety of KOT supplementation was evaluated by lipid profiles of serum, liver and feces and by clinical biochemistry and histopathology. HCD significantly increased serum levels of total cholesterol (TC), triacylglycerol (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C), LDL-C/HDL-C ratio, hepatic and fetal TC and TG levels, and degree of fatty liver as compared with controls. KOT supplementation dose-dependently decreased serum TC, TG, LDL-C levels, LDL-C/HDL-C ratio, hepatic TC and TG levels, and fecal TG level. Our study provides experiment-based evidence to support that KOT may be useful in treating or preventing the onset of hyperlipidemia. PMID:26694461

Hypolipidemic Effect of Tomato Juice in Hamsters in High Cholesterol Diet-Induced Hyperlipidemia.

PubMed

Lee, Li-Chen; Wei, Li; Huang, Wen-Ching; Hsu, Yi-Ju; Chen, Yi-Ming; Huang, Chi-Chang

2015-12-17

Tomato is a globally famous food and contains several phytonutrients including lycopene, β-carotene, anthocyanin, and flavonoids. The increased temperature used to produce tomato juice, ketchup, tomato paste and canned tomato enhances the bioactive composition. We aimed to verify the beneficial effects of processed tomato juice from Kagome Ltd. (KOT) on hypolipidemic action in hamsters with hyperlipidemia induced by a 0.2% cholesterol and 10% lard diet (i.e., high-cholesterol diet (HCD)). Male Golden Syrian hamsters were randomly divided into two groups for treatment: normal (n = 8), standard diet (control); and experimental (n = 32), HCD. The 32 hamsters were further divided into four groups (n = 8 per group) to receive vehicle or KOT by oral gavage at 2787, 5573, or 13,934 mg/kg/day for six weeks, designated the HCD-1X, -2X and -5X groups, respectively. The efficacy and safety of KOT supplementation was evaluated by lipid profiles of serum, liver and feces and by clinical biochemistry and histopathology. HCD significantly increased serum levels of total cholesterol (TC), triacylglycerol (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C), LDL-C/HDL-C ratio, hepatic and fetal TC and TG levels, and degree of fatty liver as compared with controls. KOT supplementation dose-dependently decreased serum TC, TG, LDL-C levels, LDL-C/HDL-C ratio, hepatic TC and TG levels, and fecal TG level. Our study provides experiment-based evidence to support that KOT may be useful in treating or preventing the onset of hyperlipidemia.

Relevance of the triglyceride-to-high-density lipoprotein cholesterol ratio as an important lipid fraction in apparently healthy, young, and middle-aged Indian men

PubMed Central

Kohli, Aparna; Siddhu, Anupa; Pandey, Ravindra M.; Reddy, K. Srinath

2017-01-01

Context: Cardiovascular disease (CVD) is the largest cause of mortality in Indians. Insulin resistance and related dyslipidemia of increased triglyceride (TG), small dense low-density lipoprotein (sd-LDL) particles, and decreased high-density lipoprotein-cholesterol (HDL-C) are associated with increased risk of CVD. TG/HDL-C ratio could be a potential surrogate marker for this South Asian phenotype. Data are scarce on the relevance of TG/HDL-C ratio as a useful lipid marker among Indians. Aims: To study the prevalence of TG/HDL-C ratio among healthy, young, and middle-aged Indian men (25–44 years) and its relationship with other lipid and nonlipid factors. Subjects and Methods: In this cross-sectional analysis, fasting blood samples from 236 healthy participants recruited from an urban community setting were tested for TG/HDL-C ratio, HDL-C, TG, total cholesterol (TC), non-HDL-C, TC/HDL-C, high-sensitivity C-reactive protein, body mass index (BMI), and body fat. Results: Mean (standard deviation) age of participants was 34.7 (7.7) years; median (interquartile range) TG/HDL-C ratio was 4 (2.85-5.2). More than half (51.3%) the participants (n = 121) recorded abnormal TG/HDL-C ratio (≥4.0). Across tertiles of TG/HDL-C ratio, there was a significant trend of higher conventional lipid parameters such as non-HDL-C*, TC/HDL-C ratio*, TG*, HDL-C*, TC**; and non-lipid parameters body-fat* and BMI*** (*P < 0.001, **P = 0.015, ***P = 0.002). LDL-C showed moderate and nonsignificant (P = 0.646) increase across tertiles. Conclusion: In a sample of apparently healthy, young, and middle-aged Indian men abnormal TG/HDL-C ratio levels were observed among more than half the participants. The TG/HDL-C ratio was closely associated with other lipid parameters and measures of adiposity, such as BMI and body fat, apart from its previously documented unique association with sd-LDL particles. TG/HDL-C ratio should be evaluated in future for risk prediction of incident CVD among Indians

Relevance of the triglyceride-to-high-density lipoprotein cholesterol ratio as an important lipid fraction in apparently healthy, young, and middle-aged Indian men.

PubMed

Kohli, Aparna; Siddhu, Anupa; Pandey, Ravindra M; Reddy, K Srinath

2017-01-01

Cardiovascular disease (CVD) is the largest cause of mortality in Indians. Insulin resistance and related dyslipidemia of increased triglyceride (TG), small dense low-density lipoprotein (sd-LDL) particles, and decreased high-density lipoprotein-cholesterol (HDL-C) are associated with increased risk of CVD. TG/HDL-C ratio could be a potential surrogate marker for this South Asian phenotype. Data are scarce on the relevance of TG/HDL-C ratio as a useful lipid marker among Indians. To study the prevalence of TG/HDL-C ratio among healthy, young, and middle-aged Indian men (25-44 years) and its relationship with other lipid and nonlipid factors. In this cross-sectional analysis, fasting blood samples from 236 healthy participants recruited from an urban community setting were tested for TG/HDL-C ratio, HDL-C, TG, total cholesterol (TC), non-HDL-C, TC/HDL-C, high-sensitivity C-reactive protein, body mass index (BMI), and body fat. Mean (standard deviation) age of participants was 34.7 (7.7) years; median (interquartile range) TG/HDL-C ratio was 4 (2.85-5.2). More than half (51.3%) the participants ( n = 121) recorded abnormal TG/HDL-C ratio (≥4.0). Across tertiles of TG/HDL-C ratio, there was a significant trend of higher conventional lipid parameters such as non-HDL-C*, TC/HDL-C ratio*, TG*, HDL-C*, TC**; and non-lipid parameters body-fat* and BMI*** (* P < 0.001, ** P = 0.015, *** P = 0.002). LDL-C showed moderate and nonsignificant ( P = 0.646) increase across tertiles. In a sample of apparently healthy, young, and middle-aged Indian men abnormal TG/HDL-C ratio levels were observed among more than half the participants. The TG/HDL-C ratio was closely associated with other lipid parameters and measures of adiposity, such as BMI and body fat, apart from its previously documented unique association with sd-LDL particles. TG/HDL-C ratio should be evaluated in future for risk prediction of incident CVD among Indians.

Association of methylenetetrahydrofolate reductase C677T polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

PubMed Central

2010-01-01

Background The association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and serum lipid profiles is still controversial in diverse ethnics. Bai Ku Yao is an isolated subgroup of the Yao minority in China. The aim of the present study was to eveluate the association of MTHFR C677T polymorphism and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 780 subjects of Bai Ku Yao and 686 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Genotyping of the MTHFR C677T was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.05-0.001). The frequency of C and T alleles was 77.4% and 22.6% in Bai Ku Yao, and 60.9% and 39.1% in Han (P < 0.001); respectively. The frequency of CC, CT and TT genotypes was 58.7%, 37.3% and 4.0% in Bai Ku Yao, and 32.6%, 56.4% and 11.0% in Han (P < 0.001); respectively. The levels of TC and LDL-C in both ethnic groups were significant differences among the three genotypes (P < 0.05-0.01). The T allele carriers had higher serum TC and LDL-C levels than the T allele noncarriers. The levels of ApoB in Han were significant differences among the three genotypes (P < 0.05). The T allele carriers had higher serum ApoB levels as compared with the T allele noncarriers. The levels of TC, TG and LDL-C in Bai Ku Yao were correlated with genotypes (P < 0.05-0.001), whereas the levels of LDL-C in Han were associated with genotypes (P < 0.001). Serum lipid parameters were also correlated with sex, age, body mass index, alcohol consumption, cigarette smoking, and blood pressure in the both ethnic

Effects of Apple Consumption on Lipid Profile of Hyperlipidemic and Overweight Men

PubMed Central

Vafa, Mohammad Reza; Haghighatjoo, Elham; Shidfar, Farzad; Afshari, Shirin; Gohari, Mahmood Reza; Ziaee, Amir

2011-01-01

Objectives: Fruits and vegetables may be beneficial on lipid profile of hyperlipidemic subjects. The present study was aimed to verify the effect of golden delicious apple on Lipid Profile in hyperlipidemic and overweight men. Methods: Forty six hyperlipidemic and overweight men were randomly divided into two groups. Intervention group received 300g golden delicious apple per day for 8 weeks. Control group had the regular dietary regimen for the same period of time. Blood samples were analyzed for serum triglycerides (TG), total cholesterol (TC), low density lipoprotein-cholesterol (LDL-C), high density lipoprotein-cholesterol (HDL-C), very low density lipoprotein-cholesterol (VLDL), apolipoprotein B (Apo B), lipoprotein a (Lp a) and LDL/HDL ratio at baseline and after intervention. Results: Total polyphenols and fibers were 485 mg/kg and 4.03 g/100g in fresh apple respectively. After 8 weeks, significant statistical differences were observed considering the TG and VLDL levels between two groups, but no significant differences were observed regarding TC, LDL-C, HDL-C, Apo (B), Lp (a) and LDL/HDL ratio. Conclusions: Consumption of Golden delicious apple may be increased serum TG and VLDL in hyperlipidemic and overweight men. We need more studies to assay the effect of apple consumption on serum TC, LDL-C, HDL-C, Apo (B), Lp (a) and LDL/HDL ratio. PMID:21603015

Association Between Baseline LDL-C Level and Total and Cardiovascular Mortality After LDL-C Lowering: A Systematic Review and Meta-analysis.

PubMed

Navarese, Eliano P; Robinson, Jennifer G; Kowalewski, Mariusz; Kolodziejczak, Michalina; Andreotti, Felicita; Bliden, Kevin; Tantry, Udaya; Kubica, Jacek; Raggi, Paolo; Gurbel, Paul A

2018-04-17

Effects on specific fatal and nonfatal end points appear to vary for low-density lipoprotein cholesterol (LDL-C)-lowering drug trials. To evaluate whether baseline LDL-C level is associated with total and cardiovascular mortality risk reductions. Electronic databases (Cochrane, MEDLINE, EMBASE, TCTMD, ClinicalTrials.gov, major congress proceedings) were searched through February 2, 2018, to identify randomized clinical trials of statins, ezetimibe, and PCSK9-inhibiting monoclonal antibodies. Two investigators abstracted data and appraised risks of bias. Intervention groups were categorized as "more intensive" (more potent pharmacologic intervention) or "less intensive" (less potent, placebo, or control group). The coprimary end points were total mortality and cardiovascular mortality. Random-effects meta-regression and meta-analyses evaluated associations between baseline LDL-C level and reductions in mortality end points and secondary end points including major adverse cardiac events (MACE). In 34 trials, 136 299 patients received more intensive and 133 989 received less intensive LDL-C lowering. All-cause mortality was lower for more vs less intensive therapy (7.08% vs 7.70%; rate ratio [RR], 0.92 [95% CI, 0.88 to 0.96]), but varied by baseline LDL-C level. Meta-regression showed more intensive LDL-C lowering was associated with greater reductions in all-cause mortality with higher baseline LDL-C levels (change in RRs per 40-mg/dL increase in baseline LDL-C, 0.91 [95% CI, 0.86 to 0.96]; P = .001; absolute risk difference [ARD], -1.05 incident cases per 1000 person-years [95% CI, -1.59 to -0.51]), but only when baseline LDL-C levels were 100 mg/dL or greater (P < .001 for interaction) in a meta-analysis. Cardiovascular mortality was lower for more vs less intensive therapy (3.48% vs 4.07%; RR, 0.84 [95% CI, 0.79 to 0.89]) but varied by baseline LDL-C level. Meta-regression showed more intensive LDL-C lowering was associated with a greater reduction in

Impact of the consumption of a rich diet in butter and it replacement for a rich diet in extra virgin olive oil on anthropometric, metabolic and lipid profile in postmenopausal women.

PubMed

Anderson-Vasquez, Hazel Ester; Pérez-Martínez, Pablo; Ortega Fernández, Pablo; Wanden-Berghe, Carmina

2015-06-01

To analyze the impact of the substitution of a rich diet in saturated fats with a rich diet in monounsaturated fats on anthropometric, metabolic and lipid profile in postmenopausal women. A prospective, longitudinal and comparative study where 18 postmenopausal women participated in two periods of dietary intervention of 28 days each one: 1) (SAT diet) consumed butter. Caloric formula (CF) = 15% protein, 38% fat. [20% saturated fat (SFA), 12% monounsaturated fat (MUFA) and 47% carbohydrates and 6% polyunsaturated (PUFA)]. b) Period MONO: with extra virgin olive oil (EVOO). CF = 15% protein, 38% fat (<10% SFA, 22% PUFA and 6% MUFA) and 47% carbohydrates. Size and body composition, glucose, insulin, HOMA, TC, HDL-C, LDL-C, VLDL-C, TG, TC/HDL-C, LDL-C/HDL-C, TG/HDL-C and non-HDL-C/HDL.C were measured; dietary Anamnesis/24 hours, daily food record. ANOVA and Bonferroni statistical analysis (SPSS 20) was applied. The age was 56 ± 5 years, BMI 29.8 ± 3.1 kg/m2, waist circumference: 93.2 ± 10.1 cm, waist/hip ratio: 0.86 ± 0.14, waist/height: 0.59 ± 0.06 and 38.6 ± 4% body fat (NS). Lipid profile: SAT diet increased TC (p <0.001), LDL-C (p <0.002) and non HDL-Cholesterol (p <0.000), HDL-C increased in MONO diet (p <0.000). SAT diet: TC/HDL-c ratio, Non col HDL-c/HDL-c, LDL-c/HDL-c (p <0.000) and TG/HDL-c (p <0.000). In MONO diet decreased TC/HDL-c (p <0.015) and TG/HDL-c (p <0.016). The SAT diet increased cardiovascular risk, while the MONO diet decreased the risk to develop the metabolic syndrome components and choronary heart disease. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

A promoter variant of the APOA5 gene increases atherogenic LDL levels and arterial stiffness in hypertriglyceridemic patients.

PubMed

Kim, Minjoo; Kim, Minkyung; Yoo, Hye Jin; Lee, Eunji; Chae, Jey Sook; Lee, Sang-Hyun; Lee, Jong Ho

2017-01-01

Hypertriglyceridemia is recognized as an independent risk factor for coronary artery disease. The apolipoprotein A5 gene (APOA5) is a key regulator of triglyceride levels. We aimed to evaluate the associations of single nucleotide polymorphisms (SNPs) in APOA5, including -1131T>C and c.553G>T, with hypertriglyceridemia, apoA5 concentrations, atherogenic LDL cholesterol levels, and arterial stiffness in hypertriglyceridemic patients. The study population included 599 hypertriglyceridemic patients (case) and 1,549 untreated normotriglyceridemic subjects (control). We genotyped two APOA5 variants, -1131T>C (rs662799) and c.553G>T (rs2075291). The frequencies of the CC genotype of -1131T>C (0.165) and the T allele of c.553G>T (0.119) were significantly higher in hypertriglyceridemic patients than in normotriglyceridemic subjects (0.061 and 0.070, respectively; all p<0.001). In the control and case groups, both the -1131T>C and c.553G>T variants were associated with higher triglyceride and lower HDL cholesterol levels. Controls with the -1131CC variant had lower apoA5 concentrations than controls with the -1131TT variant. Similar effects of the -1131T>C variant on apoA5 were observed in the cases. In the hypertriglyceridemic group, the -1131T>C variant was associated with a smaller LDL particle size, higher levels of oxidized LDL and malondialdehyde, and higher brachial-ankle pulse wave velocity. The -1131T>C and c.553G>T polymorphisms were associated with hypertriglyceridemia in the study population, but only the -1131T>C polymorphism directly affected apoA5 concentrations. Hypertriglyceridemic patients carrying the APOA5 -1131T>C polymorphism exhibited increased atherogenic LDL levels and arterial stiffness, probably due to an effect of the -1131T>C polymorphism on apoA5 concentrations.

Elevated Levels of LDL-C are Associated With ApoE4 but Not With the rs688 Polymorphism in the LDLR Gene.

PubMed

Cahua-Pablo, Gabriel; Cruz, Miguel; Moral-Hernández, Oscar Del; Leyva-Vázquez, Marco A; Antúnez-Ortiz, Diana L; Cahua-Pablo, José A; Alarcón-Romero, Luz Del Carmen; Ortuño-Pineda, Carlos; Moreno-Godínez, Ma Elena; Hernández-Sotelo, Daniel; Flores-Alfaro, Eugenia

2016-07-01

Apolipoprotein E (ApoE) 4 isoform has been associated with elevated levels of cholesterol, low-density lipoprotein cholesterol (LDL-C), and triglycerides (TGs), meanwhile several polymorphisms in the LDL receptor (LDLR) gene have been associated with increased levels of total cholesterol and LDL-C. We studied 400 women from Southwest Mexico. Anthropometric features and biochemical profile were evaluated, and genotyping of single nucleotide polymorphisms rs429358 and rs7412 in the APOE gene and rs688 in the LDLR gene was determined by TaqMan assays. We found significant association between LDL-C (odds ratio [OR] = 3.3, 95% confidence interval [CI]: 1.9-5.7) and marginal association with TG (OR = 1.7, 95% CI: 1.0-2.9) of atherogenic risk in women carriers of the ApoE4 isoform compared to ApoE3. The TT genotype of rs688 in the LDLR gene was not found to be associated with elevated levels of total cholesterol or LDL-C. Our results show that carrier women of the ApoE4 isoform are more likely to have elevated levels of LDL-C and therefore increased risk of developing atherosclerosis. © The Author(s) 2015.

Lipid profiles in the untreated patients with Hashimoto thyroiditis and the effects of thyroxine treatment on subclinical hypothyroidism with Hashimoto thyroiditis.

PubMed

Tagami, Tetsuya; Tamanaha, Tamiko; Shimazu, Satoko; Honda, Kyoko; Nanba, Kazutaka; Nomura, Hidenari; Yoriko, Sakane Ueda; Usui, Takeshi; Shimatsu, Akira; Naruse, Mitsuhide

2010-01-01

To evaluate the prevalence of dyslipidemia in the population of Hashimoto thyroiditis, we reviewed medical records on the consecutive 1181 cases with adult Hashimoto thyroiditis and 830 cases were adopted for the study. First, the serum TSH level increased and serum free T4 level decreased, slightly but significantly, with increasing age. There were significant positive correlations between serum TSH levels and lipid parameters such as total cholesterol (TC), triglyceride (TG), HDL-cholesterol (HDL-C), LDL-cholesterol (LDL-C), non-HDL-C and LDL-C/HDL-C ratio (L/H). In contrast, there were significant negative correlations between serum free T4 levels and all of these lipid parameters. According to the thyroid function, the cases were classified into 4 groups such as thyrotoxicosis (TT), euthyroidism (EU), subclinical hypothyroidism (SH) and overt hypothyroidism (OH). TC, HDL-C, non-HDL-C and LDL-C of TT were significantly lower than those in EU. In contrast, TC, TG, non-HDL-C, LDL-C, L/H and age of OH were significantly higher than those in EU. Interestingly, LDL-C and L/H of SH were significantly higher compared with EU. Thirty-two of SH patients were treated with small doses of levothyroxine and the effects on the lipid profile were examined. The TC, non-HDL-C, LDL-C and L/H were significantly decreased after treatment. In conclusion, the prevalence of dyslipidemia increases along with hypofunction of the thyroid and T4 replacement therapy may improve lipid profile in the cases of SH with Hashimoto thyroiditis.

[Effect of Huanglian Jiedu Decoction on Monocyte Development in apoE Gene Knockout Mice].

PubMed

Chen, Bing; Kong, Ya-xian; Ll, Yu-mei; Xue, Xin; Zhang, Jian-ping; Zeng, Hui; Hu, Jing- qing; Ma, Ya-luan

2016-01-01

To observe monocyte (Mo) development in wild type C57BL/6 mice and apoE gene knockout (apoE(-/-)) mice, and to evaluate the immuno-regulatory effect of Huanglian Jiedu Decoction (HJD) on peripheral Mo development in apoE(-/-) mice. Four, 8, 12, and 16 weeks old female C57BL/6 mice were set up as control groups of different ages, while 4, 8, 12, and 16 weeks old female apoE(-/-) mice were set up as hyperlipidemia groups of different ages. Four-week old female C57BL/6 mice were recruited as a blank group. Four-week old female apoE(-/-) mice were randomly divided into the control group, the Western medicine group, and the Chinese medicine group by paired comparison, 5 in each group. Equivalent clinical dose was administered to mice according to body weight. Mice in the Western medicine group were administered with Atrovastatin at the daily dose of 10 mg/kg by gastrogavage, while those in the Chinese medicine group were administered with HJD at the daily dose of 5 g/kg by gastrogavage. Body weight was detected each week. After 4 weeks blood lipids levels (such as TG, TC, LDL-C, and HDL-C), and the proportions of Mo and Ly6c(hi) were detected. Compared with 4-week-old homogenic mice, the proportion of Mo decreased in 16-week-old C57BL/6 mice (P < 0.05). Levels of TC and TG, and the proportion of Ly6c(hi) subtype increased, but the proportion of Mo de- creased in 8-week-old apoE(-/-) mice (P <0. 05). Levels of TC, TG, and LDL-C increased in 12-week-old apoE(-/-) mice (P < 0.05). Levels of TC, TG, LDL-C, and HDL-C increased in 16-week-old apoE(-/-) mice (P < 0.05, P < 0.01). Compared with 8-week-old homogenic mice, the proportion of Mo decreased in 16-week-old C57BL/6 mice (P < 0.05); levels of TC and LDL-C increased in 12-week-old apoE(-/-) mice (P < 0.05); levels of TC and HDL-C increased in 16-week-old apoE(-/-) mice (P < 0.05, P < 0.01). Compared with C57BL/6 mice of the same age, TC and TG increased, HDL-C decreased (P < 0.01) in 4-and 8-week-old apoE(-/-) mice (P

Intake levels of dietary long-chain PUFAs modify the association between genetic variation in FADS and LDL-C.

PubMed

Hellstrand, S; Sonestedt, E; Ericson, U; Gullberg, B; Wirfält, E; Hedblad, B; Orho-Melander, M

2012-06-01

Polymorphisms of the FA desaturase (FADS) gene cluster have been associated with LDL, HDL, and triglyceride concentrations. Because FADS converts α-linolenic acid (ALA) and linoleic acid into PUFAs, we investigated the interaction between different PUFA intakes and the FADS polymorphism rs174547 (T>C) on fasting blood lipid and lipoprotein concentrations. We included 4,635 individuals (60% females, 45-68 years) from the Swedish population-based Malmö Diet and Cancer cohort. Dietary intakes were assessed by a modified diet history method including 7-day registration of cooked meals. The C-allele of rs174547 was associated with lower LDL concentration (P = 0.03). We observed significant interaction between rs174547 and long-chain ω-3 PUFA intakes on LDL (P = 0.01); the C-allele was only associated with lower LDL among individuals in the lowest tertile of long-chain ω-3 PUFA intakes (P < 0.001). In addition, significant interaction was observed between rs174547 and the ratio of ALA and linoleic FA intakes on HDL (P = 0.03). However, no significant associations between the C-allele and HDL were detected within the intake tertiles of the ratio. Our findings suggest that dietary intake levels of different PUFAs modify the associated effect of genetic variation in FADS on LDL and HDL.

Usefulness of non-fasting lipid parameters in children.

PubMed

Kubo, Toshihide; Takahashi, Kyohei; Furujo, Mahoko; Hyodo, Yuki; Tsuchiya, Hiroki; Hattori, Mariko; Fujinaga, Shoko; Urayama, Kenji

2017-01-01

This study assessed whether non-fasting lipid markers could be substituted for fasting markers in screening for dyslipidemia, whether direct measurement of non-fasting low-density lipoprotein cholesterol [LDL-C (D)] could be substituted for the calculation of fasting LDL-C [LDL-C (F)], and the utility of measuring non-high-density lipoprotein cholesterol (non-HDL-C). In 33 children, the lipid profile was measured in the non-fasting and fasting states within 24 h. Correlations were examined between non-fasting LDL-C (D) or non-HDL-C levels and fasting LDL-C (F) levels. Non-fasting triglyceride (TG), total cholesterol (TC), HDL-C, LDL-C (D), and non-HDL-C levels were all significantly higher than the fasting levels, but the mean difference was within 10% (except for TG). Non-fasting LDL-C (D) and non-HDL-C levels were strongly correlated with the fasting LDL-C (F) levels. In conclusion, except for TG, non-fasting lipid parameters are useful when screening children for dyslipidemia. Direct measurement of non-fasting LDL-C and calculation of non-fasting non-HDL-C could replace the calculation of fasting LDL-C because of convenience.

NASH resolution is associated with improvements in HDL and triglyceride levels but not improvement in LDL or non-HDL-C levels.

PubMed

Corey, K E; Vuppalanchi, R; Wilson, L A; Cummings, O W; Chalasani, N

2015-02-01

Nonalcoholic steatohepatitis (NASH) is associated with dyslipidemia and cardiovascular disease (CVD). To determine the relationship between resolution of NASH and dyslipidemia. Individuals in the Pioglitazone vs. Vitamin E vs. Placebo for the Treatment of Nondiabetic Patients with Nonalcoholic Steatohepatitis (PIVENS) trial with paired liver biopsies and fasting lipid levels were included (N = 222). In the PIVENS trial individuals were randomised to pioglitazone 30 mg, vitamin E 800 IU or placebo for 96 weeks. Change in lipid levels at 96 weeks was compared between those with and without NASH resolution. Dyslipidemia at baseline was frequent, with low high-density lipoprotein (HDL) (<40 mg/dL in men or <50 mg/dL in women) in 63%, hypertriglyceridaemia (≥150 mg/dL) in 46%, hypercholesterolaemia (≥200 mg/dL) in 47% and triglycerides (TG)/HDL >5.0 in 25%. Low-density lipoprotein (LD) ≥160 mg/dL was found in 16% and elevated non-HDL cholesterol (non-HDL-C) (≥130 mg/dL) in 73%. HDL increased with NASH resolution but decreased in those without resolution (2.9 mg/dL vs. -2.5 mg/dL, P < 0.001). NASH resolution was associated with significant decreases in TG and TG/HDL ratio compared to those without resolution (TG: -21.1 vs. -2.3 mg/dL, P = 0.03 and TG/HDL: -0.7 vs. 0.1, P = 0.003). Non-HDL-C, LDL and cholesterol decreased over 96 weeks in both groups, but there was no significant difference between groups. Treatment group did not impact lipids. NASH resolution is associated with improvements in TG and HDL but not in other cardiovascular disease risk factors including LDL and non-HDL-C levels. Individuals with resolution of NASH may still be at increased risk of cardiovascular disease. ClinicalTrials.gov identifier: NCT00063622. © 2014 John Wiley & Sons Ltd.

Total, LDL, and HDL cholesterol decrease with age in older men and women. The Rancho Bernardo Study 1984-1994.

PubMed

Ferrara, A; Barrett-Connor, E; Shan, J

1997-07-01

The purpose of the present study was to study the effects of age, weight change, and covariates on lipid and lipoprotein levels cross-sectionally and prospectively in an elderly population. A community-based sample of 1041 men and 1303 women aged 50 to 93 years was studied cross-sectionally in 1984 to 1987, with follow-up of 372 men and 545 women 8 years later. In the cross-sectional study, levels of total cholesterol (TC) and LDL cholesterol (LDL-C) decreased and levels of HDL cholesterol (HDLC) increased with age in men (all P < .001) but not in women. In the prospective study, TC, LDL-C, and HDL-C levels all decreased in both men and women, in all age groups (50 to 64 years, 65 to 74 years, and > or = 75 years) and in all weight change groups (> 2.5-kg loss, change within 2.5 kg, and > 2.5-kg gain) and in all waist girth change groups, for an overall decrement of approximately 1% per year. In multiple linear regression models, change in weight was the most important independent and consistent predictor of changes in TC, LDL-C, and HDL-C. Similar results were obtained in analyses excluding subjects taking lipid-lowering drugs or estrogen and in analyses adjusted for changes in cigarette smoking, alcohol intake, physical activity, medication use, and incident myocardial infarction, cancer, or diabetes. Cross-sectional decrements in TC and LDL-C with age in men are not explained by survivor bias because they are also observed prospectively. Although weight change was the most important explanatory variable, TC, LDL-C, and HDL-C levels also decreased in those who lost or gained weight. Age was not an independent predictor of change. Other prospective studies are recommended to better define the causes and consequences of cholesterol and lipoprotein changes in old age.

Correlation analysis between the LDL-C in serum and the onset of transient ischemic attack caused by CSVD.

PubMed

Chen, Yaqi; Hu, Mei; Gong, Hongying

2017-08-01

The aim of this study was to investigate the correlation between the low-density lipoprotein cholesterol (LDL-C) in serum and the onset of transient ischemic attack caused by cerebral small vascular disease (CSVD). Between September 2012 and September 2015, 249 patients who were diagnosed as CSVD were randomly enrolled in this study. According to MRI results, patients were divided into the patient and control groups. In the patient group, the patients were further subdivided into the white matter lesion (WML) group (n=86) and lacunar infarction (LI) group (n=53). Head MRI and/or CT were conducted on all the patients. This included T1 and T2 phases, diffusion weighted imaging (DWI) and fluid attenuated inversion recovery (FLAIR). Additionally, mini-mental status examination (MMSE) test and Montreal cognitive assessment (MoCA) test were carried out on all the patients. As a result, the age, total cholesterol (TC) level and low-density lipoprotein (LDL) levels in the patient group were higher than those in the control group (p<0.05). The MMSE and MoCA scores in the patient group were significantly lower than those in the control group (p<0.05). With all the risk factors being set as independent variables and small vessel disease (SVD) as the dependent variable, we performed the logistic regression analysis and correlation analysis for paired data, and found that the increase in LDL was correlated to the onset of SVD, OR=1,321. After adjustment of other risk factors, we enrolled the level of triglyceride (TG) into the multivariable analysis and obtained a statistically significant difference (p<0.05). In conclusion, LDL is a major risk factor affecting the onset of transient ischemic attack (TIA) induced by CSVD. Patients with hyperlipidemia should receive head MRI or CT examination to eliminate the probability of the existence of CSVD. To reduce the occurrence of adverse events in clinical practice, we can perform early intervention in SVD by decreasing the level of

Association of APOA5 -1131T>C polymorphism and serum lipid levels in patients with type 2 diabetes.

PubMed

Celap, Ivana; Simundic, Ana-Maria; Nikolac, Nora; Kackov, Sanja; Katalinic, Darko

2013-10-01

Significant abnormalities in lipid metabolism are frequently present in patients with type 2 diabetes mellitus (T2DM). Hypertriglyceridemia, a highly proatherogenic state, is associated with increased risk of coronary artery disease. Genetic polymorphism APOA5 -1131T>C has been recognized as a significant contributor to hypertriglyceridemia in both healthy and diabetic populations. The aim of the study was to investigate the association of APOA5 -1131T>C polymorphism with the serum levels of triglycerides, total cholesterol, high-density lipoprotein (HDL) cholesterol, and low-density lipoprotein (LDL) cholesterol in patients with T2DM. In total, 234 DNA samples from patients with T2DM were genotyped using the PCR-RFLP method. Serum lipid levels were measured using standard laboratory methods. Obtained APOA5 -1131T>C genotype frequencies were 89% (T/T) and 11% (T/C+C/C). There was no significant association between APOA5 -1131T>C genotypes and triglyceride levels (1.90 mM [1.32-2.74] vs. 1.78 mM [1.54-3.05] for T/T vs. T/C+C/C genotype; p=0.553), HDL cholesterol levels (1.30 mM [1.10-1.40] vs. 1.30 mM [1.05-1.40] for T/T vs. T/C+C/C; p=0.534), and LDL cholesterol levels (3.1 mM [2.3-3.8] vs. 3.0 mM [2.2-3.5] for T/T vs. T/C+C/C; p=0.313). Our results suggest that hypertriglyceridemia in patients with T2DM is not likely to be associated with the APOA5 -1131T>C polymorphism.

Beneficial effects of cocoa, coffee, green tea, and garcinia complex supplement on diet induced obesity in rats.

PubMed

Huang, Chi-Chang; Tung, Yu-Tang; Huang, Wen-Ching; Chen, Yi-Ming; Hsu, Yi-Ju; Hsu, Mei-Chich

2016-03-12

Cocoa, coffee, green tea and garcinia contain large amounts of polyphenols. Polyphenols are well-known phytochemicals and found in plants, and have modulated physiological and molecular pathways that are involved in energy metabolism, adiposity, and obesity. To evaluate the obesity-lowering effect of a combined extract (comprising cocoa, coffee, green tea and garcinia; CCGG) in high-energy diet (HED)-induced obese rats. Male Sprague Dawley rats (8 weeks old) were randomly divided into four groups (n = 12 per group): normal diet with vehicle treatment (Control), and HED to receive vehicle or CCGG by oral gavage at 129, 258, or 517 mg/kg/day for 4 weeks, designated the HED, 0.5X, 1X and 1X groups, respectively. HED induced macrovesicular fat in the liver and the formation of adipose tissues, and significantly increased the levels of serum free fatty acids (FFA), triacylglycerol (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), and LDL-C/HDL-C, aspartate aminotransferase (AST), alanine aminotransferase (ALT) and ketone bodies in serum, and hepatic TG and TC levels, and decreased the levels of high density lipoprotein cholesterol (HDL-C) in serum and lipase activity in fat tissues. Treatment with CCGG could significantly decrease the levels of FFA, TG, TC, LDL-C, and LDL-C/HDL-C, AST, ALT, and ketone bodies in serum, and hepatic TG and TC contents, and increase the levels of HDL-C in serum and lipase activity in fat tissues compared to the HED group. Liver histopathology also showed that CCGG could significantly reduce the incidence of liver lesions. These results suggested that CCGG stimulated lipid metabolism in HED-induced obese rats, which is attributable to fat mobilization from adipose tissue.

Aerobic Exercise and Lipids and Lipoproteins in Women: A Meta-Analysis of Randomized Controlled Trials

PubMed Central

Kelley, George A.; Kelley, Kristi S.; Tran, Zung VU

2007-01-01

Background Cardiovascular disease (CVD) in women is the leading cause of mortality in the United States, and less than optimal lipid and lipoprotein levels are major risk factors for CVD. The purpose of this study was to use the meta-analytic approach to examine the effects of aerobic exercise on lipids and lipoproteins in women. Methods Studies were retrieved via computerized literature searches, review of reference lists, hand searching selected journals, and expert review of our reference list. The inclusion of studies was limited to randomized controlled trials published in the English language literature between January 1955 and January 2003 in which aerobic exercise was used as the primary intervention in adult women aged ≥18 years. One or more of the following lipids and lipoproteins were assessed: total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG). Results Using a random effects model, statistically significant improvements were observed for all lipids and lipoproteins (TC, X̄ ± SEM, −4.3 ± 1.3 mg/dl, 95% CI −6.9 to −1.7 mg/dl; HDL-C, X̄± SEM, 1.8 ± 0.9 mg/dl, 95% CI 0.1 to 3.5 mg/dl; LDL-C, X̄ ± SEM, −4.4 ± 1.1 mg/dl, 95% CI −6.5 to −2.2 mg/dl; TG, X̄ ± SEM, −4.2 ± 2.1 mg/dl, 95% CI −8.4 to −0.1 mg/dl). Reductions of approximately 2%, 3%, and 5%, respectively, were observed for TC, LDL-C, and TG, whereas an increase of 3% was observed for HDL-C. Conclusions Aerobic exercise is efficacious for increasing HDL-C and decreasing TC, LDL-C, and TG in women. PMID:15650348

Triglyceride to high-density lipoprotein cholesterol ratio and carotid intima-medial thickness in Chinese adolescents with newly diagnosed type 2 diabetes mellitus.

PubMed

Li, Xin; Deng, You-Ping; Yang, Miao; Wu, Yu-Wen; Sun, Su-Xin; Sun, Jia-Zhong

2016-03-01

To investigate the relationship between triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio and carotid intima-medial thickness (CIMT) in Chinese youth and adolescents with newly diagnosed type 2 diabetes mellitus (T2DM). Ninety-eight subjects aged 10-24 yr with newly-diagnosed T2DM had general inflammation, anthropometric, laboratory and CIMT data collected, and were divided into three groups based on TG/HDL-C tertiles. There were no significant differences in gender, age, fasting plasma glucose (FPG), hemoglobin A1c (HbA1c), and carotid arterial diameter (CAD) among the groups based on TG/HDL-C tertiles. Across TG/HDL-C tertiles, there was a significant progressive increase in body mass index (BMI), systolic blood pressure (SBP), diastolic blood pressure (DBP), homeostasis model assessment-estimated insulin resistance (HOMA-IR), TG, total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-C) and CIMT (all P < 0.01 or P < 0.05), while HDL-C was decreased significantly across the groups (P < 0.01). In general linear regression model, TG/HDL-C was an independent determinant of CIMT even after adjusting for BMI, SBP, DBP, TG, TC, LDL-C, HDL-C, HbA1c and HOMA-IR. TG/HDL-C ratio, the marker of small dense LDL particles, is an independent determinant of CIMT in Chinese youth and adolescents with newly diagnosed T2DM, and may be a simple and helpful tool in predicting the increased CIMT in such patients. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of classic ketogenic diet treatment on lipoprotein subfractions in children and adolescents with refractory epilepsy.

PubMed

Azevedo de Lima, Patricia; Baldini Prudêncio, Mariana; Murakami, Daniela Kawamoto; Pereira de Brito Sampaio, Leticia; Figueiredo Neto, Antônio Martins; Teixeira Damasceno, Nágila Raquel

2017-01-01

The aim of this study was to evaluate the effects of the classic ketogenic diet (KD) on low-density lipoprotein (LDL) and high-density lipoprotein (HDL) subfractions in children and adolescents with refractory epilepsy. This prospective study recruited children and adolescents of either sex, whose epilepsy was refractory to treatment with multiple drugs. To be included, the patient had to have an indication for treatment with the KD and be treated as an outpatient. At baseline and after 3 and 6 mo of the KD, lipid profile (total cholesterol [TC], triacylglycerols [TG], LDL cholesterol [LDL-C], and HDL cholesterol [HDL-C]), apolipoproteins (apoA-I and apoB), 10 subfractions of HDL, 7 subfractions of LDL, LDL phenotype, and LDL size were analyzed using the Lipoprint system. The lipid profile components (TC, TG, LDL-C, HDL-C, apoA-I, and apoB) increased during the 3-mo follow-up, and remained consistent after 6 mo of treatment. Similarly, non-HDL-C, TC/HDL-C, LDL-C/HDL-C, and apoB/apoA-I ratios, representing atherogenic particles, significantly increased. In contrast, qualitative lipoprotein characteristics progressively changed during the follow-up period. Small LDL subfractions increased, and this profile was related with reduced LDL size (27.3 nm to 26.7 nm). The LDL phenotype became worse; 52.1% of the patients had a non-A phenotype after 6 mo of the KD. Small HDL subfractions decreased only after 6 mo of the KD. KD treatment promotes negative changes in lipoprotein size and phenotype, contributing to atherogenic risk in these patients. Copyright © 2016 Elsevier Inc. All rights reserved.

Gender specific effect of LIPC C-514T polymorphism on obesity and relationship with plasma lipid levels in Chinese children.

PubMed

Wang, Hao; Zhang, Dandan; Ling, Jie; Lu, Wenhui; Zhang, Shuai; Zhu, Yimin; Lai, Maode

2015-09-01

Hepatic lipase (LIPC) is a key rate-limiting enzyme in lipoprotein catabolism pathways involved in the development of obesity. The C-514T polymorphism in the promoter region is associated with decreased LIPC activity. We performed a case-controlled study (850 obese children and 2119 controls) and evaluated the association between LIPC C-514T polymorphism, obesity and plasma lipid profile in Chinese children and adolescents. Additionally, we conducted a meta-analysis of all results from published studies as well as our own data. A significant association between the polymorphism and obesity is observed in boys (P = 0.042), but not in girls. And we observed a significant relationship of the polymorphism with total cholesterol (TC) and high density lipoprotein cholesterol (HDL-C) independent of obesity in boys. The T allele carriers have higher levels of low density lipoprotein cholesterol (LDL-C) in obese boys, and triglyceride (TG), TC and LDL-C in non-obese girls (all P < 0.05). In the meta-analysis, under dominant model the T allele increased body mass index (BMI) level in boys, while it decreased BMI in girls, and increased the levels of TC both in the overall and subgroups, TG and HDL-C in the overall and boys, and LDL-C in the overall (all P < 0.05). Our results suggest that the T allele might carry an increased risk of obesity in Chinese boys. The meta-analysis suggests that T allele acts as a risk allele for higher BMI levels in male childhood, while it is a protective allele in female childhood. And the polymorphism is associated with the levels of plasma lipids, which may be modulated by obesity and gender. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

PPARG gene C161T CT/TT associated with lower blood lipid levels and ischemic stroke from large-artery atherosclerosis in a Han population in Guangdong.

PubMed

Wei, Wei-Min; Wu, Xiao-Yan; Li, Shu-Ting; Shen, QingYu

2016-07-01

Peroxisome proliferator-activated receptor gamma (PPARG) is a transcription factor involved in atherosclerosis and related diseases. In this study, we aimed to investigate whether PPARG C161T was associated with lipid levels and large-artery atherosclerosis (LAA) ischemic stroke in a Han Chinese population in Guangdong province. The genotype PPARG C161T in 149 LAA ischemic stroke patients and 125 healthy controls was examined by polymerase chain reaction-restriction fragment length polymorphism (RFLP) assay. Associations with LAA ischemic stroke were analyzed for PPARG C161T genotype, total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C), and a logistic regression analysis was performed to identify risk factors for LAA ischemic stroke. The frequency of CC was higher than that of CT + TT and was significantly associated with LAA ischemic stroke. In both the LAA and control groups, TC and LDL-C levels were significantly higher in the CC type than the CT + TT, but TG and HDL-C levels were comparable. The only verified independent risk factors for LAA ischemic stroke were ischemic heart disease (OR: 2.784, 95% CI: 1.377-5.632; p = 0.004) and systolic blood pressure (OR: 1.014, 95% CI: 1.001-1.026; p = 0.029); the PPARG C161T allele was not independently associated with an increased risk of LAA ischemic stroke (OR = 0.697, 95% CI: 0.372-1.305; p = 0.260). In this Han population, PPARG C161T CT/TT was associated with LAA ischemic stroke and lower levels of blood TC and LDL-C, but was not an independent risk factor for LAA ischemic stroke.

Correlates of serum lipids and lipoproteins in Congolese patients with arterial hypertension.

PubMed

Lepira, F B; M'Buyamba-Kabangu, J R; Kayembe, K P; Nseka, M N

2005-01-01

The purpose of this study was to assess the prevalence of dyslipidaemia and the correlates of serum lipids and lipoproteins among Congolese subjects with and without arterial hypertension. One hundred hypertensive patients attending the outpatient clinics at the University of Kinshasa Hospital, and 100 age- and sex-matched controls recruited among hospital personnel or blood donors entered the case-control study. Their blood pressure (BP), heart rate (HR), body mass index (BMI), waist-to-hip ratio (WHR), serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglycerides (TG), plasma fibrinogen (only in patients) and fasting glucose, serum uric acid, creatinine and creatinine clearance (CrCl) were compared using the Student's t-test or Chi-square test as appropriate. Associations between continuous variables were assessed with Pearson correlation coefficients, and correlates of lipids and lipoproteins were determined using multiple linear-regression analysis. Compared to healthy controls, hypertensive patients had greater BMI (p TC (4.96 +/- 1.18 mmol/l for controls vs 5.01 +/- 1.49 mmol/l for hypertensives), LDL-C (3.46 +/- 1.16 mmol/l vs 3.36 +/- 1.32 mmol/l) and HDL-C (1.19 +/- 0.39 mmol/l vs 1.27 +/- 0.39 mmol/l) were similar and within the normal ranges, whereas TG in hypertensives (1.03 +/- 0.66 mmol/l) were significantly higher (p TC >or= 6.20 mmol/l. In hypertensive patients, TC (r = 0.24; p < 0.01) and LDL-C (r = 0.20; p < 0.05) were positively correlated to plasma fibrinogen. A positive correlation was also observed between TC and

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Relationship between Lipids Levels of Serum and Seminal Plasma and Semen Parameters in 631 Chinese Subfertile Men

PubMed Central

Yao, Qi; Fan, Kai; Wang, Guo-Hong; Feng, Rui-Xiang; Liang, Yuan-Jiao; Chen, Li; Ge, Yi-Feng; Yao, Bing

2016-01-01

Objective This prospective study was designed to investigate the relationship between lipids levels in both serum and seminal plasma and semen parameters. Methods 631 subfertile men were enrolled. Their obesity-associated markers were measured, and semen parameters were analyzed. Also, seminal plasma and serum TC, TG, HDL and LDL and serum FFA, FSH, LH, total testosterone (TT), estradiol (E2) and SHBG levels were detected. Results Seminal plasma and serum TG, TC and LDL levels were positively related to age. Serum TC, TG and LDL were positively related to obesity-associated markers (P < 0.001), while only seminal plasma TG was positively related to them (P < 0.05). For lipids levels in serum and seminal plasma, only TG level had slightly positive correlation between them (r = 0.081, P = 0.042). There was no significant correlation between serum lipids levels and semen parameters. However, seminal plasma TG, TC, LDL and HDL levels were negatively related to one or several semen parameters, including semen volume (SV), sperm concentration (SC), total sperm count (TSC), sperm motility, progressive motility (PR) and total normal-progressively motile sperm counts (TNPMS). Moreover, seminal plasma TG, TC, LDL and HDL levels in patients with oligospermatism, asthenospermia and teratozoospermia were higher than those with normal sperm concentration, motility or morphology. After adjusting age and serum LH, FSH, TT, E2 and SHBG levels, linear regression analysis showed that SV was still significantly correlated with seminal plasma LDL (P = 0.012), both of SC and TSC with seminal plasma HDL (P = 0.028 and 0.002), and both of PR and sperm motility with seminal plasma TC (P = 0.012 and 0.051). Conclusion The abnormal metabolism of lipids in male reproductive system may contribute to male factor infertility. PMID:26726884

[Treatment of hyperlipoidemia by xiaozhi capsule: a clinical efficacy research].

PubMed

Wang, Jian-Ping; Fan, Rui-Hong; Wang, Yan; Mei, Yan

2013-06-01

To observe the clinical effect and efficacy of Xiaozhi Capsule (XZC), a Chinese medicine preparation for tonifying Gan-Shen, invigorating Pi to dissipate dampness (TGSIPDD) on total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and endothelin (ET) in treating patients with hyperlipidemia. Totally 120 primary hyperlipidemia patients were randomly assigned to the treatment group (80 cases) and the control group (40 cases). Those in the treatment group took XZC, while those in the control group took Xuezhikang Capsule (XZKC). The serum TC, TG, HDL-C, LDL-C, and ET were detected and evaluated after 8 weeks of treatment. In the treatment group TC was reduced by 25.60%, TG by 33.70%, LDL-C by 32.90%, and ET by 11.02%, while HDL-C was elevated by 24.20%. In the control group, TC was reduced by 24.80%, TG by 33.50%, LDL-C by 31.30%, and ET by 12.05%, while HDL-C was elevated by 20.90%. There was statistical difference in the two groups when compared with before treatment (P < 0.01). But there was no statistical difference in the aforesaid indices between the two groups after treatment (P > 0.05). The integrals for main symptoms after treatment obviously decreased in the two groups, showing statistical difference when compared with before treatment in the same group (P < 0.01). But there was no statistical difference in the aforesaid indices between the two groups (P > 0.05). After 8 weeks of treatment, symptoms such as vertigo, heavy sensation of head, palpitation, chest distress, dry mouth and thirsty were obviously improved after treatment. There was statistical difference in the improvement of tinnitus after treatment in the treatment group (P < 0.01). The total effective rate was 86.25% in the treatment group and 82.50% in the control group, showing no statistical difference (P > 0.05). XZC showed certain effects on each blood lipid index and ET of hyperlipidemia patients. It had better

A case-control study of apoA5 -1131T-->C polymorphism that examines the role of triglyceride levels in diabetic nephropathy.

PubMed

Baum, Larry; Ng, Maggie C Y; So, Wing-Yee; Poon, Emily; Wang, Ying; Lam, Vincent K L; Tomlinson, Brian; Chan, Juliana C N

2007-01-01

Patients with diabetic nephropathy (DN) have increased plasma fasting triglyceride (TG) levels, and most prospective studies report that elevated TG precedes DN. TG-rich lipoprotein particles might promote progression of DN. To test the hypothesis that elevated TG levels contribute to the development of DN, one may examine whether a polymorphism strongly associated with TG levels affects DN risk. The apolipoprotein A5 (apoA5) -1131T-->C polymorphism has a large effect on the TG level, and all three genotypes are relatively common in East Asians. Therefore, we sought to examine the association of this polymorphism with DN. We genotyped the apoA5 -1131T-->C polymorphism in a case-control study involving 367 Chinese Type 2 diabetes patients with DN and 382 without DN, as well as 198 subjects without diabetes. Mean fasting TG levels were higher in CC than in TT carriers by 41%, 54%, and 62% in each of the three subject groups, respectively. However, the genotype distributions did not differ between patients with and without nephropathy (P=.69). Therefore, these results weigh against the hypothesis that high fasting TG per se causes DN. The strong association between TG level and DN may be due to a factor that is usually closely linked to TG level but that is not affected by the apoA5 polymorphism.

PROMETHEUS: an observational, cross-sectional, retrospective study of hypertriglyceridemia in Russia.

PubMed

Karpov, Yuri; Khomitskaya, Yunona

2015-08-25

Data regarding the prevalence of hypertriglyceridemia in the Russian population are lacking, despite triglyceride (TG)-mediated pathways being causal in cardiovascular disease. The prevalence of mixed dyslipidemia and severe hypertriglyceridemia in the Russian population (PROMETHEUS) was undertaken to address this gap. This was an observational, cross-sectional retrospective study. Data from adults with a full/partial lipoprotein record who had blood analyses done at an INVITRO laboratory in Russia between January 1, 2011 and December 31, 2013 were analyzed. The primary endpoint was the prevalence of hypertriglyceridemia (TG ≥ 1.7 mmol/L); secondary endpoints included prevalence of borderline high, high, and very high TG and severe hypertriglyceridemia, defined as a TG level of 1.7 to <2.3, 2.3 to <5.6, ≥5.6, and ≥10.0 mmol/L, respectively. Statistical analyses involved the Wilcoxon and the Chi square tests. Correlations between log-transformed TG and low- and high-density lipoprotein cholesterol (LDL-C and HDL-C) and total cholesterol (TC) were assessed. The correlation between glycated hemoglobin (HbA1c) and TG levels in a nested sample of subjects with HbA1c and TG data was also assessed using a log-linear model. The full dataset and nested sample comprised 357,072 and 54,602 individuals, respectively. Prevalence of hypertriglyceridemia, borderline high TG, high TG, very high TG, and severe hypertriglyceridemia in the full dataset was 29.2, 16.2, 12.9, 0.11, and 0.011%, respectively; corresponding rates in the nested sample were 19.0, 17.2, 0.25, and 0.016%, respectively. TG levels were 16.4% higher in males versus females; males had a greater risk of hypertriglyceridemia (risk ratio 1.25; 95% CI 1.24, 1.26; P < 0.0001). Prevalence of hypertriglyceridemia increased with age, peaking at 40-49 years in males (42.8%) and 60-69 years in females (34.4%); a 0.61% increase in TG levels for each year of life was predicted. Hypertriglyceridemia prevalence increased

Negative interferences by calcium dobesilate in the detection of five serum analytes involving Trinder reaction-based assays

PubMed Central

Wu, Jie; Zhao, Fang; Xia, Liangyu; Cheng, Xinqi; Liu, Qian; Liu, Li; Xu, Ermu; Qiu, Ling

2018-01-01

Previously, we reported the strong negative interference of calcium dobesilate, a vasoprotective agent, in creatinine assays involving the Trinder reaction. It is hypothesized that a similar effect occurs in the detection of uric acid (UA), total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C). The interferences of calcium dobesilate during the detection of the five serum analytes were investigated on automated systems/analysers, and the effects were compared among eight different assay systems for each analyte. A calcium dobesilate standard was added into two sets of the blank serum pools of each analyte at final concentrations of 0, 2, 4, 8, 16, 32, and 64 μg/mL. The percentage deviation of each analyte value was calculated between each drug concentration and the drug-free samples. The clinically acceptable error levels for UA, TC, TG, HDL-C, and LDL-C were defined as ±4.87%, ±4.1%, ±9.57%, ±5.61%, and ±5.46%, respectively. The observed interference was concentration dependent for each analyte. In the presence of 16 μg/mL calcium dobesilate, which was within the therapeutic range, all seven Trinder reaction-based UA assay systems, two TG assay systems, two HDL-C assay systems and one TC assay system exhibited negative drug interferences. Calcium dobesilate negatively interferes with the detection of UA, TG, TC, and HDL-C in assay systems based on the Trinder reaction. The effect was most significant in UA and TG detection. PMID:29432460

Macrophage Sortilin Promotes LDL Uptake, Foam Cell Formation, and Atherosclerosis

PubMed Central

Patel, Kevin M.; Strong, Alanna; Tohyama, Junichiro; Jin, Xueting; Morales, Carlos R.; Billheimer, Jeffery; Millar, John; Kruth, Howard; Rader, Daniel J.

2015-01-01

Rationale Non-coding gene variants at the SORT1 locus are strongly associated with LDL-C levels as well as with coronary artery disease (CAD). SORT1 encodes a protein called sortilin, and hepatic sortilin modulates LDL metabolism by targeting apoB-containing lipoproteins to the lysosome. Sortilin is also expressed in macrophages, but its role in macrophage uptake of LDL and in atherosclerosis independent of plasma LDL-C levels is unknown. Objective To determine the effect of macrophage sortilin expression on LDL uptake, foam cell formation, and atherosclerosis. Methods and Results We crossed Sort1−/− mice onto a ‘humanized’ Apobec1−/−; hAPOB Tg background and determined that Sort1 deficiency on this background had no effect on plasma LDL-C levels but dramatically reduced atherosclerosis in the aorta and aortic root. In order to test whether this effect was a result of macrophage sortilin deficiency, we transplanted Sort1−/−;LDLR−/− or Sort1+/+;LDLR−/− bone marrow into Ldlr−/− mice and observed a similar reduction in atherosclerosis in mice lacking hematopoetic sortilin without an effect on plasma LDL-C levels. In an effort to determine the mechanism by which hematopoetic sortilin deficiency reduced atherosclerosis, we found no effect of sortilin deficiency on macrophage recruitment or LPS-induced cytokine release in vivo. In contrast, sortilin deficient macrophages had significantly reduced uptake of native LDL ex vivo and reduced foam cell formation in vivo, whereas sortilin overexpression in macrophages resulted in increased LDL uptake and foam cell formation. Conclusions Macrophage sortilin deficiency protects against atherosclerosis by reducing macrophage uptake of LDL. Sortilin-mediated uptake of native LDL into macrophages may be an important mechanism of foam cell formation and contributor to atherosclerosis development. PMID:25593281

Comparison of Pure Palm Olein Oil, Hydrogenated Oil-Containing Palm, and Canola on Serum Lipids and Lipid Oxidation Rate in Rats Fed with these Oils.

PubMed

Amini, Seyed-Asadollah; Ghatreh-Samani, Keihan; Habibi-Kohi, Arash; Jafari, Laleh

2017-02-01

Due to increased consumption of canola oil and hydrogenated oil containing palm and palm olein, and their possible effects on serum lipoproteins, the present study was conducted to determine the effects of these oils on lipids and lipid oxidation level. In this experimental study, 88 Wistar rats were randomly assigned to four groups. Control group (A) was on a normal diet. Groups B, C, and D, in addition to normal diet, were fed with hydrogenated oil-contained palm oil, pure palm olein oil, and canola oil, respectively for 4 weeks. Serum Biochemical factors [total cholesterol (TC), triglyceride (TG), LDL, HDL, LDL/HDL ratio, oxLDL, paraoxanase-1 (PON1), and malondialdehyde (MDA)] were measured. The lowest mean serum TC was seen in the control group and the highest in the group B. There were differences in TC, TG, HDL, MDA, and PON1 between the control group and other groups (P<0.001). The lowest and highest LDL/HDL ratios were observed in the group C and the control group, respectively. Significant differences were seen in OxLDL and PON1 between the control group and other three groups (P<0.05), while there were no significant differences in oxLDL and PON1 among the other three groups (P>0.05). MDA was higher in groups C and D. Canola oil, hydrogenated oil-containing palm and palm olein may increase atherosclerosis risk through decreasing PON1 activity and elevating oxLDL. Palm olein oils in rats' diets cause a considerable decrease in LDL and help to increase HDL.

The effect of consumption of soy foods on the blood lipid profile of women: a pilot study from Qwa-Qwa.

PubMed

Oldewage-Theron, Wilna; Egal, Abdulkadir

2013-01-01

The objective of this study was to compare the long-term effect of 40-g daily whole bean soy consumption for a period of 18 mo on blood lipid levels of women. A single-system design was used and 90 women randomly selected in peri-urban Qwa-Qwa, South Africa. Measurements included dietary intake (24-h recall), anthropometric (weight and height) and biochemical lipid parameters with venous blood samples. The respondents were divided into a hypercholesterolemic and normo-cholesterolemic (NC) group and data analyses included descriptive statistics and t-tests on SPSS, version 21.0. The results showed that a large percentage (40%) of the women was hypercholesterolemic. The hypercholesterolemic group showed abnormal mean values for all the lipid parameters at baseline whereas the NC group showed total cholesterol (TC) and LDL-cholesterol (LDL-C) values in the normal range, but abnormally low mean HDL-cholesterol (HDL-C) (0.9±0.6) and high mean triglyceride (TG) (2.3±0.8) levels. At follow-up, the hypercholesterolemic group had significantly improved HDL-C (p=0.000), LDL-C (p=0.032) and TG (p=0.000) levels, but with significantly increased TC (p=0.01). A similar trend was observed in the NC group; however, no significantly improved HDL-C or TG values were observed. It can be concluded that dyslipidemia and obesity were prevalent amongst this group of women. The daily consumption of 40 g of whole soybean, had no significant positive effect on TC, but had a beneficial effect on LDL-C in the women in Qwa-Qwa. The HDL:LDL ratio was also improved in the in the hypercholesterolemic group, thus reducing the risk for CVD. The consumption of whole soybean thus had a beneficial effect on the lipid profile of the women in Qwa-Qwa.

PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

PubMed

Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

2012-02-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

Effect of insulin analog initiation therapy on LDL/HDL subfraction profile and HDL associated enzymes in type 2 diabetic patients.

PubMed

Aslan, Ibrahim; Kucuksayan, Ertan; Aslan, Mutay

2013-04-24

Insulin treatment can lead to good glycemic control and result in improvement of lipid parameters in type 2 diabetic patients. This study was designed to evaluate the effect of insulin analog initiation therapy on low-density lipoprotein (LDL)/ high-density lipoprotein (HDL) sub-fractions and HDL associated enzymes in type 2 diabetic patients during early phase. Twenty four type 2 diabetic patients with glycosylated hemoglobin (HbA1c) levels above 10% despite ongoing combination therapy with sulphonylurea and metformin were selected. Former treatment regimen was continued for the first day followed by substitution of sulphonylurea therapy with different insulin analogs (0.4 U/kg/day) plus metformin. Glycemic profiles were determined over 72 hours by continuous glucose monitoring system (CGMS) and blood samples were obtained from all patients at 24 and 72 hours. Plasma levels of cholesteryl ester transfer protein (CETP), lecithin-cholesterol acyltransferase (LCAT), apolipoprotein B (apoB) and apolipoprotein A-1 (apoA-I) were determined by enzyme-linked immunosorbent assay (ELISA). Measurement of CETP and LCAT activity was performed via fluorometric analysis. Paraoxonase (PON1) enzyme activity was assessed from the rate of enzymatic hydrolysis of phenyl acetate to phenol formation. LDL and HDL subfraction analysis was done by continuous disc polyacrylamide gel electrophoresis. Mean blood glucose, total cholesterol (TC), triglyceride (TG) and very low-density lipoprotein cholesterol (VLDL-C) levels were significantly decreased while HDL-C levels were significantly increased after insulin treatment. Although LDL-C levels were not significantly different before and after insulin initiation therapy a significant increase in LDL-1 subgroup and a significant reduction in atherogenic LDL-3 and LDL-4 subgroups were observed. Insulin analog initiation therapy caused a significant increase in HDL-large, HDL- intermediate and a significant reduction in HDL-small subfractions

CD64-Neutrophil expression and stress metabolic patterns in early sepsis and severe traumatic brain injury in children.

PubMed

Fitrolaki, Diana-Michaela; Dimitriou, Helen; Kalmanti, Maria; Briassoulis, George

2013-03-01

Critical illness constitutes a serious derangement of metabolism. The aim of our study was to compare acute phase metabolic patterns in children with sepsis (S) or severe sepsis/septic shock (SS) to those with severe traumatic brain injury (TBI) and healthy controls (C) and to evaluate their relations to neutrophil, lymphocyte and monocyte expressions of CD64 and CD11b. Sixty children were enrolled in the study. Forty-five children with systemic inflammatory response syndrome (SIRS) were classified into three groups: TBI (n = 15), S (n = 15), and SS (n = 15). C consisted of 15 non- SIRS patients undergoing screening tests for minor elective surgery. Blood samples were collected within 6 hours after admission for flow cytometry of neutrophil, lymphocyte and monocyte expression of CD64 and CD11b (n = 60). Procalcitonin (PCT), C-reactive protein (CRP), glucose, triglycerides (TG), total cholesterol (TC), high (HDL) or low-density-lipoproteins (LDL) were also determined in all groups, and repeated on day 2 and 3 in the 3 SIRS groups (n = 150). CRP, PCT and TG (p < 0.01) were significantly increased in S and SS compared to TBI and C; glucose did not differ among critically ill groups. Significantly lower were the levels of TC, LDL, and HDL in septic groups compared to C and to moderate changes in TBI (p < 0.0001) but only LDL differed between S and SS (p < 0.02). Among septic patients, PCT levels declined significantly (p < 0.02) with time, followed by parallel decrease of HDL (p < 0.03) and increase of TG (p < 0.02) in the SS group. Neutrophil CD64 (nCD64) expression was higher in patients with SS (81.2%) and S (78.8%) as compared to those with TBI (5.5%) or C (0.9%, p < 0.0001). nCD64 was positively related with CRP, PCT, glucose, and TG (p < 0.01) and negatively with TC, LDL, and HDL (p < 0.0001), but not with severity of illness, hematologic indices, length of stay or mechanical ventilation duration. In sepsis, the early stress-metabolic pattern is characterized by

Correlation between Cystatin C and retinopathy of type-two diabetes mellitus patients.

PubMed

Qian, C; Wan, G M; Yan, P S; Wang, W Z; Liang, S Z; Dong, Y

2017-01-01

Diabetic retinopathy is one of most common diabetic microvascular complications. In recent years the incidence of the disease has increased, hence early diagnosis and treatment are of great importance. In order to find reliable biological indexes to diagnose and treat type-two diabetes mellitus promptly, this study focused on the correlation between Cystatin C (Cys C) and retinopathy of type-two diabetes mellitus patients. One hundred and eighty type-two diabetes mellitus patients and one hundred healthy controls (the control group) were chosen in this study. Of the patients ninety-eight patients had typetwo diabetes mellitus without retinopathy (non-diabetic retinopathy group) and eighty-two had typetwo diabetes mellitus with retinopathy (diabetic retinopathy group). Correlation of Cys C and typetwo diabetic retinopathy was analyzed by examining the waist-hip ratio, fasting blood glucose (FBG), total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), glycosylated hemoglobin (HbA1c), and Cys C of both groups. The results showed that FBG, TC, TG, LDL-C, HbA1c, Cys C in the type-two diabetes mellitus patients group were higher than those of the control group (P less than 0.05). Age, course of diabetes, FBG, HbA1c, and Cys C levels were statistically significant in both the DR group and NDR group (P less than 0.05). The result of logistic regression analysis indicates that there was a positive correlation between type-two diabetic retinopathy development and age, course of diabetes, and Cys C level (P less than 0.05). Thus, it can be seen that changes of Cys C levels can assist early diagnosis and treatment of diabetic retinopathy to some extent. The patients with high Cys C level, long course of diabetes, and old age are more likely to have diabetic retinopathy.

A new rapid method to measure human platelet cholesterol: a pilot study.

PubMed

Jagroop, I Anita; Persaud, Jahm Want; Mikhailidis, Dimitri P

2011-01-01

Platelet cholesterol (PC) could be used to assess "tissue" cholesterol of patients with vascular disease. However, the methods available so far to measure PC involve a complex extraction process. We developed a rapid method to measure PC and assessed its correlation with serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), LDL-C/HDL-C ratio, triglycerides (TG), and non-HDL-C. We assessed repeatability (20 times, 3 participants) and reproducibility (8 times, 2 participants). A group of 47 healthy participants was studied. Blood was collected to analyze serum TC, LDL-C, HDL-C, and TG. Citrated blood was used to prepare a platelet pellet. A "clear soup" was produced (by disrupting this pellet using freeze-thaw and sonication cycles) and used to measure PC. Repeatability of PC showed a coefficient of variation (CV) of 4.8%. The reproducibility of PC over a period of 2 months was CV 7.5% and 8.1% (8 measurements for 2 participants). The PC of participants with serum LDL-C >2.6 mmol/L (treatment goal recommended by the National Cholesterol Education Program Adult Treatment Panel III) was 377 ± 120 μmol/10(12) platelets (n = 25). There was a significant correlation (Spearman, correlation coefficient) of PC (n = 25) with serum LDL-C (r(s) = 0.45, P = .02), LDL-C/HDL-C (r(s) = 0.45, P = .02), TG (r(s) = 0.43, P = .03), and non-HDL-C (r(s) = 0.53, P = .007). This technique of measuring PC has the advantage of being reproducible, fast, and simpler than previous methods. Thus, it may be useful for multiple sampling when investigating changes in PC in hypercholesterolemic patients. More extensive evaluation is necessary.

Elevated resting heart rate is associated with dyslipidemia in middle-aged and elderly Chinese.

PubMed

Sun, Ji Chao; Huang, Xiao Lin; Deng, Xin Ru; Lv, Xiao Fei; Lu, Jie Li; Chen, Yu Hong; Bi, Yu Fang; Wang, Wei Qing; Xu, Min; Ning, Guang

2014-08-01

To study the relationship between resting heart rate and blood lipid level. A total of 9 415 subjects aged ⋝ 40 years were included in the present study. Their resting heart rate was monitored and their serum levels of triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C) and high density lipoprotein cholesterol (HDL-C) were measured to define dyslipidemia according to the 2007 Chinese Guidelines on Prevention and Treatment of Dyslipidemia in Adults. The subjects were divided into group A with their resting heart rate <70 beats/min, group B with their resting heart rate =70-79 beats/min, group C with their resting heart rate =80-89 beats/min, and group D with their resting heart rate ⋝ 90 beats/min. High TG, TC, and LDL-C were presented across the resting heart rate (Ptrend <0.01). Multiple logistic regression analysis revealed that the risk of high TG and TC was higher in subjects with their resting heart rate ⋝ 90 beats/min than in those with their resting heart rate <70 beats/min (OR=1.42; 95% CI: 1.16-1.74 and OR=1.33; 95% CI: 1.09-1.64, respectively). Elevated resting heart rate is associated with high TG and TC in middle-aged and elderly Chinese subjects. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Efficacy and safety of a combination of red yeast rice and olive extract in hypercholesterolemic patients with and without statin-associated myalgia.

PubMed

Tshongo Muhindo, Christian; Ahn, Sylvie A; Rousseau, Michel F; Dierckxsens, Yvan; Hermans, Michel P

2017-12-01

Cholesfytol ® , a lipid-lowering dietary supplement with antioxidant and anti-atherosclerotic properties, combines red yeast rice (RYR) and olive extract (5mg hydroxytyrosol equivalent) and represents an alternative for patients who do not wish or are unable to use chemical statins, including individuals with previous statin-associated muscle symptoms (SAMS). A 2-months observational non-randomized study was performed to evaluate the efficacy, tolerance and safety of Cholesfytol ® (1 tablet/day) in 642 hypercholesterolemic patients (mean age: 59 yrs; total cholesterol (TC) ≥200; LDL-C ≥140mg/dl). Patients were followed by 126 GPs, and included irrespective of SAMS history and/or diabetes. None of the patients were taking statins or other lipid-modifying therapy at inclusion. At baseline, 26% had fasting glucose >100 ≤125mg/dL, and 5% >125mg/dL; 32% (n=194) had a SAMS history; and 21% had atherogenic dyslipidemia (AD). In the entire cohort, pre-treatment TC; non-HDL-C; LDL-C; and TG were 259; 200; 168; 158mg/dL, respectively, and decreased significantly on treatment (-17.5% (TC) and -23.3% (LDL-C)). Fasting glucose and HbA 1c decreased between visits. The reduction in lipids was greater in patients with higher values at baseline. For comparable pre-treatment values, patients with SAMS history had reductions in TC, LDL-C, non-HDL-C, and apoB 100 slightly less than patients without myalgia. AD patients had greater on-treatment decrease in TG. Overall, 13 patients reported minor side-effects, and 4 patients reporting myalgia had antecedent SAMS. In conclusion, a substantial decrease in LDL-C was obtained with a combination of RYR and olive extract in high-risk hypercholesterolemic patients, without inducing new-onset SAMS. Copyright © 2017 Elsevier Ltd. All rights reserved.

The effect of exemestane, anastrozole, and tamoxifen on lipid profiles in Japanese postmenopausal early breast cancer patients: final results of National Surgical Adjuvant Study BC 04, the TEAM Japan sub-study.

PubMed

Hozumi, Y; Suemasu, K; Takei, H; Aihara, T; Takehara, M; Saito, T; Ohsumi, S; Masuda, N; Ohashi, Y

2011-08-01

In this Tamoxifen Exemestane Adjuvant Multinational Japan sub-study, we evaluated the time course of changes in serum lipids in postmenopausal women with hormone-sensitive early breast cancer treated with exemestane, anastrozole, or tamoxifen for postoperative adjuvant therapy. A total of 154 breast cancer patients were assigned to receive exemestane, anastrozole, or tamoxifen in this randomized open-label study. Serum lipid parameters including triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were measured during 1 year of treatment. TC and LDL-C rapidly decreased in patients treated with tamoxifen at 3 months. Compared with anastrozole and exemestane patients, TC and LDL-C were significantly lower at all assessment time points in tamoxifen patients (P < 0.05). TG increased in tamoxifen patients; it was significantly higher compared with exemestane patients at all assessment time points (P < 0.05). HDL-C slightly decreased in exemestane patients; it was significantly lower compared with anastrozole patients at 3 months and 1 year (P = 0.0179 and 0.0013, respectively). Changes of lipid profiles in Japanese postmenopausal women treated with tamoxifen were relatively favorable, while exemestane and anastrozole had no clinically significant effect on the serum lipids.

Exome-wide association study of plasma lipids in >300,000 individuals.

PubMed

Liu, Dajiang J; Peloso, Gina M; Yu, Haojie; Butterworth, Adam S; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; Di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L; Auer, Paul L; Baber, Usman; Ballantyne, Christie M; Bang, Lia E; Benn, Marianne; Bis, Joshua C; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J; Chambers, John C; Chasman, Daniel I; Chen, Y Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y; Connell, John M; Cucca, Francesco; Cupples, L Adrienne; Damrauer, Scott M; Davies, Gail; Deary, Ian J; Dedoussis, George; Denny, Joshua C; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W; Frayling, Timothy M; Frikke-Schmidt, Ruth; Fritsche, Lars G; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K; Gao, Wei; Garcia, Melissa E; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B; Hayward, Caroline; Hirschhorn, Joel N; Holmen, Oddgeir L; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B; Jørgensen, Marit E; Jukema, J Wouter; Justesen, Johanne M; Kamstrup, Pia R; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V; Klarin, Derek; Koistinen, Heikki A; Kooner, Jaspal S; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J; Lauritzen, Torsten; Liewald, David C M; Lin, Li An; Linneberg, Allan; Loos, Ruth J F; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas G D; Maschio, Andrea; Meigs, James B; Melander, Olle; Metspalu, Andres; Morris, Andrew P; Morrison, Alanna C; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B; Neville, Matt J; Nielsen, Jonas B; Nielsen, Sune F; Nordestgaard, Børge G; Ordovas, Jose M; Mehran, Roxana; O'Donnell, Christoper J; Orho-Melander, Marju; Molony, Cliona M; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin N A; Pasko, Dorota; Patel, Aniruddh P; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M; Rader, Daniel J; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot F; Reiner, Alex P; Renström, Frida; Rich, Stephen S; Ridker, Paul M; Rioux, John D; Robertson, Neil R; Roden, Dan M; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M; Scott, Robert A; Sever, Peter; Sevilla, Raquel S; Shaffer, Christian M; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S; Smith, Albert V; Smith, Blair H; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D; Speliotes, Elizabeth K; Starr, John M; Stirrups, Kathleen E; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M; Surendran, Praveen; Tada, Hayato; Tall, Alan R; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D; Trompet, Stella; Tsao, Philip S; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R; Varbo, Anette; Varga, Tibor V; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J; Warren, Helen R; Weeke, Peter E; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G; Wilson, Peter W F; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna M M; Danesh, John; McCarthy, Mark I; Cowan, Chad A; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J; Kathiresan, Sekar

2017-12-01

We screened variants on an exome-focused genotyping array in >300,000 participants (replication in >280,000 participants) and identified 444 independent variants in 250 loci significantly associated with total cholesterol (TC), high-density-lipoprotein cholesterol (HDL-C), low-density-lipoprotein cholesterol (LDL-C), and/or triglycerides (TG). At two loci (JAK2 and A1CF), experimental analysis in mice showed lipid changes consistent with the human data. We also found that: (i) beta-thalassemia trait carriers displayed lower TC and were protected from coronary artery disease (CAD); (ii) excluding the CETP locus, there was not a predictable relationship between plasma HDL-C and risk for age-related macular degeneration; (iii) only some mechanisms of lowering LDL-C appeared to increase risk for type 2 diabetes (T2D); and (iv) TG-lowering alleles involved in hepatic production of TG-rich lipoproteins (TM6SF2 and PNPLA3) tracked with higher liver fat, higher risk for T2D, and lower risk for CAD, whereas TG-lowering alleles involved in peripheral lipolysis (LPL and ANGPTL4) had no effect on liver fat but decreased risks for both T2D and CAD.

Trends in lipid profiles and descriptive characteristics of U.S. adults with and without diabetes and cholesterol-lowering medication use-National Health and Nutrition Examination Survey, 2003-2012, United States.

PubMed

Mercado, Carla I; Gregg, Edward; Gillespie, Cathleen; Loustalot, Fleetwood

2018-01-01

With a cholesterol-lowering focus for diabetic adults and in the age of polypharmacy, it is important to understand how lipid profile levels differ among those with and without diabetes. Investigate the means, differences, and trends in lipid profile measures [TC, total cholesterol; LDL-c, low-density lipoprotein; HDL-c, high-density lipoprotein; and TG, triglycerides] among US adults by diabetes status and cholesterol-lowering medication. Population number and proportion of adults aged ≥21 years with diabetes and taking cholesterol-lowering medication were estimated using data on 10,384 participants from NHANES 2003-2012. Age-standardized means, trends, and differences in lipid profile measures were estimated by diabetes status and cholesterol medication use. For trends and differences, linear regression analysis were used adjusted for age, gender, and race/ethnicity. Among diabetic adults, 52% were taking cholesterol-lowering medication compared to the 14% taking cholesterol-lowering medication without diabetes. Although diabetic adults had significantly lower TC and LDL-c levels than non-diabetic adults [% difference (95% confidence interval): TC = -5.2% (-6.8 --3.5), LDL-c = -8.0% (-10.4 --5.5)], the percent difference was greater among adults taking cholesterol medication [TC = -8.0% (-10.3 --5.7); LDL-c = -13.7% (-17.1 --10.2)] than adults not taking cholesterol medication [TC = -3.5% (-5.2 --1.6); LDL-c = -4.3% (-7.1 --1.5)] (interaction p-value: TC = <0.001; LDL-c = <0.001). From 2003-2012, mean TC and HDL-c significantly decreased among diabetic adults taking cholesterol medication [% difference per survey cycle (p-value for linear trend): TC = -2.3% (0.003) and HDL-c = -2.3% (0.033)]. Mean TC, HDL-c, and LDL-c levels did not significantly change from 2003 to 2012 in non-diabetic adults taking cholesterol medication or for adults not taking cholesterol medications. Diabetic adults were more likely to have lower lipid levels, except for triglyceride

The effect of defatted cocoa powder on cholesterol-induced changes of serum lipids in rats

PubMed

Ahmad, Mousa Numan; Amr, Amira Mohammad

2017-06-05

Cocoa has been known for many health benefits, but its lipid-lowering activity still remains unresolved. To investigate effects of varying amounts of defatted cocoa on serum lipids in cholesterol-fed rats. Forty-eight male Sprague-Dawley rats were randomly assigned into four cholesterol-free (control) and four cholesterol-supplemented (experimental) diets containing 0, 1, 2 or 3% defatted cocoa (DC) and given ad libitumto the rats for ten weeks. Serum total cholesterol (TC), low- and very low-density lipoprotein cholesterol (LDL-C and VLDL-C), high-density lipoprotein cholesterol (HDL-C) and triglycerides (TG) were quantified, atherogenic index (AI) was calculated, and other biological parameters were assessed. Food intake and body weight did not respond to DC. Compared to 0% DC, 3% DC had the most prominent effect on serum lipids inducing significant fall in LDL-C and TG, and rise in TC/TG in cholesterol-deprived rats, and increase in VLDL-C and AI, and decrease in HDL-C in cholesterol-fed rats. Compared to cholesterol-deprived rats, 3% DC caused significant rise in VLDL-C, AI and TC/TG, and fall in TG in cholesterol-fed rats. This lipid-modifying effect was markedly substantiated by corresponding linear trend responses to DC. Differences in lipid variables of rats fed on DC diets were less evident. Results suggest that, in contrast to cholesterol-free situations, defatted cocoa is seemingly incapable of counteracting the atherogenic effect of cholesterol in rats, perhaps in an interaction that is likely to have clinical implications in cardiometabolic conditions.

Mechanisms of multiple neurotransmitters in the effects of Lycopene on brain injury induced by Hyperlipidemia.

PubMed

Yang, Weichun; Shen, Ziyi; Wen, Sixian; Wang, Wei; Hu, Minyu

2018-02-07

Lycopene is a kind of carotenoid, with a strong capacity of antioxidation and regulating the bloodlipid. There has been some evidence that lycopene has protective effects on the central nervous system, but few studies have rigorously explored the role of neurotransmitters in it. Therefore, the present study was designed to investigate the effects of several neurotransmitters as lycopene exerts anti-injury effects induced by hyperlipidemia. Eighty adult SD rats, half male and half female, were randomly divided into eight groups on the basis of serum total cholesterol (TC) levels and body weight. There was a control group containing rats fed a standard laboratory rodent chow diet (CD); a hypercholesterolemic diet (rat chow supplemented with 4% cholesterol, 1% cholic acid and 0.5% thiouracil - this is also called a CCT diet) group; a positive group (CCT + F) fed CCT, supplemented with 10 mg·kg·bw - 1 ·d - 1 fluvastatin sodium by gastric perfusion; and lycopene groups at five dose levels (CCT + LYCO) fed with CCT and supplied lycopene at doses of 5, 25, 45, 65, and 85 mg·kg·bw - 1 ·d - 1 . The levels of TC, triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), interleukin-1 (IL-1), tumor necrosis factor alpha (TNF-α), oxidized low density lipoprotein (ox-LDL), low-density lipoprotein receptor (LDLR), nerve growth factor (NGF), glutamic acid (Glu), Gamma aminobutyric acid (GABA), dopamine (DA), 5-hydroxytryptamine (5-HT), N-methyl-D-aspartate (NMDA1R), GABA A , 5-HT 1 , D 1 , and apoptosis-related proteins Caspase3, bax, and bcl-2 were measured after the experiment. Nissl staining was adopted to observe the morphological changes in neurons. At the end of the experiment, the levels of TC, TG, LDL-C, IL-1, TNF-α, and ox-LDL in the serum and brain as well as the content of Glu, DA, NMDA, and D 1 in the brain of rats in the CCT group were higher than those in the control group (P<0.05); the

Changes in the lipid profile of elite basketball and soccer players after a match.

PubMed

Apostolidis, N; Bogdanis, G C; Kostopoulos, N; Souglis, A; Papadopoulos, Ch

2014-01-01

The lipid profile of elite basketball and soccer athletes was evaluated and compared with that of inactive individuals. Total cholesterol (T-C), low and high density lipoprotein cholesterol (LDL-C and HDL-C), and triglyceride (TG) concentration were measured in the morning and after a soccer or a basketball match. All parameters of lipid profile measured at a fasted and resting state, except HDL-C, were lower in the athletes compared with the controls (p < 0.01). The soccer match resulted in a greater decrease in TG (78.3 ± 6.7 to 70.7 ± 6.3, p < 0.01), T-C (179.3 ± 10.7 to 171.6 ± 9.6, p < 0.01), LDL-C (110.9 ± 8.9 to 103.5 ± 7.5, p < 0.01) compared with the basketball match that resulted only in a decrease in LDL-C (126.8 ± 9.5 to 117.3 ± 9.1, p < 0.01) and an increase in HDL-C that was similar to that observed after the soccer match (9-12%). These findings support the beneficial effects of basketball and soccer on cardiovascular health.

Apolipoprotein C3 (-455T>C) polymorphism confers susceptibility to nonalcoholic fatty liver disease in the Southern Han Chinese population

PubMed Central

Li, Min-Rui; Zhang, Sheng-Hong; Chao, Kang; Liao, Xian-Hua; Yao, Jia-Yan; Chen, Min-Hu; Zhong, Bi-Hui

2014-01-01

AIM: To investigate the relationship between Apolipoprotein C3 (APOC3) (-455T>C) polymorphism and nonalcoholic fatty liver disease (NAFLD) in the Southern Chinese Han population. METHODS: In this prospective case-control study, we recruited 300 NAFLD patients and 300 healthy controls to a cohort representing Southern Chinese Han population at The First Affiliated Hospital, Sun Yat-sen University, from January to December 2012. Polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing were used to genotype the APOC3 (-455T>C) variants. RESULTS: After adjusting for age, gender, and body-mass index, TC and CC genotypes were found to increase the susceptibility to NAFLD compared to the TT genotype, with adjusted odds ratios (ORs) of 1.77 (95%CI: 1.16-2.72) and 2.80 (95%CI: 1.64-4.79), respectively. Further stratification analysis indicated that carriers of the CC genotype was more susceptible to insulin resistance (IR) than those of the TT genotype, with an OR of 3.24 (95%CI: 1.52-6.92). The CC genotype also was associated with a significantly higher risk of hypertension, hypertriglyceridemia, and low levels of high-density lipoprotein cholesterol (HDL) (P < 0.05). No association was found between the APOC3 (-455T>C) polymorphism and obesity, impaired glucose tolerance, hyperuricemia, hypercholesterolemia, or high levels of low-density lipoprotein cholesterol (LDL) (P > 0.05). CONCLUSION: APOC3 (-455T>C) genetic variation is involved in the susceptibility to developing NAFLD, IR, hypertension, hypertriglyceridemia, and low HDL in the Southern Chinese Han population. PMID:25320541

CD64-Neutrophil expression and stress metabolic patterns in early sepsis and severe traumatic brain injury in children

PubMed Central

2013-01-01

Background Critical illness constitutes a serious derangement of metabolism. The aim of our study was to compare acute phase metabolic patterns in children with sepsis (S) or severe sepsis/septic shock (SS) to those with severe traumatic brain injury (TBI) and healthy controls (C) and to evaluate their relations to neutrophil, lymphocyte and monocyte expressions of CD64 and CD11b. Methods Sixty children were enrolled in the study. Forty-five children with systemic inflammatory response syndrome (SIRS) were classified into three groups: TBI (n = 15), S (n = 15), and SS (n = 15). C consisted of 15 non- SIRS patients undergoing screening tests for minor elective surgery. Blood samples were collected within 6 hours after admission for flow cytometry of neutrophil, lymphocyte and monocyte expression of CD64 and CD11b (n = 60). Procalcitonin (PCT), C-reactive protein (CRP), glucose, triglycerides (TG), total cholesterol (TC), high (HDL) or low-density-lipoproteins (LDL) were also determined in all groups, and repeated on day 2 and 3 in the 3 SIRS groups (n = 150). Results CRP, PCT and TG (p < 0.01) were significantly increased in S and SS compared to TBI and C; glucose did not differ among critically ill groups. Significantly lower were the levels of TC, LDL, and HDL in septic groups compared to C and to moderate changes in TBI (p < 0.0001) but only LDL differed between S and SS (p < 0.02). Among septic patients, PCT levels declined significantly (p < 0.02) with time, followed by parallel decrease of HDL (p < 0.03) and increase of TG (p < 0.02) in the SS group. Neutrophil CD64 (nCD64) expression was higher in patients with SS (81.2%) and S (78.8%) as compared to those with TBI (5.5%) or C (0.9%, p < 0.0001). nCD64 was positively related with CRP, PCT, glucose, and TG (p < 0.01) and negatively with TC, LDL, and HDL (p < 0.0001), but not with severity of illness, hematologic indices, length of stay or mechanical

Evaluation of Antiatherogenic Properties of Ezetimibe Using 3H-Labeled Low-Density-Lipoprotein Cholesterol and 99mTc-cAbVCAM1-5 SPECT in ApoE-/- Mice Fed the Paigen Diet.

PubMed

Dumas, Laurent S; Briand, François; Clerc, Romain; Brousseau, Emmanuel; Montemagno, Christopher; Ahmadi, Mitra; Bacot, Sandrine; Soubies, Audrey; Perret, Pascale; Riou, Laurent M; Devoogdt, Nick; Lahoutte, Tony; Barone-Rochette, Gilles; Fagret, Daniel; Ghezzi, Catherine; Sulpice, Thierry; Broisat, Alexis

2017-07-01

The addition of ezetimibe, an intestinal cholesterol absorption inhibitor, to statin therapy has recently shown clinical benefits in the Improved Reduction of Outcomes: Vytorin Efficacy International Trial by reducing low-density-lipoprotein (LDL) cholesterol levels more than statin therapy alone. Here, we investigated the mechanisms by which inhibition of intestinal cholesterol absorption might contribute to the clinically observed reduction in cardiovascular events by evaluating its effect on inflammatory plaque development in apolipoprotein E -/- mice. Methods: Apolipoprotein E -/- mice were fed the Paigen diet (1.25% cholesterol, 0.5% cholic acid, and 15% fat) without or with ezetimibe (7 mg/kg/d) for 6 wk. In a first set of mice ( n = 15), we intravenously injected 3 H-cholesteryl oleate-labeled human LDL to test whether ezetimibe promotes LDL-derived cholesterol fecal excretion. In a second set ( n = 20), we used the imaging agent 99m Tc-cAbVCAM1-5 to evaluate expression of an inflammatory marker, vascular cell adhesion molecule 1 (VCAM-1), in atherosclerotic plaques. In a third set ( n = 21), we compared VCAM-1 expression with 99m Tc-cAbVCAM1-5 uptake in various tissues. Results: Mice treated with ezetimibe showed a 173% higher LDL-cholesteryl ester plasma disappearance rate ( P < 0.001 vs. control) after 3 H-cholesteryl oleate-labeled LDL injection. At 96 h after injection, the hepatic fraction of 3 H-tracer was 61% lower in mice treated with ezetimibe ( P < 0.001). Meanwhile, LDL-derived 3 H-cholesterol excretion in the feces was 107% higher ( P < 0.001). The antiatherogenic effect of ezetimibe monitored by 99m Tc-cAbVCAM1-5 SPECT showed a 49% reduction in aortic tracer uptake (percentage injected dose per cubic centimeter, 0.95 ± 0.04 vs. 1.87 ± 0.11; P < 0.01). In addition to hypercholesterolemia, the proinflammatory Paigen diet significantly increased VCAM-1 expression with respect to the control group in various tissues, including the aorta, and this

[Effects of silkworm pupa oil on serum lipids level and platelet function in rats].

PubMed

Yang, Xuefeng; Huang, Lianzhen; Hu, Jianping; Li, Tao

2002-08-01

To observe the effects of silkworm pupa oil on serum lipids level and platelet function in rats, according to serum TG, TC level, 40 male Wistar rats are divided into four groups (normal control group, high fat control group, silkworm pupa oil group and silkworm pupa oil + VE group). The rats are fed different diets and six weeks later, serum lipids level and platelet function are measured. The results show that (1) Compared with high fat control group, serum TC, TG, LDL-C level, AI value, Platelet aggregability, plasma TXB2 level and T/P ratio decrease significantly while HDL-C level and 6-k-PGF1 level increase in silkworm pupa oil group; (2) Serum TC, LDL-C level, T/P ratio and platelet aggregability are significantly lower in silkworm pupa oil + VE group than in silkworm pupa oil group. It is suggested that silkworm pupa oil rich in alpha-linolenic acid can reduce serum lipids level and inhibit platelet aggregation, which is more effective with the supplementation with VE.

Lp-PLA2 silencing protects against ox-LDL-induced oxidative stress and cell apoptosis via Akt/mTOR signaling pathway in human THP1 macrophages.

PubMed

Zheng, HuaDong; Cui, DaJiang; Quan, XiaoJuan; Yang, WeiLin; Li, YingNa; Zhang, Lin; Liu, EnQi

2016-09-02

Atherosclerosis is a disease of the large- and medium-size arteries that is characterized by the formation of atherosclerotic plaques, in which foam cells are the characteristic pathological cells. However, the key underlying pathomechanisms are still not fully elucidated. In this study, we investigated the role of lipoprotein-associated phospholipase A2 (Lp-PLA2) in ox-LDL-induced oxidative stress and cell apoptosis, and further, elucidated the potential machanisms in human THP1 macrophages. Flow cytometry and western blot analyses showed that both cell apoptosis and Lp-PLA2 expression were dose-dependently elevated after ox-LDL treatment for 24 h and also time-dependently increased after 50 mg/L ox-LDL incubation in THP1 macrophages. In addition, Lp-PLA2 silencing decreased ox-LDL-induced Lp-PLA2 and CD36 expression in THP1 macrophages. We also found that the levels of oil red O-staining, triglyceride (TG) and total cholesterol (TC) were significantly upregulated in ox-LDL-treated THP1 cells, but inhibited by Lp-PLA2 silencing. Furthermore, ox-LDL treatment resulted in significant increases of ROS and MDA but a marked decrease of SOD, effects that were reversed by Lp-PLA2 silencing in THP1 cells. Lp-PLA2 silencing reduced ox-LDL-induced cell apoptosis and caspase-3 expression in THP1 cells. Moreover, Lp-PLA2 siRNA transfection dramatically lowered the elevated levels of p-Akt and p-mTOR proteins in ox-LDL-treated THP1 cells. Both PI3K inhibitor LY294002 and mTOR inhibitor rapamycin decreased the augmented caspase-3 expression and TC content induced by ox-LDL, respectively. Taken together, these results revealed that Lp-PLA2 silencing protected against ox-LDL-induced oxidative stress and cell apoptosis via Akt/mTOR signaling pathway in human THP1 macrophages. Copyright © 2016 Elsevier Inc. All rights reserved.

Effect of resistance training on C-reactive protein, blood glucose and lipid profile in older women with differing levels of RT experience.

PubMed

Ribeiro, Alex S; Tomeleri, Crisieli M; Souza, Mariana F; Pina, Fábio Luiz C; Schoenfeld, Brad J; Nascimento, Matheus A; Venturini, Danielle; Barbosa, Décio S; Cyrino, Edilson S

2015-12-01

The purpose of this study was to analyze the effects of a progressive resistance training (RT) program on C-reactive protein (CRP), blood glucose (GLU), and lipid profile in older women with differing levels of RT experience. Sixty-five older women (68.9 ± 6.1 years, 67.1 ± 13.1 kg) were separated according to RT experience: an advanced group composed by 35 participants who previously carried out 24 weeks of RT and a novice group composed by 30 participants without previous experience in RT (n = 30). Both groups performed a RT program comprised of eight exercises targeting all the major muscles. Training was carried out 3 days/week for 8 weeks. Serum triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), GLU, and CRP concentrations were determined pre- and post- intervention after 12 h fasting. A significant group by time interaction (P < 0.05) for the TC (novice = -1.9% vs. advanced = 1.0%), and CRP (novice = -22.9% vs. advanced = -54.5%) was observed. A main effect of time (P < 0.05) was identified for the GLU (novice = -2.6% vs. advanced = -6.6%), TG (novice = -12.9% vs. advanced = -5.7%), HDL-C (novice = +6.7% vs. advanced = +2.6%), and LDL-C (novice = -34.0% vs. advanced = -25.4%). These results suggest that RT improves the metabolic profile of older women and that training for a longer period of time seems to produce more pronounced reductions mainly on CRP.

Effect of Hydrogenated, Liquid and Ghee Oils on Serum Lipids Profile

PubMed Central

Mohammadifard, Noushin; Nazem, Masoud; Naderi, Gholam-Ali; Saghafian, Faezeh; Sajjadi, Firoozeh; Maghroon, Maryam; Bahonar, Ahmad; Alikhasi, Hasan; Nouri, Fatemeh

2010-01-01

BACKGROUND Trans fatty acids are known as the most harmful type of dietary fats, so this study was done to compare the effects of hydrogenated, liquid and ghee oils on serum lipids profile of healthy adults. METHODS This study was a randomized clinical trial conducted on 129 healthy participants aged from 20 to 60 years old who were beneficiaries of Imam-e-Zaman charitable organization. Subjects were randomly divided into 3 groups and each group was treated with a diet containing cooking and frying liquid, ghee, or hydrogenated for 40 days. Fasting serum lipids, including total cholesterol (TC), triglyceride (TG), LDL-cholesterol (LDL-C), HDL-cholesterol (HDL-C), apoprotein A (Apo A), and apoprotein B (Apo B) were measured before and after the study. RESULTS TC, TG and Apo B had a significant reduction in the liquid oil group compared to the hydrogenated oil group. In the ghee group TG declined and Apo A increased significantly (P < 0.01). Liquid oil group had a significant reduction in HDL-C, compared to the ghee oil group (P < 0.05). CONCLUSION It was concluded that consuming liquid oil along with frying oil caused to reduce all serum lipid levels. However, ghee oil only reduced TG and increased HDL-C levels. PMID:22577408

Exome-wide association study of plasma lipids in >300,000 individuals

PubMed Central

Liu, Dajiang J.; Peloso, Gina M.; Yu, Haojie; Butterworth, Adam S.; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L.; Auer, Paul L.; Baber, Usman; Ballantyne, Christie M.; Bang, Lia E.; Benn, Marianne; Bis, Joshua C.; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P.; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J; Chambers, John C; Chasman, Daniel I.; Chen, Y. Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y.; Connell, John M; Cucca, Francesco; Cupples, L. Adrienne; Damrauer, Scott M.; Davies, Gail; Deary, Ian J; Dedoussis, George; Denny, Joshua C.; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W.; Frayling, Timothy M.; Frikke-Schmidt, Ruth; Fritsche, Lars; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K.; Gao, Wei; Garcia, Melissa E.; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O.; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L.; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B.; Hayward, Caroline; Hirschhorn, Joel N.; Holmen, Oddgeir L.; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B; Jørgensen, Marit E.; Jukema, J. Wouter; Justesen, Johanne M.; Kamstrup, Pia R.; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V.; Klarin, Derek; Koistinen, Heikki A.; Kooner, Jaspal S; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J.; Lauritzen, Torsten; Liewald, David CM; Lin, Li An; Linneberg, Allan; Loos, Ruth J.F.; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K.; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas GD; Maschio, Andrea; Meigs, James B.; Melander, Olle; Metspalu, Andres; Morris, Andrew P; Morrison, Alanna C.; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B.; Neville, Matt J; Nielsen, Jonas B.; Nielsen, Sune F; Nordestgaard, Børge G; Ordovas, Jose M.; Mehran, Roxana; O’Donnell, Christoper J.; Orho-Melander, Marju; Molony, Cliona M.; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin NA; Pasko, Dorota; Patel, Aniruddh P.; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M.; Rader, Daniel J.; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot; Reiner, Alex P.; Renström, Frida; Rich, Stephen S; Ridker, Paul M; Rioux, John D.; Robertson, Neil R; Roden, Dan M.; Rotter, Jerome I.; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M.; Scott, Robert A.; Sever, Peter; Sevilla, Raquel S.; Shaffer, Christian M.; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S; Smith, Albert V.; Smith, Blair H; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D; Speliotes, Elizabeth K.; Starr, John M; Stirrups, Kathleen E; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M; Surendran, Praveen; Tada, Hayato; Tall, Alan R.; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D; Trompet, Stella; Tsao, Philip S.; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R; Varbo, Anette; Varga, Tibor V; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J.; Warren, Helen R; Weeke, Peter E.; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G.; Wilson, Peter W. F.; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S.; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna MM; Danesh, John; McCarthy, Mark I; Cowan, Chad; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J.; Kathiresan, Sekar

2017-01-01

We screened DNA sequence variants on an exome-focused genotyping array in >300,000 participants with replication in >280,000 participants and identified 444 independent variants in 250 loci significantly associated with total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and/or triglycerides (TG). At two loci (JAK2 and A1CF), experimental analysis in mice revealed lipid changes consistent with the human data. We utilized mapped variants to address four clinically relevant questions and found the following: (1) beta-thalassemia trait carriers displayed lower TC and were protected from coronary artery disease; (2) outside of the CETP locus, there was not a predictable relationship between plasma HDL-C and risk for age-related macular degeneration; (3) only some mechanisms of lowering LDL-C seemed to increase risk for type 2 diabetes; and (4) TG-lowering alleles involved in hepatic production of TG-rich lipoproteins (e.g., TM6SF2, PNPLA3) tracked with higher liver fat, higher risk for type 2 diabetes, and lower risk for coronary artery disease whereas TG-lowering alleles involved in peripheral lipolysis (e.g., LPL, ANGPTL4) had no effect on liver fat but lowered risks for both type 2 diabetes and coronary artery disease. PMID:29083408

Synergetic cholesterol-lowering effects of main alkaloids from Rhizoma Coptidis in HepG2 cells and hypercholesterolemia hamsters.

PubMed

Kou, Shuming; Han, Bing; Wang, Yue; Huang, Tao; He, Kai; Han, Yulong; Zhou, Xia; Ye, Xiaoli; Li, Xuegang

2016-04-15

Hyperlipidemia contributes to the progression of cardiovascular diseases. Main alkaloids from Rhizoma Coptidis including berberine (BBR), coptisine (COP), palmatine (PAL), epiberberine (EPI) and jatrorrhizine (JAT), improved dyslipidemia in hypercholesterolemic hamsters to a different degree. In this study, HepG2 cells and hypercholesterolemic hamsters were used to investigate the synergetic cholesterol-lowering efficacy of these five main alkaloids. The cellular lipid and cholesterol accumulation and in HepG2 cells were evaluated by Oil Red O staining and HPLC analysis. LDL receptor, 3-Hydroxy-3-methylglutaryl CoA reductase (HMGCR) and cholesterol 7-alpha-hydroxylase (CYP7A1) that involving cholesterol metabolism in HepG2 cells were measured by qRT-PCR, western blot and immunofluorescence analysis. The serum profiles including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-c) and high-density lipoprotein cholesterol (HDL-c), as well as TC and total bile acids (TBA) of feces in hypercholesterolemic hamsters were also measured. As compared to single alkaloids, the combination of five main alkaloids (COM) reduced the lipid and cholesterol accumulation in HepG2 cells more effectively and performed an advantageous effect on controlling TC, TG, LDL-c and HDL-c in hypercholesterolemic hamsters. More effective reduction of TBA and TC levels in feces of hamsters were achieved after the administration of COM. These effects were derived from the up-regulation of LDL receptor and CYP7A1, as well as HMGCR downregulation. Our results demonstrated that COM showed a synergetic cholesterol-lowering efficacy, which was better than single alkaloids and it might be considered as a potential therapy for hypercholesterolemia. Copyright © 2016 Elsevier Inc. All rights reserved.

Hypolipidaemic Effect of Hericium erinaceum Grown in Artemisia capillaris on Obese Rats.

PubMed

Choi, Won-Sik; Kim, Young-Sun; Park, Byeoung-Soo; Kim, Jang-Eok; Lee, Sung-Eun

2013-06-01

In this study, ethanolic extracts from Hericium erinaceum cultivated with Artemisia capillaris (HEAC) were assessed for their ability to lower the cholesterol levels of male Sprague-Dawley rats fed a high-fat diet. Rats were randomly subdivided into seven test groups. Each group contained eight rats fed a high-fat diet during a growth period lasting 4 wk. Supplementation with the extracts was performed once a day for 2 wk after the high-fat diet. The control group (rats fed a high-fat diet) showed a high efficiency ratio (feed efficiency ratio) value compared to the normal group. Biochemical parameters, including total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-c), and triglyceride (TG) levels dramatically increased in the control group compared to the normal group. High-density lipoprotein-cholesterol (HDL-c) content in the control group was also significantly lower relative to the normal group. Two positive control groups, treated with simvastatin and atorvastatin, had lowered TC, LDL-c, and TG levels, and increased HDL-c content compared to the control group. Treatment with the tested extracts, including HEAC, ethanolic extracts from Hericium erinaceum, and ethanolic extracts from Artemisia capillaris reduced TC, LDL-c, and TG levels and elevated HDL-c content in the hyperlipidemia rats. The atherogenic index and cardiac risk factor values for the HEAC-treated group were 0.95 and 1.95, respectively. Simvastatin- and atorvastatin-treated groups showed atherogenic index values of 1.56 and 1.69, respectively, and cardiac risk factor values of 2.56 and 2.69, respectively. These results show HEAC possesses an ability to cure hyperlipidemia in rats and may serve as an effective natural medicine for treating hyperlipidemia in humans.

The association between lipid parameters and obesity in university students.

PubMed

Hertelyova, Z; Salaj, R; Chmelarova, A; Dombrovsky, P; Dvorakova, M C; Kruzliak, P

2016-07-01

Abdominal obesity is associated with high plasma triglyceride and with low plasma high-density lipoprotein cholesterol levels. Objective of the study was to find an association between plasma lipid and lipoprotein levels and anthropometric parameters in abdominal obesity in Slovakian university students. Lipid profile and anthropometric parameters of obesity were studied in a sample of 419 probands, including 137 men and 282 women. Males had higher values of non-high-density lipoprotein cholesterol (non-HDL-C), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG) and very low-density lipoprotein cholesterol (VLDL-C) than females, but these differences were not significant. Females had significantly (P < 0.05) higher TC and HDL-C (P < 0.001) than males. In comparison, all anthropometric parameters in the males were significantly (P < 0.001) higher than in the females. A positive correlation between non-HDL-C, TG, VLDL-C and anthropometric parameters (BMI, WC, WHR, WHtR) was found at P < 0.001. LDL was positively correlated with BMI, WCF, WHtR and TC with BMI, WHtR at P < 0.001. We also observed a correlation between TC-WCF and LDL-WHR at P < 0.01. A negative correlation was found between HDL and all monitored anthropometric parameters at P < 0.001. On the other hand, no correlation between TC and WHR was detected. This study shows an association between plasma lipid and lipoprotein levels and anthropometric parameters in abdominal obesity in young people, predominantly university students.

Telecom 2-B and 2-C (TC2B and TC2C)

NASA Technical Reports Server (NTRS)

Dulac, J.; Alvarez, H.

1991-01-01

The DSN (Deep Space Network) mission support requirements for Telecom 2-B and 2-C (TC2B and TC2C) are summarized. These Telecom missions will provide high-speed data link applications, telephone, and television service between France and overseas territories as a follow-on to TC2A. Mission objectives are outlined and the DSN support requirements are defined through the presentation of tables and narratives describing the spacecraft flight profile; DSN support coverage; frequency assignments; support parameters for telemetry, command and support systems; and tracking support responsibility.

Associated liver enzymes with hyperlipidemic profile in type 2 diabetes patients.

PubMed

Al-Jameil, Noura; Khan, Farah A; Arjumand, Sadia; Khan, Mohammad F; Tabassum, Hajera

2014-01-01

Type 2 diabetes mellitus (T2DM) is characterized by hyperglycemia and is associated with dyslipidemia and disturbed liver function. Aim of the present work is to assess the liver enzymes and to find its association with hyperlipidemic profile in T2DM. Total of 157 subjects were studied and divided into two groups; diabetes (n=81) and non-diabetes (n=76). Various biochemical parameters like fasting glucose, post prandial glucose, HbA1c, total cholesterol (TC), triglycerides (Tg), high density lipoprotein cholesterol (HDL-C), alanine amino transferase (ALT), aspartate amino transferase (AST) and gamma-glutamyl transferase (GGT) were analyzed by ROCHE module Cobas 6000 (C501 & C601) analyzer, kits were procured by ROCHE diagnostics. Low density lipoprotein cholesterol (LDL-C) was estimated by Freidwald's formula. Statistical analysis was performed by applying student t test and Pearson's correlation coefficient, at 0.0001 and 0.05 level of significance, respectively. All the glycemic control parameters, lipid profile parameters except HDL-C and liver enzymes were found increased in diabetes group and significantly differ from non-diabetes group (p>0.0001). ALT showed significant positive correlation with fasting glucose, post prandial glucose, HbA1c, TC, Tg, LDL-C and GGT at p>0.05. AST showed very weak relation with all parameters while GGT was positively associated with fasting glucose, post prandial glucose, HbA1c, TC, Tg, LDL-C and ALT at p>0.05. In conclusion, T2DM incline to elevate liver enzymes, especially ALT and GGT were of significance. Routine screening of ALT and GGT in T2DM patients may assists early detection of liver abnormalities and to arrest the progress of disease.

Comparison of cardiovascular protective effects of tropical seaweeds, Kappaphycus alvarezii, Caulerpa lentillifera, and Sargassum polycystum, on high-cholesterol/high-fat diet in rats.

PubMed

Matanjun, Patricia; Mohamed, Suhaila; Muhammad, Kharidah; Mustapha, Noordin Mohamed

2010-08-01

This study was designed to investigate the comparative in vivo cardiovascular protective effects of red, green, and brown tropical seaweeds, namely, Kappaphycus alvarezii (or Eucheuma cottonii), Caulerpa lentillifera, and Sargassum polycystum, in rats fed on high-cholesterol/high-fat (HCF) diets. Male Sprague-Dawley rats (weighing 260-300 g) on the HCF diet had significantly increased body weight, plasma total cholesterol (TC), plasma low-density lipoprotein cholesterol (LDL-C), plasma triglycerides (TG), lipid peroxidation, and erythrocyte glutathione peroxidase (GSH-Px) and superoxide dismutase levels after 16 weeks. Supplementing 5% seaweeds to HCF diet significantly reduced plasma TC (-11.4% to -18.5%), LDL-C (-22% to -49.3%), and TG (-33.7% to -36.1%) levels and significantly increased HDL-C levels (16.3-55%). Among the seaweeds, S. polycystum showed the best anti-obesity and blood GSH-Px properties, K. alvarezii showed the best antihyperlipemic and in vivo antioxidation effects, and C. lentillifera was most effective at reducing plasma TC. All seaweeds significantly reduced body weight gain, erythrocyte GSH-Px, and plasma lipid peroxidation of HCF diet rats towards the values of normal rats.

High-dose ascorbic acid decreases cholesterolemic factors of an atherogenic diet in guinea pigs.

PubMed

Filis, Konstantinos; Anastassopoulou, Aikaterini; Sigala, Fragiska; Theodorou, Dimitrios; Manouras, Andreas; Leandros, Emanouel; Sigalas, Panagiotis; Hepp, Wolfgang; Bramis, John

2007-03-01

The study evaluates the effect of a high supplemental dose of ascorbic acid (AA) on plasma concentrations of total cholesterol (TC), triglycerides (TG), total lipids (TL), and lipoprotein fractions high-density, very-low-density-, and low-density lipoprotein (HDL, VLDL, LDL) in guinea pigs fed with atherogenic diet. Group I consisted of 5 normally fed guinea pigs plus a low dose of AA (1 mg/100 g/day), group II consisted of 7 guinea pigs fed with food enriched with 2% cholesterol plus a low dose of AA (1 mg/100 g/day), and group III consisted of 7 guinea pigs fed with food enriched with 2% cholesterol plus a high dose of AA (30 mg/100 g/day). Cholesterolemic factors concentrations were determined after nine weeks. Concentrations of TC, TG, TL, LDL, and VLDL were increased in group II compared to group I (p < 0.01 for all differences). Supplementation with a high dose of AA resulted in decreased concentrations of TC (p < 0.01), TG (p < 0.01), TL (p < 0.01), and LDL (p < 0.01) in group III compared to group II. Additionally, concentration of HDL was increased in group III compared to group II (p < 0.01). High-dose AA supplementation to an atherogenic diet decreases concentrations of TC, TG, TL, and LDL and increases concentration of HDL compared to low-dose AA.

Low Birth Weight as a Predictor of Cardiovascular Risk Factors in Childhood and Adolescence? The PEP Family Heart Study

PubMed Central

Haas, Gerda-Maria; Liepold, Evelyn; Schwandt, Peter

2015-01-01

Background: Low birth weight is considered a risk factor for cardiovascular disease (CVD) in later life. Because data in children and adolescents are sparse and controversial, we assessed the association of birth weight with CVD risk factors in German youths. Methods: We categorized 843 urban children and adolescents aged 3-18 years by quintiles of birth weight and measured nine traditional risk factors in terms of body mass index (BMI), waist circumference (WC), systolic (SBP) and diastolic (DBP) blood pressure, total cholesterol (TC), LDL-C, HDL-C, Non HDL-C and triglycerides (TG). SPSS 21 was used for statistical analysis. Results: Mean values and prevalence of nine anthropometric and lipid risk variables were equally distributed over the five birth weight groups. Though risk factors clustered between 3.0 kg and 4.0 kg of birth weight in both genders we found only one significant correlation of birth weight with TG for males and females and another one for HDL-C in males. The strongest clustering of significant regression coefficients occurred in the 2nd birth weight quintile for SBP (ß 0.018), TC (ß -0.050), LDL-C (ß -0.039), non LDL-C (ß -0.049) and log TG (ß -0.001) in males and females. Conclusions: Overall we did not find significant associations between birth weight and nine traditional cardiovascular risk factors in children and adolescents. However, the 2nd quintile of birth weight might suggest clustering of risk factors. PMID:26900435

Effects of icosapent ethyl on lipid and inflammatory parameters in patients with diabetes mellitus-2, residual elevated triglycerides (200–500 mg/dL), and on statin therapy at LDL-C goal: the ANCHOR study

PubMed Central

2013-01-01

Background Icosapent ethyl (IPE) is a high-purity prescription form of eicosapentaenoic acid (EPA) ethyl ester indicated as an adjunct to diet to reduce triglyceride (TG) levels in adult patients with severe (≥500 mg/dL) hypertriglyceridemia. ANCHOR was a 12-week, phase 3 study that evaluated the efficacy and safety of IPE in patients (N = 702) with residual high fasting TG levels (≥200 and <500 mg/dL) despite having optimized low-density lipoprotein cholesterol (LDL-C) levels (≥40 and <100 mg/dL) on statin therapy. Among patients randomized to IPE (4 g/day or 2 g/day) or placebo, 514 (73%) had diabetes mellitus. Methods A post hoc subgroup analysis of the ANCHOR study was conducted to assess the effects of IPE on median placebo-adjusted percent change from baseline in efficacy end point parameters in 3 subgroups: total (all subjects with diabetes—overall median baseline glycosylated hemoglobin A1c [A1c] = 6.8%), better-controlled diabetes (below median baseline A1c), and less-controlled diabetes (above median baseline A1c). Results Baseline efficacy parameters were similar among all groups except high-sensitivity C-reactive protein (hsCRP), which was higher in the total and less-controlled diabetes groups. Compared with placebo, IPE 4 g/day significantly reduced TG, non-high-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol (VLDL-C), lipoprotein-associated phospholipase A2, apolipoprotein B (Apo B), total cholesterol, high-density lipoprotein cholesterol, VLDL-TG, oxidized LDL, and remnant-like particle cholesterol in all 3 diabetes groups, LDL-C in the total diabetes group, and hsCRP in the total and less-controlled diabetes groups. Decreases in hsCRP and Apo B were much greater in patients with less-controlled diabetes. There were no significant increases in fasting plasma glucose, A1c, insulin, or homeostasis model assessment-estimated insulin resistance in any group. Conclusion IPE 4 g/day significantly improved

Association of the rs7395662 SNP in the MADD-FOLH1 and Several Environmental Factors with Serum Lipid Levels in the Mulao and Han Populations

PubMed Central

Huang, Ke-Ke; Yin, Rui-Xing; Zeng, Xiao-Na; Huang, Ping; Lin, Quan-Zhen; Wu, Jian; Guo, Tao; Wang, Wei; Yang, De-Zhai; Lin, Wei-Xiong

2013-01-01

Background: The rs7395662 single nucleotide polymorphism (SNP) in the MADD-FOLH1 has been associated with serum lipid traits, but the results are inconsistent in different populations. The present study was undertaken to investigate the association of rs7395662 SNP and several environmental factors with serum lipid levels in the Guangxi Mulao and Han populations. Method: A total of 721 subjects of Mulao and 727 subjects of Han Chinese were randomly selected from our previous stratified randomized samples. Genotyping of the SNP was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and confirmed by direct sequencing. Results: Serum apolipoprotein (Apo) B levels were higher in Mulao than in Han (P < 0.01). The allelic and genotypic frequencies in Han were different between males and females (P < 0.05 for each), but there was no difference between Mulao and Han or between Mulao males and females. The levels of low-density lipoprotein cholesterol (LDL-C) and ApoB in Mulao females were different among the genotypes (P < 0.05), the G allele carriers had higher LDL-C and ApoB levels than the G allele non-carriers. The levels of total cholesterol (TC), triglyceride (TG), LDL-C and ApoB in Han males and TC, TG and high-density lipoprotein cholesterol (HDL-C) in Han females were different among the genotypes (P < 0.05-0.01), the subjects with GG genotype in Han males had higher TC, TG, and ApoB and lower LDL-C levels than the subjects with AA or AG genotype, and the G allele carriers in Han females had lower TC and HDL-C levels than the G allele non-carriers. The levels of LDL-C and ApoB in Mulao females were correlated with the genotypes (P < 0.05 for each). The levels of HDL-C and ApoAI in Han males and HDL-C in Han females were correlated with genotypes (P < 0.05-0.001). Serum lipid parameters were also correlated with several environmental factors in both ethnic groups (P < 0.05-0.01). Conclusion: The

The Associations of Serum Lipids with Vitamin D Status.

PubMed

Wang, Ying; Si, Shaoyan; Liu, Junli; Wang, Zongye; Jia, Haiying; Feng, Kai; Sun, Lili; Song, Shu Jun

2016-01-01

Vitamin D deficiency has been associated with some disorders including cardiovascular diseases. Dyslipidemia is a major risk factor for cardiovascular diseases. However, data about the relationships between vitamin D and lipids are inconsistent. The relationship of vitamin D and Atherogenic Index of Plasma (AIP), as an excellent predictor of level of small and dense LDL, has not been reported. The objective of this study was to investigate the effects of vitamin D status on serum lipids in Chinese adults. The study was carried out using 1475 participants from the Center for Physical Examination, 306 Hospital of PLA in Beijing, China. Fasting blood samples were collected and serum concentrations of 25(OH)D, total cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDL-C) and low density lipoprotein cholesterol (LDL-C) were measured. AIP was calculated based on the formula: log [TG/HDL-C]. Multiple linear regression analysis was used to estimate the associations between serum 25(OH)D and lipids. The association between the occurrences of dyslipidemias and vitamin D levels was assessed by multiple logistic regression analysis. Confounding factors, age and BMI, were used for the adjustment. The median of serum 25(OH)D concentration was 47 (27-92.25) nmol/L in all subjects. The overall percentage of 25(OH)D ≦ 50 nmol/L was 58.5% (males 54.4%, females 63.7%). The serum 25(OH)D levels were inversely associated with TG (β coefficient = -0.24, p < 0.001) and LDL-C (β coefficient = -0.34, p < 0.001) and positively associated with TC (β coefficient = 0.35, p < 0.002) in men. The associations between serum 25(OH)D and LDL-C (β coefficient = -0.25, p = 0.01) and TC (β coefficient = 0.39, p = 0.001) also existed in women. The serum 25(OH)D concentrations were negatively associated with AIP in men (r = -0.111, p < 0.01) but not in women. In addition, vitamin D deficient men had higher AIP values than vitamin D sufficient men. Furthermore, the

A single nucleotide polymorphism -1131T>C in the apolipoprotein A5 gene is associated with an increased risk of coronary artery disease and alters triglyceride metabolism in Chinese.

PubMed

Bi, Nan; Yan, Sheng-kai; Li, Guo-ping; Yin, Zhi-nong; Chen, Bao-sheng

2004-11-01

The disorder of triglyceride (TG) metabolism leading to hypertriglyceridemia is an independent risk factor for coronary artery disease (CAD). Variants in the newly identified apolipoprotein APOA5 gene were found to be strongly associated with elevated TG levels in different racial groups. In this study, we investigated the phenotypic effects of two polymorphisms (APOA5-1131T>C and APOC3-482C>T) on susceptibility to CAD in 312 Chinese CAD patients diagnosed by angiography. The frequency of the APOA5-1131C allele in these patients was significantly higher than that of the control group (39.9 vs. 33.3%, P=0.02). Compared with the wild type TT, CC homozygotes had a significantly increased CAD risk (OR=1.93 and OR=1.80 using unadjusted and adjusted logistic regression models, respectively). This association still existed after adjustment for the APOC3-482 variant. The APOA5-1131C allele also showed a correlation with increasing plasma TG levels (P<0.001). These data suggest that the APOA5-1131T>C polymorphism might contribute to an increased risk of CAD among Chinese as a result of its effect on TG metabolism; this effect was found to be independent of the APOC3-482C>T variant.

Differing predictive relationships between baseline LDL-C, systolic blood pressure, and cardiovascular outcomes.

PubMed

Deedwania, Prakash C; Pedersen, Terje R; DeMicco, David A; Breazna, Andrei; Betteridge, D John; Hitman, Graham A; Durrington, Paul; Neil, Andrew

2016-11-01

Traditional cardiovascular risk factors, such as hypertension and dyslipidemia, predispose individuals to cardiovascular disease, particularly patients with diabetes. We investigated the predictive value of baseline systolic blood pressure (SBP) and low-density lipoprotein cholesterol (LDL-C) on the risk of vascular outcomes in a large population of patients at high risk of future cardiovascular events. Data were pooled from the TNT (Treating to New Targets), CARDS (Collaborative Atorvastatin Diabetes Study), and IDEAL (Incremental Decrease in End-Points Through Aggressive Lipid Lowering) trials and included a total of 21,727 patients (TNT: 10,001; CARDS: 2838; IDEAL: 8888). The effect of baseline SBP and LDL-C on cardiovascular events, coronary events, and stroke was evaluated using a multivariate Cox proportional-hazards model. Overall, risk of cardiovascular events was significantly higher for patients with higher baseline SBP or LDL-C. Higher baseline SBP was significantly predictive of stroke but not coronary events. Conversely, higher baseline LDL-C was significantly predictive of coronary events but not stroke. Results from the subgroup with diabetes (5408 patients; TNT: 1501; CARDS: 2838; IDEAL: 1069) were broadly consistent with those of the total cohort: baseline SBP and LDL-C were significantly predictive of cardiovascular events overall, with the association to LDL-C predominantly related to an effect on coronary events. However, baseline SBP was not predictive of either coronary or stroke events in the pooled diabetic population. In this cohort of high-risk patients, baseline SBP and LDL-C were significantly predictive of cardiovascular outcomes, but this effect may differ between the cerebrovascular and coronary systems. NCT00327691 (TNT); NCT00327418 (CARDS); NCT00159835 (IDEAL). Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A low-fat spread with added plant sterols and fish omega-3 fatty acids lowers serum triglyceride and LDL-cholesterol concentrations in individuals with modest hypercholesterolaemia and hypertriglyceridaemia.

PubMed

Blom, Wendy A M; Koppenol, Wieneke P; Hiemstra, Harry; Stojakovic, Tatjana; Scharnagl, Hubert; Trautwein, Elke A

2018-05-03

The primary and secondary objectives were to investigate the triglyceride (TG) and LDL-cholesterol (LDL-C) lowering effects of a spread with added plant sterols (PS) and fish oil as compared to a placebo spread. This study had a randomized, double-blind, placebo-controlled, parallel group design with two intervention arms. Following a 2-week placebo run-in period, 260 healthy individuals with modestly elevated blood TG (≥ 1.4 mmol/L) and LDL-C (≥ 3.4 mmol/L) concentrations consumed either the placebo or intervention spread for 4 weeks. The intervention spread contained 2.0 g/day PS and 1.0 g/day eicosapentaenoic acid (EPA) + docosahexanoic acid (DHA) from fish oil. Fasting serum lipids and apolipoproteins (Apo) (exploratory) were measured at the end of the run-in and intervention phases. Four-week consumption of the intervention spread resulted in significantly lower TG (- 10.6%, 95% CI - 16.0 to - 4.9%; P < 0.001) and LDL-C concentrations (- 5.2%; 95% CI - 7.8 to - 2.4%) as compared to placebo. Total cholesterol (- 3.9%; 95% CI - 6.1 to - 1.5%), non-HDL-C (- 5.4%; 95% CI - 8.1 to - 2.7%), remnant-cholesterol (- 8.1%; 95% CI - 3.4 to - 12.5%), ApoAII (- 2.9%; 95% CI - 5.5 to - 0.2%), ApoCIII (- 7.7%; 95% CI - 12.1 to - 3.1%) and ApoB (- 3.2%; 95% CI - 5.9 to - 0.4%) concentrations were also significantly lower, as compared to placebo. No significant treatment effects were found for HDL-cholesterol, ApoAI, ApoCII, Apo E or ApoB/ApoAI. Four-week consumption of the intervention spread led to significant and clinically relevant decreases in serum TG, LDL-C and other blood lipid concentrations. The study was registered at clinicaltrials.gov (NCT 02728583).

Vegan diet and blood lipid profiles: a cross-sectional study of pre and postmenopausal women.

PubMed

Huang, Yee-Wen; Jian, Zhi-Hong; Chang, Hui-Chin; Nfor, Oswald Ndi; Ko, Pei-Chieh; Lung, Chia-Chi; Lin, Long-Yau; Ho, Chien-Chang; Chiang, Yi-Chen; Liaw, Yung-Po

2014-04-08

Vegan diet has been associated with lower risk of cardiovascular diseases and mortality, partly due to its effects on serum lipid profiles. Lipid profiles [high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) and triglycerides (TG)] have not been fully elucidated either in pre and postmenopausal vegans or in ovo-lacto vegetarians. This study aimed to compare lipid profiles among vegans, ovo-lacto vegetarians and omnivores. Demographic data and lipid profiles were obtained from the 2002 Taiwanese Survey on Hypertension, Hyperglycemia and Hyperlipidemia. Multivariate linear regression analysis was used to examine factors significantly and independently associated with different categories of veganism and to estimate the β value of lipid profiles in the dietary types. A total of 2397 premenopausal and 1154 postmenopausal participants who did not receive lipid lowering drugs were enrolled. Premenopausal vegans had significantly lower HDL-C and higher TG, LDL-C/HDL-C, total cholesterol (TC)/HDL-C and TG/HDL-C compared with omnivores. For postmenopausal women, vegans had lower TC while ovo-lacto vegetarians were observed with low HDL-C when compared with omnivores. Multivariate linear regression analyses showed that vegan and ovo-lacto vegetarian diets decreased HDL-C levels in premenopausal women (β = -7.63, p = 0.001 and β = -4.87, p = 0.001, respectively). There were significant associations between lower LDL-C and ovo-lacto vegetarian diets (β = -7.14, p = 0.008) and also between TG and vegan diet (β = 23.37, p = 0.008), compared with omnivorous diet. Post-menopausal women reported to have consumed either a vegan or an ovo-lacto vegetarian diet were at the risk of having low HDL-C unlike those that consumed omnivorous diets (β = -4.88, p = 0.015 and β = -4.48, p = 0.047). There were no significant changes in LDL-C in both pre and postmenopausal vegans. Vegan diet was

Vegan diet and blood lipid profiles: a cross-sectional study of pre and postmenopausal women

PubMed Central

2014-01-01

Background Vegan diet has been associated with lower risk of cardiovascular diseases and mortality, partly due to its effects on serum lipid profiles. Lipid profiles [high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) and triglycerides (TG)] have not been fully elucidated either in pre and postmenopausal vegans or in ovo-lacto vegetarians. This study aimed to compare lipid profiles among vegans, ovo-lacto vegetarians and omnivores. Methods Demographic data and lipid profiles were obtained from the 2002 Taiwanese Survey on Hypertension, Hyperglycemia and Hyperlipidemia. Multivariate linear regression analysis was used to examine factors significantly and independently associated with different categories of veganism and to estimate the β value of lipid profiles in the dietary types. Results A total of 2397 premenopausal and 1154 postmenopausal participants who did not receive lipid lowering drugs were enrolled. Premenopausal vegans had significantly lower HDL-C and higher TG, LDL-C/HDL-C, total cholesterol (TC)/HDL-C and TG/HDL-C compared with omnivores. For postmenopausal women, vegans had lower TC while ovo-lacto vegetarians were observed with low HDL-C when compared with omnivores. Multivariate linear regression analyses showed that vegan and ovo-lacto vegetarian diets decreased HDL-C levels in premenopausal women (β = -7.63, p = 0.001 and β = -4.87, p = 0.001, respectively). There were significant associations between lower LDL-C and ovo-lacto vegetarian diets (β = -7.14, p = 0.008) and also between TG and vegan diet (β = 23.37, p = 0.008), compared with omnivorous diet. Post-menopausal women reported to have consumed either a vegan or an ovo-lacto vegetarian diet were at the risk of having low HDL-C unlike those that consumed omnivorous diets (β = -4.88, p = 0.015 and β = -4.48, p = 0.047). There were no significant changes in LDL-C in both pre and postmenopausal

APOA5-1131T>C genotype effects on apolipoprotein A5 and triglyceride levels in response to dietary intervention and regular exercise (DIRE) in hypertriglyceridemic subjects.

PubMed

Jang, Yangsoo; Chae, Jey Sook; Kim, Oh Yoen; Park, Hey Jun; Kim, Ji Young; Paik, Jean Kyung; Lee, Sang-Hyun; Lee, Jong Ho

2010-08-01

We aimed to determine the influence of apolipoprotein A5 gene (APOA5)-1131T>C single nucleotide polymorphism on the effects of dietary intervention and regular exercise (DIRE) targeting ApoA5 and triglyceride (TG) concentrations. Hypertriglyceridemia patients (TG, 150-500mg/dL, n=283) undertook a 12-week DIRE (replacing 1/3 of refined rice in their diets with legumes, increasing vegetable intake, and regular walking). Pre-treatment, no genotype-related differences were detected in ApoA5, TG, or HDL cholesterol levels; however, post-treatment, subjects homozygous (T/T) for the T allele had lower serum TG (P=0.009) and higher HDL cholesterol (P=0.036) than other subjects. In T/T subjects, after adjustments for age, sex and weight changes (r1) or initial TG levels (r2), changes in ApoA5 levels negatively correlated with TG changes (r1=-0.29, P=0.05, r2=-0.28, P<0.1) and positively correlated with changes in HDL cholesterol (r1=0.30, P<0.05, r2=0.32, P<0.05) and free fatty acid (r1=0.38, P<0.01, r2=0.40, P<0.01). In those with moderate hypertriglyceridemia (TG, 200-500mg/dL, n=130), APOA5-1131T/T carriers achieved significantly lower TG (P=0.007) and higher HDL cholesterol (P<0.001) than -1131C allele carriers. Additionally, statistically significant interactions between the -1131T>C and the compliance of DIRE were found for the change in TG (P=0.002) and HDL cholesterol (P=0.039). In good compliance group, T/T subjects showed greater reduction of TG and higher increase of HDL cholesterol than other subjects. On the other hand, non-good compliance group had no significant improvement in these variables. APOA5-1131T/T carriers may benefit more from the DIRE than C allele carriers. These effects were remarkable in patients with moderate hypertriglyceridemia and the individuals with good compliance. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Protective Effect of Pulp Oil Extracted from Canarium odontophyllum Miq. Fruit on Blood Lipids, Lipid Peroxidation, and Antioxidant Status in Healthy Rabbits

PubMed Central

Shakirin, Faridah Hanim; Azlan, Azrina; Ismail, Amin; Amom, Zulkhairi; Cheng Yuon, Lau

2012-01-01

The aim of this paper was to compare the effects of pulp and kernel oils of Canarium odontophyllum Miq. (CO) on lipid profile, lipid peroxidation, and oxidative stress of healthy rabbits. The oils are rich in SFAs and MUFAs (mainly palmitic and oleic acids). The pulp oil is rich in polyphenols. Male New Zealand white (NZW) rabbits were fed for 4 weeks on a normal diet containing pulp (NP) or kernel oil (NK) of CO while corn oil was used as control (NC). Total cholesterol (TC), HDL-C, LDL-c and triglycerides (TG) levels were measured in this paper. Antioxidant enzymes (superoxide dismutase and glutathione peroxidise), thiobarbiturate reactive substances (TBARSs), and plasma total antioxidant status (TAS) were also evaluated. Supplementation of CO pulp oil resulted in favorable changes in blood lipid and lipid peroxidation (increased HDL-C, reduced LDL-C, TG, TBARS levels) with enhancement of SOD, GPx, and plasma TAS levels. Meanwhile, supplementation of kernel oil caused lowering of plasma TC and LDL-C as well as enhancement of SOD and TAS levels. These changes showed that oils of CO could be beneficial in improving lipid profile and antioxidant status as when using part of normal diet. The oils can be used as alternative to present vegetable oil. PMID:22685623

Protective effect of pulp oil extracted from Canarium odontophyllum Miq. Fruit on blood lipids, lipid peroxidation, and antioxidant status in healthy rabbits.

PubMed

Shakirin, Faridah Hanim; Azlan, Azrina; Ismail, Amin; Amom, Zulkhairi; Yuon, Lau Cheng

2012-01-01

The aim of this paper was to compare the effects of pulp and kernel oils of Canarium odontophyllum Miq. (CO) on lipid profile, lipid peroxidation, and oxidative stress of healthy rabbits. The oils are rich in SFAs and MUFAs (mainly palmitic and oleic acids). The pulp oil is rich in polyphenols. Male New Zealand white (NZW) rabbits were fed for 4 weeks on a normal diet containing pulp (NP) or kernel oil (NK) of CO while corn oil was used as control (NC). Total cholesterol (TC), HDL-C, LDL-c and triglycerides (TG) levels were measured in this paper. Antioxidant enzymes (superoxide dismutase and glutathione peroxidise), thiobarbiturate reactive substances (TBARSs), and plasma total antioxidant status (TAS) were also evaluated. Supplementation of CO pulp oil resulted in favorable changes in blood lipid and lipid peroxidation (increased HDL-C, reduced LDL-C, TG, TBARS levels) with enhancement of SOD, GPx, and plasma TAS levels. Meanwhile, supplementation of kernel oil caused lowering of plasma TC and LDL-C as well as enhancement of SOD and TAS levels. These changes showed that oils of CO could be beneficial in improving lipid profile and antioxidant status as when using part of normal diet. The oils can be used as alternative to present vegetable oil.

Correlation of Serum Lipoprotein Ratios with Insulin Resistance in Infertile Women with Polycystic Ovarian Syndrome: A Case Control Study.

PubMed

Ghaffarzad, Aisa; Amani, Reza; Mehrzad Sadaghiani, Mahzad; Darabi, Masoud; Cheraghian, Bahman

2016-01-01

Dyslipidemia and insulin resistance (IR), occurring in most infertile women with polycystic ovarian syndrome (PCOS), increase the risk of cardiovascular disease (CVD) and type 2 diabetes. This study aimed to assess the relationships between lipoprotein ratios and IR in PCOS women. Thirty six infertile women with PCOS selected based on Androgen Excess Society (AES) criteria and 29 healthy women matched for age were recruited to this case-control study. After physical measurements, fasting serum glucose (Glu), insulin and lipid profile levels [triglycerides (TGs), total cholesterol (TC), low-density lipoproteincholesterol (LDL-C) and high-density lipoprotein-cholesterol (HDL-C)] were measured, while lipoprotein ratios (TC/HDL-C, LDL-C/HDL-C, TG/HDL-C) were calculated. IR was also calculated using homeostasis model assessment (HOMA)-IR. The optimal cutoffs of lipoprotein ratios in relation to HOMA-IR were calculated based on the Receiver Operating Characteristics (ROC) curve analysis using the area under curve (AUC). Waist circumference (WC), insulin levels, HOMA-IR, TG levels, and all lipoprotein ratios were significantly higher, while HDL-C was lower in PCOS group as compared to healthy controls. All lipoprotein ratios, TG levels, and WC are significantly correlated with insulin levels and HOMA-IR. Among lipoprotein ratios, the highest AUC of the ROC belonged to TG/HDL-C ratio with sensitivity of 63.6% and specificity of 84.4% (TG/HDL-C>3.19) as a marker of IR in infertile PCOS women. Lipoprotein ratios, particularly TG/HDL-C, are directly correlated with insulin levels and can be used as a marker of IR (HOMA-IR) in infertile PCOS patients.

[Effect of electroacupuncture stimulation of "Fenglong" (ST 40) on expression of inflammatory cytokines of celiac macrophages in hyperlipidemia rats].

PubMed

Tian, Jia-Yu; Wang, Qiong; Chen, Ying-Fang; Xiao, Ying; Yue, Wei; Zhang, Hong-Xing

2014-08-01

To observe the effect of electroacupuncture (EA) stimulation of "Fenglong" (ST 40) on celiac inflammatory factors in rats with hyperlipemia (HLP), so as to reveal its mechanism underlying improvement of HLP. A total of 40 SD rats were randomized into normal control, high fat forage, high fat + common forage, high fat + EA, and high fat + common forage+ EA groups, with 8 rats in each group. The HLP model was established by feeding the animals with high fat forage for 28 days. EA (2 mA, 2 Hz/100 Hz) was applied to bilateral ST 40 for 30 min, once daily for 28 days. Contents of plasma total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C) were detected by using an automatic biochemistry analyzer. Intercellular adhesion molecule-1 (ICAM-1), monocyte chemoattractant protein 1 (MCP-1), and interleukin-1 gamma (IL-1gamma) in macrophages of the abdominal cavity were detected using flow cytometry (FCM). Compared with the normal control group, the contents of plasma TC and LDL-C, and celiac macrophages' MCP-1, ICAM-1 and IL-1gamma contents were significantly increased in the high fat forage group and high fat + common forage group (P < 0.01). In comparison with the high fat forage group, contents of plasma TC and LDL-C, and macrophages' MCP-1, ICAM-1 and IL-1gamma were considerably down-regulated in the high fat + EA group (P < 0.01). Similarly, the levels of plasma TC and LDL-C, and macrophages' MCP-1, ICAM-1 and IL-1gamma were obviously lower in the high fat+ common forage+ EA group than in the high fat + common forage group (P < 0.01). No significant differences were found in plasma TG and HDL-C levels among the five groups (P > 0.05). EA stimulation of "Fenglong" (ST 40) has a role in down-regulating contents of plasma TC and LDL-C and celiac macrophages' MCP-1, ICAM-1 and IL-1gamma in the abdominal cavity in hyperlipemia rats, which may contribute to its effect in improving hyperlipemia.

Novel circulating lipid measurements for current dyslipidemias in non-treated patients undergoing coronary angiography: PCSK9, apoC3 and sdLDL-C.

PubMed

Li, Sha; Zhao, Xi; Zhang, Yan; Zhu, Cheng-Gang; Guo, Yuan-Lin; Wu, Na-Qiong; Xu, Rui-Xia; Qing, Ping; Gao, Ying; Sun, Jing; Liu, Geng; Dong, Qian; Li, Jian-Jun

2017-02-14

Plasma levels of proprotein convertase subtilisin/kexin type 9 (PCSK9), apolipoprotein C-III (apoC3) and small dense low density lipoprotein cholesterol (sdLDL-C), have been recently recognized as circulating atherosclerosis-related lipid measurements. We aimed to elucidate their associations with current dyslipidemias, and identify their levels at increased risk to dyslipidemia. A total of 1,605 consecutive, non-treated patients undergoing diagnostic/interventional coronary angiography were examined. Plasma PCSK9 and apoC3 levels were determined using a validated ELISA assay, and sdLDL-C was measured by the Lipoprint LDL System. Plasma levels of PCSK9, apoC3, and sdLDL-C were associated with the current dyslipidemias classification (all p<0.001). PCSK9 significantly conferred prediction of both hypercholesterolemia and combined hyperlipidemia at a level of 235 ng/ml; apoC3 levels for hypertriglyceridemia, hypercholesterolemia and combined hyperlipidemia were 80.0, 71.5, and 86.4 μg/ml, respectively; and sdLDL-C for hypertriglyceridemia, hypercholesterolemia, combined hyperlipidemia and hypo high density lipoprotein (HDL) cholesterolemia 3.5, 2.5, 4.5, and 2.5 mg/dl, respectively (all p<0.001 for area under the receiver-operating characteristic curve). In a polytomous logistic model comparing increasing LDL-C categories, the interactions with high PCSK9, apoC3, and sdLDL-C elevated gradually. Similarly, apoC3 and sdLDL-C showed elevated interaction with increased triglyceride categories, and only sdLDL-C showed interaction with decreased HDL cholesterol (HDL-C) categories. Furthermore, discordances of PCSK9, apoC3, and sdLDL-C with current dyslipidemias were observed. PCSK9, apoC3, and sdLDL-C showed significant interactions with current dyslipidemias, and were predictive in the screening. The substantial discordances with current dyslipidemias might provide novel view in lipid management and further cardiovascular benefit.

Novel circulating lipid measurements for current dyslipidemias in non-treated patients undergoing coronary angiography: PCSK9, apoC3 and sdLDL-C

PubMed Central

Li, Sha; Zhao, Xi; Zhang, Yan; Zhu, Cheng-Gang; Guo, Yuan-Lin; Wu, Na-Qiong; Xu, Rui-Xia; Qing, Ping; Gao, Ying; Sun, Jing; Liu, Geng; Dong, Qian; Li, Jian-Jun

2017-01-01

Plasma levels of proprotein convertase subtilisin/kexin type 9 (PCSK9), apolipoprotein C-III (apoC3) and small dense low density lipoprotein cholesterol (sdLDL-C), have been recently recognized as circulating atherosclerosis-related lipid measurements. We aimed to elucidate their associations with current dyslipidemias, and identify their levels at increased risk to dyslipidemia. A total of 1,605 consecutive, non-treated patients undergoing diagnostic/interventional coronary angiography were examined. Plasma PCSK9 and apoC3 levels were determined using a validated ELISA assay, and sdLDL-C was measured by the Lipoprint LDL System. Plasma levels of PCSK9, apoC3, and sdLDL-C were associated with the current dyslipidemias classification (all p<0.001). PCSK9 significantly conferred prediction of both hypercholesterolemia and combined hyperlipidemia at a level of 235 ng/ml; apoC3 levels for hypertriglyceridemia, hypercholesterolemia and combined hyperlipidemia were 80.0, 71.5, and 86.4 g/ml, respectively; and sdLDL-C for hypertriglyceridemia, hypercholesterolemia, combined hyperlipidemia and hypo high density lipoprotein (HDL) cholesterolemia 3.5, 2.5, 4.5, and 2.5 mg/dl, respectively (all p<0.001 for area under the receiver-operating characteristic curve). In a polytomous logistic model comparing increasing LDL-C categories, the interactions with high PCSK9, apoC3, and sdLDL-C elevated gradually. Similarly, apoC3 and sdLDL-C showed elevated interaction with increased triglyceride categories, and only sdLDL-C showed interaction with decreased HDL cholesterol (HDL-C) categories. Furthermore, discordances of PCSK9, apoC3, and sdLDL-C with current dyslipidemias were observed. PCSK9, apoC3, and sdLDL-C showed significant interactions with current dyslipidemias, and were predictive in the screening. The substantial discordances with current dyslipidemias might provide novel view in lipid management and further cardiovascular benefit. PMID:27713142

Early changes of blood lipid levels during psychotropic drug treatment as predictors of long-term lipid changes and of new onset dyslipidemia.

PubMed

Delacrétaz, Aurélie; Vandenberghe, Frederik; Gholam-Rezaee, Mehdi; Saigi Morgui, Nuria; Glatard, Anaïs; Thonney, Jacques; Solida-Tozzi, Alessandra; Kolly, Stéphane; Gallo, Sylfa Fassassi; Baumann, Philipp; Berney, Sylvie; Zulauff, Sandrine Valloton; Aubry, Jean-Michel; Hasler, Roland; Ebbing, Karsten; von Gunten, Armin; Conus, Philippe; Eap, Chin B

Cardiovascular diseases and dyslipidemia represent a major health issue in psychiatry. Many psychotropic drugs can induce a rapid and substantial increase of blood lipid levels. This study aimed to determine the potential predictive power of an early change of blood lipid levels during psychotropic treatment on long-term change and on dyslipidemia development. Data were obtained from a prospective study including 181 psychiatric patients with metabolic parameters monitored during the first year of treatment and with adherence ascertained. Blood lipid levels (ie, total cholesterol [TC], low-density lipoprotein cholesterol [LDL-C], high-density lipoprotein cholesterol [HDL-C], non-high-density lipoprotein cholesterol [non-HDL-C], and fasting triglycerides [TGs]) were measured at baseline and after 1, 3, and/or 12 months of treatment. Receiver-operating characteristic analyses indicated that early (ie, after 1 month of psychotropic treatment) increases (≥5%) for TC, LDL-C, TG, and non-HDL-C and decrease (≥5%) for HDL-C were the best predictors for clinically relevant modifications of blood lipid levels after 3 months of treatment (≥30% TC, ≥40% LDL-C, ≥45% TG, ≥55% non-HDL-C increase, and ≥20% HDL-C decrease; sensitivity 70%-100%, specificity 53%-72%). Predictive powers of these models were confirmed by fitting longitudinal multivariate models in the same cohort (P ≤ .03) as well as in a replication cohort (n = 79; P ≤ .003). Survival models showed significantly higher incidences of new onset dyslipidemia (TC, LDL-C, and non-HDL-C hypercholesterolemia, HDL-C hypocholesterolemia, and hypertriglyceridemia) for patients with early changes of blood lipid levels compared to others (P ≤ .01). Early modifications of blood lipid levels following prescription of psychotropic drugs inducing dyslipidemia should therefore raise questions on clinical strategies to control long-term dyslipidemia. Copyright © 2017 National Lipid Association. Published

Hypolipidaemic Effect of Hericium erinaceum Grown in Artemisia capillaris on Obese Rats

PubMed Central

Choi, Won-Sik; Kim, Young-Sun; Park, Byeoung-Soo; Kim, Jang-Eok

2013-01-01

In this study, ethanolic extracts from Hericium erinaceum cultivated with Artemisia capillaris (HEAC) were assessed for their ability to lower the cholesterol levels of male Sprague-Dawley rats fed a high-fat diet. Rats were randomly subdivided into seven test groups. Each group contained eight rats fed a high-fat diet during a growth period lasting 4 wk. Supplementation with the extracts was performed once a day for 2 wk after the high-fat diet. The control group (rats fed a high-fat diet) showed a high efficiency ratio (feed efficiency ratio) value compared to the normal group. Biochemical parameters, including total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-c), and triglyceride (TG) levels dramatically increased in the control group compared to the normal group. High-density lipoprotein-cholesterol (HDL-c) content in the control group was also significantly lower relative to the normal group. Two positive control groups, treated with simvastatin and atorvastatin, had lowered TC, LDL-c, and TG levels, and increased HDL-c content compared to the control group. Treatment with the tested extracts, including HEAC, ethanolic extracts from Hericium erinaceum, and ethanolic extracts from Artemisia capillaris reduced TC, LDL-c, and TG levels and elevated HDL-c content in the hyperlipidemia rats. The atherogenic index and cardiac risk factor values for the HEAC-treated group were 0.95 and 1.95, respectively. Simvastatin- and atorvastatin-treated groups showed atherogenic index values of 1.56 and 1.69, respectively, and cardiac risk factor values of 2.56 and 2.69, respectively. These results show HEAC possesses an ability to cure hyperlipidemia in rats and may serve as an effective natural medicine for treating hyperlipidemia in humans. PMID:23874132

Association of the TRIB1 tribbles homolog 1 gene rs17321515 A>G polymorphism and serum lipid levels in the Mulao and Han populations

PubMed Central

2011-01-01

Background The association of rs17321515 single nucleotide polymorphism (SNP) near TRIB1 gene and serum lipid profiles has never been studied in the Chinese population. Therefore, the present study was undertaken to detect the association of rs17321515 SNP and several environmental factors on serum lipid levels in the Mulao and Han populations. Methods A total of 639 unrelated subjects of Mulao nationality and 644 participants of Han nationality were randomly selected from our previous stratified randomized cluster samples. Genotypes of the TRIB1 rs17321515 A>G SNP were determined via polymerase chain reaction and restriction fragment length polymorphism, and then confirmed by direct sequencing. Results Serum apolipoprotein (Apo) B levels were higher in Mulao than in Han (P < 0.05). There were no differences in the genotypic and allelic frequencies between the two ethnic groups (P > 0.05). High- and low-density lipoprotein cholesterol (HDL-C and LDL-C) levels in Han were different among the genotypes (P < 0.05 for each), the subjects with AG/GG genotypes had higher HDL-C and LDL-C levels than the subjects with AA genotype. Total cholesterol (TC), HDL-C, LDL-C, ApoA1 and ApoB levels in Han males were different among the genotypes (P < 0.05-0.001), the G carriers had higher TC, HDL-C, LDL-C, ApoA1 and ApoB levels than the G noncarriers. HDL-C levels in Mulao males were different among the genotypes (P < 0.05), the G carriers had lower HDL-C levels than the G noncarriers. Serum HDL-C and LDL-C levels in both ethnic groups and TG levels in Han were correlated with the genotypes or alleles (P < 0.05-0.01). TG and HDL-C levels in Mulao males and TG, HDL-C, LDL-C and ApoA1 levels in Han males were correlated with genotypes or alleles (P < 0.05-0.001). TG and ApoA1 levels in Han females were associated with genotypes (P < 0.05 for each). Serum lipid parameters were also associated with several environmental factors in both ethnic groups. Conclusions The associations of

The effect of high-, moderate-, and low-fat diets on weight loss and cardiovascular disease risk factors.

PubMed

Fleming, Richard M

2002-01-01

Over 60% of Americans are overweight and a number of popular diets have been advocated, often without evidence, to alleviate this public health hazard. This study was designed to investigate the effects of several diets on weight loss, serum lipids, and other cardiovascular disease risk factors. One hundred men and women followed one of four dietary programs for 1 year: a moderate-fat (MF) program without calorie restriction (28 patients); a low-fat (LF) diet (phase I) (16) ; a MF, calorie-controlled (phase II) diet (38 patients); and a high-fat (HF) diet (18 subjects) [corrected]. Weight, total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglycerides (TG), homocysteine (Ho), and lipoprotein(a) [Lp(a)], were measured every 4th month. The TC/HDL-C ratio was calculated and fibrinogen levels were measured at baseline and after one year. The MF diet resulted in a 2.6% (NS) decrease in weight compared with 18.4% (p=0.045) decrease in patients on phase I, 12.6% (p=0.0085) decrease in patients on phase II, and 13.7% (p=0.025) decrease in those on the HF diet. TC was reduced by 5% (NS) in the MF group, 39.1% (p=0.0005) in the phase I group, and 30.4% (p=0.0001) in the phase II group. HF group had a 4.3% (NS) increase in TC. LDL-C was reduced by 6.1% (NS) on MF, 52.0% (p=0.0001) on phase I, and 38.8% (p=0.0001) on phase II. Patients on HF had a 6.0% (NS) increase in LDL-C. There were nonsignificant reductions in HDL-C in those on MF (-1.5%) and HF (-5.8%). Patients on phase I showed an increase in HDL-C of 9.0% (NS), while those on phase II diet had a 3.6% increase (NS) in HDL-C. TC/HDL-C increased (9.8%) only in patients following the high-fat diets (NS). Patients on MF had a 5.3% (NS) reduction in TC/HDL-C, while those on LF had significant reductions on the phase I ( -45.8%; p=0.0001) diet and phase II diet (-34.7%; p=0.0001). TG levels increased on both the MF (1.0%) and HF (5.5%) diets, although neither

Predictors of Subclinical Cardiovascular Disease in Women with Polycystic Ovary Syndrome: Interrelationship of Dyslipidemia and Arterial Blood Pressure

PubMed Central

Macut, Djuro; Bačević, Marina; Božić-Antić, Ivana; Bjekić-Macut, Jelica; Čivčić, Milorad; Erceg, Snježana; Vojnović Milutinović, Danijela; Stanojlović, Olivera; Andrić, Zoran; Kastratović-Kotlica, Biljana; Šukilović, Tijana

2015-01-01

Background. Women with polycystic ovary syndrome (PCOS) could develop subclinical atherosclerosis during life. Purpose. To analyze cardiovascular risk (CVR) factors and their relation to clinical markers of cardiovascular disease (CVD) in respect to their age. Material and Methods. One hundred women with PCOS (26.32 ± 5.26 years, BMI: 24.98 ± 6.38 kg/m2) were compared to 50 respective controls. In all subjects, total cholesterol (TC), HDL-C, LDL-C, triglycerides, TC/HDL-C and TG/HDL-C ratios, glucose, insulin and HOMA index, waist-to-hip ratio (WHR), systolic and diastolic blood pressure (SBP and DBP, resp.), and carotid intima-media thickness (CIMT) were analyzed in respect to their age and level of androgens. Results. PCOS over 30 years had higher WHR (P = 0.008), SBP (P < 0.001), DBP (P < 0.001), TC (P = 0.028), HDL-C (P = 0.028), LDL-C (P = 0.045), triglycerides (P < 0.001), TC/HDL-C (P < 0.001), and triglycerides/HDL-C (P < 0.001) and had more prevalent hypertension and pronounced CIMT on common carotid arteries even after adjustment for BMI (P = 0.005 and 0.036, resp.). TC/HDL-C and TG/HDL-C were higher in PCOS with the highest quintile of FAI in comparison to those with lower FAI (P = 0.045 and 0.034, resp.). Conclusions. PCOS women older than 30 years irrespective of BMI have the potential for early atherosclerosis mirrored through the elevated lipids/lipid ratios and through changes in blood pressure. PMID:25878664

Impact of avocado-enriched diets on plasma lipoproteins: A meta-analysis.

PubMed

Peou, Sokunthea; Milliard-Hasting, Brittany; Shah, Sachin A

2016-01-01

Optimizing plasma lipoproteins is the primary goal of pharmacotherapy and diet interventions in people at risk for cardiovascular diseases. Avocados offer a rich source of monounsaturated fat and may pose beneficial effects on the lipid profile. We aimed to perform a meta-analysis of randomized clinical trials assessing the impact of avocados on TC, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol, and/or triglycerides (TG). We searched PUBMED, Cumulative Index to Nursing and Allied Health Literature, Index to Nursing and Allied Health Literature, and the Cochrane Database of Systemic Reviews from their inception to February 2015. The weighted mean difference from baseline was calculated for all endpoints. Subgroup analyses were performed to assess heterogeneity, and funnel plots inspected to assess publication bias. Ten unique studies (n = 229) were included. Avocado consumption significantly reduced TC, LDL-C, and TG by -18.80 mg/dL (95% confidence interval [CI], -24.56 to -13.05; I(2), 46.9%), -16.50 mg/dL (95% CI, -22.91 to -10.10; I(2), 72.5%), -27.20 mg/dL (95% CI, -44.41 to -9.99; I(2), 91.1%) respectively. High-density lipoprotein cholesterol decreased nonsignificantly by -0.18 mg/dL (95% CI, -3.23 to 2.88; I(2), 84.8%). Avocado-substituted diets significantly decrease TC, LDL-C, and TG levels. Substituting dietary fats with avocados versus adding to the free diet should be the primary recommendation strategy. Larger trials looking at the impact of avocados on major adverse cardiovascular events are warranted. Copyright © 2016 National Lipid Association. All rights reserved.

Alantolactone suppresses APOC3 expression and alters lipid homeostasis in L02 liver cells.

PubMed

Yang, Meiting; Zhao, Hanhan; Ai, Huihan; Zhu, Hongbin; Wang, Shuyue; Bao, Yongli; Li, Yuxin

2018-06-05

A high level of APOC3 expression is an independent risk factor for some lipid metabolism-related diseases, such as cardiovascular disease (CVD), nonalcoholic fatty liver disease (NAFLD) and atherosclerosis (AS). This suggests that down-regulating APOC3 expression is a potential way of regulating lipid levels. In this study, we used luciferase reporter screening to identify a natural compound, alantolactone (ALA), that can inhibit the promoter activity of APOC3. ALA decreased APOC3 expression at both mRNA and protein levels. Then we pretreated L02 liver cells with oxLDL to investigate the function of ALA in lipid homeostasis. Intriguingly, ALA attenuated oxLDL-induced foam cell formation by reducing total cholesterol (TC) and triglyceride (TG) contents. Furthermore, these results could be reversed by overexpressing APOC3 protein. ALA inhibited tyrosine phosphorylation (Tyr705pho) of STAT3 to down-regulate APOC3 expression. Intriguingly, overexpression of a wild-type STAT3 or a constitutively active form of STAT3 (STAT3-C) up-regulated APOC3 expression and partly reversed the effect of ALA in oxLDL-induced L02 cells. Overexpression of wild-type STAT3 also increased TC but not TG contents in L02 cells. However, overexpression of STAT3-C significantly increased TC and TG contents, and the effect of ALA was partly attenuated by STAT3-C, although this was not statistically significant. These results suggest that ALA attenuates lipid accumulation through down-regulation of APOC3 expression, at least in part by inhibiting STAT3 signaling. Copyright © 2018 Elsevier B.V. All rights reserved.

Effect of high fluoride and high fat on serum lipid levels and oxidative stress in rabbits.

PubMed

Sun, Liyan; Gao, Yanhui; Zhang, Wei; Liu, Hui; Sun, Dianjun

2014-11-01

The purpose of this study was to explore the effects of high fluoride and high fat on triglyceride (TG), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), total antioxidant capacity (T-AOC), lipid peroxide (LPO) and malondialdehyde (MDA) in rabbits. A factorial experimental design was used, with two factors (fluoride and fat) and three levels. Seventy-two male rabbits were randomly assigned into nine groups according to initial weight and serum lipid levels. The rabbits were fed with basic feed, moderate fat feed or high fat feed and drank tap water, fluoridated water at levels of 50 and 100mgfluorion/L freely. Biological materials were collected after 5 months, and serum lipid, T-AOC, LPO, and MDA levels were then measured. Using these data, the separate and interactive effects of high fluoride and high fat were analyzed. High fluoride and high fat both increased serum levels of TC, HDL-C and LDL-C significantly (P<0.05), and there was also a synergistic effect between high fluoride and high fat (P<0.05). High fluoride and high fat had different effects on TG levels: high fat significantly increased TG levels (P<0.01) whereas high fluoride had nothing to do with TG levels (P>0.05). High fat significantly elevated LPO and MDA levels and lowered T-AOC levels in serum (P<0.05). Similarly, high fluoride significantly increased LPO and MDA levels in serum (P<0.05). However, there was no interactive effect between high fat and high fluoride on these indexes. In summary, high fluoride and high fat increased serum TC and LDL-C levels individually and synergistically, and this would cause and aggravate hypercholesterolemia in rabbits. At the same time, high fluoride and high fat both made the accumulation of product of oxidative stress in experimental animals. Copyright © 2014 Elsevier B.V. All rights reserved.

[Treatment of combined hyperlipidemia patients by jiangzhi tongluo soft capsule combined atorvastatin calcium tablet: a clinical study].

PubMed

Xie, Ying; He, Yu-Bin; Zhang, Shi-Xin; Pan, Ai-Qun; Zhang, Jun; Guan, Xiao-Hong; Wang, Jin-Xue; Guo, Wen-Sheng

2014-09-01

To evaluate the efficacy and safety of using Jiangzhi Tongluo Soft Capsule (JTSC) combined with Atorvastatin Calcium Tablet (ACT) or ACT alone in treatment of combined hyperlipidemia. A randomized, double blinded, parallel control, and multi-center clinical research design was adopted. Totally 138 combined hyperlipidemia patients were randomly assigned to the combined treatment group (A) and the atorvastatin treatment group (B) by random digit table, 69 in each group. All patients took ACT 20 mg per day. Patients in the A group took JTSC 100 mg each time, 3 times per day. Those in the B group took JTSC simulated agent, 100 mg each time, 3 times per day. The treatment period for all was 8 weeks. Serum levels of triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), and high density lipoprotein cholesterol (HDL-C) were observed before treatment, at week 4 and 8 after treatment; and safety was assessed as well. At week 4 and 8 after treatment serum TG decreased by 26.69% and 33.29% respectively in the A group (both P < 0.01), while it was decreased by 25.7% and 22.98% respectively in the B group (both P < 0.01). At week 8 decreased serum TG was obviously higher in the A group than in the B group (P < 0.05). Compared with before treatment, serum levels of LDL-C and TC levels decreased significantly in the two groups (all P < 0.01). There was no statistical difference in the drop-out value and the drop-out rate of serum LDL-C and TC levels (P > 0.05). At week 8 the serum HDL-C level showed an increasing tendency in the two groups. No obvious increase in peptase or creatase occurred in the two groups after treatment. JTSC combined with ACT could lower the serum TG level of combined hyperlipidemia patients with safety.

PPAR{gamma} activation abolishes LDL-induced proliferation of human aortic smooth muscle cells via SOD-mediated down-regulation of superoxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heo, Kyung-Sun; Department of Pharmacy, Chungnam National University, Yuseong, Daejeon; Kim, Dong-Uk

Native LDL would be a mitogenic and chemotactic stimulus of VSMC proliferation and differentiation in the atherosclerotic lesion where endothelial disruption occurred. In previous studies, our group investigated the molecular mechanisms by which LDL induces IL-8 production and by which PPAR{alpha} activation abolishes LDL effects in human aortic SMCs (hAoSMCs). Herein is the first report of PPAR{gamma} activation by troglitazone (TG) exerting its inhibitory effects on LDL-induced cell proliferation via generation not of H{sub 2}O{sub 2}, but of O2?-, and the subsequent activation of Erk1/2 in hAoSMCs. Moreover, in this study TG abolished the LDL-accelerated G{sub 1}-S progression to controlmore » levels via down-regulation of active cyclinD1/CDK4 and cyclinE/CDK2 complexes and up-regulation of p21{sup Cip1} expression. TG exerted its anti-proliferative effects through the up-regulation of basal superoxide dismutase (SOD) expression. This data suggests that the regulation of O2?- is located at the crossroads between LDL signaling and cell proliferation.« less

Antihyperlipidemic activity of adenosine triphosphate in rabbits fed a high-fat diet and hyperlipidemic patients.

PubMed

Zhang, Lianshan; Liang, Libin; Tong, Tong; Qin, Yuguo; Xu, Yanping; Tong, Xinglong

2016-10-01

Context Recently, adenosine triphosphate (ATP) was occasionally found to decrease the triglyceride (TG) levels in several hyperlipidemic patients in our clinical practice. Objective The study investigates the anti-hyperlipidemic effects of ATP in a high-fat fed rabbit model and hyperlipidemic patients. Materials and methods Twenty-four rabbits were randomly divided into three groups of eight animals each as follows: normal diet, high-fat diet and high-fat diet + ATP group. ATP supplementation (40 mg/day) was started at the 20th day and lasted for 10 days. Serum concentrations of total cholesterol (TC), TG, LDL-C, HDL-C were measured on the 20th day and 30th day. Heart, liver and aorta were subjected histopathological examination. Twenty outpatients diagnosed primary hyperlipidemia took ATP at a dose of 60 mg twice a day for 1 week. Results Feeding rabbits with a high-fat diet resulted in a significant elevation of lipid parameters including TC, TG, LDL-C, VLDL-C compared to the normal diet group (p < 0.01). ATP treatment significantly decreased serum TG level (p < 0.01), whilst other parameters remained statistically unaltered. Meanwhile, ATP significantly reduced the thickness of fat layer in cardiac epicardium (p < 0.05) and pathological gradation of ballooning degeneration in hepatocytes (p < 0.05). After taking ATP for 1 week, hyperlipidemia patients exhibited a significant decrease of TG (p < 0.01), but other lipid parameters had no significant change. Discussion and conclusion The study indicates that ATP selectively decreases serum TG levels in high-fat diet rabbits and hyperlipidemic patients. Therefore, ATP supplementation may provide an effective approach to control TG level.

Nurse-coordinated care improves the achievement of LDL cholesterol targets through more intensive medication titration.

PubMed

Snaterse, Marjolein; Jorstad, Harald T; Heiligenberg, Marlies; Ter Riet, Gerben; Boekholdt, S Matthijs; Scholte Op Reimer, Wilma; Peters, Ron J

2017-01-01

Nurse-coordinated care (NCC) improves the achievement of low-density lipoprotein-cholesterol (LDL-C) targets after an acute coronary syndrome (ACS). We hypothesised that NCC improves achievement of LDL-C targets through more intensive medication titration. We used data from Randomised Evaluation of Secondary Prevention by Outpatient Nurse Specialists (RESPONSE), a multicentre randomised trial on the efficacy of NCC in 754 ACS patients. Follow-up data were collected at 6 and 12 months. To enable comparison between the various types and dosages of statins, we used the average lipid-lowering potency (ALLP, % LDL-C lowering) as an indicator of lipid-lowering medication intensity. Most patients in NCC intervention and usual care groups (96%) had started lipid-lowering therapy during the index hospitalisation. At 6 months, titration activities (up or down) were applied in 45% of NCC patients compared with 24% of patients receiving usual care (p<0.001), and a difference was also seen at 12 months follow-up (52% vs 34%, p<0.001). In patients not on LDL-C target at baseline, titration activities at 6 months were recorded in 63% and 30% of NCC and usual care patients respectively (p<0.001), with increased titration activities in both groups at 12 months (69% vs 43%, p<0.001). NCC is associated with more frequent and intense lipid-lowering medication titration to reach LDL-C targets as compared with usual care alone. Further, merely starting the guideline-recommended dose is insufficient to reach the guideline-recommended LDL-C target level. TC1290 (Netherlands).

Metabolic effects of protease inhibitor-sparing antiretroviral regimens given as initial treatment of HIV-1 Infection (AIDS Clinical Trials Group Study A5095).

PubMed

Shikuma, Cecilia M; Yang, Yang; Glesby, Marshall J; Meyer, William A; Tashima, Karen T; Ribaudo, Heather J; Webb, Nancy; Bastow, Barbara; Kuritzkes, Daniel R; Gulick, Roy M

2007-04-15

To assess metabolic changes after initiation of protease inhibitor (PI)-sparing regimens in antiretroviral-naive patients. Metabolic changes were analyzed within the triple-nucleoside (zidovudine [ZDV]/lamivudine [3TC]/abacavir [ABC])-containing, 3-drug efavirenz (EFV) [ZDV/3TC + EFV]-containing, and 4-drug EFV [ZDV/3TC/ABC + EFV]-containing arms of the AIDS Clinical Trials Group multicenter trial A5095. Metabolic values were compared with published US general population norms. From week 0 to week 24, all arms exhibited similar mild median increases in glucose and decreases in insulin sensitivity, whereas changes in lipids were greater in the ZDV/3TC + EFV and ZDV/3TC/ABC + EFV arms than in the ZDV/3TC/ABC arm: triglyceride (TG; 7, 18, and -1 mg/dL, respectively), total cholesterol (TC; 23, 28, and 5 mg/dL, respectively), low-density lipoprotein cholesterol (LDL-C; 9, 14, and 1 mg/dL, respectively), and high-density lipoprotein cholesterol (HDL-C; 10, 10, and 5 mg/dL, respectively). Adjusted mean study lipid values of all study participants at week 0 and week 96 compared with those of the National Health and Nutrition Examination Survey (NHANES) 1999 through 2002 values were: TG (148, 187, and 123 mg/dL, respectively), TC (164, 195, and 203 mg/dL, respectively), HDL-C (35, 47, and 51 mg/dL, respectively), and LDL-C (101, 117, and 123 mg/dL, respectively) (P < or = 0.005 for each value vs. NHANES values). Similar mild increases in glucose and decreases in insulin sensitivity were observed in all regimens, whereas lipids were modestly higher in the EFV-containing arms. Compared with general population norms, the metabolic dysfunctions of concern after these PI-sparing therapies were increasingly abnormal TC and lower (but improved relative to baseline) HDL-C levels.

Clinical and pathophysiological evidence supporting the safety of extremely low LDL levels-The zero-LDL hypothesis.

PubMed

Masana, Luis; Girona, Josefa; Ibarretxe, Daiana; Rodríguez-Calvo, Ricardo; Rosales, Roser; Vallvé, Joan-Carles; Rodríguez-Borjabad, Cèlia; Guardiola, Montserrat; Rodríguez, Marina; Guaita-Esteruelas, Sandra; Oliva, Iris; Martínez-Micaelo, Neus; Heras, Mercedes; Ferré, Raimon; Ribalta, Josep; Plana, Núria

While the impact of very low concentrations of low-density lipoprotein cholesterol (LDL-C) on cardiovascular prevention is very reassuring, it is intriguing to know what effect these extremely low LDL-C concentrations have on lipid homoeostasis. The evidence supporting the safety of extremely low LDL levels comes from genetic studies and clinical drug trials. Individuals with lifelong low LDL levels due to mutations in genes associated with increased LDL-LDL receptor (LDLR) activity reveal no safety issues. Patients achieving extremely low LDL levels in the IMPROVE-IT and FOURIER, and the PROFICIO and ODYSSEY programs seem not to have an increased prevalence of adverse effects. The main concern regarding extremely low LDL-C plasma concentrations is the adequacy of the supply of cholesterol, and other molecules, to peripheral tissues. However, LDL proteomic and kinetic studies reaffirm that LDL is the final product of endogenous lipoprotein metabolism. Four of 5 LDL particles are cleared through the LDL-LDLR pathway in the liver. Given that mammalian cells have no enzymatic systems to degrade cholesterol, the LDL-LDLR pathway is the main mechanism for removal of cholesterol from the body. Our focus, therefore, is to review, from a physiological perspective, why such extremely low LDL-C concentrations do not appear to be detrimental. We suggest that extremely low LDL-C levels due to increased LDLR activity may be a surrogate of adequate LDL-LDLR pathway function. Copyright © 2018 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Lipid Abnormalities in Type 2 Diabetes Mellitus Patients with Overt Nephropathy

PubMed Central

Viswanathan, Vijay

2017-01-01

Background Diabetic nephropathy is a major complication of diabetes and an established risk factor for cardiovascular events. Lipid abnormalities occur in patients with diabetic nephropathy, which further increase their risk for cardiovascular events. We compared the degree of dyslipidemia among type 2 diabetes mellitus (T2DM) subjects with and without nephropathy and analyzed the factors associated with nephropathy among them. Methods In this retrospective study, T2DM patients with overt nephropathy were enrolled in the study group (n=89) and without nephropathy were enrolled in the control group (n=92). Both groups were matched for age and duration of diabetes. Data on total cholesterol (TC), triglycerides (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), urea and creatinine were collected from the case sheets. TG/HDL-C ratio, a surrogate marker for small, dense, LDL particles (sdLDL) and estimated glomerular filtration rate (eGFR) were calculated using equations. Multivariate analysis was done to determine the factors associated with eGFR. Results Dyslipidemia was present among 56.52% of control subjects and 75.28% of nephropathy subjects (P=0.012). The percentage of subjects with atherogenic dyslipidemia (high TG+low HDL-C+sdLDL) was 14.13 among controls and 14.61 among nephropathy subjects. Though serum creatinine was not significantly different, mean eGFR value was significantly lower among nephropathy patients (P=0.002). Upon multivariate analysis, it was found that TC (P=0.007) and HDL-C (P=0.06) were associated with eGFR among our study subjects. Conclusion Our results show that dyslipidemia was highly prevalent among subjects with nephropathy. Regular screening for dyslipidemia may be beneficial in controlling the risk for adverse events among diabetic nephropathy patients. PMID:28447439

LDL-C levels in older people: Cholesterol homeostasis and the free radical theory of ageing converge.

PubMed

Mc Auley, Mark T; Mooney, Kathleen M

2017-07-01

The cardiovascular disease (CVD) risk factor, low density lipoprotein cholesterol (LDL-C) increases with age, up until the midpoint of life in males and females. However, LDL-C can decrease with age in older men and women. Intriguingly, a recent systematic review also revealed an inverse association between LDL-C levels and cardiovascular mortality in older people; low levels of LDL-C were associated with reduced risk of mortality. Such findings are puzzling and require a biological explanation. In this paper a hypothesis is proposed to explain these observations. We hypothesize that the free radical theory of ageing (FRTA) together with disrupted cholesterol homeostasis can account for these observations. Based on this hypothesis, dysregulated hepatic cholesterol homeostasis in older people is characterised by two distinct metabolic states. The first state accounts for an older person who has elevated plasma LDL-C. This state is underpinned by the FRTA which suggests there is a decrease in cellular antioxidant capacity with age. This deficiency enables hepatic reactive oxidative species (ROS) to induce the total activation of HMG-CoA reductase, the key rate limiting enzyme in cholesterol biosynthesis. An increase in cholesterol synthesis elicits a corresponding rise in LDL-C, due to the downregulation of LDL receptor synthesis, and increased production of very low density lipoprotein cholesterol (VLDL-C). In the second state of dysregulation, ROS also trigger the total activation of HMG-CoA reductase. However, due to an age associated decrease in the activity of cholesterol-esterifying enzyme, acyl CoA: cholesterol acyltransferase, there is restricted conversion of excess free cholesterol (FC) to cholesterol esters. Consequently, the secretion of VLDL-C drops, and there is a corresponding decrease in LDL-C. As intracellular levels of FC accumulate, this state progresses to a pathophysiological condition akin to nonalcoholic fatty liver disease. It is our

Natural honey lowers plasma glucose, C-reactive protein, homocysteine, and blood lipids in healthy, diabetic, and hyperlipidemic subjects: comparison with dextrose and sucrose.

PubMed

Al-Waili, Noori S

2004-01-01

This study included the following experiments: (1) effects of dextrose solution (250 mL of water containing 75 g of dextrose) or honey solution (250 mL of water containing 75 g of natural honey) on plasma glucose level (PGL), plasma insulin, and plasma C-peptide (eight subjects); (2) effects of dextrose, honey, or artificial honey (250 mL of water containing 35 g of dextrose and 40 g of fructose) on cholesterol and triglycerides (TG) (nine subjects); (3) effects of honey solution, administered for 15 days, on PGL, blood lipids, C-reactive protein (CRP), and homocysteine (eight subjects); (4) effects of honey or artificial honey on cholesterol and TG in six patients with hypercholesterolemia and five patients with hypertriglyceridemia; (5) effects of honey for 15 days on blood lipid and CRP in five patients with elevated cholesterol and CRP; (6) effects of 70 g of dextrose or 90 g of honey on PGL in seven patients with type 2 diabetes mellitus; and (7) effects of 30 g of sucrose or 30 g of honey on PGL, plasma insulin, and plasma C-peptide in five diabetic patients. In healthy subjects, dextrose elevated PGL at 1 (53%) and 2 (3%) hours, and decreased PGL after 3 hours (20%). Honey elevated PGL after 1 hour (14%) and decreased it after 3 hours (10%). Elevation of insulin and C-peptide was significantly higher after dextrose than after honey. Dextrose slightly reduced cholesterol and low-density lipoprotein-cholesterol (LDL-C) after 1 hour and significantly after 2 hours, and increased TG after 1, 2, and 3 hours. Artificial honey slightly decreased cholesterol and LDL-C and elevated TG. Honey reduced cholesterol, LDL-C, and TG and slightly elevated high-density lipoprotein-cholesterol (HDL-C). Honey consumed for 15 days decreased cholesterol (7%), LDL-C (1%), TG (2%), CRP (7%), homocysteine (6%), and PGL (6%), and increased HDL-C (2%). In patients with hypertriglyceridemia, artificial honey increased TG, while honey decreased TG. In patients with hyperlipidemia

Effects of cumin extract on oxLDL, paraoxanase 1 activity, FBS, total cholesterol, triglycerides, HDL-C, LDL-C, Apo A1, and Apo B in in the patients with hypercholesterolemia

PubMed Central

Samani, Keihan Ghatreh; Farrokhi, Effat

2014-01-01

Objectives Paraoxanase 1 (PON1) plays a protective role against the oxidative modification of plasma lipoproteins and hydrolyzes lipid peroxides in human atherosclerotic lesions. Cumin is the dried seed of the herb Cuminumcyminum that is known as Zeera in Iran. Cumin seeds contain flavonoids which are now generally recognized to have antioxidant activity and improve the antioxidant system. So, they possibly modify PON1 activity and oxidized low density lipoprotein (oxLDL) level. The present study was aimed to evaluate the effects of cumin extract supplementation on oxLDL, paraoxanase 1 activity, FBS, total cholesterol, triglycerides, High density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), apolipoprotein A1 (Apo A1), and apolipoprotein B (Apo B)in the patients with hypercholesterolemia. Methodology A fasting venous blood sample was obtained from the voluntary persons before and 45±3 days after taking cumin. Glucose, total cholesterol, and triglycerides were assayed using standard enzymatic procedures. HDL-Cand LDL-C were measured by direct method and ApoA1 and ApoB levels by immunoturbidimeteric methods. The levels of arylesterase and paraoxanase activities in the samples were measured by photometry methods and oxLDL by enzyme-linked immunosorbent assay (ELISA) method. 3 to 5 drops of cumin extract were added to the patient’s diet three times a day based on manufacturer’s instruction for 45±3 days. The biochemical parameters were compared before and after taking cumin. Data were analyzed using paired Student’s t-test in SPSS statistical software (version 11.5). Results The results demonstrated that there was a significant decrease in the level of oxLDL after receiving cumin. Paraoxonase and arylesterase activities increased in serum after taking cumin extract. Conclusion Based on the results, cumin reduces oxLDL level and increases both paraoxonase and arylesterase activity. PMID:24899878

A 4-week study of four 3-monochloropropane-1,2-diol diesters on lipid metabolism in C57BL/6J mice.

PubMed

Lu, Jing; Wang, Zhenning; Ren, Mengrou; Feng, Guangxin; Ye, Beining; Wang, Yi; Fang, Baochen; Deng, Xuming; Guan, Shuang

2015-09-01

3-Monochloropropane-1,2-diol (3-MCPD) esters have been detected in many foods, which have become a new safety issue worldwide. In the study, we investigated the effect of four 3-MCPD diesters (palmitate diester: CDP; stearate diester: CDS; oleate diester: CDO; linoleate diester: CDL) on lipid metabolism in C57BL/6J mice. The results showed that CDP, CDS, CDO and CDL significantly increased the serum TC, LDL-C levels and liver TG, TC levels at dose of 16.5μmol/kg/day. These results indicated that 3-MCPD diesters could potentially cause hyperlipidemia in C57BL/6J mice. Moreover, oil red O staining confirmed fat accumulation in liver induced by 3-MCPD diesters. Our work will provide more information for safety evaluation of 3-MCPD diesters. However, whether free 3-MCPD or free fatty acids or combined action compensates for the hyperlipidemia effects should be elucidated in the future. Copyright © 2015 Elsevier B.V. All rights reserved.

Nurse-coordinated care improves the achievement of LDL cholesterol targets through more intensive medication titration

PubMed Central

Snaterse, Marjolein; Jorstad, Harald T; Heiligenberg, Marlies; ter Riet, Gerben; Boekholdt, S Matthijs; Scholte op Reimer, Wilma; Peters, Ron J

2017-01-01

Background Nurse-coordinated care (NCC) improves the achievement of low-density lipoprotein-cholesterol (LDL-C) targets after an acute coronary syndrome (ACS). We hypothesised that NCC improves achievement of LDL-C targets through more intensive medication titration. Methods We used data from Randomised Evaluation of Secondary Prevention by Outpatient Nurse Specialists (RESPONSE), a multicentre randomised trial on the efficacy of NCC in 754 ACS patients. Follow-up data were collected at 6 and 12 months. To enable comparison between the various types and dosages of statins, we used the average lipid-lowering potency (ALLP, % LDL-C lowering) as an indicator of lipid-lowering medication intensity. Results Most patients in NCC intervention and usual care groups (96%) had started lipid-lowering therapy during the index hospitalisation. At 6 months, titration activities (up or down) were applied in 45% of NCC patients compared with 24% of patients receiving usual care (p<0.001), and a difference was also seen at 12 months follow-up (52% vs 34%, p<0.001). In patients not on LDL-C target at baseline, titration activities at 6 months were recorded in 63% and 30% of NCC and usual care patients respectively (p<0.001), with increased titration activities in both groups at 12 months (69% vs 43%, p<0.001). Conclusion NCC is associated with more frequent and intense lipid-lowering medication titration to reach LDL-C targets as compared with usual care alone. Further, merely starting the guideline-recommended dose is insufficient to reach the guideline-recommended LDL-C target level. Trial Registration number TC1290 (Netherlands). PMID:28761680

Efficacy of five-element gymnastics in glucose and lipid control in Taiwanese patients with type 2 diabetes.

PubMed

Huang, Chiu-Ling; Tai, Yen-Kuang; Yang, Yi-Hsin; Wang, Ruey-Hsia

2012-08-01

The purpose of this quasi-experimental study was to determine the efficacy of Five-Element Gymnastics (FEG) in controlling glycosylated hemoglobin (HbA1C), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG) at the 8th and the 16th weeks of intervention for patients with type 2 diabetes in Taiwan. FEG consolidates several traditional Chinese exercises including Qigong, Xiang Gong, and martial arts with gymnastics. The experimental group (n = 31) practiced FEG at home for 16 weeks. The control group (n = 35) maintained usual activities. FEG was associated with decrease of HbA1C, TG, and LDL-C levels at the 8th week and continuous decrease of HbA1C through the 16th week. FEG could be an exercise choice for patients with type 2 diabetes. Copyright © 2012 Wiley Periodicals, Inc.

Elevated levels of triglyceride and triglyceride-rich lipoprotein triglyceride induced by a high-carbohydrate diet is associated with polymorphisms of APOA5-1131T>C and APOC3-482C>T in Chinese healthy young adults.

PubMed

Lin, Jia; Fang, Ding Zhi; Du, Juan; Shigdar, Sarah; Xiao, Li Ying; Zhou, Xue Dong; Duan, Wei

2011-01-01

Changes in lipid profiles have been shown to be associated with diet and apolipoprotein (APO) polymorphisms. Therefore, 2 polymorphisms, i.e. APOA5-1131T>C and APOC3-482C>T, and serum lipids were examined in a Chinese healthy young population with high-carbohydrate/low-fat (HC/LF) diet intervention. After a wash-out diet for 7 days, 56 young adults (22.89 ± 1.80 years) received the HC/LF diet for 6 days. Body mass index (BMI) and fasting serum lipid profiles at baseline, after the wash-out diet, and after the HC/LF diet were measured. APOA5-1131C carriers had higher triglyceride (TG) and TG-rich lipoprotein TG (TRL-TG) levels at baseline and after the HC/LF diet, though this mainly corresponded to the female cohort. APOC3-482T carriers had higher TRL-TG levels following the wash-out and HC/LF diets, but these were not directly attributable to a single gender. Both polymorphisms may play an important role in the elevated TG and TRL-TG levels induced by the HC/LF diet, especially in females, thus indicating a potential dietary prevention of coronary heart disease in this Chinese cohort. Copyright © 2011 S. Karger AG, Basel.

The antihyperlipidemic activities of enzymatic and acidic intracellular polysaccharides by Termitomyces albuminosus.

PubMed

Zhao, Huajie; Li, Shangshang; Zhang, Jianjun; Che, Gen; Zhou, Meng; Liu, Min; Zhang, Chen; Xu, Nuo; Lin, Lin; Liu, Yu; Jia, Le

2016-10-20

Two polysaccharides, EIPS and AIPS were obtained by the hydrolysis of IPS from Termitomyces albuminosus, and their pharmacological effects on blood lipid profiles metabolism and oxidative stress were investigated. The results demonstrated that EIPS was superior to IPS and AIPS on reducing hepatic lipid levels and preventing oxidative stress by improving serum enzyme activities (ALT, AST, and ALP), serum lipid levels (TC, TG, HDL-C, LDL-C and VLDL-C), hepatic lipid levels (TC and TG), and antioxidant status (SOD, GSH-Px, CAT, T-AOC, MDA, and LPO). These conclusions indicated that EIPS, AIPS and IPS might be suitable for functional foods and natural drugs on preventing the high-fat emulsion-induced hyperlipidemia. In addition, the monosaccharide compositions of IPS and its hydrolyzate were also processed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hypolipidemic effect of arborium plus in experimentally induced hypercholestermic rabbits.

PubMed

Murty, Devarakonda; Rajesh, Enjamoori; Raghava, Doonaboina; Raghavan, Tangaraj Vijaya; Surulivel, Mukanthan Karupiah Munirajan

2010-06-01

Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of the ayurvedic herbal formulation Arborium Plus [Hyppophae ramnoides L. fruit juice (S) and Rhododendron arboreum Sm. Linn flower juice (R) in a 1:4 ratio] on triglycerides (TG), total cholesterol (TC), low-density lipoprotein (LDL), atherogenic index (AI), high-density lipoprotein (HDL), and high-sensitivity c-reactive protein (hs CRP) in experimentally induced hypercholesterolemic rabbits. Four groups of rabbits were subjected to different treatments for 8 weeks: control group, CHOL group (1% w/w cholesterol for 8 weeks), S+R group (1% w/w cholesterol and Arborium Plus for 8 weeks), and A group (1% w/w cholesterol and atorvastatin for 8 weeks). The results showed significant increases in TG, TC, LDL, AI, and hs CRP in hypercholesterolemic rabbits which was significantly reduced in Arborium Plus-treated hypercholesterolemic rabbits. The data demonstrated that the Arborium Plus formulation was associated with hypolipidemic effects in experimentally induced hypercholesterolemic rabbits.

Improvement in lipids after switch to boosted atazanavir or darunavir in children/adolescents with perinatally acquired HIV on older protease inhibitors: results from the Pediatric HIV/AIDS Cohort Study.

PubMed

Jao, J; Yu, W; Patel, K; Miller, T L; Karalius, B; Geffner, M E; DiMeglio, L A; Mirza, A; Chen, J S; Silio, M; McFarland, E J; Van Dyke, R B; Jacobson, D

2018-03-01

Dyslipidaemia is common in perinatally HIV-infected (PHIV) youth receiving protease inhibitors (PIs). Few studies have evaluated longitudinal lipid changes in PHIV youth after switch to newer PIs. We compared longitudinal changes in fasting lipids [total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and TC:HDL-C ratio] in PHIV youth enrolled in the Pediatric HIV/AIDS Cohort Study (PHACS) Adolescent Master Protocol (AMP) study who switched to atazanavir/ritonavir (ATV/r)- or darunavir/ritonavir (DRV/r)-based antiretroviral therapy (ART) from an older PI-based ART and those remaining on an older PI. Generalized estimating equation models were fitted to assess the association of a switch to ATV/r- or DRV/r-based ART with the rate of change in lipids, adjusted for potential confounders. From 2007 to 2014, 47 PHIV children/adolescents switched to ATV/r or DRV/r, while 120 remained on an older PI [primarily lopinavir/r (72%) and nelfinavir (24%)]. Baseline age ranged from 7 to 21 years. After adjustment for age, Tanner stage, race/ethnicity, and HIV RNA level, a switch to ATV/r or DRV/r was associated with a more rapid annual rate of decline in the ratio of TC:HDL-C. (β = -0.12; P = 0.039) than remaining on an older PI. On average, TC declined by 4.57 mg/dL/year (P = 0.057) more in the switch group. A switch to ATV/r or DRV/r was not associated with the rate of HDL-C, LDL-C, or TG change. A switch to ATV/r or DRV/r may result in more rapid reduction in TC and the TC:HDL-C ratio in PHIV youth, potentially impacting long-term cardiovascular disease risk. © 2017 British HIV Association.

Intracellular trafficking of the free cholesterol derived from LDL cholesteryl ester is defective in vivo in Niemann-Pick C disease: insights on normal metabolism of HDL and LDL gained from the NP-C mutation.

PubMed

Shamburek, R D; Pentchev, P G; Zech, L A; Blanchette-Mackie, J; Carstea, E D; VandenBroek, J M; Cooper, P S; Neufeld, E B; Phair, R D; Brewer, H B; Brady, R O; Schwartz, C C

1997-12-01

Niemann-Pick C disease (NP-C) is a rare inborn error of metabolism with hepatic involvement and neurological sequelae that usually manifest in childhood. Although in vitro studies have shown that the lysosomal distribution of LDL-derived cholesterol is defective in cultured cells of NP-C subjects, no unusual characteristics mark the plasma lipoprotein profiles. We set out to determine whether anomalies exist in vivo in the cellular distribution of newly synthesized, HDL-derived or LDL-derived cholesterol under physiologic conditions in NP-C subjects. Three affected and three normal male subjects were administered [14C]mevalonate as a tracer of newly synthesized cholesterol and [3H]cholesteryl linoleate in either HDL or LDL to trace the distribution of lipoprotein-derived free cholesterol. The rate of appearance of free [14C]- and free [3H]cholesterol in the plasma membrane was detected indirectly by monitoring their appearance in plasma and bile. The plasma disappearance of [3H]cholesteryl linoleate was slightly faster in NP-C subjects regardless of its lipoprotein origin. Appearance of free [14C] cholesterol ill the plasma (and in bile) was essentially identical in normal and affected individuals as was the initial appearance of free [3H]cholesterol derived from HDL, observed before extensive exchange occurred of the [3H]cholesteryl linoleate among lipoproteins. In contrast, the rate of appearance of LDL-derived free [3H]cholesterol in the plasma membrane of NP-C subjects, as detected in plasma and bile, was retarded to a similar extent that LDL cholesterol metabolism was defective in cultured fibroblasts of these affected subjects. These findings show that intracellular distribution of both newly synthesized and HDL-derived cholesterol are essentially unperturbed by the NP-C mutation, and therefore occur by lysosomal-independent paths. In contrast, in NP-C there is defective trafficking of LDL-derived cholesterol to the plasma membrane in vivo as well as in vitro

Impact of interferon-free antivirus therapy on lipid profiles in patients with chronic hepatitis C genotype 1b

PubMed Central

Endo, Daisuke; Satoh, Kenichi; Shimada, Noritomo; Hokari, Atsushi; Aizawa, Yoshio

2017-01-01

AIM To investigate the influence of interferon-free antivirus therapy on lipid profiles in chronic hepatitis C virus genotype 1b (HCV1b) infection. METHODS Interferon-free antiviral agents were used to treat 276 patients with chronic HCV1b infection, and changes in serum lipids of those who achieved sustained virologic response (SVR) were examined. The treatment regimen included 24 wk of daclatasvir plus asunaprevir (DCV + ASV) or 12 wk of sofosbuvir plus ledipasvir (SOF + LDV). SVR was achieved in 121 (85.8%) of 141 patients treated with DCV + ASV and 132 (97.8%) of 135 patients treated with SOF + LDV. In the two patient groups (DCV + ASV-SVR and SOF + LDV-SVR), serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and triglycerides were measured at baseline during treatment and at 4 and 12 wk after treatment. Then, longitudinal changes in lipid profiles were analyzed. RESULTS Serum levels of TC, LDL-C, and HDL-C were significantly increased throughout the observation period in both the DCV + ASV-SVR and SOF + LDV-SVR groups. During antivirus treatment, the increases in TC and LDL-C were significantly greater in the SOF + LDV-SVR group than in the DCV + ASV-SVR group (P < 0.001). At 4 and 12 wk after the therapy, serum levels of TC and LDL-C were similar between the two groups and were significantly greater than those at baseline. Approximately 75%-80% of the increase in TC was derived from an increased LDL-C. In multiple regression analysis, the difference in therapy protocol (DCA + ASV or SOF + LDV) was an independent predictor that was significantly associated with the increase in TC and LDL-C at 4 wk of therapy. CONCLUSION Serum cholesterol significantly increased during SOF + LDV treatment. After treatment, HCV elimination was associated with a similar increase in cholesterol regardless of the therapy protocol. PMID:28428715

Association between Eight Functional Polymorphisms and Haplotypes in the Cholesterol Ester Transfer Protein (CETP) Gene and Dyslipidemia in National Minority Adults in the Far West Region of China.

PubMed

Guo, Shuxia; Hu, Yunhua; Ding, Yusong; Liu, Jiaming; Zhang, Mei; Ma, Rulin; Guo, Heng; Wang, Kui; He, Jia; Yan, Yizhong; Rui, Dongsheng; Sun, Feng; Mu, Lati; Niu, Qiang; Zhang, Jingyu; Li, Shugang

2015-12-16

We have investigated the relationship between the polymorphisms and haplotypes in the CETP gene, and dyslipidemia among the Xinjiang Kazak and Uyghur populations in China. A total of 712 patients with dyslipidemia and 764 control subjects of CETP gene polymorphism at rs12149545, rs3764261, rs1800775, rs711752, rs708272, rs289714, rs5882, and rs1801706 loci were studied by the Snapshot method, linkage disequilibrium analysis and haplotype construction. The results are as follows: (1) the minor allele of eight loci of frequencies in the two groups were different from other results of similar studies in other countries; (2) In the linear regression analysis, the HDL-C levels of rs708272 TT, rs1800775 AA, rs289714 CC and rs711752 AA genotypes were significantly higher than those of other genotypes, however, the rs3764261 GG and rs12149545 GG genotypes were significantly lower than those of other genotypes in the two ethnic groups. The HDL-C levels of the rs12149545 GG genotype were lower than those of other genotypes; (3) in the control group, the rs708272 CT genotype of TG levels were lower than in the CC genotype, the T genotype of LDL-C levels were lower than in the CC genotype, and the HDL-C levels were higher than in the CT genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype, the rs711752 AG genotype of TG levels were lower than in the GG genotype, the AA genotype LDL-C levels were lower than in the GG genotype, and the HDL-C levels were higher than in the AG genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype. In the dyslipidemia group, the rs708272 TT genotype of TC and LDL-C levels were higher than in the CT genotype and the rs3764261 TT genotype of TC levels were higher than in the GG genotype. The rs711752 AA genotype of TC and LDL-C levels were higher than in the AG genotype, and the rs12149545 AA genotype of TC and LDL-C levels were higher than in the GG genotype; (4) perfect Linkage

Association between Eight Functional Polymorphisms and Haplotypes in the Cholesterol Ester Transfer Protein (CETP) Gene and Dyslipidemia in National Minority Adults in the Far West Region of China

PubMed Central

Guo, Shuxia; Hu, Yunhua; Ding, Yusong; Liu, Jiaming; Zhang, Mei; Ma, Rulin; Guo, Heng; Wang, Kui; He, Jia; Yan, Yizhong; Rui, Dongsheng; Sun, Feng; Mu, Lati; Niu, Qiang; Zhang, Jingyu; Li, Shugang

2015-01-01

We have investigated the relationship between the polymorphisms and haplotypes in the CETP gene, and dyslipidemia among the Xinjiang Kazak and Uyghur populations in China. A total of 712 patients with dyslipidemia and 764 control subjects of CETP gene polymorphism at rs12149545, rs3764261, rs1800775, rs711752, rs708272, rs289714, rs5882, and rs1801706 loci were studied by the Snapshot method, linkage disequilibrium analysis and haplotype construction. The results are as follows: (1) the minor allele of eight loci of frequencies in the two groups were different from other results of similar studies in other countries; (2) In the linear regression analysis, the HDL-C levels of rs708272 TT, rs1800775 AA, rs289714 CC and rs711752 AA genotypes were significantly higher than those of other genotypes, however, the rs3764261 GG and rs12149545 GG genotypes were significantly lower than those of other genotypes in the two ethnic groups. The HDL-C levels of the rs12149545 GG genotype were lower than those of other genotypes; (3) in the control group, the rs708272 CT genotype of TG levels were lower than in the CC genotype, the T genotype of LDL-C levels were lower than in the CC genotype, and the HDL-C levels were higher than in the CT genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype, the rs711752 AG genotype of TG levels were lower than in the GG genotype, the AA genotype LDL-C levels were lower than in the GG genotype, and the HDL-C levels were higher than in the AG genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype. In the dyslipidemia group, the rs708272 TT genotype of TC and LDL-C levels were higher than in the CT genotype and the rs3764261 TT genotype of TC levels were higher than in the GG genotype. The rs711752 AA genotype of TC and LDL-C levels were higher than in the AG genotype, and the rs12149545 AA genotype of TC and LDL-C levels were higher than in the GG genotype; (4) perfect Linkage

Hypoglycemic and hypolipidemic effects of Bersama engleriana leaves in nicotinamide/streptozotocin-induced type 2 diabetic rats

PubMed Central

2012-01-01

Background The present investigation was aimed at evaluating the hypoglycemic and hypolipidemic properties of the aqueous and methanolic extracts from Bersama engleriana leaves in streptozotocin/nicotinamide (STZ-NA)-induced type 2 diabetic rats. Methods Animals were orally treated for 4 consecutive weeks with Bersama engleriana extracts at doses of 300 or 600 mg/kg. The anti-diabetic effect was examined by measuring blood glucose (BG) at 0, 1, 14 and 28 days after STZ-NA treatment and, total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and triglycerides (TG) levels at sacrifice (day 29). Glibenclamide (0.25 mg/kg) was used for comparison. Results STZ-NA-induced diabetic rats showed moderate to significant increases in the levels of BG, TG, TC, LDL-C while body weight, HDL-C levels and relative weights of liver and pancreas were decreased compared to controls (non diabetic rats). Administration of the plant extracts to STZ-NA diabetic rats resulted in a significant decrease in BG, TG, TC and LDL-C and the dose 600 mg/kg of the methanolic extract was the most effective; HDL-C level was markedly increased after four weeks compared to untreated diabetic rats. A dose-dependent increase in the relative weights of the diabetogenic organs was observed in the Bersama engleriana groups. It can be also noticed that the methanolic extract, especially the dose 600 mg/kg (p<0.001), produced more effects than glibenclamide and aqueous extract. Rats treated with glibenclamide (0.25 mg/kg) generally gave lower results compared to groups treated with plant extracts. Conclusion Results of the present study showed that Bersama engleriana extracts and especially its methanolic extract possess antidiabetogenic properties and beneficial effects on diabetic hyperlipidemia. All these effects could be due to the bioactive components revealed in the Bersama engleriana extracts such as triterpenes and phenols and which could

Dietary pattern as identified by factorial analysis and its association with lipid profile and fasting plasma glucose among Iranian individuals with spinal cord injury.

PubMed

Sabour, Hadis; Soltani, Zahra; Latifi, Sahar; Javidan, Abbas Norouzi

2016-07-01

Plasma lipids (triglyceride (TG), total cholesterol (TC), high-density lipoprotein (HDL-C) and low-density lipoprotein (LDL-C)) may be associated with dietary intakes. The purpose of this study was to identify the most common food patterns among Iranian persons with spinal cord injury (SCI) and investigate their associations with lipid profile. Cross-sectional. Tertiary rehabilitation center. Referred individuals to Brain and Spinal Injury Research Center (BASIR) from 2011 to 2014. Dietary intakes were assessed by 24-hour dietary recall interviews in three non-consecutive days. Principal component analysis (PCA) was used to identify dietary patterns. Total of 100 persons (83 male and 17 female) entered the study. Four food patterns were detected. The most common dietary pattern (Pattern 1) included processed meat, sweets desserts and soft drink and was similar to 'Western' food pattern described previously. Pattern 1 was related to higher levels of TC and LDL-C (r = 0.09; P = 0.04 and r = 0.11; P = 0.03 for TC and LDL-C, respectively) only in male participants. Pattern 2 which included tea, nuts, vegetable oil and sugars had a positive association with TC level (r = 0.11; P = 0.02) again in male participants. Pattern 3 which represented a healthy food pattern showed no significant influence on lipid profiles. In this study, the four most common dietary patterns among Iranian individuals with SCI have been identified. Western food pattern was the most common diet and was associated with increased TC and LDL-C. The healthy food pattern, in which the major source of calories was protein, was not associated with variance in lipid profile.

Association between berries intake and cardiovascular diseases risk factors: a systematic review with meta-analysis and trial sequential analysis of randomized controlled trials.

PubMed

Luís, Ângelo; Domingues, Fernanda; Pereira, Luísa

2018-02-21

The main goal of this work was to clarify the effects of the consumption of berries on cardiovascular disease (CVD) risk factors by performing a systematic review according to the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analysis) statement, followed by a meta-analysis and a trial sequential analysis (TSA) of randomized controlled trials (RCTs). The electronic search was conducted in PubMed, Scopus, SciELO, Web of Science and Cochrane Library between April and June 2016. To be included, RCTs had to report 1 or more of the following outcomes: total cholesterol (TC), HDL-cholesterol (HDL), LDL-cholesterol (LDL), triglycerides (TG), blood pressure (BP), C-reactive protein (CRP), tumour necrosis factor-α (TNF-α), interleukin-6 (IL-6), vascular cell adhesion molecule-1 (VCAM), intercellular adhesion molecule-1 (ICAM), glucose, insulin, apolipoprotein A-I (Apo A-I) or apolipoprotein B (Apo B). It was observed that the intake of berries reduces TC, LDL, TG, and BP while increasing the level of HDL, suggesting a beneficial effect on the control of CVDs' risk factors. Thus, the intake of berries as nutraceuticals or functional foods could be suggested for the prevention and control of CVDs.

Association between Short-Term Exposure to Air Pollution and Dyslipidemias among Type 2 Diabetic Patients in Northwest China: A Population-Based Study

PubMed Central

Wang, Minzhen; Zheng, Shan; Nie, Yonghong; Weng, Jun; Cheng, Ning; Hu, Xiaobin; Ren, Xiaowei; Pei, Hongbo; Bai, Yana

2018-01-01

Air pollution exposure may play an adverse role in diabetes. However, little data are available directly evaluating the effects of air pollution exposure in blood lipids of which dysfunction has been linked to diabetes or its complications. We aimed to evaluate the association between air pollution and lipids level among type 2 diabetic patients in Northwest China. We performed a population-based study of 3912 type 2 diabetes patients in an ongoing cohort study in China. Both spline and multiple linear regressions analysis were used to examine the association between short-term exposure to PM10, SO2, NO2 and total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C). By spline analyses, we observed that the relationship between SO2 and HDL-C and LDL-C was shown to be non-linear (p_non-lin-association = 0.0162 and 0.000). An inverted U-shaped non-linear relationship between NO2 and LDL-C was found (p_non-lin-association < 0.0001). A J-shaped non-linear relationship between PM10 and TC, HDL-C (p_non-lin-association = 0.0173, 0.0367) was also revealed. In linear regression analyses, a 10 μg/m3 increment in SO2 was associated with 1.31% (95% CI: 0.40–2.12%), 3.52% (95% CI: 1.07–6.03%) and 7.53% (95% CI: 5.98–9.09%) increase in TC, TG and LDL-C, respectively. A 10 μg/m3 increment in PM10 was associated with 0.45% (95% CI: 0.08–0.82%), 0.29% (95% CI: 0.10–0.49%) and 0.83% (95% CI: 0.21–1.45%) increase in TC, HDL-C and LDL-C, respectively. For NO2, an increment of 10 μg/m3 was statistically associated with −3.55% (95% CI: −6.40–0.61%) and 39.01% (95% CI: 31.43–47.03%) increase in HDL-C and LDL-C. The adverse effects of air pollutants on lipid levels were greater in female and elder people. Further, we found SO2 and NO2 played a more evident role in lipid levels in warm season, while PM10 appeared stronger in cold season. The findings suggest that exposure to air pollution

Differential reactivities of four homogeneous assays for LDL-cholesterol in serum to intermediate-density lipoproteins and small dense LDL: comparisons with the Friedewald equation.

PubMed

Yamashita, Shizuya; Kawase, Ryota; Nakaoka, Hajime; Nakatani, Kazuhiro; Inagaki, Miwako; Yuasa-Kawase, Miyako; Tsubakio-Yamamoto, Kazumi; Sandoval, Jose C; Masuda, Daisaku; Ohama, Tohru; Nakagawa-Toyama, Yumiko; Matsuyama, Akifumi; Nishida, Makoto; Ishigami, Masato

2009-12-01

In routine clinical laboratory testing and numerous epidemiological studies, LDL-cholesterol (LDL-C) has been estimated commonly using the Friedewald equation. We investigated the relationship between the Friedewald equation and 4 homogeneous assays for LDL-C. LDL-C was determined by 4 homogeneous assays [liquid selective detergent method: LDL-C (L), selective solubilization method: LDL-C (S), elimination method: LDL-C (E), and enzyme selective protecting method: LDL-C (P)]. Samples with discrepancies between the Friedewald equation and the 4 homogeneous assays for LDL-C were subjected to polyacrylamide gel electrophoresis and the beta-quantification method. The correlations between the Friedewald equation and the 4 homogeneous LDL-C assays were as follows: LDL-C (L) (r=0.962), LDL-C (S) (r=0.986), LDL-C (E) (r=0.946) and LDL-C (P) (r=0.963). Discrepancies were observed in sera from type III hyperlipoproteinemia patients and in sera containing large amounts of midband and small dense LDL on polyacrylamide gel electrophoresis. LDL-C (S) was most strongly correlated with the beta-quantification method even in sera from patients with type III hyperlipoproteinemia. Of the 4 homogeneous assays for LDL-C, LDL-C (S) exhibited the closest correlation with the Friedewald equation and the beta-quantification method, thus reflecting the current clinical databases for coronary heart disease.

[The lipid-regulating effect and safety of combined statin and bezafibrate therapy in acute coronary syndrome patients complicating with dyslipidemia].

PubMed

Li, Xiang-ping; Gong, Hai-rong; Zhao, Shui-ping; Huang, Wen-yu

2013-12-01

To investigate the lipid-regulating effect and safety of combined statin and bezafibrate therapy in acute coronary syndrome(ACS) patients complicating with dyslipedemia. One hundred and four hospitalized patients with established ACS and increased serum triglycerides (TG) levels and/or low serum levels of high density lipoprotein cholesterol (HDL-C) were selected. Except for conventional therapy, the patients were randomly divided into 2 groups: control group (n = 52), treated with atorvastatin 20 mg qn or other statin equivalent to 20 mg atorvastatin; treatment group (n = 52), treated with the same dose statin plus bezafibrate 200 mg bid. The serum levels of total cholesterol (TC), TG, low-density lipoprotein cholesterol (LDL-C) and HDL-C were assessed before and after 6 and 12 weeks treatment, side effects and adverse events were recorded. After 6 weeks treatment, the serum levels of TC, TG and LDL-C in two groups were significantly reduced compared to baseline (all P < 0.05), which were further declined after 12 weeks treatment, and the reduction was more significant in treatment group(29.8%, 38.0% and 36.1%, respectively) than in control group(14.7%, 9.8% and 26.7%, respectively) (all P < 0.05). After treatment, the serum levels of HDL-C in the two groups were significantly higher than the baseline levels, especially after 12 weeks treatment (all P < 0.05), and the elevations of HDL-C levels in control group and in treatment group were 19.3% and 24.2%, respectively, but there were no significant difference between the two groups (P > 0.05). After 12 weeks, the rates reaching to target goals of LDL-C, TG, HDL-C, and non-HDL-C levels in the treatment group (69.2%, 88.5%, 92.3%, 46.2% and 65.4%, respectively) were significantly higher than those in the control group (34.6%, 65.4%, 46.2%, 7.7% and 42.3%, respectively, all P < 0.05). No serious side effects were observed in the two groups during the treatment period. The combined statin and bezafibrate treatment is

Mediation analysis reveals a sex-dependent association between ABO gene variants and TG/HDL-C ratio that is suppressed by sE-selectin level.

PubMed

Teng, Ming-Sheng; Hsu, Lung-An; Wu, Semon; Chou, Hsin-Hua; Chang, Chi-Jen; Sun, Yu-Zen; Juan, Shu-Hui; Ko, Yu-Lin

2013-06-01

Previous investigations have revealed an association between the ABO locus/blood group and total cholesterol and inflammatory biomarker levels. We aimed to test the statistical association of ABO locus variants with lipid profiles and levels of thirteen inflammatory markers in a Taiwanese population. A sample population of 617 Taiwanese subjects was enrolled. Five ABO gene region polymorphisms were selected and genotyped. After adjusting for clinical covariates and inflammatory marker levels, the genetic-inferred ABO blood group genotypes were associated with sE-selectin level (P = 3.5 × 10(-36)). Significantly higher total and low-density lipoprotein cholesterol (LDL-C) levels were noted in individuals with blood group A (P = 7.2 × 10(-4) and P = 7.3 × 10(-4), respectively). Interestingly, after adjusting for sE-selectin level, significantly lower high-density lipoprotein cholesterol (HDL-C) level as well as higher triglyceride (TG) level and ratio of triglyceride to HDL-C (TG/HDL-C ratio) were noted in individuals with blood group A comparing to non-A individuals (P = 0.009, P = 0.004 and P = 0.001, respectively); these associations were also observed in the group A male subjects (P = 0.027, P = 0.001, and P = 0.002, respectively). Mediation analysis further revealed a suppression effect of sE-selectin level on the association between genetic-inferred ABO blood group genotypes and TG/HDL-C ratio in total participants (P = 1.18 × 10(-6)) and in males (P = 5.99 × 10(-5)). Genetic variants at the ABO locus independently affect sE-selectin level in Taiwanese subjects, while the association of ABO locus variants with TG/HDL-C ratio is suppressed by sE-selectin level in Taiwanese males. These results provided further evidence for the mechanism in the association of ABO blood groups with atherosclerotic cardiovascular diseases. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

APOA5 -1131T>C and APOC3 -455T>C polymorphisms are associated with an increased risk of coronary heart disease.

PubMed

Sun, Y; Zhou, R B; Chen, D M

2015-12-28

The aim of this study was to investigate correlations between apolipoprotein A-V (APOA5) -1131T>C and apolipoprotein C-III (APOC3) -455T>C polymorphisms and coronary heart disease (CHD). PubMed, Ovid, Cochrane Library, Embase, China National Knowledge Infrastructure, and Wanfang databases were searched using combinations of keywords relating to these polymorphisms and CHD. Studies retrieved from database searches were screened using our stringent inclusion and exclusion criteria, and Comprehensive Meta-Analysis Version 2.0 software was used for statistical analyses. In total, 115 studies were initially retrieved and after further selection, 11 were included in the meta-analysis. These 11 articles comprised 4840 patients with CHD in the case group and 4913 healthy participants in the control group. Meta-analysis revealed that APOA5 -1131T>C and APOC3 -455T>C polymorphisms increased CHD risk. In addition, subgroup analysis by ethnicity showed that while the -1131T>C polymorphism elevated the risk of CHD in the Caucasian population under both allelic and dominant models, this increased risk was observed only under a dominant model in the Asian population. The results of our meta-analysis point to a strong link between both APOA5 -1131T>C and APOC3 -455T>C polymorphisms and an increased risk of CHD. Thus, these polymorphisms constitute important predictive indicators of CHD susceptibility.

Low serum free thyroxine level is correlated with lipid profile in depressive patients with suicide attempt.

PubMed

Peng, Rui; Dai, Wen; Li, Yan

2018-05-24

The present research was carried out to observe the relationships between serum free triiothyronine (FT3), free thyroxine (FT4), thyroid-stimulating hormone (TSH) levels and lipid profile and suicide risk in depressive subjects. Serum concentrations of albumin, total bilrubin, uric acid, total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), high-sensitivity C-reactive protein (hs-CRP), FT3, FT4 and TSH were measured in 271 patients meeting the DSM-IV criteria for major depressive disorder (202 subjects without suicidal behavior and 69 suicide attempters). A significant decrease in serum TC, TG and FT4 levels was found in suicide attempters with major depressive disorder compared with non-suicide attempters (all p < 0.0025). For the other biochemical factors levels (albumin, total bilrubin, uric acid, HDL, LDL, hs-CRP, FT3, and TSH), there were no significant differences between suicide attempters and non-suicide attempters. Relativity analysis suggested that FT4 is positively and significantly correlated with TC (p < 0.0025); TSH is positively associated with HDL (p < 0.0025). Univariate analysis showed that serum TC and FT4 abundances are correlated with the suicide attempts in major depressive subjects. This research demonstrated that the levels of serum TC, TG, and FT4 levels in suicidal patients were greatly decreased compared with patients without suicidal behavior. These findings support the hypothesis that low serum FT4 level affects lipid profile in major depressive patients with suicidal attempt. Copyright © 2018 Elsevier B.V. All rights reserved.

Overexpression of porcine lipoprotein-associated phospholipase A2 in swine.

PubMed

Tang, Xiaochun; Wang, Gangqi; Liu, Xingxing; Han, Xiaolei; Li, Zhuang; Ran, Guangyao; Li, Zhanjun; Song, Qi; Ji, Yuan; Wang, Haijun; Wang, Yuhui; Ouyang, Hongsheng; Pang, Daxin

2015-09-25

Lipoprotein-associated phospholipase A 2 (Lp-PLA2) is associated with the risk of vascular disease. It circulates in human blood predominantly in association with low-density lipoprotein cholesterol (LDL-C) and hydrolyses oxidized phospholipids into pro-inflammatory products. However, in the mouse circulation, it predominantly binds to high-density lipoprotein cholesterol (HDL-C) and exhibits anti-inflammatory properties. To further investigate the effects of Lp-PLA2 in the circulation, we generated over-expressed Lp-PLA2 transgenic swine. The eukaryotic expression plasmid of porcine Lp-PLA2 which driven by EF1α promoter was constructed and generate transgenic swine via SCNT. The expression and activity of Lp-PLA2 in transgenic swine were evaluated, and the total cholesterol (TC), HDL-C, LDL-C and triglyceride (TG) levels in the fasting and fed states were also assessed. Compared with wild-type swine controls, the transgenic swine exhibited elevated Lp-PLA2 mRNA levels and activities, and the activity did not depend on the feeding state. The TC, HDL-C and LDL-C levels were not significantly increased. There was no change in the TG levels in the fasting state between transgenic and control pigs. However, in the fed state, the TG levels of transgenic swine were slightly increased compared with the control pigs and were significantly elevated compared with the fasting state. In addition, inflammatory gene (interleukin [IL]-6, monocyte chemotactic protein [MCP]-1 and tumor necrosis factor [TNF]-α) mRNA levels in peripheral blood mononuclear cells (PBMCs) were significantly increased. The results demonstrated that Lp-PLA2 is associated with triglycerides which may be helpful for understanding the relationship of this protein with cardiovascular disease. Copyright © 2015 Elsevier Inc. All rights reserved.

An independent effect of parental lipids on the offspring lipid levels in a cohort of adolescents with type 1 diabetes.

PubMed

Marcovecchio, M Loredana; Tossavainen, Paivi H; Heywood, James Jn; Dalton, R Neil; Dunger, David B

2012-09-01

Genetic factors modulate lipid levels and an intrafamilial aggregation of abnormal lipid profiles has been reported in the general population. As dyslipidemia is common among people with diabetes and has been related to diabetic nephropathy, we investigated whether parental lipid levels were related to lipids and albumin excretion in young offspring with childhood-onset type 1 diabetes (T1D). Non-fasting blood samples were collected from 895 offspring, 808 mothers and 582 fathers. Total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and non-HDL-C were measured. Three early morning urinary albumin-creatinine ratios (ACR), hemoglobin A1C (HbA1c) and anthropometric parameters were also assessed. The offspring's mean age (±SD) was 14.5 ± 2.2 yr, mean diabetes duration 5.5 ± 3.7 yr; the fathers' age was 45.7 ± 6.1 yr and the mothers' age was 42.8 ± 5.5 yr. After adjusting for the offspring age, gender, body mass index, HbA1c, maternal (TC: β = 0.242; TG: β = 0.152; HDL-C: β = 0.285; LDL-C: β = 0.278; non-HDL-C: β = 0.253; all p < 0.001) and paternal lipid levels (TC: β = 0.188; TG: β = 0.108; HDL-C: β = 0.253; LDL-C: β = 0.187; non-HDL-C: β = 0.173; all p < 0.001) were significantly associated with the offspring's lipid parameters. In contrast, no significant association was found between parental lipid levels and the offspring's ACR. In the present study, parental lipid levels were independently associated with the same traits in the offspring, suggesting a role of genetic influences and/or shared environmental factors in modulating the metabolic profile of adolescents with T1D. In contrast, there was no significant association between parental lipid levels and the offspring's albumin excretion. © 2012 John Wiley & Sons A/S.

The impact of diurnal fasting during Ramadan on the lipid profile, hs-CRP, and serum leptin in stable cardiac patients.

PubMed

Khafaji, Hadi Abdul Ridha Hadi; Bener, Abdulbari; Osman, Mohammed; Al Merri, Ajayeb; Al Suwaidi, Jassim

2012-01-01

To study the effect of strict prolonged fasting on lipid profile, serum leptin, and high- sensitivity C-reactive protein (hs-CRP) in patients with different stable cardiac illnesses and look for associated new cardiac events and any correlation between entire variables. A total of 56 patients of different stable cardiac illnesses were followed in our cardiology outpatient for 3 months. Data concerning their ability to fast were collected: New York Heart Association class of congestive cardiac failure, angina class, previous myocardial infarction, previous coronary artery bypass graft, percutaneous coronary intervention, severity of valvular lesion, metallic prosthetic valve, and traditional risk factors (diabetes mellitus, insulin requirement, hypertension, hypercholesterolemia, smoking habit, and obesity). Detailed clinical examination and electrocardiography were performed in all patients in three consecutive visits before, during, and after Ramadan. Echocardiographic and angiographic findings and medication plans were collected from patient records. Lipid profile, serum leptin, and hs-CRP were assessed before, during, and after Ramadan. All patients fasted during Ramadan: 80.4% were male, 67.9% were aged >50 years, 71.4% had no change in their symptoms during fasting while 28.6% felt better. No patient has deteriorated. 91.1% of the patients were compliant with medicine during Ramadan, 73.2% after. 89.3% were compliant with diet during Ramadan with no significant change in body weight in the follow-up period. No cardiac or noncardiac morbidity or mortality was reported. High- density lipoprotein-cholesterol (HDL-C) decreased significantly during compared to before fasting (P = 0.012). Low-density lipoprotein-cholesterol (LDL-C) significantly increased during compared to before fasting (P = 0.022). No statistically significant changes were observed in total cholesterol (TC), triglycerides (TG), serum leptin, or hs-CRP. Significant correlation was observed between

The effects of treatment on lipoprotein subfractions evaluated by polyacrylamide gel electrophoresis in patients with autoimmune hypothyroidism and hyperthyroidism.

PubMed

Minarikova, Zuzana; Gaspar, Ludovit; Kruzliak, Peter; Celecová, Zuzana; Oravec, Stanislav

2014-10-10

Atherogenic dyslipoproteinemia is one of the most important risk factor for atherosclerotic changes development. Hypothyroidism is one of the most common causes of secondary dyslipidemias which results from reduced LDL clearance and therefore raised levels of LDL and apoB. Association between small dense LDL (sdLDL) presentation and thyroid status has been examinated using polyacrylamide gel electrophoresis for lipoprotein subfractions evaluation. 40 patients with diagnosed autoimmune hypothyroidism and 30 patients with autoimmune hyperthyroidism were treated with thyroxine replacement or thyreo-suppressive treatment. In both groups lipid profiles, LDL subractions, apolipoproteins (apoA1, apoB), apoA1/apoB ratio and atherogenic index of plazma (AIP) were examined before treatment and in state of euthyreosis. Thyroxine replacement therapy significantly reduced levels of total cholesterol (TC), LDL, triglycerides (TG) and also decreased levels of sdLDL (8,55±11,671 vs 0,83±1,693mg/dl; p<0,001), apoB and AIP. For estimation of atherogenic lipoprotein profile existence an AIP evaluation seems to be better than apoB measurement because of the more evident relationship with sdLDL (r=0,538; p<0,01). Thyreo-suppressive therapy significantly increased levels of TC, LDL, TG and apoB. The sdLDL was not found in hyperthyroid patients. Atherogenic lipoprotein profile was present in 52.5% of hypothyroid subjects, which is higher prevalence than in normal, age-related population. Substitution treatment leads to an improvement of the lipid levels, TG, apoB, AIP and LDL subclasses. It significantly changed the presentation of sdLDL - we noticed shift to large, less atherogenic LDL particles. Significantly positive correlation between sdLDL and TAG; sdLDL and VLDL alerts to hypertriglyceridemia as a major cardiovascular risk factor.

Atherogenic index of plasma: a useful marker for subclinical atherosclerosis in ankylosing spondylitis : AIP associate with cIMT in AS.

PubMed

Cure, Erkan; Icli, Abdullah; Uslu, Ali Ugur; Sakiz, Davut; Cure, Medine Cumhur; Baykara, Rabia Aydogan; Yavuz, Fatma; Arslan, Sevket; Kucuk, Adem

2018-05-01

Ankylosing spondylitis (AS) is associated with an increased risk of atherosclerotic cardiovascular disease (ACD). The atherogenic index of plasma (AIP), which is the logarithmic transformation of the plasma triglyceride (TG) level to the high-density lipoprotein level (HDL) ratio, has been suggested to be a novel marker in the identification of atherosclerosis risk. Therefore, this study aims to determine if the AIP can act as an accurate marker for the detection of subclinical atherosclerosis. Fifty-two male patients with AS and 52 age-, gender-, and body mass index (BMI)-matched healthy control subjects were included in the study. For each patient, AIP and total cholesterol (TC)/HDL values were calculated and carotid artery intima-media thickness (cIMT) was measured. The mean (SD) cIMT and median (range) AIP values for AS patients were higher than that of the healthy control subjects (0.60 ± 0.18 vs. 0.51 ± 0.10, p = 0.003 and 0.23 [- 0.32 to 0.85] vs. 0.09 [- 0.53 to 0.49], p = 0.007, respectively). A positive correlation was found between the patients' cIMT and AIP values (r = 0.307, p = 0.002) and TC/HDL values (r = 0.241, p = 0.014). Regression analysis revealed an independent association between the subclinical atherosclerosis and AIP (beta [β] = 0.309, p = 0.002). There were no independent correlations between subclinical atherosclerosis and TC (β = 0.245, p = 0.065), TG (β = 0.185, p = 0.515), HDL (β = 0.198, p = 0.231), TC/HDL (β = 0.032, p = 0.862), and low-density lipoprotein (LDL) (β = 0.151, p = 0.246). A strong and independent correlation exists between AIP and cIMT values. Therefore, the AIP could serve as a better marker than the TC/HDL ratio for the detection of subclinical atherosclerosis in AS patients.

Association between Triglyceride to HDL-C Ratio (TG/HDL-C) and Insulin Resistance in Chinese Patients with Newly Diagnosed Type 2 Diabetes Mellitus

PubMed Central

Ren, Xingxing; Chen, Zeng.ai; Zheng, Shuang; Han, Tingting; Li, Yangxue; Liu, Wei; Hu, Yaomin

2016-01-01

Objectives To explore the association between the triglyceride to HDL-C ratio (TG/HDL-C) and insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus. Methods Patients with newly diagnosed type 2 diabetes mellitus (272 men and 288 women) were enrolled and divided into three groups according to TG/HDL-C tertiles. Insulin resistance was defined by homeostatic model assessment of insulin resistance (HOMA-IR). Demographic information and clinical characteristics were obtained. Spearman’s correlation was used to estimate the association between TG/HDL-C and other variables. Multiple logistic regression analyses were adopted to obtain probabilities of insulin resistance. A receiver operating characteristic analysis was conducted to evaluate the ability of TG/HDL-C to discriminate insulin resistance. Results TG/HDL-C was associated with insulin resistance in Chinese patients with newly diagnosed T2DM (Spearman’s correlation coefficient = 0.21, P < 0.01). Patients in the higher tertiles of TG/HDL-C had significantly higher HOMA-IR values than patients in the lower tertiles [T1: 2.68(1.74–3.70); T2: 2.96(2.29–4.56); T3: 3.09(2.30–4.99)]. Multiple logistic regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR, and patients in the higher TG/HDL-C tertile had a higher OR than those in the lower TG/HDL-C tertile, after adjusting for multiple covariates including indices for central obesity [T1: 1; T2: 4.02(1.86–8.71); T3: 4.30(1.99–9.29)]. Following stratification of waist circumference into quartiles, the effect of TG/HDL-C on insulin resistance remained significant irrespective of waist circumference. Conclusions TG/HDL-C was associated with insulin resistance independent of waist circumference. Whether it could be a surrogate marker for insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus still needs to be confirmed by more researches. PMID:27115999

Association between Triglyceride to HDL-C Ratio (TG/HDL-C) and Insulin Resistance in Chinese Patients with Newly Diagnosed Type 2 Diabetes Mellitus.

PubMed

Ren, Xingxing; Chen, Zeng Ai; Zheng, Shuang; Han, Tingting; Li, Yangxue; Liu, Wei; Hu, Yaomin

2016-01-01

To explore the association between the triglyceride to HDL-C ratio (TG/HDL-C) and insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus. Patients with newly diagnosed type 2 diabetes mellitus (272 men and 288 women) were enrolled and divided into three groups according to TG/HDL-C tertiles. Insulin resistance was defined by homeostatic model assessment of insulin resistance (HOMA-IR). Demographic information and clinical characteristics were obtained. Spearman's correlation was used to estimate the association between TG/HDL-C and other variables. Multiple logistic regression analyses were adopted to obtain probabilities of insulin resistance. A receiver operating characteristic analysis was conducted to evaluate the ability of TG/HDL-C to discriminate insulin resistance. TG/HDL-C was associated with insulin resistance in Chinese patients with newly diagnosed T2DM (Spearman's correlation coefficient = 0.21, P < 0.01). Patients in the higher tertiles of TG/HDL-C had significantly higher HOMA-IR values than patients in the lower tertiles [T1: 2.68(1.74-3.70); T2: 2.96(2.29-4.56); T3: 3.09(2.30-4.99)]. Multiple logistic regression analysis showed that TG/HDL-C was significantly associated with HOMA-IR, and patients in the higher TG/HDL-C tertile had a higher OR than those in the lower TG/HDL-C tertile, after adjusting for multiple covariates including indices for central obesity [T1: 1; T2: 4.02(1.86-8.71); T3: 4.30(1.99-9.29)]. Following stratification of waist circumference into quartiles, the effect of TG/HDL-C on insulin resistance remained significant irrespective of waist circumference. TG/HDL-C was associated with insulin resistance independent of waist circumference. Whether it could be a surrogate marker for insulin resistance in Chinese patients with newly diagnosed type 2 diabetes mellitus still needs to be confirmed by more researches.

Efficacy and safety of coadministration of fenofibrate and ezetimibe compared with each as monotherapy in patients with type IIb dyslipidemia and features of the metabolic syndrome: a prospective, randomized, double-blind, three-parallel arm, multicenter, comparative study.

PubMed

Ansquer, Jean-Claude; Bekaert, Ivan; Guy, Martine; Hanefeld, Markolf; Simon, Alain

2009-01-01

Patients with type IIb, or mixed, dyslipidemia have high levels of low-density lipoprotein cholesterol (LDL-C) with predominance of small dense LDL particles, high levels of triglycerides (TG), and low levels of high-density lipoprotein cholesterol (HDL-C). Fenofibrate significantly reduces TG and, more moderately, LDL-C, increases HDL-C and produces a shift from small to large LDL particle size; the main effect of ezetimibe is a reduction in LDL-C levels. Combined treatment with fenofibrate and ezetimibe may correct all the abnormalities of type IIb dyslipidemia. To assess the efficacy and safety of coadministration of fenofibrate (NanoCrystal(R)) and ezetimibe in patients with type IIb dyslipidemia and the metabolic syndrome compared with administration of fenofibrate and ezetimibe alone (ClinicalTrials.gov Identifier: NCT00349284; Study ID: CLF178P 04 01). This was a prospective, randomized, double-blind, three-parallel arm, multicenter, comparative study. Sixty ambulatory patients (mean age 56 years; 50% women, 50% men) were treated in each group. For inclusion in the study, patients were required to have LDL-C >or=4.13 mmol/L (>or=160 mg/dL), TG >or=1.71 mmol/L and or=150 mg/dL and C or increased fasting plasma glucose, blood pressure, or waist circumference. Patients received fenofibrate 145 mg, ezetimibe 10 mg, or coadministration of both (fenofibrate/ezetimibe) daily for 12 weeks. The outcome measures were changes in lipids and related parameters, apolipoproteins, glucose metabolism parameters, and high-sensitivity C-reactive protein (hsCRP). Fenofibrate/ezetimibe was more effective than either fenofibrate or ezetimibe in reducing LDL-C (-36.2% vs -22.4% and -22.8%, respectively), non-HDL-C (-36.2% vs -24.8% and -20.9%, respectively), total cholesterol (TC) [-27.9% vs -18.9% and -17

[Effects of ganoderma lucidum polysaccharides on serum lipids and lipoperoxidation in experimental hyperlipidemic rats].

PubMed

Chen, Wei-qiang; Luo, Shao-hong; Ll, Hong-zhi; Yang, Hong

2005-09-01

To investigate the effect of ganoderma lucidum polysaccharides on blood lipid and lipoperoxidation from the experimental hyperlipidemic rats. 50 rats were randomly divided into normal group, hyperlipidemia control group, experimental group 1, 2 and 3 in which the rats were treated with ganoderma lucidum polysaccharides at dosages of 200 mg x kg(-1) and 400 mg x kg(-1) and 800 mg x kg(-1) respectively. Apart from the rats in control group, all the rats in other groups were fed with high fat forage for 30 days. The blood was collected from the tails of rats for measuring the serum TC, TG, HDL-C, LDL-C, GSH-Px, SOD and LPO. Ganoderma lucidum polysaccharides could significantly decrease the serum contents of TC, TG, LDL-c in the experimental hyperlipidemic rats (P < 0.01), and markedly increase the level of serum HDL-C (P < 0.05), Mean Level of blood LPO in the experimental groups treated by ganoderma lacidum polysaccharides at different dosages were much lower than that in hyper lipidema group, and the GSH-Px and SOD activities of blood in the group of ganoderma were much higher than those in hyperlipidema group. Ganoderma can regulate lipid metabolism, enhance the antioxidation and reduce the lipid peroxidation in the rats with hyperlipidemia.

Chrysin treatment improves diabetes and its complications in liver, brain, and pancreas in streptozotocin-induced diabetic rats.

PubMed

Samarghandian, Saeed; Azimi-Nezhad, Mohsen; Samini, Fariborz; Farkhondeh, Tahereh

2016-04-01

Chrysin (CH) is a natural flavonoid with pharmacological influences. The purpose of the current study was the assessment of possible protective effects of CH against oxidative damage in the serum, liver, brain, and pancreas of streptozotocin (STZ)- induced diabetic rats. In the present study, the rats were divided into the following groups of 8 animals each: control, untreated diabetic, 3 CH (20, 40, 80 mg/kg/day)-treated diabetic groups. To find out the modulations of cellular antioxidant defense systems, malondialdehyde (MDA) level and antioxidant enzymes including glutathione-S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT) activities were determined in the serum, liver, brain, and pancreas. STZ caused an elevation of glucose, MDA, TG, TC, LDL-C and with reduction of HDL-C, total protein, SOD, CAT, and GST in the serum, liver, brain, and pancreas (p < 0.01). The findings showed that the significant elevation in the glucose, MDA, TG, TC, LDL-C and reduction of HDL-C, total protein, SOD, CAT, and GST were ameliorated in the CH-treated diabetic groups versus to the untreated groups, in a dose dependent manner (p < 0.05). The current study offers that CH may be recovered diabetes and its complications by modification of oxidative stress.

Xuezhikang Capsule for Type 2 Diabetes with Hyperlipemia: A Systematic Review and Meta-Analysis of Randomized Clinical Trails

PubMed Central

Li, Min; He, Qingyong; Chen, Yinfeng; Li, Bo; Feng, Bo; Zhang, Zhenpeng; Wang, Jie

2015-01-01

Objective. To evaluate the efficacy and safety of Xuezhikang capsule treating type 2 diabetes with hyperlipidemia. Methods. We searched six databases to identify relevant studies published before January 2015. Two review authors independently extracted data and assessed the Cochrane risk of bias tool. We resolved disagreements with this assessment through discussion and a decision was achieved by consensus. Results. We included 21 studies (1548 participants). Treatment courses were at least 8 weeks. Overall, the risk of bias of included trials was unclear. Among them, 16 studies could conduct meta-analysis. The result showed that compared with routine group (5 studies), Xuezhikang group had more effect on decreasing TC, TG, LDL-C, and rising HDL-C. However, compared with statins group (11 studies), Xuezhikang group has less effect on decreasing TC, TG, and rising HDL-C. Meanwhile, two groups had no statistical differences of LDL-C level. Conclusion. Xuezhikang capsule may be effective for treating type 2 diabetes with hyperlipemia. Our findings should be considered cautiously due to unclear risk of bias of the included studies and low methodological quality. Therefore, more strictly designed large-scale randomized clinical trials are needed to evaluate the efficacy of Xuezhikang capsule in type 2 diabetes with hyperlipemia. PMID:26246836

Serum lipid levels and suicidality: a meta-analysis of 65 epidemiological studies

PubMed Central

Wu, Shunquan; Ding, Yingying; Wu, Fuquan; Xie, Guoming; Hou, Jun; Mao, Panyong

2016-01-01

Background We conducted a systematic review and meta-analysis to determine the association between serum lipid levels and suicidality, as evidence from previous studies has been inconsistent. Methods We identified relevant studies by searching Medline, Web of Science, EMBASE, and the Cochrane Database of Systematic Reviews (1980 to Dec. 5, 2014). Studies assessing the association between serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and/or triglycerides (TG) levels and suicidality were included. We used a random-effects model to take into account heterogeneity among studies. Results We included 65 studies with a total of 510 392 participants in our analysis. Compared with the nonsuicidal patients, suicidal patients had significantly lower serum TC (weighted mean difference [WMD] −22.35, 95% confidence interval [CI] −27.95 to −16.75), LDL-C (WMD −19.56, 95% CI −26.13 to −12.99) and TG (WMD −23.40, 95% CI −32.38 to −14.42) levels, while compared with the healthy controls, suicidal patients had significantly lower TC (WMD −24.75, 95% CI −27.71 to −21.78), HDL-C (WMD −1.75, 95% CI −3.01 to −0.48) and LDL-C (WMD −3.85, 95% CI −7.45 to −0.26) levels. Furthermore, compared with the highest serum TC level category, a lower serum TC level was associated with a 112% (95% CI 40%–220%) higher risk of suicidality, including a 123% (95% CI 24%–302%) higher risk of suicide attempt and an 85% (95 CI 7%–221%) higher risk of suicide completion. The cut-off values for low and high serum TC level were in compliance with the categories reported in the original studies. Limitations A major limitation of our study is the potential heterogeneity in most of the analyses. In addition, the suicidal behaviour was examined using different scales or methods across studies, which may further explain heterogeneity among the studies. Conclusion We identified an inverse association

The TG/HDL-C Ratio Might Be a Surrogate for Insulin Resistance in Chinese Nonobese Women.

PubMed

He, Jiyun; He, Sen; Liu, Kai; Wang, Yong; Shi, Di; Chen, Xiaoping

2014-01-01

Obejective. To examine the discriminatory power of triglyceride (TG) and triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) for insulin resistance (IR) in a normoglycaemic Chinese population. Methods. The data were collected from 711 individuals. The normoglycaemic individuals were eventually included in the study (n = 533, age: 62.8 ± 6.6 years, male: 56.8%), who were with a fasting plasma glucose < 6.1 mmol/L and without a history of diabetes. IR was defined as the upper quintile (≥1.6) of homeostasis model assessment of IR. Area under the receiver operating characteristic curve (AROC) was used to examine the discriminatory power. Results. The discriminatory power of TG/HDL-C for IR was acceptable in women with a BMI < 24 kg/m(2) or waist circumference < 80 cm (AROCs: 0.718 and 0.713, resp.); however, the discriminatory power was not acceptable in the obese women. TG/HDL-C was not an acceptable marker of IR in men. The discriminatory power of TG for IR was not acceptable in both men and women. Conclusions. The discriminatory power of TG/HDL-C for IR differs by gender and obesity index in the normoglycaemic Chinese population, and TG/HDL-C could discriminate IR in the nonobese and normoglycaemic women.

Relation of four nontraditional lipid profiles to diabetes in rural Chinese H-type hypertension population.

PubMed

Wang, Haoyu; Guo, Xiaofan; Chen, Yintao; Li, Zhao; Xu, Jiaqi; Sun, Yingxian

2017-10-11

Mounting evidence suggested that nontraditional lipid profiles have been recognized as a reliable indicator for unfavorable cardiovascular events. The purpose of this study was to explore the role of nontraditional lipid profiles as potential clinical indices for the assessment of prevalent diabetes in rural Chinese H-type hypertension population. During 2012 to 2013, we conducted a large cross-sectional study of 2944 H-type hypertension participants (≥35 years of age) from rural areas in northeast China. Subjects underwent accurate assessment of lipid profiles, fasting plasma glucose (FPG), homocysteine (Hcy) according to standard protocols. The proportion of diabetes showed a graded and linear increase across the quartiles for all four nontraditional lipid parameters. Nontraditional lipid variables were independent determinants of FPG, and its correlation for TG/HDL-C was strongest, whether potential confounders were adjusted or not. Multivariable logistic regression analysis established that the highest triglycerides (TG)/ high-density lipoprotein cholesterol (HDL-C) quartile manifested the largest ORs of prevalent diabetes (OR: 3.275, 95%CI: 2.109-5.087) compared with the lowest quartile. The fully adjusted ORs (95%CI) were 2.753 (1.783-4.252), 2.178 (1.415-2.351), 1.648 (1.097-2.478) for the top quartile of total cholesterol (TC)/HDL-C, low-density lipoprotein cholesterol (LDL-C)/HDL-C, and non-high-density lipoprotein cholesterol (non-HDL-C), respectively. On the basis of the area under receiver-operating characteristic curve (AUC), TG/HDL-C showed the optimal discriminating power for diabetes (AUC: 0.684, 95% CI: 0.650-0.718). Nontraditional lipid profiles (TG/HDL-C, TC/HDL-C, LDL-C/HDL-C and non-HDL-C) were all consistently and independently correlated with prevalent diabetes among the H-type hypertension population in rural China. TG/HDL-C was prone to be more profitable in assessing the risk of prevalent diabetes and should be encouraged as an

The Expanding Burden of Cardiometabolic Risk in China: the China Health and Nutrition Survey

PubMed Central

Yan, Shengkai; Li, Jiang; Li, Shuang; Zhang, Bing; Du, Shufa; Gordon-Larsen, Penny; Adair, Linda; Popkin, Barry

2012-01-01

Background China faces a major increase in cardiovascular disease, yet there is limited population-based data on risk factors, particularly in children. Methods and Results Fasting blood samples, anthropometry and blood pressure were collected on 9,244 children and adults aged ≥7 years in late 2009 as part of the national China Health and Nutrition Survey. Prevalent overweight, elevated blood pressure, and cardiometabolic risk factors: glucose, HbA1c, triglycerides (TG), total cholesterol (TC), high and low density lipoprotein cholesterol (HDL-C and LDL-C), and C-reactive protein (CRP) are presented. Results 11% of Chinese children and 30% of Chinese adults are overweight. Rates of diabetes, dyslipidemia, hypertension, and inflammation are high and increased with age and were associated with urbanization. Approximately 42% of children have at least one of the following: pre-diabetes or diabetes, hypertension, high TC, LDL-C, TG, and CRP and low HDL-C, as do 70% males and 60% females aged 18–40 years and >86% of males and females ≥40 years. Conclusions HbA1c findings suggest that as many as 29.4 million Chinese children and 415.8 million Chinese adults may be prediabetic or diabetic. The high prevalence in less urban areas and across all income levels suggests that cardiometabolic risk is pervasive across rural and urban China. PMID:22738663

Prevalence of Dyslipidemia Among Antiretroviral-Naive HIV-Infected Individuals in China

PubMed Central

Shen, Yinzhong; Wang, Jiangrong; Wang, Zhenyan; Qi, Tangkai; Song, Wei; Tang, Yang; Liu, Li; Zhang, Renfang; Lu, Hongzhou

2015-01-01

Abstract Little is known about the epidemiological features of dyslipidemia among antiretroviral-naive HIV-infected individuals in China. We used a cross-sectional study design to estimate the prevalence of dyslipidemia in this population, and to identify risk factors associated with the presence of dyslipidemia. One thousand five hundred and eighteen antiretroviral-naive HIV-infected individuals and 347 HIV-negative subjects in China were enrolled during 2009 to 2010. Demographics and medical histories were recorded. After an overnight fast, serum samples were collected to measure lipid levels. Factors associated with the presence of dyslipidemia were analyzed by logistic regression. Mean total cholesterol (TC), low-density lipoprotein cholesterol (LDL), high-density lipoprotein cholesterol (HDL) levels were lower in HIV-positive than HIV-negative subjects, but mean triglyceride (TG) was higher in HIV-positive subjects. The overall prevalence of dyslipidemia in HIV-positive and HIV-negative groups did not differ (75.6% vs. 73.7%, P = 0.580). However, the prevalence of high TC (8.4% vs. 28.2%, P < 0.001) and high LDL (8.5% vs. 62.6%, P < 0.001) was lower in HIV-positive than HIV-negative subjects, and the prevalence of high TG (33.9% vs. 17.0%, P < 0.001) and low HDL (59.6% vs. 11.2%, P < 0.001) was higher in HIV-positive than HIV-negative subjects. Logistic analysis showed that HIV positivity was significantly associated with both an increased risk of high TG and low HDL and a decreased risk of high TC and high LDL. The mean levels of TC, of LDL and of HDL showed an increasing trend with increasing CD4 count in HIV-positive subjects. Multivariable logistic regression found that lower CD4 count was significantly associated with both an increased risk of high TG and low HDL and a decreased risk of high TC in HIV-positive subjects. Among antiretroviral-naive HIV-infected Chinese adults, there was a high prevalence of dyslipidemia characterized by

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Dyslipidemia in subclinical hypothyroidism requires assessment of small dense low density lipoprotein cholesterol (sdLDL-C).

PubMed

Saric, Maida Seferovic; Jurasic, Miljenka-Jelena; Sovic, Slavica; Kranjcec, Bojana; Glivetic, Tatjana; Demarin, Vida

2017-09-26

Usually both hypothyroidism and hyperthyroidism are related to the cardiovascular and cerebrovascular disease development. The relationship between subclinical hypothyroidism has been widely investigated but the findings remain controversial. The aim of the present study was to evaluate the lipid profile in patients with subclinical hypothyroidism (SHypo) in comparison to controls and to determine the association of SHypo and dyslipidemia in attempt to find importance of small dense low-density lipoprotein cholesterol (sdLDL-C) in atherosclerosis. In this study we included 100 women, aged 30 to 70 years that were divided into subgroups according to their age. According to the values of levels of thyroid hormones they were divided into euthyroid (control) group (n = 64) and (newly discovered) subclinical hypothyroidism (SHypo) group (n = 36). A high-sensitivity C-reactive protein (hs-CRP) and lipid profile, including small dense low-density lipoprotein cholesterol (sdLDL-C) were determined. Body weight and height were measured and BMI calculated. History of the current illness, medication, alcohol consumption and cigarettes smoking were noted. Changed lipid profile as well as elevated triglycerides and sdLDL-C were observed in the group with subclinical hypothyroidism compared to the control group. It is important to determine serum lipid levels, especially serum sdLDL-C levels at an early stage of subclinical hypothyroidism, since they represent atherogenic LDL particles and are better indicators for dyslipidaemia in subclinical hypothyroidism and the development of atherosclerosis with potential complications such as cardiovascular and cerebrovascular diseases.

The TG/HDL-C Ratio Might Be a Surrogate for Insulin Resistance in Chinese Nonobese Women

PubMed Central

He, Jiyun; He, Sen; Liu, Kai; Wang, Yong; Shi, Di

2014-01-01

Obejective. To examine the discriminatory power of triglyceride (TG) and triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) for insulin resistance (IR) in a normoglycaemic Chinese population. Methods. The data were collected from 711 individuals. The normoglycaemic individuals were eventually included in the study (n = 533, age: 62.8 ± 6.6 years, male: 56.8%), who were with a fasting plasma glucose < 6.1 mmol/L and without a history of diabetes. IR was defined as the upper quintile (≥1.6) of homeostasis model assessment of IR. Area under the receiver operating characteristic curve (AROC) was used to examine the discriminatory power. Results. The discriminatory power of TG/HDL-C for IR was acceptable in women with a BMI < 24 kg/m2 or waist circumference < 80 cm (AROCs: 0.718 and 0.713, resp.); however, the discriminatory power was not acceptable in the obese women. TG/HDL-C was not an acceptable marker of IR in men. The discriminatory power of TG for IR was not acceptable in both men and women. Conclusions. The discriminatory power of TG/HDL-C for IR differs by gender and obesity index in the normoglycaemic Chinese population, and TG/HDL-C could discriminate IR in the nonobese and normoglycaemic women. PMID:25136362

Variants for HDL-C, LDL-C and Triglycerides Identified from Admixture Mapping and Fine-Mapping Analysis in African-American Families

PubMed Central

Shetty, Priya B.; Tang, Hua; Feng, Tao; Tayo, Bamidele; Morrison, Alanna C.; Kardia, Sharon L.R.; Hanis, Craig L.; Arnett, Donna K.; Hunt, Steven C.; Boerwinkle, Eric; Rao, D.C.; Cooper, R.S.; Risch, Neil; Zhu, Xiaofeng

2015-01-01

Background Admixture mapping of lipids was followed-up by family-based association analysis to identify variants for cardiovascular disease in African-Americans. Methods and Results The present study conducted admixture mapping analysis for total cholesterol, high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and triglycerides. The analysis was performed in 1,905 unrelated African-American subjects from the National Heart, Lung and Blood Institute’s Family Blood Pressure Program. Regions showing admixture evidence were followed-up with family-based association analysis in 3,556 African-American subjects from the FBPP. The admixture mapping and family-based association analyses were adjusted for age, age2, sex, body-mass-index, and genome-wide mean ancestry to minimize the confounding due to population stratification. Regions that were suggestive of local ancestry association evidence were found on chromosomes 7 (LDL-C), 8 (HDL-C), 14 (triglycerides) and 19 (total cholesterol and triglycerides). In the fine-mapping analysis, 52,939 SNPs were tested and 11 SNPs (8 independent SNPs) showed nominal significant association with HDL-C (2 SNPs), LDL-C (4 SNPs) and triglycerides (5 SNPs). The family data was used in the fine-mapping to identify SNPs that showed novel associations with lipids and regions including genes with known associations for cardiovascular disease. Conclusions This study identified regions on chromosomes 7, 8, 14 and 19 and 11 SNPs from the fine-mapping analysis that were associated with HDL-C, LDL-C and triglycerides for further studies of cardiovascular disease in African-Americans. PMID:25552592

Ocimum gratissmum aqueous extract reduces plasma lipid in hypercholesterol-fed hamsters

PubMed Central

Chao, Pei-Yu; Lin, James A.; Ting, Wei-Jen; Lee, Hsueh-Hui; Hsieh, Kuanghui; Chiu, Yung-Wei; Lai, Te-Jen; Hwang, Jin-Ming; Liu, Je-rYuh; Huang, Chih-Yang

2016-01-01

Objectives: Hyperlipidemia is a significant risk factor in the development of atherosclerosis and related diseases which are major health problem in many developed and developing countries that can lead to fatality due to the changes in lifestyle and dietary habits in this modern age. Methods: In the present study, the Ocimum gratissimum aqueous extract (OGE) was tested for the lowering effect on the serum lipid level of male hamsters on a high-fat (12%) and high-cholesterol (0.2%) diet (HFCD). Results: The results showed that the levels of serum high-density-lipoprotein-cholesterol (HDL-C) low-density-lipoprotein-cholesterol (LDL-C), total cholesterol (TC), and triglycerols (TG) were increased in the HFCD group (113±11, 259±87, 629±175 and 625±262, respectively), as compared to the control normal diet group (51±8, 19±5, 77±16 and 101±44, respectively). When co-treated with various doses (10 and 20 mg/kg) of the OGE or rosuvastatin, the rats exhibited the restoration of normal serum LDL-C, TC, and TG levels. Conclusion: Therefore, we suggest that the Ocimum gratissimum aqueous extract may have the potential function of lowering serum lipid in rats. PMID:27877073

A mixture of Salacia oblonga extract and IP-PA1 reduces fasting plasma glucose (FPG) and low-density lipoprotein (LDL) cholesterol levels

PubMed Central

Nakata, Kazue; Taniguchi, Yoshie; Yoshioka, Noriko; Yoshida, Aya; Inagawa, Hiroyuki; Nakamoto, Takeru; Yoshimura, Hiroshi; Miyake, Shin-ichiro; Kohchi, Chie; Kuroki, Masahide

2011-01-01

At present, lifestyle-related diseases are one of the most critical health issues worldwide. It has been reported that lipopolysaccharide derived from a Gram-negative bacteria (IP-PA1) symbiotic with wheat exhibited several advantageous biological effects, such as the reduction of plasma glucose levels in NOD mice and low-density lipoprotein (LDL) levels in WHHL rabbits. In this study, the beneficial effects on plasma glucose and lipids of a tea (SI tea) consisting of IP-PA1 and Salacia (which contains an inhibitor of α-glucosidase) were investigated in the KK-Ay/TaJcl type 2 diabetic model mice and in human subjects with premetabolic syndrome in a double-blind, randomized study. SI tea significantly decreased plasma glucose levels in KK-Ay/TaJcl mice. A clinical trial of SI tea was performed with 41 subjects between the ages of 40 and 69, who belonged either to a high plasma glucose group (HG: FPG 100-125 mg/dl) or to a hyperlipidemia group (HL: TG ≥ 150 mg/dl, or LDL ≥ 120 mg/dl, or HDL < 40 mg/dl). These subjects ingested either Salacia without IP-PA1 (the control) or SI tea. Blood samples were collected at 0, 30, and 60 days after initiating SI tea treatment, and were measured for FPG, HbA1c, TG, LDL, and HDL. These results showed that SI tea reduced FPG and HbA1c more rapidly than the control in the HL group, and also significantly improved LDL and HDL levels in the HG group. Thus, SI tea may be helpful in preventing lifestyle-related diseases. PMID:22125681

Cardiometabolic risk in US Army recruits and the effects of basic combat training.

PubMed

Pasiakos, Stefan M; Karl, J Philip; Lutz, Laura J; Murphy, Nancy E; Margolis, Lee M; Rood, Jennifer C; Cable, Sonya J; Williams, Kelly W; Young, Andrew J; McClung, James P

2012-01-01

Cardiometabolic disease risk in US military recruits and the effects of military training have not been determined. This study examined lifestyle factors and biomarkers associated with cardiometabolic risk in US Army recruits (209; 118 male, 91 female, 23 ± 5 yr) before, during, and after basic combat training (BCT). Anthropometrics; fasting total (TC), high-density lipoprotein (HDL) and low-density lipoprotein (LDL) cholesterol; triglycerides (TG); glucose; and insulin were measured at baseline and every 3 wks during the 10 wk BCT course. At baseline, 14% of recruits were obese (BMI>30 kg/m(2)), 27% were cigarette smokers, 37% were sedentary, and 34% reported a family history of cardiometabolic disease. TC was above recommended levels in 8%, LDL in 39%, TG in 5%, and glucose in 8% of recruits, and HDL was below recommended levels in 33% of recruits at baseline. By week 9, TC decreased 8%, LDL 10%, TG 13%, glucose 6% and homeostasis model assessment of insulin resistance (HOMA-IR) 40% in men (P<0.05). In women, TC, LDL, glucose and HOMA-IR were decreased from baseline at weeks 3 and 6 (P<0.05), but were not different from baseline levels at week 9. During BCT, body weight declined in men but not women, while body fat percentage declined in both men and women (P<0.05). At the start of military service, the prevalence of cardiometabolic risk in US military recruits is comparable to that reported in similar, college-aged populations. Military training appears to be an effective strategy that may mitigate risk in young people through improvements in lipid profiles and glycemic control.

Cardiometabolic Risk in US Army Recruits and the Effects of Basic Combat Training

PubMed Central

Lutz, Laura J.; Murphy, Nancy E.; Margolis, Lee M.; Rood, Jennifer C.; Cable, Sonya J.; Williams, Kelly W.; Young, Andrew J.; McClung, James P.

2012-01-01

Background Cardiometabolic disease risk in US military recruits and the effects of military training have not been determined. This study examined lifestyle factors and biomarkers associated with cardiometabolic risk in US Army recruits (209; 118 male, 91 female, 23±5 yr) before, during, and after basic combat training (BCT). Methodology/Principal Findings Anthropometrics; fasting total (TC), high-density lipoprotein (HDL) and low-density lipoprotein (LDL) cholesterol; triglycerides (TG); glucose; and insulin were measured at baseline and every 3 wks during the 10 wk BCT course. At baseline, 14% of recruits were obese (BMI>30 kg/m2), 27% were cigarette smokers, 37% were sedentary, and 34% reported a family history of cardiometabolic disease. TC was above recommended levels in 8%, LDL in 39%, TG in 5%, and glucose in 8% of recruits, and HDL was below recommended levels in 33% of recruits at baseline. By week 9, TC decreased 8%, LDL 10%, TG 13%, glucose 6% and homeostasis model assessment of insulin resistance (HOMA-IR) 40% in men (P<0.05). In women, TC, LDL, glucose and HOMA-IR were decreased from baseline at weeks 3 and 6 (P<0.05), but were not different from baseline levels at week 9. During BCT, body weight declined in men but not women, while body fat percentage declined in both men and women (P<0.05). Conclusions/Significance At the start of military service, the prevalence of cardiometabolic risk in US military recruits is comparable to that reported in similar, college-aged populations. Military training appears to be an effective strategy that may mitigate risk in young people through improvements in lipid profiles and glycemic control. PMID:22384004

Improving the Strength of the ZrC-SiC and TC4 Brazed Joint Through Fabricating Graded Double-Layered Composite Structure on TC4 Surface

NASA Astrophysics Data System (ADS)

Shi, J. M.; Zhang, L. X.; Chang, Q.; Sun, Z.; Feng, J. C.; Ma, N.

2018-06-01

In order to improve the ZrC-SiC ceramic and TC4 brazed joint property, graded double-layered SiC particles (SiCp)-reinforced TC4-based composite structure (named as GLS for convenience) was designed to relieve the residual stress in the joint. The GLS was successfully fabricated on TC4 substrate by double-layered laser deposition technology before the brazing process. The investigation of the GLS shows that the volume fraction of SiCp in the two composite layers was graded (20 and 39 vol pct, respectively). Ti5Si3 and TiC phases formed in the GLS due to the reaction of SiCp and TC4. The laser power-II (the laser power for the second deposition layer) affected the microstructure of the GLS significantly. Increasing the laser power-II would promote the reaction between the SiCp and TC4. But the high laser power-II made the layer I remelt completely and the two layers became homogeneous rather than graded structure. In the ZrC-SiC and TC4 brazed joint, the CTE (coefficient of thermal expansion) was graded from the TC4 to the ZrC-SiC due to the GLS, and the strength of the joint with the GLS (91 MPa) was higher than that without the GLS (43 MPa).

[Regulative effects of the acupuncture on glucose and lipid metabolism disorder in the patients of metabolic syndrome].

PubMed

Chen, Jie; Xing, Haijiao; Li, Qing; Li, Mei; Wang, Shaojin

2017-04-12

To observe the regulative effects of the acupuncture on glucose and lipid metabolism disorder in the patients of metabolic syndrome. Seventy-six patients of metabolic syndrome were rando-mized into an acupuncture plus western medicine group (37 cases) and a western medicine group (39 cases). In the western medicine group, the conventional western medication was used for 40 days. In the acupuncture plus western medicine group, the acupuncture was combined on the basis of the treatment as the western medicine group, the acupoints were Danzhong (CV 17), Zhongwan (CV 12), Tianshu (ST 25), etc. Ten treatments were as one session. There were 3 to 5 days of intervals between the sessions and totally 30 treatments were required. The body mass index (BMI), blood lipid, blood glucose, and comprehensive therapeutic effects were compared before and after treatment in the two groups. Before and after treatment, the differences were all significant in BMI, triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), fasting blood glucose (FBG), plasma glucose of 2 hours post glucose-load (2 hPG), fasting insulin (FINS) and insulin resistance index (HOMA-IR) (all P <0.05) in the acupuncture plus western medicine group, and the results after treatment were superior to those before treatment; the difference was not significant in BMI ( P >0.05) and those were all significant statistically in TG, TC, LDL-C, HDL-C, FBG, 2 hPG, FINS, HOMA-IR (all P <0.05) in the western medicine group, and the results after treatment were superior to those before treatment. After treatment, in comparison of the two groups, the results in the acupuncture plus western medicine group were better than those in the western medicine group. The differences were all signif-icant sta-tistically in BMI, TG, TC, LDL-C, HDL-C, FBG, 2 hPG, FINS, HOMA-IR (all P <0.05). On the basis of the conventional western medicine, the acupuncture relieves

The Expected Cardiovascular Benefit of Plasma Cholesterol Lowering with or Without LDL-C Targets in Healthy Individuals at Higher Cardiovascular Risk.

PubMed

Cesena, Fernando Henpin Yue; Laurinavicius, Antonio Gabriele; Valente, Viviane A; Conceição, Raquel D; Santos, Raul D; Bittencourt, Marcio S

2017-06-01

There is controversy whether management of blood cholesterol should be based or not on LDL-cholesterol (LDL-c) target concentrations. To compare the estimated impact of different lipid-lowering strategies, based or not on LDL-c targets, on the risk of major cardiovascular events in a population with higher cardiovascular risk. We included consecutive individuals undergoing a routine health screening in a single center who had a 10-year risk for atherosclerotic cardiovascular disease (ASCVD) ≥ 7.5% (pooled cohort equations, ACC/AHA, 2013). For each individual, we simulated two strategies based on LDL-c target (≤ 100 mg/dL [Starget-100] or ≤ 70 mg/dL [Starget-70]) and two strategies based on percent LDL-c reduction (30% [S30%] or 50% [S50%]). In 1,897 subjects (57 ± 7 years, 96% men, 10-year ASCVD risk 13.7 ± 7.1%), LDL-c would be lowered from 141 ± 33 mg/dL to 99 ± 23 mg/dL in S30%, 71 ± 16 mg/dL in S50%, 98 ± 9 mg/dL in Starget-100, and 70 ± 2 mg/dL in Starget-70. Ten-year ASCVD risk would be reduced to 8.8 ± 4.8% in S50% and 8.9 ± 5.2 in Starget-70. The number of major cardiovascular events prevented in 10 years per 1,000 individuals would be 32 in S30%, 31 in Starget-100, 49 in S50%, and 48 in Starget-70. Compared with Starget-70, S50% would prevent more events in the lower LDL-c tertile and fewer events in the higher LDL-c tertile. The more aggressive lipid-lowering approaches simulated in this study, based on LDL-c target or percent reduction, may potentially prevent approximately 50% more hard cardiovascular events in the population compared with the less intensive treatments. Baseline LDL-c determines which strategy (based or not on LDL-c target) is more appropriate at the individual level. Há controvérsias sobre se o controle do colesterol plasmático deve ou não se basear em metas de concentração de colesterol LDL (LDL-c). Comparar o impacto estimado de diferentes estratégias hipolipemiantes, baseadas ou não em metas de LDL-c, sobre o

Alteration of Lipid Parameters in Patients With Subclinical Hypothyroidism

PubMed Central

Laway, Bashir Ahmad; War, Fayaz Ahmad; Shah, Sonaullah; Misgar, Raiz Ahmad; Kumar Kotwal, Suman

2014-01-01

Background: Overt hypothyroidism is associated with abnormalities of lipid metabolism, but conflicting results regarding the degree of lipid changes in subclinical hypothyroidism (SCH) exist. Objectives: The aim of this study was to assess differences in lipid profile parameters between subjects with and without SCH in a north Indian population. Patients and Methods: Serum lipid parameters of 70 patients with subclinical hypothyroidism and 100 age and sex matched euthyroid controls were evaluated in a cross-sectional study. Results: Mean serum total cholesterol (TC), triglycerides (TG) and very low-density cholesterol (VLDL) were significantly higher in patients with SCH than controls (P < 0.05). Mean TC, TG and low-density cholesterol (LDL) concentrations were higher in patients with serum thyroid stimulating hormone (TSH) greater than 10 mU/L than those with serum TSH equal to or less than 10 mU/L, but this difference was not statistically significant. No association was found between serum high-density cholesterol (HDL-C) concentration and serum TSH level. Conclusions: High TC, TG and VLDL were observed in our patients with SCH. PMID:25237326

The plasma parameter log (TG/HDL-C) as an atherogenic index: correlation with lipoprotein particle size and esterification rate in apoB-lipoprotein-depleted plasma (FER(HDL)).

PubMed

Dobiásová, M; Frohlich, J

2001-10-01

To evaluate if logarithm of the ratio of plasma concentration of triglycerides to HDL-cholesterol (Log[TG/HDL-C]) correlates with cholesterol esterification rates in apoB-lipoprotein-depleted plasma (FER(HDL)) and lipoprotein particle size. We analyzed previous data dealing with the parameters related to the FER(HDL) (an indirect measure of lipoprotein particle size). In a total of 1433 subjects from 35 cohorts with various risk of atherosclerosis (cord plasma, children, healthy men and women, pre- and postmenopausal women, patients with hypertension, type 2 diabetes, dyslipidemia and patients with positive or negative angiography findings) were studied. The analysis revealed a strong positive correlation (r = 0.803) between FER(HDL) and Log(TG/HDL-C). This parameter, which we propose to call "atherogenic index of plasma" (AIP) directly related to the risk of atherosclerosis in the above cohorts. We also confirmed in a cohort of 35 normal subjects a significant inverse correlation of LDL size with FER(HDL) (r = -0.818) and AIP (r = -0.776). Values of AIP correspond closely to those of FER(HDL) and to lipoprotein particle size and thus could be used as a marker of plasma atherogenicity.

Triglyceride to HDL-C ratio and increased arterial stiffness in apparently healthy individuals.

PubMed

Wen, Jiang-Hua; Zhong, Yu-Yu; Wen, Zhi-Gang; Kuang, Chao-Qun; Liao, Jie-Rong; Chen, Li-Hua; Wang, Pei-Shen; Wu, Yue-Xia; Ouyang, Chu-Jun; Chen, Zhi-Jin

2015-01-01

High triglycerides and low high density lipoprotein cholesterol are important cardiovascular risk factors. Triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) has been reported to be useful in predicting cardiovascular disease. Brachial-ankle pulse wave velocity (baPWV) is a valid and reproducible measurement by which to assess arterial stiffness and a surrogate marker of atherosclerosis. However, there is limited evidence about the relationship between them. Therefore, we tested the hypotheses that TG/HDL-C is associated with baPWV in healthy individuals. Fasting lipid profiles, baPWV and clinical data were measured in 1498 apparently healthy, medication-free subjects (926 men, 572 women) who participated in a routine health screening from 2011 to 2013. Participants were stratified into quartiles of TG/HDL-C ratio. BaPWV > 1400 cm/s was defined as abnormal baPWV, Multivariable logistic regression was used to identify associations of TG/HDL-C quartiles and baPWV, after adjusting for the presence of conventional cardiovascular risk factors. In both genders, we observed positive relationships between TG/HDL-C quartiles and BMI, systolic BP, diastolic BP, fasting glucose, total cholesterol, LDL-C, triglycerides, uric acid, and percentages of high baPWV. Multivariable logistic regression revealed that baPWV abnormality OR value of the highest TG/HDL-C quartiles was 1.91 (95% CI: 1.11-3.30, P < 0.05) and 2.91 (95% CI: 1.02-8.30, P < 0.05) in male and female after adjusting for age, systolic BP, diastolic BP, BMI, fasting plasma glucose, LDL-C, uric acid and estimated glomerular filtration rate when compared with the lowest TG/HDL-C quartiles. Increased TG/HDL-C was independently associated with baPWV abnormality in apparently healthy individuals.

Triglyceride to HDL-C ratio and increased arterial stiffness in apparently healthy individuals

PubMed Central

Wen, Jiang-Hua; Zhong, Yu-Yu; Wen, Zhi-Gang; Kuang, Chao-Qun; Liao, Jie-Rong; Chen, Li-Hua; Wang, Pei-Shen; Wu, Yue-Xia; Ouyang, Chu-Jun; Chen, Zhi-Jin

2015-01-01

Objectives: High triglycerides and low high density lipoprotein cholesterol are important cardiovascular risk factors. Triglyceride to high-density lipoprotein cholesterol ratio (TG/HDL-C) has been reported to be useful in predicting cardiovascular disease. Brachial-ankle pulse wave velocity (baPWV) is a valid and reproducible measurement by which to assess arterial stiffness and a surrogate marker of atherosclerosis. However, there is limited evidence about the relationship between them. Therefore, we tested the hypotheses that TG/HDL-C is associated with baPWV in healthy individuals. Methods: Fasting lipid profiles, baPWV and clinical data were measured in 1498 apparently healthy, medication-free subjects (926 men, 572 women) who participated in a routine health screening from 2011 to 2013. Participants were stratified into quartiles of TG/HDL-C ratio. BaPWV > 1400 cm/s was defined as abnormal baPWV, Multivariable logistic regression was used to identify associations of TG/HDL-C quartiles and baPWV, after adjusting for the presence of conventional cardiovascular risk factors. Results: In both genders, we observed positive relationships between TG/HDL-C quartiles and BMI, systolic BP, diastolic BP, fasting glucose, total cholesterol, LDL-C, triglycerides, uric acid, and percentages of high baPWV. Multivariable logistic regression revealed that baPWV abnormality OR value of the highest TG/HDL-C quartiles was 1.91 (95% CI: 1.11-3.30, P < 0.05) and 2.91 (95% CI: 1.02-8.30, P < 0.05) in male and female after adjusting for age, systolic BP, diastolic BP, BMI, fasting plasma glucose, LDL-C, uric acid and estimated glomerular filtration rate when compared with the lowest TG/HDL-C quartiles. Conclusion: Increased TG/HDL-C was independently associated with baPWV abnormality in apparently healthy individuals. PMID:26064351

Self-Reported Snoring Is Associated with Dyslipidemia, High Total Cholesterol, and High Low-Density Lipoprotein Cholesterol in Obesity: A Cross-Sectional Study from a Rural Area of China.

PubMed

Zhang, Naijin; Chen, Yintao; Chen, Shuang; Jia, Pengyu; Guo, Xiaofan; Sun, Guozhe; Sun, Yingxian

2017-01-17

Studies to explore the relationship between self-reported snoring and dyslipidemia, especially high total cholesterol (TC) and high low-density lipoprotein cholesterol (LDL-C), in the general population are still lacking. Our study was designed to examine whether self-reported snoring is significantly associated with dyslipidemia and ascertain the effects of different snoring intensities on dyslipidemia. There were 10,139 participants in our study. After adjustment for all confounding factors, self-reported snoring (OR = 1.207; p = 0.003), moderate (OR = 1.229; p = 0.015), strong (OR = 1.222; p = 0.033), and very strong (OR = 1.467; p = 0.012) snoring intensity, but not low (OR = 1.110; p = 0.224) snoring intensity, were significantly associated with dyslipidemia among adults with BMI (body mass index) ≥ 25 kg/m². In addition, self-reported snoring was significantly associated with high TC (OR = 1.167; p = 0.048) and high LDL-C (OR = 1.228; p = 0.044), rather than low HDL-C (OR = 1.171; p = 0.057) and high triglyceride (TG) (OR = 1.110; p = 0.141). In conclusion, adults with BMI ≥ 25 kg/m² and who experience snoring, especially moderate, strong, and very strong intensity levels of snoring, should be on the alert regarding the possibility of dyslipidemia, especially high LDL-C and high TC.

Independent association of TG/HDL-C with urinary albumin excretion in normotensive subjects in a rural Korean population.

PubMed

Kang, Hee-Taik; Kim, Jong-Koo; Kim, Jang-Young; Linton, John A; Yoon, Jin-Ha; Koh, Sang-Baek

2012-01-18

The ratio of triglycerides (TG, mg/dl) to high-density lipoprotein cholesterol (HDL-C, mg/dl) is a reliable indicator of insulin resistance and atherosclerotic diseases in some ethnic groups. This study is performed to examine the association between TG/HDL-C and albuminuria. This cross-sectional study included 9094 adult subjects (4091 men, 5003 women) who were enrolled in the Korean Genomic Rural Cohort (KGRC) and aged 40 years or more. Albuminuria was defined as a urine albumin/creatinine ratio ≥ 30 mg/g. Participants were categorized into TG/HDL-C quartile. Compared to the lowest TG/HDL-C quartile (<1.94 in men, <1.71 in women), the odds ratios (ORs) for albuminuria in participants who were categorized in the highest TG/HDL-C quartile (≥ 4.98 in men, ≥ 4.20 in women) were 1.30 (95% CI: 0.97-1.75) and 1.36 (1.03-1.79) in men and women, respectively, when adjusted for blood pressure and other covariates. In normotensive men and women, the ORs for albuminuria in the highest TG/HDL-C quartile were 1.58 (1.04-2.39) and 1.68 (1.15-2.45), respectively, even after fully adjusted. In contrast, TG/HDL-C was not associated with albuminuria in hypertensive subjects. TG/HDL-C was independently associated with increased prevalence of albuminuria in normotensive rural Korean subjects aged 40 years or more in KGRC. Copyright © 2011 Elsevier B.V. All rights reserved.

Human plasma lipid modulation in schistosomiasis mansoni depends on apolipoprotein E polymorphism.

PubMed

Martins da Fonseca, Caíque Silveira; Pimenta Filho, Adenor Almeida; dos Santos, Bianka Santana; da Silva, César Augusto; Domingues, Ana Lúcia Coutinho; Owen, James Stuart; Lima, Vera Lúcia de Menezes

2014-01-01

Schistosomiasis mansoni is a parasitic liver disease, which causes several metabolic disturbances. Here, we evaluate the influence of Apolipoprotein E (APOE) gene polymorphism, a known modulator of lipid metabolism, on plasma lipid levels in patients with hepatosplenic schistosomiasis. Blood samples were used for APOE genotyping and to measure total cholesterol (TC), LDL-C, HDL-C and triglycerides. Schistosomiasis patients had reduced TC, LDL-C and triglycerides (25%, 38% and 32% lower, respectively; P<0.0001) compared to control individuals, whereas HDL-C was increased (10% higher; P = 0.0136). Frequency of the common alleles, ε2, ε3 and ε4, was similar (P = 0.3568) between controls (n = 108) and patients (n = 84), implying that APOE genotype did not affect susceptibility to the advanced stage of schistosomiasis. Nevertheless, while patient TC and LDL-C levels were significantly reduced for each allele (except TC in ε2 patients), changes in HDL-C and triglycerides were noted only for the less common ε2 and ε4 alleles. The most striking finding, however, was that accepted regulation of plasma lipid levels by APOE genotype was disrupted by schistosomiasis. Thus, while ε2 controls had higher TC and LDL-C than ε3 carriers, these parameters were lower in ε2 versus ε3 patients. Similarly, the inverse relationship of TG levels in controls (ε2>ε3>ε4) was absent in patients (ε2 or ε4>ε3), and the increase in HDL-C of ε2 or ε4 patients compared to ε3 patients was not seen in the control groups. We confirm that human schistosomiasis causes dyslipidemia and report for the first time that certain changes in plasma lipid and lipoprotein levels depend on APOE gene polymorphism. Importantly, we also concluded that S. mansoni disrupts the expected regulation of plasma lipids by the different ApoE isoforms. This finding suggests ways to identify new metabolic pathways affected by schistosomiasis and also potential molecular targets to treat

Prehypertension and Cardiovascular Risk Factors in Children and Adolescents Participating in the Community-Based Prevention Education Program Family Heart Study

PubMed Central

Haas, Gerda-Maria; Bertsch, Thomas; Schwandt, Peter

2014-01-01

Background: Because prehypertension identifies children most at risk for the development of future hypertensive disease, the purpose of this study was, to examine the association of prehypertension with risk factors for cardiovascular disease (CVD) in a large sample of youths participating in the community-based prevention education program family heart study. Methods: We estimated blood pressure and body mass index (BMI) for age and the lipid profile in terms of total cholesterol (TC), low-density-lipoprotein-cholesterol (LDL-C), high-density-lipoprotein-cholesterol (HDL-C), non-HDL-C, triglycerides (TG) and the LDL-C to HDL-C ratio. Results: Among 10,841 (5,628 males) children and adolescents 1,587 (14.6%) had prehypertension (85th to <95th percentile). This was strongly affected by weight, resulting in 19.7% in overweight (BMI ≥85th percentile) and 23.7% in obese (>95th percentile) youth. The prevalence of dyslipidemia was similar in prehypertensive boys and girls in terms of LDL-C 11.2% versus 11.8%, non HDL-C 11.9% versus 14.3%, TG 2.4% versus 2.7% and for low HDL-C 2.1% versus 2.3%. The prevalence of low HDL-C increased from 2.1% in non-overweight, through 3.9% in overweight to 5.2% in obese youth and of elevated TG from 1.2% via 4.5% to 6.5% respectively. The number of risk factors is affected by BMI. Significant associations between prehypertension and CVD risk factors were observed in boys and girls for overweight/obesity odds ratios (OR 2.0/2.4), for hypertriglyceridemia (OR 1.9/2.0), for high non HDL-C (OR 1.4/1.4) and for elevated LDL-C (OR 1.3/1.1). Conclusions: Prehypertension was significantly associated with overweight, obesity and dyslipidemia in 10,841 children and adolescents. PMID:24791192

Treatment patterns and low-density lipoprotein cholesterol (LDL-C) goal attainment among patients receiving high- or moderate-intensity statins.

PubMed

Fox, Kathleen M; Tai, Ming-Hui; Kostev, Karel; Hatz, Maximilian; Qian, Yi; Laufs, Ulrich

2018-05-01

European clinical guidelines recommend a low-density lipoprotein cholesterol (LDL-C) goal of < 70 mg/dL. Statin use varies and past studies suggest low rates of real-world goal attainment. This study describes LDL-C goal attainment among atherosclerotic CV disease (ASCVD) patients with various utilization patterns of moderate- or high-intensity statins in routine care. This retrospective cohort study used electronic medical records data from the QuintilesIMS® Disease Analyzer (> 2 million individuals annually) to identify ASCVD (coronary atherosclerosis, stable/unstable angina, myocardial infarction, ischemic stroke, transient ischemic attack, aneurysm, peripheral artery disease) patients on moderate-/high-intensity statin in Germany. Proportion of patients with LDL-C < 70 mg/dL was determined using the lowest LDL-C value for each patient (index) in 2012, 2013, and 2014, while on statin. Treatment patterns were assessed for patients with at least 1 year of post-index follow-up. Results were stratified by year and treatment pattern [no change, switch, dose up-/down-titration, discontinuation (≥ 90 day gap)]. In > 14,000 patients assessed in each year (mean age 71 years, 35% female, 8-12% taking high-intensity statins), approximately 80% had LDL-C ≥ 70 mg/dL. Treatment patterns were assessed for most (88-93%) patients. Approximately 79-81% of patients made no change to statin regimens, 1% switched statins, 14-16% discontinued; 1% of moderate-intensity patients up-titrated, and 3% of all patients down-titrated. LDL-C goal attainment in these treatment pattern groups was 20, 16-24, 17, 11-14, and 17-19%, respectively. Majority of ASCVD patients had LDL-C ≥ 70 mg/dL while on moderate-/high-intensity statins. Despite low LDL-C goal attainment, few patients changed their treatment regimens.

Effect of L-thyroxine treatment versus a placebo on serum lipid levels in patients with sub-clinical hypothyroidism

PubMed Central

Li, Xue; Meng, Zhaowei; Jia, Qiang; Ren, Xiaojun

2016-01-01

Sub-clinical hypothyroidism is a common disease and whether L-thyroxine replacement treatment improves serum lipid levels in affected patients remains controversial. Thus, the aim of the present meta-analysis was to assess the effect of L-thyroxine therapy on serum lipid levels in sub-clinical hyperthyroidism. Relevant randomized controlled trials (RCTs) containing continuous data, published until July 2015 were retrieved from the Cochrane Library, PubMed, Medline, Google Scholar and Embase databases and subjected to meta-analysis using Review Manager software version 5.2 (The Nordic Cochrane Centre, Copenhagen, Denmark). Seven RCTs comprising 319 patients were included. The overall methodological quality of the RCTs was good. Statistical analysis revealed that serum low-density lipoprotein-cholesterol (LDL-C) levels were significantly decreased after L-thyroxine treatment [mean difference (MD): −0.23; 95% confidence interval: −0.44, −0.03; P=0.02], while changes of total cholesterol (TC), triglyceride (TG) and high-density lipoprotein-cholesterol (HDL-C) were not significant (MD: −0.18, P=0.09; MD: −0.02, P=0.78; and MD: −0.06, P=0.14, respectively). In conclusion, the meta-analysis performed in the present study revealed that compared with placebo treatment, L-thyroxine significantly improved serum LDL-C levels in patients with sub-clinical hypothyroidism, while not significantly affecting TC, TG and HDL-C levels. PMID:27699011

Impact of Dietary Calcium Supplement on Circulating Lipoprotein Concentrations and Atherogenic Indices in Overweight and Obese Individuals: A Systematic Review.

PubMed

Heshmati, Javad; Sepidarkish, Mahdi; Namazi, Nazli; Shokri, Fatemeh; Yavari, Mahsa; Fazelian, Siavash; Khorshidi, Masoud; Shidfar, Farzad

2018-03-21

Dyslipidemia is the main risk factor for developing cardiovascular disease. There are discrepancies in the effects of calcium supplementation on modulation of lipid status. Therefore, we aimed to summarize the effects of dietary calcium supplement on circulating lipoprotein concentrations and atherogenic indices in overweight and obese individuals. We conducted a systematic literature search from 2000 until July 2016. PubMed, Scopus, Cochran Library, and ISI Web of Science databases were searched for clinical trials written in English. Placebo controlled clinical trials on calcium or calcium with vitamin D supplement in overweight and obese indiciduals were considered. Finally, 11 clinical trials met the criteria and were included. Most studies (n = 9) evaluated Ca/D co-supplementation. Positive effects of calcium supplementation alone or with vitamin D were as follows: serum levels of total cholesterol (TC; n = 1), triglyceride (TG) concentrations (n = 1), serum levels of low-density lipoprotein cholesterol (LDL-C; n = 5) and high-density lipoprotein cholesterol (HDL-C; n = 3). Seven clinical trials reported atherogenic indices and three of them demonstrated beneficial effects of calcium supplementation on at least one atherogenic index. Calcium supplementation may not be helpful to reduce serum levels of TC and TG in overweight and obese individuals. However, it may modulate LDL-C and HDL-C concentration. More studies are warranted to clarify the effects of calcium supplementation on each atherogenic index.

A Genome Wide Association Study Identifies Common Variants Associated with Lipid Levels in the Chinese Population

PubMed Central

Wu, Chen; Yang, Handong; Yu, Dianke; Yang, Xiaobo; Zhang, Xiaomin; Wang, Yiqin; Sun, Jielin; Gao, Yong; Tan, Aihua; He, Yunfeng; Zhang, Haiying; Qin, Xue; Zhu, Jingwen; Li, Huaixing; Lin, Xu; Zhu, Jiang; Min, Xinwen; Lang, Mingjian; Li, Dongfeng; Zhai, Kan; Chang, Jiang; Tan, Wen; Yuan, Jing; Chen, Weihong; Wang, Youjie; Wei, Sheng; Miao, Xiaoping; Wang, Feng; Fang, Weimin; Liang, Yuan; Deng, Qifei; Dai, Xiayun; Lin, Dafeng; Huang, Suli; Guo, Huan; Lilly Zheng, S.; Xu, Jianfeng; Lin, Dongxin; Hu, Frank B.; Wu, Tangchun

2013-01-01

Plasma lipid levels are important risk factors for cardiovascular disease and are influenced by genetic and environmental factors. Recent genome wide association studies (GWAS) have identified several lipid-associated loci, but these loci have been identified primarily in European populations. In order to identify genetic markers for lipid levels in a Chinese population and analyze the heterogeneity between Europeans and Asians, especially Chinese, we performed a meta-analysis of two genome wide association studies on four common lipid traits including total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL) and high-density lipoprotein cholesterol (HDL) in a Han Chinese population totaling 3,451 healthy subjects. Replication was performed in an additional 8,830 subjects of Han Chinese ethnicity. We replicated eight loci associated with lipid levels previously reported in a European population. The loci genome wide significantly associated with TC were near DOCK7, HMGCR and ABO; those genome wide significantly associated with TG were near APOA1/C3/A4/A5 and LPL; those genome wide significantly associated with LDL were near HMGCR, ABO and TOMM40; and those genome wide significantly associated with HDL were near LPL, LIPC and CETP. In addition, an additive genotype score of eight SNPs representing the eight loci that were found to be associated with lipid levels was associated with higher TC, TG and LDL levels (P = 5.52×10-16, 1.38×10-6 and 5.59×10-9, respectively). These findings suggest the cumulative effects of multiple genetic loci on plasma lipid levels. Comparisons with previous GWAS of lipids highlight heterogeneity in allele frequency and in effect size for some loci between Chinese and European populations. The results from our GWAS provided comprehensive and convincing evidence of the genetic determinants of plasma lipid levels in a Chinese population. PMID:24386095

Association of peripheral differential leukocyte counts with dyslipidemia risk in Chinese patients with hypertension: insight from the China Stroke Primary Prevention Trial.

PubMed

Liu, Yanhong; Kong, Xiangyi; Wang, Wen; Fan, Fangfang; Zhang, Yan; Zhao, Min; Wang, Yi; Wang, Yupeng; Wang, Yu; Qin, Xianhui; Tang, Genfu; Wang, Binyan; Xu, Xiping; Hou, Fan Fan; Gao, Wei; Sun, Ningling; Li, Jianping; Venners, Scott A; Jiang, Shanqun; Huo, Yong

2017-01-01

The aim of the present study was to examine the association between peripheral differential leukocyte counts and dyslipidemia in a Chinese hypertensive population. A total of 10,866 patients with hypertension were enrolled for a comprehensive assessment of cardiovascular risk factors using data from the China Stroke Primary Prevention Trial. Plasma lipid levels and total leukocyte, neutrophil, and lymphocyte counts were determined according to standard methods. Peripheral differential leukocyte counts were consistently and positively associated with serum total cholesterol (TC), LDL cholesterol (LDL-C), and TG levels (all P < 0.001 for trend), while inversely associated with HDL cholesterol levels (P < 0.05 for trend). In subsequent analyses where serum lipids were dichotomized (dyslipidemia/normolipidemia), we found that patients in the highest quartile of total leukocyte count (≥7.6 × 10 9 cells/l) had 1.64 times the risk of high TG [95% confidence interval (CI): 1.46, 1.85], 1.34 times the risk of high TC (95% CI: 1.20, 1.50), and 1.24 times the risk of high LDL-C (95% CI: 1.12, 1.39) compared with their counterparts in the lowest quartile of total leukocyte count. Similar patterns were also observed with neutrophils and lymphocytes. In summary, these findings indicate that elevated differential leukocyte counts are directly associated with serum lipid levels and increased odds of dyslipidemia. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

Anti-atherosclerotic effect of Cynodon dactylon extract on experimentally induced hypercholesterolemia in rats

PubMed Central

Pashaie, Belal; Hobbenaghi, Rahim; Malekinejad, Hassan

2017-01-01

Cynodon dactylon (Bermuda grass) is a perennial plant traditionally used as an herbal medicine in many countries. In the present study, anti-atherosclerotic property of ethanolic extract of C. dactylon was investigated in the experimentally induced hypercholesterolemia in rats. In this study, 36 male Wistar rats were selected and allocated into six groups (n = 6). The control group received a normal diet, sham group received a high cholesterol diet (HCD; 1.50% cholesterol and 24.00% fat) and other groups received a HCD and ethanolic extract of C. dactylon at low (100 mg kg-1), moderate (200 mg kg-1) and maximum (400 mg kg-1) doses via gavages. The last group received atorvastatin (10 mg kg-1) through gavage with a HCD. The study period for all groups was six months. At the end of this period, parameters including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) were assessed in the blood samples. Additionally, histopathological and immunohistochemical examinations on coronary and aorta arteries sections were performed. The results showed an increase in vessels wall thickness and proliferation of smooth muscle cells in the HCD group, while these pathological changes were not seen in C. dactylon-treated groups. Treatment of HCD animals with C. dactylon positively changed lipid profile by lowering of TC, TG and LDL-C. The results indicate that C. dactylon prevents from early atherosclerotic changes in the vessels wall. PMID:29085605

Anti-atherosclerotic effect of Cynodon dactylon extract on experimentally induced hypercholesterolemia in rats.

PubMed

Pashaie, Belal; Hobbenaghi, Rahim; Malekinejad, Hassan

2017-01-01

Cynodon dactylon (Bermuda grass) is a perennial plant traditionally used as an herbal medicine in many countries. In the present study, anti-atherosclerotic property of ethanolic extract of C. dactylon was investigated in the experimentally induced hypercholesterolemia in rats. In this study, 36 male Wistar rats were selected and allocated into six groups (n = 6). The control group received a normal diet, sham group received a high cholesterol diet (HCD; 1.50% cholesterol and 24.00% fat) and other groups received a HCD and ethanolic extract of C. dactylon at low (100 mg kg -1 ), moderate (200 mg kg -1 ) and maximum (400 mg kg -1 ) doses via gavages. The last group received atorvastatin (10 mg kg -1 ) through gavage with a HCD. The study period for all groups was six months. At the end of this period, parameters including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) were assessed in the blood samples. Additionally, histopathological and immunohistochemical examinations on coronary and aorta arteries sections were performed. The results showed an increase in vessels wall thickness and proliferation of smooth muscle cells in the HCD group, while these pathological changes were not seen in C. dactylon -treated groups. Treatment of HCD animals with C. dactylon positively changed lipid profile by lowering of TC, TG and LDL-C. The results indicate that C. dactylon prevents from early atherosclerotic changes in the vessels wall.

The role of dietary fat on the association between dietary amino acids and serum lipid profile in European adolescents participating in the HELENA Study.

PubMed

Bel-Serrat, S; Mouratidou, T; Huybrechts, I; Cuenca-García, M; Manios, Y; Gómez-Martínez, S; Molnár, D; Kafatos, A; Gottrand, F; Widhalm, K; Sjöström, M; Wästlund, A; Stehle, P; Azzini, E; Vyncke, K; González-Gross, M; Moreno, L A

2014-04-01

The objective of this study was to examine the relationship between amino acid (AA) intake and serum lipid profile in European adolescents from eight European cities participating in the cross-sectional (2006-2007) HELENA (Healthy Lifestyle in Europe by Nutrition in Adolescence) study, and to assess whether this association was independent of total fat intake. Diet, skinfold thickness, triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-c), TC/HDL-c ratio, low-density lipoprotein cholesterol (LDL-c), apolipoprotein B (Apo B), apolipoprotein A1 (Apo A1) and Apo B/Apo A1 ratio were measured in 454 12.5- to 17.5-year-old adolescents (44% boys). Intake was assessed via two non-consecutive 24-h dietary recalls. Data on maternal education and sedentary behaviors were obtained via questionnaires. Physical activity was objectively measured by accelerometry. Alanine, arginine, asparaginic acid, glycine, histidine, lysine and serine intakes were inversely associated with serum TG concentrations in both boys and girls. Intake of other AA like alanine and/or arginine was also inversely associated with serum TC, LDL-c and Apo B/Apo A1 ratio only in girls. An inverse association was observed between intakes of alanine, isoleucine, leucine, methionine, serine, tryptophan, tyrosine and valine and TC/HDL-c ratio among female adolescents. Similar results were found in males for serine and tryptophan intakes. It is noteworthy, however, that associations were no longer significant in both genders when total fat intake was considered as a confounding factor. In this sample of adolescents, the association between AA intakes and serum lipid profile did not persist when dietary fat was considered. Therefore, dietary interventions and health promotion activities should focus on fat intake to improve lipid profile and potentially prevent cardiovascular disease.

Better Body Composition and Lipid Profile Can Be Associated with Vitamin D Status in Spanish Elderly? The PHYSMED Study.

PubMed

Souza, W N; Aparicio-Ugarriza, R; Bibiloni, M M; Palacios, G; Aguilar, I; Tur, J A; González-Gross, M

2017-01-01

Studies have shown that vitamin D deficiency increases the risk for lipid metabolism disorders, but this relationship has provided inconsistent results in elderly. Thus the aim was to assess the association between body composition and blood lipid profile levels on serum 25-hydrovitamin D [25(OH)D] concentration in Spanish elderly. A cross-sectional multicentre study was carried out in 383 participants (58.2% females) aged of 55-88 years. Fasting blood samples analyzed serum concentrations of 25(OH)D, low-density lipoprotein (LDL), high-density lipoprotein (HDL), triglycerides (TG) and total cholesterol (TC). Body composition parameters (fat mass, fat free mass) were obtained by bioimpedance, waist circumference (WC), physical activity and vitamin D intake were also evaluated. BMI, fat mass and total fat mass were lower in vitamin D sufficient subjects than vitamin D insufficient and deficient subjects, but this difference was not significant (p>0,05). Those with vitamin D adequate levels also showed lower TC/HDL ratio than those who had inadequate (insufficient or deficient) vitamin D levels (p=0.04). Significant association between 25(OH)D and BMI, waist circumference, total muscle mass, TC/HDL-c ratio, HDL and TG (for all p≤ 0.05) was found after controlling for some confounders. Subjects with inadequate HDL levels (<40mg/dL) showed 1.7 times higher odds than vitamin D deficiency than those with adequate HDL levels (>60mg/dL) (95% CI= 1.10 to 2.85 p= 0.017) and WC was negatively associated with vitamin D status odds ratio of 0.98 (0.96 to 1.00; p= 0.04). Vitamin D concentration was positively correlated with HDL-c and total muscle mass, as well as negatively correlated with WC, LDL-c/HDL-c and TC/HDL-c independently of age, gender and some confounders.

Triglyceride to high-density lipoprotein cholesterol (HDL-C) ratio and arterial stiffness in Japanese population: a secondary analysis based on a cross-sectional study.

PubMed

Chen, Chi; Dai, Jia-Lin

2018-05-29

Previous studies have revealed that triglyceride to high-density lipoprotein cholesterol (HDL-C) ratio (henceforth TG/HDL-C) is one of major risk factors of cardiovascular diseases, insulin resistance and metabolism syndrome. However, there are fewer scientific dissertations about the correlation between TG/HDL-C and bapWV. This study was undertaken to investigate the relationship between Triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio and brachial-ankle pulse wave velocity (baPWV) in Japanese. The present study was a cross-sectional study. 912 Japanese men and women, aging 24-84 years old, received a health medical a health check-up program including the results from baPWV inspection and various standardized questionnaire in a health examination Center in Japan. Main outcome measures included TG/HDL-C ratio, baPWV, fatty liver, postmenopausal status. Abdominal ultrasonography was used to diagnose fatty liver. Postmenopausal state was defined as beginning 1 year after the cessation of menses. It was noted that the entire study was completed by Fukuda et al., and uploaded the data to the DATADRYAD website. The author only used this data for secondary analysis. After adjusting potential confounders (age, sex, BMI, SBP, DBP, AST, ALT, GGT, uric acid, fasting glucose, TC, LDL, eGFR, smoking and exercise status, fatty liver, alcohol consumption and ABI), non-linear relationship was detected between TG/HDL-C and baPWV, whose point was 5.6. The effect sizes and the confidence intervals on the left and right sides of inflection point were 12.7 (1.9 to 23.5) and - 16.7 (- 36.8 to 3.3), respectively. Subgroup analysis showed, in participants with excessive alcohol consumption (more than 280 g/week), that TG/HDL-C had a negative correlation with BAPWV (β = - 30.7, 95%CI (- 53.1, - 8.4)), and the P for interaction was less than 0.05, CONCLUSION: The relationship between TG/HDL-C and baPWV is non-linear. TG/HDL-C was positively

LDL-cholesterol lowering effect of a new dietary supplement: an open label, controlled, randomized, cross-over clinical trial in patients with mild-to-moderate hypercholesterolemia.

PubMed

Magno, S; Ceccarini, G; Pelosini, C; Jaccheri, R; Vitti, J; Fierabracci, P; Salvetti, G; Airoldi, G; Minale, M; Saponati, G; Santini, F

2018-05-24

Hypercholesterolemia is a major risk factor for cardiovascular disorders and requires specific intervention through an adequate lifestyle (diet and physical exercise) and, if necessary, an appropriate drug treatment. Lipid-lowering drugs, although generally efficacious, may sometimes cause adverse events. A growing attention has been devoted to the correction of dyslipidemias through the use of dietary supplements. The aim of this study was to assess the lipid-lowering activity and safety of a dietary supplement containing monacolin K, L-arginine, coenzyme Q10 and ascorbic acid, named Argicolina (A), compared to a commercially available product containing monacolin K and coenzyme Q10, Normolip 5 (N). This was a single center, controlled, randomized, open-label, cross-over clinical study enrolling 20 Caucasian outpatients aged 18-75 years with serum LDL-C between 130 and 180 mg/dL. Patients assumed two different dietary supplements (A and N) both containing monacolin K 10 mg for 8 weeks each, separated by a 4-week wash-out period. Evaluated parameters were: Total cholesterol (Tot-C), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglycerides (TG), fasting blood glucose, aspartate aminotransferase, alanine aminotransferase, creatinekinase, gamma-glutamyl-transpeptidase, brachial arterial pressure and heart rate, measured at the start and at the end of each treatment period. Safety was monitored through the study. LDL-C decreased by 23.3% during treatment with N (p < 0.0001) and by 25.6% during treatment with A (p < 0.0001); the LDL-C mean reduction was 36.4 (95% CI: 45,6-27,1) mg/dL during N treatment and 40.1 (95% CI: 49.2-30,9) mg/dL during A treatment. Tot-C decreased significantly (p < 0.0001) within each treatment period. HDL-C increase was negligible during A whereas it was significant during N. TG diminished markedly during A and not significantly during N. The difference between treatments was not

Antioxidant activity of Artocarpus heterophyllus Lam. (Jack Fruit) leaf extracts: remarkable attenuations of hyperglycemia and hyperlipidemia in streptozotocin-diabetic rats.

PubMed

Omar, Haidy S; El-Beshbishy, Hesham A; Moussa, Ziad; Taha, Kamilia F; Singab, Abdel Nasser B

2011-04-05

The present study examines the antioxidative, hypoglycemic, and hypolipidemic activities of Artocarpus heterophyllus (jack fruit) leaf extracts (JFEs). The 70% ethanol (JFEE), n-butanol (JFBE), water (JFWE), chloroform (JFCE), and ethyl acetate (JFEAE) extracts were obtained. Both JFEE and JFBE markedly scavenge diphenylpicrylhydrazyl radical and chelate Fe+2 in vitro. A compound was isolated from JFBE and identified using 1D and 2D 1H- and 13C-NMR. The administration of JFEE or JFBE to streptozotocin (STZ)-diabetic rats significantly reduced fasting blood glucose (FBG) from 200 to 56 and 79 mg%, respectively; elevated insulin from 10.8 to 19.5 and 15.1 µU/ml, respectively; decreased lipid peroxides from 7.3 to 5.4 and 5.9 nmol/ml, respectively; decreased %glycosylated hemoglobin A1C (%HbA1C) from 6.8 to 4.5 and 5.0%, respectively; and increased total protein content from 2.5 to 6.3 and 5.7 mg%, respectively. Triglycerides (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), VLDL-C, and LDL/HDL ratio significantly declined by -37, -19, -23, -37, and -39%, respectively, in the case of JFEE; and by -31, -14, -17, -31, and -25%, respectively, in the case of JFBE; as compared to diabetic rats. HDL-C increased by +37% (JFEE) and by +11% (JFBE). Both JFEE and JFBE have shown appreciable results in decreasing FBG, lipid peroxides, %HbA1C, TC, LDL-C, and TG levels, and increasing insulin, HDL-C, and protein content. The spectrometric analysis confirmed that the flavonoid isolated from JFBE was isoquercitrin. We can conclude from this study that JFEE and JFBE exert hypoglycemic and hypolipidemic effects in STZ-diabetic rats through an antioxidative pathway that might be referred to their flavonoid contents.

Antioxidant Activity of Artocarpus heterophyllus Lam. (Jack Fruit) Leaf Extracts: Remarkable Attenuations of Hyperglycemia and Hyperlipidemia in Streptozotocin-Diabetic Rats

PubMed Central

Omar, Haidy S.; El-Beshbishy, Hesham A.; Moussa, Ziad; Taha, Kamilia F.; Singab, Abdel Nasser B.

2011-01-01

The present study examines the antioxidative, hypoglycemic, and hypolipidemic activities of Artocarpus heterophyllus (jack fruit) leaf extracts (JFEs). The 70% ethanol (JFEE), n-butanol (JFBE), water (JFWE), chloroform (JFCE), and ethyl acetate (JFEAE) extracts were obtained. Both JFEE and JFBE markedly scavenge diphenylpicrylhydrazyl radical and chelate Fe+2in vitro. A compound was isolated from JFBE and identified using 1D and 2D 1H- and 13C-NMR. The administration of JFEE or JFBE to streptozotocin (STZ)-diabetic rats significantly reduced fasting blood glucose (FBG) from 200 to 56 and 79 mg%, respectively; elevated insulin from 10.8 to 19.5 and 15.1 μU/ml, respectively; decreased lipid peroxides from 7.3 to 5.4 and 5.91 nmol/ml, respectively; decreased %glycosylated hemoglobin A1C (%HbA1C) from 6.8 to 4.5 and 5.0%, respectively; and increased total protein content from 2.5 to 6.3 and 5.7 mg%, respectively. Triglycerides (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), VLDL-C, and LDL/HDL ratio significantly declined by -37, -19, -23, -37, and -39%, respectively, in the case of JFEE; and by -31, -14, -17, -31, and -25%, respectively, in the case of JFBE; as compared to diabetic rats. HDL-C increased by +37% (JFEE) and by +11% (JFBE). Both JFEE and JFBE have shown appreciable results in decreasing FBG, lipid peroxides, %HbA1C, TC, LDL-C, and TG levels, and increasing insulin, HDL-C, and protein content. The spectrometric analysis confirmed that the flavonoid isolated from JFBE was isoquercitrin. We can conclude from this study that JFEE and JFBE exert hypoglycemic and hypolipidemic effects in STZ-diabetic rats through an antioxidative pathway that might be referred to their flavonoid contents. PMID:21479350

Association of lipoprotein lipase S447X, apolipoprotein E exon 4, and apoC3 -455T>C polymorphisms on the susceptibility to diabetic nephropathy.

PubMed

Ng, M C Y; Baum, L; So, W-Y; Lam, V K L; Wang, Y; Poon, E; Tomlinson, B; Cheng, S; Lindpaintner, K; Chan, J C N

2006-07-01

Diabetic nephropathy (DN) is the leading cause of end-stage renal disease. In DN patients, triglyceride (TG) level is elevated and lipoprotein lipase (LPL) activity, which hydrolyzes TG, is decreased. The LPL S447X and apolipoprotein E (APOE) exon 4 polymorphisms affect TG levels, and the APOC3 -455T>C polymorphism affects LPL activity. Our aim was to examine the association of these polymorphisms with nephropathy in type 2 diabetes. We examined these polymorphisms in a case-control study of type 2 diabetic patients including 374 with DN and 392 without DN. LPL 447X-containing genotypes (447X+) were significantly decreased in DN patients [18.6 vs 25.6%, odds ratio (OR) = 0.66, p = 0.02], as were APOE epsilon3/epsilon3 genotypes (64.8 vs 73.1%, OR = 0.68, p = 0.01). In addition, combinations of genotypes [APOE epsilon3/epsilon3 and LPL 447X+ (OR = 0.56), APOC3 CC and LPL 447X+ (OR = 0.31), APOE epsilon3/epsilon3 and APOC3 CC (OR = 0.61] were protective for DN compared with the most common combination of the respective polymorphisms. Our findings suggest the importance of interactions among lipid genes in modulating the risk of DN.

The triglyceride-to-high density lipoprotein cholesterol ratio in overweight Korean children and adolescents.

PubMed

Yoo, Dong-Yoon; Kang, Yu Sun; Kwon, Eun Byul; Yoo, Eun-Gyong

2017-09-01

The triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio has recently been reported as a biomarker of cardiometabolic risk in obese children and adolescents. The purpose of this study is to describe the TG/HDL-C ratio and related factors in overweight and normal weight Korean children and to evaluate whether the high TG/HDL-C ratio is associated with insulin resistance in overweight children and adolescents. Data from 255 overweight (aged 8.7±2.0 years) and 514 normal weight (aged 8.9±1.8 years) children and adolescents were evaluated. Glucose, insulin, total cholesterol (TC), HDL-C and TG levels were measured after overnight fasting, and the TG/HDL-C ratio, non-HDL-C and the homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. The TG/HDL-C ratio was higher in overweight group compared to normal weight group (P<0.001). Among overweight children and adolescents, alanine aminotransferase (P=0.018), non-HDL-C (P<0.001), and HOMA-IR (P=0.004) were different between the TG/HDL-C ratio tertile groups. The prevalence of elevated HOMA-IR was increased with increasing TG/HDL-C ratio tertiles (P for trend=0.003). On regression analysis adjusted for age and sex, the BMI (β=0.402, P=0.001) and TG/HDL-C ratio (β=0.251, P=0.014) were independently associated with HOMA-IR (adjusted R2=0.324). The TG/HDL-C ratio of 2.0 or more showed higher sensitivity (55.6%) and specificity (72.9%), when compared to TC (≥200 mg/dL), non-HDL-C (≥145 mg/dL), and LDL-C (≥130 mg/dL) for identifying overweight children with elevated HOMA-IR. The TG/HDL-C ratio is independently associated with insulin resistance in overweight children and adolescents, and it can be useful in identifying those at higher cardiometabolic risk.

The triglyceride-to-high density lipoprotein cholesterol ratio in overweight Korean children and adolescents

PubMed Central

Yoo, Dong-Yoon; Kang, Yu Sun; Kwon, Eun Byul

2017-01-01

Purpose The triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio has recently been reported as a biomarker of cardiometabolic risk in obese children and adolescents. The purpose of this study is to describe the TG/HDL-C ratio and related factors in overweight and normal weight Korean children and to evaluate whether the high TG/HDL-C ratio is associated with insulin resistance in overweight children and adolescents. Methods Data from 255 overweight (aged 8.7±2.0 years) and 514 normal weight (aged 8.9±1.8 years) children and adolescents were evaluated. Glucose, insulin, total cholesterol (TC), HDL-C and TG levels were measured after overnight fasting, and the TG/HDL-C ratio, non–HDL-C and the homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Results The TG/HDL-C ratio was higher in overweight group compared to normal weight group (P<0.001). Among overweight children and adolescents, alanine aminotransferase (P=0.018), non–HDL-C (P<0.001), and HOMA-IR (P=0.004) were different between the TG/HDL-C ratio tertile groups. The prevalence of elevated HOMA-IR was increased with increasing TG/HDL-C ratio tertiles (P for trend=0.003). On regression analysis adjusted for age and sex, the BMI (β=0.402, P=0.001) and TG/HDL-C ratio (β=0.251, P=0.014) were independently associated with HOMA-IR (adjusted R2=0.324). The TG/HDL-C ratio of 2.0 or more showed higher sensitivity (55.6%) and specificity (72.9%), when compared to TC (≥200 mg/dL), non–HDL-C (≥145 mg/dL), and LDL-C (≥130 mg/dL) for identifying overweight children with elevated HOMA-IR. Conclusions The TG/HDL-C ratio is independently associated with insulin resistance in overweight children and adolescents, and it can be useful in identifying those at higher cardiometabolic risk. PMID:29025201

Mediterranean dietary pattern and VEGF +405 G/C gene polymorphisms in patients with metabolic syndrome: An aspect of gene-nutrient interaction

PubMed Central

Hajiluian, Ghazaleh; Abbasalizad Farhangi, Mahdieh; Jahangiry, Leila

2017-01-01

Aims To evaluate the relationship between Mediterranean dietary pattern, anthropometric and metabolic biomarkers and vascular endothelial growth factor (VEGF) +405 G/C gene polymorphism in patient with metabolic syndrome (Mets). Materials and methods In this study 150 patients with Mets and 50 healthy subjects were enrolled. Dietary intakes were evaluated with a semi-quantitative food-frequency questionnaire (FFQ) and Mediterranean dietary quality index (Med-DQI) was assessed. Anthropometric assessments and blood pressure measurement were performed. Biochemical assays including fasting serum glucose (FSG), matrix metalloproteinase-3 (MMP-3), liver enzymes and lipid profiles were also assessed. Polymorphism of +405 G/C VEGF gene was determined utilizing polymerase chain reaction-restriction fragments length polymorphism (PCR-RFLP) method. Results Serum high density lipoprotein-cholesterol (HDL-C) was significantly lower and low density lipoprotein cholesterol (LDL-C), triglyceride (TG), total cholesterol (TC) concentrations and FSG were significantly higher in metabolic syndrome patients compared with control group (P < 0.05). Metabolic syndrome group with high consumption of “cholesterol” had significantly upper serum TG; also high consumption of “fish” and “vegetables-fruits” was associated with a significantly lower serum LDL concentrations. In metabolic syndrome patients with CC genotype, mean score of “saturated fatty acid” subgroup was significantly higher compared with other genotypes; whereas, in healthy individuals, mean score of “fruit-vegetable” subgroup in individuals of CC and GG genotype was significantly higher (P<0.05). Conclusion Our findings indicated a significant relationship between Mediterranean dietary quality index and both anthropometric and metabolic risk factors. We also indicated a higher “saturated fatty acid” intake in CC genotype among metabolic syndrome patients. PMID:28212431

Sida rhomboidea.Roxb aqueous extract down-regulates in vivo expression of vascular cell adhesion molecules in atherogenic rats and inhibits in vitro macrophage differentiation and foam cell formation.

PubMed

Thounaojam, Menaka C; Jadeja, Ravirajsinh N; Salunke, Sunita P; Devkar, Ranjitsinh V; Ramachandran, A V

2012-10-01

The present study evaluates efficacy of Sida rhomboidea.Roxb (SR) leaves extract in ameliorating experimental atherosclerosis using in vitro and in vivo experimental models. Atherogenic (ATH) diet fed rats recorded significant increment in the serum total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), very LDL (VLDL), autoantibody against oxidized LDL (Ox-LDL), markers of LDL oxidation and decrement in high-density lipoprotein (HDL) along with increment in aortic TC and TG. The ex vivo LDL oxidation assay revealed an increased susceptibility of LDL isolated from ATH rats to undergo copper mediated oxidation. These set of changes were minimized by simultaneous co-supplementation of SR extract to ATH diet fed rats. Histopathology of aorta and immunolocalization studies recorded pronounced atheromatous plaque formation, vascular calcification, significant elastin derangements and higher expression of macrophage surface marker (F4/80), vascular cell adhesion molecule-1 (VCAM-1) and p-selectin in ATH rats. Whereas, ATH+SR rats depicted minimal evidence of atheromatous plaque formation, calcium deposition, distortion/defragmentation of elastin and accumulation of macrophages along with lowered expression of VCAM-1 and P-selectin compared to ATH rats. Further, monocyte to macrophage differentiation and in vitro foam cell formation were significantly attenuated in presence of SR extract. In conclusion, SR extract has the potency of controlling experimental atherosclerosis and can be used as promising herbal supplement in combating atherosclerosis.

[BO's abdominal acupuncture for obese type-2 diabetes mellitus].

PubMed

Yang, Yuan; Liu, Yunxia

2015-04-01

To observe the clinical efficacy of BO's abdominal acupuncture for obese type-2 diabetes mellitus (T2DM). Sixty patients of obese T2DM were randomly divided into an acupuncture group and a medication group, 30 cases in each one. Patients in the medication group were treated with basic treatment combined with oral administration of regular antidiabetics, three weeks as one session. Patients in the acupuncture group, based on the medication group, were treated with abdominal acupuncture at Yinqiguiyuan [Zhongwan (CV 12), Xiawan (CV 10), Qihai (CV 6), Guanguan (CV 4)], Fusiguan [Huaroumen (ST 24), Wailing (TE 5)], Tianshu (ST 25), Daheng (SP 15), Qixue (KI 13), etc.; the treatment was given three times per week, 3 weeks as one session. The systolic blood pressure (SBP), diastolic blood pressure (DBP), body weight, waist circumference (WC), hip circumference, body mass index (BI) were observed before and after treatment in the two groups, and fasting plasma glucose (FPG), fasting insulin (FINS), 2-hours postprandial blood glucose by oral glucose tolerance test (OGTT) and insulin, total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C), HOMA-IR of insulin resistance index were calculated and adverge events were recorded. Compared before the treatment, SBP, WC, body weight, BMI, FPG, OG-TT2hBG, FINS, GTT2h insulin, HOMA-IR, TC and LDL-C in the acupuncture group were all significantly reduced (all P <0. 05), while FPG, OGTT2H insulin and TG were increased in the medication group (all P<0. 05)'. The differences of reducing SBP, WC, FPG, OGTT2H insulin, HOMA-IR, TC, TG and LDL-C were statistically significant between the two groups (all P<0. 05). The total effective rate was 93. 3% (28/30) in the acupuncture group, which was significantly superior to 23. 3% (7/30) in the medication group (P<0. 01). BO's abdominal acupuncture has obvious clinical efficacy for obese type-2 diabetes mellitus

Statistical inference for tumor growth inhibition T/C ratio.

PubMed

Wu, Jianrong

2010-09-01

The tumor growth inhibition T/C ratio is commonly used to quantify treatment effects in drug screening tumor xenograft experiments. The T/C ratio is converted to an antitumor activity rating using an arbitrary cutoff point and often without any formal statistical inference. Here, we applied a nonparametric bootstrap method and a small sample likelihood ratio statistic to make a statistical inference of the T/C ratio, including both hypothesis testing and a confidence interval estimate. Furthermore, sample size and power are also discussed for statistical design of tumor xenograft experiments. Tumor xenograft data from an actual experiment were analyzed to illustrate the application.

The association between achieving low-density lipoprotein cholesterol (LDL-C) goal and statin treatment in an employee population.

PubMed

Burton, Wayne N; Chen, Chin-Yu; Schultz, Alyssa B; Edington, Dee W

2010-02-01

Statin medications are recommended for patients who have not achieved low-density lipoprotein cholesterol (LDL-C) goals through lifestyle modifications. The objective of this retrospective observational study was to examine statin medication usage patterns and the relationship with LDL-C goal levels (according to Adult Treatment Panel III guidelines) among a cohort of employees of a major financial services corporation. From 1995 to 2004, a total of 1607 executives participated in a periodic health examination program. An index date was assigned for each study participant (date of their exam) and statin medication usage was determined from the pharmacy claims database for 365 days before the index date. Patients were identified as adherent to statins if the medication possession ratio was > or =80%. In all, 150 (9.3%) executives filled at least 1 statin prescription in the 365 days prior to their exam. A total of 102 statin users (68%) were adherent to statin medication. Among all executives who received statin treatment, 70% (odds ratio [OR] = 2.30, 95% confidence interval [CI] = 1.82, 2.90) achieved near-optimal (<130 mg/dL) and 30% (OR = 1.78, 95% CI = 1.15, 2.76) achieved optimal (<100 mg/dL) LDL-C goals, which is significantly higher than the rates among statin nonusers (55% and 21%). Adherent statin users were more likely to achieve recommended near-optimal LDL-C goals compared to statin nonusers (overall P = 0.002; adherent: OR = 2.75, 95% CI = 1.662, 4.550), while nonadherent statin users were more likely to achieve the optimal goal compared to statin nonusers (OR = 2.223; CI = 1.145, 4.313). Statin usage was associated with improvements in LDL-C goal attainment among executives who participated in a periodic health examination. Appropriate statin medication adherence should be encouraged in working populations in order to achieve LDL-C goals.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

PubMed

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

2018-01-01

The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16) and percent truncal body fat (p<2*10-16). Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001). Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations. Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

NAMPT -3186C/T polymorphism affects repaglinide response in Chinese patients with Type 2 diabetes mellitus.

PubMed

Sheng, Fei-Feng; Dai, Xing-Ping; Qu, Jian; Lei, Guang-Hua; Lu, Hong-Bin; Wu, Jing; Xu, Xiao-Jing; Pei, Qi; Dong, Min; Liu, Ying-Zi; Zhou, Hong-Hao; Liu, Zhao-Qian

2011-08-01

1. In the present study, we investigated the associations of nicotinamide phosphoribosyltransferase (NAMPT)-3186 C/T and -948G/T polymorphisms with the risk of Type 2 diabetes mellitus (T2DM) and their impact on the efficacy of repaglinide in Chinese Han T2DM patients. 2. In all, 170 patients with T2DM and 129 healthy controls were genotyped for NAMPT-948G>T and -3186C>T polymorphisms. Thirty-five patients with different NAMPT -3186 C/T genotypes and the same organic anion-transporting polypeptide 1B1 (OATP1B1521) T/C genotype were randomly selected to undergo 8 weeks preprandial repaglinide treatment (1 mg, three times daily). Serum fasting plasma glucose (FPG), post-prandial plasma glucose (PPG), glycated haemoglobin (HbAlc), fasting serum insulin (FINS), post-prandial serum insulin (PINS), triglyceride (TG), total cholesterol (CHO), homeostasis model assessment of insulin resistance (HOMA-IR), low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol (HDL-C) were determined before and after repaglinide treatment. 3. After repaglinide treatment for 8 consecutive weeks, there were significantly decreases in PFG, PPG, HbAlc, CHO and LDL-C, and increases in FINS, HDL-C and the HDL-C : LDL-C ratio, in T2DM patients. The elevated PINS value in patients with CT genotypes was significantly lower than that in patients with the CC and TT genotypes (P < 0.05) and there were significant differences in CHO between patients with the CT genotype and the CC or TT genotype (P < 0.05). 4. The data suggest that the NAMPT -3186C>T polymorphism is significantly associated with plasma levels of PINS and CHO in Chinese T2DM patients with repaglinide monotherapy. © 2011 The Authors. Clinical and Experimental Pharmacology and Physiology © 2011 Blackwell Publishing Asia Pty Ltd.

The Impact of Cardiorespiratory Fitness on Age-Related Lipids and Lipoproteins

PubMed Central

Park, Yong-Moon Mark; Sui, Xuemei; Liu, Junxiu; Zhou, Haiming; Kokkinos, Peter F.; Lavie, Carl J.; Hardin, James W.; Blair, Steven N.

2015-01-01

Background Evidence on the effect of cardiorespiratory fitness (CRF) on age-related longitudinal changes of lipids and lipoproteins is scarce. Objectives This study sought to assess the longitudinal, aging trajectory of lipids and lipoproteins for the life course in adults, and to determine whether CRF modifies the age-associated trajectory of lipids and lipoproteins. Methods Data came from 11,418 men, 20 to 90 years of age, without known high cholesterol, high triglycerides, cardiovascular disease, and cancer at baseline and during follow-up from the Aerobics Center Longitudinal Study. There were 43,821 observations spanning 2 to 25 (mean 3.5) health examinations between 1970 and 2006. CRF was quantified by a maximal treadmill exercise test. Marginal models using generalized estimating equations were applied. Results Total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), and non-high-density lipoprotein cholesterol (non-HDL-C) presented similar inverted U-shaped quadratic trajectories with aging: gradual increases were noted until the mid-40s to early 50s, with subsequent declines (all p < 0.0001). Compared to men with higher CRF, those with lower CRF developed abnormal values earlier in life: TC (≥200 mg/dl), LDL-C (≥130 mg/dl), non-HDL-C (≥160 mg/dl), and TG/HDL-C ratio (≥3.0). Notably, abnormal values for TC and LDL-C in men with low CRF were observed around 15 years earlier than in those with high CRF. After adjusting for time-varying covariates, a significant interaction was found between age and CRF in each trajectory, indicating that CRF was more strongly associated with the aging trajectories of lipids and lipoproteins in young to middle-aged men than in older men. Conclusions Our investigation reveals a differential trajectory of lipids and lipoproteins with aging according to CRF in healthy men, and suggests that promoting increased CRF levels may help delay the development of dyslipidemia. PMID:25975472

Impact of the Use of Different Diagnostic Criteria in the Prevalence of Dyslipidemia in Pregnant Women

PubMed Central

Feitosa, Alina Coutinho Rodrigues; Barreto, Luciana Tedgue; da Silva, Isabela Matos; da Silva, Felipe Freire; Feitosa Filho, Gilson Soares

2017-01-01

Background There is a physiologic elevation of total cholesterol (TC) and triglycerides (TG) during pregnancy. Some authors define dyslipidemia (DLP) in pregnant women when TC, LDL and TG concentrations are above the 95th percentile (p95%) and HDL concentration is below the 5th percentile (P5%) for gestational age (GA). Objective To compare the prevalence of DLP in pregnant women using percentiles criteria with the V Brazilian Guidelines on Dyslipidemia and the association with maternal and fetal outcomes. Results Pregnant women with high-risk conditions, aged 18-50 years, and at least one lipid profile during pregnancy was classified as the presence of DLP by two diagnostic criteria. Clinical and laboratorial data of mothers and newborns were evaluated. Conclusion 433 pregnant women aged 32.9 ± 6.5 years were studied. Most (54.6%) had lipid profile collected during third trimester. The prevalence of any lipid abnormalities according to the criteria of the National Guidelines was 83.8%: TC ≥ 200 mg/dL was found in 49.9%; LDL ≥ 160 mg/dL, in 14.3%, HDL ≤ 50 mg/dL in 44.4% and TG ≥ 150 mg/dL in 65.3%. Any changes of lipid according to percentiles criteria was found in 19.6%: elevation above the P95% for TC was found in 0.7%; for LDL, 1.7%; for TG 6.4% and HDL lower than the P5% in 13%. The frequency of comorbidity: hypertension, diabetes, smoking, obesity and preeclampsia was similar among pregnant women when DLP was compared by both criteria. Conclusion The prevalence of DLP during pregnancy varies significantly depending on the criteria used, however none demonstrated superiority in association with comorbidities. PMID:28591252

Protective effects of C-phycocyanin on alcohol-induced acute liver injury in mice

NASA Astrophysics Data System (ADS)

Xia, Dong; Liu, Bing; Luan, Xiying; Sun, Junyan; Liu, Nana; Qin, Song; Du, Zhenning

2016-03-01

Excessive alcohol consumption leads to liver disease. Extensive evidence suggests that C-phycocyanin (C-PC), a chromophore phycocyanobilin derived from Spirulina platensis, exerts protective effects against chemical-induced organ damage. In this study, we investigated whether C-PC could protect against ethanol-induced acute liver injury. Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), total cholesterol (CHOL), low-density lipoprotein (LDL), liver homogenate malondialdehyde (MDA), superoxide dismutase (SOD) content were measured, and pathological examination of liver sections were examined. C-PC showed obvious inhibitory effects on serum ALT, AST, TG, CHOL, LDL and MDA, and SOD content significantly increased in the liver. The structure of hepatic lobules was clear, liver sinus returned to normal, and liver cell cords were arranged in neat rows. Cloudiness, swelling, inflammatory cell infiltration and spotty necrosis of liver cells were significantly reduced. Therefore, C-PC can significantly protect against ethanol-induced acute liver injury.

Appreciation of concentration of lipoproteins and apolipoproteins in serum of male rats under the influence of diet change composition and its supplementation with group B vitamins.

PubMed

Goluch-Koniuszy, Zuzanna; Wierzbicka, Aldona

2011-01-01

This study was aimed at exploring, on animal model, how the diet changes, which results in exceeding 5 times the amount of deficit of group B vitamins after diet change, which up to a certain extent imitates supplementation method in people, influences the concentration of apolipoprotein A-I and apolipoprotein B – the components of lipoprotein HDL-C and LDL-C. The research was conducted on 24 WISTAR male rats, aged ca 5 months. The animals were divided into 3 feeding groups: I was fed with basic compound which contained among others full wheat grain and corn grain, group II and III with modified compound in which part of the full wheat grain, from basic compound, was substituted for wheat flour, and 50% of corn with saccharose. Group I and II animals were drinking pure tap water which was left to stand for some time beforehand, group III animals vitamins dissolved in water: B(1), B(2), B(6), and PP – five times exceeded the difference between the amount of basic and modified feed, which in a certain way imitated the supplementation in human food. After one week of animals conditioning, the experiment was conducted for 6 weeks. In their blood serum were determined concentration of glucose (GL), triacyloglycerols (TG), total cholesterol (TC), fraction of HDL-cholesterol (HDLC), fraction of LDL-cholesterol (LDL-C) and apolipoproteins A-I (apo A-I) and apolipoproteins B (apoB). In the dissected muscles and in the animals' livers the amount of fat was determined with Soxhlet's method. The obtained results were analysed with one factor variance by use of statistic computer program Statistica® with application of Duncan test. Analysing the influence of diet change and its supplementation with chosen group B vitamins on the amount of consumed feed, it was ascertained that in spite of the same calorific value of the used feed, significantly less, compared to other groups, was consumed by the animals from the supplemented group. However, there was no significant gain of

A nutraceutical approach (Armolipid Plus) to reduce total and LDL cholesterol in individuals with mild to moderate dyslipidemia: Review of the clinical evidence.

PubMed

Barrios, Vivencio; Escobar, Carlos; Cicero, Arrigo Francesco Giuseppe; Burke, David; Fasching, Peter; Banach, Maciej; Bruckert, Eric

2017-02-01

Compelling evidence supports the effectiveness of the reduction of total and LDL cholesterol (TC and LDL-C) in primarily preventing cardiovascular events, within the framework of life-long prevention programs mainly consisting in lifestyle changes. Pharmacological treatment should be introduced when lifestyle changes, including use of nutraceuticals, have failed. ESC/EAS guidelines list a number of nutraceutical compounds and functional foods which have been individually studied in randomized, controlled clinical trials (RCTs). To date only a proprietary formulation of three naturally occurring substances with putative complementary lipid-lowering properties - red yeast rice, policosanol and berberine - combined with folic acid, astaxanthin, and coenzyme Q10 (Armolipid Plus ® ) has been extensively investigated in several RCTs, 7 of which were placebo-controlled, 2 were ezetimibe comparators and 4 were "real life" studies comparing diet and Armolipid Plus to diet alone. The trials included mostly patients with mild to moderate dyslipidemia, treated for 6-48 weeks. The trials also included special populations and patients in whom statins were contraindicated or who could not tolerate them. Armolipid Plus has proved to be able to achieve significant reductions in TC (11-21%) and in LDL-C (15-31%) levels, which is equivalent to expectations from low dose statins. In patients intolerant to statins, who do not achieve their therapeutic target with ezetimibe, Armolipid Plus can achieve a further 10% improvement in TC and LDL-C. The safety and tolerability of Armolipid Plus were excellent, thought likely due to the intentional combination of low doses of its active ingredients: low enough not to be associated with untoward effects, but high enough to exert therapeutic effects in combination with other complementary substances. Consequently, in the event of intolerance to statins, Armolipid Plus offers an effective alternative, which is devoid of the safety risks

Non-traditional Serum Lipid Variables and Recurrent Stroke Risk

PubMed Central

Park, Jong-Ho; Lee, Juneyoung; Ovbiagele, Bruce

2014-01-01

Background and Purpose Expert consensus guidelines recommend low-density lipoprotein cholesterol (LDL-C) as the primary serum lipid target for recurrent stroke risk reduction. However, mounting evidence suggests that other lipid parameters might be additional therapeutic targets or at least also predict cardiovascular risk. Little is known about the effects of non-traditional lipid variables on recurrent stroke risk. Methods We analyzed the Vitamin Intervention for Stroke Prevention study database comprising 3680 recent (<120 days) ischemic stroke patients followed up for 2 years. Independent associations of baseline serum lipid variables with recurrent ischemic stroke (primary outcome) and the composite endpoint of ischemic stroke/coronary heart disease (CHD)/vascular death (secondary outcomes) were assessed. Results Of all variables evaluated, only triglycerides (TG)/high-density lipoprotein cholesterol (HDL-C) ratio was consistently and independently related to both outcomes: compared with the lowest quintile, the highest TG/HDL-C ratio quintile was associated with stroke (adjusted hazard ratio, 1.56; 95% CI, 1.05−2.32) and stroke/CHD/vascular death (1.39; 1.05−1.83), including adjustment for lipid modifier use. Compared with the lowest quintile, the highest total cholesterol/HDL-C ratio quintile was associated with stroke/CHD/vascular death (1.45; 1.03−2.03). LDL-C/HDL-C ratio, non-HDL-C, elevated TG alone, and low HDL-C alone were not independently linked to either outcome. Conclusions Of various non-traditional lipid variables, elevated baseline TG/HDL-C and TC/HDL-C ratios predict future vascular risk after a stroke, but only elevated TG/HDL-C ratio is related to risk of recurrent stroke. Future studies should assess the role of TG/HDL as a potential therapeutic target for global vascular risk reduction after stroke. PMID:25236873

Hypoglycemic and hypolipidemic effects of Coriandrum sativum L. in Meriones shawi rats.

PubMed

Aissaoui, Abderrahmane; Zizi, Soumia; Israili, Zafar H; Lyoussi, Badiâa

2011-09-01

The use of an aqueous extract of coriander (Coriandrum sativum L.; Apiaceae, Umbelliferae) seeds (CS-extract) in Moroccan traditional treatment of diabetes remains to be experimentally validated. The study aim was to investigate potential hypoglycemic (and hypolipidemic) activity of CS-extract after a single oral dose and after daily dosing for 30 days (sub-chronic study) in normal and obese-hyperglycemic-hyperlipidemic (OHH) Meriones shawi rats. After a single oral dose of CS-extract (20mg/kg; predetermined as optimum), plasma glucose, insulin, total cholesterol (TC), and triglycerides (TG) were measured in normal and OHH rats (hypercaloric diet and forced limited physical activity); glibenclamide (GLB; 2.5mg/kg) was used as reference. In the sub-chronic study, the effect of CS-extract and GLB (at the above doses) on body weight (BW), plasma glucose, insulin, TC, LDL-cholesterol, HDL-cholesterol, TG, urea and creatinine was determined in normal and OHH rats; insulin resistance (IR as HOMA-IR), atherosclerotic and cardioprotective indices were calculated. A single dose of CS-extract or GLB suppressed hyperglycemia in OHH rats, and normo-glycemia was achieved at 6-h post-dose; there was no effect on lipids, TG or insulin, but IR decreased significantly. The hypoglycemic effect was lower in normal rats. In the sub-chronic study in OHH rats, the test substances (CS-extract>GLB) reduced plasma glucose (normoglycemia on Day 21), insulin and IR, TC, LDL-cholesterol, and TG. Atherosclerotic index decreased while cardioprotective indices increased only by CS-extract, with no effect on BW, urea or creatinine. Sub-chronic administration of CS-extract in OHH Meriones shawi rats normalized glycemia and decreased the elevated levels of insulin, IR, TC, LDL-cholesterol and TG. Since, the CS-extract decreased several components of the metabolic syndrome and decreased atherosclerotic and increased cardioprotective indices, CS-extract may have cardiovascular protective effect. The

Dietary patterns associated with HbA1c and LDL cholesterol among individuals with type 1 diabetes in China

PubMed Central

Jaacks, Lindsay M.; Crandell, Jamie; Mendez, Michelle A.; Lamichhane, Archana P.; Liu, Wei; Ji, Linong; Du, Shufa; Rosamond, Wayne; Popkin, Barry M.; Mayer-Davis, Elizabeth J.

2015-01-01

Aims To identify dietary patterns that influence cardiometabolic risk among individuals with type 1 diabetes (T1D) in China. Methods Data are from a cross-sectional study of T1D in China (n=99). Dietary intake was assessed using three 24-hour recalls. Reduced rank regression was used to identify dietary patterns from a set of 20 food groups that maximized the explained variation in glycated hemoglobin A1c (HbA1c) and low-density lipoprotein (LDL) cholesterol. Results Dietary pattern 1 was characterized by low intakes of wheat products and high-fat cakes, and high intakes of beans and pickled vegetables. Dietary pattern 2 was characterized by low intakes of high-fat cakes, nuts/seeds, fish/shellfish, and teas/coffee, and high intakes of rice and eggs. Participants in the highest tertile of dietary pattern 1 had significantly (p<0.05) higher HbA1c and LDL cholesterol compared to participants in the lowest tertile: mean difference in HbA1c was 1.0 percentage point (11mmol/mol) and in LDL cholesterol was 0.36 mmol/L after adjustment for age and household income. Dietary pattern 2 was not associated with HbA1c or LDL cholesterol. Conclusions We identified a dietary pattern that is significantly related to HbA1c and LDL cholesterol. These findings provide support for behavioral strategies to prevent complications in individuals with T1D in China. PMID:25630525

Investigation of singlet oxygen generation in Vit C-Cu2+ -LDL system by chemiluminescence method

NASA Astrophysics Data System (ADS)

Wang, Juan; Xing, Da; Tan, Shici; Tang, Yonghong; He, Yonghong

2002-04-01

In this study, by chemiluminescence method using a Cypridina luciferin analog, 2-methyl-6-(p-methoxyphenyl)-3,7- dihydroimidazo[1,2-a]pyrazin-3-one (MCLA), as a selective and sensitive chemiluminescence probe, singlet oxygen (1O2) formation was observed in the vit C- LDL-Cu2+ reaction system. Another experimental evidence for the generation of 1O2 was the quenching effect of sodium azide (NaN3) on vit C-induced chemiluminescence in the reaction mixture of LDL- Cu2+-MCLA. Analysis based on the experimental results indicated the plausible reaction mechanism is that vit C converts Cu2+ to its reduced state and vit C becomes vit C radical itself, thereby stimulating the formation of peroxyl radicals, and bimolecular reaction of peroxyl radicals results in 1O2 production in the above systems.

Variability of the LDL-C lowering response to ezetimibe and ezetimibe + statin therapy in hypercholesterolemic patients.

PubMed

Descamps, Olivier; Tomassini, Joanne E; Lin, Jianxin; Polis, Adam B; Shah, Arvind; Brudi, Philippe; Hanson, Mary E; Tershakovec, Andrew M

2015-06-01

We compared the variability of LDL-C-lowering responses to treatment with ezetimibe + statins versus statins in hypercholesterolemic patients. An analysis of patient-level data pooled from 27 double-blind, placebo and/or active-controlled studies in 21,671 patients treated with ezetimibe + statins versus statins on first-line (statin-naïve/wash-out) or second-line (on statin, randomized to ezetimibe versus placebo [add-on] or ezetimibe versus uptitrated statin [uptitrate]) for 6-24 wks. Variances (standard deviation [SD], coefficient of variation [CV], and root mean squared error [RMSE] adjusted for various factors) for % change from baseline in LDL-C were compared. In first-line and second-line add-on studies, the variability (SD, RMSE) of % change from baseline in LDL-C was lower in ezetimibe + statin-treated patients versus statin-treated patients, ±covariates. Differences were small but statistically significant due to the large sample size. In second-line uptitrate studies, ezetimibe + statin treatment resulted in greater unadjusted variability (SD) versus statin therapy, while the adjusted variability (RMSE) was significantly lower. Relative variability (CV=SD/mean) was lower for ezetimibe + statins versus statin therapy for all study types, being more pronounced in second-line add-on and uptitrate studies, attributed to larger mean LDL-C reductions for ezetimibe + statins versus statin groups. When assessed by individual study/type, statin brand, potency or dose, the CVs remained lower for ezetimibe + statins versus statins in second-line studies. The SDs showed no consistent trend for either therapy. In hypercholesterolemic patients, the absolute variability of LDL-C-lowering responses to ezetimibe + statins was not greater versus statins alone and appeared lower when adjusted for other factors. Relative variability was lower in patients treated with statins + ezetimibe. A better understanding of the variability of the LDL-C lowering

Ferulic acid combined with astragaloside IV protects against vascular endothelial dysfunction in diabetic rats.

PubMed

Yin, Yonghui; Qi, Fanghua; Song, Zhenhua; Zhang, Bo; Teng, Jialin

2014-08-01

Dysfunction of the endothelium is regarded as an important factor in the pathogenesis of vascular disease in diabetes mellitus (DM). Unfortunately, prevention of the progression of vascular complications of DM remains pessimistic. Ferulic acid and astragaloside IV, isolated from traditional Chinese medicine Angelica sinensis and Radix astragali respectively, exhibit potential cardio-protective and anti-hyperglycemic properties. In the present study, we investigated the protective effects and underlying mechanism of ferulic acid and astragaloside IV against vascular endothelial dysfunction in diabetic rats. After the diabetic rat model was established using streptozotocin, sixty rats were divided into 6 groups (control, model, ferulic acid, astragaloside IV, ferulic acid + astragaloside IV, and metformin) and treated for 10 weeks. Blood samples were collected to measure levels of hemoglobin A1c (HbAlc), triglyceride (TG), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), low density lipoproteins (Ox-LDL), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and creatinine (Cr), nitric oxide (NO) and endothelial nitric oxide synthase (eNOS), and abdominal aorta tissue samples were collected for observing histological morphology changes of endothelium and detecting gene and protein expression of nuclear factor-κB (NF-κB) P65, monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor α (TNF-α). We found that ferulic acid combined with astragaloside IV was capable of improving the structure of the aortic endothelium wall, attenuating the increase of HbAlc, TG, TC, LDL-C and Ox-LDL, promoting the release of NO and eNOS, and inhibiting over-activation of MCP-1, TNF-α, and NF-κB P65, without damage to liver and kidney function. In conclusion, ferulic acid combined with astragaloside IV exhibited significant protective effects against vascular endothelial dysfunction in diabetic rats through the NF-κB pathway involving

[Prevalence of dyslipidemia and its influential factors in 2 028 students from primary and middle schools in Changsha].

PubMed

Li, Yamei; Luo, Jiayou; Ma, Jun; Zou, Zhiyong; Liu, Xiaoqun; Li, Huixia

2017-06-28

To determine the prevalence of dyslipidemia in students from the primary and middle schools and the influential factors, and to provide evidence for the prevention and control of dyslipidemia and relevant chronic diseases in primary and middle schools. 
 Methods: A total of 2 028 students aged 7 to 17 from the primary and middle schools in Changsha were selected by stratified random cluster sampling. The contents of the study included questionnaire survey, physical measurement and blood tests for fasting blood triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels. Non-high-density lipoprotein cholesterol (non-HDL-C) level was calculated by TC level minus HDL-C level. Chi-square test and non-conditional logistic regression model were used to analyze the factors that contributed to dyslipidemia.
 Results: The dyslipidemia rate was 18.6%, and the abnormal rates of TG, TC, LDL-C, non-HDL-C and HDL-C were 6.8%, 5.6%, 2.3%, 4.2% and 8.6%, respectively. By chi-square test, the dyslipidemia rate in students with different ages, home locations, BMI groups, central obesity, time on watching TV or playing computer per day, and daily sleep time was statistically significant. Non-conditional logistic regression analysis showed that home location for the city (OR=1.332), overweight (OR=1.548), obesity (OR=2.201), central obesity (OR=1.695), watching TV or playing computer for more than 2 hours per day (OR=1.357), daily sleep time longer than 11 hours (OR=2.518) were the risk factors for dyslipidemia in students from the primary and middle schools. 
 Conclusion: Nearly 1/5 primary and middle school students show dyslipidemia, which is associated with obesity and other bad behaviors.

Lipid changes and their relationship with vitamin D levels in children under 18 years with type 1 diabetes.

PubMed

Zambrana-Calví, Gabriela D R; Palomo-Atance, Enrique; Gourdet, Marie E; León-Martín, Alberto; Ballester-Herrera, María José; Giralt-Muiña, Patricio

2016-03-01

To analyze lipid changes and their relationship with 25-hydroxy vitamin D3 (25-OH-D) levels in patients under 18 years old with type 1 diabetes mellitus (T1DM). A cross-sectional, descriptive study. Patients under 18 years with T1DM were enrolled by consecutive, nonrandomized sampling. Data collected included sex, age, pubertal stage, time since T1DM onset, weight, height, body mass index (BMI), waist circumference, glycosylated hemoglobin (HbA1c), 25-OH-D, total cholesterol (TC), LDL cholesterol (LDL-C), HDL cholesterol (HDL-C), and triglycerides (TG). Results were stratified by sex, age, and pubertal stage. Data were analyzed using SPSS(®). Ninety patients with a mean age of 11.7 ± 3.6 years (51.1% males) and mean HbA1c levels of 7.5 ± 1.3% were enrolled. Of these, 26.6% had 25-OH-D levels<20 ng/mL and 13.3% 25-OH-D levels ≤ 15 ng/mL. No differences were found in 25-OH-D between patients with overweight or obesity and the rest. HDL-C levels<40 ng/mL were found in 1.1%, 34.4% had LDL-C levels ≥ 100 mg/dL, and 2.2% had TG levels ≥ 150 mg/dL. Patients with 25-OH-D<20 ng/mL had higher TG levels than the rest (76.80 ± 45.62 vs 57.55 ± 26.08; P=.04) in the multivariate analysis controlled for BMI, waist circumference, and HbA1c. A correlation was found between 25-OH-D and TG levels (-0.230; P=.029). Patients in our population with vitamin D deficiency had higher TG levels. Long-term follow-up should be performed to understand the potential impact of such levels on diabetes-related complications. Copyright © 2015 SEEN. Published by Elsevier España, S.L.U. All rights reserved.

Preparation and comparative evaluation of 99m Tc-HYNIC-cNGR and 99m Tc-HYNIC-PEG2 -cNGR as tumor-targeting molecular imaging probes.

PubMed

Vats, Kusum; Satpati, Drishty; Sharma, Rohit; Kumar, Chandan; Sarma, Haladhar Dev; Banerjee, Sharmila

2018-02-01

The tripeptide sequence asparagine-glycine-arginine (NGR) specifically recognizes aminopeptidase N (APN or CD13) receptors highly expressed on tumor cells and vasculature. Thus, NGR peptides can precisely deliver therapeutic and diagnostic compounds to CD13 expressing cancer sites. In this regard, 2 NGR peptide ligands, HYNIC-c(NGR) and HYNIC-PEG 2 -c(NGR), were synthesized, radiolabeled with 99m Tc, and evaluated in CD13-positive human fibrosarcoma HT-1080 tumor xenografts. The radiotracers, 99m Tc-HYNIC-c(NGR) and 99m Tc-HYNIC-PEG 2 -c(NGR), could be prepared in approximately 95% radiochemical purity and exhibited excellent in vitro and in vivo stability. The radiotracers were hydrophilic in nature with log P values being -2.33 ± 0.05 and -2.61 ± 0.08. The uptake of 2 radiotracers 99m Tc-HYNIC-c(NGR) and 99m Tc-HYNIC-PEG 2 -c(NGR) was similar in nude mice bearing human fibrosarcoma HT-1080 tumor xenografts, which was significantly reduced (P < .05) during blocking studies. The 2 radiotracers being hydrophilic cleared rapidly from blood, liver, and intestine and were excreted through renal pathway. The pharmacokinetics of 99m Tc-labeled HYNIC peptide could not be modulated through introduction of PEG 2 unit, thus posing a challenge for studies with other linkers towards enhanced tumor uptake and retention. Copyright © 2017 John Wiley & Sons, Ltd.

Ezetimibe Use and LDL-C Goal Achievement: A Retrospective Database Analysis of Patients with Clinical Atherosclerotic Cardiovascular Disease or Probable Heterozygous Familial Hypercholesterolemia.

PubMed

Menzin, Joseph; Aggarwal, Jyoti; Boatman, Brian; Yu, Jeffrey; Stern, Kevin; Harrison, David J; Patel, Jeetvan G

2017-12-01

Ezetimibe is recommended by clinical practice guidelines as a second-line therapy for lowering low-density lipoprotein cholesterol (LDL-C) levels, but little is known about its use and effectiveness in real-world populations. To understand the real-world impact of adding or switching to ezetimibe on LDL-C goal achievement in patients with clinical atherosclerotic cardiovascular disease (ASCVD) and/or heterozygous familial hypercholesterolemia (HeFH). Patients aged ≥ 18 years with an LDL-C measurement available between January 1, 2013, and June 30, 2014, were identified using the Inovalon MORE 2 database; this included commercial, health insurance exchange, Medicare Advantage, and managed Medicaid patients. The index date was the date of the first LDL-C measurement. Patients were required to have evidence of clinical ASCVD or probable HeFH based on ICD-9-CM codes and ≥ 1 outpatient pharmacy claim for a statin in the 1-year pre-index period, as well as continuous medical and pharmacy coverage for 1 year pre- and post-index. Patients who added ezetimibe to existing statin therapy or switched to ezetimibe within 90 days post-index LDL-C measurement were identified in order to replicate the typical time a clinician takes to assess the use of ezetimibe. The primary outcome was the proportion of patients who met the LDL-C goal of < 70 mg/dL within the follow-up period. LDL-C goal achievement was evaluated by baseline LDL-C level groupings: < 70 mg/dL, 70-99 mg/dL, 100-129 mg/dL, or ≥ 130 mg/dL; and across 4 patient diagnosis categories: all patients, ASCVD only, probable HeFH only, and ASCVD and probable HeFH. Descriptive analyses were reported. Categorical variables were summarized as the number of and corresponding percentage of patients. Continuous variables were presented as the mean and SD of the number of observations and median and range where appropriate. Of 125,330 patients who met selection criteria, mean age was 70.1 (SD = 9.9) years and mean LDL-C

SWIFT: Prospective 48-Week Study to Evaluate Efficacy and Safety of Switching to Emtricitabine/Tenofovir From Lamivudine/Abacavir in Virologically Suppressed HIV-1 Infected Patients on a Boosted Protease Inhibitor Containing Antiretroviral Regimen

PubMed Central

Campo, R.; DeJesus, E.; Bredeek, U. F.; Henry, K.; Khanlou, H.; Logue, K.; Brinson, C.; Benson, P.; Dau, L.; Wang, H.; White, K.; Flaherty, J.; Fralich, T.; Guyer, B.; Piontkowsky, D.

2013-01-01

Background. In the United States, emtricitabine/tenofovir disoproxil fumarate (FTC/TDF) is a preferred nucleoside reverse transcriptase inhibitor (NRTI) backbone with lamivudine/abacavir (3TC/ABC) as a commonly used alternative. For patients infected with human immunodeficiency virus (HIV-1) virologically suppressed on a boosted protease inhibitor (PI) + 3TC/ABC regimen, the merits of switching to FTC/TDF as the NRTI backbone are unknown. Methods. SWIFT was a prospective, randomized, open-label 48-week study to evaluate efficacy and safety of switching to FTC/TDF. Subjects receiving 3TC/ABC + PI + ritonavir (RTV) with HIV-1 RNA < 200 c/mL ≥3 months were randomized to continue 3TC/ABC or switch to FTC/TDF. The primary endpoint was time to loss of virologic response (TLOVR) with noninferiority measured by delta of 12%. Virologic failure (VF) was defined as confirmed rebound or the last HIV-1 RNA measurement on study drug ≥200 c/mL. Results. In total, 311 subjects were treated in this study (155 to PI + RTV + FTC/TDF, 156 to PI + RTV + 3TC/ABC). Baseline characteristics were similar between the arms: 85% male, 28% black, median age, 46 years; and median CD4 532 cells/mm3. By TLOVR through week 48, switching to FTC/TDF was noninferior compared to continued 3TC/ABC (86.4% vs 83.3%, treatment difference 3.0% (95% confidence interval, −5.1% to 11.2%). Fewer subjects on FTC/TDF experienced VF (3 vs 11; P = .034). FTC/TDF showed greater declines in fasting low-density lipoproteins (LDL), total cholesterol (TC), and triglycerides (TG) with significant declines in LDL and TC beginning at week 12 with no TC/HDL ratio change. Switching to FTC/TDF showed improved NCEP thresholds for TC and TG and improved 10-year Framingham TC calculated scores. Decreased epidermal growth factor receptor (eGFR) was observed in both arms with a larger decrease in the FTC/TDF arm. Conclusions. Switching to FTC/TDF from 3TC/ABC maintained virologic suppression, had fewer VFs, improved

Evidence for a gene influencing the TG/HDL-C ratio on chromosome 7q32.3-qter: a genome-wide scan in the Framingham study.

PubMed

Shearman, A M; Ordovas, J M; Cupples, L A; Schaefer, E J; Harmon, M D; Shao, Y; Keen, J D; DeStefano, A L; Joost, O; Wilson, P W; Housman, D E; Myers, R H

2000-05-22

Some studies show that plasma triglyceride (TG) levels are a significant independent risk factor for cardiovascular disease (CVD). TG levels are inversely correlated with high density lipoprotein cholesterol (HDL-C) levels, and their metabolism may be closely interrelated. Therefore, the TG/HDL-C ratio may be a relevant CVD risk factor. Our analysis of families in the Framingham Heart Study gave a genetic heritability estimate for log(TG) of 0.40 and for log(TG/HDL-C) of 0.49, demonstrating an important genetic component for both. A 10 cM genome-wide scan for log(TG) level and log(TG/HDL-C) was carried out for the largest 332 extended families of the Framingham Heart Study (1702 genotyped individuals). The highest multipoint variance component LOD scores obtained for both log(TG) and log(TG/HDL-C) were on chromosome 7 (at 155 cM), where the results for the two phenotypes were 1.8 and 2.5, respectively. The 7q32.3-qter region contains several candidate genes. Four other regions with multipoint LOD scores greater than one were identified on chromosome 3 [LOD score for log(TG/HDL-C) = 1.8 at 140 cM], chromosome 11 [LOD score for log(TG/HDL-C) = 1.1 at 125 cM], chromosome 16 [LOD score for log(TG) = 1.5 at 70 cM, LOD score for log(TG/HDL-C) = 1.1 at 75 cM] and chromosome 20 [LOD score for log(TG/HDL-C) = 1.7 at 35 cM, LOD score for log(TG) = 1.3 at 40 cM]. These results identify loci worthy of further study.

ANGPTL3 is part of the machinery causing dyslipidemia majorily via LPL inhibition in mastitis mice.

PubMed

Xiao, Hong-Bo; Wang, Ji-Ying; Sun, Zhi-Liang

2017-12-01

Previous investigations have shown that inflammation induces changes in lipid and lipoprotein metabolism, and increased expression of angiopoietin-like protein 3 (ANGPTL3) contributes to the development of dyslipidemia. Here we investigated whether there is a correlation between increased ANGPTL3 expression and dyslipidemia in mastitis mice. Thirty mice were divided into two groups: control group and Staphylococcus aureus (S. aureus)-induced mastitis mice group. Changes in the levels of blood lipids [total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C)]; activity of myeloperoxidase (MPO); concentrations of plasma inflammation biomarkers [interferon-γ (IFNγ), tumor necrosis factor α (TNFα), and interleukin-1α (IL-1α)]; concentration of plasma ANGPTL3 protein; lipoprotein lipase (LPL) activities in postheparin plasma; expressions of hepatic N-acetylgalactosaminyltransferase 2 (GALNT2), hepatic ANGPTL3 and adipose LPL were determined. The major results indicated specific pathological mammary tissue changes, elevated MPO activity, reduced GALNT2 mRNA expression, elevated ANGPTL3 mRNA and protein expression and reduced LPL mRNA and protein expression. In plasma samples the S.aureus infused mice displayed elevated ANGPTL3 protein concentration, TG, TC and LDL-C levels, and reduced postheparin LPL activities and HDL-C level. The data suggests that ANGPTL3 is part of the machinery causing dyslipidemia majorily via LPL inhibition in mastitis mice. Copyright © 2017 Elsevier Inc. All rights reserved.

The TG/HDL-C ratio does not predict insulin resistance in overweight women of African descent: a study of South African, African American and West African women.

PubMed

Knight, Michael G; Goedecke, Julia H; Ricks, Madia; Evans, Juliet; Levitt, Naomi S; Tulloch-Reid, Marshall K; Sumner, Anne E

2011-01-01

Women of African descent have a high prevalence of diseases caused by insulin resistance. To positively impact cardiometabolic health in Black women, effective screening tests for insulin resistance must be identified. Recently, the TG/HDL-C ratio has been recommended as a tool to predict insulin resistance in overweight people. While the ratio predicts insulin resistance in White women, it is ineffective in African American women. As there are no data for African women, we tested the ability of the TG/HDL-C ratio to predict insulin resistance in Black women from South Africa, West Africa and the United States. For comparison, the ratio was also tested in White women from South Africa. Participants were 801 women (157 Black South African, 382 African American, 119 West African, 143 White South African, age 36 +/- 9y [mean +/- SD]). Standardized scores were created from log-transformed homeostasis model assessment-insulin resistance values from each population. Participants in the upper third of their population distribution were classified as insulin-resistant. To predict insulin resistance by the TC/HDL-C ratio, area under the receiver operating characteristic (AUC-ROC) curve was used and criteria were: 0.50 for no discrimination and > or = 0.70 for acceptable. Seventy-one percent of the Black women were overweight vs 51% of White women (P<.01). In overweight White women, AUC-ROC curve for prediction of insulin resistance by TG/HDL-C was 0.76 +/- 0.06, but below the 0.70 threshold in each group of overweight Black women (Black South African: 0.64 +/- 0.06, African American: 0.66 +/- 0.03, and West African: 0.63 +/- 0.07). Therefore, TG/HDL-C does not predict insulin resistance in overweight African American women and this investigation extends that finding to overweight Black South African and West African women. Resources to identify effective markers of insulin resistance are needed to improve cardiometabolic health in women of African descent.

Small dense low density lipoprotein-cholesterol and cholesterol ratios to predict arterial stiffness progression in normotensive subjects over a 5-year period.

PubMed

Li, Gang; Wu, Hui-Kun; Wu, Xiao-Wei; Cao, Zhe; Tu, Yuan-Chao; Ma, Yi; Wang, Wei-Qing; Cheng, Jian; Zhou, Zi-Hua

2018-02-12

Small dense low density lipoprotein-cholesterol (sdLDL-C), cholesterol ratios and carotid-femoral pulse wave velocity (cf-PWV) impart risk for all-cause morbidity and mortality independently of conventional cardiovascular disease (CVD) risk factors. This study was designed to identify feasible indicators for predicting arterial stiffness progression. We followed up 816 normotensive participants without diabetes or CVD for nearly 5.0 years. Cholesterol parameters, ratios and other clinical and laboratory data were collected at baseline. cf-PWV were measured at baseline and the end of follow-up. PWV progression subjects had higher levels of PWV parameters, sdLDL-C and TG/HDL-C ratio. sdLDL-C and TG/HDL-C were significantly correlated with all PWV parameters. Multiple regression models showed that sdLDL-C was closely associated with follow-up PWV (β = 0.222, p < 0.001) and △PWV (β = 0.275, p < 0.001). TG/HDL-C was only one cholesterol ratios that associated with all PWV parameters. sdLDL-C (OR = 2.070, 95%CI: 1.162 to 3.688, p = 0.014) and TG/HDL-C (OR = 1.355, 95%CI: 1.136 to 1.617, p = 0.001) could significantly determine the progression of PWV after correction for covariates. High sd-LDL-C quantiles subjects were more likely to develop arterial stiffness progression than low quantiles (Tertiles 3 vs Tertiles1, RR = 2.867, 95%CI: 1.106 to 7.434, p = 0.03). We founded that sdLDL-C and TG/HDL-C ratio can independently predict arterial stiffness progression in normotensive subjects, and high level sdLDL-C and TG/HDL-C ratio were associated with a higher risk of arterial stiffness.

Lipoproteins during the estrous cycle in swine.

PubMed

Liu, Ying; Rector, R Scott; Thomas, Tom R; Taylor, Julia A; Holiman, Denise A; Henderson, Kyle K; Welshons, Wade V; Sturek, Michael S

2004-02-01

The purpose of this study was to examine lipoprotein values at high versus low 17beta-estradiol (E2) concentrations in Yucatan miniature swine. Estrous cycles were measured by heat checking the female on a daily basis using a boar. All swine were fed a 1,050-g low-fat, standard chow diet (8% kcal from fat) once per day. Fasted (24 hours) blood samples were collected during low (early luteal, day 5) and high (late follicular, day 18) E2 concentrations to determine differences in concentrations of total cholesterol (TC), triglyceride (TG), low-density lipoprotein (LDL-C), high-density lipoprotein cholesterol (HDL-C), and subfractions. Concentrations of E2 differed significantly from day 5 (3.5 +/- 0.7 pg/mL) to day 18 (14.2 +/- 1.8 pg/mL) of the estrous cycle. Except for HDL(3)-C, all lipoprotein parameters examined were significantly elevated during high E2 versus low E2. TC/HDL-C and LDL-C/HDL-C ratios were significantly lower during the high E2 phase. These results suggest that lipoprotein concentrations fluctuate during the estrous cycle of swine, with high E2 concentrations associated with elevated lipoprotein concentrations.

Relationship between TG/HDL-C ratio and metabolic syndrome risk factors with chronic kidney disease in healthy adult population.

PubMed

Ho, Chih-I; Chen, Jau-Yuan; Chen, Shou-Yen; Tsai, Yi-Wen; Weng, Yi-Ming; Tsao, Yu-Chung; Li, Wen-Cheng

2015-10-01

The triglycerides-to-high-density lipoprotein-cholesterol (TG/HDL-C) ratio has been identified as a biomarker of insulin resistance and a predictor for atherosclerosis. The objectives of this study were to investigate which the TG/HDL-C ratio is useful to detect metabolic syndrome (MS) risk factors and subclinical chronic kidney disease (CKD) in general population without known CKD or renal impairment and to compare predictive accuracy of MS risk factors. This was a cross-sectional study. A total 46,255 subjects aged ≥18 years undergoing health examination during 2010-2011 in Taiwan. The independent associations between TG/HDL-C ratio quartiles, waist circumstance (WC) waist-to-height ratio (WHtR), mean atrial pressure (MAP), and CKD prevalence was analyzed by using logistic regression models. Analyses of the areas under receiver operating characteristic (ROC) were performed to determine the accuracy of MS risk factors in predicting CKD. A dose-response manner was observed for the prevalence of CKD and measurements of MS risk factors, showing increases from the lowest to the highest quartile of the TG/HDL-C ratio. Males and females in the highest TG/HDL-C ratio quartile (>2.76) had a 1.4-fold and 1.74-fold greater risk of CKD than those in the lowest quartile (≤1.04), independent of confounding factors. Mean arterial pressure (MAP) had the highest AUC for predicting CKD among MS risk factors. The TG/HDL-C ratio was an independent risk factor for CKD, but it showed no superiority over MAP in predicting CKD. A TG/HDL-C ratio ≥2.76 may be useful in clinical practice to detect subjects with worsened cardiometabolic profile who need monitoring to prevent CKD. TG/HDL-C ratio is an independent risk factor for CKD in adults aged 18-50 years. MAP was the most powerful predictor over other MS risk factors in predicting CKD. However, longitudinal and comparative studies are required to demonstrate the predictive value of TG/HDL-C on the onset and progression of CKD over

Oxidized LDL activates blood platelets through CD36/NOX2–mediated inhibition of the cGMP/protein kinase G signaling cascade

PubMed Central

Magwenzi, Simbarashe; Woodward, Casey; Wraith, Katie S.; Aburima, Ahmed; Raslan, Zaher; Jones, Huw; McNeil, Catriona; Wheatcroft, Stephen; Yuldasheva, Nadira; Febbriao, Maria; Kearney, Mark

2015-01-01

Oxidized low-density lipoprotein (oxLDL) promotes unregulated platelet activation in dyslipidemic disorders. Although oxLDL stimulates activatory signaling, it is unclear how these events drive accelerated thrombosis. Here, we describe a mechanism for oxLDL-mediated platelet hyperactivity that requires generation of reactive oxygen species (ROS). Under arterial flow, oxLDL triggered sustained generation of platelet intracellular ROS, which was blocked by CD36 inhibitors, mimicked by CD36-specific oxidized phospholipids, and ablated in CD36−/− murine platelets. oxLDL-induced ROS generation was blocked by the reduced NAD phosphate oxidase 2 (NOX2) inhibitor, gp91ds-tat, and absent in NOX2−/− mice. The synthesis of ROS by oxLDL/CD36 required Src-family kinases and protein kinase C (PKC)-dependent phosphorylation and activation of NOX2. In functional assays, oxLDL abolished guanosine 3′,5′-cyclic monophosphate (cGMP)-mediated signaling and inhibited platelet aggregation and arrest under flow. This was prevented by either pharmacologic inhibition of NOX2 in human platelets or genetic ablation of NOX2 in murine platelets. Platelets from hyperlipidemic mice were also found to have a diminished sensitivity to cGMP when tested ex vivo, a phenotype that was corrected by infusion of gp91ds-tat into the mice. This study demonstrates that oxLDL and hyperlipidemia stimulate the generation of NOX2-derived ROS through a CD36-PKC pathway and may promote platelet hyperactivity through modulation of cGMP signaling. PMID:25710879

[Research of Hippophae rhamnoides fruits on serum lipids and liver protection effects in high-fat-diet rats].

PubMed

Song, Chunmei; Du, Juan; Ge, Hongjuan

2015-07-01

To study the effects o Hippophae rhamnoides fruits on serum lipids and liver protection in high-fat-diet rats. Wistar rats were divided into 5 groups,including control group, high lipid model group and Hippophae rhamnoides low-, medium- and high- dose groups,every group wastaken high-fat diet except control group. The rats in control group and high lipid group were lavaged with physiological saline. The doses of Hippophae rhamnoides in low, middle and high groups were determined based on the 1x, 5x, and 10x standard human doses (50 g/60 kg BW), respectively. The rat were orally given test sample respectively for 28 days, once a day. Observed the changes of serum lipids and hepatic tissues pathology. Compared with the control group, the serum levels of total cholesterol (TC), triglyceride (TG) and low density lipoprotein cholesterol (LDL-C) were increased significantly (P < 0.05) in high-fat-diet rats. Compared with the high lipid group, Hippophae rhamnoides of different doses could significantly reduce the content of TG (P < 0.01). Hippophae rhamnoides reduced the tendency of TC and LDL-C in serum and reduced the fatty degeneration of liver cells. The Hippophae rhamnoides fruits can reduce the level of serum lipids and prevent the occurrence of fatty liver, can be used for the prevention of hyperlipidemia.

Impact of second-line antiretroviral regimens on lipid profiles in an African setting: the DART trial sub-study.

PubMed

Gomo, Zvenyika Ar; Hakim, James G; Walker, Sarah A; Tinago, Willard; Mandozana, Gibson; Kityo, Cissy; Munderi, Paula; Katabira, Elly; Reid, Andrew; Gibb, Diana M; Gilks, Charles F

2014-01-01

Increasing numbers of HIV-infected patients in sub-Saharan Africa are exposed to antiretroviral therapy (ART), but there are few data on lipid changes on first-line ART, and even fewer on second-line. DART was a randomized trial comparing monitoring strategies in Ugandan/Zimbabwean adults initiating first-line ART and switching to second-line at clinical/immunological failure. We evaluated fasting lipid profiles at second-line initiation and ≥48 weeks subsequently in stored samples from Zimbabwean patients switching before 18 September 2006. Of 91 patients switched to second-line ART, 65(73%) had fasting samples at switch and ≥48 weeks, 14(15%) died or were lost <48 weeks, 10(11%) interrupted ART for >14 days and 2(2%) had no samples available. 56/65(86%) received ZDV/d4T + 3TC + TDF first-line, 6(9%) ZDV/d4T + 3TC + NVP and 3(5%) ZDV + 3TC with TDF and NVP. Initial second-line regimens were LPV/r + NNRTI in 27(41%), LPV/r + NNRTI + ddI in 33(50%) and LPV/r + TDF + ddI/3TC/ZDV in 6(9%). At second-line initiation median (IQR) TC, LDL-C, HDL-C and TG (mmol/L) were 3.3(2.8-4.0), 1.7(1.3-2.2), 0.7(0.6-0.9) and 1.1(0.8-1.9) respectively. Levels were significantly increased 48 weeks later, by mean (SE) +2.0(0.1), +1.1(0.1), +0.5(0.05) and +0.4(0.2) respectively (p < 0.001; TG p = 0.01). 3% at switch vs 25% 48 weeks later had TC >5.2 mmol/L; 3% vs 25% LDL-C >3.4 mmol/L and 91% vs 41% HDL-C <1.1 mmol/L (p < 0.001). Similar proportions had TG >1.8 mmol/L (0 vs 3%) and TC/HDL-C ≥5 (40% vs 33%) (p > 0.15). Modest lipid elevations were observed in African patients on predominantly LPV/r + NNRTI-based second-line regimens. Routine lipid monitoring during second-line ART regimens may not be warranted in this setting but individual cardiovascular risk assessment should guide practice.

Ramadan fasting ameliorates arterial pulse pressure and lipid profile, and alleviates oxidative stress in hypertensive patients.

PubMed

Al-Shafei, Ahmad I M

2014-06-01

Effects of Ramadan fasting on health are important. Its effects on arterial pulse pressure (PP), lipid profile and oxidative stress were characterized in hypertensives. PP, indices of lipid profile and oxidative stress were measured pre-, during and post-fasting in equal (40 each), sex- and age-matched groups (age 55 ± 5 years) of hypertensives (HT) and controls (C). Fasting reduced PP significantly by 17.2% and insignificantly by 9.3% in the HT and C groups, respectively. Total cholesterol (TC) was lowered insignificantly by 11.7% and 4.7% in the HT and C patients, respectively. Triglycerides (TG) and malondialdehyde (MDA) were significantly lowered by: TG: 24.5% and 22.8%; MDA: 45.6% and 54.3%; while glutathione (GSH) elevated by 56.8% and 52.6% in the HT and C groups, respectively. High-density lipoproteins (HDL) were raised significantly by 33.3% and insignificantly by 6.7%, whereas low-density lipoproteins (LDL) decreased significantly by 17.7% and insignificantly by 4.0% in the HT and C groups, respectively. At 6 weeks post-fasting, MDA remained significantly lower than the pre-fasting level by 24.3% and 25.7%, and GSH higher by 30.2% and 26.3% in the HT and C groups, respectively, while PP and TC returned to pre-fasting values in both groups. The post-fasting, HDL was significantly higher by 20.3% and LDL lower by 12.0% than the fasting levels in the HT patients. Fasting improves PP and lipids profile and ameliorates oxidative stress in hypertensives.

LDL-C goal attainment in patients who remain on atorvastatin or switch to equivalent or non-equivalent doses of simvastatin: a retrospective matched cohort study in clinical practice.

PubMed

Rublee, Dale A; Burke, James P

2010-03-01

As clinical trials have shown the benefits of more intensive cholesterol control, treatment targets for low-density lipoprotein cholesterol (LDL-C) have decreased progressively. At the same time, physicians have been encouraged to contain costs by prescribing cheaper, generic statins for cholesterol management. To determine how these possibly conflicting goals are managed in clinical practice, we examined LDL-C control in patients switched from a potent, branded statin (atorvastatin) to a less potent, generic statin (simvastatin). Patients who switched from atorvastatin to simvastatin between July 2006 and January 2008 were retrospectively identified from a US medical and pharmacy claims database, and matched with controls remaining on atorvastatin. Outcomes measured were the number of switched patients receiving a simvastatin milligram dose>or=2 times their previous atorvastatin dose, changes in LDL-C levels, and percentage of patients achieving recommended LDL-C targets. All study variables were analyzed descriptively. After applying exclusion and inclusion criteria, 1048 patients who switched from atorvastatin to simvastatin and 1048 matched controls who remained on atorvastatin were included. Among the switchers, 379 (36%) received an inappropriately low dose of simvastatin (<2 times atorvastatin dose). In patients remaining on atorvastatin, mean LDL-C decreased from 105.7 mg/dL to 102.3 mg/dL after 44 weeks, whereas in switched patients, LDL-C remained similar, at 105.9 mg/dL on atorvastatin and 105.8 mg/dL on simvastatin. Before switching, when all patients were receiving atorvastatin, 67.4% of switchers and 69.9% of controls achieved recommended LDL-C targets. After switching, significantly fewer switchers than controls met LDL-C targets (69.1% vs 74.6%; P=0.005). However, among patients who switched to an equivalent dose of simvastatin (>or=2 times prior atorvastatin dose), similar proportions met LDL-C targets (72.8% vs 74.6% of controls; P=0.402), whereas

A comparative study of the effect of icodextrin based peritoneal dialysis and hemodialysis on lipid metabolism.

PubMed

Kadiroğlu, A K; Ustündag, S; Kayabaşi, H; Yilmaz, Z; Yildirım, Y; Sen, S; Yilmaz, M E

2013-09-01

Dyslipidemia is frequent in patients with end stage renal disease. Excessive peritoneal glucose absorption from high glucose-containing peritoneal dialysis solutions may enhance disturbances on the lipid metabolism of patients on peritoneal dialysis. We compared the effect of icodextrin-based peritoneal dialysis therapy with hemodialysis (HD) therapy on lipid metabolism. A total of 157 non-diabetic patients on dialysis at least for 3 months; 78 patients on Icodextrin-based continuous ambulatory peritoneal dialysis (CAPD) (44 M, 34 F) and 79 patients in HD group (47M, 32F) were included into the study. After 12 h of fasting and before the dialysis session, serum urea, creatinin, glucose, Sodium, potasium, and albumin, total cholesterol (TC), triglycerides (TG), very low density lipoprotein (VLDL), low density lipoprotein (LDL)-C, high-density lipoprotein (HDL)-C, apolipoprotein A (Apo A), apolipoprotein B, and lipoprotein a were measured. TG (P = 0018) and VLDL (P = 0.022) were lower in CAPD group than HD group, HDL-C (P < 0.001) and Apo A (P = 0.001) were higher in CAPD group than in HD group. A total of 24.4% in CAPD group and 11.4% in HD group (P < 0.034) had normal serum levels of TG, LDL-C, and HDL-C. More patients in CAPD group (47.4%) had high serum Apo A levels than in HD group (21.5%) (P = 0.001). We suggest that patients receiving icodextrin-based CAPD may have better TG, HDL-C, and Apo A levels than patients on HD.

Thyroglobulin (Tg) Testing Revisited: Tg Assays, TgAb Assays, and Correlation of Results With Clinical Outcomes.

PubMed

Netzel, Brian C; Grebe, Stefan K G; Carranza Leon, B Gisella; Castro, M Regina; Clark, Penelope M; Hoofnagle, Andrew N; Spencer, Carole A; Turcu, Adina F; Algeciras-Schimnich, Alicia

2015-08-01

Measurement of thyroglobulin (Tg) by mass spectrometry (Tg-MS) is emerging as a tool for accurate Tg quantification in patients with anti-Tg autoantibodies (TgAbs). The objective of the study was to perform analytical and clinical evaluations of two Tg-MS assays in comparison with immunometric Tg assays (Tg-IAs) and Tg RIAs (Tg-RIAs) in a cohort of thyroid cancer patients. A total of 589 samples from 495 patients, 243 TgAb-/252 TgAb+, were tested by Beckman, Roche, Siemens-Immulite, and Thermo-Brahms Tg and TgAb assays, two Tg-RIAs, and two Tg-MS assays. The frequency of TgAb+ was 58%, 41%, 27%, and 39% for Roche, Beckman, Siemens-Immulite, and Thermo-Brahms, respectively. In TgAb- samples, clinical sensitivities and specificities of 100% and 74%-100%, respectively, were observed across all assays. In TgAb+ samples, all Tg-IAs demonstrated assay-dependent Tg underestimation, ranging from 41% to 86%. In TgAb+ samples, the use of a common cutoff (0.5 ng/mL) for the Tg-MS, three Tg-IAs, and the USC-RIA improved the sensitivity for the Tg-MSs and Tg-RIAs when compared with the Tg-IAs. In up to 20% of TgAb+ cases, Tg-IAs failed to detect Tg that was detectable by Tg-MS. In Tg-RIAs false-high biases were observed in TgAb+ samples containing low Tg concentrations. Tg-IAs remain the method of choice for Tg quantitation in TgAb- patients. In TgAb+ patients with undetectable Tg by immunometric assay, the Tg-MS will detect Tg in up to 20% additional cases. The Tg-RIA will detect Tg in approximately 35% cases, but a significant proportion of these will be clinical false-positive results. The undetectable Tg-MS seen in approximately 40% of TgAb+ cases in patients with disease need further evaluation.

Effects of the duration of hyperlipidemia on cerebral lipids, vessels and neurons in rats.

PubMed

Yang, Weichun; Shi, He; Zhang, Jianfen; Shen, Ziyi; Zhou, Guangyu; Hu, Minyu

2017-01-31

The present study was designed to investigate the effects of hyperlipidemia on the cerebral lipids, vessels and neurons of rats, and to provide experimental evidence for subsequent intervention. One hundred adult SD rats, half of which were male and half of which were female, were randomly divided into five groups on the basis of serum total cholesterol (TC) levels. Four groups were fed a hypercholesterolemic diet (rat chow supplemented with 4% cholesterol, 1% cholic acid and 0.5% thiouracil - this is also called a CCT diet) for periods of 1 week, 2 weeks, 3 weeks and 4 weeks, respectively. A control group was included. The levels of serum lipids, cerebral lipids, free fatty acids (FFA), interleukin-6 (IL-6), interleukin-1 (IL-1), tumor necrosis factor alpha (TNF-α), vascular endothelial growth factor (VEGF), oxidized low density lipoprotein (ox-LDL), A-beta precursor proteins (APP), amyloid beta (Aβ), glial fibrillary acidic protein (GFAP) and tight junction protein Claudin-5 were measured after the experiment. The pathologic changes and apoptosis of the rat brains were evaluated. Compared with the control group, after 1 week of a CCT diet, the levels of serum total cholesterol (TC), triglycerides (TG), low density lipoprotein cholesterol (LDL-C) and brain triglycerides had increased by 2.40, 1.29 and 1.75 and 0.3 times, respectively. The serum high density lipoprotein cholesterol (HDL-C) had decreased by 0.74 times (P < 0.05) and the expression of IL-1, TNF-α and GFAP in the brains had increased (P < 0.05). In the second week, the expression of FFA and APP in the brains, and the amount of apoptotic neurons, had increased (P < 0.05). In the third week, the levels of VEGF, Ox-LDL and Aβ had increased, and the expression of Claudin-5 had decreased in the brains (P < 0.05). In the fourth week, the levels of TC, LDL-C and the amount of apoptotic neurons had increased (P < 0.05). The correlation analysis showed a positive correlation among

High concentrations of AGE-LDL and oxidized LDL in circulating immune complexes are associated with progression of retinopathy in type 1 diabetes.

PubMed

Lopes-Virella, Maria F; Baker, Nathaniel L; Hunt, Kelly J; Lyons, Timothy J; Jenkins, Alicia J; Virella, Gabriel

2012-06-01

To determine whether immunocomplexes (ICs) containing advanced glycation end product (AGE)-LDL (AGE-LDL) and oxidized LDL (oxLDL) contribute to the development of retinopathy over a 16-year period in subjects with type 1 diabetes. Levels of AGE-LDL and oxLDL in ICs were measured in 517 patients of the Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications (DCCT/EDIC) cohort. Retinopathy was assessed by stereoscopic fundus photography. Cox proportional hazards models were used to assess the effect of AGE-LDL-ICs and oxLDL-ICs on retinopathy progression. In unadjusted models, higher baseline levels of AGE-LDL-ICs and oxLDL-ICs significantly predicted progression of diabetic retinopathy outcomes. After adjustment by study-design variables (treatment group, retinopathy cohort, duration of type 1 diabetes, and baseline albumin excretion rate [AER], hemoglobin A(1c) (HbA(1c)), and Early Treatment Diabetic Retinopathy Study [ETDRS] score), one SD increase in IC levels was associated with 47% (hazard ratio [HR] 1.47 [95% CI 1.19-1.81]; AGE-LDL-IC) and 45% (1.45 [1.17-1.80]; oxLDL-IC) increased risk of developing proliferative diabetic retinopathy (PDR) and 37% (1.37 [1.12-1.66]; to both ICs) increased risk of progressing to severe nonproliferative retinopathy. Analyses were stratified by retinopathy cohort because results differed between primary and secondary cohorts. For AGE-LDL-ICs, HR for progression to PDR was 2.38 (95% CI 1.30-4.34) in the primary cohort and attenuated in the secondary cohort (1.29 [1.03-1.62]). Similar results were observed for oxLDL-ICs. Increased levels of AGE-LDL and oxLDL in ICs are associated with increased risk for progression to advanced retinopathy in patients with type 1 diabetes, indicating that the antibody response to modified LDL plays a significant role in retinopathy progression.

Association of I-FABP gene polymorphism and the risk of coronary heart disease.

PubMed

Yuan, Dong; Yu, Changqing; Zeng, Chunyu

2015-01-01

The study aimed to investigate the association between polymorphism of I-FABP gene and coronary heart disease (CHD). 225 patients with CHD were randomly recruited into the case group, and 196 healthy elderly volunteers were recruited from Medical Examination Center of our hospital as control. General clinical data were collected and plasma TC, TG, LDL-C, HDL-C levels were measured. Besides, polymerase chain reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) technology were used to detect the polymorphism of Hha-I enzyme cleavage sites in I-FABP gene in the study population. Hha-I cleavage sites occurred at codon 54 in exon in the coding sequencing of I-FABP gene in all participants. After cleavage with Hha-I enzyme, the genotypes were identified as wild-type A/A, heterozygous mutant A/T and homozygous mutant T/T. In case group, A/T and T/T genetic carriers had significantly higher levels of TC, TG and LDL-C than A/A carriers (P<0.05). However, in control group, similar differences were not observed (P>0.05). BMI, dietary habits and I-FABP alleles were independent risk factors of CHD. The polymorphism of I-FABP gene existed in the study population. And this genetic variation had influence on lipid metabolism, which was associated with the risk of developing CHD. I-FABP gene polymorphism may contribute to the increased genetic susceptibility to CHD.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations

PubMed Central

Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

2018-01-01

Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6–21.7), and median BMI SDS 2.8 (range 1.3–5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4–7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. Results At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10−4) and positively with TG (p = 9.7*10−6). Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10−16) and percent truncal body fat (p<2*10−16). Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001). Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by

A comparative systematic review of Yasmin (drospirenone pill) versus standard treatment options for symptoms of polycystic ovary syndrome.

PubMed

Li, Jing; Ren, Jing; Sun, Wenxia

2017-03-01

To systematically review the impact of Yasmin (drospirenone pill) compares with other standard treatments for symptoms of Polycystic Ovary Syndrome (PCOS). The relevant studies of the randomized controlled trials in women with PCOS treated with drospirenone were retrieved and the systematic evaluation was conducted. Eighteen articles were included. Compared with drospirenone (DRSP) monotherapy, DRSP plus metformin was better in reducing body mass index (BMI), luteinizing hormone (LH) and low-density lipoprotein cholesterol (LDL-C). Compared with metformin, DRSP was better in modulating serum total testosterone (T), sex hormone-binding globulin (SHBG), follicle stimulating hormone (FSH) and free androgen index (FAI), while metformin was more effective in reducing BMI, total cholesterol (TC), LDL-C and Triglyceride (TG). DRSP was superior to cyproterone acetate (CPA) in reducing TC and homeostasis model assessment of insulin resistance (HOMA-IR). DRSP shows better effect in modulating LDL-C and high-density lipoprotein cholesterol (HDL-C) compared with desogestrel (DSG). The available data suggested that DRSP was effective in modulating hormones, insulin and lipid metabolism in women with PCOS. Compared with commonly used drugs for symptoms of PCOS as CPA and DSG, DRSP shows identical or better effect in improving symptoms and protect cardiovascular system. For the PCOS patients with IR, obesity or high LH/FSH ratio, DRSP combines with metformin maybe more effective than use DRSP alone. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Endothelial LOX-1 activation differentially regulates arterial thrombus formation depending on oxLDL levels: role of the Oct-1/SIRT1 and ERK1/2 pathways.

PubMed

Akhmedov, Alexander; Camici, Giovanni G; Reiner, Martin F; Bonetti, Nicole R; Costantino, Sarah; Holy, Erik W; Spescha, Remo D; Stivala, Simona; Schaub Clerigué, Ariane; Speer, Thimoteus; Breitenstein, Alexander; Manz, Jasmin; Lohmann, Christine; Paneni, Francesco; Beer, Juerg-Hans; Lüscher, Thomas F

2017-04-01

The lectin-like oxLDL receptor-1 (LOX-1) promotes endothelial uptake of oxidized low-density lipoprotein (oxLDL) and plays an important role in atherosclerosis and acute coronary syndromes (ACS). However, its role in arterial thrombus formation remains unknown. We investigated whether LOX-1 plays a role in arterial thrombus formation in vivo at different levels of oxLDL using endothelial-specific LOX-1 transgenic mice (LOX-1TG) and a photochemical injury thrombosis model of the carotid artery. In mice fed a normal chow diet, time to arterial occlusion was unexpectedly prolonged in LOX-1TG as compared to WT. In line with this, tissue factor (TF) expression and activity in carotid arteries of LOX-1TG mice were reduced by half. This effect was mediated by activation of octamer transcription factor 1 (Oct-1) leading to upregulation of the mammalian deacetylase silent information regulator-two 1 (SIRT1) via binding to its promoter and subsequent inhibition of NF-κB signaling. In contrast, intravenous injection of oxLDL as well as high cholesterol diet for 6 weeks led to a switch from the Oct-1/SIRT1 signal transduction pathway to the ERK1/2 pathway and in turn to an enhanced thrombotic response with shortened occlusion time. Thus, LOX-1 differentially regulates thrombus formation in vivo depending on the degree of activation by oxLDL. At low oxLDL levels LOX-1 activates the protective Oct-1/SIRT1 pathway, while at higher levels of the lipoprotein switches to the thrombogenic ERK1/2 pathway. These findings may be important for arterial thrombus formation in ACS and suggest that SIRT1 may represent a novel therapeutic target in this context. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions, please email: journals.permissions@oup.com.

The associations between metabolic variables and NT-proBNP are blunted at pathological ranges: the Multi-Ethnic Study of Atherosclerosis

PubMed Central

Sanchez, Otto A.; Duprez, Daniel A.; Bahrami, Hossein; Daniels, Lori B.; Folsom, Aaron R.; Lima, Joao A.; Maisel, Alan; Peralta, Carmen A.; Jacobs, David R.

2014-01-01

Objective Under physiological conditions brain natriuretic peptide (BNP) is inversely associated with metabolic risk factors, but under pathological conditions these associations may tend to plateau. Material end methods 5597 individuals in the Multi-Ethnic Study of Atherosclerosis (MESA), 45–84 years of age, free of overt cardiovascular disease in 2000–02 and then again in 2003–05 participated in this study. Associations between NT-proBNP and BMI, blood lipids, homeostasis model of insulin resistance (HOMA-IR) using linear regression models were adjusted for age, race, sex, BMI, % of energy from saturated fats, intentional exercise, statin use, antihypertensive medication use, diabetes and glomerular filtration rate. The inflection points (IP) at which these associations became nonlinear were determined using linear splines with knots at different levels of NT-proBNP. Results Participants with NT-proBNP ≥100 pg/mL (29%) tended to be older, on statins and anti-hypertensive medications vs. those with NT-proBNP <100 pg/mL. The IP point varies among variables and ranged from 50–120 pg/mL. NT-proBNP TC), LDL-C, triglycerides (TG) and HOMA-IR, but positively with HDL-C. A higher proportion of participants with NT-proBNP ≥100 pg/mL had subclinical CVD. All associations with NT-proBNP plateaued when NT-proBNP ≥IP. Baseline level in NT-proBNP was not associated with 3-year change in BMI, TG, HDL-C or fasting glucose. Conclusions In a large cardiovascular disease-free cohort, NT-proBNP within the lower (physiological) range was inversely associated with TC, LDL-C, TG and insulin resistance with different inflection points, but at higher (pathological) levels these associations were blunted. PMID:24388001

Dietary Total Antioxidant Capacity and Cardiovascular Disease Risk Factors: A Systematic Review of Observational Studies.

PubMed

Mozaffari, Hadis; Daneshzad, Elnaz; Surkan, Pamela J; Azadbakht, Leila

2018-05-01

Measurement of dietary total antioxidant capacity (DTAC) is considered a new holistic dietary approach and assesses total antioxidants present in the overall diet. Our aim was to perform a comprehensive review of the literature on the association between DTAC and cardiovascular disease (CVD) risk factors. PubMed, Web of Science, and Scopus were used to conduct a comprehensive search for articles published on this topic through September 2017. There was no limit on earliest year of publication. The search was based on the following keywords: dietary total antioxidant capacity, nonenzymatic antioxidant capacity, total radical-trapping antioxidant parameter, ferric reducing ability of plasma, oxygen radical absorbance capacity, Trolox equivalent antioxidant capacity, high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), total cholesterol (TC), waist circumference (WC), insulin resistance, homeostatic model assessment of insulin resistance (HOMA-IR), insulin, obesity, glucose, C-reactive protein (CRP), blood pressure (BP), and body mass index. In total, 16 papers were identified for inclusion in the present systematic review. Most well-designed studies that evaluated associations between DTAC and CVD risk factors showed inverse associations for fasting blood glucose, CRP, BP, and WC and positive associations for HDL-C. However, there was no association between DTAC and LDL-C or TC in any of the studies. Results regarding the association of DTAC with insulin, HOMA-IR, high-sensitivity CRP, and TG in the published literature were inconsistent. Findings indicated a substantial association between high DTAC and most CVD-related risk factors.

Lipid and lipoprotein changes in women following 6 months of exercise training in a worksite fitness program.

PubMed

Grandjean, P W; Oden, G L; Crouse, S F; Brown, J A; Green, J S

1996-03-01

It was the purpose of this investigation to examine the influence of a worksite aerobic training program on serum lipid and lipoproteins and cardiovascular fitness in female employees. Thirty-seven healthy but previously untrained, female employees (Ss) from Westinghouse Corporation, (College Station, Texas) volunteered for the study. Ss were randomly assigned to either an exercise group (Ex) (n = 20) or control group (C) (n = 17). Prior to training (PRE) and following training (POST), all Ss were measured for weight (WT), body composition (%FAT) and tested for maximal oxygen consumption (VO2 max). PRE and POST Lipid analysis included: total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), very low-density lipoprotein cholesterol (VLDL-C), and triglycerides (TG). Following PRE testing, the Ex group aerobically trained by walking, jogging and/or cycling, at least 3 days per wk for 24 wks. Exercise training resulted in an improvement in VO2 max (p < 0.0006) and a 2 kg WT loss in Ex (p < 0.025) with no change in C. Both Ex and C Ss exhibited a loss in %-FAT (p < 0.0001), and a decrease in TC (p < 0.0001) and LDL-C (p < 0.0001). No differences were observed between groups or over the training period for VLDL-C or TG. Although HDL-C increased 6 mg/dl in the Ex group but not in C, this difference did not reach statistical significance (p < 0.0625). These results demonstrate that aerobic training by females in a worksite fitness program significantly improves cardiovascular fitness without altering lipids or lipoproteins.

Associations of serum LDL particle concentration with carotid intima-media thickness and coronary artery calcification.

PubMed

Zaid, Maryam; Miura, Katsuyuki; Fujiyoshi, Akira; Abbott, Robert D; Hisamatsu, Takashi; Kadota, Aya; Arima, Hisatomi; Kadowaki, Sayaka; Torii, Sayuki; Miyagawa, Naoko; Suzuki, Sentaro; Takashima, Naoyuki; Ohkubo, Takayoshi; Sekikawa, Akira; Maegawa, Hiroshi; Horie, Minoru; Nakamura, Yasuyuki; Okamura, Tomonori; Ueshima, Hirotsugu

2016-01-01

Low-density lipoprotein particle (LDL-P) has recently been found to be a stronger predictor of cardiovascular disease (CVD) than LDL-cholesterol (LDL-C). Whether LDL-P is associated with subclinical atherosclerosis, independent of LDL-C, as well as other lipid measures has not been fully examined. We aimed to analyze LDL-P associations with measures of subclinical atherosclerosis. We examined 870 Japanese men randomly selected from Kusatsu City, Shiga, Japan, aged 40-79 years from 2006-2008, free of clinical CVD and not using lipid-lowering medication. Cross-sectional associations of lipid measures with carotid intima-media thickness (cIMT) and coronary artery calcification (CAC; >0 Agatston score) were examined. LDL-P was significantly positively associated with cIMT and maintained this association after adjustments for LDL-C and other lipid measures. Although these lipid measures were positively associated with cIMT, model adjustment for LDL-P removed any significant relationships. Higher LDL-P was associated with a significantly higher odds ratio of CAC and further adjustment for LDL-C did not affect this relationship. In contrast, the LDL-C association with CAC was no longer significant after adjustment for LDL-P. Other lipid measures attenuated associations of LDL-P with CAC. Likewise, associations of these measures with CAC were attenuated when model adjustments for LDL-P were made. In a community-based sample of Japanese men, free of clinical CVD, LDL-P was a robust marker for subclinical atherosclerosis, independent of LDL-C and other lipid measures. Associations of LDL-C and other lipid measures with either cIMT or CAC were generally not independent of LDL-P. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

The comparative effectiveness of mail order pharmacy use vs. local pharmacy use on LDL-C control in new statin users.

PubMed

Schmittdiel, Julie A; Karter, Andrew J; Dyer, Wendy; Parker, Melissa; Uratsu, Connie; Chan, James; Duru, O Kenrik

2011-12-01

Mail order pharmacies are commonly used to deliver CVD risk factor medications. Previous studies have shown that mail order pharmacy use is associated with greater medication adherence; however, no studies have examined whether mail order pharmacy use is related to improved CVD risk factor outcomes. To examine the comparative effectiveness of mail order pharmacy vs. local pharmacy use on LDL-C control in new statin users. Observational cohort study. 100,298 adult Kaiser Permanente Northern California (KPNC) members who were new users of statins between January 1, 2005 and December 31, 2007. The main outcome measure was LDL-C control in the 3-15 month period after statin therapy was initiated. After adjustment for patient, clinical, and census-block characteristics, and for potential unmeasured differences between mail order and local KPNC pharmacy users with instrumental variables analysis, 85.0% of patients who used the mail order pharmacy to deliver their statin at any time achieved target LDL-C levels compared with 74.2% of patients who only used the local KPNC pharmacy to dispense the statin (p < 0.001). Greater adjusted rates of LDL-C control in mail order pharmacy users were seen across all gender and race/ethnicity subgroups. Mail order pharmacy use was positively associated with LDL-C control in new statin users. Future research should continue to explore the relationship between mail order pharmacy use and outcomes, and address how to appropriately target mail order services to patients most likely to benefit without compromising patient choice, care, and safety.

Osteopenia is associated with glycemic levels and blood pressure in Chinese postmenopausal women: a cross-sectional study.

PubMed

Sun, Qihong; Zheng, Yu; Chen, Kang; Yan, Wenhua; Lu, Juming; Dou, Jingtao; Lv, Zhaohui; Wang, Baoan; Gu, Weijun; Ba, Jianming; Mu, Yiming

2017-02-01

The aim of present study was to explore the relationships between osteopenia and dyslipidemia, glycemic levels or blood pressure in postmenopausal Chinese women. A total of 4080 women aged 42-85 years were enrolled in this cross-sectional study, which was nested in an ongoing longitudinal (REACTION) study. Calcaneus quantitative ultrasound (QUS) was performed and QUS T score was calculated to assess bone mineral density. Osteopenia was defined as a T score ≤-1.0. The relationship between osteopenia and dyslipidemia, glycemic levels or blood pressure was investigated. The prevalence of osteopenia was significantly lower in subjects with systolic blood pressure (SBP) ≥140 mmHg, fasting blood glucose (FBG) ≥8.0 mmol/L, postprandial blood glucose (PBG) ≥15.0 mmol/L, hemoglobin A1c (HbA1C) 6.5-7.5 %, HbA1C ≥7.5 %. These relationships remained significant after controlling for multiple factors. Moreover, significant trend between osteopenia and SBP, FBG, PBG and HbA1C was observed in women. In contrast, no significant associations between osteopenia and diastolic blood pressure (DBP), total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) were found, and no significant trend relationship between osteopenia and DBP, TC, TG, HDL-C, LDL-C was found in postmenopausal Chinese women. The present study showed a relationship between SBP, FBG, PBG, HbA1C and osteopenia in postmenopausal Chinese women, while no significant relationship was observed between dyslipidemia, DBP and osteopenia, even after controlling for multiple confounding factors.

Cross-sectional relations of race and poverty status to cardiovascular risk factors in the Healthy Aging in Neighborhoods of Diversity across the Lifespan (HANDLS) study.

PubMed

Waldstein, Shari R; Moody, Danielle L Beatty; McNeely, Jessica M; Allen, Allyssa J; Sprung, Mollie R; Shah, Mauli T; Al'Najjar, Elias; Evans, Michele K; Zonderman, Alan B

2016-03-14

Examine interactive relations of race and poverty status with cardiovascular disease (CVD) risk factors in a socioeconomically diverse sample of urban-dwelling African American (AA) and White adults. Participants were 2,270 AAs and Whites (57% AA; 57% female; ages 30-64 years) who completed the first wave of the Healthy Aging in Neighborhoods of Diversity across the Life Span (HANDLS) study. CVD risk factors assessed included body mass index (BMI), waist circumference (WC), total cholesterol (TC), high- and low-density lipoprotein cholesterol (HDL-C, LDL-C), triglycerides (TG), glycated hemoglobin (HbA1c), high-sensitivity C-reactive protein (CRP), and systolic, diastolic, and pulse pressure (SBP, DBP, PP). Interactive and independent relations of race, poverty status, and sex were examined for each outcome via ordinary least squares regression adjusted for age, education, literacy, substance use, depressive symptoms, perceived health care barriers, medical co-morbidities, and medications. Significant interactions of race and poverty status (p's < .05) indicated that AAs living in poverty had lower BMI and WC and higher HDL-C than non-poverty AAs, whereas Whites living in poverty had higher BMI and WC and lower HDL-C than non-poverty Whites. Main effects of race revealed that AAs had higher levels of HbA1c, SBP, and PP, and Whites had higher levels of TC, LDL-C and TG (p's < .05). Poverty status moderated race differences for BMI, WC, and HDL-C, conveying increased risk among Whites living in poverty, but reduced risk in their AA counterparts. Race differences for six additional risk factors withstood extensive statistical adjustments including SES indicators.

SOD2 gene polymorphism and response of oxidative stress parameters in young wrestlers to a three-month training.

PubMed

Jówko, Ewa; Gierczuk, Dariusz; Cieśliński, Igor; Kotowska, Jadwiga

2017-05-01

The aim of the study was to analyse the effect of Val 16Ala polymorphism in SOD2 gene on oxidative stress parameters and lipid profile of the blood during a three-month wrestling training. The study included 53 Polish young wrestlers. Blood samples were collected at the beginning of the programme and following three months of the training. The list of analysed parameters included erythrocyte and serum activities of superoxide dismutase (SOD), whole blood glutathione peroxidase (GPx) activity, total glutathione (tGSH) level, concentration of lipid hydroperoxides (LHs), total antioxidant capacity (TAC) and creatine kinase (CK) activity in the serum, as well as lipid profile parameters: triglycerides (TG), total cholesterol (TC), high-density (HDL-C), and low-density lipoprotein cholesterol (LDL-C). Three-month training resulted in a decrease in CK activity, an increase in serum SOD activity, as well as in unfavourable changes in serum lipid profile: an increase in TC, LDL-C, and TG, and a decrease in HDL-C. Aside from CK activity, all these changes seemed to be associated with presence of Val allele. Prior to the training programme, subjects with Ala/Ala genotype presented with lower levels of LHs, lower whole blood GPx activity, and lower serum concentrations of TC than the individuals with Ala/Val genotype. Both prior to and after three-month training, higher levels of tGSH were observed in Val/Val genotype as compared to Ala/Val genotype carriers. Moreover, multiple regression analysis demonstrated that SOD2 genotype was a significant predictor of pre-training whole blood GPx activity and erythrocyte SOD activity (Val/Val > Ala/Val > Ala/Ala). Altogether, these findings suggest that Val 16Ala polymorphism in SOD2 gene contributes to individual variability in oxidative stress status and lipid profile of the blood in young wrestlers, and may modulate biochemical response to training.

VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

PubMed Central

Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

2001-01-01

BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and

Effects of ezetimibe added to statin therapy on markers of cholesterol absorption and synthesis and LDL-C lowering in hyperlipidemic patients

PubMed Central

Thongtang, Nuntakorn; Lin, Jianxin; Schaefer, Ernst J.; Lowe, Robert S.; Tomassini, Joanne E.; Shah, Arvind K.; Tershakovec, Andrew M.

2013-01-01

Objective Statins inhibit cholesterol synthesis but can upregulate cholesterol absorption, with higher doses producing larger effects. Ezetimibe inhibits cholesterol absorption but also upregulates synthesis. We tested whether ezetimibe added to ongoing statin therapy would be most effective in lowering LDL-cholesterol (LDL-C) in subjects on high-potency statins and whether these effects would be related to alterations in cholesterol absorption (β-sitosterol) and synthesis (lathosterol) markers. Methods Hypercholesterolemic subjects (n=874) on statins received ezetimibe 10 mg/day. Plasma lipids, lathosterol, and β-sitosterol were measured at baseline and on treatment. Subjects were divided into low- (n=133), medium- (n=582), and high- (n=159) statin potency groups defined by predicted LDL-C–lowering effects of each ongoing statin type and dose (reductions of ~20-30%, ~31-45%, or ~46-55%, respectively). Results The high-potency group had significantly lower baseline lathosterol (1.93 vs. 2.58 vs. 3.17 μmol/l; p <0.001) and higher baseline β-sitosterol values (6.21 vs. 4.58 vs. 4.51 μmol/l, p <0.001) than medium-/low-potency groups. Ezetimibe treatment in the high-potency group produced significantly greater reductions from baseline in LDL-C than medium-/low-potency groups (−29.1% vs. −25.0% vs. −22.7%; p <0.001) when evaluating unadjusted data. These effects and group differences were significantly (p <0.05) related to greater β-sitosterol reductions and smaller lathosterol increases. However, LDL-C reduction differences between groups were no longer significant after controlling for placebo effects, due mainly to modest LDL-C lowering by placebo in the high-potency group. Conclusion Patients on high-potency statins have the lowest levels of cholesterol synthesis markers and the highest levels of cholesterol absorption markers at baseline, and the greatest reduction in absorption markers and the smallest increases in synthesis markers with ezetimibe

Correlation of compliance to statin therapy with lipid profile and serum HMGCoA reductase levels in dyslipidemic patients.

PubMed

Grover, Abhinav; Rehan, Harmeet Singh; Gupta, Lalit Kumar; Yadav, Madhur

The efficacy of statin therapy may be lost or vary with reduction in compliance and intensity of statin therapy. To study and correlate the quantitative effect of compliance on lipid profile and 3-hydroxyl-3-methylglutaryl coenzyme A reductase (HMGCoA-R) levels in dyslipidemic patients. Compliance to different intensity of statin therapy assessed by pill count was correlated with serum levels of total cholesterol (TC), low density lipoprotein-cholesterol (LDL-C), high density lipoprotein-cholesterol (HDL-C), triglycerides (TG), apolipoprotein A1 (ApoA1), apolipoprotein B (ApoB) and HMGCoA-R. Out of 200 patients, 160 received moderate intensity statin therapy whereas 40 were on high intensity statin therapy. The overall mean compliance of patients was 56.7%. The compliance of patients on moderate intensity statin therapy was higher (56.8%) than those on high intensity (56.4%) (p=0.92). There was significant inverse correlation (p<0.05) between compliance and TC, TG, LDL-C and HMGCoA-R levels and positive correlation (p<0.05) with HDL-C levels. The mean serum HMGCoA-R levels did not fall below 9-10ng/mL when compliance to either moderate or high intensity statin therapy was increased above 60%. It is appropriate to improve the compliance to existing statin therapy than switching over to higher intensity statin therapy. Estimation of HMGCoA-R levels may be explored as a surrogate marker to monitor and assess the compliance of patients to statin therapy. Copyright © 2016. Published by Elsevier B.V.

Is In-Stent Restenosis After a Successful Coronary Stent Implantation Due to Stable Angina Associated With TG/HDL-C Ratio?

PubMed

Kundi, Harun; Korkmaz, Ahmet; Balun, Ahmet; Cicekcioglu, Hulya; Kiziltunc, Emrullah; Gursel, Koray; Cetin, Mustafa; Ornek, Ender; Ileri, Mehmet

2017-10-01

We examined the impact of the preprocedural triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) ratio on risk of in-stent restenosis (ISR). Patients with typical anginal symptoms and/or positive treadmill or myocardial perfusion scintigraphy test results who underwent successful coronary stent implantation due to stable angina were examined; 1341 patients were enrolled. The hospital files of the patients were used to gather data. Cox regression analysis showed that the TG/HDL-C ratio was independently associated with the presence of ISR ( P < .001). Moreover, diabetes mellitus ( P = .007), smaller stent diameter ( P = .046), and smoking status ( P = .001) were also independently associated with the presence of ISR. Using a cutoff of 3.8, the TG/HDL-C ratio predicted the presence of ISR with a sensitivity of 71% and a specificity of 68%. Also, the highest quartile of TG/HDL-C ratio had the highest rate of ISR ( P < .001). Measuring preprocedural TG/HDL-C ratio, in fasting or nonfasting samples, could be beneficial for the risk assessment of ISR. However, further large-scale prospective studies are required to establish the exact role of this simple, easily calculated, and reproducible parameter in the pathogenesis of ISR.

Lipoprotein profiles and serum peroxide levels of aged women consuming palmolein or oleic acid-rich sunflower oil diets.

PubMed

Cuesta, C; Ródenas, S; Merinero, M C; Rodríguez-Gil, S; Sánchez-Muniz, F J

1998-09-01

To investigate the hypercholesterolemic effects of a dietary exchange between 16:0 and 18:1 while 18:2 was at relatively lower level (approximately 4%) in aged women with initially high total serum cholesterol (TC) and low density lipoprotein cholesterol (LDL-C) values and with high intakes of dietary cholesterol. Subjects were assigned to two consecutive 28 d periods. In the first period all subjects followed an oleic acid-rich diet in the form of oleic acid-rich sunflower oil. This was followed by a second period rich in palmitic acid in the form of palmolein. Nutrient intakes, serum lipids, lipoproteins, antioxidant vitamins, peroxides and LDL-peroxides were measured at two dietary periods. Instituto de Nutrición y Bromatología (CSIC), Departamento de Nutrición y Bromatología I (Nutrición) and Sección Departamental de Quimica Analítica, Universidad Complutense, Madrid, Spain. The palmolein period led to an increase in TC (P < 0.001; 17.7%) and serum apolipoprotein (Apo) B levels (P < 0.001; 18.0%). LDL-C and LDL-Apo B concentrations were higher (P < 0.001, 4.33+/-0.94 mmol/L and P < 0.01, 1.08+/-0.20 g/L, respectively) following this period than following the oleic acid-rich sunflower oil diet (3.56+/-0.85 mmol/L, 0.93+/-0.16g/L, respectively). No significant differences were observed in the TC/high density lipoprotein cholesterol (TC/HDL-C) ratio between the two dietary periods. Serum and LDL-peroxides were lower (P < 0.01, 49.5%, and P < 0.001, 69.0%, respectively) after the palmolein diet than after the oleic acid-rich sunflower oil diet. The palmolein diet significantly increased TC, LDL-C, Apo B, VLDL-ApoB, LDL-ApoB in women with TC > or = 6.21 mmol/L or with TC < 6.21 mmol/L, but the increase in Apo B, LDL-C and LDL-Apo B was greater among the women with high TC. The palmolein diet increased HDL-C in women with high or with low TC but this rise was on the borderline of statistical significance (P = 0.06) only in normocholesterolemics. Serum and LDL

Sibutramine and L-carnitine compared to sibutramine alone on insulin resistance in diabetic patients.

PubMed

Derosa, Giuseppe; Maffioli, Pamela; Salvadeo, Sibilla A T; Ferrari, Ilaria; Gravina, Alessia; Mereu, Roberto; D'Angelo, Angela; Palumbo, Ilaria; Randazzo, Sabrina; Cicero, Arrigo F G

2010-01-01

To evaluate the effects of one year of treatment with sibutramine plus L-carnitine compared to sibutramine on body weight, glycemic control, and insulin resistance state in type 2 diabetic patients. Two hundred and fifty-four patients with uncontrolled type 2 diabetes mellitus (T2DM) [glycated hemoglobin (HbA(1c)) >8.0%] in therapy with different oral hypoglycemic agents or insulin were enrolled in this study and randomised to take sibutramine 10 mg plus L-carnitine 2 g or sibutramine 10 mg in monotherapy. We evaluated at baseline, and after 3, 6, 9, and 12 months these parameters: body weight, body mass index (BMI), glycated hemoglobin (HbA(1c)), fasting plasma glucose (FPG), post-prandial plasma glucose (PPG), fasting plasma insulin (FPI), homeostasis model assessment insulin resistance index (HOMA-IR), total cholesterol (TC), low density lipoprotein-cholesterol (LDL-C), high density lipoprotein-cholesterol (HDL-C), triglycerides (Tg), retinol binding protein-4 (RBP-4), resistin, visfatin, high sensitivity-C reactive protein (Hs-CRP). There was a decrease in body weight, BMI, HbA(1c), FPI, HOMA-IR, and RBP-4 in both groups, even when the values obtained with sibutramine plus L-carnitine were lower than the values obtained in sibutramine group. There was a faster decrease of FPG, PPG, TC, LDL-C, resistin and Hs-CRP with sibutramine plus L-carnitine even when no differences between the two groups were obtained. Furthermore, only sibutramine plus L-carnitine improved Tg, and visfatin. Sibutramine plus L-carnitine gave a faster improvement of lipid profile, insulin resistance parameters, glycemic control, and body weight compared to sibutramine.

Wives of patients with acute myocardial infarction are at an increased risk of developing coronary artery disease.

PubMed

Papamichael, Ch; Zampelas, A; Cimponerio, A; Adamopoulos, P N

2002-02-01

The present study was carried out to investigate risk factors for developing coronary artery disease in wives of patients with acute myocardial infarction. Risk factors for developing coronary artery disease were investigated in 50 wives of patients who developed an acute myocardial infarction (group A) and were compared with those of 50 wives of normal healthy men (group B). The average age was 50.20 +/- 1.56 years (mean +/- SD) and 50.20 +/- 1.53 years for group A and group B respectively. The parameters assessed were: plasma cholesterol (TC), high density lipoprotein cholesterol (HDL-C), triglycerides (TG), low density lipoprotein cholesterol (LDL-C), systolic and diastolic blood pressure, smoking habits and body mass index (BMI). The levels of LDL-C in the wives of patients with myocardial infarction were higher than those of the wives of normal healthy men (167.8 +/- 5.84 mg/dl and 148.4 +/- 4.85 mg/dl, respectively, P < 0.01). Moreover, HDL-C concentrations were lower in the wives of the patients (51.34 +/- 0.92 mg/dl) than in the wives of the healthy men (58.14 +/- 1.39 mg/dl), (P < 0.001). Finally, TG levels were higher in the wives of the patients (132.2 +/- 7.9 mg/dl) than in the wives of the normal healthy men (96.9 +/- 5.94 mg/dl) (P < 0.01). Although plasma lipid levels themselves were not excessively high, the wives of patients with an acute myocardial infarction are at a higher risk of developing coronary artery disease than the wives of normal healthy men, in the long term, due to higher levels of LDL-C and TG as well as lower levels of HDL-C.

Gender differences in the lipid profile of dyslipidemic subjects.

PubMed

Kolovou, Genovefa D; Anagnostopoulou, Katherine K; Damaskos, Dimitris S; Bilianou, Helen I; Mihas, Constantinos; Milionis, Haralampos J; Kostakou, Peggy M; Cokkinos, Dennis V

2009-03-01

We evaluated the gender-associated differences in lipid profile of subjects intended to receive lipid-lowering therapy with emphasis on the associations between triglycerides (TG) and other plasma lipid variables. Lipid profiles of 1385 patients [aged 55+/-11 years, 549 women (40%)] were evaluated. Eligible subjects fulfilled one or more of the following criteria: total cholesterol (TC)>or=6.2 mmol/l, TG>or=1.7 mmol/l, and high-density lipoprotein cholesterol (HDL-C)<1.0 mmol/l. Patients were divided into subgroups according to TG and HDL-C levels. Women aged on average 3.5 years older, had higher TC and HDL-C, lower TG and a correspondingly lower TC/HDL-C ratio than men. High TG and low HDL-C in tandem appeared twice more frequently in men. Inverse correlations between HDL-C and TG levels were found to exist in the entire cohort (r=-0.354, p<0.001) and in all various subgroups. In the subgroup with TG<1.7 mmol/l, women had higher TC and HDL-C, lower TG levels and lower TC/HDL-C ratio compared with men. In the subgroup with TG>or=1.7 mmol/l, women had higher TC and HDL-C levels and lower TC/HDL ratio compared with men. In the subgroup with HDL-C>or=1.0 mmol/l women had higher HDL-C, lower TG levels and lower TC/HDL-C ratio compared with men. Elevated TG levels and low HDL-C in tandem are common lipid abnormalities in the clinical setting of primary and secondary preventions. Gender-associated differences in the lipid profile are evident in subjects presenting with dyslipidemia and might be of potential relevance for diagnostics and therapy for the prevention of atherosclerosis.

Combined nattokinase with red yeast rice but not nattokinase alone has potent effects on blood lipids in human subjects with hyperlipidemia.

PubMed

Yang, Nae-Cherng; Chou, Chien-Wen; Chen, Chung-Yin; Hwang, Kai-Lin; Yang, Yi-Chueh

2009-01-01

The purpose of this randomized, double-blind, placebo-controlled, parallel comparison study was to evaluate the lipid-lowering effect of orally administrated nattokinase and nattokinase combined with red yeast rice (RYR) extract on blood lipids in patients with hyperlipidemia. A total of 47 patients with hyperlipidemia were assigned to one of three groups: 1. nattokinase-mono formula (50 mg/capsule), 2. combined formula of nattokinase with RYR (300 mg of extract/capsule) and 3. placebo. Subjects received a twice daily dose of two capsules for six months. The mono formula showed no effects on blood lipids until month six, while the combined formula ameliorated all of measured lipids starting from month one. In the combined group significant decreases were found with regard to: triglycerides (TG) by 15%, total cholesterol (TC) by 25%, low-density lipoprotein cholesterol (LDL-C) by 41%, TC/high-density lipoprotein cholesterol (HDL-C) ratio by 29.5%, and increases in HDL-C by 7.5%. These changes were sustained until the end of study. After controlling for baseline levels, only the combined group, but not mono group, showed a significant difference (p<0.0001) in TC, LDL-C and TC/HDL-C ratio when compared with the placebo group. In summary, this study provides long-term efficacy of nattokinase supplementation and shows that the combined formula has relatively more potent effects than the mono formula on lowering of blood lipids, suggesting that combined nattokinase with RYR will be a better neutraceutical for patients with hyperlipidemia than nattokinase alone.

Effects of Fortunella margarita fruit extract on metabolic disorders in high-fat diet-induced obese C57BL/6 mice.

PubMed

Tan, Si; Li, Mingxia; Ding, Xiaobo; Fan, Shengjie; Guo, Lu; Gu, Ming; Zhang, Yu; Feng, Li; Jiang, Dong; Li, Yiming; Xi, Wanpeng; Huang, Cheng; Zhou, Zhiqin

2014-01-01

Obesity is a nutritional disorder associated with many health problems such as dyslipidemia, type 2 diabetes and cardiovascular diseases. In the present study, we investigated the anti-metabolic disorder effects of kumquat (Fortunella margarita Swingle) fruit extract (FME) on high-fat diet-induced C57BL/6 obese mice. The kumquat fruit was extracted with ethanol and the main flavonoids of this extract were analyzed by HPLC. For the preventive experiment, female C57BL/6 mice were fed with a normal diet (Chow), high-fat diet (HF), and high-fat diet with 1% (w/w) extract of kumquat (HF+FME) for 8 weeks. For the therapeutic experiment, female C57BL/6 mice were fed with high-fat diet for 3 months to induce obesity. Then the obese mice were divided into two groups randomly, and fed with HF or HF+FME for another 2 weeks. Body weight and daily food intake amounts were recorded. Fasting blood glucose, glucose tolerance test, insulin tolerance test, serum and liver lipid levels were assayed and the white adipose tissues were imaged. The gene expression in mice liver and brown adipose tissues were analyzed with a quantitative PCR assay. In the preventive treatment, FME controlled the body weight gain and the size of white adipocytes, lowered the fasting blood glucose, serum total cholesterol (TC), serum low density lipoprotein cholesterol (LDL-c) levels as well as liver lipid contents in high-fat diet-fed C57BL/6 mice. In the therapeutic treatment, FME decreased the serum triglyceride (TG), serum TC, serum LDL-c, fasting blood glucose levels and liver lipid contents, improved glucose tolerance and insulin tolerance. Compared with the HF group, FME significantly increased the mRNA expression of PPARα and its target genes. Our study suggests that FME may be a potential dietary supplement for preventing and ameliorating the obesity and obesity-related metabolic disturbances.

Genetic Risk Factors for Psoriasis in Turkish Population: -1540 C/A, -1512 Ins18, and +405 C/G Polymorphisms within the Vascular Endothelial Growth Factor Gene

PubMed Central

Bozduman, Tuba; Ersoy Evans, Sibel; Karahan, Sevilay; Hayran, Yildiz; Akbiyik, Filiz

2016-01-01

Background Evidence regarding the vascular endothelial growth factor A (VEGFA) as a potent mediator of angiogenesis and inflammation in psoriasis has revealed variations in this gene as surrogate markers of psoriasis. Objective VEGFA gene polymorphisms (-1540 C/A, -1512 Ins18, -460 T/C, and +405 C/G) in psoriasis susceptibility in Turkish population were investigated. Methods A total of 200 age, sex and ethnicity-matched psoriatic and healthy individuals were examined for clinical type, response to therapy, serum VEGFA and its receptor levels, genotypes and haplotypes. Results The +405 GG, +405 CG, -1540 CA, and -1512 +Ins18 genotypes conferred a significant risk for developing psoriasis. The C-InsTC haplotype in the controls and C+InsTG, A+InsTC, and A-InsTG haplotypes in psoriatic patients were observed to be significantly high. Increased serum levels of VEGFA were detected in psoriatic patients with the C-InsTC haplotype than that in the controls. The +405 GG genotype was significantly more frequent in psoriatic patients with a positive family history, and the moderate form of psoriasis was more frequent among C+InsTG haplotype carriers than that among the other patients. The +405 GG genotype was found to be more frequent in patients responding to oral retinoids. Serum VEGFR1/FLT1 and VEGFR2/KDR levels were not significantly different when psoriatic patients and controls were stratified based on the risk polymorphic variants. Conclusion VEGFA gene +405 GG and CG, -1512+Ins18, and -1540 CA genotypes are associated with an increased risk of psoriasis in Turkish population. The G allele at +405 and an 18-bp insertion at -1512 are primarily the risk factors for psoriasis, and this risk is potentiated by the presence of the A allele at the -1540 locus. PMID:26848216

Apple peel bioactive rich extracts effectively inhibit in vitro human LDL cholesterol oxidation.

PubMed

Thilakarathna, Surangi H; Rupasinghe, H P Vasantha; Needs, Paul W

2013-05-01

Apple peels are rich in antioxidant bioactives and hence can possess the ability to inhibit human low density lipoprotein cholesterol (LDL-C) oxidation. LDL-C oxidation is known to initiate atherosclerotic plaque formation. Unique quercetin-rich (QAE) and triterpene-rich (TAE) apple peel extracts, their constituent compounds and three in vivo quercetin metabolites were investigated for in vitro LDL-C oxidation inhibition. Both extracts effectively inhibited Cu(2+)-induced LDL-C oxidation. IC(50) of QAE and TAE for LDL-C oxidation products were 0.06-8.29 mg/L and 29.58-95.49 mg/L, respectively. Quercetin compounds, chlorogenic acid and phloridzin could contribute more to the effectiveness of QAE at physiological concentrations. The three in vivo quercetin metabolites; quercetin-3'-sulfate, quercetin-3-glucuronic acid and isorhamnetin-3-glucuronic acid were effective at physiological concentrations and therefore, QAE can be effective in LDL-C oxidation inhibition under physiological conditions. Constituent TAE compounds did not perform well under Cu(2+)-induction. Overall, both extracts effectively inhibited LDL-C oxidation in vitro. Copyright © 2012 Elsevier Ltd. All rights reserved.

Thermal Expansion Behavior in TcO2. Toward Breaking the Tc-Tc Bond.

PubMed

Reynolds, Emily; Zhang, Zhaoming; Avdeev, Maxim; Thorogood, Gordon J; Poineau, Frederic; Czerwinski, Kenneth R; Kimpton, Justin A; Kennedy, Brendan J

2017-08-07

The structure of TcO 2 between 25 and 1000 °C has been determined in situ using X-ray powder diffraction methods and is found to remain monoclinic in space group P2 1 /c. Thermal expansion in TcO 2 is highly anisotropic, with negative thermal expansion of the b axis observed above 700 °C. This is the result of an anomalous expansion along the a axis that is a consequence of weakening of the Tc-Tc bonds.

Ramadan fasting ameliorates oxidative stress and improves glycemic control and lipid profile in diabetic patients.

PubMed

Al-Shafei, Ahmad I

2014-10-01

The effects of Ramadan fasting on public health are important. The present study characterized the metabolic effects of Ramadan fasting and evaluated its influence on oxidative stress in diabetic patients. The current study was carried out in the city of Benha, Egypt, during the period from July 12, 2012 to October 4, 2012. This corresponds to 22 Shaban 1433 to 18 Dhul Al-Qi'dah 1433 in the Islamic Calendar. Two equal, sex- and age-matched groups (n = 40 each; age 55 ± 5 years) of non-diabetic subjects (ND group) and diabetic patients (D group) were recruited for this study. Parameters of glycemic control, lipid profile, and oxidative stress were measured pre-, during and post-fasting. Ramadan fasting reduced fasting blood glucose (FBG) insignificantly by 5.8% and significantly by 23.0% in the (ND) and (D) groups, respectively. Serum triglycerides (TG) and malondialdehyde (MDA) were lowered significantly by: TG (22.8, 22.1%), MDA (54.3, 46.6%), and total cholesterol (TC) and low-density lipoproteins (LDL) insignificantly by: TC: (4.7, 6.1%), LDL: (4.0, 5.1%), whereas high-density lipoproteins (HDL) were raised significantly by 6.7% and insignificantly by 2.2%, and blood glutathione (GSH) significantly by 52.6 and 59.4%, in the (ND) and (D) groups, respectively. At 6 weeks post-fasting FBG, TG, TC, HDL, and LDL returned to levels indistinguishable from their baseline values in both groups, while MDA was maintained significantly lower by (25.7, 22.7%), and GSH significantly higher by (26.3, 31.3%), in the (ND) and (D) groups, respectively. Ramadan fasting improves glycemic control and lipids profile and alleviates oxidative stress in diabetics.

Anti-hyperlipidemia of garlic by reducing the level of total cholesterol and low-density lipoprotein: A meta-analysis.

PubMed

Sun, Yue-E; Wang, Weidong; Qin, Jie

2018-05-01

This study aimed to understand the impact of garlic on improving blood lipids using a meta-analysis. A literature search of the PubMed, EMBASE, and Cochrane Library databases was performed using keywords such as "garlic" and "hypercholesterolemia," and the deadline "July 14 (th), 2017." After extracting relevant details, each selected literature was evaluated for quality according to the quality evaluation criteria of bias risk recommended by Cochrane Collaboration recommendations and heterogeneity tests were performed. Standardized mean difference (SMD) and 95% confidence interval (CI) were evaluated using R 3.12 software. The publication bias was assessed using Egger method. A total of 14 eligible papers published from 1981 to 2016 were included. The quality of the literatures was of moderate to high qualities. The values of TC (SMD = -1.26, 95% CI, -1.86 to -0.66), low-density lipoprotein (LDL) (SMD = -1.07, 95% CI, -1.67 to -0.47), and high-density lipoprotein (HDL) (SMD = 0.50, 95% CI, 0.06-0.94) after taking garlic in the experimental group and the control group have statistical significance, while there was no significant difference of TG in the 2 groups (SMD = -0.16, 95% CI, -0.87-0.55). However, the result of HDL was reversed when removed some of the literatures. No significant publication bias among the eligible studies with values of TC (P = .0625), LDL (P = .0770), HDL (P = .2293), and TG (P = .3436). Garlic can reduce the level of TC and LDL instead of HDL and TG, indicating the ability of anti-hyperlipidemia.

[Effect of anthocyanins from Aronia melanocarpa on blood pressure, concentration of endothelin-1 and lipids in patients with metabolic syndrome].

PubMed

Broncel, Marlena; Koziróg-Kołacińska, Marzena; Andryskowski, Grzegorz; Duchnowicz, Piotr; Koter-Michalak, Maria; Owczarczyk, Aleksandra; Chojnowska-Jezierska, Julita

2007-08-01

To estimate the influence of anthocyanins from Aronia melanocarpa on blood pressure, concentration of endothelin-1 (ET-1), serum lipids, fasting glucose, uric acid and membrane cholesterol in erythrocytes of patients (pts) with metabolic syndrome (MS). The study comprised 22 healthy volunteers and 25 pts with MS treated with anthocyanins (3 x 100 mg/d) for 2 months. Waist circumference (> or = 80 cm for women and > or =94 cm for men), triglicerydes (TG) level >150 mg/dl (1.7 mmol/l), cholesterol-HDL (HDL-C) level < 40 mg/dl (1.0 mmol/l) for men and <50 mg/dl (1.3 mmol/l) for women, systolic blood pressure (SBP) >130 mmHg and/or diastolic blood pressure (DBP) >85 mmHg were inclusion criteria for patients with MS. Before and after 2 months of treatment the following parameters were determined: SBP, DBP, serum lipids (total cholesterol--TC, cholesterol LDL--LDL-C, cholesterol HDL--HDL-C, TG--by enzymatic method), membrane cholesterol in erythrocytes (method of IIcy), ET-1 (immunoenzymatic method), fasting glucose level was (colorimetric method), uric acid (enzymatic--colorimetric method). After two months therapy of anthocyanins from Aronia melanocarpa in comparison with baseline it was observed a significant decrease of: SBP (144.20 +/- 9.97 vs. 131.83 +/- 12.24 mmHg, p < 0.001) and DBP (87.20 +/- 9.9 vs. 82.13 +/- 10.33 mmHg, p < 0.05), TC (242.80 +/- 34.48 vs. 227.96 +/- 33.07 mg/dl, p < 0.001), LDL-C (158.71 +/- 35.78 vs. 146.21 +/- 34.63 mg/dl, p < 0.01), TG (215.92 +/- 63.61 vs. 187.58 +/- 90 mg/dl, p < 0.05), ET-1 (2.44 +/- 0.51 vs. 1.74 +/- 0.42 pg/ml, p < 0.001) and membrane cholesterol (4.85 +/- 0.65 vs. 2.81 +/- 0.54 mmol/Lpc, p < 0.001), uric acid and fasting blood glucose levels did not change significantly after study cessation. The results of our study show that anthocyanins from Aronia melanocarpa may be of benefit to patients with MS as for as atherosclerosis prevention is concerned. It seems to result from anthocyanins influence on blood pressure

Argan oil reduces, in rats, the high fat diet-induced metabolic effects of obesity.

PubMed

Sour, S; Belarbi, M; Sari, N; Benammar, C H; Baghdad, C H; Visioli, F

2015-04-01

Obesity is a multi-factorial disorder which is of worldwide concern. In addition to calorie control, some specific dietary components might help resolving some of the complication of obesity, by providing antioxidant and anti-inflammatory activities. We investigated the effect of argan oil supplementation on plasma lipid profile and oxidant-antioxidant status of rats with high-fat diet (HFD)-induced obesity compared with rats fed a normal diet (ND). We used an animal model of high fat diet-induced obesity to study the metabolic effects of argan oil and we measured several markers lipid and redox statuses. Consumption of a high-fat diet led to an increase in serum total cholesterol (TC), LDL-cholesterol (LDL-C), and triacylglycerols (TAG) concentrations; however, argan oil blunted the increases of TC, LDL-C and TG, glucose, and insulin. Plasma total antioxidant capacity, erythrocyte catalase and superoxide dismutase activities were lower, whereas plasma hydroperoxide, thiobarbituric acid-reacting substances, and susceptibility of LDL to copper-induced oxidation were higher in obese rats compared with normal rats. Administration of argan oil ameliorated all these indices of redox status. Proper diet and lifestyle should be foremost implemented to reduce the lipoprotein metabolism and oxidant/antioxidant status alterations brought about by obesity. In addition, argan oil reduces the metabolic effects of obesity and its use might be promoted within the context of a balanced diet. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of Chinese Dietary Pattern of Fat Content, n-6/n-3 Polyunsaturated Fatty Acid Ratio, and Cholesterol Content on Lipid Profile in Rats

PubMed Central

Zou, Xian-Guo; Huang, Yu-Hua; Xu, Tong-Cheng; Fan, Ya-Wei; Li, Jing

2018-01-01

This study aims to investigate the effect of Chinese diet pattern of fat content (30% or 36.06%), n-6/n-3 polyunsaturated fatty acid (PUFA) ratio (5 : 1 or 9 : 1), and cholesterol content (0.04 or 0.057 g/kg total diet) on lipid profile using a rat model. Results showed that rats' body weights (BWs) were controlled by the simultaneous intakes of cholesterol level of 0.04 g/kg total diet and n-6/n-3 ratio of 5 : 1. In addition, under high-fat diet, increased cholesterol feeding led to increased total cholesterol (TC) and low density lipoprotein cholesterol (LDL-C) levels and decreased triacylglycerols (TG) in rats' plasma. However, high density lipoprotein cholesterol (HDL-C) level and the ratios of HDL-C/LDL-C and HDL-C/TC in rats' plasma increased in response to simultaneous intakes of low n-6/n-3 ratio (5 : 1) and cholesterol (0.04 g/kg total diet) even under high-fat diet. Moreover, as the n-6/n-3 PUFA ratio in the diet decreased, the proportion of n-3 PUFAs increased in plasma, liver, and muscle and resulted in the decrease of n-6/n-3 PUFA ratio. PMID:29744358

Associations of the APOC3 rs5128 polymorphism with plasma APOC3 and lipid levels: a meta-analysis.

PubMed

Song, Yongyan; Zhu, Liren; Richa, Mudwari; Li, Ping; Yang, Yang; Li, Suping

2015-04-18

Studies of the association between the apolipoprotein C3 gene (APOC3) rs5128 polymorphism and plasma levels of apolipoprotein C3 (APOC3) and lipids have reported apparently conflicting findings. This meta-analysis aimed to investigate the associations of the rs5128 polymorphism with fasting APOC3 and lipid levels. The following information was abstracted for each study: ethnicity, age, sex, health condition, sample size, genotyping and lipid assay methods, mean and standard deviation or standard error by genotypes for APOC3 and lipid variables. There were 42 eligible studies with 23846 subjects included in this meta-analysis. A dominant model was used for this meta-analysis. The results showed that the carriers of the variant allele G had higher levels of APOC3 [standardized mean difference (SMD): 0.22, 95% confidence interval (CI): 0.12-0.31, P<0.00001], triglycerides (TG) (SMD: 0.33, 95% CI: 0.23-0.44, P<0.00001), total cholesterol (TC) (SMD: 0.15, 95% CI: 0.09-0.22, P<0.00001), and low-density lipoprotein cholesterol (LDL-C) (SMD: 0.11, 95% CI: 0.04-0.17, P=0.001) than the non-carriers. No significant association between the APOC3 rs5128 polymorphism and lower levels of high-density lipoprotein cholesterol (HDL-C) was detected under the dominant model (SMD: -0.03, 95% CI: -0.06-0.01, P=0.156). The results from the present meta-analysis demonstrate a significant association between the APOC3 rs5128 polymorphism and higher levels of APOC3, TG, TC and LDL-C, but further studies are needed to elucidate the underlying mechanisms.

Size and oxidative susceptibility of low-density lipoprotein particles in breast cancer patients with tamoxifen-induced fatty liver.

PubMed

Wakatsuki, Akihiko; Ogawa, Yasuhiro; Saibara, Toshiji; Okatani, Yuji; Fukaya, Takao

2002-08-01

The purpose of the present study was to investigate the effects of tamoxifen on the size and oxidative susceptibility of low-density lipoprotein (LDL) particles in breast cancer patients with tamoxifen-induced fatty liver. We investigated the following breast cancer patients: 13 receiving no tamoxifen (group A), 13 receiving tamoxifen 40 mg daily but without fatty liver (group B), and 13 receiving tamoxifen 40 mg daily with fatty liver (group C). Plasma lipids and diameter of LDL particles were measured. Susceptibility of LDL to oxidation was analyzed by incubation with CuSO(4) while monitoring conjugated diene formation and assaying thiobarbituric acid reactive substances (TBARS). Plasma total and LDL cholesterol concentrations in groups B and C were significantly lower than those in group A. In group C, concentrations of plasma triglyceride (TG) and TBARS were significantly greater, but LDL particle diameter and lag time for LDL oxidation were significantly smaller than those in groups A and B. Plasma TG concentrations correlated negatively with computed tomography ratio of liver to spleen (r = -0.76; P < 0.001). LDL particle diameter correlated negatively with plasma TG (r = -0.62; P < 0.001) and TBARS (r = -0.44; P < 0.01), but positively with LDL lag time (r = 0.47; P < 0.01). Tamoxifen-induced fatty liver in breast cancer patients may be atherogenic, via increased TG and consequent small, easily oxidized LDL particles.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

PubMed

Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

2017-11-01

Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

Values of (99m)Tc-methoxyisobutylisonitrile imaging after first-time large-dose (131)I therapy in treating differentiated thyroid cancer.

PubMed

Pan, Xiaomei; Duan, Dong; Zhu, Yuquan; Pang, Hua; Guan, Lili; Lv, Zhixiang

2016-01-01

The aim of this study is to investigate the use of (99m)Tc-methoxyisobutylisonitrile (MIBI) imaging for evaluating the treatment response of differentiated thyroid cancer (DTC) after the first administration of a high dose of (131)I. Patients with DTC who received (131)I therapy underwent (99m)Tc-MIBI imaging after successive increases in the therapeutic dose of (131)I, and the serum levels of thyroglobulin (Tg) were measured. A total of 191 patients were enrolled in the final analysis, including 65 metastases and/or thyroid remnant-positive patients (22 patients with metastases and 43 patients with thyroid remnants). The sensitivity of (99m)Tc-MIBI imaging for detecting positive cases and thyroid remnants was 56.9% and 39.5%, respectively, which was significantly lower than that of (131)I imaging (92.3% and 100%, respectively, P<0.01 for both). The sensitivity of (99m)Tc-MIBI imaging for detecting metastases was 90.9%, which was slightly higher than that of (131)I imaging (77.3%, P>0.05). The Tg levels in the positive group were significantly higher than that in the negative group (P<0.01). In addition, the Tg levels in the (99m)Tc-MIBI(+)/(131)I(-) group were significantly higher than that in the (131)I(+)/(99m)Tc-MIBI group (P<0.05). After the first (131)I therapy, although (99m)Tc-MIBI imaging was able to detect the existence of metastatic lesions in patients with DTC better, its assessment for the removal efficiency of thyroid remnants was unsatisfactory. The results of (99m)Tc-MIBI imaging showed good correlations with the Tg level.

Low daily dose of 3 mg monacolin K from RYR reduces the concentration of LDL-C in a randomized, placebo-controlled intervention.

PubMed

Heinz, Tina; Schuchardt, Jan Philipp; Möller, Katharina; Hadji, Peyman; Hahn, Andreas

2016-10-01

Hypercholesterolemia and elevated homocysteine concentrations are associated with cardiovascular risk. Previous studies have demonstrated a cholesterol-lowering effect of red yeast rice (RYR) supplements which contained 5 to 10 mg of monacolin K. We hypothesized that the intake of a low monacolin K dose may likewise reduce low-density lipoprotein-cholesterol (LDL-C) and other plasma lipids. In secondary analyses, we tested the homocysteine lowering effect of folic acid, which was also included in the study preparation. Therefore, we conducted a randomized, double-blind, and placebo-controlled intervention study. One hundred forty-two nonstatin-treated participants with hypercholesterolemia (LDL-C ≥ 4.14 ≤ 5.69 mmol/L) were randomized to the supplement group with RYR or the placebo group. Participants of the supplement group consumed 3 mg monacolin K and 200 μg folic acid per day. A significant (P < .001) reduction of LDL-C (-14.8%), total cholesterol (-11.2%), and homocysteine (-12.5%) was determined in the supplement group after 12 weeks. A total of 51% of the participants treated with RYR achieved the limit of LDL-C <4.14 mmol/L advised and 26% reached the threshold level of homocysteine <10 μmol/L. No significant changes were exhibited within the placebo group. Other parameters remained unchanged and no intolerances or serious adverse events were observed. In conclusion, we demonstrated that a low dose of daily 3 mg monacolin K from RYR reduces the concentration of LDL-C; a risk factor for cardiovascular diseases. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

oxLDL induces endothelial cell proliferation via Rho/ROCK/Akt/p27kip1 signaling: opposite effects of oxLDL and cholesterol loading.

PubMed

Zhang, Chongxu; Adamos, Crystal; Oh, Myung-Jin; Baruah, Jugajyoti; Ayee, Manuela A A; Mehta, Dolly; Wary, Kishore K; Levitan, Irena

2017-09-01

Oxidized modifications of LDL (oxLDL) play a key role in the development of endothelial dysfunction and atherosclerosis. However, the underlying mechanisms of oxLDL-mediated cellular behavior are not completely understood. Here, we compared the effects of two major types of oxLDL, copper-oxidized LDL (Cu 2+ -oxLDL) and lipoxygenase-oxidized LDL (LPO-oxLDL), on proliferation of human aortic endothelial cells (HAECs). Cu 2+ -oxLDL enhanced HAECs' proliferation in a dose- and degree of oxidation-dependent manner. Similarly, LPO-oxLDL also enhanced HAEC proliferation. Mechanistically, both Cu 2+ -oxLDL and LPO-oxLDL enhance HAEC proliferation via activation of Rho, Akt phosphorylation, and a decrease in the expression of cyclin-dependent kinase inhibitor 1B (p27 kip1 ). Both Cu 2+ -oxLDL or LPO-oxLDL significantly increased Akt phosphorylation, whereas an Akt inhibitor, MK2206, blocked oxLDL-induced increase in HAEC proliferation. Blocking Rho with C3 or its downstream target ROCK with Y27632 significantly inhibited oxLDL-induced Akt phosphorylation and proliferation mediated by both Cu 2+ - and LPO-oxLDL. Activation of RhoA was blocked by Rho-GDI-1, which also abrogated oxLDL-induced Akt phosphorylation and HAEC proliferation. In contrast, blocking Rac1 in these cells had no effect on oxLDL-induced Akt phosphorylation or cell proliferation. Moreover, oxLDL-induced Rho/Akt signaling downregulated cell cycle inhibitor p27 kip1 Preloading these cells with cholesterol, however, prevented oxLDL-induced Akt phosphorylation and HAEC proliferation. These findings provide a new understanding of the effects of oxLDL on endothelial proliferation, which is essential for developing new treatments against neovascularization and progression of atherosclerosis. Copyright © 2017 the American Physiological Society.

Epidemiological Survey of Dyslipidemia in Civil Aviators in China from 2006 to 2011

PubMed Central

Zhao, Rongfu; Xiao, Dan; Fan, Xiaoying; Ge, Zesong; Wang, Linsheng; Yan, Tiecheng; Wang, Jianzhi; Wei, Qixin; Zhao, Yan

2014-01-01

Aim. This study aimed to analyze blood lipid levels, temporal trend, and age distribution of dyslipidemia in civil aviators in China. Methods. The 305 Chinese aviators were selected randomly and followed up from 2006 to 2011. Their total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) levels were evaluated annually. Mean values for each parameter by year were compared using a linear mixed-effects model. The temporal trend of borderline high, high, and low status for each index and of overall borderline high, hyperlipidemia, and dyslipidemia by year was tested using a generalized linear mixed model. Results. The aviators' TC (F = 4.33, P < 0.01), HDL-C (F = 23.25, P < 0.01), and LDL-C (F = 6.13, P < 0.01) values differed across years. The prevalence of dyslipidemia (F = 5.53, P < 0.01), borderline high (F = 6.52, P < 0.01), and hyperlipidemia (F = 3.90, P < 0.01) also differed across years. The prevalence rates for hyperlipidemia and dyslipidemia were the highest in the 41–50-year-old and 31–40-year-old groups. Conclusions. Civil aviators in China were in high dyslipidemia and borderline high level and presented with dyslipidemia younger than other Chinese populations. PMID:24693285

Separation of [(99m)Tc]pertechnetate and molybdate using polyethylene glycol coated C18 and C30 resins.

PubMed

Andersson, J D; Wilson, J S; Romaniuk, J A; McEwan, A J B; Abrams, D N; McQuarrie, S A; Gagnon, K

2016-04-01

Hydrophobic adsorbents such as C18 and C30 were coated with PEG and subsequently used for the separation of Mo/Tc. The most effective resin for adsorbing PEG was the C18-U resin, which demonstrated a coating capacity of 97.6±2.8mg PEG per g of resin. The ability to adsorb pertechnetate was proportional to the amount of PEG coated on the hydrophobic resin. The [(99m)Tc]pertechnetate recovery during the separation of cyclotron produced (99m)Tc from (100)Mo was 91.8±0.3% (n=2). The resultant product met relevant USP monograph specifications. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effects of Different Types of Statins on Lipid Profile: A Perspective on Asians.

PubMed

Meor Anuar Shuhaili, Meor Fairuz Rizal; Samsudin, Intan Nureslyna; Stanslas, Johnson; Hasan, Shariful; Thambiah, Subashini C

2017-04-01

The present review aimed at reviewing the effects of different statins on lipid profile, particularly in Asians. PubMed searches were conducted using the keywords 'statin, effect, and lipid profile' from database inception through March 2016. In this review, 718 articles were retrieved from the primary search. After reviewing the titles, abstracts, and full texts, we found that 59 studies met our inclusion criteria. These also included subsequent reference searches of retrieved articles. CURVES study compared the effect on lipid profile between atorvastatin and other statins. This study demonstrated that low-density lipoprotein cholesterol (LDL-C), total cholesterol (TC), and triglycerides (TG) were reduced more with atorvastatin compared to simvastatin, pravastatin, lovastatin, and fluvastatin. However, simvastatin provided a greater elevation of high-density lipoprotein cholesterol (HDL-C) compared to atorvastatin. The STELLAR trial was based on dose-to-dose comparisons between atorvastatin and rosuvastatin efficacy in reducing LDL-C. Te present study also revealed that as the doses of rosuvastatin, simvastatin, and pravastatin increased, HDL-C also increased, with rosuvastatin having the greatest effect. However, HDL-C levels decreased as the dose of atorvastatin increased. The DISCOVERY study involving the Asian population revealed that the percentage of patients achieving the European goals for LDL-C and TC at 12 weeks was higher in rosuvastatin group compared to atorvastatin group. The effects of statins on lipid profile are dose dependent. Most studies showed that rosuvastatin has the best effect on lipid profile. Prescribing lower doses of statins in Asians seems necessary.

Stearoyl-CoA desaturase indexes and n-6/n-3 fatty acids ratio as biomarkers of cardiometabolic risk factors in normal-weight rabbits fed high fat diets.

PubMed

Alarcón, Gabriela; Roco, Julieta; Medina, Analia; Van Nieuwenhove, Carina; Medina, Mirta; Jerez, Susana

2016-01-20

Biomarkers for cardiometabolic risk (CMR) factors would be important tools to maximize the effectiveness of dietary interventions to prevent cardiovascular diseases. Thus, the aim of this work was to analyze stearoyl-CoA desaturase (SCD) indexes and n-6/n-3 fatty acids (FA) ratio as biomarkers of CMR induced by feeding rabbits on high fat diets (HFDs). Rabbits were fed either regular diet or 18 % fat in regular diet (HFD) or 1 % cholesterol diet (HD) or diet containing 1 % cholesterol and 18 % fat (HFD-HD) during 6 weeks. Body weights (BW), blood pressure, visceral abdominal fat (VAF) and glucose tolerance test were determined. Total cholesterol (TC), low density lipoprotein-cholesterol (LDL-C), high density lipoprotein-cholesterol (HDL-C), triglycerides (TG), fasting glucose (FG), and FA levels from plasma were measured. SCD indexes were calculated as product/precursor ratios of individual FA. BW was similar in all diet groups. HD increased TC, LDL-C, HDL-C, and TG. HFD increased TG, VAF and FG, and decreased HDL-C. The addition of HFD to HD joined to dyslipidemia increased VAF and FG. SCD indexes were increased and n-6/n-3 was unchanged in HD. SCD indexes were reduced and n-6/n-3 FA ratio was increased in HFD and HFD-HD. CMR factors were correlated positively with n-6/n-3 FA ratio. Although VAF had a stronger correlation with n-6/n-3 FA ratio than with SCD indexes, VAF was associated independently to both markers. HFD simulating lipid composition of the average Western-style diet induced experimental rabbit models of normal-weight metabolic syndrome (MS). SCD indexes and n-6/n-3 were modified according to the type of dietary fat. Considering that VAF and CMR factors appear to be stronger associated to n-6/n-3 FA ratio than to SCD indexes, n-6/n-3 FA ratio may be a better biomarker of MS and CMR in normal-weight subjects than SCD indexes.

[Physical activity, dietary habits and plasma lipoproteins in young men and women].

PubMed

Malara, Marzena; Lutosławska, Grazyna

2010-01-01

There are studies suggesting that in young women strenuous physical activity and inadequate daily energy intake cause unfavorable changes in lipoprotein profile. However until know data concerning this issue are contradictory, possibly due to small number of participants. This study aimed at evaluation of lipoprotein profile in young men and women with different weekly physical activity together with their dietary habits. A total of 202 subjects volunteered to participate of the study--54 female and 56 male students of physical education and 46 female and 49 male students representing other specialization. Daily energy and macronutrient intakes were assessed using FOOD 2 computer program. Plasma TG, TC and HDL-C were assayed colorimetically using Randox commercial kits (Great Britain). It has been demonstrated that high physical activity adversely affects lipoprotein profile in young women characterized by higher TC and LDL-C in comparison with women with low physical activity and with men with high physical activity. The effect of high physical activity on plasma lipoproteins is equivocal. Active men are characterized by higher HDL, but also by higher frequency of unfavorable plasma TC and similar frequency of unfavorable plasma LDL-C C as compared with their less active counterparts. The mean daily energy intake in highly active men and women covered 82% and 72.2% recommended intake, respectively. It seems feasible that in both sexes high physical activity and inadequate energy intake brings about unfavorable changes in plasma lipoproteins.

Mediterranean-style diet reduces metabolic syndrome components in obese children and adolescents with obesity

PubMed Central

2014-01-01

Background The beneficial effects of the Mediterranean diet have been amply proven in adults with cardiovascular risk factors. The effects of this diet have not been extensively assessed in pediatric populations with obesity, insulin resistance (IR) and metabolic syndrome (MetS). The aim of this study was to assess the efficacy of the Mediterranean style diet (MSD) to decrease cardiovascular risk factors in children and adolescents with obesity. Methods Participants were randomly assigned to a MSD rich in polyunsaturated fatty acids, fiber, flavonoids and antioxidants (60% of energy from carbohydrate, 25% from fat, and 15% from protein, (n = 24); or a standard diet (55% of carbohydrate, 30% from fat and 15% from protein, (n = 25), the caloric ingest was individualized. At baseline and 16-week of intervention, the glucose, triglycerides (TG), total cholesterol (TC), HDL-C, LDL-C were measured as well as the body composition and anthropometric data. The diet compliance was determined by the 24-hour recalls. Paired Student’s t and Macnemar’s test were used to compare effects in biochemical, body composition, anthropometric, and dietary variables. Results The MSD group had a significantly decrease in BMI, lean mass, fat mass, glucose, TC, TG, HDL-C and LDL-C. (p < 0.05); the diet compliance increased consumption of omega 9 fatty acids, zinc, vitamin E, selenium, and decreased consumption of saturated fatty acids (p < 0.05). The standard diet group decrease in glucose levels and frequency of glucose >100 mg/dL (p < 0.05). Conclusion The MSD improves the BMI, glucose and lipid profile in children and adolescents with obesity and any MetS component. PMID:24997634

Mediterranean-style diet reduces metabolic syndrome components in obese children and adolescents with obesity.

PubMed

Velázquez-López, Lubia; Santiago-Díaz, Gerardo; Nava-Hernández, Julia; Muñoz-Torres, Abril V; Medina-Bravo, Patricia; Torres-Tamayo, Margarita

2014-07-05

The beneficial effects of the Mediterranean diet have been amply proven in adults with cardiovascular risk factors. The effects of this diet have not been extensively assessed in pediatric populations with obesity, insulin resistance (IR) and metabolic syndrome (MetS). The aim of this study was to assess the efficacy of the Mediterranean style diet (MSD) to decrease cardiovascular risk factors in children and adolescents with obesity. Participants were randomly assigned to a MSD rich in polyunsaturated fatty acids, fiber, flavonoids and antioxidants (60% of energy from carbohydrate, 25% from fat, and 15% from protein, (n = 24); or a standard diet (55% of carbohydrate, 30% from fat and 15% from protein, (n = 25), the caloric ingest was individualized. At baseline and 16-week of intervention, the glucose, triglycerides (TG), total cholesterol (TC), HDL-C, LDL-C were measured as well as the body composition and anthropometric data. The diet compliance was determined by the 24-hour recalls.Paired Student's t and Macnemar's test were used to compare effects in biochemical, body composition, anthropometric, and dietary variables. The MSD group had a significantly decrease in BMI, lean mass, fat mass, glucose, TC, TG, HDL-C and LDL-C. (p < 0.05); the diet compliance increased consumption of omega 9 fatty acids, zinc, vitamin E, selenium, and decreased consumption of saturated fatty acids (p < 0.05). The standard diet group decrease in glucose levels and frequency of glucose >100 mg/dL (p < 0.05). The MSD improves the BMI, glucose and lipid profile in children and adolescents with obesity and any MetS component.

A Meta-Analysis of Red Yeast Rice: An Effective and Relatively Safe Alternative Approach for Dyslipidemia

PubMed Central

Li, Yinhua; Jiang, Long; Jia, Zhangrong; Xin, Wei; Yang, Shiwei; Yang, Qiu; Wang, Luya

2014-01-01

Objective To explore whether red yeast rice is a safe and effective alternative approach for dyslipidemia. Methods Pubmed, the Cochrane Library, EBSCO host, Chinese VIP Information (VIP), China National Knowledge Infrastructure (CNKI), Wanfang Databases were searched for appropriate articles. Randomized trials of RYR (not including Xuezhikang and Zhibituo) and placebo as control in patients with dyslipidemia were considered. Two authors read all papers and independently extracted all relevant information. The primary outcomes were serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triglyceride (TG), and high-density lipoprotein cholesterol (HDL-C). The secondary outcomes were increased levels of alanine transaminase, aspartate aminotransferase, creatine kinase, creatinine and fasting blood glucose. Results A total of 13 randomized, placebo-controlled trials containing 804 participants were analyzed. Red yeast rice exhibited significant lowering effects on serum TC [WMD = −0.97 (95% CI: −1.13, −0.80) mmol/L, P<0.001], TG [WMD = −0.23 (95% CI: −0.31, −0.14) mmol/L, P<0.001], and LDL-C [WMD = −0.87 (95% CI: −1.03, −0.71) mmol/L, P<0.001] but no significant increasing effect on HDL-C [WMD = 0.08 (95% CI: −0.02, 0.19) mmol/L, P = 0.11] compared with placebo. No serious side effects were reported in all trials. Conclusions The meta-analysis suggests that red yeast rice is an effective and relatively safe approach for dyslipidemia. However, further long-term, rigorously designed randomized controlled trials are still warranted before red yeast rice could be recommended to patients with dyslipidemia, especially as an alternative to statins. PMID:24897342

Serum vaspin levels and vaspin mRNA expression in subcutaneous adipose tissue in women with gestational diabetes mellitus.

PubMed

Mm, Wei Qian; Fan, Jianxia; Khor, Shuzin; Song, Mengfan; Hong, Wei; Dai, Xiaobei

2014-11-01

To compare serum vaspin level and mRNA and protein levels of vaspin in adipose tissue in women with gestational diabetes mellitus (GDM) and normal glucose tolerance (NGR), along with the correlation between serum vaspin level with fasting insulin (FINS), homeostasis model assessment of insulin resistance (HOMA-IR) and birth-weight. Thirty-seven women with GDM and 36 with NGR were enrolled. Total cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), fasting plasma glucose (FPG), FINS and vaspin levels were measured. The mRNA and protein levels were detected using RT-PCR and Western blot. Pearson correlation analysis (PCA) was performed to reveal the correlation between serum vaspin level and FINS, HOMA-IR. Spearman correlation analysis (SCA) was conducted to examine the association between serum vaspin level and birth-weight. HDL-C level in GDM was lower than NGR group (P<0.05), and there were no statistical differences in TC, TG, LDL-C, FPG, FINS and HOMA-IR between the two groups. Serum vaspin level, mRNA and protein expression levels of vaspin in GDM were higher than NGR group (P<0.05). Serum vaspin level was not significantly correlated with FINS and HOMA-IR, but had a positive correlation with birth-weight (P=0.023). Serum vaspin level cannot serve as an independent predictor of IR. The increased serum vaspin level and increased vaspin mRNA and protein expression in adipose tissues in GDM women indicate that vaspin may be involved in the pathogenesis of GDM, but its exact mechanism needs further study. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

The LDL receptor.

PubMed

Goldstein, Joseph L; Brown, Michael S

2009-04-01

In this article, the history of the LDL receptor is recounted by its codiscoverers. Their early work on the LDL receptor explained a genetic cause of heart attacks and led to new ways of thinking about cholesterol metabolism. The LDL receptor discovery also introduced three general concepts to cell biology: receptor-mediated endocytosis, receptor recycling, and feedback regulation of receptors. The latter concept provides the mechanism by which statins selectively lower plasma LDL, reducing heart attacks and prolonging life.

Effect of Vaccinium bracteatum Thunb. leaves extract on blood glucose and plasma lipid levels in streptozotocin-induced diabetic mice.

PubMed

Wang, Li; Zhang, Xue Tong; Zhang, Hai Yan; Yao, Hui Yuan; Zhang, Hui

2010-08-09

To investigate the hypoglycemic effects of Vaccinium bracteatum Thunb. leaves (VBTL) extract in streptozotocin-induced diabetic mice. After administration of VBTL extract for 4 weeks, the body weight, organ weight, blood glucose (BG), insulin and plasma lipid levels of streptozotocin-induced diabetic mice were measured. Body weights of diabetic mice treated with VBTL extract were partly recovered. The BG levels of AEG (diabetic mice treated with VBTL aqueous extract) were reduced to 91.52 and 85.82% at week 2 and week 4, respectively (P<0.05), while those of EEG (diabetic mice treated with VBTL ethanolic extract) were reduced slightly (P>0.05). The insulin levels of AEG and EEG were obviously higher (P<0.05) than those of MC (diabetic mice in model control group). Comparing with MC, AEG and EEG had significantly lower (P<0.05) TC or TG levels and similar HDL-cholesterol or LDL-cholesterol levels. In comparison with non-diabetic control mice, AEG had similar plasma lipid levels except higher LDL-cholesterol level, while EEG had higher TC, TG and LDL-cholesterol levels and lower HDL-cholesterol levels. Both aqueous and ethanolic extract of VBTL possess a potential hypoglycemic effect in streptozotocin-induced diabetic mice. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

A new pure ω-3 eicosapentaenoic acid ethyl ester (AMR101) for the management of hypertriglyceridemia: the MARINE trial.

PubMed

Jacobson, Terry A

2012-06-01

ω-3 fatty acids reduce triglyceride (TG) levels, but corresponding increases in low-density lipoprotein cholesterol (LDL-C) levels may compromise achievement of lipid goals in patients with elevated cardiovascular risk. AMR101 is an investigational agent containing ≥96% of pure icosapent ethyl (the ethyl ester of eicosapentaenoic acid). The Phase III Multi-Center, Placebo-Controlled, Randomized, Double-Blind, 12-Week Study with an Open-Label Extension (MARINE) investigated the efficacy and safety of AMR101 in 229 patients with very high TG levels (≥500 mg/dl). AMR101 4 g/day significantly reduced median placebo-adjusted TG levels from baseline by 33.1% (p < 0.0001), and AMR101 2 g/day reduced TG levels by 19.7% (p = 0.0051). Changes in LDL-C were minimal and nonsignificant. AMR101 may offer substantial TG lowering without increases in LDL-C levels.

Optimization of bioactive compounds in buckwheat sprouts and their effect on blood cholesterol in hamsters.

PubMed

Lin, Li-Yun; Peng, Chiung-Chi; Yang, Ya-Lu; Peng, Robert Y

2008-02-27

Nutrient levels in buckwheats that were maximized in day 8 sprouts (D8SP) included total phenolics, quercetin, and l-ascorbic acid, whereas those of oxalic, malic, tartaric, and citric acids, rutin, and gamma-aminobutyric acid (GABA) were found to reach maximum levels on day 10. Ethanolic extract of D8SP (2.5 mg/mL) revealed potent free-radical scavenging (FRS) and antioxidative (ANO) capabilities. However, its Fe2+-chelating capability was only moderate. To further study the hypolipidemic activity of D8SP, 36 Syrian hamsters were grouped into six groups and fed for 28 days, respectively, with (i) control meal, (ii) high fat plus high cholesterol meal, (iii) high fat plus high cholesterol plus 2.5% of buckwheat seeds, (iv) high fat plus high cholesterol plus 25% of buckwheat seeds, (v) high fat plus high cholesterol plus 2.5% of D8SP, and (vi) high fat plus high cholesterol plus 25% of D8SP. High seed meal prominently enhanced body weight gain, whereas high sprout meal exhibited the highest feed efficiency. Ratios of liver/body weight (L/B) were significantly lowered by all BS meals. Although low seed meal reduced serum total cholesterol (TC) levels (p<0.05), its effect was still inferior to the high seed and sprout meals (p<0.01). In contrast, serum triglyceride (TG) levels were lowered only by the high seed and sprout meals (p<0.05). Alternatively, levels of serum low-density lipoprotein cholesterol (LDL-C) were significantly suppressed by all buckwheat meals (p<0.01). Serum high-density lipoprotein cholesterol (HDL-C) levels were increased, however, insignificantly. Nutraceutically more meaningful is that both LDL-C/HDL-C and TC/HDL-C ratios were significantly lowered (p<0.01). Apparently, hepatic TC levels were significantly reduced, whereas hepatic TG levels were totally unaffected. Conclusively, sprouting triggers a variety of nutritional changes in buckwheats. Day 8 sprouts, consisting of high polyphenolic and moderate quercetin contents, are nutraceutically

Effect of obstructive sleep apnea hypopnea syndrome on lipid profile: a meta-regression analysis.

PubMed

Nadeem, Rashid; Singh, Mukesh; Nida, Mahwish; Waheed, Irfan; Khan, Adnan; Ahmed, Saeed; Naseem, Jawed; Champeau, Daniel

2014-05-15

Obstructive sleep apnea (OSA) is associated with obesity, metabolic syndrome, and dyslipidemia, which may be related to decrease androgen levels found in OSA patients. Dyslipidemia may contribute to atherosclerosis leading to increasing risk of heart disease. Systematic review was conducted using PubMed and Cochrane library by utilizing different combinations of key words; sleep apnea, obstructive sleep apnea, serum lipids, dyslipidemia, cholesterol, total cholesterol, low density lipoprotein (LDL), high density lipoprotein (HDL), and triglyceride (TG). Inclusion criteria were: English articles, and studies with adult population in 2 groups of patients (patients with OSA and without OSA). A total 96 studies were reviewed for inclusion, with 25 studies pooled for analysis. Sixty-four studies were pooled for analysis; since some studies have more than one dataset, there were 107 datasets with 18,116 patients pooled for meta-analysis. All studies measured serum lipids. Total cholesterol pooled standardized difference in means was 0.267 (p = 0.001). LDL cholesterol pooled standardized difference in means was 0.296 (p = 0.001). HDL cholesterol pooled standardized difference in means was -0.433 (p = 0.001). Triglyceride pooled standardized difference in means was 0.603 (p = 0.001). Meta-regression for age, BMI, and AHI showed that age has significant effect for TC, LDL, and HDL. BMI had significant effect for LDL and HDL, while AHI had significant effect for LDL and TG. Patients with OSA appear to have increased dyslipidemia (high total cholesterol, LDL, TG, and low HDL).

Reduction of VLDL secretion decreases cholesterol excretion in niemann-pick C1-like 1 hepatic transgenic mice.

PubMed

Marshall, Stephanie M; Kelley, Kathryn L; Davis, Matthew A; Wilson, Martha D; McDaniel, Allison L; Lee, Richard G; Crooke, Rosanne M; Graham, Mark J; Rudel, Lawrence L; Brown, J Mark; Temel, Ryan E

2014-01-01

An effective way to reduce LDL cholesterol, the primary risk factor of atherosclerotic cardiovascular disease, is to increase cholesterol excretion from the body. Our group and others have recently found that cholesterol excretion can be facilitated by both hepatobiliary and transintestinal pathways. However, the lipoprotein that moves cholesterol through the plasma to the small intestine for transintestinal cholesterol efflux (TICE) is unknown. To test the hypothesis that hepatic very low-density lipoproteins (VLDL) support TICE, antisense oligonucleotides (ASO) were used to knockdown hepatic expression of microsomal triglyceride transfer protein (MTP), which is necessary for VLDL assembly. While maintained on a high cholesterol diet, Niemann-Pick C1-like 1 hepatic transgenic (L1Tg) mice, which predominantly excrete cholesterol via TICE, and wild type (WT) littermates were treated with control ASO or MTP ASO. In both WT and L1Tg mice, MTP ASO decreased VLDL triglyceride (TG) and cholesterol secretion. Regardless of treatment, L1Tg mice had reduced biliary cholesterol compared to WT mice. However, only L1Tg mice treated with MTP ASO had reduced fecal cholesterol excretion. Based upon these findings, we conclude that VLDL or a byproduct such as LDL can move cholesterol from the liver to the small intestine for TICE.

Rosiglitazone increases LDL particle size and buoyancy and decreases C-reactive protein in patients with type 2 diabetes on statin therapy.

PubMed

Yu, Dahong; Murdoch, Susan J; Parikh, Shamik J; Marcovina, Santica M; Cobitz, Alexander; Chen, Hongzi; Brunzell, John D

2006-12-01

A substantial number of individuals with type 2 diabetes mellitus (T2DM) demonstrate a predominance of small dense low-density lipoprotein (sdLDL), which is associated with an increased risk of cardiovascular disease (CVD). In some cases, sdLDL persists after treatment with a statin to reduce levels of LDL. The effect of the addition of a thiazolidinedione, rosiglitazone (RSG) (4 mg/day or 8 mg/day) to statin therapy on LDL phenotype and C reactive protein (CRP) levels was investigated in a 12- week, placebo-controlled study of 72 T2DM patients who were well controlled and on a statin, but who had persistently predominant sdLDL. Addition of RSG 8 mg to statin therapy significantly increased LDL buoyancy (relative flotation +0.014, p = 0.003) and LDL particle size (+4.2A, p = 0.001) from baseline and relative to the change with placebo (+0.014 and +3.8A; p = 0.03 and p = 0.04, respectively), and was associated with a non-significant decrease in sdLDL. RSG 8 mg moderately, but significantly, increased total cholesterol (by 12.2%, p = 0.004), LDL-cholesterol (11.2%, p = 0.02) and intermediate-density lipoprotein (IDL)-cholesterol from baseline but did not increase total or LDL apolipoprotein B. RSG 4 mg and 8 mg significantly reduced CRP compared with placebo (-44.9% and -48.0%; p = 0.008 and p = 0.004, respectively), and significantly reduced insulin resistance and fasting plasma glucose from baseline. Addition of RSG to statin therapy may further reduce cardiovascular risk by improving the LDL phenotype, as well as reducing insulin resistance and CRP levels. However, the increase in IDL may be proatherogenic and must be considered when assessing the benefits of rosiglitazone.

Protective effect of exercise and alpha tocopherol on atherosclerosis promotion in hypercholesterolemic domestic rabbits

NASA Astrophysics Data System (ADS)

Shekh, Mudhir S.; Mahmud, Almas M. R.

2017-09-01

This study was designed to determine effects of exercise training (Moderate and severe) and alpha tocopherol on lipid profiles and organ weights in hypercholesterolemic domestic rabbits. Hypercholesterolemia (HC) and atherosclerotic lesions were induced by feeding the male rabbits the standard chow supplemented with 1% cholesterol (atherogenic diet) for 36 days. Experimental rabbits were divided into seven groups: normal (T1), HC control (T2), HC plus alpha tocopherol (0.5mg /animal/day) (T3), HC plus moderate exercise 40 minutes/day (0.5km/day) 5 days/week (T4), HC plus severe exercise 40 minutes/day (1km/day) 5 days/week (T5), HC plus alpha tocopherol plus moderate exercise (T6) and HC plus alpha tocopherol plus severe exercise (T7). After the treatment period of 36th day, blood samples were collected and total cholesterol (TC), Triglyceride (TG), Very low-density lipoprotein (VLDL)-cholesterol, High-density lipoproteins (HDL)-cholesterol, Low-density lipoprotein (LDL)-cholesterol, serum glucose, body and organ weights were assayed and compared with hypercholesterolemic control. Combination of moderate exercise with alpha tocopherol produced significant reduction (P<0.01) in TG and high significant decrement (P<0.001), in VLDL-cholesterol, TC and LDL-cholesterol compared with hypercholesterolemic rabbits. Serum TC, LDL and VLDL (P<0.001) and TG (P<0.01) significantly increased when compared with normal rabbits diet, while, HDL decreased (P<0.05) significantly. Severe exercise group showed no significant change in all lipid profiles. However, the decrement in the above parameters was comparable with hypercholesterolemic rabbits in combination of severe exercise with alpha tocopherol. The results suggest that the combination of moderate exercise with alpha tocopherol can be exploited for prevention of atherosclerosis in hypercholesterolemic rabbits.

Variable (Tg, Ts) Measurements of Alkane Dissociative Sticking Coefficients

NASA Astrophysics Data System (ADS)

Valadez, Leticia; Dewitt, Kristy; Abbott, Heather; Kolasinski, Kurt; Harrision, Ian

2006-03-01

Dissociative sticking coefficients S(Tg, Ts) for CH4 and C2H6 on Pt(111) have been measured as a function of gas temperature (Tg) and surface temperature (Ts) using an effusive molecular beam. Microcanonical unimolecular rate theory (MURT) was employed to extract transition state characteristics [e.g., E0(CH4) = 52.5±3.5 kJ/mol-1 and E0(C2H6) = 26.5±3 kJ/mol-1]. MURT allows our S(Tg, Ts) values to be directly compared to other supersonic molecular beam and thermal equilibrium sticking measurements. The S(Tg, Ts) depend strongly on Ts, however, only for CH4 is a strong Tg dependence observed. The fairly weak Tg dependence for C2H6 suggests that vibrational mode specific behavior and/or molecular rotations play stronger roles in the dissociative chemisorption of C2H6 than they do for CH4. Interestingly, thermal S(Tg=Ts) predictions based on MURT modeling of our CH4/Pt(111) data are three orders of magnitude higher than recent thermal equilibrium measurements on supported Pt nanocrystallite catalysts [J. M. Wei, E. Iglesia, J. Phys. Chem. B 108, 4094 (2004)].

Lack of a direct role for macrosialin in oxidized LDL metabolism.

PubMed

de Beer, Maria C; Zhao, Zhenze; Webb, Nancy R; van der Westhuyzen, Deneys R; de Villiers, Willem J S

2003-04-01

Murine macrosialin (MS), a scavenger receptor family member, is a heavily glycosylated transmembrane protein expressed predominantly in macrophage late endosomes. MS is also found on the cell surface where it is suggested, on the basis of ligand blotting, to bind oxidized LDL (oxLDL). Here we report on the regulation of MS by an atherogenic high-fat diet and oxLDL, and on the inability of MS in transfected cells to bind oxLDL. MS expression was markedly increased in the livers of atherosclerosis-susceptible C57BL/6 and atherosclerosis-resistant C3H/HeJ mice fed an atherogenic high-fat diet. In resident-mouse peritoneal macrophages, treatment with oxLDL upregulated MS mRNA and protein expression 1.5- to 3-fold. MS, overexpressed in COS-7 cells through adenovirus mediated gene transfer, bound oxLDL by ligand blotting. However, no binding of oxLDL to MS was observed in intact transfected COS-7 and Chinese hamster ovary cells, despite significant cell surface expression of MS. Furthermore, inhibition of MS through gene silencing did not affect the binding of oxLDL to macrophages. We conclude that although MS expression in macrophages and Kupffer cells is responsive to a proatherogenic inflammatory diet and to oxLDL, MS does not function as an oxLDL receptor on the cell surface.

Talinum triangulare Whole wheat meal fortified with soy flour consumed with Talinum triangulare (gbure) soup glycemic index and the test human subjects' lipid profiles.

PubMed

Emaleku, Sunday Adeola; Omueti, Olusola D; Emaleku, Godsent Oluwakemi

2017-08-24

Cardiovascular diseases (CVDs) and diabetes mellitus (DM) are some of the leading causes of death in the world, and diet has roles in their etiology. This research study therefore investigates the glycemic index (GI) of soy flour fortified whole wheat meal (SFFWWM) consumed with Talinum triangulare (gbure) soup and the effects of the meal on the lipid profiles of the test human subjects. The control human subjects and test human subjects were fed D-glucose (DG) and whole wheat meal (WWM) with Talinum triangulare soup respectively on the first day of the experiment, and SFFWWM with the same soup the next day (for test subjects only) after 10-12h overnight fasting. Blood glucose levels of the subjects were taken before and 2h after meals' consumption at 30min interval and blood samples collected for lipid profiles evaluations. The result of the study showed that; SFFWWM consumed with Talinum trianguilare soup has a non-significant lower GI than WWM consumed with the same soup, but a significant lower GI than DG at (P<0.05). Furthermore, there was no significant difference in lipid profiles of the test human subjects between when they consumed WWM and SFFWWM with the soup however, SFFWWM reduced TC, TG, LDL-C and VDL-C and increased HDL-C and TP than WMM at (P<0.05). In addition, GI is positively correlated with TC, TG, LDL-C and VLDL-C, but is negatively correlated with TP and HDL-C. It can therefore be concluded that; fortifying WWM with soy flour would reduce the risk factors of CVDs and DM, the diseases recently claiming thousands of today. Copyright © 2017 Diabetes India. Published by Elsevier Ltd. All rights reserved.

Dyslipidemia and Food Security in Low-Income US Adolescents: National Health and Nutrition Examination Survey, 2003-2010.

PubMed

Tester, June M; Laraia, Barbara A; Leung, Cindy W; Mietus-Snyder, Michele L

2016-02-11

Low levels of food security are associated with dyslipidemia and chronic disease in adults, particularly in women. There is a gap in knowledge about the relationship between food security among youth and dyslipidemia and chronic disease. We investigated the relationship between food security status and dyslipidemia among low-income adolescents. We analyzed data from adolescents aged 12 to 18 years (N = 1,072) from households with incomes at or below 200% of the federal poverty level from the National Health and Nutrition Examination Survey (NHANES) 2003-2010. We used logistic regression to examine the relationship between household food security status and the odds of having abnormalities with fasting total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), serum triglycerides (TGs), high-density lipoprotein cholesterol (HDL-C), TG/HDL-C ratio, and apolipoprotein B (Apo B). Models included age, sex, race/ethnicity, smoking status, partnered status in the household, and maternal education, with additional adjustment for adiposity. Household food security status was not associated with elevated TC or LDL-C. Adolescents with marginal food security were more likely than food-secure peers to have elevated TGs (odds ratio [OR] = 1.86; 95% confidence interval [CI], 1.14-3.05), TG/HDL-C ratio (OR = 1.74; 95% CI, 1.11-2.82), and Apo B (OR = 1.98; 95% CI, 1.17-3.36). Female adolescents with marginal food security had greater odds than male adolescents of having low HDL-C (OR = 2.69; 95% CI, 1.14-6.37). No elevated odds of dyslipidemia were found for adolescents with low or very low food security. Adjustment for adiposity did not attenuate estimates. In this nationally representative sample, low-income adolescents living in households with marginal food security had increased odds of having a pattern consistent with atherogenic dyslipidemia, which represents a cardiometabolic burden above their risk from adiposity alone.

Evidence of major genes for plasma HDL, LDL cholesterol and triglyceride levels at baseline and in response to 20 weeks of endurance training: the HERITAGE Family Study.

PubMed

An, P; Borecki, I B; Rankinen, T; Després, J-P; Leon, A S; Skinner, J S; Wilmore, J H; Bouchard, C; Rao, D C

2005-01-01

This study assessed major gene effects for baseline HDL-C, LDL-C, TG, and their training responses (post-training minus baseline) in 527 individuals from 99 White families and 326 individuals from 113 Black families in the HERITAGE Family Study. The baseline phenotypes were adjusted for the effects of age and BMI, and the training response phenotypes were adjusted for the effects of age, BMI, and their respective baseline values, within each of the sex-by-generation-by-race groups, prior to genetic analyses. In Whites, we found that LDL-C at baseline and HDL-C training response were under influence of major recessive genes (accounting for 2--30 % of the variance) and multifactorial (polygenic and familial environmental) effects. Interactions of these major genes with sex, age, and BMI were tested, and found to be nonsignificant. In Blacks, we found that baseline HDL-C was influenced by a major dominant gene without a multifactorial component. This major gene effect accounted for 45 % of the variance, and exhibited no significant genotype-specific interactions with age, sex, and BMI. Evidence of major genes for the remaining phenotypes at baseline and in response to endurance training were not found in both races, though some were influenced by major effects that did not follow Mendelian expectations or were with ambiguous transmission from parents to offspring. In summary, major gene effects that influence baseline plasma HDL-C and LDL-C levels as well as changes in HDL-C levels in response to regular exercise were detected in the current study.

Effects of Simulated Heat Waves with Strong Sudden Cooling Weather on ApoE Knockout Mice

PubMed Central

Zhang, Shuyu; Kuang, Zhengzhong; Zhang, Xiakun

2015-01-01

This study analyzes the mechanism of influence of heat waves with strong sudden cooling on cardiovascular diseases (CVD) in ApoE−/− mice. The process of heat waves with strong sudden cooling was simulated with a TEM1880 meteorological-environment simulation chamber according to the data obtained at 5 a.m. of 19 June 2006 to 11 p.m. of 22 June 2006. Forty-eight ApoE−/− mice were divided into six blocks based on their weight. Two mice from each block were randomly assigned to control, heat wave, temperature drop, and rewarming temperature groups. The experimental groups were transferred into the climate simulator chamber for exposure to the simulated heat wave process with strong sudden temperature drop. After 55, 59, and 75 h of exposure, the experimental groups were successively removed from the chamber to monitor physiological indicators. Blood samples were collected by decollation, and the hearts were harvested in all groups. The levels of heat stress factors (HSP60, SOD, TNF, sICAM-1, HIF-1α), cold stress factors (NE, EPI), vasoconstrictor factors (ANGII, ET-1, NO), and four items of blood lipid (TC, TG, HDL-C, and LDL-C) were measured in each ApoE−/− mouse. Results showed that the heat waves increased the levels of heat stress factors except SOD decreased, and decreased the levels of vasoconstrictor factors and blood lipid factors except TC increased. The strong sudden temperature drop in the heat wave process increased the levels of cold stress factors, vasoconstrictor factors and four blood lipid items (except the level of HDL-C which decreased) and decreased the levels of heat stress factors (except the level of SOD which increased). The analysis showed that heat waves could enhance atherosclerosis of ApoE−/− mice. The strong sudden temperature drop during the heat wave process increased the plasma concentrations of NE and ANGII, which indicates SNS activation, and resulted in increased blood pressure. NE and ANGII are vasoconstrictors

Effects of Simulated Heat Waves with Strong Sudden Cooling Weather on ApoE Knockout Mice.

PubMed

Zhang, Shuyu; Kuang, Zhengzhong; Zhang, Xiakun

2015-05-26

This study analyzes the mechanism of influence of heat waves with strong sudden cooling on cardiovascular diseases (CVD) in ApoE-/- mice. The process of heat waves with strong sudden cooling was simulated with a TEM1880 meteorological-environment simulation chamber according to the data obtained at 5 a.m. of 19 June 2006 to 11 p.m. of 22 June 2006. Forty-eight ApoE-/- mice were divided into six blocks based on their weight. Two mice from each block were randomly assigned to control, heat wave, temperature drop, and rewarming temperature groups. The experimental groups were transferred into the climate simulator chamber for exposure to the simulated heat wave process with strong sudden temperature drop. After 55, 59, and 75 h of exposure, the experimental groups were successively removed from the chamber to monitor physiological indicators. Blood samples were collected by decollation, and the hearts were harvested in all groups. The levels of heat stress factors (HSP60, SOD, TNF, sICAM-1, HIF-1α), cold stress factors (NE, EPI), vasoconstrictor factors (ANGII, ET-1, NO), and four items of blood lipid (TC, TG, HDL-C, and LDL-C) were measured in each ApoE-/- mouse. Results showed that the heat waves increased the levels of heat stress factors except SOD decreased, and decreased the levels of vasoconstrictor factors and blood lipid factors except TC increased. The strong sudden temperature drop in the heat wave process increased the levels of cold stress factors, vasoconstrictor factors and four blood lipid items (except the level of HDL-C which decreased) and decreased the levels of heat stress factors (except the level of SOD which increased). The analysis showed that heat waves could enhance atherosclerosis of ApoE-/- mice. The strong sudden temperature drop during the heat wave process increased the plasma concentrations of NE and ANGII, which indicates SNS activation, and resulted in increased blood pressure. NE and ANGII are vasoconstrictors involved in systemic

Vitamin C-lipid metabolites: uptake and retention and effect on plasma C-reactive protein and oxidized LDL levels in healthy volunteers.

PubMed

Pancorbo, Dario; Vazquez, Carlos; Fletcher, Mary Ann

2008-11-01

Previously, a novel formulation of vitamin C-lipid metabolites (PureWay-C) was shown to be more rapidly taken-up by human T-lymphocytes and more rapidly stimulate neurite outgrowth, fibroblast adhesion and inhibition of xenobiotic-induced T-cell hyperactivation. Here, PureWay-C serum levels were measured in healthy volunteers after oral supplementation. Plasma C-reactive protein and oxidized low density lipoprotein levels (LDL) were also measured. Healthy volunteers maintained a low vitamin C diet for 14 days and, following an overnight fast, received a single oral dose of (vitamin C) 1000 mg of either ascorbic acid (AA), calcium ascorbate (CaA), vitamin C-lipid metabolites (PureWay-C), or calcium ascorbate-calcium threonate-dehydroascorbate (Ester-C). Blood samples were collected immediately prior to the oral dose administration and at various times post ingestion. Twenty-four-hour urine collections were saved for oxalate and uric acid assays. PureWay-C supplementation leads to the highest absolute serum vitamin C levels when compared to AA, CaA and Ester-C. PureWay-C provides a statistically significant greater serum level than calcium ascorbate at 1, 2, 4, and 6 hours post oral supplementation whereas Ester-C shows a less but slightly statistically significant increase at only 1 and 4 hours. Oral supplementation with PureWay-C also led to a greater reduction in plasma C-reactive protein and oxidized LDL levels compared to the other vitamin C formulations. PureWay-C is more rapidly absorbed and leads to higher serum vitamin C levels and greater reduction of plasma levels of inflammatory and oxidative stress markers than other forms of vitamin C, including Ester-C.

Impact of the Use of Different Diagnostic Criteria in the Prevalence of Dyslipidemia in Pregnant Women.

PubMed

Feitosa, Alina Coutinho Rodrigues; Barreto, Luciana Tedgue; Silva, Isabela Matos da; Silva, Felipe Freire da; Feitosa, Gilson Soares

2017-07-01

There is a physiologic elevation of total cholesterol (TC) and triglycerides (TG) during pregnancy. Some authors define dyslipidemia (DLP) in pregnant women when TC, LDL and TG concentrations are above the 95th percentile (p95%) and HDL concentration is below the 5th percentile (P5%) for gestational age (GA). To compare the prevalence of DLP in pregnant women using percentiles criteria with the V Brazilian Guidelines on Dyslipidemia and the association with maternal and fetal outcomes. Pregnant women with high-risk conditions, aged 18-50 years, and at least one lipid profile during pregnancy was classified as the presence of DLP by two diagnostic criteria. Clinical and laboratorial data of mothers and newborns were evaluated. 433 pregnant women aged 32.9 ± 6.5 years were studied. Most (54.6%) had lipid profile collected during third trimester. The prevalence of any lipid abnormalities according to the criteria of the National Guidelines was 83.8%: TC ≥ 200 mg/dL was found in 49.9%; LDL ≥ 160 mg/dL, in 14.3%, HDL ≤ 50 mg/dL in 44.4% and TG ≥ 150 mg/dL in 65.3%. Any changes of lipid according to percentiles criteria was found in 19.6%: elevation above the P95% for TC was found in 0.7%; for LDL, 1.7%; for TG 6.4% and HDL lower than the P5% in 13%. The frequency of comorbidity: hypertension, diabetes, smoking, obesity and preeclampsia was similar among pregnant women when DLP was compared by both criteria. The prevalence of DLP during pregnancy varies significantly depending on the criteria used, however none demonstrated superiority in association with comorbidities. Durante a gestação ocorrem, fisiologicamente, elevações do colesterol total (CT) e triglicerídios (TG). Alguns autores definem dislipidemia (DLP) gestacional quando as concentrações de CT, LDL e TG são superiores ao percentil 95 (P95%) e de HDL, inferiores ao percentil 5 (P5%) para a idade gestacional. Comparar a prevalência da DLP em gestantes conforme critério por percentis com o da V

78 FR 7395 - Foreign-Trade Zone 129-Bellingham, WA; Notification of Proposed Production Activity; T.C. Trading...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-01

... DEPARTMENT OF COMMERCE Foreign-Trade Zones Board [B-8-2013] Foreign-Trade Zone 129--Bellingham, WA; Notification of Proposed Production Activity; T.C. Trading Company, Inc. (Eyeglass Assembly and Kitting... activity on behalf of T.C. Trading Company, Inc. (T.C. Trading), located in Blaine, Washington. The...

Variations of Human DNA Polymerase Genes as Biomarkers of Prostate Cancer Progression

DTIC Science & Technology

2011-07-01

Forward sequence Reverse sequence Sequence contextb 1 g.39835C4Tc P169S 15 25 gTG GGG TC CTT g.39897C4T Intronic 22 15 AGA T GGt TA AAT g.39985T4C...Intronic 34 25 AGA TT tAA AAG g.40051C4Tc P184S 19 34 TGt CT GGA ATT 4 g.39835C4Tc P169S 19 29 gTG GGG TC CTT g.40051C4Tc P184S 23 34 TGt CT GGA ATT 6 g...39835C4Tc P169S 14 24 gTG GGG TC CTT g.40051C4Tc P184S 21 32 TGt CT GGA ATT 11 g.40055A4G D185G 28 35 TTC C AGA C AAG g.40073A4G Y191C 28 20 gGA T AtG CC

Serum phospholipid omega-3 polyunsaturated fatty acids and insulin resistance in type 2 diabetes mellitus and non-alcoholic fatty liver disease.

PubMed

Lou, Da-Jun; Zhu, Qi-Qian; Si, Xu-Wei; Guan, Li-Li; You, Qiao-Ying; Yu, Zhong-Ming; Zhang, Ai-Zhen

2014-01-01

To investigate the relationship between serum phospholipid omega-3 polyunsaturated fatty acids (ω-3 PUFAs) and insulin resistance (IR) in patients with type 2 diabetes mellitus (T2DM) and non-alcoholic fatty liver disease (NAFLD). 51 patients with T2DM and NAFLD (T2DM+NAFLD group), 50 with T2DM alone (T2DM group), 45 with NAFLD alone (NAFLD group), and 42 healthy control subjects (NC group) were studied. Serum ω-3 PUFA profiles were analyzed by gas chromatography, and alanine aminotransferase (ALT), aspartate aminotransferase (AST), γ-glutamyltransferase (GGT), and serum lipid concentrations were measured. Insulin resistance was assessed by the homeostasis model assessment method (HOMA-IR). HOMA-IR levels were higher in the T2DM+NAFLD group than in the T2DM, NAFLD and NC groups (p<0.05), as were ALT, AST, GGT, total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and triglyceride (TG) concentrations (p<0.05). Conversely, serum ω-3 PUFA levels were significantly lower in the T2DM+NAFLD group than in the other groups (p<0.05). The ω-3 PUFA level was negatively correlated with HOMA-IR, TC, LDL-C and TG. Serum phospholipid ω-3 PUFA levels were significantly decreased in patients with T2DM and NAFLD, and were negatively related with insulin resistance. Thus, reduced ω-3 PUFAs may play an important role in the development of T2DM and NAFLD. Copyright © 2014 Elsevier Inc. All rights reserved.

Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

DOE PAGES

Um, Wooyong; Luksic, Steven A.; Wang, Guohui; ...

2017-09-07

We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Um, Wooyong; Luksic, Steven A.; Wang, Guohui

We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

Imputation of Baseline LDL Cholesterol Concentration in Patients with Familial Hypercholesterolemia on Statins or Ezetimibe.

PubMed

Ruel, Isabelle; Aljenedil, Sumayah; Sadri, Iman; de Varennes, Émilie; Hegele, Robert A; Couture, Patrick; Bergeron, Jean; Wanneh, Eric; Baass, Alexis; Dufour, Robert; Gaudet, Daniel; Brisson, Diane; Brunham, Liam R; Francis, Gordon A; Cermakova, Lubomira; Brophy, James M; Ryomoto, Arnold; Mancini, G B John; Genest, Jacques

2018-02-01

Familial hypercholesterolemia (FH) is the most frequent genetic disorder seen clinically and is characterized by increased LDL cholesterol (LDL-C) (>95th percentile), family history of increased LDL-C, premature atherosclerotic cardiovascular disease (ASCVD) in the patient or in first-degree relatives, presence of tendinous xanthomas or premature corneal arcus, or presence of a pathogenic mutation in the LDLR , PCSK9 , or APOB genes. A diagnosis of FH has important clinical implications with respect to lifelong risk of ASCVD and requirement for intensive pharmacological therapy. The concentration of baseline LDL-C (untreated) is essential for the diagnosis of FH but is often not available because the individual is already on statin therapy. To validate a new algorithm to impute baseline LDL-C, we examined 1297 patients. The baseline LDL-C was compared with the imputed baseline obtained within 18 months of the initiation of therapy. We compared the percent reduction in LDL-C on treatment from baseline with the published percent reductions. After eliminating individuals with missing data, nonstandard doses of statins, or medications other than statins or ezetimibe, we provide data on 951 patients. The mean ± SE baseline LDL-C was 243.0 (2.2) mg/dL [6.28 (0.06) mmol/L], and the mean ± SE imputed baseline LDL-C was 244.2 (2.6) mg/dL [6.31 (0.07) mmol/L] ( P = 0.48). There was no difference in response according to the patient's sex or in percent reduction between observed and expected for individual doses or types of statin or ezetimibe. We provide a validated estimation of baseline LDL-C for patients with FH that may help clinicians in making a diagnosis. © 2017 American Association for Clinical Chemistry.

A novel mutation in the TG gene (G2322S) causing congenital hypothyroidism in a Sudanese family: a case report.

PubMed

Watanabe, Y; Sharwood, E; Goodwin, B; Creech, M K; Hassan, H Y; Netea, M G; Jaeger, M; Dumitrescu, A; Refetoff, S; Huynh, T; Weiss, R E

2018-05-02

Congenital hypothyroidism (CH) has an incidence of approximately 1:3000, but only 15% have mutations in the thyroid hormone synthesis pathways. Genetic analysis allows for the precise diagnosis. A 3-week old girl presented with a large goiter, serum TSH > 100 mIU/L (reference range: 0.7-5.9 mIU/L); free T 4  < 3.2 pmol/L (reference range: 8.7-16 pmol/L); thyroglobulin (TG) 101 μg/L. Thyroid Tc-99 m scan showed increased radiotracer uptake. One brother had CH and both affected siblings have been clinically and biochemically euthyroid on levothyroxine replacement. Another sibling had normal thyroid function. Both Sudanese parents reported non-consanguinity. Peripheral blood DNA from the proposita was subjected to whole exome sequencing (WES). WES identified a novel homozygous missense mutation of the TG gene: c.7021G > A, p.Gly2322Ser, which was subsequently confirmed by Sanger sequencing and present in one allele of both parents. DNA samples from 354 alleles in four Sudanese ethnic groups (Nilotes, Darfurians, Nuba, and Halfawien) failed to demonstrate the presence of the mutant allele. Haplotyping showed a 1.71 centiMorgans stretch of homozygosity in the TG locus suggesting that this mutation occurred identical by descent and the possibility of common ancestry of the parents. The mutation is located in the cholinesterase-like (ChEL) domain of TG. A novel rare missense mutation in the TG gene was identified. The ChEL domain is critical for protein folding and patients with CH due to misfolded TG may present without low serum TG despite the TG gene mutations.

Relationships between alcohol intake and atherogenic indices in women.

PubMed

Wakabayashi, Ichiro

2013-01-01

Light-to-moderate alcohol consumption is known to reduce the risk of coronary artery disease. The purpose of this study was to investigate relationships of alcohol intake with atherogenic indices, such as the ratio of low-density lipoprotein cholesterol to high-density lipoprotein cholesterol (LDL-C/HDL-C ratio) and the ratio of triglycerides to high-density lipoprotein cholesterol (TG/HDL-C ratio), in women. Subjects (14,067 women, 20-45 years) were divided by alcohol intake into three groups of nondrinkers, occasional drinkers, and regular drinkers, and each drinker group was further divided into lower- (<22 g ethanol/drinking day) and greater- (≥ 22 g ethanol/drinking day) quantity drinkers. Atherogenic indices were compared among the alcohol groups. Odds ratio (OR) for high LDL-C/HDL-C ratio or high TG/HDL-C ratio calculated after adjustment for age, body mass index, smoking, and habitual exercise was significantly lower (P < .05) than a reference level of 1.00 in regular or occasional lower- and higher quantity drinkers vs. nondrinkers (OR for high LDL-C/HDL-C ratio, 0.28 (95% confidence interval [95% CI], 0.18-0.44) in regular lower-quantity drinkers, 0.18 (95% CI, 0.12-0.28) in regular higher quantity drinkers, 0.71 (95% CI, 0.61-0.83) in occasional lower-quantity drinkers, and 0.53 (95% CI, 0.44-0.64) in occasional higher quantity drinkers; OR for high TG/HDL-C ratio, 0.52 (95% CI, 0.32-0.85) in regular lower-quantity drinkers, 0.67 (95% CI, 0.47-0.96) in regular higher-quantity drinkers, 0.61 (95% CI, 0.50-0.76) in occasional lower-quantity drinkers, and 0.63 (95% CI, 0.50-0.79) in occasional higher-quantity drinkers. Both LDL-C/HDL-C ratio and log-transformed TG/HDL-C ratio were significantly greater in smokers than in nonsmokers. Both in smokers and nonsmokers, LDL-C/HDL-C ratio and log-transformed TG/HDL-C ratio were significantly lower in regular lower- and higher-quantity drinkers than in nondrinkers. In nonsmokers, LDL-C/HDL-C ratio and log

Effects of direct-to-consumer advertising of hydroxymethylglutaryl coenzyme a reductase inhibitors on attainment of LDL-C goals.

PubMed

Bradford, W David; Kleit, Andrew N; Nietert, Paul J; Ornstein, Steven

2006-12-01

Although highly controversial, directto-consumer (DTC) television advertising for prescription drugs is an established practice in the US health care industry. While the US Food and Drug Administration is currently reexamining its regulatory stance, little evidence exists regarding the impact of DTC advertising on patient health outcomes. The objective of this research was to study the relationship between heavy television promotion of 3 major hydroxymethylglutaryl coenzyme A reductase inhibitors ("statins") and the frequency with which patients are able to attain low-density lipoprotein cholesterol (LDL-C) blood-level goals after treatment with any statin. We used logistic regression to determine achievement of LDL-C goals at 6 months after statin treatment, using electronic medical record extract data from patients from geographically dispersed primary care practices in the United States. We identified LDL-C blood levels as being at or less than goal, as defined by risk-adjusted guidelines published by the National Heart, Lung, and Blood Institute from the Adult Treatment Panel III (ATP III) data. A total of 50,741 patients, identified from 88 practices, were diagnosed with hyperlipidemia and had begun therapy with any statin medication during the 1998-2004 time period. In addition, total dollars spent each month on television advertising at the national and local levels for atorvastatin, pravastatin, and simvastatin were obtained. DTC advertising data were merged by local media market where the physician practice was located and by the month in which the patient was first prescribed a statin. The models were run for all patients who initiated therapy, and also on a subsample of patients who continued to receive prescriptions for the drugs for at least 6 months. Logistic regressions were used to predict the likelihood that each patient attained the ATP III LDL-C blood-level goals as a function of DTC advertising and other factors. High levels of national DTC

Effects of intensive atorvastatin and rosuvastatin treatment on apolipoprotein B-48 and remnant lipoprotein cholesterol levels

USDA-ARS?s Scientific Manuscript database

Atorvastatin and rosuvastatin at maximal doses are both highly effective in lowering low-density lipoprotein cholesterol (LDL-C) and triglyceride (TG) levels. Rosuvastatin has been shown to be more effective than atorvastatin in lowering LDL-C, small dense LDL-C and in raising high-density lipoprote...

Novel lipid modifying drugs to lower LDL cholesterol.

PubMed

Cupido, Arjen J; Reeskamp, Laurens F; Kastelein, John J P

2017-08-01

Statins have long been the cornerstone for the prevention of cardiovascular disease (CVD). However, because of perceived adverse effects and insufficient efficacy in certain groups of patients, considerable interest exists in the search for alternatives to lower LDL-cholesterol (LDL-C), and the recent approvals of proprotein convertase subtilisin/kexin type 9 (PCSK9) inhibitors underlines the success of this quest. Here, we give an updated overview on the most recent developments in the area of LDL-C lowering agents. The clinical effects of the PCSK9 inhibitors are promising, especially now that the FOURIER and SPIRE programmes are published. Most cholesterylester-transfer protein inhibitors, however, except anacetrapib, have been discontinued because of either toxicity or lack of efficacy in large cardiovascular outcome trials. Other agents - like mipomersen, lomitapide, ETC-1002, and gemcabene - aim to lower LDL-C in different ways than solely through the LDL receptor, opening up possibilities for treating patients not responding to conventional therapies. New discoveries are also being made at the DNA and RNA level, with mipomersen being the first approved therapy based on RNA intervention in the United States for homozygous familial hypercholesterolemia. Recent years have witnessed a new beginning for cholesterol-lowering compounds. With increased knowledge of lipid metabolism a score of new therapeutic targets has been identified. Mechanisms for modulation of those targets are also becoming more diverse while statins remain the backbone of CVD prevention, the new alternatives, such as PCSK9 monoclonals will probably play an important additional role in treatment of patients at risk for CVD.

The triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio as a predictor of β-cell function in African American women.

PubMed

Maturu, Amita; DeWitt, Peter; Kern, Philip A; Rasouli, Neda

2015-05-01

The TG/HDL-C ratio is used as a marker of insulin resistance (IR) in Caucasians. However, there are conflicting data on TG/HDL-C ratio as a predictor of IR in African Americans. Compared to Caucasians, African Americans have lower TG levels and increased insulin levels despite a greater risk for diabetes. We hypothesized that the TG/HDL-C ratio is predictive of IR and/or β-cell function in African American (AA) women. Non-diabetic AA women (n = 41) with a BMI > 25 kg/m(2) underwent frequently sampled intravenous glucose tolerance test (FSIGTT). Insulin sensitivity (SI) and the acute insulin response to glucose (AIRg) were measured using minimal model and β-cell function was determined by disposition index (DI = S I*AIRg). IR was defined as the lowest tertile of SI (<1.8 × 10(-4)min(-1)/μU/ml) and inadequate β cell compensation was defined as the lowest tertile of DI (< 900). Data were analyzed using logistic regression models and area under the receiver operating characteristic curve (AUC-ROC). An AUC-ROC > 0.70 was defined as significant discrimination. The mean (± SD) age was 38.5 ± 11.3 years, with BMI of 33.5 ± 6.7 kg/m(2) and fasting glucose of 86.5 ± 10.5 mg/dL. The AUC-ROC for the prediction of DI < 900 was 0.74 indicating that a higher TG/HDL-C ratio was associated with decreased DI. However, the AUC-ROC for prediction of IR or low AIRg (<335 μU/ml) was not significant. This study confirmed that the TG/HDL-C ratio is a poor predictor of IR in AA women. However, we did show an inverse association between the TG/HDL-C ratio and β-cell function, suggesting that this simple tool may effectively identify AA women at risk for DM2. Copyright © 2015 Elsevier Inc. All rights reserved.

Microstructure and Mechanical Properties of C/C Composite/TC17 Joints with Ag-Cu-Ti Brazing Alloy

NASA Astrophysics Data System (ADS)

Cao, Xiujie; Zhu, Ying; Guo, Wei; Peng, Peng; Ma, Kaituo

2017-12-01

Carbon/Carbon composite(C/C) was vacuum brazed to titanium alloy (TC17) using Ag-Cu-Ti brazing alloy. The effects of brazing temperature on the interfacial microstructure and joint properties were investigated by energy dispersive spectrometer (EDS), a scanning electron microscope (SEM), X-ray diffraction (XRD) and Gleeble1500D testing machine. Results show that C/C composite and TC17 were successfully brazed using AgCuTi brazing alloy. Various phases including TiC, Ag(s, s), Cu(s, s), Ti3Cu4, TiCu, and Ti2Cu were formed in the brazed joint. The maximum shear strength of the brazed joints with AgCuTi brazing alloy was 24±1 MPa when brazed at 860°C for 15 min.

Association of PvuII and XbaI polymorphisms on estrogen receptor alpha (ESR1) gene to changes into serum lipid profile of post-menopausal women: Effects of aging, body mass index and breast cancer incidence

PubMed Central

Gomes-Rochette, Neuza Felix; Souza, Letícia Soncini; Tommasi, Bruno Otoni; Pedrosa, Diego França; Fin, Irani do Carmo Francischetto; Vieira, Fernando Luiz Herkenhoff; Graceli, Jones Bernardes; Rangel, Letícia Batista Azevedo; Silva, Ian Victor

2017-01-01

Estrogen is a steroidal hormone involved in several physiological functions in the female body including regulation of serum lipid metabolism and breast cancer (BC). Estrogen actions on serum lipids mostly occur through its binding to intracellular Estrogen Receptor alpha (ERalpha) isoform, expressed in most of tissues. This gene (ESR1) exhibit many polymorphic sites (SNPs) located either on translated and non-translated regions that regulate ERalpha protein expression and function. This paper aimed to investigate the association of two intronic SNPs of ESR1 gene, namely c454-397T>C (PvuII) and c454-351A>G (XbaI) to alterations in serum levels of total cholesterol (T-chol), total lipid (TL), low density lipoprotein cholesterol (LDL), high density lipoprotein (HDL), and triglycerides (TG) in a cohort of post-menopausal women. In addition, we aimed to associate presence of these SNPs to development of BC along 5 years period. To do so, a group of healthy 499, highly miscigenated, post-menopausal Brazilian women, were carried using PCR-FRLP technique and further confirmed by automatic sequence analysis as well followed through 5 years for BC incidence. Measurements of serum lipid profile by standard commercial methods were carried individually whereas Dual Energy X-ray Absorciometry (DXA) measured Body Mass Indexes (BMI), Fat Mass (FM), Lean Body Mass (LBM), and Body Water Content (BWC). No effects of PvuII SNP on ESR1 gene were observed on patient´s serum T-chol, TL, LDL, HDL, and TG. However, c454-397T>C PvuII SNP is associated to lower body fat and higher levels of lean mass and body water and lower incidence of BC. On the other hand, statistically significant effect of XbaI c454-351A>G SNP on serum TG and TL levels. Patients homozygous for X allele were followed up from 2010–2015. They showed higher incidence of breast cancer (BC) when compared to either heterozygous and any P allele combination. Moreover, the increasing of TG and TL serum concentrations

Association of PvuII and XbaI polymorphisms on estrogen receptor alpha (ESR1) gene to changes into serum lipid profile of post-menopausal women: Effects of aging, body mass index and breast cancer incidence.

PubMed

Gomes-Rochette, Neuza Felix; Souza, Letícia Soncini; Tommasi, Bruno Otoni; Pedrosa, Diego França; Eis, Sérgio Ragi; Fin, Irani do Carmo Francischetto; Vieira, Fernando Luiz Herkenhoff; Graceli, Jones Bernardes; Rangel, Letícia Batista Azevedo; Silva, Ian Victor

2017-01-01

Estrogen is a steroidal hormone involved in several physiological functions in the female body including regulation of serum lipid metabolism and breast cancer (BC). Estrogen actions on serum lipids mostly occur through its binding to intracellular Estrogen Receptor alpha (ERalpha) isoform, expressed in most of tissues. This gene (ESR1) exhibit many polymorphic sites (SNPs) located either on translated and non-translated regions that regulate ERalpha protein expression and function. This paper aimed to investigate the association of two intronic SNPs of ESR1 gene, namely c454-397T>C (PvuII) and c454-351A>G (XbaI) to alterations in serum levels of total cholesterol (T-chol), total lipid (TL), low density lipoprotein cholesterol (LDL), high density lipoprotein (HDL), and triglycerides (TG) in a cohort of post-menopausal women. In addition, we aimed to associate presence of these SNPs to development of BC along 5 years period. To do so, a group of healthy 499, highly miscigenated, post-menopausal Brazilian women, were carried using PCR-FRLP technique and further confirmed by automatic sequence analysis as well followed through 5 years for BC incidence. Measurements of serum lipid profile by standard commercial methods were carried individually whereas Dual Energy X-ray Absorciometry (DXA) measured Body Mass Indexes (BMI), Fat Mass (FM), Lean Body Mass (LBM), and Body Water Content (BWC). No effects of PvuII SNP on ESR1 gene were observed on patient´s serum T-chol, TL, LDL, HDL, and TG. However, c454-397T>C PvuII SNP is associated to lower body fat and higher levels of lean mass and body water and lower incidence of BC. On the other hand, statistically significant effect of XbaI c454-351A>G SNP on serum TG and TL levels. Patients homozygous for X allele were followed up from 2010-2015. They showed higher incidence of breast cancer (BC) when compared to either heterozygous and any P allele combination. Moreover, the increasing of TG and TL serum concentrations

Effect of Cucurbita ficifolia and Probiotic Yogurt Consumption on Blood Glucose, Lipid Profile, and Inflammatory Marker in Type 2 Diabetes

PubMed Central

Bayat, Azade; Azizi-Soleiman, Fatemeh; Heidari-Beni, Motahar; Feizi, Awat; Iraj, Bijan; Ghiasvand, Reza; Askari, Gholamreza

2016-01-01

Background: Control of blood sugar, hypertension, and dyslipidemia are key factors in diabetes management. Cucurbita ficifolia (pumpkin) is a vegetable which has been used traditionally as a remedy for diabetes in Iran. In addition, consumption of probiotics may have beneficial effects on people with Type 2 diabetes. The aim of this study was an investigation of the effects of C. ficifolia and probiotic yogurt consumption alone or at the same time on blood glucose and serum lipids in diabetic patients. Methods: Eighty eligible participants randomly were assigned to four groups: 1 - green C. ficifolia (100 g); 2 - probiotic yogurt (150 g); 3 - C. ficifolia plus probiotic yogurt (100 g C. ficifolia plus 150 g yogurt); and 4 -control (dietary advice) for 8 weeks. Blood pressure, glycemic response, lipid profile, and high-sensitive C-reactive protein (hsCRP) were measured before and after the intervention. Results: Total cholesterol (TC) decreased significantly in yogurt and yogurt plus C. ficifolia groups (within groups P = 0.010, and P < 0.001, respectively). C. ficifolia plus yogurt consumption resulted in a decrease in triglyceride (TG) and an increase in high-density lipoprotein cholesterol (HDL-C) (within groups P < 0.001 and P = 0.001, respectively). All interventions led to a significant decrease in blood sugar, hemoglobin A1c (HbA1c), hsCRP, and low-density lipoprotein cholesterol (LDL-C) level within groups. Blood pressure decreased significantly in Cucurbita group and yogurt group (within groups P < 0.001, and P = 0.001 for systolic blood pressure [SBP] and P < 0.001, and P = 0.004 for diastolic blood pressure [DBP], respectively). All variables changed between groups significantly except LDL-C level. Conclusions: Variables including TG, HDL-C, TC, fasting blood sugar, HbA1c, SBP, DBP, and hsCRP changed beneficially between groups. It seems that consumption of C. ficifolia and probiotic yogurt may help treatment of diabetic patients. PMID:26955460

Unesterified plant sterols and stanols do not affect LDL electrophoretic characteristics in hypercholesterolemic subjects.

PubMed

Charest, Amélie; Desroches, Sophie; Vanstone, Catherine A; Jones, Peter J H; Lamarche, Benoît

2004-03-01

The extent to which sterols and stanols modulate LDL particle size is unknown. We examined the effects of supplementation with unesterified plant sterols and stanols on several LDL electrophoretic characteristics. Healthy hypercholesterolemic subjects (n = 14) consumed each of four experimental diets contained plant sterols (S), plant stanols (SN), a 50:50 mixture of sterols and stanols (SSN), or cornstarch (control) in a randomized crossover design. The butter component of the diet was blended with unesterified sterols and stanols at a dose of 1.8 g/d. The LDL particles were characterized by polyacrylamide gradient gel electrophoresis of whole plasma. LDL cholesterol (LDL-C) concentrations decreased by 8.8, 13.6, and 13.1% in the S, SN, and SSN groups, respectively (P < 0.01) with a significant increase of 4.3% in the control group. None of the treatments with sterols and stanols induced significant changes in LDL peak particle diameter or in the cholesterol levels of the small LDL subfraction (<25.5 nm). The reduction in plasma LDL-C levels with SN consumption was due mainly to a decrease (P < 0.05) in the concentration of cholesterol in the large subfraction (>26.0 nm). The significant reduction in plasma LDL-C concentrations by sterol and stanol consumption in subjects was not paralleled by any beneficial changes in LDL electrophoretic characteristics.

A more accurate profile of Achyrocline satureioides hypocholesterolemic activity.

PubMed

Espiña, Débora Corrêa; Carvalho, Fabiano Barbosa; Zanini, Daniela; Schlemmer, Josiane Bizzi; Coracini, Juliane Dors; Rubin, Maribel Antonello; Morsch, Vera Maria; Schetinger, Maria Rosa Chitolina; Leal, Daniela Bitencourt Rosa; Baiotto, Cléia Rosani; Jaques, Jeandre Augusto dos Santos

2012-06-01

The aim of this study was to investigate the effect of the aqueous extract (AE) of Achyrocline satureioides on serum lipid profile, liver oxidative profile and Na(+),K(+)-ATPase activity of rats submitted to a hyperlipidic diet. The animals were divided into four groups: control (C), AE 10% (A(10)), hyperlipidic (H) and hyperlipidic/AE 10% (HA(10)). In serum, we measured the levels of total cholesterol (TC), high-density lipoprotein, very-low-density lipoprotein, low-density lipoprotein (LDL) and triglyceride (TG). In liver homogenates, we measured the thiobarbituric acid reactive substances, the carbonyl proteins, the non-protein thiols (NPSHs) and the activity of superoxide dismutase, catalase (CAT) and Na(+),K(+)-ATPase. We observed a significant increase in the TC and LDL levels in the H group. A. satureioides prevented these effects, decreased the TG levels in the HA(10) group and increased the NPSH levels in the A(10) and HA(10) groups. The H group showed an increase in the carbonyl protein level and a decrease in CAT and Na(+),K(+)-ATPase activities. With the use of this model, results show that increased levels of lipids are related to a redox imbalance in the liver, which is also related to the inhibition of Na(+),K(+)-ATPase activity, and that chronic administration of the AE of A. satureioides is capable of changing this profile. Copyright © 2012 John Wiley & Sons, Ltd.

Effect of evolocumab or ezetimibe added to moderate- or high-intensity statin therapy on LDL-C lowering in patients with hypercholesterolemia: the LAPLACE-2 randomized clinical trial.

PubMed

Robinson, Jennifer G; Nedergaard, Bettina S; Rogers, William J; Fialkow, Jonathan; Neutel, Joel M; Ramstad, David; Somaratne, Ransi; Legg, Jason C; Nelson, Patric; Scott, Rob; Wasserman, Scott M; Weiss, Robert

2014-05-14

In phase 2 studies, evolocumab, a fully human monoclonal antibody to PCSK9, reduced LDL-C levels in patients receiving statin therapy. To evaluate the efficacy and tolerability of evolocumab when used in combination with a moderate- vs high-intensity statin. Phase 3, 12-week, randomized, double-blind, placebo- and ezetimibe-controlled study conducted between January and December of 2013 in patients with primary hypercholesterolemia and mixed dyslipidemia at 198 sites in 17 countries. Patients (n = 2067) were randomized to 1 of 24 treatment groups in 2 steps. Patients were initially randomized to a daily, moderate-intensity (atorvastatin [10 mg], simvastatin [40 mg], or rosuvastatin [5 mg]) or high-intensity (atorvastatin [80 mg], rosuvastatin [40 mg]) statin. After a 4-week lipid-stabilization period, patients (n = 1899) were randomized to compare evolocumab (140 mg every 2 weeks or 420 mg monthly) with placebo (every 2 weeks or monthly) or ezetimibe (10 mg or placebo daily; atorvastatin patients only) when added to statin therapies. Percent change from baseline in low-density lipoprotein cholesterol (LDL-C) level at the mean of weeks 10 and 12 and at week 12. Evolocumab reduced LDL-C levels by 66% (95% CI, 58% to 73%) to 75% (95% CI, 65% to 84%) (every 2 weeks) and by 63% (95% CI, 54% to 71%) to 75% (95% CI, 67% to 83%) (monthly) vs placebo at the mean of weeks 10 and 12 in the moderate- and high-intensity statin-treated groups; the LDL-C reductions at week 12 were comparable. For moderate-intensity statin groups, evolocumab every 2 weeks reduced LDL-C from a baseline mean of 115 to 124 mg/dL to an on-treatment mean of 39 to 49 mg/dL; monthly evolocumab reduced LDL-C from a baseline mean of 123 to 126 mg/dL to an on-treatment mean of 43 to 48 mg/dL. For high-intensity statin groups, evolocumab every 2 weeks reduced LDL-C from a baseline mean of 89 to 94 mg/dL to an on-treatment mean of 35 to 38 mg/dL; monthly evolocumab reduced LDL-C from a baseline mean

Diet rich in high glucoraphanin broccoli reduces plasma LDL cholesterol: Evidence from randomised controlled trials

PubMed Central

Armah, Charlotte N; Derdemezis, Christos; Traka, Maria H; Dainty, Jack R; Doleman, Joanne F; Saha, Shikha; Leung, Wing; Potter, John F; Lovegrove, Julie A; Mithen, Richard F

2015-01-01

Scope Cruciferous-rich diets have been associated with reduction in plasma LDL-cholesterol (LDL-C), which may be due to the action of isothiocyanates derived from glucosinolates that accumulate in these vegetables. This study tests the hypothesis that a diet rich in high glucoraphanin (HG) broccoli will reduce plasma LDL-C. Methods and results One hundred and thirty volunteers were recruited to two independent double-blind, randomly allocated parallel dietary intervention studies, and were assigned to consume either 400 g standard broccoli or 400 g HG broccoli per week for 12 weeks. Plasma lipids were quantified before and after the intervention. In study 1 (37 volunteers), the HG broccoli diet reduced plasma LDL-C by 7.1% (95% CI: –1.8%, –12.3%, p = 0.011), whereas standard broccoli reduced LDL-C by 1.8% (95% CI +3.9%, –7.5%, ns). In study 2 (93 volunteers), the HG broccoli diet resulted in a reduction of 5.1% (95% CI: –2.1%, –8.1%, p = 0.001), whereas standard broccoli reduced LDL-C by 2.5% (95% CI: +0.8%, –5.7%, ns). When data from the two studies were combined the reduction in LDL-C by the HG broccoli was significantly greater than standard broccoli (p = 0.031). Conclusion Evidence from two independent human studies indicates that consumption of high glucoraphanin broccoli significantly reduces plasma LDL-C. PMID:25851421

Diet rich in high glucoraphanin broccoli reduces plasma LDL cholesterol: Evidence from randomised controlled trials.

PubMed

Armah, Charlotte N; Derdemezis, Christos; Traka, Maria H; Dainty, Jack R; Doleman, Joanne F; Saha, Shikha; Leung, Wing; Potter, John F; Lovegrove, Julie A; Mithen, Richard F

2015-05-01

Cruciferous-rich diets have been associated with reduction in plasma LDL-cholesterol (LDL-C), which may be due to the action of isothiocyanates derived from glucosinolates that accumulate in these vegetables. This study tests the hypothesis that a diet rich in high glucoraphanin (HG) broccoli will reduce plasma LDL-C. One hundred and thirty volunteers were recruited to two independent double-blind, randomly allocated parallel dietary intervention studies, and were assigned to consume either 400 g standard broccoli or 400 g HG broccoli per week for 12 weeks. Plasma lipids were quantified before and after the intervention. In study 1 (37 volunteers), the HG broccoli diet reduced plasma LDL-C by 7.1% (95% CI: -1.8%, -12.3%, p = 0.011), whereas standard broccoli reduced LDL-C by 1.8% (95% CI +3.9%, -7.5%, ns). In study 2 (93 volunteers), the HG broccoli diet resulted in a reduction of 5.1% (95% CI: -2.1%, -8.1%, p = 0.001), whereas standard broccoli reduced LDL-C by 2.5% (95% CI: +0.8%, -5.7%, ns). When data from the two studies were combined the reduction in LDL-C by the HG broccoli was significantly greater than standard broccoli (p = 0.031). Evidence from two independent human studies indicates that consumption of high glucoraphanin broccoli significantly reduces plasma LDL-C. © 2015 The Authors. Molecular Nutrition & Food Research published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nordic Walking Training Causes a Decrease in Blood Cholesterol in Elderly Women Supplemented with Vitamin D.

PubMed

Prusik, Krzysztof; Kortas, Jakub; Prusik, Katarzyna; Mieszkowski, Jan; Jaworska, Joanna; Skrobot, Wojciech; Lipinski, Marcin; Ziemann, Ewa; Antosiewicz, Jedrzej

2018-01-01

Different studies have demonstrated that regular exercise can induce changes in the lipid profile, but results remain inconclusive. Available data suggest that correction of vitamin D deficiency can improve the lipid profile. In this study, we have hypothesized that Nordic Walking training will improve lipid profile in elderly women supplemented with vitamin D. A total of 109 elderly women (68 ± 5.12 years old) took part in the study. First group [experimental group (EG): 35 women] underwent 12 weeks of Nordic Walking (NW) training combined with vitamin D supplementation (4,000 IU/day), second group [supplementation group (SG): 48 women] was only supplemented with vitamin D (4,000 IU/day), and third group [control group (CG): 31 women] was not subject to any interventions. Blood analysis of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and 25-OH-D 3 was performed at baseline and after the 12 weeks of NW training. Additionally, a battery of field tests specifically developed for older adults was used to assess the components of functional fitness. The same blood analysis was repeated for the EG 6 months after the main experiment. After 12 weeks of NW training and vitamin D supplementation, in the EG a decrease in TC, LDL-C, and TG was observed. In the SG, no changes in the lipid profile were observed, whereas in the CG an increase in the HDL-C level was noticed. Positive physical fitness changes were only observed in the EG. Our obtained data confirmed baseline assumption that regular exercise induces positive alternations in lipid profile in elderly women supported by supplementation of vitamin D.

LDL oxidation by THP-1 monocytes: implication of HNP-1, SgIII and DMT-1.

PubMed

He, Chunyan; Huang, Rui; Du, Fen; Zheng, Fang; Wei, Lei; Wu, Junzhu

2009-04-01

Oxidized low-density lipoprotein (oxLDL) plays an important role in the pathogenesis of atherosclerosis. However, the mechanisms of the initiation and progression of LDL oxidation by cells are still unknown. We investigated the molecular mechanism underlying THP-1 cell-mediated LDL oxidation. LDL oxidation was monitored at 234 nm by detecting the formation of conjugated dienes. cDNA array analysis was applied to profile changes in gene expression of human THP-1 monocytes in response to LDL stimulation. The mRNA and protein levels of secretogranin III (SgIII), divalent metal transporter (DMT-1) and human alpha-defensin 1 (HNP-1) were determined by real-time RT-PCR and Western blotting respectively. Eukaryotic expression vectors containing full-length cDNA sequence of HNP-1 (pEGFP-C1/HNP-1) SgIII (pEGFP-C1/SgIII) or DMT-1 (pEGFP-C1/DMT-1) were constructed and transfected to THP-1 cells. The effects of overexpression of these three genes on THP-1 cell-mediated LDL oxidation were observed. LDL oxidation was most pronounced after LDL was incubated with THP-1 cells for 9 h. 1651 genes in total were detected by cDNA array analysis in THP-1 cells with or without LDL treatment for 9 h. Thirteen genes with >2-fold relative expression difference were identified, including nine genes whose expression was up-regulated and four genes whose expression was down-regulated. Among the up-regulated genes, SgIII, DMT-1 and HNP-1 were reported to be associated with atherosclerosis. The increased mRNA expressions of these three genes were confirmed by real-time RT-PCR. Western blotting analysis demonstrated that protein expressions of SgIII and DMT-1 were also enhanced in THP-1 cells in response to LDL. Furthermore, transient overexpression of HNP-1, SgIII or DMT-1 in THP-1 cells significantly increased THP-1 cell-mediated LDL oxidation. Our data suggest that SgIII, DMT-1 and HNP-1 are implicated in cell-mediated LDL oxidation.

Statin underuse and low prevalence of LDL-C control among U.S. adults at high risk of coronary heart disease.

PubMed

Gamboa, Christopher M; Safford, Monika M; Levitan, Emily B; Mann, Devin M; Yun, Huifeng; Glasser, Stephen P; Woolley, J Michael; Rosenson, Robert; Farkouh, Michael; Muntner, Paul

2014-08-01

Statins reduce the risk of coronary heart disease (CHD) in individuals with a history of CHD or risk equivalents. A 10-year CHD risk >20% is considered a risk equivalent but is frequently not detected. Statin use and low-density lipoprotein cholesterol (LDL-C) control were examined among participants with CHD or risk equivalents in the nationwide Reasons for Geographic and Racial Differences in Stroke study (n = 8812). Participants were categorized into 4 mutually exclusive groups: (1) history of CHD (n = 4025); (2) no history of CHD but with a history of stroke and/or abdominal aortic aneurysm (AAA) (n = 946); (3) no history of CHD or stroke/AAA but with diabetes mellitus (n = 3134); or (4) no history of the conditions in (1) through (3) but with 10-year Framingham CHD risk score (FRS) >20% calculated using the third Adult Treatment Panel point scoring system (n = 707). Statins were used by 58.4% of those in the CHD group and 41.7%, 40.4% and 20.1% of those in the stroke/AAA, diabetes mellitus and FRS >20% groups, respectively. Among those taking statins, 65.1% had LDL-C <100 mg/dL, with no difference between the CHD, stroke/AAA, or diabetes mellitus groups. However, compared with those in the CHD group, LDL-C <100 mg/dL was less common among participants in the FRS >20% group (multivariable adjusted prevalence ratio: 0.72; 95% confidence interval: 0.62-0.85). Results were similar using the 2013 American College of Cardiology/American Heart Association cholesterol treatment guideline. These data suggest that many people with high CHD risk, especially those with an FRS >20%, do not receive guideline-concordant lipid-lowering therapy and do not achieve an LDL-C <100 mg/dL.

Risk of type 2 diabetes mellitus associated with plasma lipid levels: The rural Chinese cohort study.

PubMed

Zhang, Ming; Zhou, Junmei; Liu, Yu; Sun, Xizhuo; Luo, Xinping; Han, Chengyi; Zhang, Lu; Wang, Bingyuan; Ren, Yongcheng; Zhao, Yang; Zhang, Dongdong; Liu, Xuejiao; Hu, Dongsheng

2018-01-01

To investigate the association of type 2 diabetes mellitus (T2DM) risk and plasma lipid levels in rural Chinese. Each lipid variable was divided into quartiles and dichotomized by clinical cutoff points. Cox proportional-hazards model was used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association of T2DM risk and plasma lipid levels and explore the interaction between plasma lipid levels and other risk factors. 11,929 participants were included in the analysis. We documented 720 incident cases of T2DM over 70,720.84 person-years of follow-up, for an incidence of 10.18/1,000 person-years. In the multivariable-adjusted model, risk of T2DM was increased with the highest versus lowest quartiles of total cholesterol (TC) and triglycerides (TG) levels and TC/high-density lipoprotein-cholesterol (HDL-C) and TG/HDL-C ratios. The HRs (95% CIs) for the fourth quartiles, for example, were 1.34 (1.03-1.74), 2.32 (1.73-3.13), 1.66 (1.23-2.25), and 1.84 (1.38-2.45), respectively. In addition, risk of T2DM was increased with high TG level and TC/HDL-C and TG/HDL-C ratios by clinical cutoffs. The HRs (95% CIs) were 1.50 (1.25-1.80), 1.24 (1.03-1.48), and 1.44 (1.18-1.75), respectively. Risk of T2DM was associated with interactions between all lipid variables and age and BMI. TG level and TG/HDL-C ratio additionally interacted with gender (all P interaction  < 0.0001). Risk of T2DM was increased with elevated serum levels of TC and TG and TC/HDL-C and TG/HDL-C ratios and also with interactions between high TC and TG levels and TC/HDL-C and TG/HDL-C ratios and age and BMI in a rural Chinese population. Copyright © 2017 Elsevier B.V. All rights reserved.

JUPITER to Earth: A statin helps people with normal LDL-C and high hs-CRP, but what does it mean?

PubMed Central

SHISHEHBOR, MEHDI H.; HAZEN, STANLEY L.

2010-01-01

The JUPITER trial (Justification for the Use of Statins in Prevention: an Intervention Trial Evaluating Rosuvastatin) (N Engl J Med 2008; 359:2195–2207) compared rosuvastatin (Crestor) 20 mg daily vs placebo in apparently healthy people who had levels of low-density lipoprotein cholesterol (LDL-C) lower than 130 mg/dL but elevated levels (≥ 2 mg/L) of high-sensitivity C-reactive protein (hs-CRP). Rosuvastatin treatment lowered LDL-C levels by 50% and hs-CRP levels by 37%, accompanied by a 44% relative risk reduction in the composite end point of unstable angina, revascularization, and confirmed death from cardiovascular causes. In absolute terms, 95 people had to be treated over 2 years to prevent one event. There was, however, a higher incidence of diabetes in the rosuvastatin group. PMID:19122109

Emerging LDL therapies: Mipomersen-antisense oligonucleotide therapy in the management of hypercholesterolemia.

PubMed

Toth, Peter P

2013-01-01

Familial hypercholesterolemia (FH) is characterized by severe elevations in low-density lipoprotein cholesterol (LDL-C) and poses considerable treatment challenges. Substantive LDL-C reductions are difficult to achieve with standard therapies, and many patients with FH do not tolerate currently available lipid-lowering medications. Mipomersen is an antisense oligonucleotide injectable drug that was recently approved by the Food and Drug Administration for the treatment of homozygous FH. It is complementary in sequence to a segment of the human apolipoprotein (Apo) B-100 messenger RNA and specifically binds to it, blocking translation of the gene product. Reducing the production of Apo B-100 reduces hepatic production of very low-density lipoprotein, consequently decreasing circulating levels of atherogenic very low-density lipoprotein remnants, intermediate-density lipoproteins, LDL, and lipoprotein(a) particles. Results from a pivotal trial conducted in patients with homozygous FH, and supporting trials in patients with heterozygous FH with coronary artery disease (CAD) (LDL-C ≥ 100 mg/dL, triglycerides < 200 mg/dL), severe hypercholesterolemia (LDL-C ≥ 300 mg/dL or ≥ 200 mg/dL with CAD), and individuals at high risk for CAD (LDL-C ≥ 100 mg/dL, triglycerides ≤ 200 mg/dL), have indicated that mipomersen reduces all Apo B-containing atherogenic lipoproteins. The average LDL-C reduction was >100 mg/dL in homozygous FH and severe hypercholesterolemia populations. The main on-treatment adverse events were mild-to-moderate injection site reactions and flu-like symptoms. Available data regarding the efficacy, safety and tolerability of mipomersen, including results at up to 104 weeks of therapy, support the use of mipomersen for the treatment of FH. Copyright © 2013 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Fixed-dose combination ezetimibe+atorvastatin lowers LDL-C equivalent to co-administered components in randomized trials: use of a dose-response model.

PubMed

Bays, Harold E; Chen, Erluo; Tomassini, Joanne E; McPeters, Gail; Polis, Adam B; Triscari, Joseph

2015-04-01

Co-administration of ezetimibe with atorvastatin is a generally well-tolerated treatment option that reduces LDL-C levels and improves other lipids with greater efficacy than doubling the atorvastatin dose. The objective of the study was to demonstrate the equivalent lipid-modifying efficacy of fixed-dose combination (FDC) ezetimibe/atorvastatin compared with the component agents co-administered individually in support of regulatory filing. Two randomized, 6-week, double-blind cross-over trials compared the lipid-modifying efficacy of ezetimibe/atorvastatin 10/20 mg (n = 353) or 10/40 mg (n = 280) vs. separate co-administration of ezetimibe 10 mg plus atorvastatin 20 mg (n = 346) or 40 mg (n = 280), respectively, in hypercholesterolemic patients. Percent changes from baseline in LDL-C (primary endpoint) and other lipids (secondary endpoints) were assessed by analysis of covariance; triglycerides were evaluated by longitudinal-data analysis. Expected differences between FDC and the corresponding co-administered doses were predicted from a dose-response relationship model; sample size was estimated given the expected difference and equivalence margins (±4%). LDL-C-lowering equivalence was based on 97.5% expanded confidence intervals (CI) for the difference contained within the margins; equivalence margins for other lipids were not prespecified. Ezetimibe/atorvastatin FDC 10/20 mg was equivalent to co-administered ezetimibe+atorvastatin 20 mg in reducing LDL-C levels (54.0% vs. 53.8%) as was FDC 10/40 mg and ezetimibe+atorvastatin 40 mg (58.9% vs. 58.7%), as predicted by the model. Changes in other lipids were consistent with equivalence (97.5% expanded CIs <±3%, included 0); triglyceride changes varied more. All treatments were generally well tolerated. Hypercholesterolemic patients administered ezetimibe/atorvastatin 10/20 and 10/40 mg FDC had equivalent LDL-C lowering. This FDC formulation proved to be an efficacious and generally well

Citrus ichangensis Peel Extract Exhibits Anti-Metabolic Disorder Effects by the Inhibition of PPARγ and LXR Signaling in High-Fat Diet-Induced C57BL/6 Mouse

PubMed Central

Ding, Xiaobo; Fan, Shengjie; Lu, Yan; Zhang, Yu; Gu, Ming; Zhang, Lu; Liu, Gaigai; Guo, Lu; Jiang, Dong; Lu, Xiong; Li, Yiming; Zhou, Zhiqin; Huang, Cheng

2012-01-01

Obesity is a common nutritional disorder associated with type 2 diabetes, cardiovascular diseases, dyslipidemia, and certain cancers. In this study, we investigated the effects of Citrus ichangensis peel extract (CIE) in high-fat (HF) diet-induced obesity mice. Female C57BL/6 mice were fed a chow diet or an HF diet alone or supplemented with 1% w/w CIE for 8 weeks. We found that CIE treatment could lower blood glucose level and improve glucose tolerance. In the HF+CIE group, body weight gain, serum total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-c) levels, and liver triglyceride (TG) and TC concentrations were significantly (P < 0.05) decreased relative to those in the HF group. To elucidate the mechanism of CIE on the metabolism of glucose and lipid, related genes expression in liver were examined. In liver tissue, CIE significantly decreased the mRNA expression levels of peroxisome proliferator-activated receptor γ (PPARγ) and its target genes, such as fatty acid synthase (FAS) and acyl-CoA oxidase (ACO). Moreover, CIE also decreased the expression of liver X receptor (LXR) α and β which are involved in lipid and glucose metabolism. These results suggest that CIE administration could alleviate obesity and related metabolic disorders in HF diet-induced obesity mice through the inhibition of PPARγ and LXR signaling. PMID:23320036

Validation of the Martin Method for Estimating Low-Density Lipoprotein Cholesterol Levels in Korean Adults: Findings from the Korea National Health and Nutrition Examination Survey, 2009-2011

PubMed Central

Lee, Jongseok; Jang, Sungok; Son, Heejeong

2016-01-01

Despite the importance of accurate assessment for low-density lipoprotein cholesterol (LDL-C), the Friedewald formula has primarily been used as a cost-effective method to estimate LDL-C when triglycerides are less than 400 mg/dL. In a recent study, an alternative to the formula was proposed to improve estimation of LDL-C. We evaluated the performance of the novel method versus the Friedewald formula using a sample of 5,642 Korean adults with LDL-C measured by an enzymatic homogeneous assay (LDL-CD). Friedewald LDL-C (LDL-CF) was estimated using a fixed factor of 5 for the ratio of triglycerides to very-low-density lipoprotein cholesterol (TG:VLDL-C ratio). However, the novel LDL-C (LDL-CN) estimates were calculated using the N-strata-specific median TG:VLDL-C ratios, LDL-C5 and LDL-C25 from respective ratios derived from our data set, and LDL-C180 from the 180-cell table reported by the original study. Compared with LDL-CF, each LDL-CN estimate exhibited a significantly higher overall concordance in the NCEP-ATP III guideline classification with LDL-CD (p< 0.001 for each comparison). Overall concordance was 78.2% for LDL-CF, 81.6% for LDL-C5, 82.3% for LDL-C25, and 82.0% for LDL-C180. Compared to LDL-C5, LDL-C25 significantly but slightly improved overall concordance (p = 0.008). LDL-C25 and LDL-C180 provided almost the same overall concordance; however, LDL-C180 achieved superior improvement in classifying LDL-C < 70 mg/dL compared to the other estimates. In subjects with triglycerides of 200 to 399 mg/dL, each LDL-CN estimate showed a significantly higher concordance than that of LDL-CF (p< 0.001 for each comparison). The novel method offers a significant improvement in LDL-C estimation when compared with the Friedewald formula. However, it requires further modification and validation considering the racial differences as well as the specific character of the applied measuring method. PMID:26824910

Differences of prevalence of dyslipidemia and risk factors related to LDL-c in the patients with abnormal fasting glucose between Uygur and Han in Xinjiang.

PubMed

Quan, Li; Hu, Lin; Zhang, Li; Jiang, Sheng

2015-01-01

To evaluate the incidence of dyslipidemia among Uygur and Han patients with impaired fasting glucose (IFG). To investigate the influence factors on LDL-c in this population. This cross-sectional study included a total of 4709 participants, consisting of Uygurs patients (n=2053) and Han patients (n=2656) from Xinjiang province, who were screened for diabetes mellitus. A stratified multistage sampling design was used to collect the participants. The influence factors on LDL-c were analyzed by Logistic regression analysis. Among the IFG patients (n=1757), Uighur IFG group had a higher prevalence of dyslipidemia than that of Han IFG group, 99.8% vs. 63.7%, P<0.05. Similar trends were existed in the prevalence of hypercholesteremia, hypertriglyceridemia, high LDL-c and low HDL-c (all P<0.05). Among the Uighur groups, IFG group had higher dyslipidemia rate than that of euglycemia group (74%). However, there was no such difference in the Han groups. Logistic regression analysis revealed that risk factors associated with LDL-c were age, total cholesterol and 2 h postprandial blood glucose for the Uighur IFG patients. However, gender and total cholesterol were risk factors for Han IFG patients. Uighur IFG patients had higher incidence of dyslipidemia than that of Han IFG patients. For Uyghur IFG patients, closing follow-up of total cholesterol and 2 h postprandial blood glucose were necessary. As to the Han IFG patients, we should pay more attention to male and total cholesterol in order to lower LDL-c levels. So, appropriately preventive and therapeutic measures should be chosen based on the characteristics of abnormal lipid profiles in different nationality.

Triglyceride to high-density lipoprotein cholesterol ratio predicts worse outcomes after acute ischaemic stroke.

PubMed

Deng, Q-W; Wang, H; Sun, C-Z; Xing, F-L; Zhang, H-Q; Zuo, L; Gu, Z-T; Yan, F-L

2017-02-01

The effect of the triglyceride (TG) to high-density lipoprotein cholesterol (HDL-C) ratio (TG/HDL-C) on clinical outcomes of acute ischaemic stroke (AIS) patients is unclear. This study sought to determine whether the TG/HDL-C ratio in AIS patients is associated with worse outcomes at 3 months. Acute ischaemic stroke patients who were admitted from 2011 to 2014 were enrolled in this study. TG, total cholesterol (TC), HDL-C and low-density lipoprotein cholesterol (LDL-C) were collected on admission. Three end-points were defined according to the modified Rankin scale (mRS) score at 3 months after symptom onset (excellent outcome, mRS 0-1; good outcome, mRS 0-2; and death, mRS 6). In all, 1006 patients were included (median age 68.5 years; 58.2% male). Higher TG, non-HDL-C and TG/HDL-C were strongly associated with the three end-points after adjustments: excellent [odds ratio (OR) = 1.39, OR 1.89 and OR 2.34, respectively] and good (OR 1.48, OR 2.90 and OR 4.12) outcomes, and death (OR 0.59, OR 0.29 and OR 0.26). According to receiver operating characteristic (ROC) analysis, the best discriminating factor was a TG/HDL-C ≥ 0.87 for excellent outcomes [area under the ROC curve (AUC) 0.596; sensitivity 73.3%; specificity 42.7%] and non-death (AUC 0.674; sensitivity 67.8%; specificity 60.6%) as well as a TG/HDL-C ≥ 1.01 for a good outcome (AUC 0.652; sensitivity 61.6%; specificity 63.2%). Patients with a TG/HDL-C < 0.87 had a 2.94-fold increased risk of death (95% confidence interval 1.89-4.55) compared with patients with a TG/HDL-C ≥ 0.87. A lower TG/HDL-C was independently associated with death and worse outcome at 3 months in AIS. © 2016 EAN.

Gene-gene interaction between CETP and APOE polymorphisms confers higher risk for hypertriglyceridemia in oldest-old Chinese women.

PubMed

Sun, Liang; Hu, Caiyou; Zheng, Chenguang; Huang, Zezhi; Lv, Zeping; Huang, Jin; Liang, Siying; Shi, Xiaohong; Zhu, Xiaoquan; Yuan, Huiping; Yang, Ze

2014-07-01

The knowledge of dyslipidemia and its genetic contributors in oldest-old subjects is limited; in addition, the majority of oldest-old subjects are females. Evidence has accumulated that multiple genetic factors play important roles in determining susceptibility to dyslipidemia and extended life span. Cholesterol ester transfer protein (CETP) and apolipoprotein E (APOE) are two plausible candidate genes for human longevity owing to their functionally related modulation of circulating lipid homeostasis; however, few studies have considered their interplay. In this study, we analyzed the distribution of CETP*V (rs5882) and APOE*4 (rs429358 and rs7412) in 372 oldest-old Chinese women (aged 80-109) and 340 controls (aged 20-58). In addition to replicating the association of longevity, our main goal was to evaluate the contribution of CETP*V, APOE*4 and CETP*APOE interaction to the risk of dyslipidemia. Only APOE*4 conferred a risk against longevity and was associated with high-cholesterol (hTC) and mixed dyslipidemia for oldest-old females. Moreover, CETP*V was found to be associated with hypertriglyceridemia (hTG) independently from APOE*4, age, BMI, alcohol drinking, TC, TG, HDL-c, and LDL-c. The stratification test, multivariable-adjusted logistic regression, and nonparametric MDR analysis all suggested a significant CETP*APOE interaction associated with hTG. The unadjusted odds for hTG were more than 4-fold in subjects with CETP*V and APOE*4 than those without either (OR=4.36, P<0.001). These results provide evidence of strong independent associations between hTG and CETP*V in oldest-old Chinese females, and APOE*4, as an independently non-significant variant, might interact with CETP*V resulting in an increased risk for hTG. Copyright © 2014 Elsevier Inc. All rights reserved.

The Effect of Cloud Ear Fungus (Auricularia polytricha) on Serum Total Cholesterol, LDL And HDL Levels on Wistar Rats Induced by Reused Cooking Oil

NASA Astrophysics Data System (ADS)

Budinastiti, Ratih; Sunoko, Henna Rya; Widiastiti, Nyoman Suci

2018-02-01

The usage of reused cooking oil affects the increase of serum total cholesterol (TC) and LDL, also the decrease of serum HDL. This condition escalates the risk of atherosclerosis, which could lead to the incidence of cardiovascular disease. Cloud ear fungus is a natural antioxidant that contains polysaccharides, flavonoids, niacin, and vitamin C, which can improve the lipid profiles. Objective of this research is to analyze the impact of water from boiled cloud ear fungus on total cholesterol, LDL, and HDL level of Wistar rats that have been given reused cooking oil. This study is a true experimental research with post test only control group design, using 12 weeks-aged male Wistar rats (n = 24) that were randomly divided into 4 groups. K1 as the negative control, K2 was given reused cooking oil and standard diet, K3 was given water from boiled cloud ear fungus and standard diet, and K4 was given reused cooking oil, water from boiled cloud ear fungus and standard diet. Serum total cholesterol, LDL, and HDL levels were measured by the CHOD-PAP method after 28 days treatment. The study showed that TC mean value of K1 (80.2217 ± 3.61 mg / dL), K2 (195.8483 ± 5.47 mg / dL), K3 (75.5800 ± 4.02 mg / dL), and K4 (110.8683 ± 5.82 mg / dL); p = 0.000. LDL mean value of K1 (29.9200 ± 1.53 mg / dL), K2 (78.4167 ± 1.77 mg / dL), K3 (24.3167 ± 1.77 mg / dL), and K4 (40, 1617 ± 2.84 mg / dL); p = 0.000. HDL mean value of K1 (65.8950 ± 1.99 mg / dL), K2 (24.3233 ± 1.44 mg / dL), K3 (73.2300 ± 1.92 mg / dL), and K4 (54, 9550 ± 2.04 mg / dL); p= 0.000. Conclusion: Water from boiled cloud ear fungus decreases the serum total cholesterol and LDL, 06006 increases serum HDL levels of Wistar rats that has been given reused cooking oil.

Effects of smoking and alcohol consumption on lipid profile in male adults in northwest rural China.

PubMed

Li, X X; Zhao, Y; Huang, L X; Xu, H X; Liu, X Y; Yang, J J; Zhang, P J; Zhang, Y H

2018-04-01

To determine the individual and combined influences of smoking and alcohol consumption on lipid profile in male adults in northwest rural China. Cross-sectional study. In total, 4614 subjects were enrolled in the cross-sectional study, performed between 2008 and 2012. The present study examined males aged ≥18 years from northwest rural China (n = 707). Data on current smoking and drinking status were collected. Logistic regression was used to estimate the individual and combined influences of smoking and alcohol consumption on lipid profile. Age, ethnic group, educational background, smoking (or alcohol consumption), waist circumference, body mass index, blood pressure and fasting blood glucose were adjusted as confounders. Total cholesterol (TC)/high-density lipoprotein cholesterol (HDL-C) ratio, triglycerides (TG)/HDL-C ratio, low-density lipoprotein cholesterol (LDL-C)/HDL-C ratio and visceral adiposity index (VAI) were significantly higher in smokers than in non-smokers, whereas HDL-C was lower in smokers. TG/HDL-C ratio, LDL-C/HDL-C ratio, TG, lipid accumulation product and VAI were significantly higher in drinkers than non-drinkers. After adjustment for confounders, significant relationships were observed between smoking status and any dyslipidemia, low HDL-C and high VAI (odds ratios [ORs]: 2.53 [95% confidence interval {CI}: 1.25-5.15], 6.13 [95% CI: 2.84-13.25] and 4.39 [95% CI: 2.02-9.54], respectively). The OR for any dyslipidaemia was 1.94 (95% CI: 1.09-3.48) for subjects who smoke and drank alcohol compared with subjects who did not smoke or drink alcohol. Abnormalities in lipid profile are correlated with smoking and alcohol consumption, which calls for intervention strategies to prevent dyslipidaemia and control risk factors for cardiovascular disease. Copyright © 2018 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Comparison of lipoprotein derived indices for evaluating cardio-metabolic risk factors and subclinical organ damage in middle-aged Chinese adults.

PubMed

Cao, Xia; Wang, Dongliang; Zhou, Jiansong; Chen, Zhiheng

2017-12-01

High-density lipoprotein cholesterol (HDL-C) and related lipoprotein ratios were used to assess lipid atherogenesis or insulin resistance. However, which of these indices is superior remains controversial and could differ across ethnic groups. We evaluated the efficacy of HDL-C, and related lipoprotein ratios in identifying cardio-metabolic risk factors (CMRs) or preclinical organ damage among a health check-ups population in China. We conducted a cross-sectional study of 17,596 Chinese adults aged 40-64years, who participated in annual health checkups in China. Anthropometric, biochemical, liver ultrasound scan, brachial-ankle pulse wave velocity (baPWV) and carotid intima-media thickness (cIMT) were analyzed. Partial spearman correlations, receiver operating characteristic (ROC) curves were used for statistical analyses. In both gender, the triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio consistently had the highest correlation with various CMRs and subclinical organ damage. Overall, the area under the curve (AUC) of TG/HDL-C ratio was significantly greater than that of the rest lipid variables/ratios in the prediction of abdominal obese, high blood pressure, impaired fasting glucose, metabolic syndrome, and preclinical signs of organ damage (all P<0.001). In both gender with a normal TG and HDL-C concentration, those with an increased TG/HDL-C, had higher concentrations of various CMRs and higher presence of subclinical organ damage (despite no significant differences were found between different TG/HDL-C for part of CMRs indicators). In this population, TG/HDL-C ratio of ≥1.255 in men and ≥0.865 in women can identify individuals with cardio-metabolic risk, despite TG/HDL-C ratio, TC/HDL-C ratio, and LDL-C/HDL-C ratio seem comparable in their association with CMRs and subclinical signs of organ damage. Copyright © 2017. Published by Elsevier B.V.

HEMOGLOBIN A1C, BLOOD PRESSURE, AND LDL-CHOLESTEROL CONTROL AMONG HISPANIC/LATINO ADULTS WITH DIABETES: RESULTS FROM THE HISPANIC COMMUNITY HEALTH STUDY/STUDY OF LATINOS (HCHS/SOL).

PubMed

Casagrande, Sarah Stark; Aviles-Santa, Larissa; Corsino, Leonor; Daviglus, Martha L; Gallo, Linda C; Espinoza Giacinto, Rebeca A; Llabre, Maria M; Reina, Samantha A; Savage, Peter J; Schneiderman, Neil; Talavera, Gregory A; Cowie, Catherine C

2017-10-01

To determine the prevalence of Hispanic/Latino adults with diabetes who meet target hemoglobin A1c, blood pressure (BP), and low-density-lipoprotein cholesterol (LDL-C) recommendations, and angiotensin-converting enzyme (ACE) inhibitors/angiotensin receptor blocker (ARB) and statin medication use by heritage and sociodemographic and diabetes-related characteristics. Data were cross-sectional, collected between 2008 and 2011, and included adults age 18 to 74 years who reported a physician diagnosis of diabetes in the Hispanic Community Health Study/Study of Latinos (N = 2,148). Chi-square tests compared the prevalence of hemoglobin A1c, BP, and LDL-C targets and ACE/ARB and statin use across participant characteristics. Predictive margins regression was used to determine the prevalence adjusted for sociodemographic characteristics. The overall prevalence of A1c <7.0% (53 mmol/mol), BP <130/80 mm Hg, and LDL-C <100 mg/dL was 43.0, 48.7, and 36.6%, respectively, with 8.4% meeting all three targets. Younger adults aged 18 to 39 years with diabetes were less likely to have A1c <7.0% (53 mmol/mol) or LDL-C <100 mg/dL compared to those aged 65 to 74 years; younger adults were more likely to have BP <130/80 mm Hg (P<.05 for all). Individuals of Mexican heritage were significantly less likely to have A1c <7.0% (53 mmol/mol) compared to those with Cuban heritage, but they were more likely to have BP <130/80 mm Hg compared to those with Dominican, Cuban, or Puerto Rican heritage (P<.05 for all); there was no difference in LDL-C by heritage. Overall, 38.2% of adults with diabetes were taking a statin, and 50.5% were taking ACE/ARB medications. Hemoglobin A1c, BP, and LDL-C control are suboptimal among Hispanic/Latinos with diabetes living in the U.S. With 8.4% meeting all three recommendations, substantial opportunity exists to improve diabetes control in this population. A1c = hemoglobin A1c; ABC = hemoglobin A1c, blood pressure, low-density-lipoprotein cholesterol; ACE

Associations of Circulating Oxidized LDL and Conventional Biomarkers of Cardiovascular Disease in a Cross-Sectional Study of the Navajo Population

PubMed Central

Harmon, Molly E.; Campen, Matthew J.; Miller, Curtis; Shuey, Chris; Cajero, Miranda; Lucas, Selita; Pacheco, Bernadette; Erdei, Esther; Ramone, Sandy; Nez, Teddy; Lewis, Johnnye

2016-01-01

The prevalences of cardiovascular disease (CVD) and type 2 diabetes (T2D) have increased among the Navajo Native American community in recent decades. Oxidized low-density lipoprotein (oxLDL) is a novel CVD biomarker that has never been assessed in the Navajo population. We examined the relationship of oxLDL to conventional CVD and T2D risk factors and biomarkers in a cross-sectional population of Navajo participants. This cross-sectional study included 252 participants from 20 Navajo communities from the Diné Network for Environmental Health Project. Plasma samples were tested for oxLDL levels by a sandwich enzyme-linked immunosorbent assay. Univariate and multivariate analyses were used to determine the relationship of oxLDL and oxidized- to non-oxidized lipoprotein ratios to glycated hemoglobin (HbA1c), C-reactive protein (CRP), interleukin 6 (IL6) and demographic and health variables. Type 2 diabetes, hypertension and obesity are very prevalent in this Navajo population. HbA1c, CRP, body mass index (BMI), high-density lipoprotein, and triglycerides were at levels that may increase risk for CVD and T2D. Median oxLDL level was 47 (36.8–57) U/L. Correlational analysis showed that although oxLDL alone was not associated with HbA1c, oxLDL/HDL, oxLDL/LDL and CRP were significantly associated with HbA1c and glucose. OxLDL, oxLDL/HDL and oxLDL/LDL were significantly associated with CRP. Multivariate analysis showed that triglycerides were a common and strong predictor of oxLDL, oxLDL/HDL and oxLDL/LDL. OxLDL was trended with HbA1c and glucose but did not reach significance, however, HbA1c was an independent predictor of OxLDL/HDL. CRP trended with oxLDL/HDL and was a weak predictor of oxLDL/LDL. This Navajo subset appears to have oxLDL levels comparable to subjects without evidence of CVD reported in other studies. The high prevalence of T2D, hypertension and obesity along with abnormal levels of other biomarkers including HbA1c indicate that the Navajo population

Hibiscus anthocyanins-rich extract inhibited LDL oxidation and oxLDL-mediated macrophages apoptosis.

PubMed

Chang, Yun-Ching; Huang, Kai-Xun; Huang, An-Chung; Ho, Yung-Chyuan; Wang, Chau-Jong

2006-07-01

The oxidative modification of low-density lipoprotein (LDL) plays a key role in the pathogenesis of atherosclerosis. Anti-oxidative reagents, which can effectively inhibit LDL oxidation, may prevent atherosclerosis via reducing early atherogenesis, and slowing down the progression to advance stages. As shown in previous studies Hibiscus sabdariffa L. is a natural plant containing a lot of pigments that was found to possess anti-oxidative of activity. Therefore, in this study, we evaluated the anti-oxidative activity of Hibiscus anthocyanins (HAs) by measuring their effects on LDL oxidation (in cell-free system) and anti-apoptotic abilities (in RAW264.7 cells). HAs have been tested in vitro examining their relative electrophoretic mobility (REM), Apo B fragmentation, thiobarbituric acid relative substances (TBARS) and radical 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging activity assay. The anti-oxidative activity of HAs was defined by relative electrophoretic mobility of oxLDL (decrease of 50% at 2 mg/ml), fragmentation of Apo B (inhibition of 61% at 1mg/ml), and TBARS assay (IC(50): 0.46 mg/ml) in the Cu(2+)-mediated oxidize LDL. Furthermore, the addition of >0.1 mg/ml of HAs could scavenge over 95% of free DPPH radicals, HAs showed strong potential in inhibiting LDL oxidation induced by copper. In addition, to determine whether oxLDL-induced apoptosis in macrophages is inhibited by HAs, we studied the viability, morphology and caspase-3 expression of RAW 264.7 cells. MTT assay, Leukostate staining analysis and Western blotting reveals that HAs could inhibit oxLDL-induced apoptosis. According to these findings, we suggest that HAs may be used to inhibit LDL oxidation and oxLDL-mediated macrophage apoptosis, serving as a chemopreventive agent. However, further investigations into the specificity and mechanism(s) of HAs are needed.

Goal attainments and their discrepancies for low density lipoprotein cholesterol (LDL-C) and apolipoprotein B (apo B) in over 2,000 Chinese patients with known coronary artery disease or type 2 diabetes.

PubMed

He, Yong-Ming; Yang, Xiang-Jun; Zhao, Xin; Xu, Hai-Feng

2015-04-01

Low density lipoprotein cholesterol (LDL-C) is primary treatment target for patients with dislipidemia. The apolipoprotein B (apo B), an emerging biomarker for cardiovascular risk prediction, appears to be superior to the LDL-C. However, little is known about goal attainments and their discrepancies for LDL-C and apo B in Chinese patients with known CAD or DM. A total of 2,172 hospitalized patients with known coronary artery disease (CAD) or DM, aged >27 years of old, were enrolled. The success rates for apo B and LDL-C goal attainments were evaluated and compared by categorization and by sex. When the success rates for apo B were compared with the ones for LDL-C, the former was higher than the latter across all categorizations, with the statistically significant differences seen in all patients, CAD alone and DM alone (P<0.0001), but not in coexistence of CAD and DM (P=0.190). The trend toward to higher success rates for LDL-C and apo B goal attainments in men than in women were noteworthy across all categorizations although only in all patients and in DM alone patients were the statistically significant differences found (P<0.01). The LDL-C lags behind the apo B in goal attainments in Chinese patients. Whether these discrepancies are associated with the occurrence differences for CAD and for stroke between the East Asia and the Western countries warrants further study.

HEMOGLOBIN A1C, BLOOD PRESSURE, AND LDL-CHOLESTEROL CONTROL AMONG HISPANIC/LATINO ADULTS WITH DIABETES: RESULTS FROM THE HISPANIC COMMUNITY HEALTH STUDY/STUDY OF LATINOS (HCHS/SOL)

PubMed Central

Casagrande, Sarah Stark; Aviles-Santa, Larissa; Corsino, Leonor; Daviglus, Martha L.; Gallo, Linda C.; Espinoza Giacinto, Rebeca A.; Llabre, Maria M.; Reina, Samantha A.; Savage, Peter J.; Schneiderman, Neil; Talavera, Gregory A.; Cowie, Catherine C.

2018-01-01

Objective To determine the prevalence of Hispanic/Latino adults with diabetes who meet target hemoglobin A1c, blood pressure (BP), and low-density-lipoprotein cholesterol (LDL-C) recommendations, and angiotensin-converting enzyme (ACE) inhibitors/angiotensin receptor blocker (ARB) and statin medication use by heritage and sociodemographic and diabetes-related characteristics. Methods Data were cross-sectional, collected between 2008 and 2011, and included adults age 18 to 74 years who reported a physician diagnosis of diabetes in the Hispanic Community Health Study/Study of Latinos (N = 2,148). Chi-square tests compared the prevalence of hemoglobin A1c, BP, and LDL-C targets and ACE/ARB and statin use across participant characteristics. Predictive margins regression was used to determine the prevalence adjusted for sociodemographic characteristics. Results The overall prevalence of A1c <7.0% (53 mmol/mol), BP <130/80 mm Hg, and LDL-C <100 mg/dL was 43.0, 48.7, and 36.6%, respectively, with 8.4% meeting all three targets. Younger adults aged 18 to 39 years with diabetes were less likely to have A1c <7.0% (53 mmol/mol) or LDL-C <100 mg/dL compared to those aged 65 to 74 years; younger adults were more likely to have BP <130/80 mm Hg (P<.05 for all). Individuals of Mexican heritage were significantly less likely to have A1c <7.0% (53 mmol/mol) compared to those with Cuban heritage, but they were more likely to have BP <130/80 mm Hg compared to those with Dominican, Cuban, or Puerto Rican heritage (P<.05 for all); there was no difference in LDL-C by heritage. Overall, 38.2% of adults with diabetes were taking a statin, and 50.5% were taking ACE/ARB medications. Conclusion Hemoglobin A1c, BP, and LDL-C control are suboptimal among Hispanic/Latinos with diabetes living in the U.S. With 8.4% meeting all three recommendations, substantial opportunity exists to improve diabetes control in this population. PMID:28816530

Clinical usefulness of lipid ratios, visceral adiposity indicators, and the triglycerides and glucose index as risk markers of insulin resistance.

PubMed

Du, Tingting; Yuan, Gang; Zhang, Muxun; Zhou, Xinrong; Sun, Xingxing; Yu, Xuefeng

2014-10-20

To directly compare traditional lipid ratios (total cholesterol [TC]/high density lipoprotein cholesterol [HDL-C], non-HDL-C/HDL-C, low density lipoprotein cholesterol [LDL-C]/HDL-C, and triglycerides [TG]/HDL-C), apolipoprotein B (apoB)/apolipoprotein A-I (apoA-I) ratio, visceral adiposity index (VAI), lipid accumulation product (LAP), and the product of TG and fasting glucose (TyG) for strength and independence as risk factors for insulin resistance (IR). We conducted a cross-sectional analysis of 7629 Chinese adults using data from the China Health and Nutrition Survey 2009. For all lipid ratios (traditional lipid ratios and apoB/apoA-I), among both sexes, TG/HDL-C explained the most additional percentage of variation in HOMA-IR (2.9% in men, and 2.3% in women); for all variables of interest, the variability in HOMA-IR explained by VAI and TG/HDL-C were comparable; TyG had the most significant association with HOMA-IR, which explained 9.1% for men and 7.8% for women of the variability in HOMA-IR. Logistic regression analysis showed the similar patterns. Receiver operating characteristic (ROC) curve analysis showed that, among both sexes, TG/HDL-C was a better discriminator of IR than apoB/apoA-I; the area under the ROC curve (AUC) for VAI (0.695 in men and 0.682 in women) was greater than that for TG/HDL-C (AUC 0.665 in men and 0.664 in women); TyG presented the greatest value of AUC (0.709 in men and 0.711 in women). The apoB/apoA-I performs no better than any of the traditional lipid ratios in correlating with IR. The TG/HDL-C, VAI and TyG are better markers for early identification of IR individuals.

Short-term isocaloric fructose restriction lowers apoC-III levels and yields less atherogenic lipoprotein profiles in children with obesity and metabolic syndrome.

PubMed

Gugliucci, Alejandro; Lustig, Robert H; Caccavello, Russell; Erkin-Cakmak, Ayca; Noworolski, Susan M; Tai, Viva W; Wen, Michael J; Mulligan, Kathleen; Schwarz, Jean-Marc

2016-10-01

Dietary fructose may play a role in the pathogenesis of metabolic syndrome (MetS). In a recently published study of obese children with MetS, we showed that isocaloric fructose restriction reduced fasting triglyceride (TG) and LDL-cholesterol (LDL-C). In these ancillary analyses, we tested the hypothesis that these effects were also accompanied by improved quantitative and qualitative changes in LDL and HDL subclasses and their apolipoproteins; as well as change in VLDL, particularly apoC-III. Obese children with MetS (n = 37) consumed a diet that matched self-reported macronutrient composition for nine days, with the exception that dietary fructose was reduced from 11.7 ± 4.0% to 3.8 ± 0.5% of daily calories and substituted with glucose (in starch). Participants underwent fasting biochemical analyses on Days 0 and 10. HDL and LDL subclasses were analyzed using the Lipoprint HDL and LDL subfraction analysis systems from Quantimetrix. Significant reductions in apoB (78 ± 24 vs. 66 ± 24 mg/dl) apoC-III (8.7 ± 3.5 vs. 6.5 ± 2.6 mg/dl) and apoE (4.6 ± 2.3 vs. 3.6 ± 1.1 mg/dl), all p < 0.001) were observed. LDL size increased by 0.87 Å (p = 0.008). Small dense LDL was present in 25% of our cohort and decreased by 68% (p = 0.04). Small HDL decreased by 2.7% (p < 0.001) and large HDL increased by 2.4% (p = 0.04). The TG/HDL-C ratio decreased from 3.1 ± 2.5 to 2.4 ± 1.4 (p = 0.02). These changes in fasting lipid profiles correlated with changes in insulin sensitivity. Isocaloric fructose restriction for 9 days improved lipoprotein markers of CVD risk in children with obesity and MetS. The most dramatic reduction was seen for apoC-III, which has been associated with atherogenic hypertriglyceridemia. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

DIETARY MANAGEMENT FOR DYSLIPIDEMIA IN LIVER TRANSPLANT RECIPIENTS.

PubMed

Pinto, Andressa S; Chedid, Marcio F; Guerra, Léa T; Cabeleira, Daiane D; Kruel, Cleber D P

2016-01-01

Dyslipidemia occurs in approximately 70% of all liver transplant (LT) recipients, and no prior control studies have demonstrated any dietary intervention to change it. To analyze the effects of a dietary intervention on the lipid profile of dyslipidemic LT recipients. All LT recipients with dyslipidemia on clinical follow-up were enrolled. Anthropometric evaluation, food history, body composition (bioimpedance) and assessment of basal metabolism through indirect calorimetry were performed. Patients met with a dietitian and an individualized diet based on estimate of basal metabolism and consisting of 25% of the total energy value in total fat and <200 mg/day of cholesterol was prescribed. Total cholesterol (TC), HDL-cholesterol (HDL), LDL-cholesterol (LDL), triglycerides (TG) and anthropometric measures were measured at baseline and six months after intervention. Fifty-thee out of 56 patients concluded follow-up; age was 59±10 years; 29 were men (51.8%). The analysis pre- and post-intervention were, respectively: TC 238.9±30 and 165.1±35, p<0.001; LDL 154±33 and 90±29, p<0.001; and TG 168 (IQR=51-200) and 137 (IQR=94-177), p=<0.001. They were all modified at six months following intervention. At baseline, none of the patients had normal TC, and only 12 (22.7%) had optimal/near optimal LDL. Following dietary intervention, 45 patients (84.9%) reached normal TC and 50 (94.4%) had optimal/near optimal LDL. HDL and anthropometric measures were not modified. Dietary counseling with prescription of individualized diet based on estimate of basal metabolism through indirect calorimetry was able to manage dyslipidemia in most LT recipients; so, all dyslipidemic LT recipients must be enrolled on a dietary program. A dislipidemia ocorre em aproximadamente 70% de todos os pacientes transplantados de fígado em acompanhamento ambulatorial. Não há relato prévio de qualquer intervenção dietética que houvesse controlado a dislipidemia nesse grupo de pacientes. Analisar

Effects of non-surgical periodontal therapy on serum lipids and C-reactive protein among hyperlipidemic patients with chronic periodontitis.

PubMed

Tawfig, Ahmed

2015-05-01

To evaluate the effect of non-surgical periodontal therapy on plasma lipid levels in hyperlipidemic patients with chronic periodontitis. After considering the inclusion and exclusion criteria, 30 hyperlipidemic patients with chronic periodontitis in the age group of 30-70 years, undergoing treatment in Ahmed Gasim Cardiac and Renal transplant Centre in north Sudan were recruited for the study. Patients were randomly assigned to the study and control groups. The study group received non-surgical periodontal therapy - oral hygiene instructions, scaling and root planing. The control group participants received only oral hygiene instructions. Lipid profile [total cholesterol (TC), low density lipoprotein (LDL), high density lipoprotein (HDL), triglycerides (TG)], C-reactive protein (CRP), and periodontal parameters [Plaque index (PI), Gingival index (GI), probing pocket depth (PD), and attachment loss (ATL)] were measured and compared at baseline and after 3 months of the respective intervention. Between-groups analysis was done using independent "t" test and within-group analysis was done using dependent "t" test. At baseline, groups were comparable based on lipid profile and periodontal parameters. After 3 months, the control group showed significant decrease in the PI and GI scores while there was no significant change in the other parameters. However, the study group showed significant decrease in the LDL and CRP levels along with a significant decrease in PD, ATL, PI, and GI scores, compared to the baseline values. Local non-surgical periodontal therapy resulted in improved periodontal health, with significant decrease in the LDL and CRP levels in hyperlipidemic patients with chronic periodontitis. Hence, local non-surgical periodontal therapy may be considered as an adjunct in the control of hyperlipidemia, along with standard care.

Detection of c. -32T>G (IVS1-13T>G) mutation of Pompe disease by real-time PCR in dried blood spot specimen.

PubMed

Bobillo Lobato, Joaquin; Sánchez Peral, Blas A; Durán Parejo, Pilar; Jiménez Jiménez, Luis M

2013-03-15

Pompe disease, or acid maltase deficiency, is a genetic muscle disorder caused by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme, which is essential for the degradation of glycogen to glucose in lysosomes. The wide clinical variability is resulted from genetic heterogeneity, and many different mutations of the GAA gene have been reported. Some of these mutations are associated with specific phenotypes, such as the c. -32T>G (IVS1-13T>G) mutation seen in late-onset Pompe disease. We used a real-time PCR, after genomic DNA extraction isolated from DBS (dried blood spots) and PCR amplification. Our results successfully detected in controls and patients have been 100% concordant with sequencing results. This assay combines simple sample processing and rapid analysis and it allows to detect the patients with a milder form and slower progression of this disease with a high reliability. Copyright © 2013 Elsevier B.V. All rights reserved.

[Association between chronic periodontitis and hyperlipidemia: a Meta-analysis based on observational studies].

PubMed

Lianhui, Yang; Meifei, Lian; Zhongyue, Hu; Yunzhi, Feng

2017-08-01

Objective The aim of this study is to evaluate the relationship between periodontitis and hyperlipidemia risks through Meta-analysis. Methods Two researchers conducted an electronic search on PubMed, Cochrane Library, Embase, CBM, CNKI, Wanfang and VIP databases established until July 2016 for observational studies on the association between periodontitis and hyperlipidemia. The language used was limited to Chinese and English. After data extraction and quality evaluation of included trials, Meta-analysis was conducted using the RevMan 5.3 software. The GRADE 3.6 software was used to evaluate the quality level of the evidence. Results Six case-control studies and one cohort study were included. The results of Meta-analysis showed that serum triglyceride (TG) in patients with periodontitis was significantly higher than that of the periodontal health group (MD=50.50, 95% confidence interval=39.57-61.42, P<0.000 01), as well as serum total cholesterol (TC) (MD=17.54, 95% confidence interval=10.91-24.18, P<0.000 01). Furthermore, the risks of TG and TC in the serum of patients with chronic periodontitis were 4.73 times (OR=4.73, 95% confidence interval=2.74-8.17, P<0.000 01) and 3.62 times (OR=3.62, 95% confidence interval=2.18-6.03, P<0.000 01) of that of periodontal healthy patients. No significant difference was observed between the group with high-density lipoprotein cholesterol (HDL-C) and that with low density lipoprotein cholesterol (LDL-C). Conclusion Current evidence indicates that a correlation exists between chronic periodontitis and hyperlipidemia, and chronic periodontitis is an independent risk factor for hyperlipidemia, especially for TC and TG in serum.

The contribution of the SPINK1 c.194+2T>C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients.