Sample records for time-resolved fluorescence spectroscopy

  1. Emerging biomedical applications of time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Lakowicz, Joseph R.; Szmacinski, Henryk; Koen, Peter A.

    1994-07-01

    Time-resolved fluorescence spectroscopy is presently regarded as a research tool in biochemistry, biophysics, and chemical physics. Advances in laser technology, the development of long-wavelength probes, and the use of lifetime-based methods are resulting in the rapid migration of time-resolved fluorescence to the clinical chemistry lab, to the patient's bedside, to flow cytometers, to the doctor's office, and even to home health care. Additionally, time-resolved imaging is now a reality in fluorescence microscopy, and will provide chemical imaging of a variety of intracellular analytes and/or cellular phenomena. In this overview paper we attempt to describe some of the opportunities available using chemical sensing based on fluorescence lifetimes, and to predict those applications of lifetime-based sensing which are most likely in the near future.

  2. Time-resolved Hyperspectral Fluorescence Spectroscopy using Frequency Modulated Excitation

    SciTech Connect

    ,; Neill, M

    2012-07-01

    An intensity-modulated excitation light source is used together with a micro channel plate intensified CCD (ICCD) detector gated at a slightly different frequency to generate a beat frequency from a fluorescent sample. The addition of a spectrograph produces a hyperspectral time-resolved data product where the resulting beat frequency is detected with a low frame rate camera. Measuring the beat frequency of the spectrum as a function of time allows separation of the excited fluorescence from ambient constant light sources. The excitation and detector repetition rates are varied over a range of discrete frequencies, and the phase shift of the beat wave maps out the emission decay rate(s).

  3. Excitation emission and time-resolved fluorescence spectroscopy of selected varnishes used in historical musical instruments

    Microsoft Academic Search

    Austin Nevin; Jean-Philippe Echard; Mathieu Thoury; Daniela Comelli; Gianluca Valentini; Rinaldo Cubeddu

    2009-01-01

    The analysis of various varnishes from different origins, which are commonly found on historical musical instruments was carried out for the first time with both fluorescence excitation emission spectroscopy and laser-induced time-resolved fluorescence spectroscopy. Samples studied include varnishes prepared using shellac, and selected diterpenoid and triterpenoid resins from plants, and mixtures of these materials. Fluorescence excitation emission spectra have been

  4. Automation of the Laguerre Expansion Technique for Analysis of Time-resolved Fluorescence Spectroscopy Data 

    E-print Network

    Dabir, Aditi Sandeep

    2010-07-14

    Time-resolved fluorescence spectroscopy (TRFS) is a powerful analytical tool for quantifying the biochemical composition of organic and inorganic materials. The potentials of TRFS as nondestructive clinical tool for tissue diagnosis have been...

  5. Development of a Time Resolved Fluorescence Spectroscopy System for Near Real-Time Clinical Diagnostic Applications 

    E-print Network

    Trivedi, Chintan A.

    2010-07-14

    The design and development of a versatile time resolved fluorescence spectroscopy (TRFS) system capable of near real time data acquisition and processing for potential clinical diagnostic applications is reported. The TRFS apparatus is portable...

  6. Excitation emission and time-resolved fluorescence spectroscopy of selected varnishes used in historical musical instruments.

    PubMed

    Nevin, Austin; Echard, Jean-Philippe; Thoury, Mathieu; Comelli, Daniela; Valentini, Gianluca; Cubeddu, Rinaldo

    2009-11-15

    The analysis of various varnishes from different origins, which are commonly found on historical musical instruments was carried out for the first time with both fluorescence excitation emission spectroscopy and laser-induced time-resolved fluorescence spectroscopy. Samples studied include varnishes prepared using shellac, and selected diterpenoid and triterpenoid resins from plants, and mixtures of these materials. Fluorescence excitation emission spectra have been collected from films of naturally aged varnishes. In parallel, time-resolved fluorescence spectroscopy of varnishes provides means for discriminating between short- (less than 2.0 ns) and long-lived (greater than 7.5 ns) fluorescence emissions in each of these complex materials. Results suggest that complementary use of the two non destructive techniques allows a better understanding of the main fluorophores responsible for the emission in shellac, and further provides means for distinguishing the main classes of other varnishes based on differences in fluorescence lifetime behaviour. Spectrofluorimetric data and time resolved spectra presented here may form the basis for the interpretation of results from future in situ fluorescence examination and time resolved fluorescence imaging of varnished musical instruments. PMID:19782228

  7. Time-resolved two-photon excited fluorescence spectroscopy based on a streak camera

    NASA Astrophysics Data System (ADS)

    Liu, Lixin; Qu, Junle; Chen, Danni; Lin, Ziyang; Xu, Gaixia; Guo, Baoping; Niu, Hanben

    2006-09-01

    Combination of fluorescence spectral and temporal resolutions can improve the sensitivity and specificity of biomedical diagnostics. In this paper, we present the development of a time resolved two-photon excited fluorescence spectroscopy system that consists of a Ti: Sapphire femtosecond laser, a fluorescence microscope objective, a prism spectrophotometer and a high repetition rate picosecond streak camera. The streak camera and the time-resolved fluorescence spectroscopy system. have been calibrated with an F-P etalon and a spectral line lamp respectively. Validation experiment of the system is also performed on two standard fluorescent dyes (Rhodamine 6G and Coumarin 314), and the results agree well with those reported in the literatures. Preliminary experimental results on autofluorescence spectra and lifetimes of freshly picked leaves and in vivo human skin are also presented, which demonstrates the potential applications of this system in tissue discrimination and clinical diagnostics.

  8. Classification of aortic atherosclerotic lesions with time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Maarek, Jean-Michel I.; Marcu, Laura; Grundfest, Warren S.; Fishbein, Michael C.

    1999-07-01

    In this study, we examine the possibility of differentiating between classes of atherosclerotic lesions based on time- resolved fluorescence spectroscopy and we compare the performance of classification schemes that use either the time-resolved spectra or only the intensity spectra. Transient fluorescence emissions induced by pulsed nitrogen laser excitation was measured on 87 excised samples of human aorta. The samples were classified histologically using the AHA classification Predictor variables derived from the time-resolved spectra included the spectral intensities at 360-510 nm and parameters of a biexponential fit of the fluorescence impulse response function. Stepwise discriminant analysis using these predict variables showed that a few predictor variables sufficed to correctly classify 89 percent of the samples. Excluding the time- dependent decay and using only the spectral intensities, the percentage of correctly classified cases was significantly lower: 51 percent. These results establish that time- resolved fluorescence spectroscopy markedly improved on the performance of steady-state fluorescence spectroscopy for fine classification of atherosclerotic lesions.

  9. Multispectral scanning time-resolved fluorescence spectroscopy (TRFS) technique for intravascular diagnosis

    PubMed Central

    Xie, Hongtao; Bec, Julien; Liu, Jing; Sun, Yang; Lam, Matthew; Yankelevich, Diego R.; Marcu, Laura

    2012-01-01

    This study describes a scanning time-resolved fluorescence spectroscopy (TRFS) system designed to continuously acquire fluorescence emission and to reconstruct fluorescence lifetime images (FLIM) from a luminal surface by using a catheter-based optical probe with rotary joint and pull-back device. The ability of the system to temporally and spectrally resolve the fluorescence emission from tissue was validated using standard dyes and tissue phantoms (e.g., ex vivo pig aorta phantom). Current results demonstrate that this system is capable to reliably resolve the fluorescence emission of multiple fluorophores located in the lumen; and suggest its potential for intravascular detection of distinct biochemical features of atherosclerotic plaques. PMID:22808425

  10. Validation of a time-resolved fluorescence spectroscopy apparatus in a rabbit atherosclerosis model

    NASA Astrophysics Data System (ADS)

    Fang, Qiyin; Jo, Javier A.; Papaioannou, Thanassis; Dorafshar, Amir; Reil, Todd; Qiao, Jian-Hua; Fishbein, Michael C.; Freischlag, Julie A.; Marcu, Laura

    2004-07-01

    Time-resolved laser-induced fluorescence spectroscopy (tr-LIFS) has been studied as a potential tool for in vivo diagnosis of atherosclerotic lesions. This study is to evaluate the potential of a compact fiber-optics based tr-LIFS instrument developed in our laboratory for in vivo analysis of atherosclerotic plaque composition. Time-resolved fluorescence spectroscopy studies were performed in vivo on fifteen New Zealand White rabbits (atherosclerotic: N=8, control: N=7). Time-resolved fluorescence spectra were acquired (range: 360-600 nm, increment: 5 nm, total acquisition time: 65 s) from normal aorta wall and lesions in the abdominal aorta. Data were analyzed in terms of fluorescence emission spectra and wavelength specific lifetimes. Following trichrome staining, tissue specimens were analyzed histopathologically in terms of intima/media thickness and biochemical composition (collagen, elastin, foam cells, and etc). Based on intimal thickness, the lesions were divided into thin and thick lesions. Each group was further separated into two categories: collagen rich lesions and foam cell rich lesions based on their biochemical composition. The obtained spectral and time domain fluorescence signatures were subsequently correlated to the histopathological findings. The results have shown that time-domain fluorescence spectral features can be used in vivo to separate atherosclerotic lesions from normal aorta wall as well discrimination within certain types of lesions.

  11. Time-resolved fluorescence spectroscopy for application to PAH contaminated areas and hydrogeological research

    SciTech Connect

    Kotzick, R.; Haaszio, S.; Niessner, R. [Technical Univ. of Munich (Germany). Institute for Hydrochemistry

    1995-12-31

    A mobile fiber-optical sensor system for the on-line and in situ detection of aquatic fluorophores has been developed. By the use of time-resolved laser-induced fluorescence spectroscopy the determination of contaminants i.e. polycyclic aromatic hydrocarbons (PAH) or fluorescence tracers in various environments is possible. In both cases attempts to detect these substances in water by means of fluorescence spectroscopy are complicated by the low concentrations and the overlapping and featureless fluorescence spectroscopy are complicated by the low concentrations and the overlapping and featureless fluorescence spectra in combination with background fluorescence caused by further compounds e.g. humic material. By collecting the fluorescence decay time as an additional independent dimension, the analytical information is significantly increased, and to certain extent the determination of the desired analyte in complex natural matrices is possible. At a first application, the detection of pyrene (PYR) in real samples from a contaminated former coking plant site has been realized. The system is also best suitable for hydrogeological research. Here applications spread from the investigation of the fluorescence tracer migration in an artificial aquifer system to the determination of hydrogeological parameters at a domestic waste disposal.

  12. Time-Resolved Fluorescence Spectroscopy as a Diagnostic Technique of Oral Carcinoma

    PubMed Central

    Farwell, D. Gregory; Meier, Jeremy D.; Park, Jesung; Sun, Yang; Coffman, Heather; Poirier, Brian; Phipps, Jennifer; Tinling, Steve; Enepekides, Danny J.; Marcu, Laura

    2014-01-01

    Objective To investigate the benefit of using time-resolved, laser-induced fluorescence spectroscopy for diagnosing malignant and premalignant lesions of the oral cavity. Design The carcinogen 7,12-dimethylbenz[a]anthracene (DMBA) was applied to 1 cheek pouch of 19 hamsters. The contralateral pouch and the cheek pouches of 3 hamsters without DMBA exposure served as controls. Setting University of California, Davis. Participants Twenty-two golden/Syrian hamsters. Intervention A nitrogen pulse laser was used to induce tissue autofluorescence between the wavelengths of 360 and 650 nm. Main Outcome Measures Spectral intensities and time-domain measurements were obtained and compared with the histopathologic findings at each corresponding site. Results Spectral intensities and lifetime values at 3 spectral bands (SBs; SB1=380±10 nm; SB2=460±10 nm, and SB3 = 635 ± 10 nm) allowed for discrimination among healthy epithelium, dysplasia, carcinoma in situ, and invasive carcinoma. The lifetime values at SB2 were the most important when distinguishing the lesions using only time-resolved parameters. An algorithm combining spectral fluorescence parameters derived from both spectral and time-domain parameters (peak intensities, average fluorescence lifetimes, and the Laguerre coefficient [zero-order]) for healthy epithelium, dysplasia, carcinoma in situ, and invasive carcinoma provided the best diagnostic discrimination, with 100%, 100%, 69.2%, and 76.5% sensitivity and 100%, 92.2%, 97.1%, and 96.2% specificity, respectively. Conclusions The addition of time-resolved fluorescence-derived parameters significantly improves the capability of fluorescence spectroscopy–based diagnostics in the hamster buccal pouch. This technique provides a potential non-invasive diagnostic instrument for head and neck cancer. PMID:20157056

  13. Design and evaluation of a device for fast multispectral time-resolved fluorescence spectroscopy and imaging

    SciTech Connect

    Yankelevich, Diego R. [Department of Electrical and Computer Engineering, University of California, 3101 Kemper Hall, Davis, California 95616 (United States) [Department of Electrical and Computer Engineering, University of California, 3101 Kemper Hall, Davis, California 95616 (United States); Department of Biomedical Engineering, University of California, 451 Health Sciences Drive, Davis, California 95616 (United States); Ma, Dinglong; Liu, Jing; Sun, Yang; Sun, Yinghua; Bec, Julien; Marcu, Laura, E-mail: lmarcu@ucdavis.edu [Department of Biomedical Engineering, University of California, 451 Health Sciences Drive, Davis, California 95616 (United States)] [Department of Biomedical Engineering, University of California, 451 Health Sciences Drive, Davis, California 95616 (United States); Elson, Daniel S. [Hamlyn Centre for Robotic Surgery, Department of Surgery and Cancer, Imperial College London, Exhibition Road, London SW7 2AZ (United Kingdom)] [Hamlyn Centre for Robotic Surgery, Department of Surgery and Cancer, Imperial College London, Exhibition Road, London SW7 2AZ (United Kingdom)

    2014-03-15

    The application of time-resolved fluorescence spectroscopy (TRFS) to in vivo tissue diagnosis requires a method for fast acquisition of fluorescence decay profiles in multiple spectral bands. This study focusses on development of a clinically compatible fiber-optic based multispectral TRFS (ms-TRFS) system together with validation of its accuracy and precision for fluorescence lifetime measurements. It also presents the expansion of this technique into an imaging spectroscopy method. A tandem array of dichroic beamsplitters and filters was used to record TRFS decay profiles at four distinct spectral bands where biological tissue typically presents fluorescence emission maxima, namely, 390, 452, 542, and 629 nm. Each emission channel was temporally separated by using transmission delays through 200 ?m diameter multimode optical fibers of 1, 10, 19, and 28 m lengths. A Laguerre-expansion deconvolution algorithm was used to compensate for modal dispersion inherent to large diameter optical fibers and the finite bandwidth of detectors and digitizers. The system was found to be highly efficient and fast requiring a few nano-Joule of laser pulse energy and <1 ms per point measurement, respectively, for the detection of tissue autofluorescent components. Organic and biological chromophores with lifetimes that spanned a 0.8–7 ns range were used for system validation, and the measured lifetimes from the organic fluorophores deviated by less than 10% from values reported in the literature. Multi-spectral lifetime images of organic dye solutions contained in glass capillary tubes were recorded by raster scanning the single fiber probe in a 2D plane to validate the system as an imaging tool. The lifetime measurement variability was measured indicating that the system provides reproducible results with a standard deviation smaller than 50 ps. The ms-TRFS is a compact apparatus that makes possible the fast, accurate, and precise multispectral time-resolved fluorescence lifetime measurements of low quantum efficiency sub-nanosecond fluorophores.

  14. Design and evaluation of a device for fast multispectral time-resolved fluorescence spectroscopy and imaging.

    PubMed

    Yankelevich, Diego R; Ma, Dinglong; Liu, Jing; Sun, Yang; Sun, Yinghua; Bec, Julien; Elson, Daniel S; Marcu, Laura

    2014-03-01

    The application of time-resolved fluorescence spectroscopy (TRFS) to in vivo tissue diagnosis requires a method for fast acquisition of fluorescence decay profiles in multiple spectral bands. This study focusses on development of a clinically compatible fiber-optic based multispectral TRFS (ms-TRFS) system together with validation of its accuracy and precision for fluorescence lifetime measurements. It also presents the expansion of this technique into an imaging spectroscopy method. A tandem array of dichroic beamsplitters and filters was used to record TRFS decay profiles at four distinct spectral bands where biological tissue typically presents fluorescence emission maxima, namely, 390, 452, 542, and 629 nm. Each emission channel was temporally separated by using transmission delays through 200 ?m diameter multimode optical fibers of 1, 10, 19, and 28 m lengths. A Laguerre-expansion deconvolution algorithm was used to compensate for modal dispersion inherent to large diameter optical fibers and the finite bandwidth of detectors and digitizers. The system was found to be highly efficient and fast requiring a few nano-Joule of laser pulse energy and <1 ms per point measurement, respectively, for the detection of tissue autofluorescent components. Organic and biological chromophores with lifetimes that spanned a 0.8-7 ns range were used for system validation, and the measured lifetimes from the organic fluorophores deviated by less than 10% from values reported in the literature. Multi-spectral lifetime images of organic dye solutions contained in glass capillary tubes were recorded by raster scanning the single fiber probe in a 2D plane to validate the system as an imaging tool. The lifetime measurement variability was measured indicating that the system provides reproducible results with a standard deviation smaller than 50 ps. The ms-TRFS is a compact apparatus that makes possible the fast, accurate, and precise multispectral time-resolved fluorescence lifetime measurements of low quantum efficiency sub-nanosecond fluorophores. PMID:24689603

  15. Development of a Time Resolved Fluorescence Spectroscopy System for Near Real-Time Clinical Diagnostic Applications

    E-print Network

    Trivedi, Chintan A.

    2010-07-14

    sensitive to the biological micro- environment, thus providing more information about the tissue as compared to steady state fluorescence. Several groups have demonstrated the application of TRFS as a clinical diagnostic tool using different approaches.13... of fluorescence due to the presence of molecular quenchers such as oxygen32 in the tissue micro environment are difficult to interpret using steady state fluorescence.33 Time resolved measurements measure the lifetimes of the fluorophores. Time resolved...

  16. Use of time-resolved fluorescence spectroscopy to evaluate diagnostic value of collagen degradation products.

    PubMed

    Sikora, Joanna; Cyrankiewicz, Micha?; Wybranowski, Tomasz; Ziomkowska, Blanka; O?mia?owski, Borys; Obo?ska, Ewa; Augusty?ska, Beata; Kruszewski, Stefan; Kubica, Jacek

    2015-05-01

    The concentration of collagen degradation products (CDPs) may reflect the process of left ventricular remodeling (LVR). The aim of this study was to evaluate the potential diagnostic usefulness of time-resolved fluorescence spectroscopy (TRFS) in assessment of CDPs. The preliminary experiment was designed to establish if CDPs’ characteristics might be visible by mean fluorescence lifetime (FLT) in determined conditions. The in vitro model of CDPs was prepared by conducting the hydrolysis of type III collagen. The FLT of samples was measured by the time-resolved spectrometer Life Spec II with the subnanosecond pulsed 360-nm EPLED diode. The FLTs were obtained by deconvolution analysis of the data using a multiexponential model of fluorescence decay. In order to determine the limit of traceability of CDPs, a comparison of different collagen/plasma ratio in samples was performed. The results of our study showed that the increase of added plasma to hydrolyzed collagen extended the mean FLT. Thus, the diagnosis of LVR based on measurements using TRFS is possible. However, it is important to point out the experiment was preliminary and further investigation in this field of research is crucial. PMID:25764396

  17. Structure and dynamics of a DNA: polymerase complex by time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Millar, David P.; Benkovic, Stephen J.

    1990-05-01

    The interaction of a fluorescent DNA primer:template with the Klenow fragment of DNA polymerase I has been studied in solution using time-resolved fluorescence spectroscopy. The excited-state decay behavior and internal reorientation dynamics of a dansyl sulfonamide probe connected by a propyl chain to a modified uridine base in the primer strand were very sensitive to the local probe environment and exhibited characteristic changes upon binding of Kienow fragment to the DNA and elongation of the primer strand. Between 5 and 7 bases of duplex DNA upstream of the 3' primer terminus were protected from the solvent by the Kienow fragment and the strength of DNA:protein contacts varied within this region, being strongest at the 3' primer terminus. About 5% of the substrates were bound in a second spatially distinct site on the enzyme. Site-directed mutagenesis of the Kienow fragment was consistent with this being the active site for 3'->5' exonuclease activity.

  18. Time-resolved spectroscopy of the probe fluorescence in the study of human blood protein dynamic structure on SR beam

    NASA Astrophysics Data System (ADS)

    Dobretsov, G. E.; Kurek, N. K.; Syrejshchikova, T. I.; Yakimenko, M. N.; Clarke, D. T.; Jones, G. R.; Munro, I. H.

    2000-06-01

    Time-resolved spectroscopy on the SRS of the Daresbury Laboratory was used for the study of the human serum lipoproteins and human blood albumins with fluorescent probes K-37 and K-35, developed in Russia. The probe K-37 was found sensitive to the difference in dynamic properties of the lipid objects. Two sets of the parameters were used for the description of lipid dynamic structure: (1) time-resolved fluorescence spectra and (2) time-resolved fluorescence depolarization as a function of rotational mobility of lipid molecules. Each measured dynamic parameter reflected the monotonous changes of dynamic properties in the range: lipid spheres-very low density lipoproteins-low density lipoproteins-high density lipoproteins-phospholipid liposomes. The range is characterized by the increase of the ratio polar/ nonpolar lipids. Thus, time-resolved fluorescence could be used to detect some structural modifications in lipoproteins related to atherosclerosis and subsequent cardiovascular diseases development.

  19. Uranyl sorption onto gibbsite studied by time-resolved laser-induced fluorescence spectroscopy (TRLFS).

    PubMed

    Baumann, Nils; Brendler, Vinzenz; Arnold, Thuro; Geipel, Gerhard; Bernhard, Gert

    2005-10-15

    Time-resolved laser-induced fluorescence spectroscopy (TRLFS) was combined with batch experiments to study the sorption of uranium(VI) onto gibbsite (gamma-Al(OH)3). The experiments were performed under ambient conditions in 0.1 M NaClO4 solution in the pH range from 5.0 to 8.5 using a total uranium concentration of 1x10(-5) M, and a solid concentration of 0.5 g/40 ml. Two uranyl surface species with fluorescence lifetimes of 330+/-115 and 5600+/-1640 ns, respectively, were identified. The first species was dominating the more acid pH region whereas the second one became gradually more prominent towards higher pH values. The fluorescence spectra of both adsorbed uranyl(VI) surface species were described with six characteristic fluorescence emission bands situated at 479.5+/-1.1, 497.4+/-0.8, 518.7+/-1.0, 541.6+/-0.7, 563.9+/-1.2, and 585.8+/-2.1 nm. The surface species with the short-lived fluorescence lifetime of 330 ns is attributed to a bidentate mononuclear inner-sphere surface complex in which the uranyl(VI) is bound to two reactive OH- groups at the broken edge linked to one Al. The second surface species with the significant longer fluorescence lifetime of 5600 ns was attributed to small sorbed clusters of polynuclear uranyl(VI) surface species. The longer fluorescence lifetime of the long-lived uranyl surface species at pH 8.5 is explained with the growing average size of the adsorbed polynuclear uranyl surface species. PMID:16129445

  20. Light adaptation of the unicellular red alga, Cyanidioschyzon merolae, probed by time-resolved fluorescence spectroscopy.

    PubMed

    Ueno, Yoshifumi; Aikawa, Shimpei; Kondo, Akihiko; Akimoto, Seiji

    2015-08-01

    Photosynthetic organisms change the quantity and/or quality of their pigment-protein complexes and the interactions among these complexes in response to light conditions. In the present study, we analyzed light adaptation of the unicellular red alga Cyanidioschyzon merolae, whose pigment composition is similar to that of cyanobacteria because its phycobilisomes (PBS) lack phycoerythrin. C. merolae were grown under different light qualities, and their responses were measured by steady-state absorption, steady-state fluorescence, and picosecond time-resolved fluorescence spectroscopies. Cells were cultivated under four monochromatic light-emitting diodes (blue, green, yellow, and red), and changes in pigment composition and energy transfer were observed. Cells grown under blue and green light increased their relative phycocyanin levels compared with cells cultured under white light. Energy-transfer processes to photosystem I (PSI) were sensitive to yellow and red light. The contribution of direct energy transfer from PBS to PSI increased only under yellow light, while red light induced a reduction in energy transfer from photosystem II to PSI and an increase in energy transfer from light-harvesting chlorophyll protein complex I to PSI. Differences in pigment composition, growth, and energy transfer under different light qualities are discussed. PMID:25577254

  1. Adsorption of uranyl on gibbsite: A time-resolved laser-induced fluorescence spectroscopy study.

    PubMed

    Chang, Hyun-Shik; Korshin, Gregory V; Wang, Zheming; Zachara, John M

    2006-02-15

    Uranyl adsorbed on gibbsite at pH 4.0-8.0 and ionic strengths (ISs) 0.001-0.4 M (NaClO4) in the absence of carbonate was studied using time-resolved laser-induced fluorescence spectroscopy (TRLIFS) under cryogenic conditions. TRLIFS data showed the presence of several distinct emission components. Their contributions were determined using the evolving factor analysis approach. Four components denoted as species A, B, C, and D were discerned. Each of them was characterized by a characteristic response to pH and IS changes and also by a unique combination of the values of the fundamental transition energy E0,0, vibronic spacing deltaE, and half-width of the vibronic lines deltaW. Species A and B were major contributors to the overall emission. They were mainly affected by the pH and predominated below and above pH 5.0, respectively. In contrast with that, the contribution of species C was noticeable only at IS = 0.001 M, while it was suppressed or absent at high IS values. It was concluded that species A and B are likely to correspond to inner-sphere surface aluminol complexes =AlO-(UO2)+ and =AlO-(UO2)OH degrees, while species C was hypothesized to correspond to electrostatically bound uranyl complexes (predominantly [UO2(OH)3]-). PMID:16572782

  2. Time resolved fluorescence spectroscopy of quercetin and morin complexes with Al3+.

    PubMed

    Gutierrez, Amanda C; Gehlen, Marcelo H

    2002-01-01

    The association process of Al3+ with quercetin and morin in methanol was studied by electronic absorption and emission spectroscopies. The number of species in solution with different absorption spectra were determined by the method of Rank analysis of the absorbance matrix, and the stoichiometries of the complexes were evaluated using the Job method. The number of fluorescent species in solution were calculated from the Rank analysis method of the time resolved emission spectra (TRES), and compared with a global analysis of the decay surface using a proper multi-exponential decay model. The association of Al3+ with morin gives rise to two complexes with 1:1 and 2:1 (morin: Al3+) stoichiometries, but in both species the association of the cation involves the carbonyl and 3-hydroxyl groups of the pyrone ring. The fluorescence decay surface of this system is biexponential and the lifetimes of the 1:1 and 2:1 complexes are 4.3 and 2.0 ns, respectively. The association of Al3+ with quercetin forms preferentially two complexes with 1:1 and 1:2 (quercetin: Al3+) stoichiometries where the first cation binds to the site of the pyrone ring but the second one is bound to the cathecol group of the molecule. However, the multichelation character of the quercetin ligand allows larger aggregates to be formed, thereby the species Al2Q3 is also detected in methanol. The lifetime of the 1:1 complex is about 2.7 ns, while for 1:2 and 3:2 complexes the lifetimes measured are 3.5 and 1.8 ns, respectively. PMID:11808653

  3. Far-field infrared super-resolution microscopy using picosecond time-resolved transient fluorescence detected IR spectroscopy

    NASA Astrophysics Data System (ADS)

    Sakai, Makoto; Kawashima, Yasutake; Takeda, Akihiro; Ohmori, Tsutomu; Fujii, Masaaki

    2007-05-01

    A new far-field infrared super-resolution microscopy combining laser fluorescence microscope and picosecond time-resolved transient fluorescence detected IR (TFD-IR) spectroscopy is proposed. TFD-IR spectroscopy is a kind of IR-visible/UV double resonance spectroscopy, and detects IR transitions by the transient fluorescence due to electronic transition originating from vibrationally excited level populated by IR light. IR images of rhodamine-6G solution and of fluorescent beads were clearly observed by monitoring the transient fluorescence. Super-resolution twice higher than the diffraction limit for IR light was achieved. The IR spectrum due to the transient fluorescence was also measured from spatial domains smaller than the diffraction limit.

  4. Development of a dual-modal tissue diagnostic system combining time-resolved fluorescence spectroscopy and ultrasonic backscatter microscopy

    Microsoft Academic Search

    Yang Sun; Douglas N. Stephens; Javier A. Jo; Lei Sun; Jonathan M. Cannata; Ramez M. G. Saroufeem; K. Kirk Shung; Laura Marcu

    2009-01-01

    We report a tissue diagnostic system which combines two complementary techniques of time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) and ultrasonic backscatter microscopy (UBM). TR-LIFS evaluates the biochemical composition of tissue, while UBM provides tissue microanatomy and enables localization of the region of diagnostic interest. The TR-LIFS component consists of an optical fiber-based time-domain apparatus including a spectrometer, gated multichannel plate photomultiplier,

  5. TIME-RESOLVED VIBRATIONAL SPECTROSCOPY

    SciTech Connect

    Andrei Tokmakoff, MIT (Conference Chair) [Conference Chair; Paul Champion, Northeastern University; Edwin J. Heilweil, NIST; Keith A. Nelson, MIT; Larry Ziegler, Boston University

    2009-05-14

    This document contains the Proceedings from the 14th International Conference on Time-Resolved Vibrational Spectroscopy, which was held in Meredith, NH from May 9-14, 2009. The study of molecular dynamics in chemical reaction and biological processes using time-resolved spectroscopy plays an important role in our understanding of energy conversion, storage, and utilization problems. Fundamental studies of chemical reactivity, molecular rearrangements, and charge transport are broadly supported by the DOE�s Office of Science because of their role in the development of alternative energy sources, the understanding of biological energy conversion processes, the efficient utilization of existing energy resources, and the mitigation of reactive intermediates in radiation chemistry. In addition, time-resolved spectroscopy is central to all five of DOE�s grand challenges for fundamental energy science. The Time-Resolved Vibrational Spectroscopy conference is organized biennially to bring the leaders in this field from around the globe together with young scientists to discuss the most recent scientific and technological advances. The latest technology in ultrafast infrared, Raman, and terahertz spectroscopy and the scientific advances that these methods enable were covered. Particular emphasis was placed on new experimental methods used to probe molecular dynamics in liquids, solids, interfaces, nanostructured materials, and biomolecules.

  6. Energy transfer in the chlorophyll f-containing cyanobacterium, Halomicronema hongdechloris, analyzed by time-resolved fluorescence spectroscopies.

    PubMed

    Akimoto, Seiji; Shinoda, Toshiyuki; Chen, Min; Allakhverdiev, Suleyman I; Tomo, Tatsuya

    2015-08-01

    We prepared thylakoid membranes from Halomicronema hongdechloris cells grown under white fluorescent light or light from far-red (740 nm) light-emitting diodes, and observed their energy-transfer processes shortly after light excitation. Excitation-relaxation processes were examined by steady-state and time-resolved fluorescence spectroscopies. Two time-resolved fluorescence techniques were used: time-correlated single photon counting and fluorescence up-conversion methods. The thylakoids from the cells grown under white light contained chlorophyll (Chl) a of different energies, but were devoid of Chl f. At room temperature, the excitation energy was equilibrated among the Chl a pools with a time constant of 6.6 ps. Conversely, the thylakoids from the cells grown under far-red light possessed both Chl a and Chl f. Two energy-transfer pathways from Chl a to Chl f were identified with time constants of 1.3 and 5.0 ps, and the excitation energy was equilibrated between the Chl a and Chl f pools at room temperature. We also examined the energy-transfer pathways from phycobilisome to the two photosystems under white-light cultivation. PMID:25648637

  7. Time-Resolved Emission Spectra Of Tryptophan And Proteins From Frequency-Domain Fluorescence Spectroscopy

    NASA Astrophysics Data System (ADS)

    Szmacineki, Henryk; Lakowicz, Joseph R.; Johnson, Michael L.

    1988-06-01

    We report measurements of time-resolved emission spectra of N-acetyl-L-tryptophanamide (NATA), adrenocorticotropic hormone (ACTH, residues 1-24), and of S. Nuclease. These spectra were calculated from the frequency-response of the emission, measured at several wavelengths across the emission spectra. Measurements were performed on samples not quenched and quenched by acrylamide, the latter providing additional information on the short time events. The time-resolved center-of-gravity does not decay as a single exponential. At least two spectral relaxation times are needed to account for the present data. NATA and ACTH each display relaxation times near 50 and 800 ps, which may be characteristic of exposed tryptophan residues. S. nuclease displayed slower relaxation times near 0.5 and 10 ns, which probably reflect the dynamic protein matrix which surrounds the residue.

  8. Development of a dual-modal tissue diagnostic system combining time-resolved fluorescence spectroscopy and ultrasonic backscatter microscopy

    PubMed Central

    Sun, Yang; Park, Jesung; Stephens, Douglas N.; Jo, Javier A.; Sun, Lei; Cannata, Jonathan M.; Saroufeem, Ramez M. G.; Shung, K. Kirk; Marcu, Laura

    2009-01-01

    We report a tissue diagnostic system which combines two complementary techniques of time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) and ultrasonic backscatter microscopy (UBM). TR-LIFS evaluates the biochemical composition of tissue, while UBM provides tissue microanatomy and enables localization of the region of diagnostic interest. The TR-LIFS component consists of an optical fiber-based time-domain apparatus including a spectrometer, gated multichannel plate photomultiplier, and fast digitizer. It records the fluorescence with high sensitivity (nM concentration range) and time resolution as low as 300 ps. The UBM system consists of a transducer, pulser, receiving circuit, and positioning stage. The transducer used here is 45 MHz, unfocused, with axial and lateral resolutions 38 and 200 ?m. Validation of the hybrid system and ultrasonic and spectroscopic data coregistration were conducted both in vitro (tissue phantom) and ex vivo (atherosclerotic tissue specimens of human aorta). Standard histopathological analysis of tissue samples was used to validate the UBM-TRLIFS data. Current results have demonstrated that spatially correlated UBM and TR-LIFS data provide complementary characterization of both morphology (necrotic core and calcium deposits) and biochemistry (collagen, elastin, and lipid features) of the atherosclerotic plaques at the same location. Thus, a combination of fluorescence spectroscopy with ultrasound imaging would allow for better identification of features associated with tissue pathologies. Current design and performance of the hybrid system suggests potential applications in clinical diagnosis of atherosclerotic plaque. PMID:19566223

  9. Development of a dual-modal tissue diagnostic system combining time-resolved fluorescence spectroscopy and ultrasonic backscatter microscopy

    NASA Astrophysics Data System (ADS)

    Sun, Yang; Park, Jesung; Stephens, Douglas N.; Jo, Javier A.; Sun, Lei; Cannata, Jonathan M.; Saroufeem, Ramez M. G.; Shung, K. Kirk; Marcu, Laura

    2009-06-01

    We report a tissue diagnostic system which combines two complementary techniques of time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) and ultrasonic backscatter microscopy (UBM). TR-LIFS evaluates the biochemical composition of tissue, while UBM provides tissue microanatomy and enables localization of the region of diagnostic interest. The TR-LIFS component consists of an optical fiber-based time-domain apparatus including a spectrometer, gated multichannel plate photomultiplier, and fast digitizer. It records the fluorescence with high sensitivity (nM concentration range) and time resolution as low as 300 ps. The UBM system consists of a transducer, pulser, receiving circuit, and positioning stage. The transducer used here is 45 MHz, unfocused, with axial and lateral resolutions 38 and 200 ?m. Validation of the hybrid system and ultrasonic and spectroscopic data coregistration were conducted both in vitro (tissue phantom) and ex vivo (atherosclerotic tissue specimens of human aorta). Standard histopathological analysis of tissue samples was used to validate the UBM-TRLIFS data. Current results have demonstrated that spatially correlated UBM and TR-LIFS data provide complementary characterization of both morphology (necrotic core and calcium deposits) and biochemistry (collagen, elastin, and lipid features) of the atherosclerotic plaques at the same location. Thus, a combination of fluorescence spectroscopy with ultrasound imaging would allow for better identification of features associated with tissue pathologies. Current design and performance of the hybrid system suggests potential applications in clinical diagnosis of atherosclerotic plaque.

  10. Time-resolved spectroscopy and fluorescence resonance energy transfer in the study of excimer laser damage of chromatin

    NASA Astrophysics Data System (ADS)

    Radu, L.; Mihailescu, I.; Radu, S.; Gazdaru, D.

    2007-09-01

    The analysis of chromatin damage produced by a 248 nm excimer laser radiation, for doses of 0.3-3 MJ/m 2 was carried out by time-resolved spectroscopy and fluorescence resonance energy transfer (FRET). The chromatin was extracted from a normal and a tumoral tissue of Wistar rats. The decrease with laser dose of the relative contribution of the excited state lifetimes of ethidium bromide (EtBr) bounded to chromatin constitutes an evidence of the reduction of chromatin deoxyribonucleic acid (DNA) double-strand structure. FRET was performed from dansyl chloride to acridine orange, both coupled to chromatin. The increase of the average distance between these ligands, under the action of laser radiation, reflects a loosening of the chromatin structure. The radiosensitivity of tumor tissue chromatin is higher than that of a normal tissue. The determination of the chromatin structure modification in an excimer laser field can be of interest in laser therapy.

  11. Short-term light adaptation of a cyanobacterium, Synechocystis sp. PCC 6803, probed by time-resolved fluorescence spectroscopy.

    PubMed

    Akimoto, Seiji; Yokono, Makio; Yokono, Erina; Aikawa, Shimpei; Kondo, Akihiko

    2014-08-01

    In photosynthetic organisms, the interactions among pigment-protein complexes change in response to light conditions. In the present study, we analyzed the transfer of excitation energy from the phycobilisome (PBS) and photosystem (PS) II to PSI in the cyanobacterium Synechocystis sp. PCC 6803. After 20 min of dark adaptation, Synechocystis cells were illuminated for 5 min with strong light with different spectral profiles, blue, green, two kinds of red, and white light. After illumination, the energy-transfer characteristics were evaluated using steady-state fluorescence and picosecond time-resolved fluorescence spectroscopy techniques. The fluorescence rise and decay curves were analyzed by global analysis to obtain fluorescence decay-associated spectra, followed by spectral component analysis. Under illumination with strong light, the contribution of the energy transfer from the PSII to PSI (spillover) became greater, and that of the energy transfer from the PBS to PSI decreased; the former change was larger than the latter. The energy transfer pathway to PSI was sensitive to red light. We discuss the short-term adaptation of energy-transfer processes in Synechocystis under strong-light conditions. PMID:24495908

  12. Picosecond time-resolved fluorescence spectroscopy of K-590 in the bacteriorhodopsin photocycle.

    PubMed Central

    Atkinson, G H; Blanchard, D; Lemaire, H; Brack, T L; Hayashi, H

    1989-01-01

    The fluorescence spectrum of a distinct isometric and conformational intermediate formed on the 10(-11) s time scale during the bacteriorhodopsin (BR) photocycle is observed at room temperature using a two laser, pump-probe technique with picosecond time resolution. The BR photocycle is initiated by pulsed (8 ps) excitation at 565 nm, whereas the fluorescence is generated by 4-ps laser pulses at 590 nm. The unstructured fluorescence extends from 650 to 880 nm and appears in the same general spectral region as the fluorescence spectrum assigned to BR-570. The transient fluorescence spectrum can be distinguished from that assigned to BR-570 by a larger emission quantum yield (approximately twice that of BR-570) and by a maximum intensity near 731 nm (shifted 17 nm to higher energy from the maximum of the BR-570 fluorescence spectrum). The fluorescence spectrum of BR-570 only is measured with low energy, picosecond pulsed excitation at 590 nm and is in good agreement with recent data in the literature. The assignment of the transient fluorescence spectrum to the K-590 intermediate is based on its appearance at time delays longer than 40 ps. The K-590 fluorescence spectrum remains unchanged over the entire 40-100-ps interval. The relevance of these fluorescence data with respect to the molecular mechanism used to model the primary processes in the BR photocycle also is discussed. PMID:2713439

  13. Time resolved fluorescence of CdSe nanocrystals using single molecule spectroscopy

    E-print Network

    Fisher, Brent R

    2005-01-01

    A wide variety of spectroscopic studies of CdSe nanocrystals (NCs) are presented in this thesis, all studying some aspect of the temporal evolution of NC fluorescence tinder different conditions. In particular the methods ...

  14. Highly Time Resolved Measurements of OH during POPCORN Using Laser-Induced Fluorescence Spectroscopy

    Microsoft Academic Search

    F. Holland; U. Aschmutat; M. Heßling; A. Hofzumahaus; D. H. Ehhalt

    1998-01-01

    Tropospheric hydroxyl radical (OH) concentrations were measured by laser-induced fluorescence (LIF) during the POPCORN field campaign in August 1994 at a rural site in the North East of Germany. Ambient air spectra were recorded by tuning the laser wavelength over a spectral region covering the Q11(3), Q21(3), and P11(1) rotational transitions of the (0-0) band in the A-X system of

  15. Picosecond time resolved fluorescence spectroscopy study of aggregation of porphyrin derivative Mn(3,4,5-OMeTPP)Cl

    NASA Astrophysics Data System (ADS)

    Chen, Ju-Tao; Yu, Zhen-Xin

    1990-04-01

    The picosecond time-resolved fluorescence spectrum I(?, t) of the porphyrin derivative Mn(3,4,5-OMeTPP)Cl is measured. Experiments show that the fluorescence relaxation of the concentrated sample solution is composed of a fast (ps), a moderately fast (100 ps) and a slow (ns) decay process. Furthermore, the fluorescence spectra for various times after excitation have different shapes. Detailed analysis shows that the fluorescence is composed of three components with different relaxation times and spectrum shapes. The three components are attributed to monomers, dimers, and aggregates respectively.

  16. Detection of high-risk atherosclerotic lesions by time-resolved fluorescence spectroscopy based on the Laguerre deconvolution technique

    NASA Astrophysics Data System (ADS)

    Jo, J. A.; Fang, Q.; Papaioannou, T.; Qiao, J. H.; Fishbein, M. C.; Beseth, B.; Dorafshar, A. H.; Reil, T.; Baker, D.; Freischlag, J.; Marcu, L.

    2006-02-01

    This study introduces new methods of time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) data analysis for tissue characterization. These analytical methods were applied for the detection of atherosclerotic vulnerable plaques. Upon pulsed nitrogen laser (337 nm, 1 ns) excitation, TR-LIFS measurements were obtained from carotid atherosclerotic plaque specimens (57 endarteroctomy patients) at 492 distinct areas. The emission was both spectrally- (360-600 nm range at 5 nm interval) and temporally- (0.3 ns resolution) resolved using a prototype clinically compatible fiber-optic catheter TR-LIFS apparatus. The TR-LIFS measurements were subsequently analyzed using a standard multiexponential deconvolution and a recently introduced Laguerre deconvolution technique. Based on their histopathology, the lesions were classified as early (thin intima), fibrotic (collagen-rich intima), and high-risk (thin cap over necrotic core and/or inflamed intima). Stepwise linear discriminant analysis (SLDA) was applied for lesion classification. Normalized spectral intensity values and Laguerre expansion coefficients (LEC) at discrete emission wavelengths (390, 450, 500 and 550 nm) were used as features for classification. The Laguerre based SLDA classifier provided discrimination of high-risk lesions with high sensitivity (SE>81%) and specificity (SP>95%). Based on these findings, we believe that TR-LIFS information derived from the Laguerre expansion coefficients can provide a valuable additional dimension for the diagnosis of high-risk vulnerable atherosclerotic plaques.

  17. Effect of ouabain on metabolic oxidative state in living cardiomyocytes evaluated by time-resolved spectroscopy of endogenous NAD(P)H fluorescence

    NASA Astrophysics Data System (ADS)

    Chorvatova, Alzbeta; Elzwiei, Fathia; Mateasik, Anton; Chorvat, Dusan

    2012-10-01

    Time-resolved spectrometry of endogenous nicotinamide dinucleotide phosphate [NAD(P)H] fluorescence is a useful method to evaluate metabolic oxidative state in living cells. Ouabain is a well-known pharmaceutical drug used in the treatment of cardiovascular disease, the effects of which on myocardial metabolism were recently demonstrated. Mechanisms implicated in these actions are still poorly understood. We investigate the effect of ouabain on the metabolic oxidative state of living cardiac cells identified by time-resolved fluorescence spectroscopy of mitochondrial NAD(P)H. Spectral unmixing is used to resolve individual NAD(P)H fluorescence components. Ouabain decreased the integral intensity of NAD(P)H fluorescence, leading to a reduced component amplitudes ratio corresponding to a change in metabolic state. We also noted that lactate/pyruvate, affecting the cytosolic NADH gradient, increased the effect of ouabain on the component amplitudes ratio. Cell oxidation levels, evaluated as the percentage of oxidized NAD(P)H, decreased exponentially with rising concentrations of the cardiac glycoside. Ouabain also stimulated the mitochondrial NADH production. Our study sheds a new light on the role that ouabain plays in the regulation of metabolic state, and presents perspective on a noninvasive, pharmaceutical approach for testing the effect of drugs on the mitochondrial metabolism by means of time-resolved fluorescence spectroscopy in living cells.

  18. Photosystem II Does Not Possess a Simple Excitation Energy Funnel: Time-Resolved Fluorescence Spectroscopy Meets Theory

    PubMed Central

    2013-01-01

    The experimentally obtained time-resolved fluorescence spectra of photosystem II (PS II) core complexes, purified from a thermophilic cyanobacterium Thermosynechococcus vulcanus, at 5–180 K are compared with simulations. Dynamic localization effects of excitons are treated implicitly by introducing exciton domains of strongly coupled pigments. Exciton relaxations within a domain and exciton transfers between domains are treated on the basis of Redfield theory and generalized Förster theory, respectively. The excitonic couplings between the pigments are calculated by a quantum chemical/electrostatic method (Poisson-TrEsp). Starting with previously published values, a refined set of site energies of the pigments is obtained through optimization cycles of the fits of stationary optical spectra of PS II. Satisfactorily agreement between the experimental and simulated spectra is obtained for the absorption spectrum including its temperature dependence and the linear dichroism spectrum of PS II core complexes (PS II-CC). Furthermore, the refined site energies well reproduce the temperature dependence of the time-resolved fluorescence spectrum of PS II-CC, which is characterized by the emergence of a 695 nm fluorescence peak upon cooling down to 77 K and the decrease of its relative intensity upon further cooling below 77 K. The blue shift of the fluorescence band upon cooling below 77 K is explained by the existence of two red-shifted chlorophyll pools emitting at around 685 and 695 nm. The former pool is assigned to Chl45 or Chl43 in CP43 (Chl numbering according to the nomenclature of Loll et al. Nature2005, 438, 1040) while the latter is assigned to Chl29 in CP47. The 695 nm emitting chlorophyll is suggested to attract excitations from the peripheral light-harvesting complexes and might also be involved in photoprotection. PMID:23537277

  19. Renato Torre Time-Resolved Spectroscopy

    E-print Network

    Marrucci, Lorenzo

    Renato Torre Editor Time-Resolved Spectroscopy in Complex Liquids An Experimental Perspective #12 in these materials. Moreover they prove the feasibility of a `fluctuating-friction molecular motor', a concept which

  20. Time-resolved fluorescence decay measurements for flowing particles

    DOEpatents

    Deka, C.; Steinkamp, J.A.

    1999-06-01

    Time-resolved fluorescence decay measurements are disclosed for flowing particles. An apparatus and method for the measurement and analysis of fluorescence for individual cells and particles in flow are described, wherein the rapid measurement capabilities of flow cytometry and the robust measurement and analysis procedures of time-domain fluorescence lifetime spectroscopy are combined. A pulse-modulated CW laser is employed for excitation of the particles. The characteristics and the repetition rate of the excitation pulses can be readily adjusted to accommodate for fluorescence decays having a wide range of lifetimes. 12 figs.

  1. Time-resolved fluorescence decay measurements for flowing particles

    DOEpatents

    Deka, Chiranjit (Miami, FL); Steinkamp, John A. (Los Alamos, NM)

    1999-01-01

    Time-resolved fluorescence decay measurements for flowing particles. An apparatus and method for the measurement and analysis of fluorescence for individual cells and particles in flow are described, wherein the rapid measurement capabilities of flow cytometry and the robust measurement and analysis procedures of time-domain fluorescence lifetime spectroscopy are combined. A pulse-modulated cw laser is employed for excitation of the particles. The characteristics and the repetition rate of the excitation pulses can be readily adjusted to accommodate for fluorescence decays having a wide range of lifetimes.

  2. Interaction of quinine sulfate with anionic micelles of sodium dodecylsulfate: A time-resolved fluorescence spectroscopy at different pH.

    PubMed

    Joshi, Sunita; Pant, Debi D

    2015-09-01

    Photophysical behavior and rotational relaxation dynamics of quinine sulfate (QS) in anionic surfactant, sodium dodecylsulfate (SDS) at different pH have been studied using steady state and time resolved fluorescence spectroscopy. It has been observed that the cationic form of quinine sulfate (at pH 2) forms a fluorescent ion pair complex with the surfactant molecules at lower concentrations of surfactant. However, for higher concentrations of SDS, the probe molecules bind strongly with the micelles and reside at the water-micelle interface. At pH 7, QS is singly protonated in bulk aqueous solution. At lower concentrations of SDS aggregation between probe and surfactant molecules has been observed. However, for higher concentrations of SDS, an additional fluorescence peak corresponding to dicationic form of QS appears and this has been attributed to double protonation of the QS molecule in micellar solution. At pH 7, in the presence of SDS micelles, the photophysical properties of QS showed substantial changes compared to that in the bulk water solution. At pH 12, an increase in fluorescence intensity and lifetime has been observed and this has been attributed to the increase in radiative rate due to the incorporation of QS at the micelle-water interface. The local pH at micellar surface has been found different from the pH of bulk solution. PMID:25863459

  3. Monitoring Local Unfolding of Bovine Serum Albumin During Denaturation Using Steady-State and Time-Resolved Fluorescence Spectroscopy

    Microsoft Academic Search

    Denisio M. Togashi; Alan G. Ryder; Domhnall O’Shaughnessy

    2010-01-01

    In a previous report (J. Fluoresc. 16, 153, 2006) we studied the chaotropiclly induced denaturation of Bovine Serum Albumin (BSA) using the fluorescence decay\\u000a kinetics at different stages in the denaturation of BSA by guanidinium hydrochloride (GuHCl). In this work, we gain a more\\u000a detailed insight into the BSA denaturation process by investigating the thermodynamics of the process. Structural changes

  4. Time-resolved fluorescence lifetime for cutaneous melanoma detection

    PubMed Central

    Pires, Layla; Nogueira, Marcelo Saito; Pratavieira, Sebastião; Moriyama, Lilian Tan; Kurachi, Cristina

    2014-01-01

    Melanoma is the most aggressive skin cancer type. It is characterized by pigmented lesions with high tissue invasion and metastatic potential. The early detection of melanoma is extremely important to improve patient prognosis and survival rate, since it can progress to the deadly metastatic stage. Presently, the melanoma diagnosis is based on the clinical analysis of the macroscopic lesion characteristics such as shape, color, borders following the ABCD rules. The aim of this study is to evaluate the time-resolved fluorescence lifetime of NADH and FAD molecules to detect cutaneous melanoma in an experimental in vivo model. Forty-two lesions were analyzed and the data was classified using linear discriminant analysis, a sensitivity of 99.4%, specificity of 97.4% and accuracy of 98.4% were achieved. These results show the potential of this fluorescence spectroscopy for melanoma detection. PMID:25401022

  5. Time-resolved fluorescence lifetime for cutaneous melanoma detection.

    PubMed

    Pires, Layla; Nogueira, Marcelo Saito; Pratavieira, Sebastião; Moriyama, Lilian Tan; Kurachi, Cristina

    2014-09-01

    Melanoma is the most aggressive skin cancer type. It is characterized by pigmented lesions with high tissue invasion and metastatic potential. The early detection of melanoma is extremely important to improve patient prognosis and survival rate, since it can progress to the deadly metastatic stage. Presently, the melanoma diagnosis is based on the clinical analysis of the macroscopic lesion characteristics such as shape, color, borders following the ABCD rules. The aim of this study is to evaluate the time-resolved fluorescence lifetime of NADH and FAD molecules to detect cutaneous melanoma in an experimental in vivo model. Forty-two lesions were analyzed and the data was classified using linear discriminant analysis, a sensitivity of 99.4%, specificity of 97.4% and accuracy of 98.4% were achieved. These results show the potential of this fluorescence spectroscopy for melanoma detection. PMID:25401022

  6. Ultrafast time-resolved vibrational spectroscopies of carotenoids in photosynthesis.

    PubMed

    Hashimoto, Hideki; Sugisaki, Mitsuru; Yoshizawa, Masayuki

    2015-01-01

    This review discusses the application of time-resolved vibrational spectroscopies to the studies of carotenoids in photosynthesis. The focus is on the ultrafast time regime and the study of photophysics and photochemistry of carotenoids by femtosecond time-resolved stimulated Raman and four-wave mixing spectroscopies. This article is part of a Special Issue entitled: Vibrational spectroscopies and bioenergetic systems. PMID:25223589

  7. Time-resolved fluorescence spectrum of Quinacrine Mustard

    Microsoft Academic Search

    A. Andreoni; R. Cubeddu; S. de Silvestri; P. Laporta

    1980-01-01

    Time-resolved fluorescence spectrum of Quinacrine Mustard in acetate buffer solution (pH 4.6) under excitation of subnanosecond laser pulses is reported. The decay curve has been found to consist of three exponential components, whose amplitudes depend on both excitation and observation wavelengths. This behaviour has been attributed to the formation of three protonated species of the molecule in the excited state.

  8. The dependence of the ultrafast relaxation kinetics of the S2 and S1 states in ?-carotene homologs and lycopene on conjugation length studied by femtosecond time-resolved absorption and Kerr-gate fluorescence spectroscopies

    NASA Astrophysics Data System (ADS)

    Kosumi, Daisuke; Fujiwara, Masazumi; Fujii, Ritsuko; Cogdell, Richard J.; Hashimoto, Hideki; Yoshizawa, Masayuki

    2009-06-01

    The ultrafast relaxation kinetics of all-trans-?-carotene homologs with varying numbers of conjugated double bonds n(n =7-15) and lycopene (n =11) has been investigated using femtosecond time-resolved absorption and Kerr-gate fluorescence spectroscopies, both carried out under identical excitation conditions. The nonradiative relaxation rates of the optically allowed S2(1Bu+1) state were precisely determined by the time-resolved fluorescence. The kinetics of the optically forbidden S1(2Ag-1) state were observed by the time-resolved absorption measurements. The dependence of the S1 relaxation rates upon the conjugation length is adequately described by application of the energy gap law. In contrast to this, the nonradiative relaxation rates of S2 have a minimum at n =9 and show a reverse energy gap law dependence for values of n above 11. This anomalous behavior of the S2 relaxation rates can be explained by the presence of an intermediate state (here called the Sx state) located between the S2 and S1 states at large values of n (such as n =11). The presence of such an intermediate state would then result in the following sequential relaxation pathway S2?Sx?S1?S0. A model based on conical intersections between the potential energy curves of these excited singlet states can readily explain the measured relationships between the decay rates and the energy gaps.

  9. Time resolved imaging microscopy. Phosphorescence and delayed fluorescence imaging.

    PubMed Central

    Marriott, G; Clegg, R M; Arndt-Jovin, D J; Jovin, T M

    1991-01-01

    An optical microscope capable of measuring time resolved luminescence (phosphorescence and delayed fluorescence) images has been developed. The technique employs two phase-locked mechanical choppers and a slow-scan scientific CCD camera attached to a normal fluorescence microscope. The sample is illuminated by a periodic train of light pulses and the image is recorded within a defined time interval after the end of each excitation period. The time resolution discriminates completely against light scattering, reflection, autofluorescence, and extraneous prompt fluorescence, which ordinarily decrease contrast in normal fluorescence microscopy measurements. Time resolved image microscopy produces a high contrast image and particular structures can be emphasized by displaying a new parameter, the ratio of the phosphorescence to fluorescence. Objects differing in luminescence decay rates are easily resolved. The lifetime of the long lived luminescence can be measured at each pixel of the microscope image by analyzing a series of images that differ by a variable time delay. The distribution of luminescence decay rates is displayed directly as an image. Several examples demonstrate the utility of the instrument and the complementarity it offers to conventional fluorescence microscopy. Images FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 PMID:1723311

  10. Motor Oil Classification Based on Time-Resolved Fluorescence

    PubMed Central

    Mu, Taotao; Chen, Siying; Zhang, Yinchao; Guo, Pan; Chen, He; Meng, Fandong

    2014-01-01

    A time-resolved fluorescence (TRF) technique is presented for classifying motor oils. The system is constructed with a third harmonic Nd:YAG laser, a spectrometer, and an intensified charge coupled device (ICCD) camera. Steady-state and time-resolved fluorescence (TRF) measurements are reported for several motor oils. It is found that steady-state fluorescence is insufficient to distinguish the motor oil samples. Then contour diagrams of TRF intensities (CDTRFIs) are acquired to serve as unique fingerprints to identify motor oils by using the distinct TRF of motor oils. CDTRFIs are preferable to steady-state fluorescence spectra for classifying different motor oils, making CDTRFIs a particularly choice for the development of fluorescence-based methods for the discrimination and characterization of motor oils. The two-dimensional fluorescence contour diagrams contain more information, not only the changing shapes of the LIF spectra but also the relative intensity. The results indicate that motor oils can be differentiated based on the new proposed method, which provides reliable methods for analyzing and classifying motor oils. PMID:24988439

  11. Enhancement Of Fluorescent Fingerprints By Time-Resolved Imaging

    NASA Astrophysics Data System (ADS)

    Menzel, E. R.; Pleil, M.; Gangopadhyay, S.; Borst, W.

    1987-01-01

    Laser detection of latent fingerprints tends to fail when prints are located on certain types of surface, such as brown cardboard and wood, because the generally weak fingerprint fluorescence is overwhelmed by background luminescence from these substrates. The fingerprint and background fluorescence lifetimes, which are of nanosecond order, were measured for samples of the above surface types and for fingerprints treated by the most successful current detection procedures. Our results indicate that time-resolved imaging can in these situations improve image contrast by about an order of magnitude.

  12. Time-resolved fluorescence studied at dielectric interfaces

    NASA Astrophysics Data System (ADS)

    Uhl, S.; Krabichler, G.; Rempfer, K.; Oelkrug, D.

    1986-03-01

    Luminescence spectra, fluorescence decay curves and time-resolved emission spectra of aromatic molecules and aromatics with proton donating or accepting groups adsorbed on low activated dielectric metal oxides have been investigated. The non-exponential decay is assigned to a superposition of monomer and aggregate fluorescence, to different orientation of the transition dipole moments relative to the dielectric surface, and to different chemical nature of the adsorbed species. According to the extremely prolongation of the decay times of aromatics with proton donating and accepting groups it is assumed that these molecules are adsorbed perpendicular to the surface while pure aromatics are flat adsorbed via their aromatic ?-system.

  13. Time resolved spectroscopy using synchrotron infrared pulses

    SciTech Connect

    Carr, G.L. [Brookhaven National Lab., Upton, NY (United States). National Synchrotron Light Source; Lobo, R.P.S.M. [Brookhaven National Lab., Upton, NY (United States). National Synchrotron Light Source]|[Univ. of Florida, Gainesville, FL (United States). Physics Dept.; Hirschmugl, C.J. [Lawrence Berkeley National Lab., CA (United States). Advanced Light Source; LaVeigne, J.; Reitze, D.H.; Tanner, D.B. [Univ. of Florida, Gainesville, FL (United States). Physics Dept.

    1997-09-01

    Electron synchrotron storage rings, such as the VUV ring at the National Synchrotron Light Source (NSLS), produce short pulses of infrared (IR) radiation suitable for investigating the time-dependent phenomena in a variety of interesting experimental systems. In contrast to other pulses sources of IR, the synchrotron produces a continuum spectral output over the entire IR (and beyond), though at power levels typically below those obtained from laser systems. The infrared synchrotron radiation (IRSR) source is therefore well-suited as a probe using standard FTIR spectroscopic techniques. Here the authors describe the pump-probe spectroscopy facility being established at the NSLS and demonstrate the technique by measuring the photocarrier decay in a semiconductor.

  14. Time-resolved terahertz spectroscopy of black silicon

    Microsoft Academic Search

    H. P. Porte; D. Turchinovich; P. U. Jepsen; S. Persheyev; Y. Fan; M. J. Rose

    2010-01-01

    The ultrafast photoconductivity dynamics of black silicon is measured by time-resolved terahertz spectroscopy. Black silicon is produced by laser annealing of an a-Si:H film. We show that the decay time of the photoconductivity depends on the annealing method and fluence used in the production process.

  15. Portable optical oxygen sensor based on time-resolved fluorescence.

    PubMed

    Chu, Cheng-Shane; Chu, Ssu-Wei

    2014-11-10

    A new, simple signal processing, low-cost technique for the fabrication of a portable oxygen sensor based on time-resolved fluorescence is described. The sensing film uses the oxygen sensing dye platinum meso-tetra (pentfluorophenyl) porphyrin (PtTFPP) embedded in a polymer matrix. The ratio ?0/?100 measures sensitivity of the sensing film, where ?0 and ?100 represent the detected fluorescence lifetimes from the sensing film exposed to 100% nitrogen and 100% oxygen, respectively. The experimental results reveal that the PtTFPP-doped oxygen sensor has a sensitivity of 2.2 in the 0%-100% range. A preparation procedure for coating the photodiodes with the oxygen sensor film that produces repetitive and reliable sensing devices is proposed. The developed time-resolved optical oxygen sensor is portable, low-cost, has simple signal processing, and lacks optical filter elements. It is a cost-effective alternative to traditional electrochemical-based oxygen sensors and provides a platform for other optical based sensors. PMID:25402987

  16. Combined time-resolved laser fluorescence spectroscopy and extended X-ray absorption fine structure spectroscopy study on the complexation of trivalent actinides with chloride at T = 25-200 °C.

    PubMed

    Skerencak-Frech, Andrej; Fröhlich, Daniel R; Rothe, Jörg; Dardenne, Kathy; Panak, Petra J

    2014-01-21

    The complexation of trivalent actinides (An(III)) with chloride is studied in the temperature range from 25 to 200 °C by spectroscopic methods. Time-resolved laser fluorescence spectroscopy (TRLFS) is applied to determine the thermodynamic data of Cm(III)-Cl(-) complexes, while extended X-ray absorption fine structure spectroscopy (EXAFS) is used to determine the structural data of the respective Am(III) complexes. The experiments are performed in a custom-built high-temperature cell which is modified for the respective spectroscopic technique. The TRLFS results show that at 25 °C the speciation is dominated mainly by the Cm(3+) aquo ion. Only a minor fraction of the CmCl(2+) complex is present in solution. As the temperature increases, the fraction of this species decreases further. Simultaneously, the fraction of the CmCl2(+) complex increases strongly with the temperature. Also, the CmCl3 complex is formed to a minor extent at T > 160 °C. The conditional stability constant log ?'2 is determined as a function of the temperature and extrapolated to zero ionic strength with the specific ion interaction theory approach. The log ?°2(T) values increase by more than 3 orders of magnitude in the studied temperature range. The temperature dependency of log ?°2 is fitted by the extended van't Hoff equation to determine ?rH°m, ?rS°m, and ?rC°p,m. The EXAFS results support these findings. The results confirm the absence of americium(III) chloride complexes at T = 25 and 90 °C ([Am(III)] = 10(-3) m, [Cl(-)] = 3.0 m), and the spectra are described by 9-10 oxygen atoms at a distance of 2.44-2.48 Å. At T = 200 °C two chloride ligands are present in the inner coordination sphere of Am(III) at a distance of 2.78 Å. PMID:24383499

  17. Soft x-ray time-resolved spectroscopy

    Microsoft Academic Search

    Hai Zhang; Q. L. Yang; B. P. Guo; Han-Ben Niu; Jingzhen Li; Y. C. Wang; Zhong X. Song; Z. L. Liu

    1993-01-01

    The soft x-ray time-resolved spectroscopy is composed of a soft x-ray spectroscopic head and a soft x-ray streak camera. Because the soft x-ray spectroscopic head possesses a spectral resolution of 0.1 angstrom, the performances of the whole system mainly depend on the characteristics of the soft x-ray streak camera. In this paper, therefore, the design features and characterization of the

  18. Proceedings of BiOS, Photonics West 2001, No.4252-27, San Jose, 2001. Time-Resolved Fluorescence Spectroscopy of Dopamine

    E-print Network

    Okamoto, Koichi

    of approximately 0.80 ns. The influence of deep-UV laser excitation on cells is also discussed for the direct camera. The fluorescence decay curve was fitted by 1-exponentional functions, with the lifetime excited by a ultraviolet (UV) laser light has been shown to be a powerful probe for single cell analysis

  19. Time-resolved diffuse optical spectroscopy: a differential absorption approach.

    PubMed

    Taroni, Paola; Bassi, Andrea; Spinelli, Lorenzo; Cubeddu, Rinaldo; Pifferi, Antonio

    2010-11-01

    A method is presented for the estimate of spectral changes in the absorption properties of turbid media from time-resolved diffuse optical spectroscopy. The method relies on the hypothesis of constant scattering over the wavelength range of interest, but no limitations come from the sample size and shape as the method is derived directly from the Beer-Lambert law. The effects of a moderate spectral dependence of the scattering properties and of the non-ideal instrument response function were investigated theoretically, and the results were confirmed experimentally, showing that the method can be profitably applied in cases of practical interest. PMID:21073789

  20. Thermally activated delayed fluorescence of fluorescein derivative for time-resolved and confocal fluorescence imaging.

    PubMed

    Xiong, Xiaoqing; Song, Fengling; Wang, Jingyun; Zhang, Yukang; Xue, Yingying; Sun, Liangliang; Jiang, Na; Gao, Pan; Tian, Lu; Peng, Xiaojun

    2014-07-01

    Compared with fluorescence imaging utilizing fluorophores whose lifetimes are in the order of nanoseconds, time-resolved fluorescence microscopy has more advantages in monitoring target fluorescence. In this work, compound DCF-MPYM, which is based on a fluorescein derivative, showed long-lived luminescence (22.11 ?s in deaerated ethanol) and was used in time-resolved fluorescence imaging in living cells. Both nanosecond time-resolved transient difference absorption spectra and time-correlated single-photon counting (TCSPC) were employed to explain the long lifetime of the compound, which is rare in pure organic fluorophores without rare earth metals and heavy atoms. A mechanism of thermally activated delayed fluorescence (TADF) that considers the long wavelength fluorescence, large Stokes shift, and long-lived triplet state of DCF-MPYM was proposed. The energy gap (?EST) of DCF-MPYM between the singlet and triplet state was determined to be 28.36 meV by the decay rate of DF as a function of temperature. The ?E(ST) was small enough to allow efficient intersystem crossing (ISC) and reverse ISC, leading to efficient TADF at room temperature. The straightforward synthesis of DCF-MPYM and wide availability of its starting materials contribute to the excellent potential of the compound to replace luminescent lanthanide complexes in future time-resolved imaging technologies. PMID:24936960

  1. Multidimensional Time-Resolved Spectroscopy of Vibrational Coherence in Biopolyenes

    NASA Astrophysics Data System (ADS)

    Buckup, Tiago; Motzkus, Marcus

    2014-04-01

    Multidimensional femtosecond time-resolved vibrational coherence spectroscopy allows one to investigate the evolution of vibrational coherence in electronic excited states. Methods such as pump-degenerate four-wave mixing and pump-impulsive vibrational spectroscopy combine an initial ultrashort laser pulse with a nonlinear probing sequence to reinduce vibrational coherence exclusively in the excited states. By carefully exploiting specific electronic resonances, one can detect vibrational coherence from 0 cm-1 to over 2,000 cm-1 and map its evolution. This review focuses on the observation and mapping of high-frequency vibrational coherence for all-trans biological polyenes such as β-carotene, lycopene, retinal, and retinal Schiff base. We discuss the role of molecular symmetry in vibrational coherence activity in the S1 electronic state and the interplay of coupling between electronic states and vibrational coherence.

  2. Steady state and time-resolved fluorescence spectroscopic characterization of normal and cancerous urine

    NASA Astrophysics Data System (ADS)

    Rajasekaran, Ramu; Aruna, Prakasa Rao; Balu David, Munusamy; Koteeswaran, Dornadula; Muthuvelu, Kulandaivel; Rai, R.; Ganesan, Singaravelu

    2013-03-01

    Urine is one of the diagnostically important bio fluids, as it has many metabolites and some of them are native fluorophores. There may be a variation in the distribution and the physiochemical properties of the fluorophores during any metabolic change and pathologic conditions. Native fluorescence spectroscopy has been considered as a promising tool to characterize the fluorophores present in the urine. In this study, we aimed at characterizing the urine of both normal and patients with confirmed cancer using steady state and time-resolved fluorescence spectroscopy at 280 nm and 350 nm excitation. It is observed that the metabolites indoxyl sulphate and neopterin and its derivatives are responsible for altered spectral signatures at 280 nm, and 350 nm excitation. The overall spectral data were subjected to Principal Component Analysis and the resultant components were used as input in the linear discriminant analysis. As a total, 84% and 81.8% of samples were correctly classified at 280 nm and 350 nm respectively.

  3. Nanosecond-regime correlation time scales for equilibrium protein structural fluctuations of metal-free cytochrome c from picosecond time-resolved fluorescence spectroscopy and the dynamic Stokes shift.

    PubMed

    Tripathy, Jagnyaseni; Beck, Warren F

    2010-12-01

    We used picosecond time-resolved fluorescence spectroscopy to characterize the fluorescence Stokes shift (FSS) response function of metal-free (or free-base, fbCytc) cytochrome c under the solution conditions that favor the native states of ferricytochrome c (FeCytc) and Zn(II)-substituted cytochrome c (ZnCytc). The intrinsic porphyrin chromophore serves in these experiments as a fluorescent probe of the structural fluctuations of the surrounding protein and solvent. Demetalation of the porphyrin destabilizes the folded structure of cytochrome c owing to the loss of the axial metal-histidine and metal-methionine bonds. Thus, these experiments examine how the time scales detected in a dynamic solvation experiment in a chromoprotein report changes in the character of motion. The FSS response function in fbCytc in water and pH 7 is well described by a biexponential response over the 100 ps to 50 ns regime with time constants of 1.4 and 9.1 ns; under similar conditions, ZnCytc exhibits a biexponential FSS response with time constants of 250 ps and 1.5 ns [Lampa-Pastirk and Beck, J. Phys. Chem. B 2004, 108, 16288]. These time constants correspond, respectively, to the correlation time scales for motions of the hydrophobic core and the solvent-contact layer of the protein. Both of the time constants observed in fbCytc are further lengthened upon addition of glycerol to the external solvent so that a significant fraction of the protein dynamics is rendered effectively static on the fluorescence time scale. The solvation reorganization energy, the time-integrated Stokes shift of the fluorescence spectrum, is reduced by about a third to 33 cm(-1) in 50% glycerol from 43 cm(-1) in water. These results are interpreted structurally using a model for Brownian diffusive motion with thermally activated barrier crossings on the protein-folding energy landscape. The results suggest that the mean-squared deviations of the structural fluctuations exhibited by fbCytc are nearly a factor of 10 larger than those of ZnCytc. This conclusion is consistent with the suggestion that fbCytc assumes a dynamic, partially unfolded structure with some of the characteristics of a molten globule. PMID:21077593

  4. Time-resolved fluorescence studies of nucleotide flipping by restriction enzymes.

    PubMed

    Neely, Robert K; Tamulaitis, Gintautas; Chen, Kai; Kubala, Marta; Siksnys, Virginijus; Jones, Anita C

    2009-11-01

    Restriction enzymes Ecl18kI, PspGI and EcoRII-C, specific for interrupted 5-bp target sequences, flip the central base pair of these sequences into their protein pockets to facilitate sequence recognition and adjust the DNA cleavage pattern. We have used time-resolved fluorescence spectroscopy of 2-aminopurine-labelled DNA in complex with each of these enzymes in solution to explore the nucleotide flipping mechanism and to obtain a detailed picture of the molecular environment of the extrahelical bases. We also report the first study of the 7-bp cutter, PfoI, whose recognition sequence (T/CCNGGA) overlaps with that of the Ecl18kI-type enzymes, and for which the crystal structure is unknown. The time-resolved fluorescence experiments reveal that PfoI also uses base flipping as part of its DNA recognition mechanism and that the extrahelical bases are captured by PfoI in binding pockets whose structures are quite different to those of the structurally characterized enzymes Ecl18kI, PspGI and EcoRII-C. The fluorescence decay parameters of all the enzyme-DNA complexes are interpreted to provide insight into the mechanisms used by these four restriction enzymes to flip and recognize bases and the relationship between nucleotide flipping and DNA cleavage. PMID:19740769

  5. Time-resolved fluorescence studies of nucleotide flipping by restriction enzymes

    PubMed Central

    Neely, Robert K.; Tamulaitis, Gintautas; Chen, Kai; Kubala, Marta; Siksnys, Virginijus; Jones, Anita C.

    2009-01-01

    Restriction enzymes Ecl18kI, PspGI and EcoRII-C, specific for interrupted 5-bp target sequences, flip the central base pair of these sequences into their protein pockets to facilitate sequence recognition and adjust the DNA cleavage pattern. We have used time-resolved fluorescence spectroscopy of 2-aminopurine-labelled DNA in complex with each of these enzymes in solution to explore the nucleotide flipping mechanism and to obtain a detailed picture of the molecular environment of the extrahelical bases. We also report the first study of the 7-bp cutter, PfoI, whose recognition sequence (T/CCNGGA) overlaps with that of the Ecl18kI-type enzymes, and for which the crystal structure is unknown. The time-resolved fluorescence experiments reveal that PfoI also uses base flipping as part of its DNA recognition mechanism and that the extrahelical bases are captured by PfoI in binding pockets whose structures are quite different to those of the structurally characterized enzymes Ecl18kI, PspGI and EcoRII-C. The fluorescence decay parameters of all the enzyme-DNA complexes are interpreted to provide insight into the mechanisms used by these four restriction enzymes to flip and recognize bases and the relationship between nucleotide flipping and DNA cleavage. PMID:19740769

  6. Time-resolved spectroscopy of the pulsating CV GW Lib

    E-print Network

    van Spaandonk, L; Marsh, T R; Torres, M A P

    2009-01-01

    We present time-resolved optical spectroscopy of the dwarf nova GW Librae during its rare April 2007 super-outburst and compare these with quiescent epochs. The data provide the first opportunity to track the evolution of the principal spectral features. In the early stages of the outburst, the optically thick disc dominates the optical and the line components show clear orbital radial velocity excursions. In the course of several weeks, optically thin regions become more prominent as strong emission lines replace the broad disc absorption. Post-outburst spectroscopy covering the I-band illustrates the advantages of CaII relative to the commonly used Balmer lines when attempting to constrain binary parameters. Due to the lower ionisation energy combined with smaller thermal and shear broadening of these lines, a sharp emission component is seen to be moving in between the accretion disc peaks in the CaII line. No such component is visible in the Balmer lines. We interpret this as an emission component origina...

  7. Quantitative Time-Resolved Fluorescence Spectrum of the Cortical Sarcoma and the Adjacent Normal Tissue

    Microsoft Academic Search

    Yuezhi Li; Mingzhao Li; Tao Xu

    2007-01-01

    The difference in time-resolved fluorescence spectrum between the cortical sarcoma and the adjacent normal tissue was studied\\u000a in both experimental and theoretical ways. The Clinical data were obtained in vivo using a time-resolved fluorescence spectrometer employing a single fiber-optic probe for excitation and detection. Tissue\\u000a was modeled as s-180 sarcoma tumor surrounded with normal muscle and was mediated by the

  8. A time-resolved 128128 SPAD camera for laser Raman spectroscopy

    E-print Network

    Rossman. George R.

    A time-resolved 128×128 SPAD camera for laser Raman spectroscopy SPIE Conference, Paper 8374 of Technology, Pasadena, California, USA Abstract In continuous wave (CW) Raman spectroscopy, significant charge coupled devices (iCCDs) or streak cameras. Thus, time- resolved Raman spectroscopy has not been

  9. Polar plot representation of time-resolved fluorescence.

    PubMed

    Eichorst, John Paul; Wen Teng, Kai; Clegg, Robert M

    2014-01-01

    Measuring changes in a molecule's fluorescence emission is a common technique to study complex biological systems such as cells and tissues. Although the steady-state fluorescence intensity is frequently used, measuring the average amount of time that a molecule spends in the excited state (the fluorescence lifetime) reveals more detailed information about its local environment. The lifetime is measured in the time domain by detecting directly the decay of fluorescence following excitation by short pulse of light. The lifetime can also be measured in the frequency domain by recording the phase and amplitude of oscillation in the emitted fluorescence of the sample in response to repetitively modulated excitation light. In either the time or frequency domain, the analysis of data to extract lifetimes can be computationally intensive. For example, a variety of iterative fitting algorithms already exist to determine lifetimes from samples that contain multiple fluorescing species. However, recently a method of analysis referred to as the polar plot (or phasor plot) is a graphical tool that projects the time-dependent features of the sample's fluorescence in either the time or frequency domain into the Cartesian plane to characterize the sample's lifetime. The coordinate transformations of the polar plot require only the raw data, and hence, there are no uncertainties from extensive corrections or time-consuming fitting in this analysis. In this chapter, the history and mathematical background of the polar plot will be presented along with examples that highlight how it can be used in both cuvette-based and imaging applications. PMID:24108625

  10. Monitoring tissue metabolism via time-resolved laser fluorescence

    NASA Astrophysics Data System (ADS)

    Maerz, Holger K.; Buchholz, Rainer; Emmrich, Frank; Fink, Frank; Geddes, Clive L.; Pfeifer, Lutz; Raabe, Ferdinand; Marx, Uwe

    1999-05-01

    Most assays for drug screening are monitoring the metabolism of cells by detecting the NADH content, which symbolize its metabolic activity, indirectly. Nowadays, the performance of a LASER enables us to monitor the metabolic state of mammalian cells directly and on-line by using time-resolved autofluorescence detection. Therefore, we developed in combination with tissue engineering, an assay for monitoring minor toxic effects of volatile organic compounds (VOC), which are accused of inducing Sick Building Syndrome (SBS). Furthermore, we used the Laserfluoroscope (LF) for pharmacological studies on human bone marrow in vitro with special interest in chemotherapy simulation. In cancer research and therapy, the effect of chemostatica in vitro in the so-called oncobiogram is being tested; up to now without great success. However, it showed among other things that tissue structure plays a vital role. Consequently, we succeeded in simulating a chemotherapy in vitro on human bone marrow. Furthermore, after tumor ektomy we were able to distinguish between tumoric and its surrounding healthy tissue by using the LF. With its sensitive detection of metabolic changes in tissues the LF enables a wide range of applications in biotechnology, e.g. for quality control in artificial organ engineering or biocompatability testing.

  11. Time-resolved fluorescence spectroscopic study of flavin fluorescence in purified enzymes of bioluminescent bacteria

    NASA Astrophysics Data System (ADS)

    Vetrova, Elena; Kudryasheva, N.; Cheng, K.

    2006-10-01

    Time-resolved fluorescence intensity and anisotropy decay measurements have been used to study the environment and rotational mobility of endogenous flavin in two purified enzymes of bioluminescent bacteria, Luciferase from Photobacterium leiognathi and NAD(P)H:FMN-oxidoreductase from Vibrio fischeri. We compared the time-resolved fluorescence parameters, intensity decay lifetimes, rotational correlation times, and their fractional contribution, of the endogeneous flavin fluorescence in each of the two enzymes in the presence or absence of quinones of different structures and redox potentials. The endogeneous flavin exhibited multi-exponential decay characteristics as compared to a single decay lifetime of around 5 ns for free flavin, suggesting a complex and heterogeneous environment of flavin bound to the enzyme. In addition, a significant increase in the rotational correlation time and a certain degree of ordering of the molecule were observed for endogenous flavin when compared to a single and fast rotational correlation time of 150 ps of free flavin. Quinone significantly altered both the lifetime and rotational characteristics of endogenous flavin suggesting specific interactions of quinones to the endogeneous flavin in the bacterial enzyme.

  12. Evidence of fluorescent carbon nanoparticles produced in premixed flames by time-resolved fluorescence polarization anisotropy

    SciTech Connect

    Bruno, A.; de Lisio, C. [Centro di Ricerca e Sviluppo ''Coherentia,'' C.N.R.-I.N.F.M., Unita di Ricerca di Napoli, and Dipartimento di Scienze Fisiche, Universita di Napoli ''Federico II,'' Complesso di Monte S. Angelo, Via Cintia, 80126, Napoli (Italy); Minutolo, P. [Istituto di Ricerche sulla Combustione, CNR, P.le Tecchio, 80, 80126, Napoli (Italy); D'Alessio, A. [Dipartimento di Ingegneria Chimica, Universita di Napoli ''Federico II,'' P.le Tecchio, 80, 80126, Napoli (Italy)

    2007-11-15

    In this work we report on the analysis of combustion-generated nano-organic carbon (NOC) particles by means of time-resolved fluorescence polarization anisotropy (TRFPA). NOC samples were collected in water from nonsooting regions of ethylene/air laminar flames. The size of collected particles was determined with subnanometer accuracy by exploiting femtosecond laser pulses as an excitation source. Moreover, the TRFPA measurements were realized by selecting narrow-wavelength bands within the fluorescence spectrum. With this procedure, the ensemble-averaged size of particles emitting in the selected fluorescence band was determined, to provide additional information on composition and spectroscopic properties of the investigated particles. In particular, the NOC samples consisted of two groups of particles, preferentially emitting in two distinct wavelength bands: smaller particles, with diameter d=1-1.5nm, mostly fluorescing in the UV ({lambda}{proportional_to}300-470nm), and larger particles, d>2nm, fluorescing in the visible ({lambda}{proportional_to}490-580nm). The results of this work strongly support the attribution of UV/visible fluorescence generally detected in flames to nanoparticles. They also evidence that nanoparticles undergo a chemical transformation during the growth process, which produces a red shift in the fluorescence spectrum. (author)

  13. Light-harvesting ability of the fucoxanthin chlorophyll a/c-binding protein associated with photosystem II from the Diatom Chaetoceros gracilis as revealed by picosecond time-resolved fluorescence spectroscopy.

    PubMed

    Nagao, Ryo; Yokono, Makio; Teshigahara, Ayaka; Akimoto, Seiji; Tomo, Tatsuya

    2014-05-15

    The fucoxanthin chlorophyll a/c-binding protein (FCP) is a unique antenna complex possessed by diatoms. Although FCP complexes have been isolated from various diatoms, there is no direct evidence for the existence of FCP associated with photosystem II (FCPII). Here, we report the isolation and spectroscopic characterization of FCPII complex from the diatom Chaetoceros gracilis. The FCPII complex was purified using sucrose centrifugation and anion-exchange chromatography. Clear-native PAGE and SDS-PAGE analyses revealed that the FCPII complex was composed of FCP-A oligomer and FCP-B/C trimer. Time-resolved fluorescence spectra of the FCPII complex were measured at 77 K. The characteristic lifetimes and fluorescence components were determined using global fitting analysis, followed by the construction of fluorescence decay-associated spectra (FDAS). FDAS exhibited fluorescence rises and decays, reflecting excitation energy transfer, with the time constants of 150 ps, 800 ps, and 2.9 ns. The long time constants are most likely attributed to the intercomplex excitation energy transfer between FCP-A oligomer and FCP-B/C trimer in the FCPII complex. The 5.6 ns FDAS likely originates from the final energy traps. In contrast, the FDAS exhibited no quenching component with any time constant. These results indicate that the FCPII complex is efficient in light harvesting and excitation energy transfer. PMID:24773012

  14. Optical biopsy of benign and malignant tissue by time resolved spectroscopy.

    PubMed

    Masilamani, V; Das, B B; Secor, J; AlSalhi, M; Devanesan, S; Prasad, S; Rabah, D; Alfano, R R

    2013-12-01

    Pathological condition of malignant tissue could be analyzed by spectral domain or time domain spectroscopy, the two being the complementary to each other in optical biopsy (OB) of cancer. This paper reports results of time resolved emission spectroscopy (TRS) of 24 excised tissue samples of breast and prostate (normal control = 12; benign = 4; malignant = 8), employing a 390 nm, 100 fs, Ti-Sapphire laser pulses.The fluorescence decay times were measured using streak camera and the resultant data were fitted for single and bi-exponential decays with reliability of 97%. Our results show the distinct difference between normal, benign and malignant tissues mostly due to the emission spectra of Nicotinamide Adenine Dinucleotide (NADH), Flavin Mononucleotide (FAD) and also due to the heterogeneity of micro environments associated with the diseased tissues. In this short report, fit is also shown that TRS of breast tissues are similar to those of prostate tissues. PMID:23745786

  15. Studies of Minerals, Organic and Biogenic Materials through Time-Resolved Raman Spectroscopy

    NASA Technical Reports Server (NTRS)

    Garcia, Christopher S.; Abedin, M. Nurul; Ismail, Syed; Sharma, Shiv K.; Misra, Anupam K.; Nyugen, Trac; Elsayed-Ali, hani

    2009-01-01

    A compact remote Raman spectroscopy system was developed at NASA Langley Research center and was previously demonstrated for its ability to identify chemical composition of various rocks and minerals. In this study, the Raman sensor was utilized to perform time-resolved Raman studies of various samples such as minerals and rocks, Azalea leaves and a few fossil samples. The Raman sensor utilizes a pulsed 532 nm Nd:YAG laser as excitation source, a 4-inch telescope to collect the Raman-scattered signal from a sample several meters away, a spectrograph equipped with a holographic grating, and a gated intensified CCD (ICCD) camera system. Time resolved Raman measurements were carried out by varying the gate delay with fixed short gate width of the ICCD camera, allowing measurement of both Raman signals and fluorescence signals. Rocks and mineral samples were characterized including marble, which contain CaCO3. Analysis of the results reveals the short (approx.10-13 s) lifetime of the Raman process, and shows that Raman spectra of some mineral samples contain fluorescence emission due to organic impurities. Also analyzed were a green (pristine) and a yellow (decayed) sample of Gardenia leaves. It was observed that the fluorescence signals from the green and yellow leaf samples showed stronger signals compared to the Raman lines. Moreover, it was also observed that the fluorescence of the green leaf was more intense and had a shorter lifetime than that of the yellow leaf. For the fossil samples, Raman shifted lines could not be observed due the presence of very strong short-lived fluorescence.

  16. Investigations of protein-protein interactions using time-resolved fluorescence and phasors.

    PubMed

    Jameson, David M; Vetromile, Carissa M; James, Nicholas G

    2013-03-01

    Protein interactions are critical for biological specificity and techniques able to characterize these interactions are of fundamental importance in biochemistry and cell biology. Fluorescence methodologies have been extremely useful for studying many biological systems including protein-ligand and protein-protein interactions. In this review we focus on the application of time-resolved fluorescence approaches to macromolecular systems. We also include a detailed discussion of a relatively new time-resolved technique, the phasor method, for studying protein interactions both in vitro and in live cells. PMID:23348372

  17. Conductivity of ZnO Nanowires, Nanoparticles, and Thin Films Using Time-Resolved Terahertz Spectroscopy

    E-print Network

    Conductivity of ZnO Nanowires, Nanoparticles, and Thin Films Using Time-Resolved Terahertz of nanostructured ZnO have been determined using time-resolved terahertz spectroscopy, a noncontact optical probe. ZnO properties were measured directly for thin films and were extracted from measurements of nanowire

  18. Ultrafast time-resolved spectroscopy of the light-harvesting complex 2 (LH2) from the photosynthetic bacterium Thermochromatium tepidum

    SciTech Connect

    Niedzwiedzki, Dariusz M. [Photosynthetic Antenna Research Center, Washington Univ., St. Louis, MO (United States); Fuciman, Marcel [Univ. of Connecticut, Storrs, CT (United States); Kobayashi, Masayuki [Ariake National College of Technology, Fukuoka (Japan); Frank, Harry A. [Univ. of Connecticut, Storrs, CT (United States); Blankenship, Robert E. [Photosynthetic Antenna Research Center, Washington Univ., St. Louis, MO (United States)

    2011-10-01

    The light-harvesting complex 2 from the thermophilic purple bacterium Thermochromatium tepidum was purified and studied by steady-state absorption and fluorescence, sub-nanosecond-time-resolved fluorescence and femtosecond time-resolved transient absorption spectroscopy. The measurements were performed at room temperature and at 10 K. The combination of both ultrafast and steady-state optical spectroscopy methods at ambient and cryogenic temperatures allowed the detailed study of carotenoid (Car)-to-bacteriochlorophyll (BChl) as well BChl-to-BChl excitation energy transfer in the complex. The studies show that the dominant Cars rhodopin (N = 11) and spirilloxanthin (N = 13) do not play a significant role as supportive energy donors for BChl a. This is related with their photophysical properties regulated by long ?-electron conjugation. On the other hand, such properties favor some of the Cars, particularly spirilloxanthin (N = 13) to play the role of the direct quencher of the excited singlet state of BChl.

  19. Diffuse optical fluorescence tomography using time-resolved data acquired in transmission

    E-print Network

    Friedlander, Michael P.

    Diffuse optical fluorescence tomography using time-resolved data acquired in transmission Frederic constraints adapted for optical problems where a physical non-negative constraint can be imposed. Finally, we the deep interior of highly scattering biological tissues. A novelty in our tomography algorithm

  20. Proceedings of the Fourteenth International Conference on Time-Resolved Vibrational Spectroscopy (TRVS XIV)

    E-print Network

    Tokmakoff, Andrei

    2011-08-31

    Abstracts of presentations made at the Fourteenth International Conference on Time-Resolved Vibrational Spectroscopy (TRVS XIV) held May 9-14, 2009 in Meredith, New Hampshire. TRVS is a series of biennial conferences ...

  1. Time-resolved phase-sensitive second harmonic generation spectroscopy.

    PubMed

    Nowakowski, Pawe? J; Woods, David A; Bain, Colin D; Verlet, Jan R R

    2015-02-28

    A methodology based on time-resolved, phase-sensitive second harmonic generation (SHG) for probing the excited state dynamics of species at interfaces is presented. It is based on an interference measurement between the SHG from the sample and a local oscillator generated at a reference together with a lock-in measurement to remove the large constant offset from the interference. The technique is characterized by measuring the phase and excited state dynamics of the dye malachite green at the water/air interface. The key attributes of the technique are that the observed signal is directly proportional to sample concentration, in contrast to the quadratic dependence from non-phase sensitive SHG, and that the real and imaginary parts of the 2nd order non-linear susceptibility can be determined independently. We show that the method is highly sensitive and can provide high quality excited state dynamics in short data acquisition times. PMID:25725724

  2. Time-resolved phase-sensitive second harmonic generation spectroscopy

    NASA Astrophysics Data System (ADS)

    Nowakowski, Pawe? J.; Woods, David A.; Bain, Colin D.; Verlet, Jan R. R.

    2015-02-01

    A methodology based on time-resolved, phase-sensitive second harmonic generation (SHG) for probing the excited state dynamics of species at interfaces is presented. It is based on an interference measurement between the SHG from the sample and a local oscillator generated at a reference together with a lock-in measurement to remove the large constant offset from the interference. The technique is characterized by measuring the phase and excited state dynamics of the dye malachite green at the water/air interface. The key attributes of the technique are that the observed signal is directly proportional to sample concentration, in contrast to the quadratic dependence from non-phase sensitive SHG, and that the real and imaginary parts of the 2nd order non-linear susceptibility can be determined independently. We show that the method is highly sensitive and can provide high quality excited state dynamics in short data acquisition times.

  3. Use of Time-Resolved Fluorescence to Monitor Bioactive Compounds in Plant Based Foodstuffs.

    PubMed

    Lemos, M Adília; Sárniková, Katarína; Bot, Francesca; Anese, Monica; Hungerford, Graham

    2015-01-01

    The study of compounds that exhibit antioxidant activity has recently received much interest in the food industry because of their potential health benefits. Most of these compounds are plant based, such as polyphenolics and carotenoids, and there is a need to monitor them from the field through processing and into the body. Ideally, a monitoring technique should be non-invasive with the potential for remote capabilities. The application of the phenomenon of fluorescence has proved to be well suited, as many plant associated compounds exhibit fluorescence. The photophysical behaviour of fluorescent molecules is also highly dependent on their microenvironment, making them suitable probes to monitor changes in pH, viscosity and polarity, for example. Time-resolved fluorescence techniques have recently come to the fore, as they offer the ability to obtain more information, coupled with the fact that the fluorescence lifetime is an absolute measure, while steady state just provides relative and average information. In this work, we will present illustrative time-resolved measurements, rather than a comprehensive review, to show the potential of time-resolved fluorescence applied to the study of bioactive substances. The aim is to help assess if any changes occur in their form, going from extraction via storage and cooking to the interaction with serum albumin, a principal blood transport protein. PMID:26132136

  4. A fluorescence LIDAR sensor for hyper-spectral time-resolved remote sensing and mapping.

    PubMed

    Palombi, Lorenzo; Alderighi, Daniele; Cecchi, Giovanna; Raimondi, Valentina; Toci, Guido; Lognoli, David

    2013-06-17

    In this work we present a LIDAR sensor devised for the acquisition of time resolved laser induced fluorescence spectra. The gating time for the acquisition of the fluorescence spectra can be sequentially delayed in order to achieve fluorescence data that are resolved both in the spectral and temporal domains. The sensor can provide sub-nanometric spectral resolution and nanosecond time resolution. The sensor has also imaging capabilities by means of a computer-controlled motorized steering mirror featuring a biaxial angular scanning with 200 ?radiant angular resolution. The measurement can be repeated for each point of a geometric grid in order to collect a hyper-spectral time-resolved map of an extended target. PMID:23787661

  5. Locating and classifying fluorescent tags behind turbid layers using time-resolved inversion

    NASA Astrophysics Data System (ADS)

    Satat, Guy; Heshmat, Barmak; Barsi, Christopher; Raviv, Dan; Chen, Ou; Bawendi, Moungi G.; Raskar, Ramesh

    2015-04-01

    The use of fluorescent probes and the recovery of their lifetimes allow for significant advances in many imaging systems, in particular, medical imaging systems. Here we propose and experimentally demonstrate reconstructing the locations and lifetimes of fluorescent markers hidden behind a turbid layer. This opens the door to various applications for non-invasive diagnosis, analysis, flowmetry and inspection. The method is based on a time-resolved measurement that captures information about both fluorescence lifetime and spatial position of the probes. To reconstruct the scene, the method relies on a sparse optimization framework to invert time-resolved measurements. This wide-angle technique does not rely on coherence, and does not require the probes to be directly in line of sight of the camera, making it potentially suitable for long-range imaging.

  6. Locating and classifying fluorescent tags behind turbid layers using time-resolved inversion.

    PubMed

    Satat, Guy; Heshmat, Barmak; Barsi, Christopher; Raviv, Dan; Chen, Ou; Bawendi, Moungi G; Raskar, Ramesh

    2015-01-01

    The use of fluorescent probes and the recovery of their lifetimes allow for significant advances in many imaging systems, in particular, medical imaging systems. Here we propose and experimentally demonstrate reconstructing the locations and lifetimes of fluorescent markers hidden behind a turbid layer. This opens the door to various applications for non-invasive diagnosis, analysis, flowmetry and inspection. The method is based on a time-resolved measurement that captures information about both fluorescence lifetime and spatial position of the probes. To reconstruct the scene, the method relies on a sparse optimization framework to invert time-resolved measurements. This wide-angle technique does not rely on coherence, and does not require the probes to be directly in line of sight of the camera, making it potentially suitable for long-range imaging. PMID:25865155

  7. CMOS time-resolved, contact, and multispectral fluorescence imaging for DNA molecular diagnostics.

    PubMed

    Guo, Nan; Cheung, Kawai; Wong, Hiu Tong; Ho, Derek

    2014-01-01

    Instrumental limitations such as bulkiness and high cost prevent the fluorescence technique from becoming ubiquitous for point-of-care deoxyribonucleic acid (DNA) detection and other in-field molecular diagnostics applications. The complimentary metal-oxide-semiconductor (CMOS) technology, as benefited from process scaling, provides several advanced capabilities such as high integration density, high-resolution signal processing, and low power consumption, enabling sensitive, integrated, and low-cost fluorescence analytical platforms. In this paper, CMOS time-resolved, contact, and multispectral imaging are reviewed. Recently reported CMOS fluorescence analysis microsystem prototypes are surveyed to highlight the present state of the art. PMID:25365460

  8. Frame-Transfer Gating Raman Spectroscopy for Time-Resolved Multiscalar Combustion Diagnostics

    NASA Technical Reports Server (NTRS)

    Nguyen, Quang-Viet; Fischer, David G.; Kojima, Jun

    2011-01-01

    Accurate experimental measurement of spatially and temporally resolved variations in chemical composition (species concentrations) and temperature in turbulent flames is vital for characterizing the complex phenomena occurring in most practical combustion systems. These diagnostic measurements are called multiscalar because they are capable of acquiring multiple scalar quantities simultaneously. Multiscalar diagnostics also play a critical role in the area of computational code validation. In order to improve the design of combustion devices, computational codes for modeling turbulent combustion are often used to speed up and optimize the development process. The experimental validation of these codes is a critical step in accepting their predictions for engine performance in the absence of cost-prohibitive testing. One of the most critical aspects of setting up a time-resolved stimulated Raman scattering (SRS) diagnostic system is the temporal optical gating scheme. A short optical gate is necessary in order for weak SRS signals to be detected with a good signal- to-noise ratio (SNR) in the presence of strong background optical emissions. This time-synchronized optical gating is a classical problem even to other spectroscopic techniques such as laser-induced fluorescence (LIF) or laser-induced breakdown spectroscopy (LIBS). Traditionally, experimenters have had basically two options for gating: (1) an electronic means of gating using an image intensifier before the charge-coupled-device (CCD), or (2) a mechanical optical shutter (a rotary chopper/mechanical shutter combination). A new diagnostic technology has been developed at the NASA Glenn Research Center that utilizes a frame-transfer CCD sensor, in conjunction with a pulsed laser and multiplex optical fiber collection, to realize time-resolved Raman spectroscopy of turbulent flames that is free from optical background noise (interference). The technology permits not only shorter temporal optical gating (down to <1 s, in principle), but also higher optical throughput, thus resulting in a substantial increase in measurement SNR.

  9. A review of the analysis of complex time-resolved fluorescence anisotropy data

    NASA Astrophysics Data System (ADS)

    Smith, Trevor A.; Ghiggino, Kenneth P.

    2015-06-01

    Time-resolved fluorescence anisotropy measurements (TRAMs) are widely used to probe the dynamics of the various processes that can lead to the depolarisation of emission following photoselection by polarised excitation. The most commonly investigated of these emission depolarising phenomena is molecular rotational motion, but TRAMs are very useful for determining the kinetics of a host of other processes. In this paper we review several examples for which we have observed in our laboratories initially unexpectedly complex temporal behaviour of the time-resolved fluorescence anisotropy signal from relatively ‘simple’ chemical systems. In certain circumstances the anisotropy (i) decays on timescales when superficially it might be thought it should remain constant, (ii) shows marked ‘dip and rise’ behaviour in its intensity, or (iii) can change sign as the anisotropy evolves in time. Fundamentally simple processes, including molecular rotational motion, energy migration and excited state photophysics, can cause such behaviour.

  10. Time-resolved atomic inner-shell spectroscopy

    Microsoft Academic Search

    M. Drescher; M. Hentschel; R. Kienberger; M. Uiberacker; V. Yakovlev; A. Scrinzi; Th. Westerwalbesloh; U. Kleineberg; U. Heinzmann; F. Krausz

    2002-01-01

    The characteristic time constants of the relaxation dynamics of core-excited atoms have hitherto been inferred from the linewidths of electronic transitions measured by continuous-wave extreme ultraviolet or X-ray spectroscopy. Here we demonstrate that a laser-based sampling system, consisting of a few-femtosecond visible light pulse and a synchronized sub-femtosecond soft X-ray pulse, allows us to trace these dynamics directly in the

  11. BHHST: An improved lanthanide chelate for time-resolved fluorescence applications

    NASA Astrophysics Data System (ADS)

    Connally, Russell; Jin, Dayong; Piper, James

    2005-04-01

    The detection of the waterborne pathogens Giardia lamblia and Cryptosporidium parvum in environmental water bodies requires concentration of large volumes of water due to the low dose required for infection. The highly concentrated (10,000-fold) water sample is often rich in strongly autofluorescent algae, organic debris and mineral particles that can obscure immunofluorescently labeled (oo)cysts during analysis. Time-resolved fluorescence techniques exploit the long fluorescence lifetimes of lanthanide chelates (ms) to differentiate target fluorescence from background autofluorescence (ns). Relatively simple instrumentation can be used to enhance the signal-to-noise ratio (S/N) of labelled target. Time-resolved fluorescence techniques exploit the large difference in lifetime by briefly exciting fluorescence from the sample using a pulsed excitation source. Capture of the resulting fluorescence emission is delayed until the more rapidly decaying autofluorescence has faded beyond detection, whereon the much stronger and slower fading emission from labelled target is collected. BHHCT is a tetradentate beta-diketone chelate that is activated to bind with protein (antibody) as the chlorosulfonate. The high activity of this residue makes conjugations difficult to control and can lead to the formation of unstable immunoconjugates. To overcome these limitations a 5-atom hydrophylic molecular tether was attached to BHHCT via the chlorosulfonate and the BHHCT derivative was then activated to bind to proteins as the succinimide. The new compound (BHHST) could be prepared in high purity and was far more stable than the chlorosulfonate on storage. A high activity immunocojugate was prepared against Cryptosporidium that yielded an 8-fold increase in SNR using a lab-built time-resolved fluorescence microscope.

  12. Combining precision spin-probe partitioning with time-resolved fluorescence quenching to study micelles

    Microsoft Academic Search

    Miroslav Peric; Marilene Alves; Barney L. Bales

    2006-01-01

    Micelles of lysomyristoylphosphatidylcholine (LMPC) and mixed micelles of LMPC with anionic detergent sodium dodecyl sulfate (SDS) have been characterized by spin-probe-partitioning electron paramagnetic resonance (SPPEPR) and time-resolved fluorescence quenching (TRFQ) experiments. SPPEPR is a novel new method to study structure and dynamics in lipid assemblies successfully applied here for the first time to micelles. Several improvements to the computer program

  13. Time-resolvable fluorescent conjugates for the detection of pathogens in environmental samples containing autofluorescent material

    NASA Astrophysics Data System (ADS)

    Connally, Russell; Veal, Duncan; Piper, James A.

    2003-07-01

    Water is routinely monitored for environmental pathogens such a Cryptosporidium and Giardia using immunofluorescence microscopy (IFM). Autofluorescence can greatly diminish an operators capacity to resolve labeled pathogens from non-specific background. Naturally fluorescing components (autofluorophores) encountered in biological samples typically have fluorescent lifetimes (?) of less than 100 nanoseconds and their emissions may be excluded through use of time-resolved fluorescence microscopy (TRFM). TRFM relies on the large differences in ? between autofluorescent molecules and long-lived lanthanide chelates. In TRFM, targets labeled with a time-resolvable fluorescent immunoconjugate are excited by an intense (UV) light pulse. A short delay is imposed to permit the decay of autofluorescence before capture of luminescence from the excited chelate using an image intensified CCD camera. In our experience, autofluorescence can be reduced to insignificant levels with a consequent 30-fold increase in target visibility using TRFM techniques. We report conjugation of a novel europium chelate to a monoclonal antibody specific for Giardia lamblia and use of the immunoconjugate for TRFM studies. Initial attempts to conjugate the same chelate to a monoclonal antibody directed against Cryptosporidium parvum led to poorly fluorescent constructs that were prone to denature and precipitate. We successfully conjugated BHHCT to anti-mouse polyvalent immunoglobulin and used this construct to overcome the difficulties in direct labeling of the anti-Cryptosporidium antibody. Both Giardia and Cryptosporidium were labeled using the anti-mouse protocol with a subsequent 20-fold and 6.6-fold suppression of autofluorescence respectively. A rapid protocol for conjugating and purifying the immunoconjugate was found and methods of quantifying the fluorescence to protein ratio determined. Performance of our TRFM was dependent on the quality and brightness of the immunoconjugate and optimization of the conjugation process is necessary to reap the full benefit of time-resolved techniques.

  14. Mechanism of response of potential-sensitive dyes studied by time-resolved fluorescence

    PubMed Central

    Das, Tapan K.; Periasamy, N.; Krishnamoorthy, G.

    1993-01-01

    The mechanism of response of two potential-sensitive dyes, diOC2(5) (3,3?-diethyloxadicarbocyanine iodide) and oxonol V (bis-[3-phenyl-5-oxoisoxazol-4-yl]pentamethine oxonol), were studied by using steady-state and time-resolved fluorescence techniques. The lipid concentration dependence of the ?? (membrane potential)-induced change in total fluorescence intensity was quite different for these two dyes. Time-resolved fluorescence measurements showed that the fluorescence decay of these dyes in membranes could be resolved into at least three exponentials. ??-induced changes in the levels of these three populations were also measured under a variety of conditions. In the case of diOC2(5) an inside negative ?? increased the levels of the bound forms. This shows that diOC2(5) responds to ?? mainly by an “on-off” mechanism whereby ?? perturbs the membrane-water partition coefficient of the dye. The ??-induced changes approached zero when the dye was totally membrane bound. In contrast, the ??-induced response of oxonol V increased with increased membrane binding. An inside negative ?? decreased the level of the bound form with a longer lifetime. This shows that the mechanism of response of oxonol V is a ??-induced shift in the equilibrium between bound forms of the dye. PMID:19431883

  15. Time-resolved fluorescence anisotropy of HIV-1 protease inhibitor complexes correlates with inhibitory activity.

    PubMed

    Kungl, A J; Visser, N V; van Hoek, A; Visser, A J; Billich, A; Schilk, A; Gstach, H; Auer, M

    1998-03-01

    The tryptophan time-resolved fluorescence intensity and anisotropy of the HIV-1 protease dimer is shown to be a quick and efficient method for the conformational characterization of protease inhibitor complexes. Four fluorescence lifetimes were needed to adequately describe the fluorescence decay of the two tryptophan residues, W6 and W42, per protease monomer. As a result of the wavelength dependence of the respective amplitudes, the 2.06 ns and the 4.46 ns decay constants were suggested to be the intrinsic fluorescence lifetimes of the more solvent-exposed W6 and the less exposed W42 residues, respectively. Analysis of the fluorescence anisotropy decay yielded a short correlation time of 250 ps corresponding to local chromophore motions, and a long correlation time of 12.96 ns resulting from overall rotation of the protease enzyme. Fluorescence lifetimes and rotational correlation times changed when inhibitors of the HIV-1 protease were added. The effects of 11 different inhibitors including statine-derived, hydroxyethylamine-derived, and 2 symmetrical inhibitors on the protease fluorescence dynamics were investigated. Inhibitor binding is shown to induce an increase of the mean fluorescence lifetime taumean, an increase of the short rotational correlation time phi1, as well as a decrease of the long rotational correlation time phi2. The mean rotational correlation time phimean was identified as the global dynamic parameter for a given molecular complex, which correlates with the inhibitor dissociation constant Ki, and therefore with the activity of the inhibitor. PMID:9485428

  16. Time-resolved tryptophan fluorescence in photosynthetic reaction centers from Rhodobacter sphaeroides

    NASA Technical Reports Server (NTRS)

    Godik, V. I.; Blankenship, R. E.; Causgrove, T. P.; Woodbury, N.

    1993-01-01

    Tryptophan fluorescence of reaction centers isolated from Rhodobacter sphaeroides, both stationary and time-resolved, was studied. Fluorescence kinetics were found to fit best a sum of four discrete exponential components. Half of the initial amplitude was due to a component with a lifetime of congruent to 60 ps, belonging to Trp residues, capable of efficient transfer of excitation energy to bacteriochlorophyll molecules of the reaction center. The three other components seem to be emitted by Trp ground-state conformers, unable to participate in such a transfer. Under the influence of intense actinic light, photooxidizing the reaction centers, the yield of stationary fluorescence diminished by congruent to 1.5 times, while the number of the kinetic components and their life times remained practically unchanged. Possible implications of the observed effects for the primary photosynthesis events are considered.

  17. Time-resolved wavelength modulation spectroscopy measurements of HO2 kinetics

    E-print Network

    and Daniel B. Oh High-frequency wavelength modulation spectroscopy WMS has been applied to the detection with a 1.5- m diode laser directly modulated at 5 MHz. The measured 2f WMS signal is calibrated by direct line at 6625.80 cm 1 . The utility of time-resolved WMS as a second-order kinetics probe

  18. Time-Resolved Areal-Density Measurements with Proton Spectroscopy in Spherical Implosions

    E-print Network

    Time-Resolved Areal-Density Measurements with Proton Spectroscopy in Spherical Implosions V. A areal-density near peak compression of direct-drive spherical target implosions has been inferred reaching 123 16 mg=cm2 at peak compression in the implosion of a 950-m-diam, 20-m-thick plastic CH capsule

  19. Time-resolved optical spectroscopy of the chest: is it possible to probe the lung?

    NASA Astrophysics Data System (ADS)

    Quarto, G.; Farina, A.; Pifferi, A.; Taroni, P.; Miniati, M.

    2013-06-01

    Monte Carlo simulations and preliminary time-resolved spectroscopy measurements were performed to investigate the feasibility of the in vivo optical diagnostics of lung conditions and diseases. Absorption and reduced scattering properties of the chest, arising from in vivo spectral measurements on volunteers are presented.

  20. Time-resolved photoelectron nano-spectroscopy of individual silver particles

    E-print Network

    Aeschlimann, Martin

    silver particles, which were deposited from a gas aggregation cluster source onto a silicon substrate. We of small silver nanoparticles deposited onto a surface from a gas aggregation cluster source. We showTime-resolved photoelectron nano-spectroscopy of individual silver particles: Perspectives

  1. Time-Resolved Spectroscopy of Electrostatic Discharge and Secondary Arc Plasma on Spacecraft Solar Array

    Microsoft Academic Search

    Jean-Charles Mateo-Velez; Virginie Inguimbert; Kazuhiro Toyoda; Denis Payan; Nicolas Balcon

    2012-01-01

    Primary electrostatic discharges (ESD) and secondary arcs on spacecraft solar panels are simulated experimentally by introducing a needle trigger and investigated with a time-resolved emission spectroscopy method. The total spectral domain investigated ranges from 220 to 750 nm. An innovative active method has been developed in order to initiate ESD at a controllable time and location on triple-junction solar cells.

  2. Time-resolved imaging of fluorescent inclusions in optically turbid medium — phantom study

    NASA Astrophysics Data System (ADS)

    Kacprzak, M.; Liebert, A.; Sawosz, P.; ?o?ek, N.; Milej, D.; Maniewski, R.

    2010-03-01

    We present results of application of a time-resolved optical system for imaging of fluorescence excited in an inclusion containing indocyanine green (ICG), and located in optically turbid medium. The developed imaging system enabled simultaneous acquisition of fluorescence and diffusive reflectance. Eight independent time-resolved measurement channels based on time-correlated single photon counting technique were applied. In four of these channels, used for the fluorescence detection, sets of filters were applied in order to block the excitation light. Fast optomechanical switches allowed us to illuminate sequentially nine different spots on the surface of the studied object and finally 4×4 pixels maps at excitation and emission wavelengths were obtained. A liquid phantom used in this study consists of the fish tank filed with a solution ofmilk and water with black ink added to obtain optical properties in the range of the optical properties typical for the living tissue. A gel ball of a diameter of 5 mm with precisely controlled concentration of ICG was immersed in the liquid. The measurements were performed for inclusion located at different depths and for various ICG concentrations in the gel ball and in the surrounding liquid. The recorded distributions of times of arrival (DTA) of fluorescence photons and times of flight (DTOF) of diffusely reflected photons were analyzed by calculation of their statistical moments. We observed specific changes in moments of the measured DTAs as a function of depth of immersion of the fluorescent inclusion in the medium. We noted also that the changes of moments depend significantly on concentration of the dye in the fluorescence inclusion as well as in the surrounding liquid.

  3. A Vertically Integrated CMOS Microsystem for Time-Resolved Fluorescence Analysis

    Microsoft Academic Search

    Bruce R. Rae; Jingbin Yang; Jonathan McKendry; Zheng Gong; David Renshaw; John M. Girkin; Erdan Gu; Martin D. Dawson; Robert K. Henderson

    2010-01-01

    We describe a two-chip micro-scale time-resolved fluorescence analyzer integrating excitation, detection, and filtering. A new 8×8 array of drivers realized in standard low-voltage 0.35-?m complementary metal-oxide semiconductor is bump-bonded to AlInGaN blue micro-pixellated light-emitting diodes (micro-LEDs). The array is capable of producing sample excitation pulses with a width of 777 ps (FWHM), enabling short lifetime fluorophores to be investigated. The

  4. Sodium dodecylsulfate-poly(ethyleneoxide) Interactions studied by time-resolved fluorescence quenching

    Microsoft Academic Search

    J. van Stam; M. Almgren; C. Lindblad

    The interaction between sodium dodecylsulfate (SDS) and poly(ethyleneoxide) (PEO) has been studied by time-resolved fluorescence\\u000a quenching at 20°C and 40°C in the dilute regime, i.e., 0.2% w\\/v, and in the semi-dilute regime, i.e., 2% w\\/v, with respect\\u000a to PEO. Lifetime measurements show that PEO wraps around the micelle-like cluster formed by SDS upon interaction with PEO\\u000a — the polymer shields

  5. Application of Time-Resolved Fluorescence for Direct and Continuous Probing of Release from Polymeric Delivery Vehicles

    PubMed Central

    Viger, Mathieu L.; Sheng, Wangzhong; McFearin, Cathryn L.; Berezin, Mikhail Y.; Almutairi, Adah

    2013-01-01

    Though accurately evaluating the kinetics of release is critical for validating newly designed therapeutic carriers for in vivo applications, few methods yet exist for release measurement in real time and without the need for any sample preparation. Many of the current approaches (e.g. chromatographic methods, absorption spectroscopy, or NMR spectroscopy) rely on isolation of the released material from the loaded vehicles, which require additional sample purification and can lead to loss of accuracy when probing fast kinetics of release. In this study we describe the use of time-resolved fluorescence for in situ monitoring of small molecule release kinetics from biodegradable polymeric drug delivery systems. This method relies on the observation that fluorescent reporters being released from polymeric drug delivery systems possess distinct excited-state lifetime components, reflecting their different environments in the particle suspensions, i.e., confined in the polymer matrices or free in the aqueous environment. These distinct lifetimes enable real-time quantitative mapping of the relative concentrations of dye in each population to obtain precise and accurate temporal information on the release profile of particular carrier/payload combinations. We found that fluorescence lifetime better distinguishes subtle differences in release profiles, (e.g. differences associated with dye loading) than conventional steady-state fluorescence measurements, which represent the averaged dye behavior over the entire scan. Given the method's applicability to both hydrophobic and hydrophilic cargo, it could be employed to model the release of any drug-carrier combination. PMID:23792808

  6. Trace pollutants analysis in soil by a time-resolved laser-induced breakdown spectroscopy technique

    Microsoft Academic Search

    A. Ciucci; V. Palleschi; S. Rastelli; R. Barbini; F. Colao; R. Fantoni; A. Palucci; S. Ribezzo; H. J. L. van der Steen

    1996-01-01

    The results of a joint experiment of IFAM-Pisa and ENEA-Frascati for the detection of traces of pollutants in soil by a time-resolved laser-induced spectroscopy technique are reported. Using samples of soil with known pollutants' concentration [Geochemical Exploration Reference (GXR) silicate from US Geological Survey], we were able to estimate the sensitivity of this Laser-Induced Breakdown Spectroscopy (LIBS) technique to be

  7. Detection of bacteria by time-resolved laser-induced breakdown spectroscopy

    Microsoft Academic Search

    Stéphane Morel; Nicolas Leone; Philippe Adam; Jacques Amouroux

    2003-01-01

    A laser-induced breakdown spectroscopy technique for analyzing biological matter for the detection of biological hazards is investigated. Eight species were considered in our experiment: six bacteria and two pollens in pellet form. The experimental setup is described, then a cumulative intensity ratio is proposed as a quantitative criterion because of its linearity and reproducibility. Time-resolved laser-induced breakdown spectroscopy (TRELIBS) exhibits

  8. Development of Time Resolved Fluorescence Resonance Energy Transfer-based Assay for FXR Antagonist Discovery

    PubMed Central

    Yu, Donna D.; Lin, Wenwei; Chen, Taosheng; Forman, Barry M.

    2013-01-01

    FXR (farnesoid X receptor, NRIH4), a nuclear receptor, plays a major role in the control of cholesterol metabolism. FXR ligands have been investigated in preclinical studies for targeted therapy against metabolic diseases, but have shown limitations. Therefore, there is a need for new agonist or antagonist ligands of FXR, both for potential clinical applications, as well as to further elucidate its biological functions. Here we describe the use of the X-ray crystal structure of FXR complexed with the potent small molecule agonist GW4064 to design and synthesize a novel fluorescent, high-affinity probe (DY246) for time resolved fluorescence resonance energy transfer (TR-FRET) assays. We then used the TR-FRET assay for high throughput screening of a library of over 5,000 bioactive compounds. From this library, we identified 13 compounds that act as putative FXR transcriptional antagonists. PMID:23688559

  9. Time-resolved fluorescence study of exciplex formation in diastereomeric naproxen-pyrrolidine dyads.

    PubMed

    Khramtsova, Ekaterina A; Plyusnin, Viktor F; Magin, Ilya M; Kruppa, Alexander I; Polyakov, Nikolay E; Leshina, Tatyana V; Nuin, Edurne; Marin, M Luisa; Miranda, Miguel A

    2013-12-19

    The influence of chirality on the elementary processes triggered by excitation of the (S,S)- and (R,S)- diastereoisomers of naproxen-pyrrolidine (NPX-Pyr) dyads has been studied by time-resolved fluorescence in acetonitrile-benzene mixtures. In these systems, the quenching of the (1)NPX*-Pyr singlet excited state occurs through electron transfer and exciplex formation. Fluorescence lifetimes and quantum yields revealed a significant difference (around 20%) between the (S,S)- and (R,S)- diastereomers. In addition, the quantum yields of exciplexes differed by a factor of 2 regardless of solvent polarity. This allows us to suggest a similar influence of the chiral centers on the local charge transfer resulting in exciplex and full charge separation that leads to ion-biradicals. A simplified scheme is proposed to estimate a set of rate constant values (k1-k5) for the elementary stages in each solvent system. PMID:24294968

  10. A Novel Europium Chelate Coated Nanosphere for Time-Resolved Fluorescence Immunoassay

    PubMed Central

    Shen, Yifeng; Xu, Shaohan; He, Donghua

    2015-01-01

    A novel europium ligand 2, 2’, 2’’, 2’’’-(4, 7-diphenyl-1, 10-phenanthroline-2, 9-diyl) bis (methylene) bis (azanetriyl) tetra acetic acid (BC-EDTA) was synthesized and characterized. It shows an emission spectrum peak at 610 nm when it is excited at 360 nm, with a large Stock shift (250 nm). It is covalently coated on the surface of a bare silica nanosphere containi free amino groups, using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-Hydroxysuccinimide. We also observed an interesting phenomenon that when BC-EDTA is labeled with a silica nanosphere, the chelate shows different excitation spectrum peaks of about 295 nm. We speculate that the carboxyl has a significant influence on its excitation spectrum. The BC-EDTA/Eu3+coated nanosphere could be used as a fluorescent probe for time-resolved fluorescence immunoassay. We labeled the antibody with the fluorescent nanosphere to develop a nanosphere based hepatitis B surface antigen as a time-resolved fluorescence immunoassay reagent, which is very easy to operate and eliminates potential contamination of Eu3+ contained in the environment. The analytical and functional sensitivities are 0.0037 ?g/L and 0.08 ?g/L (S/N?2.0) respectively. The detection range is 0.08-166.67 ?g/L, which is much wider than that of ELISA (0.2-5?g/L). It is comparable to the commercial dissociation-enhanced lanthanide fluoro-immunoassay system (DELFIA) reagents (0.2-145?g/L). We propose that it can fulfill clinical applications. PMID:26056826

  11. Time-resolved Photoelectron Spectroscopy and the Photoprotective Properties of Adenine

    NASA Astrophysics Data System (ADS)

    Evans, Nick; Potter, William; Briouillette, Amanda; Ullrich, Susanne

    2008-10-01

    A system for fs time-resolved photoelectron and photoion spectroscopy has recently been developed at the University of Georgia, Department of Physics and Astronomy, in order to study the photophysical properties of isolated biomolecular building blocks. Ultrafast electronic excited state deactivation processes are observed in these chromophores and contribute to their photostability under UV radiation. Time-resolved photoelectron spectroscopy (TRPES) provides a unique tool to investigate these processes as the two dimensional data comprises both spectral and dynamic information. The spectral data allows identification of participating electronically excited states while the dynamic data allows the state's associated lifetimes to be extracted. Details of the experimental setup and technique will be presented in this talk as well as our initial results on the deactivation pathways in the DNA base adenine following excitation by wavelengths between 245 - 266 nm.

  12. Applications of phasors to in vitro time-resolved fluorescence measurements.

    PubMed

    Stefl, Martin; James, Nicholas G; Ross, Justin A; Jameson, David M

    2011-03-01

    The phasor method of treating fluorescence lifetime data provides a facile and convenient approach to characterize lifetime heterogeneity and to detect the presence of excited state reactions such as solvent relaxation and Förster resonance energy transfer. The method uses a plot of M sin(?) versus M cos(?), where M is the modulation ratio and ? is the phase angle taken from frequency domain fluorometry. A principal advantage of the phasor method is that it provides a model-less approach to time-resolved data amenable to visual inspection. Although the phasor approach has been recently applied to fluorescence lifetime imaging microscopy, it has not been used extensively for cuvette studies. In the current study, we explore the applications of the method to in vitro samples. The phasors of binary and ternary mixtures of fluorescent dyes demonstrate the utility of the method for investigating complex mixtures. Data from excited state reactions, such as dipolar relaxation in membrane and protein systems and also energy transfer from the tryptophan residue to the chromophore in enhanced green fluorescent protein, are also presented. PMID:21078290

  13. Energy transfer in Anabaena variabilis filaments under nitrogen depletion, studied by time-resolved fluorescence.

    PubMed

    Onishi, Aya; Aikawa, Shimpei; Kondo, Akihiko; Akimoto, Seiji

    2015-08-01

    Some filamentous cyanobacteria (including Anabaena) differentiate into heterocysts under nitrogen-depleted conditions. During differentiation, the phycobiliproteins and photosystem II in the heterocysts are gradually degraded. Nitrogen depletion induces changes in the pigment composition of both vegetative cells and heterocysts, which affect the excitation energy transfer processes. To investigate the changes in excitation energy transfer processes of Anabaena variabilis filaments grown in standard medium (BG11) and a nitrogen-free medium (BG110), we measured their steady-state absorption spectra, steady-state fluorescence spectra, and time-resolved fluorescence spectra (TRFS) at 77 K. TRFS were measured with a picosecond time-correlated single photon counting system. The pigment compositions of the filaments grown in BG110 changed throughout the growth period; the relative phycocyanin levels monotonically decreased, whereas the relative carotenoid (Car) levels decreased and then recovered to their initial value (at day 0), with formation of lower-energy Cars. Nitrogen starvation also altered the fluorescence kinetics of PSI; the fluorescence maximum of TRFS immediately after excitation occurred at 735, 740, and 730 nm after 4, 8, and 15 days growth in BG110, respectively. Based on these results, we discuss the excitation energy transfer dynamics of A. variabilis filaments under the nitrogen-depleted condition throughout the growth period. PMID:25596847

  14. Dynamic Operational Stress Measurement of MEMS Using Time-Resolved Raman Spectroscopy

    Microsoft Academic Search

    James W. Pomeroy; Petros Gkotsis; Meiling Zhu; G. Leighton; Paul Kirby; Martin Kuball

    2008-01-01

    A dynamic-stress analysis method, based on time-resolved micro Raman spectroscopy, has been developed for reliability studies of microelectromechanical systems. This novel technique is illustrated by measuring temporally and spatially resolved stress maps of a piezoelectrically actuated silicon microcantilever when driven at its first- (6.094 kHz) and second-order (37.89 kHz) resonant frequencies. Stress amplitudes of up to 180 plusmn 10 MPa

  15. Set-up for time-resolved step-scan FTIR spectroscopy of noncyclic reactions

    Microsoft Academic Search

    Robin Rammelsberg; Sophie Boulas; Harald Chorongiewski; Klaus Gerwert

    1999-01-01

    We have established a novel technique, which allows the application of time-resolved step-scan FTIR difference spectroscopy on noncyclic reactions. Cyclic reactions are ideally suited for the step-scan technique. However, it is difficult to apply the step-scan technique to noncyclic reactions, because the investigated process has to be repeated at about 1000 sampling positions of the interferogram. Consequently, to investigate noncyclic

  16. Time-resolved magnetic circular dichroism spectroscopy of photolyzed carbonmonoxy cytochrome c oxidase (cytochrome aa3).

    PubMed Central

    Goldbeck, R A; Dawes, T D; Einarsdóttir, O; Woodruff, W H; Kliger, D S

    1991-01-01

    Nanosecond time-resolved magnetic circular dichroism (TRMCD) and time-resolved natural circular dichroism (TRCD) measurements of photolysis products of the CO complex of eukaryotic cytochrome c oxidase (CcO-CO) are presented. TRMCD spectra obtained at 100 ns and 10 microseconds after photolysis are diagnostic of pentacoordinate cytochrome a3Fe2+, as would be expected for simple photodissociation. Other time-resolved spectroscopies (UV-visible and resonance Raman), however, show evidence for unusual Fea3(2+) coordination after CO photolysis (Woodruff, W. H., O. Einarsdóttir, R. B. Dyer, K. A. Bagley, G. Palmer, S. J. Atherton, R. A. Goldbeck, T. D. Dawes, and D. S. Kliger. 1991. Proc. Nat. Acad. Sci. U.S.A. 88:2588-2592). Furthermore, time-resolved IR experiments have shown that photodissociated CO binds to CuB+ prior to recombining with Fea3(2+) (Dyer, R. B., O. Einarsdóttir, P. M. Killough, J. J. López-Garriga, and W. H. Woodruff. 1989. J. Am. Chem. Soc. 111:7657-7659). A model of the CcO-CO photolysis cycle which is consistent with all of the spectroscopic results is presented. A novel feature of this model is the coordination of a ligand endogenous to the protein to the Fe axial site vacated by the photolyzed CO and the simultaneous breaking of the Fe-imidazole(histidine) bond. PMID:1653049

  17. State of the art in time-resolved laser-induced fluorescence for actinides analysis: Applications and trends

    Microsoft Academic Search

    C. Moulin; P. Decambox; P. Mauchien

    1997-01-01

    Time-resolved laser-induced fluorescence (TRLIF) is a method of choice for actinides and lanthanides determination at low level in nuclear, biological and environmental samples. This technique is based on pulsed laser excitation followed by temporal resolution of the fluorescence signal. This technique has many advantages such as: high sensitivity, rapidity, triple selectivity and is applicable in a wide range of activity

  18. Time resolved measurements of cathode fall in high frequency fluorescent lamps

    NASA Astrophysics Data System (ADS)

    Hadrath, S.; Garner, R. C.; Lieder, G. H.; Ehlbeck, J.

    2007-11-01

    Measurements are presented of the time resolved cathode and anode falls of high frequency fluorescent lamps for a range of discharge currents typically encountered in dimming mode. Measurements were performed with the movable anode technique. Supporting spectroscopic emission measurements were made of key transitions (argon 420.1 nm and mercury 435.8 nm), whose onset coincide with cathode fall equalling the value associated with the energy, relative to the ground state, of the upper level of the respective transition. The measurements are in general agreement with the well-known understanding of dimmed lamp operation: peak cathode fall decreases with increasing lamp current and with increasing auxiliary coil heating. However, the time dependence of the measurements offers additional insight.

  19. Comparison of the rate constants for energy transfer in the light-harvesting protein, C-phycocyanin, calculated from Foerster`s theory and experimentally measured by time-resolved fluorescence spectroscopy

    SciTech Connect

    Debreczeny, M.P.

    1994-05-01

    We have measured and assigned rate constants for energy transfer between chromophores in the light-harvesting protein C-phycocyanin (PC), in the monomeric and trimeric aggregation states, isolated from Synechococcus sp. PCC 7002. In order to compare the measured rate constants with those predicted by Fdrster`s theory of inductive resonance in the weak coupling limit, we have experimentally resolved several properties of the three chromophore types ({beta}{sub 155} {alpha}{sub 84}, {beta}{sub 84}) found in PC monomers, including absorption and fluorescence spectra, extinction coefficients, fluorescence quantum yields, and fluorescence lifetimes. The cpcB/C155S mutant, whose PC is missing the {beta}{sub 155} chromophore, was, useful in effecting the resolution of the chromophore properties and in assigning the experimentally observed rate constants for energy transfer to specific pathways.

  20. A multi-analytical investigation of semi-conductor pigments with time-resolved spectroscopy and imaging

    NASA Astrophysics Data System (ADS)

    Nevin, A.; Cesaratto, A.; D'Andrea, C.; Valentini, Gianluca; Comelli, D.

    2013-05-01

    We present the non-invasive study of historical and modern Zn- and Cd-based pigments with time-resolved fluorescence spectroscopy, fluorescence multispectral imaging and fluorescence lifetime imaging (FLIM). Zinc oxide and Zinc sulphide are semiconductors which have been used as white pigments in paintings, and the luminescence of these pigments from trapped states is strongly dependent on the presence of impurities and crystal defects. Cadmium sulphoselenide pigments vary in hue from yellow to deep red based on their composition, and are another class of semiconductor pigments which emit both in the visible and the near infrared. The Fluorescence lifetime of historical and modern pigments has been measured using both an Optical Multichannel Analyser (OMA) coupled with a Nd:YAG nslaser, and a streak camera coupled with a ps-laser for spectrally-resolved fluorescence lifetime measurements. For Znbased pigments we have also employed Fluorescence Lifetime Imaging (FLIM) for the measurement of luminescence. A case study of FLIM applied to the analysis of the painting by Vincent Van Gogh on paper - "Les Bretonnes et le pardon de Pont-Aven" (1888) is presented. Through the integration of complementary, portable and non-invasive spectroscopic techniques, new insights into the optical properties of Zn- and Cd-based pigments have been gained which will inform future analysis of late 19th] and early 20th C. paintings.

  1. Non-contact characterization of bacteria by time-resolved fluorescence

    NASA Astrophysics Data System (ADS)

    Bouchard, Alain; Frechette, Julie; Long, William F.; Vernon, Marcia; Cormier, Jean-Francois; Vallee, Real; Mafu, Akier A.; Lemay, Marie-Josee

    2004-07-01

    Accurate real-time methods for the detection of pathogenic microorganisms in the agri-food industry would represent an improvement over standard methods of analysis. We are currently developing a non-contact, scanning optical system for the detection of bacteria on meat surfaces based on fluorescence lifetime and intensity measurements. The system detects autofluorescent light emitted by the naturally occurring fluorophores in bacteria. Potential expected advantages of this system include accurate and efficient 2D real-time mapping of bacterial contamination of surfaces, and elimination of sample-to-sample cross-contamination. Furthermore, as the technique only requires minimal sample preparation and handling, the chemical properties of the specimen are preserved. This article presents the preliminary results obtained from a time-resolved fluorescence imaging system for the characterization of a non-pathogenic gram-negative bacteria, Pseudomonas fluorescens. Additionally we present a particular application of the system of interest to the agri-food industry, demonstrating its potential as a real-time macroscopic imaging system for mapping bacterial contamination on meat surfaces. Initial results indicate that the combination of fluorescence lifetime and intensity measurements provides a means for characterizing biological media and for detecting microorganisms on surfaces.

  2. Unfolding of acrylodan-labeled human serum albumin probed by steady-state and time-resolved fluorescence methods.

    PubMed Central

    Flora, K; Brennan, J D; Baker, G A; Doody, M A; Bright, F V

    1998-01-01

    Steady-state and time-resolved fluorescence spectroscopy was used to follow the local and global changes in structure and dynamics during chemical and thermal denaturation of unlabeled human serum albumin (HSA) and HSA with an acrylodan moiety bound to Cys34. Acrylodan fluorescence was monitored to obtain information about unfolding processes in domain I, and the emission of the Trp residue at position 214 was used to examine domain II. In addition, Trp-to-acrylodan resonance energy transfer was examined to probe interdomain spatial relationships during unfolding. Increasing the temperature to less than 50 degrees C or adding less than 1.0 M GdHCl resulted in an initial, reversible separation of domains I and II. Denaturation by heating to 70 degrees C or by adding 2.0 M GdHCl resulted in irreversible unfolding of domain II. Further denaturation of HSA by either method resulted in irreversible unfolding of domain I. These results clearly demonstrate that HSA unfolds by a pathway involving at least three distinct steps. The low detection limits and high information content of dual probe fluorescence should allow this technique to be used to study the unfolding behavior of entrapped or immobilized HSA. PMID:9675210

  3. Picosecond time-resolved infrared spectroscopy of rhodium and iridium azides.

    PubMed

    Portius, Peter; Meijer, Anthony J H M; Towrie, Michael; Crozier, Benjamin F; Schiager, Ingrid

    2014-12-21

    Picosecond time-resolved infrared spectroscopy was used to elucidate early photochemical processes in the diazido complexes M(Cp*)(N3)2(PPh3), M = Rh (), Ir (), using 266 nm and 400 nm excitation in THF, CH2Cl2, MeCN and toluene solutions. The time-resolved data have been interpreted with the aid of DFT calculations on vibrational spectra of the singlet ground states and triplet excited states and their rotamers. While the yields of phototransformations via N2 loss are low in both complexes, cleaves a N3 ligand under 266 nm excitation. The molecular structure of is also reported as determined by single crystal X-ray diffraction. PMID:25182870

  4. Semiconductors investigated by time resolved Raman absorption and photoluminescence spectroscopy using femtosecond and picosecond laser techniques

    Microsoft Academic Search

    R. R. Alfano; A. G. Doukas

    1984-01-01

    We report on the research performed during the period 1982-1983 under the auspices of AFOSR. The research effort follows two directions: (1) laser development: subpicosecond laser, application of anti-resonant cavity to Nd:glass, study of the emerald laser, and study of a new mode-locking dye for shorter pulses. (2) Time-resolved fluorescence and absorption studies of CdCr2Se4, GaAs and Ga(0,5)In(0.5)P with the

  5. The use of time-resolved fluorescence in gel-based proteomics for improved biomarker discovery

    NASA Astrophysics Data System (ADS)

    Sandberg, AnnSofi; Buschmann, Volker; Kapusta, Peter; Erdmann, Rainer; Wheelock, Åsa M.

    2010-02-01

    This paper describes a new platform for quantitative intact proteomics, entitled Cumulative Time-resolved Emission 2-Dimensional Gel Electrophoresis (CuTEDGE). The CuTEDGE technology utilizes differences in fluorescent lifetimes to subtract the confounding background fluorescence during in-gel detection and quantification of proteins, resulting in a drastic improvement in both sensitivity and dynamic range compared to existing technology. The platform is primarily designed for image acquisition in 2-dimensional gel electrophoresis (2-DE), but is also applicable to 1-dimensional gel electrophoresis (1-DE), and proteins electroblotted to membranes. In a set of proof-of-principle measurements, we have evaluated the performance of the novel technology using the MicroTime 100 instrument (PicoQuant GmbH) in conjunction with the CyDye minimal labeling fluorochromes (GE Healthcare, Uppsala, Sweden) to perform differential gel electrophoresis (DIGE) analyses. The results indicate that the CuTEDGE technology provides an improvement in the dynamic range and sensitivity of detection of 3 orders of magnitude as compared to current state-of-the-art image acquisition instrumentation available for 2-DE (Typhoon 9410, GE Healthcare). Given the potential dynamic range of 7-8 orders of magnitude and sensitivities in the attomol range, the described invention represents a technological leap in detection of low abundance cellular proteins, which is desperately needed in the field of biomarker discovery.

  6. Photodissociation of thioglycolic acid studied by femtosecond time-resolved transient absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Attar, Andrew R.; Blumling, Daniel E.; Knappenberger, Kenneth L.

    2011-01-01

    Steady-state and time-resolved spectroscopies were employed to study the photodissociation of both the neutral (HS-CH2-COOH) and doubly deprotonated (-S-CH2-COO-) forms of thioglycolic acid (TGA), a common surface-passivating ligand used in the aqueous synthesis and organization of semiconducting nanostructures. Room temperature UV-Vis absorption spectroscopy indicated strong absorption by the S1 and S2 excited states at 250 nm and 185 nm, respectively. The spectrum also contained a weaker absorption band that extended to approximately 550 nm, which was assigned to the ? ^ * _{CO} leftarrow n_O transition. Femtosecond time-resolved transient absorption spectroscopy was performed on TGA using 400 nm excitation and a white-light continuum probe to provide the temporally and spectrally resolved data. Both forms of TGA underwent a photoinduced dissociation from the excited state to form an ?-thiol-substituted acyl radical (?-TAR, S-CH2-CO•). For the acidic form of TGA, radical formation occurred with an apparent time constant of 60 ± 5 fs; subsequent unimolecular decay took 400 ± 60 fs. Similar kinetics were observed for the deprotonated form of TGA (70 ± 10 fs radical formation; 420 ± 40 fs decay). The production of the ?-TAR was corroborated by the observation of its characteristic optical absorption. Time-resolved data indicated that the photoinduced dissociation of TGA via cleavage of the C-OH bond occurred rapidly (?100 fs). The prevalence of TGA in aqueous semiconducting nanoparticles makes its absorption in the visible spectral region and subsequent dissociation key to understanding the behavior of nanoscale systems.

  7. Time-resolved photoelectron spectroscopy of coupled electron-nuclear motion

    SciTech Connect

    Falge, Mirjam; Engel, Volker [Institut fuer Physikalische und Theoretische Chemie and Roentgen Research Center for Complex Material Systems, Universitaet Wuerzburg, Am Hubland, 97074 Wuerzburg (Germany); Graefe, Stefanie [Institute for Theoretical Physics, Vienna University of Technology, Wiedner Hauptstr. 8-10, A-1040 Vienna (Austria)

    2011-05-14

    We investigate pump-probe electron detachment spectroscopy in a model system which is ideally suited to study coupled electronic and nuclear wave-packet dynamics. Time-resolved photoelectron spectra are calculated within the adiabatic approximation and a discretization of the detachment continuum. These spectra are compared to those which derive from a non-Born-Oppenheimer description and a numerically exact treatment of the detachment process. In this way it is possible to identify the influence of non-adiabatic effects on the spectra in a systematic way and also to test commonly applied approximations.

  8. Ordering of PCDTBT Revealed by Time-Resolved Electron Paramagnetic Resonance Spectroscopy of Its Triplet Excitons.

    PubMed

    Biskup, Till; Sommer, Michael; Rein, Stephan; Meyer, Deborah L; Kohlstädt, Markus; Würfel, Uli; Weber, Stefan

    2015-06-22

    Time-resolved electron paramagnetic resonance (TREPR) spectroscopy is shown to be a powerful tool to characterize triplet excitons of conjugated polymers. The resulting spectra are highly sensitive to the orientation of the molecule. In thin films cast on PET film, the molecules' orientation with respect to the surface plane can be determined, providing access to sample morphology on a microscopic scale. Surprisingly, the conjugated polymer investigated here, a promising material for organic photovoltaics, exhibits ordering even in bulk samples. Orientation effects may significantly influence the efficiency of solar cells, thus rendering proper control of sample morphology highly important. PMID:25959127

  9. Time resolved spectroscopy of the multiperiodic pulsating subdwarf B star PG1605+072

    E-print Network

    A. Tillich; U. Heber; S. J. O'Toole

    2006-12-19

    We present results for the 2m spectroscopic part of the MultiSite Spectroscopic Telescope campaign, which took place in May/June 2002. In order to perform an asteroseismological analysis on the multiperiodic pulsating subdwarf B star PG 1605+072 we used over 150 hours of time resolved spectroscopy in order to search for and analyse line profile variations by using phase binning. We succeeded in finding variations in effective temperature and gravity for four modes. A pilot analysis using the \\textit{BRUCE} and \\textit{KYLIE} programs and assuming strong rotation and low inclination favours models with $l=1$ or $l=2$ with $m\\leq0$.

  10. Nonlinear Raman Techniques in Femtosecond Time Resolved Spectroscopy for the Analysis and Control of Molecular Dynamics

    SciTech Connect

    Materny, Arnulf; Konradi, Jakow; Namboodiri, Vinu; Namboodiri, Mahesh; Scaria, Abraham [Jacobs University Bremen, School of Science and Engineering Campus Ring 1, 28759 Bremen (Germany)

    2008-11-14

    The use of four-wave mixing techniques in femtosecond time-resolved spectroscopy has considerable advantages. Due to the many degrees of freedom offered e.g. by coherent anti-Stokes Raman scattering (CARS), the dynamics even of complex systems can be analyzed in detail. Using pulse shaping techniques in combination with a self-learning loop approach, molecular mode excitation can be controlled very efficiently in a multi-photon excitation process. Results obtained from the optimal control of CARS on {beta}-carotene are discussed.

  11. Time resolved single molecule spectroscopy of semiconductor quantum dot/conjugated organic hybrid nanostructures

    NASA Astrophysics Data System (ADS)

    Odoi, Michael Yemoh

    Single molecule studies on CdSe quantum dots functionalized with oligo-phenylene vinylene ligands (CdSe-OPV) provide evidence of strong electronic communication that facilitate charge and energy transport between the OPV ligands and the CdSe quantum dot core. This electronic interaction greatly modify, the photoluminescence properties of both bulk and single CdSe-OPV nanostructure thin film samples. Size-correlated wide-field fluorescence imaging show that blinking suppression in single CdSe-OPV is linked to the degree of OPV coverage (inferred from AFM height scans) on the quantum dot surface. The effect of the complex electronic environment presented by photoexcited OPV ligands on the excited state property of CdSe-OPV is measured with single photon counting and photon-pair correlation spectroscopy techniques. Time-tagged-time-resolved (TTTR) single photon counting measurements from individual CdSe-OPV nanostructures, show excited state lifetimes an order of magnitude shorter relative to conventional ZnS/CdSe quantum dots. Second-order intensity correlation measurements g(2)(tau) from individual CdSe-OPV nanostructures point to a weak multi-excitonic character with a strong wavelength dependent modulation depth. By tuning in and out of the absorption of the OPV ligands we observe changes in modulation depth from g(2) (0) ? 0.2 to 0.05 under 405 and 514 nm excitation respectively. Defocused images and polarization anisotropy measurements also reveal a well-defined linear dipole emission pattern in single CdSe-OPV nanostructures. These results provide new insights into to the mechanism behind the electronic interactions in composite quantum dot/conjugated organic composite systems at the single molecule level. The observed intensity flickering , blinking suppression and associated lifetime/count rate and antibunching behaviour is well explained by a Stark interaction model. Charge transfer from photo-excitation of the OPV ligands to the surface of the CdSe quantum dot core, mixes electron/holes states and lifts the degeneracy in the band edge bright exciton state, which induces a well define linear dipole behaviour in single CdSe-OPV nanostructures. The shift in the electron energies also affects Auger assisted hole trapping rates, suppress access to dark states and reduce the excited state lifetime.

  12. Picosecond Time-Resolved Fourier Transform Raman Spectroscopy of 9,10-Diphenylanthracene in the Excited Singlet State

    E-print Network

    Jas, Gouri S.; Wan, Chaozhi; Johnson, Carey K.

    1995-05-01

    Picosecond Time-Resolved Fourier Transform Raman Spectroscopy of 9,10-Diphenylanthracene i the Excited Singlet State GOURI S. JAS, CHAOZHI WAN, and CAREY K. JOHNSON* Department ofChemistry, University of Kansas, Lawrence, Kansas 66045 Time...

  13. Time-resolved photoluminescence spectroscopy and imaging: new approaches to the analysis of cultural heritage and its degradation.

    PubMed

    Nevin, Austin; Cesaratto, Anna; Bellei, Sara; D'Andrea, Cosimo; Toniolo, Lucia; Valentini, Gianluca; Comelli, Daniela

    2014-01-01

    Applications of time-resolved photoluminescence spectroscopy (TRPL) and fluorescence lifetime imaging (FLIM) to the analysis of cultural heritage are presented. Examples range from historic wall paintings and stone sculptures to 20th century iconic design objects. A detailed description of the instrumentation developed and employed for analysis in the laboratory or in situ is given. Both instruments rely on a pulsed laser source coupled to a gated detection system, but differ in the type of information they provide. Applications of FLIM to the analysis of model samples and for the in-situ monitoring of works of art range from the analysis of organic materials and pigments in wall paintings, the detection of trace organic substances on stone sculptures, to the mapping of luminescence in late 19th century paintings. TRPL and FLIM are employed as sensors for the detection of the degradation of design objects made in plastic. Applications and avenues for future research are suggested. PMID:24699285

  14. Validation and evaluation of a novel time-resolved laser-induced fluorescence technique.

    PubMed

    Durot, C J; Gallimore, A D; Smith, T B

    2014-01-01

    We present a novel technique to measure time-resolved laser-induced fluorescence signals in plasma sources that have a relatively constant Fourier spectrum of oscillations in steady-state operation, but are not periodically pulsed, e.g., Hall thrusters. The technique uses laser modulation of the order of MHz and recovers signal via a combination of band-pass filtering, phase-sensitive detection, and averaging over estimated transfer functions calculated for many different cycles of the oscillation. Periodic discharge current oscillations were imposed on a hollow cathode. Measurements were validated by comparison with independent measurements from a lock-in amplifier and by comparing the results of the transfer function average to an independent analysis technique triggering averaging over many oscillation cycles in the time domain. The performance of the new technique is analyzed and compared to prior techniques, and it is shown that this new technique has a niche in measurements where the analog photomultiplier signal has a nonwhite noise spectral density and cycles of oscillation are not sufficiently repeatable to allow for reliable triggering or a meaningful average waveform in the time domain. PMID:24517766

  15. Measuring human beta-secretase (BACE1) activity using homogeneous time-resolved fluorescence.

    PubMed

    Kennedy, Matthew E; Wang, Wenyan; Song, Lixin; Lee, Julie; Zhang, Lili; Wong, Gwen; Wang, Liyang; Parker, Eric

    2003-08-01

    The human beta-secretase enzyme, BACE1, mediates a critical step in the production of A beta(40) and A beta(42) peptides which are responsible for the severe neuronal cell death and insoluble amyloid plaques of Alzheimer's disease (AD). Several lines of evidence suggest that potent BACE1 inhibitors represent an attractive A beta-lowering strategy for AD. We designed a simple homogeneous time-resolved fluorescence (HTRF) assay which utilizes the fluorescence resonance energy transfer (FRET) pair europium and allophycocyanin for measuring BACE1 enzymatic activity in a high-throughput manner. Robust FRET was observed when an 18-amino-acid APP Swedish-synthetic peptide that was N-terminally labeled with europium cryptate and C-terminally biotinylated was incubated with streptavidin-coupled cross-linked allophycocyanin (SA-XL665). Purified BACE1 enzyme caused a time- and concentration-dependent linear change in FRET at low nanomolar enzyme concentrations. This assay was used to compare the autoprocessed "mature" BACE1 enzyme (sautoBACe1) and the soluble proBACE1 for activity and inhibition by selected peptidic BACE inhibitors. sautoBACE1 displayed only a modest increase in activity compared to sproBACE1 and this activity was uninhibited by the BACE1 prodomain peptide. Interestingly, the BACE1 prodomain peptide was able to partially inhibit sproBACE1 activity. IC(50s) for a P10-P4' statine BACE1 inhibitor, OM99-2, and OM-003 determined using the HTRF assay were in good agreement with those reported in the literature. The primary advantages of the HTRF-formatted BACE1 protease assay include appropriate reflection of native BACE1 activity, high sensitivity, low variability, and intrinsic quench correction afforded by ratiometric measurements made between EuK and SA-XL665 fluorophores. PMID:12842106

  16. A sensitive solid-phase time-resolved fluorescence immunoassay apparatus

    NASA Astrophysics Data System (ADS)

    Wang, Yun-lei; Song, Ke-fei; Zhang, Wei-lai; Li, Jun-ling

    2009-07-01

    In the device, a He-Ne laser of flash frequency 1-20 Hz was adopted as exciting light source, and three key technical problems have been solved successfully in order to enhance the detecting sensitivity and measuring stability of the device for time-resolved fluorimmunoassays(TRFIA)[1]. The first one is to design optimum exciting optical system, so that the exciting light beam excite the sample most effectively. The second one is to have a project spectrum filter which can reduce the affection of the background light to the photomultiplier tube and also ensure influence of the stray light and mixed diffusion light to the sample fluorescence to the least, the sample fluorescence through the integrating sphere and come to the grating monochromator, The right wavelength will be chosed through changing the angle of incidence of the grating monochromator. The third one is to simulate the principle of sample averaging of BOXCAR averager. In the device, SCM was used as primary controller and CPLD was used as timing controller. Through the preparation process, signal-to-noise ratio(SNR) will be improved, also adjust delay time, ampling frequency and sampling number arbitrarily. By testing, the sensitivity is 10-12mol/L(substance marked by Eu3+), examination repeat is <=2.5%, examination linearity is from 10-8mol/L to 10-12mol/L, correlation coefficient is 99.98%(p<=0.01). The instrument is advanced for ultrasensitive detection of antigen and antibody , and solve the tumor, genetic variation, the virus protein detection.

  17. Highly sensitive detection of human papillomavirus type 16 DNA using time-resolved fluorescence microscopy and long lifetime probes

    NASA Astrophysics Data System (ADS)

    Wang, Xue F.; Periasamy, Ammasi; Wodnicki, Pawel; Siadat-Pajouh, M.; Herman, Brian

    1995-04-01

    We have been interested in the role of Human Papillomavirus (HPV) in cervical cancer and its diagnosis; to that end we have been developing microscopic imaging and fluorescent in situ hybridization (FISH) techniques to genotype and quantitate the amount of HPV present at a single cell level in cervical PAP smears. However, we have found that low levels of HPV DNA are difficult to detect accurately because theoretically obtainable sensitivity is never achieved due to nonspecific autofluorescence, fixative induced fluorescence of cells and tissues, and autofluorescence of the optical components in the microscopic system. In addition, the absorption stains used for PAP smears are intensely autofluorescent. Autofluorescence is a rapidly decaying process with lifetimes in the range of 1-100 nsec, whereas phosphorescence and delayed fluorescence have lifetimes in the range of 1 microsecond(s) ec-10 msec. The ability to discriminate between specific fluorescence and autofluorescence in the time-domain has improved the sensitivity of diagnostic test such that they perform comparably to, or even more sensitive than radioisotopic assays. We have developed a novel time-resolved fluorescence microscope to improve the sensitivity of detection of specific molecules of interest in slide based specimens. This time-resolved fluorescence microscope is based on our recently developed fluorescence lifetime imaging microscopy (FILM) in conjunction with the use of long lifetime fluorescent labels. By using fluorescence in situ hybridization and the long lifetime probe (europium), we have demonstrated the utility of this technique for detection of HPV DNA in cervicovaginal cells. Our results indicate that the use of time-resolved fluorescence microscopy and long lifetime probes increases the sensitivity of detection by removing autofluorescence and will thus lead to improved early diagnosis of cervical cancer. Since the highly sensitive detection of DNA in clinical samples using fluorescence in situ hybridization image is useful for the diagnosis of many other type of diseases, the system we have developed should find numerous applications for the diagnosis of disease states.

  18. Hyperspectral time-resolved wide-field fluorescence molecular tomography based on structured light and single-pixel detection.

    PubMed

    Pian, Qi; Yao, Ruoyang; Zhao, Lingling; Intes, Xavier

    2015-02-01

    We present a time-resolved fluorescence diffuse optical tomography platform that is based on wide-field structured illumination, single-pixel detection, and hyperspectral acquisition. Two spatial light modulators (digital micro-mirror devices) are employed to generate independently wide-field illumination and detection patterns, coupled with a 16-channel spectrophotometer detection module to capture hyperspectral time-resolved tomographic data sets. The main system characteristics are reported, and we demonstrate the feasibility of acquiring dense 4D tomographic data sets (space, time, spectra) for time domain 3D quantitative multiplexed fluorophore concentration mapping in turbid media. PMID:25680065

  19. Development of a broadband picosecond infrared spectrometer and its incorporation into an existing ultrafast time-resolved resonance Raman, UV/visible, and fluorescence spectroscopic apparatus.

    PubMed

    Towrie, Michael; Grills, David C; Dyer, Joanne; Weinstein, Julia A; Matousek, Pavel; Barton, Robin; Bailey, Philip D; Subramaniam, Naresh; Kwok, Wai M; Ma, Chensheng; Phillips, David; Parker, Anthony W; George, Michael W

    2003-04-01

    We have constructed a broadband ultrafast time-resolved infrared (TRIR) spectrometer and incorporated it into our existing time-resolved spectroscopy apparatus, thus creating a single instrument capable of performing the complementary techniques of femto-/picosecond time-resolved resonance Raman (TR3), fluorescence, and UV/visible/infrared transient absorption spectroscopy. The TRIR spectrometer employs broadband (150 fs, approximately 150 cm(-1) FWHM) mid-infrared probe and reference pulses (generated by difference frequency mixing of near-infrared pulses in type I AgGaS2), which are dispersed over two 64-element linear infrared array detectors (HgCdTe). These are coupled via custom-built data acquisition electronics to a personal computer for data processing. This data acquisition system performs signal handling on a shot-by-shot basis at the 1 kHz repetition rate of the pulsed laser system. The combination of real-time signal processing and the ability to normalize each probe and reference pulse has enabled us to achieve a high sensitivity on the order of deltaOD approximately 10(-4) - 10(-5) with 1 min of acquisition time. We present preliminary picosecond TRIR studies using this spectrometer and also demonstrate how a combination of TRIR and TR3 spectroscopy can provide key information for the full elucidation of a photochemical process. PMID:14658632

  20. Semiconductors investigated by time resolved Raman absorption and photoluminescence spectroscopy using femtosecond and picosecond laser techniques

    NASA Astrophysics Data System (ADS)

    Alfano, R. R.; Doukas, A. G.

    1984-03-01

    We report on the research performed during the period 1982-1983 under the auspices of AFOSR. The research effort follows two directions: (1) laser development: subpicosecond laser, application of anti-resonant cavity to Nd:glass, study of the emerald laser, and study of a new mode-locking dye for shorter pulses. (2) Time-resolved fluorescence and absorption studies of CdCr2Se4, GaAs and Ga(0,5)In(0.5)P with the goal to understand the interaction and kinetics of photogenerated carriers and basic assignments of the valence-conduction band transitions (CdCr2Se4). We have also investigated the dynamics of semi-insulating CdSe. Finally we have continued the research on radiation damage (neutrons and protons) in CdSe and GaAs.

  1. Time resolved optical biopsy spectroscopy of normal, benign and malignant tissues from NADH and FAD changes

    NASA Astrophysics Data System (ADS)

    Masilamani, V.; Das, B. B.; Secor, J.; AlSalhi, M.; Amer, S. B.; Farhat, K.; Rabah, D.; Alfano, R. R.

    2012-01-01

    Histo pathological examination is the gold standard to discriminate between benign and malignant growth of tissue. But this is invasive and stressful. Hence many non invasive imaging techniques, such as CT, MRI, PET, etc are employed, each having certain advantages and disadvantages. In this context optical biopsy is a newly emerging technique, since it employs non-ionizing radiation like light or laser, which could be shined directly or launched through optical fiber to reach any part of the body. This paper reports results of time resolved emission spectra of 24 excised tissue sample (normal control=12; benign=4; malignant=8) of breast and prostate, employing a 390nm, 100 fs, Ti-Sapphire laser pulses. The fluorescence decay times were measured using streak camera and fitted for single and bi- exponential decays with reliability of 97%. Our results show the distinct difference between normal, benign and malignant tissues attributed changes of NADH and FAD levels.

  2. Rapid homogenous time-resolved fluorescence (HTRF) immunoassay for anthrax detection.

    PubMed

    Cohen, Noam; Mechaly, Adva; Mazor, Ohad; Fisher, Morly; Zahavy, Eran

    2014-05-01

    Infection with Bacillus anthracsis spores induces an acute anthrax disease that can cause casualties and death in untreated cases. Thus rapid diagnosis of anthrax at early stage of the disease is essential to allow an effective treatment. Here we present the development of rapid and sensitive homogenous time-resolved fluorescence (HTRF) immunoassays based on the energy transfer process of europium cryptate (EuK) donor to AlexaFluor647 acceptor. The energy transfer process is limited to d?

  3. White-light time-resolved reflectance spectroscopy for monitoring constituents concentrations in layered diffusive media

    NASA Astrophysics Data System (ADS)

    Giusto, A.; D'Andrea, C.; Spinelli, L.; Contini, D.; Torricelli, A.; Martelli, F.; Zaccanti, G.; Cubeddu, R.

    2007-07-01

    We performed reflectance measurements with a time-resolved white-light spectroscopy system to monitor concentrations changes in a two-layer liquid phantom with optical properties similar to human tissues. By varying the concentrations of three inks with different spectral features, we changed the absorption coefficient of the upper and lower layer to simulate either haemodynamics changes in the muscle covered by adipose layer, or functional brain activation with systemic response in the scalp. Data were analyzed by a time-resolved spectrally constrained fitting method based on a homogeneous model of photon diffusion. Although this approach is based on a homogeneous model and employs a single 2cm source-detector distance, the technique is able to monitor changes in the lower layer, while it is scarcely affected by variation in the upper layer. Preliminary in vivo measurements have been performed on one healthy volunteer to monitor oxy- and deoxy-haemoglobin changes in the muscle during arterial occlusion and in the brain during a motor task. Even if the overall sensitivity of the technique is reduced, in vivo results are in general agreement with the findings of dedicated system for tissue oximetry.

  4. Microcontroller based resonance tracking unit for time resolved continuous wave cavity-ringdown spectroscopy measurements

    NASA Astrophysics Data System (ADS)

    Votava, Ondrej; Mašát, Milan; Parker, Alexander E.; Jain, Chaithania; Fittschen, Christa

    2012-04-01

    We present in this work a new tracking servoloop electronics for continuous wave cavity-ringdown absorption spectroscopy (cw-CRDS) and its application to time resolved cw-CRDS measurements by coupling the system with a pulsed laser photolysis set-up. The tracking unit significantly increases the repetition rate of the CRDS events and thus improves effective time resolution (and/or the signal-to-noise ratio) in kinetics studies with cw-CRDS in given data acquisition time. The tracking servoloop uses novel strategy to track the cavity resonances that result in a fast relocking (few ms) after the loss of tracking due to an external disturbance. The microcontroller based design is highly flexible and thus advanced tracking strategies are easy to implement by the firmware modification without the need to modify the hardware. We believe that the performance of many existing cw-CRDS experiments, not only time-resolved, can be improved with such tracking unit without any additional modification to the experiment.

  5. Monitoring the folding kinetics of a ?-hairpin by time-resolved IR spectroscopy in silico.

    PubMed

    Daidone, Isabella; Thukral, Lipi; Smith, Jeremy C; Amadei, Andrea

    2015-04-01

    Protein folding is one of the most fundamental problems in modern biochemistry. Time-resolved infrared (IR) spectroscopy in the amide I region is commonly used to monitor folding kinetics. However, associated atomic detail information on the folding mechanism requires simulations. In atomistic simulations structural order parameters are typically used to follow the folding process along the simulated trajectories. However, a rigorous test of the reliability of the mechanisms found in the simulations requires calculation of the time-dependent experimental observable, i.e., in the present case the IR signal in the amide I region. Here, we combine molecular dynamics simulation with a mixed quantum mechanics/molecular mechanics theoretical methodology, the Perturbed Matrix Method, in order to characterize the folding of a ?-hairpin peptide, through modeling the time-dependence of the amide I IR signal. The kinetic and thermodynamic data (folding and unfolding rate constants, and equilibrium folded- and unfolded-state probabilities) obtained from the fit of the calculated signal are in good agreement with the available experimental data [Xu et al. J. Am. Chem. Soc. 2003, 125, 15388-15394]. To the best of our knowledge, this is the first report of the simulation of the time-resolved IR signal of a complex process occurring on a long (microsecond) time scale. PMID:25777154

  6. Time-Resolved Spectroscopy in Time-Dependent Density Functional Theory: An Exact Condition

    NASA Astrophysics Data System (ADS)

    Fuks, Johanna I.; Luo, Kai; Sandoval, Ernesto D.; Maitra, Neepa T.

    2015-05-01

    A fundamental property of a quantum system driven by an external field is that when the field is turned off the positions of its response frequencies are independent of the time at which the field is turned off. We show that this leads to an exact condition for the exchange-correlation potential of time-dependent density functional theory. The Kohn-Sham potential typically continues to evolve after the field is turned off, which leads to time dependence in the response frequencies of the Kohn-Sham response function. The exchange-correlation kernel must cancel out this time dependence. The condition is typically violated by approximations currently in use, as we demonstrate by several examples, which has severe consequences for their predictions of time-resolved spectroscopy.

  7. Time-resolved broadband cavity-enhanced absorption spectroscopy for chemical kinetics.

    SciTech Connect

    Sheps, Leonid; Chandler, David W.

    2013-04-01

    Experimental measurements of elementary reaction rate coefficients and product branching ratios are essential to our understanding of many fundamentally important processes in Combustion Chemistry. However, such measurements are often impossible because of a lack of adequate detection techniques. Some of the largest gaps in our knowledge concern some of the most important radical species, because their short lifetimes and low steady-state concentrations make them particularly difficult to detect. To address this challenge, we propose a novel general detection method for gas-phase chemical kinetics: time-resolved broadband cavity-enhanced absorption spectroscopy (TR-BB-CEAS). This all-optical, non-intrusive, multiplexed method enables sensitive direct probing of transient reaction intermediates in a simple, inexpensive, and robust experimental package.

  8. Time-resolved spectroscopy in time-dependent density functional theory: an exact condition.

    PubMed

    Fuks, Johanna I; Luo, Kai; Sandoval, Ernesto D; Maitra, Neepa T

    2015-05-01

    A fundamental property of a quantum system driven by an external field is that when the field is turned off the positions of its response frequencies are independent of the time at which the field is turned off. We show that this leads to an exact condition for the exchange-correlation potential of time-dependent density functional theory. The Kohn-Sham potential typically continues to evolve after the field is turned off, which leads to time dependence in the response frequencies of the Kohn-Sham response function. The exchange-correlation kernel must cancel out this time dependence. The condition is typically violated by approximations currently in use, as we demonstrate by several examples, which has severe consequences for their predictions of time-resolved spectroscopy. PMID:26000998

  9. Bayesian Comparison of Fit Parameters: An Application to Time-Resolved X-Ray Spectroscopy

    NASA Astrophysics Data System (ADS)

    Kashyap, V.

    Analysis of X-ray data of the stars AD Leo and Wolf 630, obtained with ROSAT provide important clues to the structure of the coronae on these low-mass, main-sequence stars. In particular, time-resolved X-ray spectroscopy of these stars allow us to derive estimates for the low- and high-temperature components of the plasma emission measures. Using Bayes' theorem, we show that the high-temperature components are correlated with the X-ray light-curves of the stars, while the low-temperature components are steady. Thus we are able to model the low-temperature emission as relatively compact, quiescent, static coronal loops, and the high-temperature emission as unstable flaring components.

  10. Collisional deactivation of N2O(0001) studied by time-resolved infrared fluorescence

    NASA Astrophysics Data System (ADS)

    Poel, Kathleen L.; Alwahabi, Zeyad T.; King, Keith D.

    1996-07-01

    The time-resolved infrared fluorescence (IRF) technique has been used to study the vibrational deactivation of excited N2O by large polyatomic colliders at ambient temperature (295±2 K). N2O(0001) molecules were prepared by direct pumping with the P(18) line of a pulsed CO2 laser at 9.536 ?m. The bimolecular rate constant for self-deactivation was determined to be (0.763±0.006)×103 Torr-1 s-1, in very good agreement with previous work. The rate constants for deactivation by Ar and H2 were found to be (0.103±0.003) and (4.89±0.52)×103 Torr-1 s-1, respectively. The deactivation rate constants for the large polyatomic molecules, c-C6H10, c-C6H12, C6H6, C6D6, C7H8, C7D8, C6H5F, p-C6H4F2, C6HF5 and C6F6, were found to be (176±10), (153±22), (115±4), (201±2), (127±11), (407±52), (144±14), (173±13), (129±8), and (48±9)×103 Torr-1 s-1, respectively. Experimental deactivation probabilities and average energies removed per collision are calculated and compared. There is little difference in deactivation probabilities between the acyclic ring compounds and their aromatic analogues and the partially-fluorinated benzenes but the perfluorinated compound, C6F6 is much less efficient than the other species. The perdeuterated species, C6D6 and C7D8, especially the latter, show enhanced deactivation relative to the other species, probably as a result of near-resonant intermolecular V-V energy transfer. The results are compared with our recent work on the deactivation of CO2(0001) by the same group of large polyatomic colliders [K. L. Poel, Z. T. Alwahabi, and K. D. King, Chem. Phys. 201, 263 (1995)].

  11. Lanthanide labeling of a potent protease activated receptor-2 agonist for time-resolved fluorescence analysis

    PubMed Central

    Hoffman, Justin; Flynn, Andrea N.; Tillu, Dipti V.; Zhang, Zhenyu; Patek, Renata; Price, Theodore J.; Vagner, Josef; Boitano, Scott

    2012-01-01

    Protease activated receptor-2 (PAR2) is one of four G-protein coupled receptors (GPCRs) that can be activated by exogenous or endogenous proteases, which cleave the extracellular amino-terminus to expose a tethered ligand and subsequent G-protein signaling. Alternatively, PAR2 can be activated by peptide or peptidomimetic ligands derived from the sequence of the natural tethered ligand. Screening of novel ligands that directly bind to PAR2 to agonize or antagonize the receptor has been hindered by the lack of a sensitive, high-throughput, affinity binding assay. In this report we describe the synthesis and use of a modified PAR2 peptidomimetic agonist, 2-furoyl-LIGRLO-(diethylenetriaminepentaacetic acid)-NH2 (2-f-LIGRLO-dtpa), designed for lanthanide-based time resolved fluorescence screening. We first demonstrate that 2-f-LIGRLO-dtpa is a potent and specific PAR2 agonist across a full spectrum of in vitro assays. We then show that 2-f-LIGRLO-dtpa can be utilized in an affinity binding assay to evaluate the ligand-receptor interactions between known high potency peptidomimetic agonists (2-furoyl-LIGRLO-NH2, 2-f-LIGRLO; 2-aminothiazol-4-yl-LIGRL-NH2, 2-at-LIGRL and; 6-aminonicotinyl-LIGRL-NH2, 6-an-LIGRL) and PAR2. A separate N-terminal peptidomimetic modification (3-indoleacetyl-LIGRL-NH2, 3-ia-LIGRL) that does not activate PAR2 signaling was used as a negative control. All three peptidomimetic agonists demonstrated sigmoidal competitive binding curves, with the more potent agonists (2-f-LIGRLO and 2-at-LIGRL) displaying increased competition. In contrast, the control peptide (3-ia-LIGRL) displayed limited competition for PAR2 binding. In summary, we have developed a Europium-containing PAR2 agonist that can be used in a highly sensitive affinity binding assay to screen novel PAR2 ligands in a high-throughput format. This ligand can serve as a critical tool in the screening and development of PAR2 ligands. PMID:22994402

  12. One- and two-photon time-resolved fluorescence of visible and near-infrared dyes in scattering media

    NASA Astrophysics Data System (ADS)

    Esposito, R.; Altucci, C.; Velotta, R.; Gaeta, G. M.; Lepore, M.

    2009-02-01

    Visible and near-infrared dyes are largely used in diagnostics and sensing. For this reason, it is very important to study their time-resolved fluorescence in presence or in absence of proper scattering medium in order to simulate the optical characteristics of biological tissues. Moreover, if one- or two-photon excitation processes are available also visible dyes will be employed taking advantages from using exciting sources in the diagnostic window (red and near IR) of the electromagnetic spectrum, where the photons are rarely absorbed and more often scattered. Visible and near IR fluorescent samples (Indocyanine Green and Rhodamine 6G) in absence and in presence of scattering agents (different Intralipid concentrations) and one- and two- photon time-resolved experiments have been performed. As expected, the presence of scattering agents modified time-resolved spectra and the related lifetime components. The experimental results have been used to preliminarly test different theoretical approaches describing the propagation of fluorescence signals in scattering media.

  13. Manganese-doped ZnSe quantum dots as a probe for time-resolved fluorescence detection of 5-fluorouracil.

    PubMed

    Zhu, Dong; Chen, Yun; Jiang, Liping; Geng, Jun; Zhang, Jianrong; Zhu, Jun-Jie

    2011-12-01

    Quantum dots (QDs) are generally used for the conventional fluorescence detection. However, it is difficult for the QDs to be applied in time-resolved fluorometry due to their short-lived emission. In this paper, high-quality Mn-doped ZnSe QDs with long-lived emission were prepared using a green and rapid microwave-assisted synthetic approach in aqueous solution. Fluorescence lifetime of the Mn-doped ZnSe QDs was extended as long as 400 ?s, which was 10,000 times higher than that of conventional QDs such as CdS, CdSe, and CdTe. The QDs exhibited an excellent photostability over 35 h under continuous irradiation at 260 nm. Capped with mercaptopropionic acid (MPA), the Mn-doped ZnSe QDs were used for the time-resolved fluorescence detection of 5-fluorouracil (5-FU) with the detection limit of 128 nM. The relative standard deviation for seven independent measurements of 1.5 ?M 5-FU was 3.8%, and the recovery ranged from 93% to 106%. The results revealed that the Mn-doped ZnSe QDs could be a good candidate as a luminescence probe for highly sensitive time-resolved fluorometry. PMID:22026809

  14. A field programmable gate array-based time-resolved scaler for collinear laser spectroscopy with bunched radioactive potassium beams.

    PubMed

    Rossi, D M; Minamisono, K; Barquest, B R; Bollen, G; Cooper, K; Davis, M; Hammerton, K; Hughes, M; Mantica, P F; Morrissey, D J; Ringle, R; Rodriguez, J A; Ryder, C A; Schwarz, S; Strum, R; Sumithrarachchi, C; Tarazona, D; Zhao, S

    2014-09-01

    A new data acquisition system including a Field Programmable Gate Array (FPGA) based time-resolved scaler was developed for laser-induced fluorescence and beam bunch coincidence measurements. The FPGA scaler was tested in a collinear laser-spectroscopy experiment on radioactive (37)K at the BEam COoler and LAser spectroscopy (BECOLA) facility at the National Superconducting Cyclotron Laboratory at Michigan State University. A 1.29 ?s bunch width from the buncher and a bunch repetition rate of 2.5 Hz led to a background suppression factor of 3.1 × 10(5) in resonant photon detection measurements. The hyperfine structure of (37)K and its isotope shift relative to the stable (39)K were determined using 5 × 10(4) s(-1) (37)K ions injected into the BECOLA beam line. The obtained hyperfine coupling constants A((2)S(1/2)) = 120.3(1.4) MHz, A((2)P(1/2)) = 15.2(1.1) MHz, and A((2)P(3/2)) = 1.4(8) MHz, and the isotope shift ??(39, 37) = -264(3) MHz are consistent with the previously determined values, where available. PMID:25273722

  15. Probing Kinetic Mechanisms of Protein Function and Folding with Time-Resolved Natural and Magnetic Chiroptical Spectroscopies

    PubMed Central

    Kliger, David S.; Chen, Eefei; Goldbeck, Robert A.

    2012-01-01

    Recent and ongoing developments in time-resolved spectroscopy have made it possible to monitor circular dichroism, magnetic circular dichroism, optical rotatory dispersion, and magnetic optical rotatory dispersion with nanosecond time resolution. These techniques have been applied to determine structural changes associated with the function of several proteins as well as to determine the nature of early events in protein folding. These studies have required new approaches in triggering protein reactions as well as the development of time-resolved techniques for polarization spectroscopies with sufficient time resolution and sensitivity to probe protein structural changes. PMID:22312279

  16. Time-resolved reflectance spectroscopy for nondestructive assessment of fruit and vegetable quality

    NASA Astrophysics Data System (ADS)

    Torricelli, Alessandro; Spinelli, Lorenzo; Vanoli, Maristella; Rizzolo, Anna; Eccher Zerbini, Paola

    2007-09-01

    In the majority of food and feed, due to the microscopic spatial changes in the refractive index, visible (VIS) and near infrared (NIR) light undergoes multiple scattering events and the overall light distribution is determined more by scattering rather than absorption. Conventional steady state VIS/NIR reflectance spectroscopy can provide information on light attenuation, which depends both on light absorption and light scattering, but cannot discriminate these two effects. On the contrary, time-resolved reflectance spectroscopy (TRS) provides a complete optical characterisation of diffusive media in terms of their absorption coefficient and reduced scattering coefficient. From the assessment of the absorption and reduced scattering coefficients, information can then be derived on the composition and internal structure of the medium. Main advantages of the technique are the absolute non-invasiveness, the potentiality for non-contact measurements, and the capacity to probe internal properties with no influence from the skin. In this work we review the physical and technical issues related to the use of TRS for nondestructive quality assessment of fruit and vegetable. A laboratory system for broadband TRS, based on tunable mode-locked lasers and fast microchannel plate photomultiplier, and a portable setup for TRS measurements, based on pulsed diode lasers and compact metal-channel photomultiplier, will be described. Results on broadband optical characterisation of fruits and applications of TRS to the detection of internal defects in pears and to maturity assessment in nectarines will be presented.

  17. Time-Resolved FTIR and Mass Spectroscopy of Laser-Ablated Magnesium.

    NASA Astrophysics Data System (ADS)

    Miyamoto, Y.; Ikeda, N.; Tang, J.; Kawaguchi, K.; Masaki, C.

    2012-06-01

    Laser-ablated Magnesium (Mg) was subjected to time-resolved Fourier transform emission spectroscopy combined with quadrupole mass spectroscopy. Emission of Mg atoms was observed in 2000 ˜4000 cm-1 region with resolution of 0.03 cm-1. It was found that emission lines consist of two components with different Doppler width. One with wider linewidth appeared just after ablation, while the other appeared after about 10 ?s. Doppler width of the narrow one corresponds to estimated velocity of atoms sputtered directly from bulk Mg. Mass spectra suggested major products of the ablation under our experimental conditions are Mg^+ and Mg2+. MgO+ was also observed in the mass spectra under thin oxygen condition (˜10-4 Torr). Considering the linewidth and energy levels of these species, the wide component is attributed to Mg atoms produced by dissociative recombination of MgO+ and electrons. Information about the electronic energy level of MgO+ was also obtained, which is compared with {ab initio} calculations.

  18. Time-resolved tuned diode laser absorption spectroscopy of pulsed plasma

    NASA Astrophysics Data System (ADS)

    Adámek, P.; Do, H. T.; ?ada, M.; Hubi?ka, Z.; Hippler, R.

    2014-05-01

    A novel method for time-resolved tuned diode laser absorption spectroscopy has been developed. In this paper, we describe in detail developed electronic module that controls time-resolution of laser absorption spectroscopy system. The TTL signal triggering plasma pulse is used for generation of two signals: the first one triggers the fine tuning of laser wavelength and second one controls time-defined signal sampling from absorption detector. The described method and electronic system enable us to investigate temporal evolution of sputtered particles in technological low-temperature plasma systems. The pulsed DC planar magnetron sputtering system has been used to verify this method. The 2" in diameter titanium target was sputtered in pure argon atmosphere. The working pressure was held at 2 Pa. All the experiments were carried out for pulse ON time fixed at 100 (is. When changing OFF time the discharge has operated between High Power Impulse Magnetron Sputtering regime and pulsed DC magnetron regime. The effect of duty cycle variation results in decrease of titanium atom density during ON time while length of OFF time elongates. We believe that observed effect is connected with higher degree of ionization of sputtered particles. As previously reported by Bohlmark et al., the measured optical emission spectra in HiPIMS systems were dominated by emission from titanium ions [1].

  19. Fast time-resolved Fourier-transform spectroscopy for the study of transient chemical reactions

    NASA Astrophysics Data System (ADS)

    Carere, C. A.; Neil, W. S.; Sloan, J. J.

    1996-06-01

    We describe the most recent implementation of the data acquisition system which we have developed for fast time-resolved (FTR) Fourier transform spectroscopy (FTS) and report spectra that were obtained by using this instrument. This FTRFTS data system operates in conjunction with any continuous-scan Michelson interferometer, giving it the capability to record many time-delayed spectra of a transient event, with a minimum time resolution of 1 mu s. The sensitivity and the spectral resolution of the complete system are the same as those that would be obtained if the interferometer were used in conventional steady-state spectroscopy. To illustrate the performance of the FTRFTS system, we recorded emission spectra from the products of transient chemical reactions of H atoms with CF3Cl, CF2Cl2, CFCl3 , and NO2. These are laser-initiated reactions involving atoms with energies that correspond to a temperature of approximately 27,000 K and lifetimes of a few microseconds, but the FTRFTS system records the time evolution of their products with high signal-to-noise ratio.

  20. Simulation modelling for the analysis and the optimal design of SPAD detectors for time-resolved fluorescence measurements

    NASA Astrophysics Data System (ADS)

    Repich, Marina; Stoppa, David; Pancheri, Lucio; Dalla Betta, Gian-Franco

    2009-05-01

    This paper describes a simulation model (implemented in MATLAB) of a typical setup used for time-resolved fluorescence measurements, including: a laser source, basic fluorescence sample, optics, single-photon avalanche diode and read-out electronics. The correctness of the model has been verified by setting up a simple time-resolved fluorescence measurement using a CMOS SPAD-based detector. The solution of fluorophore (CdSe/ZnS quantum dots in toluene) in a glass capillary was placed above the detecting surface and excited by laser pulses. We have used a time-gating technique with 10-ns observation window shifted at 60-ps time steps across the appropriate time interval. The observed curve corresponds to the convolution of the fluorescence emission and the 10-ns observation window. Simulation accuracy has been verified by comparing the experimental fluorescence decay with the simulated one using chi-square test. The proposed model allows researchers to simulate the behaviour of SPAD detectors with a good accuracy and demonstrates how imperfections in the experimental system can affect the result. The model enables the design of SPAD-based detectors with the best performance for a specific application area.

  1. In vivo time-resolved spectroscopy of the human bronchial early cancer autofluorescence

    NASA Astrophysics Data System (ADS)

    Uehlinger, Pascal; Gabrecht, Tanja; Glanzmann, Thomas; Ballini, Jean-Pierre; Radu, Alexandre; Andrejevic, Snezana; Monnier, Philippe; Wagnières, Georges

    2009-03-01

    Time-resolved measurements of tissue autofluorescence (AF) excited at 405 nm were carried out with an optical-fiber-based spectrometer in the bronchi of 11 patients. The objectives consisted of assessing the lifetime as a new tumor/normal (T/N) tissue contrast parameter and trying to explain the origin of the contrasts observed when using AF-based cancer detection imaging systems. No significant change in the AF lifetimes was found. AF bronchoscopy performed in parallel with an imaging device revealed both intensity and spectral contrasts. Our results suggest that the spectral contrast might be due to an enhanced blood concentration just below the epithelial layers of the lesion. The intensity contrast probably results from the thickening of the epithelium in the lesions. The absence of T/N lifetime contrast indicates that the quenching is not at the origin of the fluorescence intensity and spectral contrasts. These lifetimes (6.9 ns, 2.0 ns, and 0.2 ns) were consistent for all the examined sites. The fact that these lifetimes are the same for different emission domains ranging between 430 and 680 nm indicates that there is probably only one dominant fluorophore involved. The measured lifetimes suggest that this fluorophore is elastin.

  2. Evaluating steady-state and time-resolved fluorescence as a tool to study the behavior of asphaltene in toluene.

    PubMed

    Zhang, Hui Ting; Li, Rui; Yang, Zixin; Yin, Cindy-Xing; Gray, Murray R; Bohne, Cornelia

    2014-06-01

    A combination of steady-state fluorescence, fluorescence lifetime measurements and the determination of time-resolved emission spectra were employed to characterize asphaltene toluene solutions. Lifetime measurements were shown to be insensitive to the source of asphaltene or the alkane solvent from which asphaltene was precipitated. This insensitivity suggests that either the composition of Athabasca and Cold Lake asphaltene is very similar or that the fluorescence behavior is dominated by the same sub-set of fluorophores for the different samples. These results highlight the limitations in using fluorescence to characterize asphaltene solutions. Different dependencies were observed for the average lifetimes with the asphaltene concentration when measured at two different emission wavelengths (420 nm and 520 nm). This result suggests that different fluorophores underwent diverse interactions with other asphaltene molecules as the asphaltene concentration was raised, suggesting that models for asphaltene aggregation need to include molecular diversity. PMID:24722727

  3. Time-resolved HST and IUE UV spectroscopy of the Intermediate Polar FO Aqr

    E-print Network

    D. de Martino; R. Silvotti; D. A. H Buckley; B. T. Gänsicke; M. Mouchet; K. Mukai; S. R. Rosen

    1999-09-03

    Time resolved spectroscopy of the Intermediate Polar FO Aqr reveals the presence of multiple periodicities in the UV range. A strong orbital modulation dominates both continuum and emission line flux variabilities, while line velocity motions are only detected at the rotational frequency. A prominent orbital periodicity is also observed in coordinated optical photometry, where FO Aqr was previously found to be spin dominated. The spectral dependence of the main periodicities shows the presence of multi-temperature components in FO Aqr and for the first time a hot and a cool component in the rotational modulation. From a comparison with previous UV and optical data obtained in 1990, no spectral variations in the orbital and rotational variabilities are detected, indicating no significant changes in the effects of X-ray illumination but rather a shrinking of the accretion curtain accompained by an increase in size of the thickened part of the accretion disc. These observations, consistent with the recently discovered long term trend in the X-ray pulsation amplitudes, independently confirm a change in the accretion mode in FO Aqr, which switched from a disc-fed into a disc-overflow state, likely triggered by mass accretion variations.

  4. Nanosecond Time-Resolved Polarization Spectroscopies: Tools for Probing Protein Reaction Mechanisms

    PubMed Central

    Chen, Eefei; Goldbeck, Robert A.; Kliger, David S.

    2010-01-01

    Polarization methods, introduced in the 1800’s, offered one of the earliest ways to examine protein structure. Since then, many other structure-sensitive probes have been developed, but circular dichroism (CD) remains a powerful technique because of its versatility and the specificity of protein structural information that can be explored. With improvements in time-resolution, from millisecond to picosecond CD measurements, it has proven to be an important tool for studying the mechanism of folding and function in many biomolecules. For example, nanosecond time-resolved CD (TRCD) studies of the sub-microsecond events of reduced cytochrome c folding have provided direct experimental evidence of kinetic heterogeneity, which is an inherent property of the diffusional nature of early folding dynamics on the energy landscape. In addition, TRCD has been applied to the study of many biochemical processes, such as ligand rebinding in hemoglobin and myoglobin and signaling state formation in photoactive yellow protein and prototropin 1 LOV2. The basic approach to TRCD has also been extended to include a repertoire of nanosecond polarization spectroscopies: optical rotatory dispersion (ORD), magnetic CD and ORD, and linear dichroism. This article will discuss the details of the polarization methods used in this laboratory, as well as the coupling of timeresolved ORD with the temperature-jump trigger so that protein folding can be studied in a larger number of proteins. PMID:20438842

  5. Nanosecond time-resolved infrared spectroscopy distinguishes two K species in the bacteriorhodopsin photocycle.

    PubMed Central

    Sasaki, J; Yuzawa, T; Kandori, H; Maeda, A; Hamaguchi, H

    1995-01-01

    The photochemical reaction process of bacteriorhodopsin in the nanosecond time range (-120-860 ns) was measured in the 1400-900 cm-1 region with an improved time resolved dispersive-type infrared spectrometer. The system is equipped with a newly developed detection unit whose instrumental response to a 5-ns laser pulse has a full width of the half-maximum of 60 ns. It provides highly accurate data that enabled us to extract a kinetic process one order of magnitude faster than the instrumental response. The spectral changes in the 1400-900 cm-1 region were analyzed by singular value decomposition and resolved into three components. These components were separated by fitting with 10- and 1000-ns exponential functions and a step function, which were convoluted with the instrumental response function. The components with decay time constants of 10 and 1000 ns are named K and KL, respectively, on the basis of previous visible spectroscopy. The spectral shapes of K and KL are distinguishable by their hydrogen-out-of-plane (HOOP) modes, at 958 and 984 cm-1, respectively. The former corresponds to the K intermediate recorded at 77 K and the latter to a K-like photoproduct at 135 K. On the basis of published data, these bands are assigned to the 15-HOOP mode, indicating that the K and KL differ in a twist around the C14-C15 bond. PMID:7612850

  6. Optical analysis of cirrhotic liver by near infrared time resolved spectroscopy

    NASA Astrophysics Data System (ADS)

    Nishio, Toshihiro; Kitai, Toshiyuki; Miwa, Mitsuharu; Takahashi, Rei; Yamaoka, Yoshio

    1999-10-01

    The severity of liver cirrhosis was related with the optical properties of liver tissue. Various grades of liver cirrhosis were produced in rats by intraperitoneal injection of thioacetamide (TAA) for different periods: 4 weeks, 8 weeks, 12 weeks, and 16 weeks. Optical properties of the liver, absorption, coefficient ((mu) a) and scattering coefficient (microsecond(s) '), were measured by near-infrared time- resolved spectroscopy. Histological examination confirmed cirrhotic changes in the liver, which were more severe in rats with TAA administration for longer periods. The (mu) a increased in 4- and 8-week rats, and then decreased in 12- and 16-week rats. The (mu) a of blood-free liver decreased as liver cirrhosis progressed. The hemoglobin content in the liver calculated from the (mu) a values increased in 4- and 8-week rats and decreased in 12- and 16-week rats. The microsecond(s) ' decreased in the cirrhotic liver, probably reflecting the decrease in the mitochondria content. It was shown that (mu) a and microsecond(s) ' determination is useful to assess the severity of liver cirrhosis.

  7. a Study of the Hydroxycyclohexadienyl Radical Absorption Using Time-Resolved Resonance Raman Spectroscopy

    NASA Astrophysics Data System (ADS)

    O'Donnell, Deanna M.; Tripathi, G. N. R.; Brinkmann, Nicole R.

    2009-06-01

    Thus far there has been little understanding of the vibrational spectra, structure and electronic absorption of hydroxycyclohexadienyl radicals in water. They are primary chemical species formed on interaction of radiation with aqueous solutions containing aromatic molecules. We have applied time- resolved resonance Raman (TR-RR) spectroscopy to structurally identify isomers of cyclohexadienyl radicals formed in the pulse radiolysis, using aqueous benzoate solutions as a model system. An early ESR study ((Eiben, K; Fessenden, R.W.; J. Phys. Chem. 1971, 75, 1186-1201) has shown that a mixture of three benzoate hydroxycyclohexadienyl radical isomers: ortho-, meta- and para- are formed upon electron irradiation of N_{2}O saturated benzoate solution. Their collective transient absorption is believed to exhibit a single broad band in the near UV region (?_{max} = 330 nm, ?_{330} = 3800 M^{-1}cm^{-1}). To extract the single isomeric contribution to this collective absorption, we applied TR-RR at various wavelengths within the broad transient absorption range looking for the characteristic indication of each individual isomer. Raman signals of various para-substituted benzoates were also collected to aid in the vibrational studies of the aforementioned benzoate hydroxycyclohexadienyl radicals.

  8. Time-resolved wavelength modulation spectroscopy measurements of HO{sub 2} kinetics

    SciTech Connect

    Taatjes, Craig A. [Combustion Research Facility, Mail Stop 9055, Sandia National Laboratories, Livermore, California 94551-0969 (United States)] Oh, Daniel B. [Southwest Sciences, Incorporated, 1570 Pacheco Street, Suite E-11, Santa Fe, New Mexico 87505 (United States)

    1997-08-01

    High-frequency wavelength modulation spectroscopy (WMS) has been applied to the detection of the hydroperoxyl radical (HO{sub 2}) in a laser photolysis and long-path absorption pump-probe kinetics reactor with a near-infrared distributed feedback diode laser. The HO{sub 2} is formed by the 355-nm photolysis of Cl{sub 2} in the presence of CH{sub 3}OH and O{sub 2} and monitored by a phase-sensitive detection of the second-harmonic (2f) signal in the 2{nu}{sub 1} band with a 1.5-{mu}m diode laser directly modulated at 5 MHz. The measured 2f WMS signal is calibrated by direct absorption and converted to an absolute number density with the known absorption line strength of the HO{sub 2} line at 6625.80 cm{sup {minus}1}. The utility of time-resolved WMS as a second-order kinetics probe is demonstrated through the measurement of the HO{sub 2} self-reaction rate constant at 295 K. {copyright} 1997 Optical Society of America

  9. Velocity distribution function of sputtered Cu atoms obtained by time resolved optical absorption spectroscopy

    SciTech Connect

    Kang, Namjun; Gaboriau, Freddy; Ricard, Andre [Universite de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d'Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); CNRS, LAPLACE, Toulouse F-31062 (France); Oh, Soo-ghee [Division of Energy Systems Research, Ajou University, Suwon 443-749 (Korea, Republic of)

    2010-01-15

    A new method based on time resolved optical absorption spectroscopy is proposed to determine the velocity distribution function of sputtered Cu atoms in a magnetron plasma discharge. The method consists of applying a short pulse of 1.5 {mu}s and of recording time variations in copper atom density in off pulse at different positions (1, 2, and 3 cm) from target surface under 3-30 mTorr. The time evolution of the density is then converted into velocity distribution. We estimate that only sputtered atoms with radial velocity component lower than 0.5 km/s are detected. The average velocity of Cu atoms is evaluated as the first order moment of the velocity distribution functions. The velocity distribution functions become the more dispersive the farther from target surface. The average velocities vary in the range of 2.5-3 km/s at the vicinity of target surface whereas at 3 cm a decrease from 2.5 to 1.2 km/s is observed at 30 mTorr.

  10. High-resolution Time-resolved Extreme Ultraviolet Spectroscopy on NSTX

    NASA Astrophysics Data System (ADS)

    Lepson, J. K.; Beiersdorfer, P.; Clementson, J.; Bitter, M.; Hill, K.; Kaita, R.; Roquemore, L.; Skinner, C. H.; Zimmer, G.

    2011-10-01

    We report on high-resolution, time-resolved spectroscopy in the extreme ultraviolet spectral region (10-200 Å) on the NSTX tokamak. This work utilizes two flat-field spectrometers on loan from LLNL's electron beam ion trap facility. XEUS, installed in 2004, has a 2400 line/mm flat-field grating with field of view of ~50 Å that can be positioned to survey 5-135 Å with an instrumental resolution of ~0.1 Å and ? / ?? ~ 100 at 10 Å to ~1000 at 100 Å. LoWEUS, installed in 2008, utilizes a 1200 line/mm grating with field of view of ~180 Å, is typically positioned to survey 60-280 Å with an instrumental resolution of ~0.3 Å and ? / ?? ~ 300 at 100 Å to ~600 at 200 Å. New cameras have achieved a time resolution of 12-13 ms for both instruments. We can now examine time dependence and evolution of both intrinsic and extrinsic impurities on NSTX in the EUV band. Of particular interest is monitoring the entry of molybdenum into the plasma after installation of Mo tiles for the 2011 run. Work supported by DOE General Plasma Science program. Part of this work performed under the auspices of DOE by LLNL under contract DE-AC52-07NA27344 and PPPL under contract DE-AC02-09CH11466.

  11. A compact time-resolved system for near infrared spectroscopy based on wavelength space multiplexing

    NASA Astrophysics Data System (ADS)

    Re, Rebecca; Contini, Davide; Caffini, Matteo; Cubeddu, Rinaldo; Spinelli, Lorenzo; Torricelli, Alessandro

    2010-11-01

    We designed and developed a compact dual-wavelength and dual-channel time-resolved system for near-infrared spectroscopy studies of muscle and brain. The system employs pulsed diode lasers as sources, compact photomultipliers, and time-correlated single photon counting boards for detection. To exploit the full temporal and dynamic range of the acquisition technique, we implemented an approach based on wavelength space multiplexing: laser pulses at the two wavelengths are alternatively injected into the two channels by means of an optical 2×2 switch. In each detection line (i.e., in each temporal window), the distribution of photon time-of-flights at one wavelength is acquired. The proposed approach increases the signal-to-noise ratio and avoids wavelength cross-talk with respect to the typical approach based on time multiplexing. The instrument was characterized on tissue phantoms to assess its properties in terms of linearity, stability, noise, and reproducibility. Finally, it was successfully tested in preliminary in vivo measurements on muscle during standard cuff occlusion and on the brain during a motor cortex response due to hand movements.

  12. Conductivity of ZnO nanowires, nanoparticles, and thin films using time-resolved terahertz spectroscopy.

    PubMed

    Baxter, Jason B; Schmuttenmaer, Charles A

    2006-12-21

    The terahertz absorption coefficient, index of refraction, and conductivity of nanostructured ZnO have been determined using time-resolved terahertz spectroscopy, a noncontact optical probe. ZnO properties were measured directly for thin films and were extracted from measurements of nanowire arrays and mesoporous nanoparticle films by applying Bruggeman effective medium theory to the composite samples. Annealing significantly reduces the intrinsic carrier concentration in the ZnO films and nanowires, which were grown by chemical bath deposition. The complex-valued, frequency-dependent photoconductivities for all morphologies were found to be similar at short pump-probe delay times. Fits using the Drude-Smith model show that films have the highest mobility, followed by nanowires and then nanoparticles, and that annealing the ZnO increases its mobility. Time constants for decay of photoinjected electron density in films are twice as long as those in nanowires and more than 5 times those for nanoparticles due to increased electron interaction with interfaces and grain boundaries in the smaller-grained materials. Implications for electron transport in dye-sensitized solar cells are discussed. PMID:17165967

  13. Monitoring brain temperature by time-resolved near-infrared spectroscopy: pilot study

    NASA Astrophysics Data System (ADS)

    Bakhsheshi, Mohammad Fazel; Diop, Mamadou; St. Lawrence, Keith; Lee, Ting-Yim

    2014-05-01

    Mild hypothermia (HT) is an effective neuroprotective strategy for a variety of acute brain injuries. However, the wide clinical adaptation of HT has been hampered by the lack of a reliable noninvasive method for measuring brain temperature, since core measurements have been shown to not always reflect brain temperature. The goal of this work was to develop a noninvasive optical technique for measuring brain temperature that exploits both the temperature dependency of water absorption and the high concentration of water in brain (80%-90%). Specifically, we demonstrate the potential of time-resolved near-infrared spectroscopy (TR-NIRS) to measure temperature in tissue-mimicking phantoms (in vitro) and deep brain tissue (in vivo) during heating and cooling, respectively. For deep brain tissue temperature monitoring, experiments were conducted on newborn piglets wherein hypothermia was induced by gradual whole body cooling. Brain temperature was concomitantly measured by TR-NIRS and a thermocouple probe implanted in the brain. Our proposed TR-NIRS method was able to measure the temperature of tissue-mimicking phantoms and brain tissues with a correlation of 0.82 and 0.66 to temperature measured with a thermometer, respectively. The mean difference between the TR-NIRS and thermometer measurements was 0.15°C±1.1°C for the in vitro experiments and 0.5°C±1.6°C for the in vivo measurements.

  14. Probing Reaction Dynamics of Transition-Metal Complexes in Solution via Time-Resolved Soft X-ray Spectroscopy

    SciTech Connect

    Huse, Nils; Kim, Tae Kyu; Khalil, Munira; Jamula, Lindsey; McCusker, James K.; Schoenlein, Robert W.

    2010-05-02

    We report the first time-resolved soft x-ray measurements of solvated transition-metal complexes. L-edge spectroscopy directly probes dynamic changes in ligand-field splitting of 3d orbitals associated with the spin transition, and mediated by changes in ligand-bonding.

  15. Time resolved photoelectron spectroscopy of germanium and silicon during the solid to the liquid state phase transition

    Microsoft Academic Search

    G. Gantner; H.-G. Boyen; P. Oelhafen

    1996-01-01

    Photoelectron spectroscopy of liquid silicon and germanium has been performed by using a new technique based on laser-pulse induced melting of sample surfaces and time resolved detection of the photoelectrons. With this method it has, for the first time, been possible to observe the solid to liquid phase transition of silicon, an element with a vapor pressure in the liquid

  16. Global and time-resolved monitoring of crop photosynthesis with chlorophyll fluorescence

    PubMed Central

    Guanter, Luis; Zhang, Yongguang; Jung, Martin; Joiner, Joanna; Voigt, Maximilian; Berry, Joseph A.; Frankenberg, Christian; Huete, Alfredo R.; Zarco-Tejada, Pablo; Lee, Jung-Eun; Moran, M. Susan; Ponce-Campos, Guillermo; Beer, Christian; Camps-Valls, Gustavo; Buchmann, Nina; Gianelle, Damiano; Klumpp, Katja; Cescatti, Alessandro; Baker, John M.; Griffis, Timothy J.

    2014-01-01

    Photosynthesis is the process by which plants harvest sunlight to produce sugars from carbon dioxide and water. It is the primary source of energy for all life on Earth; hence it is important to understand how this process responds to climate change and human impact. However, model-based estimates of gross primary production (GPP, output from photosynthesis) are highly uncertain, in particular over heavily managed agricultural areas. Recent advances in spectroscopy enable the space-based monitoring of sun-induced chlorophyll fluorescence (SIF) from terrestrial plants. Here we demonstrate that spaceborne SIF retrievals provide a direct measure of the GPP of cropland and grassland ecosystems. Such a strong link with crop photosynthesis is not evident for traditional remotely sensed vegetation indices, nor for more complex carbon cycle models. We use SIF observations to provide a global perspective on agricultural productivity. Our SIF-based crop GPP estimates are 50–75% higher than results from state-of-the-art carbon cycle models over, for example, the US Corn Belt and the Indo-Gangetic Plain, implying that current models severely underestimate the role of management. Our results indicate that SIF data can help us improve our global models for more accurate projections of agricultural productivity and climate impact on crop yields. Extension of our approach to other ecosystems, along with increased observational capabilities for SIF in the near future, holds the prospect of reducing uncertainties in the modeling of the current and future carbon cycle. PMID:24706867

  17. Global and time-resolved monitoring of crop photosynthesis with chlorophyll fluorescence.

    PubMed

    Guanter, Luis; Zhang, Yongguang; Jung, Martin; Joiner, Joanna; Voigt, Maximilian; Berry, Joseph A; Frankenberg, Christian; Huete, Alfredo R; Zarco-Tejada, Pablo; Lee, Jung-Eun; Moran, M Susan; Ponce-Campos, Guillermo; Beer, Christian; Camps-Valls, Gustavo; Buchmann, Nina; Gianelle, Damiano; Klumpp, Katja; Cescatti, Alessandro; Baker, John M; Griffis, Timothy J

    2014-04-01

    Photosynthesis is the process by which plants harvest sunlight to produce sugars from carbon dioxide and water. It is the primary source of energy for all life on Earth; hence it is important to understand how this process responds to climate change and human impact. However, model-based estimates of gross primary production (GPP, output from photosynthesis) are highly uncertain, in particular over heavily managed agricultural areas. Recent advances in spectroscopy enable the space-based monitoring of sun-induced chlorophyll fluorescence (SIF) from terrestrial plants. Here we demonstrate that spaceborne SIF retrievals provide a direct measure of the GPP of cropland and grassland ecosystems. Such a strong link with crop photosynthesis is not evident for traditional remotely sensed vegetation indices, nor for more complex carbon cycle models. We use SIF observations to provide a global perspective on agricultural productivity. Our SIF-based crop GPP estimates are 50-75% higher than results from state-of-the-art carbon cycle models over, for example, the US Corn Belt and the Indo-Gangetic Plain, implying that current models severely underestimate the role of management. Our results indicate that SIF data can help us improve our global models for more accurate projections of agricultural productivity and climate impact on crop yields. Extension of our approach to other ecosystems, along with increased observational capabilities for SIF in the near future, holds the prospect of reducing uncertainties in the modeling of the current and future carbon cycle. PMID:24706867

  18. Global and Time-Resolved Monitoring of Crop Photosynthesis with Chlorophyll Fluorescence

    NASA Technical Reports Server (NTRS)

    Guanter, Luis; Zhang, Yongguang; Jung, Martin; Joiner, Joanna; Voigt, Maximilian; Berry, Joseph A.; Frankenberg, Christian; Huete, Alfredo R.; Zarco-Tejada, Pablo; Lee, Jung-Eun; Moran, M. Susan; Ponce-Campos, Guillermo; Beer, Christian; Camps-Valls, Gustavo; Buchmann, Nina; Gianelle, Damiano; Klumpp, Katja; Cescatti, Alessandro; Baker, John M.; Griffis, Timothy J.

    2014-01-01

    Photosynthesis is the process by which plants harvest sunlight to produce sugars from carbon dioxide and water. It is the primary source of energy for all life on Earth; hence it is important to understand how this process responds to climate change and human impact. However, model-based estimates of gross primary production (GPP, output from photosynthesis) are highly uncertain, in particular over heavily managed agricultural areas. Recent advances in spectroscopy enable the space-based monitoring of sun-induced chlorophyll fluorescence (SIF) from terrestrial plants. Here we demonstrate that spaceborne SIF retrievals provide a direct measure of the GPP of cropland and grassland ecosystems. Such a strong link with crop photosynthesis is not evident for traditional remotely sensed vegetation indices, nor for more complex carbon cycle models. We use SIF observations to provide a global perspective on agricultural productivity. Our SIF-based crop GPP estimates are 50-75% higher than results from state-of-the-art carbon cycle models over, for example, the US Corn Belt and the Indo-Gangetic Plain, implying that current models severely underestimate the role of management. Our results indicate that SIF data can help us improve our global models for more accurate projections of agricultural productivity and climate impact on crop yields. Extension of our approach to other ecosystems, along with increased observational capabilities for SIF in the near future, holds the prospect of reducing uncertainties in the modeling of the current and future carbon cycle.

  19. Cellular uptake of modified oligonucleotides enhanced by porphyrins studied by time-resolved microspectrofluorimetry and fluorescence imaging techniques

    NASA Astrophysics Data System (ADS)

    Praus, P.; Ko?išová, E.; Mojzeš, P.; Št?pánek, J.; Turpin, P.-Y.; Sureau, F.

    2011-05-01

    Fluorescence microimaging and homodyne phase-resolved confocal microspectrofluorimetry were used to monitor the transport of antisense oligonucleotide into 3T3 living cells and its subsequent intracellular distribution. Phosphorothioate analog of 15-mer oligothymidylate labeled by ATTO 425 was complexed with 5,10,15,20-tetrakis (1-methyl-4-pyridyl) porphyrin (H 2TMPyP4) as an uptake-mediating agent. High frequency (up to 180 MHz) analog modulation of both exciting diode laser and the detector image intensifier gain was used to record time-resolved fluorescence spectra. Fluorescence lifetime data within a broad spectral range have revealed preservation of oligonucleotide/porphyrin complex integrity and binding properties of both components inside the cell.

  20. Self-association of the polyene antibiotic nystatin in dipalmitoylphosphatidylcholine vesicles: a time-resolved fluorescence study.

    PubMed Central

    Coutinho, A; Prieto, M

    1995-01-01

    The interaction between Nystatin and small unilamellar vesicles of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, both in gel (T = 21 degrees C) and in liquid-crystalline (T = 45 degrees C) phases, was studied by steady-state and time-resolved fluorescence measurements by taking advantage of the intrinsic tetraene fluorophore present in this antibiotic. It was shown that Nystatin aggregates in aqueous solution with a critical concentration of 3 microM. The enhancement in the fluorescence intensity of the antibiotic was applied to study the membrane binding of Nystatin, and it was shown that the antibiotic had an almost fivefold higher partition coefficient for the vesicles in a gel (P = (1.4 +/- 0.1) x 10(3)) than in a liquid-crystalline phase (P = (2.9 +/- 0.1) x 10(2)). Moreover, a time-resolved fluorescence study was used to examine Nystatin aggregation in the membrane. The emission decay kinetics of Nystatin was described by three and two exponentials in the lipid membrane at 21 degrees C and 45 degrees C, respectively. Nystatin mean fluorescence lifetime is concentration-dependent in gel phase lipids, increasing steeply from 11 to 33 ns at an antibiotic concentration of 5-6 microM, but the fluorescence decay parameters of Nystatin were unvarying with the antibiotic concentration in fluid lipids. These results provide evidence for the formation of strongly fluorescent antibiotic aggregates in gel-phase membrane, an interpretation that is at variance with a previous study. However, no antibiotic self-association was detected in a liquid-crystalline lipid bilayer within the antibiotic concentration range studied (0-14 microM). PMID:8599661

  1. Two-Dimensional Subpicosecond Time-Resolved Fluorescence Anisotropy: Optical Kerr-Gating with a Dynamic Polarization Excitation.

    NASA Astrophysics Data System (ADS)

    Fujiwara, Takashige; Romano, Natalie C.; Modarelli, David A.; Lim, Edward C.

    2013-06-01

    With an advent of ultrafast lasers, a number of applications are widely adopted to probe photophysical and photochemical properties of a molecule that occurs in an ultrafast (femtosecond to picosecond) time scale. Intramolecular charge transfer (ICT) or proton transfer in photoexcited electron donor-acceptor (EDA) molecules, for instance, has been a topic of very extensive time-resolved studies for several decades. Time-evolution of an anisotropic property can track dipole orientations or conformational changes in their photoexcited molecular systems, which is of extreme importance to examine its structure and excited-state dynamics rather than probing an isotropic "population change".With this respect, we recently developed a subpicosecond time-resolved 2-D fluorescence anisotropy (TRFA) in which method implements a dynamic alternation of laser polarizations to excite a sample using a photoelastic modulator (PEM). In the combination of an ultrafast optical shutter (Kerr-gating) and a spectrograph that is coupled with a CCD, two signal phases so-obtained dynamically, I_{?}( t, ?) and I_{?}( t, ?), provide a 2-D mapped information on both a wide range for spectra and time-resolved kinetics of photoexcited molecules of interest. From the definition of an anisotropy 2-D TRFA, r (t, ?), is given instantly and even more reliably at a single measurement. In this paper we will present benchmark tests of some target samples to establish performance of TRFA.

  2. Time-resolved stand-off UV-Raman spectroscopy for planetary exploration

    NASA Astrophysics Data System (ADS)

    Skulinova, M.; Lefebvre, C.; Sobron, P.; Eshelman, E.; Daly, M.; Gravel, J.-F.; Cormier, J.-F.; Châteauneuf, F.; Slater, G.; Zheng, W.; Koujelev, A.; Léveillé, R.

    2014-03-01

    The exploration of Mars, Europa and Enceladus has provided evidence that support the existence of present or past potentially habitable environments, which may shelter signatures of extinct or extant life. A search for further evidence for habitability or for life requires the development of sophisticated instruments and techniques that enable detailed investigations of locations, which are of great interest to planetary scientists and astrobiologists. Raman spectroscopy is a powerful and versatile technique; a rover based Raman Laser Spectrometer (RLS) operating at 532 nm excitation wavelength has been selected for the 2018 ExoMars mission. In this study, we demonstrate the feasibility of the utilisation of a time-resolved stand-off UV-Raman prototype for the detection and identification of pure organics, organics mixed in a quartz matrix and minerals that have been selected based on their potential relevance to astrobiology and planetary exploration. The samples of organics (?-carotene, L-ascorbic acid, thiamine hydrochloride, L-alanine, L-serine, thymine), carbonates (calcite, dolomite), sulfates (gypsum), silicates (quartz), and natural rock (an altered meta-volcanic rock featuring quartz inclusions) were analyzed at a distance of 6 m using a 355 nm excitation source and a gated intensified charged-coupled device (ICCD) as the detector. We were able to obtain spectra with clear Raman signals enabling unequivocal identification of all selected samples. We assert for the first time, that such an instrument can effectively identify minerals and a wide range of organics that may serve as geo- and biomarkers thus showing great potential for the exploration of planets and astrobiology.

  3. High Resolution Time-resolved UCLES Spectroscopy of AE Aqr: I. The Secondary Star Revealed

    NASA Astrophysics Data System (ADS)

    Echevarria, J.; Diego, F.; Mills, D.; Connon Smith, R.

    2006-06-01

    High-dispersion time-resolved spectroscopy of the cataclysmic variable AE Aqr has been obtained. The emission lines have a complex structure that make difficult to measure the motion of the white dwarf. The cross correlation for the absorption lines shows a clear asymmetric profile as expected from a heated side of the red star. The spectral type for the secondary star varies from K2 to K5; there are clear indications that the temperature varies as a function of star longitude. The radial velocity analysis yield Kab = 165.2 ± 0.6 Km s-1 for the cross-correlated secondary star. The rotational velocity of the red star has been measured as a function of orbital period. It shows ellipsoidal variations with a period half the orbital period. The rotational velocities vary within the range Vrot sin i = 105 ± 3 Km s-1 and Vrot sin i = 130 ± 3 Km s-1. The former can be used to constrain the white dwarf semi-amplitude value to yield Kem = 139 ± 4 Km s-1 consistent with derived values from published radial velocity measurements. From a variation in the absorption line strength of 30%, we constrain the inclination angle to i = 58° ± 3. The estimated masses of the binary are: Mw = 1.07 ± 0.07 M? and Mr = 0.90 ± 0.05 M?. If this is correct we should expect a spectral type of G5 if the secondary star is a main sequence star. We suggest that the discrepancy is explained if the star has a radius 40% greater than a main sequence star for a mass of 0.90 M?.

  4. Continuous-scan time-resolved FTIR spectroscopy measurements of high energy molecular collisions

    NASA Astrophysics Data System (ADS)

    Sloan, J. J.; Neil, W. S.; Roscoe, J.; Kong, F.-A.

    1998-06-01

    We have studied the dynamics of gas phase collisions between high energy radicals and several small molecules under low pressure conditions, which enable us to resolve single collision events. The experiments are carried out in a fast-flow, low pressure chemiluminescence emission apparatus. Using nanosecond laser photofragmentation, we create pulses of high energy radicals in a flowing stream of a reagent molecule, then record a series of broad-band IR spectra of the emission from the products of the resulting reaction, using time-resolved FTIR spectroscopy (TRFTS). Our TRFTS instrument uses a continuous scan Michelson interferometer to which we have added a data acquisition system of our own design. The latter is based on VME architecture, and permits time resolutions between 1 ?s and 3 ms at the full spectral bandwidth and maximum spectral resolution of the interferometer. Slower time resolutions, down to a few tens of milliseconds, can be obtained at reduced spectral bandwidths. The work to be reported uses a time resolution of a few tens of nanoseconds for the first spectrum, then from 1-3 ?s for the second and subsequent spectra; typically, we record in excess of 20 spectra. The principal observable is the infrared emission from the vibrationally and rotationally excited products of the reaction. This is a very low-background experiment; the sensitivity is on the order of 10-15 moles/litre/quantum state. Where more than one reaction is possible, the relative intensities of the various spectra give the branching ratios for the different channels, while the time dependence of the emission gives the reaction kinetics.

  5. Determination of radiative lifetimes of excited states in neutral gold using time-resolved vacuum-ultraviolet laser spectroscopy

    Microsoft Academic Search

    M. B. Gaarde; R. Zerne; Luo Caiyan; Jiang Zhankui; J. Larsson; S. Svanberg

    1994-01-01

    Natural radiative lifetimes of the states in the highly perturbed 5d10np 2P sequence in neutral gold, Au i, for n=6-9, as well as of four of the perturbing 5d96s6p 2P states, have been measured. This was done by direct excitation from the ground state with short-pulse vacuum-ultraviolet laser light and time-resolved detection of the laser-induced fluorescence. We found the lifetimes

  6. Spectral and time-resolved fluorescence signature of four weed species as affected by selected herbicides

    Microsoft Academic Search

    Mauricio Hunsche; Kathrin Bürling; Georg Noga

    2011-01-01

    In the present study we show for the first time the suitability of the laser-induced fluorescence technique to evaluate in vivo herbicide-induced damages as revealed by changes of fluorescence spectra and lifetime. Four herbicides of different modes of action (glyphosate, bromoxynil, mesotrione, and amitrole) were selected and applied to four weed species (Stellaria media, Setaria viridis, Chenopodium album, and Viola

  7. Time-resolved fluorescence microscopy for quantitative Ca2+ imaging in living cells.

    PubMed

    Sagolla, Kristina; Löhmannsröben, Hans-Gerd; Hille, Carsten

    2013-10-01

    Calcium (Ca(2+)) is a ubiquitous intracellular second messenger and involved in a plethora of cellular processes. Thus, quantification of the intracellular Ca(2+) concentration ([Ca(2+)]i) and of its dynamics is required for a comprehensive understanding of physiological processes and potential dysfunctions. A powerful approach for studying [Ca(2+)]i is the use of fluorescent Ca(2+) indicators. In addition to the fluorescence intensity as a common recording parameter, the fluorescence lifetime imaging microscopy (FLIM) technique provides access to the fluorescence decay time of the indicator dye. The nanosecond lifetime is mostly independent of variations in dye concentration, allowing more reliable quantification of ion concentrations in biological preparations. In this study, the feasibility of the fluorescent Ca(2+) indicator Oregon Green Bapta-1 (OGB-1) for two-photon fluorescence lifetime imaging microscopy (2P-FLIM) was evaluated. In aqueous solution, OGB-1 displayed a Ca(2+)-dependent biexponential fluorescence decay behaviour, indicating the presence of a Ca(2+)-free and Ca(2+)-bound dye form. After sufficient dye loading into living cells, an in situ calibration procedure has also unravelled the Ca(2+)-free and Ca(2+)-bound dye forms from a global biexponential fluorescence decay analysis, although the dye's Ca(2+) sensitivity is reduced. Nevertheless, quantitative [Ca(2+)]i recordings and its stimulus-induced changes in salivary gland cells could be performed successfully. These results suggest that OGB-1 is suitable for 2P-FLIM measurements, which can gain access to cellular physiology. PMID:23975087

  8. The supercontinuum laser as a flexible source for quasi-steady state and time resolved fluorescence studies

    NASA Astrophysics Data System (ADS)

    Fenske, Roger; Näther, Dirk U.; Dennis, Richard B.; Smith, S. Desmond

    2010-02-01

    Commercial Fluorescence Lifetime Spectrometers have long suffered from the lack of a simple, compact and relatively inexpensive broad spectral band light source that can be flexibly employed for both quasi-steady state and time resolved measurements (using Time Correlated Single Photon Counting [TCSPC]). This paper reports the integration of an optically pumped photonic crystal fibre, supercontinuum source1 (Fianium model SC400PP) as a light source in Fluorescence Lifetime Spectrometers (Edinburgh Instruments FLS920 and Lifespec II), with single photon counting detectors (micro-channel plate photomultiplier and a near-infrared photomultiplier) covering the UV to NIR range. An innovative method of spectral selection of the supercontinuum source involving wedge interference filters is also discussed.

  9. Time-resolved laser-induced fluorescence of normal and atherosclerotic coronary artery

    NASA Astrophysics Data System (ADS)

    Marcu, Laura; Maarek, Jean-Michel I.; Fishbein, Michael C.; Grundfest, Warren S.

    1999-07-01

    This study investigates the spectro-temporal fluorescence emission of normal and diseased coronary arteries with graded levels of atherosclerosis. Fluorescence emission of 58 excised human coronary artery samples was induced with N2 laser pulses and detected with a MCP-PMT connected to a digital oscilloscope. The samples were H and E and Movat stained and histologically classified in accordance with AHA classification. An algorithm based on Laguerre expansion of kernels was used to deconvolve the intrinsic fluorescence impulse response function from the measured transient pulse. A biexponential function depicted the fluorescence decay characteristics. We noticed 1) in spectral domain: peak fluorescence intensity was at 380 nm for normal and initial lesions samples and blue-shifted for advanced lesions; intensity at 450-480 nm decreased from approximately 65 percent peak intensity for normal samples to approximately 30 percent for Type V lesions; 2) in time domain: longer lasting emission for the advanced lesions. The decay constants varied as a function emission wavelength and lesion type. For instance the time constants for Type V lesions measured at 390 nm were significantly larger that those measured on normal arterial wall. The fast term decay contributed to a higher degree to the impulse response function for normal tissue. These results reveal that the analysis of the temporal characteristics of fluorescence can be used to differentiate between coronary lesion and normal coronary wall. The time domain information complements the spectral domain intensity data for improved differentiation between graded levels of coronary lesions.

  10. Quantification of joint inflammation in rheumatoid arthritis by time-resolved diffuse optical spectroscopy and tracer kinetic modeling

    NASA Astrophysics Data System (ADS)

    Ioussoufovitch, Seva; Morrison, Laura B.; Lee, Ting-Yim; St. Lawrence, Keith; Diop, Mamadou

    2015-03-01

    Rheumatoid arthritis (RA) is characterized by chronic synovial inflammation, which can cause progressive joint damage and disability. Diffuse optical spectroscopy (DOS) and imaging have the potential to become potent monitoring tools for RA. We devised a method that combined time-resolved DOS and tracer kinetics modeling to rapidly and reliably quantify blood flow in the joint. Preliminary results obtained from two animals show that the technique can detect joint inflammation as early as 5 days after onset.

  11. Wave packet dynamics in different electronic states investigated by femtosecond time-resolved four-wave-mixing spectroscopy

    Microsoft Academic Search

    A. Materny; T. Chen; M. Schmitt; T. Siebert; A. Vierheilig; V. Engel; W. Kiefer

    2000-01-01

    .   This paper reviews results on wave packet dynamics investigated by means of femtosecond time-resolved four-wave-mixing (FWM)\\u000a spectroscopy. First, it is shown that by making use of the various degrees of freedom which are offered by this technique\\u000a information about molecular dynamics on different potential-energy surfaces can be accessed and separated from each other.\\u000a By varying the timing, polarization, and

  12. Short-lived excited triplet states studied by time-resolved EPR spectroscopy

    Microsoft Academic Search

    Noboru Hirota; Seigo Yamauchi

    2003-01-01

    In this review, we present an overview of the application of time-resolved electron paramagnetic resonance (TREPR) to the study of excited triplet states. After a brief discussion of background and experimental methods, triplet properties clarified by TREPR are reviewed to show how TREPR provides rich information about electronic and molecular structures and dynamic properties of the lowest excited triplet states.

  13. The measurement of the phosphorescence and singlet oxygen fluorescence time-resolved waveforms of Photofrin(II) and Talaporfin sodium with pulsed excitation

    NASA Astrophysics Data System (ADS)

    Hakomori, Shiho; Ohmori, Sayaka; Masuda, Kensuke; Yamamoto, Kojiro; Arai, Tsunenori

    2007-02-01

    In order to investigate the interaction between the triplet state T I and ground state oxygen 3O II during pulsed excitation photodynamic therapy (PDT), we measured the phosphorescence and singlet oxygen 1O II fluorescence time-resolved waveform. The phosphorescence time-resolved waveform from clinical photosensitizers has not been obtained because this signal was buried in the photosensitizer fluorescence. We constructed the experimental setup with a spectral and temporal filter to select the phosphorescence signals from the Photofrin(II) (R) and Talaporfin sodium solution. The lifetimes and spectrums of the measured luminescence coincided with the phosphorescence characteristics, respectively. We obtained the phosphorescence time-resolved waveforms from the clinical photosensitizer solutions successfully. The 1O II fluorescence time-resolved waveforms from these photosensitizers were measured with an IR-PMT with a photon counter. The fluorescence time-resolved waveforms of each photosensitizer were also obtained by the authors. We could consequently describe sequential generation of three time-resolved waveforms throughout the photosensitive reaction in the clinical photosensitizers. We think we may evaluate the photoseisitizer characteristics by these waveforms.

  14. Laguerre-based method for analysis of time-resolved fluorescence data: application to in-vivo characterization and diagnosis of atherosclerotic lesions

    NASA Astrophysics Data System (ADS)

    Jo, Javier A.; Fang, Qiyin; Papaioannou, Thanassis; Baker, J. Dennis; Dorafshar, Amir; Reil, Todd; Qiao, Jianhua; Fishbein, Michael C.; Freischlag, Julie A.; Marcu, Laura

    2006-03-01

    We report the application of the Laguerre deconvolution technique (LDT) to the analysis of in-vivo time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) data and the diagnosis of atherosclerotic plaques. TR-LIFS measurements were obtained in vivo from normal and atherosclerotic aortas (eight rabbits, 73 areas), and subsequently analyzed using LDT. Spectral and time-resolved features were used to develop four classification algorithms: linear discriminant analysis (LDA), stepwise LDA (SLDA), principal component analysis (PCA), and artificial neural network (ANN). Accurate deconvolution of TR-LIFS in-vivo measurements from normal and atherosclerotic arteries was provided by LDT. The derived Laguerre expansion coefficients reflected changes in the arterial biochemical composition, and provided a means to discriminate lesions rich in macrophages with high sensitivity (>85%) and specificity (>95%). Classification algorithms (SLDA and PCA) using a selected number of features with maximum discriminating power provided the best performance. This study demonstrates the potential of the LDT for in-vivo tissue diagnosis, and specifically for the detection of macrophages infiltration in atherosclerotic lesions, a key marker of plaque vulnerability.

  15. Time-resolved fluorescence of 2-aminopurine as a probe of base flipping in M.HhaI–DNA complexes

    PubMed Central

    Neely, Robert K.; Daujotyte, Dalia; Grazulis, Saulius; Magennis, Steven W.; Dryden, David T. F.; Klimašauskas, Saulius; Jones, Anita C.

    2005-01-01

    DNA base flipping is an important mechanism in molecular enzymology, but its study is limited by the lack of an accessible and reliable diagnostic technique. A series of crystalline complexes of a DNA methyltransferase, M.HhaI, and its cognate DNA, in which a fluorescent nucleobase analogue, 2-aminopurine (AP), occupies defined positions with respect the target flipped base, have been prepared and their structures determined at higher than 2 ? resolution. From time-resolved fluorescence measurements of these single crystals, we have established that the fluorescence decay function of AP shows a pronounced, characteristic response to base flipping: the loss of the very short (?100 ps) decay component and the large increase in the amplitude of the long (?10 ns) component. When AP is positioned at sites other than the target site, this response is not seen. Most significantly, we have shown that the same clear response is apparent when M.HhaI complexes with DNA in solution, giving an unambiguous signal of base flipping. Analysis of the AP fluorescence decay function reveals conformational heterogeneity in the DNA–enzyme complexes that cannot be discerned from the present X-ray structures. PMID:16340006

  16. Time-Resolved Fluorescence of Carbon Nanotubes and Its Implication for Radiative Lifetimes Feng Wang,1

    E-print Network

    Heinz, Tony F.

    of Chemistry, Columbia University, 3000 Broadway, New York, New York 10027, USA (Received 27 October 2003 rate and a determination of fluorescence quantum efficiency, we deduce a radiative lifetime of 110 ns in excess of 1012 A=m2 and to exhibit favorable switching character- istics. The interaction of nanotubes

  17. Time-Resolved Fluorescence Analysis of the Photosystem II Antenna Proteins in Detergent Micelles and Liposomes

    E-print Network

    and Liposomes Ismael Moya, Mariuccia Silvestri,§ Olivier Vallon,| Gianfelice Cinque, and Roberto Bassi*, LURE conformation of the Lhc proteins. Upon incorporation of Lhc proteins into liposomes, a quenching of chlorophyll in the liposomes, and therefore the probability of protein-protein interactions, a further decrease of fluorescence

  18. Time-resolved fluorescence studies of tomaymycin bonding to synthetic DNAs.

    PubMed Central

    Barkley, M D; Chen, Q; Walczak, W J; Maskos, K

    1996-01-01

    Tomaymycin reacts covalently with guanine in the DNA minor groove, exhibiting considerable specificity for the flanking bases. The sequence dependence of tomaymycin bonding to DNA was investigated in synthetic DNA oligomers and polymers. The maximum extent of bonding to DNA is greater for homopurine and natural DNA sequences than for alternating purine-pyrimidine sequences. Saturation of DNA with tomaymycin has little effect on the melting temperature in the absence of unbound drug. Fluorescence lifetimes were measured for DNA adducts at seven of the ten unique trinucleotide bonding sites. Most of the adducts had two fluorescence lifetimes, representing two of the four possible binding modes. The lifetimes cluster around 2-3 ns and 5-7 ns; the longer lifetime is the major component for most bonding sites. The two lifetime classes were assigned to R and S diastereomeric adducts by comparison with previous NMR results for oligomer adducts. The lifetime difference between binding modes is interpreted in terms of an anomeric effect on the excited-state proton transfer reaction that quenches tomaymycin fluorescence. Bonding kinetics of polymer adducts were monitored by fluorescence lifetime measurements. Rates of adduct formation vary by two orders of magnitude with poly(dA-dG).poly(dC-dT), reacting the fastest at 4 x 10(-2) M-1 s-1. The sequence specificity of tomaymycin is discussed in light of these findings and other reports in the literature. PMID:8785351

  19. Microsecond protein folding events revealed by time-resolved fluorescence resonance energy transfer in a microfluidic mixer.

    PubMed

    Jiang, Liguo; Zeng, Yan; Sun, Qiqi; Sun, Yueru; Guo, Zhihong; Qu, Jianan Y; Yao, Shuhuai

    2015-06-01

    We demonstrate the combination of the time-resolved fluorescence resonance energy transfer (tr-FRET) measurement and the ultrarapid hydrodynamic focusing microfluidic mixer. The combined technique is capable of probing the intermolecular distance change with temporal resolution at microsecond level and structural resolution at Angstrom level, and the use of two-photon excitation enables a broader exploration of FRET with spectrum from near-ultraviolet to visible wavelength. As a proof of principle, we used the coupled microfluidic laminar flow and time-resolved two-photon excitation microscopy to investigate the early folding states of Cytochrome c (cyt c) by monitoring the distance between the tryptophan (Trp-59)-heme donor-acceptor (D-A) pair. The transformation of folding states of cyt c in the early 500 ?s of refolding was revealed on the microsecond time scale. For the first time, we clearly resolved the early transient state of cyt c, which is populated within the dead time of the mixer (<10 ?s) and has a characteristic Trp-59-heme distance of ?31 Å. We believe this tool can find more applications in studying the early stages of biological processes with FRET as the probe. PMID:25938953

  20. Time-Resolved Laser-Induced Fluorescence Measurements of the Ion Velocity Distribution in the H6 Hall Thruster Plume

    NASA Astrophysics Data System (ADS)

    Durot, Christopher; Gallimore, Alec

    2013-09-01

    We developed a technique to measure time-resolved laser-induced fluorescence signals in plasma sources that have a relatively constant spectrum of oscillations in steady-state operation but are not periodically pulsed, such as Hall thrusters. We present the first results using the new technique to capture oscillations in a Hall Thruster. The ion velocity distribution function in the plume of the H6 Hall thruster is interrogated during breathing mode oscillations. The breathing mode is characterized by an oscillating depletion and replenishment of neutrals at a frequency of about 10-25 kHz. We use laser modulation on the order of megahertz, well above the time scale of interest (about 0.1 ms). Band-pass filtering and phase-sensitive detection (with a time constant on the order of microseconds) raise the signal-to-noise ratio and demodulate the signal while preserving time-resolved information. Following phase-sensitive detection, we average over transfer functions to finish recovering the signal. This technique has advantages such as a shorter dwell time than other techniques and the lack of a need for triggering for averaging in the time domain.

  1. A novel luminescent terbium-3-carboxycoumarin probe for time-resolved fluorescence sensing of pesticides methomyl, aldicarb and prometryne.

    PubMed

    Azab, Hassan A; Duerkop, Axel; Saad, E M; Awad, F K; Abd El Aal, R M; Kamel, Rasha M

    2012-11-01

    The luminescence arising from lanthanide cations offers several advantages over organic fluorescent molecules: sharp, distinctive emission bands allow for easy resolution between multiple lanthanide signals; long emission lifetimes (?s-ms) make them excellent candidates for time-resolved measurements; and high resistance to photo bleaching allow for long or repeated experiments. A time-resolved (gated) luminescence-based method for determination of pesticides methomyl, aldicarb and prometryne in microtiterplate format using the long-lived terbium-3-carboxycoumarin in 1:3 metal:ligand ratio has been developed. The limit of detection is 1.20×10(6), 5.19×10(5) and 2.74×10(6)ng L(-1) for methomyl, prometryne and aldicarb, respectively. The quantum yield (QY=0.08) of Tb(III)-3-carboxycoumarin was determined using 3-(2-benzothiazolyl)-7-diethylamino-coumarin (coumarin 6). Stern-volmer studies at different temperatures indicate that collisional quenching dominates for methomyl, aldicarb and prometryne. Binding constants were determined at 303, 308 and 313 K by using Lineweaver-Burk equation. A thermodynamic analysis showed that the reaction is spontaneous with negative ?G. Effect of some relevant interferents on the detection of pesticides has been investigated. PMID:22906968

  2. Quantifying the cerebral metabolic rate of oxygen by combining diffuse correlation spectroscopy and time-resolved near-infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Verdecchia, Kyle; Diop, Mamadou; Lee, Ting-Yim; St. Lawrence, Keith

    2013-02-01

    Preterm infants are highly susceptible to ischemic brain injury; consequently, continuous bedside monitoring to detect ischemia before irreversible damage occurs would improve patient outcome. In addition to monitoring cerebral blood flow (CBF), assessing the cerebral metabolic rate of oxygen (CMRO2) would be beneficial considering that metabolic thresholds can be used to evaluate tissue viability. The purpose of this study was to demonstrate that changes in absolute CMRO2 could be measured by combining diffuse correlation spectroscopy (DCS) with time-resolved near-infrared spectroscopy (TR-NIRS). Absolute CBF was determined using bolus-tracking TR-NIRS to calibrate the DCS measurements. Cerebral venous blood oxygenation (SvO2) was determined by multiwavelength TR-NIRS measurements, the accuracy of which was assessed by directly measuring the oxygenation of sagittal sinus blood. In eight newborn piglets, CMRO2 was manipulated by varying the anesthetics and by injecting sodium cyanide. No significant differences were found between the two sets of SvO2 measurements obtained by TR-NIRS or sagittal sinus blood samples and the corresponding CMRO2 measurements. Bland-Altman analysis showed a mean CMRO2 difference of 0.0268±0.8340 mL O2/100 g/min between the two techniques over a range from 0.3 to 4 mL O2/100 g/min.

  3. The picosecond time-resolved fluorescence spectrum of rhodamine 6G

    Microsoft Academic Search

    M. M. Malley; G. Mourou

    1974-01-01

    We have observed the spontaneous flourescence spectrum of rhodamine 6G in glycerol with picosecond resolution using a mode-locked Nd:glass laser. The position, width and shape of the fluorescence spectrum are a function of the delay time between excitation and observation of the spectrum. Initially, the spectrum is close to a lorentzian with 12 nm halfwidth centered at 559 nm. The

  4. Gene expression analysis with an integrated CMOS microarray by time-resolved fluorescence detection

    PubMed Central

    Huang, Ta-chien D.; Paul, Sunirmal; Gong, Ping; Levicky, Rastislav; Kymissis, John; Amundson, Sally A.; Shepard, Kenneth L.

    2010-01-01

    DNA microarrays have proven extraordinarily powerful for differential expression studies across thousands of genes in a single experiment. Microarrays also have the potential for clinical applications, including the detection of infectious and immunological diseases and cancer, if they can be rendered both reliable and cost-effective. Here we report the first practical application of an active microarray based on integrated circuit technology, completely obviating the need for external measurement instrumentation while employing protocols compatible with traditional fluorescence-based surface bioassays. In a gene-expression biodosimetry study, we determine the differential activity of genes from leucocytes in irradiated human blood. Quantum dots are used as fluorescence labels to realize filterless, time-gated fluorescence detection on an active complementary metal-oxide-semiconductor (CMOS) microarray with 100-pM sensitivity. Improvements in surface chemistry should allow sensitivities that approach the microarray hardware limit of less than 10 pM. Techniques for covalent attachment of DNA capture strands to the CMOS active microarrays allow integrated sensors to be placed in immediate proximity to hybridized analyte strands, maximizing photon collection efficiencies. PMID:20392628

  5. Time-resolved imaging system for fluorescence-guided surgery with lifetime imaging capability

    NASA Astrophysics Data System (ADS)

    Powolny, F.; Homicsko, K.; Sinisi, R.; Bruschini, Claudio E.; Grigoriev, E.; Homulle, H.; Prior, John O.; Hanahan, D.; Dubikovskaya, E.; Charbon, E.

    2014-05-01

    We present a single-photon camera for fluorescence imaging, with a time resolution better than 100ps, capable of providing both intensity and lifetime images. the camera was fabricated in standard CMOS technology. With this FluoCam we show the possibility to study sub-nanosecond fluorescence mechanisms. The FluoCam was used to characterize a near-infrared probe, indocyanine green, conjugated with multimeric cyclic pentapeptide (cRGD). The fluorescent probe-conjugated was used to target and mark tumors with better specificity, in particular aiming at targeting the integrins ?v?3 and ?v?5. As a first step towards clinical studies, preliminary results obtained in-vivo are presented. The first envisioned clinical application would be image-guided surgical oncology to help the surgeon to remove tumor tissue by a better discrimination from normal tissues and also to improve the detection of metastatic lymph nodes. A further application could be the in-vivo determination of the ?v?3 and ?v?5 targets to select patients for therapy with RGD chemotherapy conjugates.

  6. Time-resolved IR spectroscopy of a trinuclear palladium complex in solution.

    PubMed

    Zimmer, M; Rupp, F; Singer, P; Walz, F; Breher, F; Klopper, W; Diller, R; Gerhards, M

    2015-06-01

    This paper presents a combined spectroscopic and theoretical analysis of a trinuclear [Pd3{Si(mt(Me))3}2] complex (mt(Me) = methimazole) which has been demonstrated to be a potential catalyst for coupling reactions. It is a highly symmetric model system (D3 in the electronic ground state) for the investigation of electronic states and the structure of polynuclear transition metal complexes. Different time-resolved IR spectroscopic methods covering the femtosecond up to the microsecond range as well as density functional computations are performed to unravel the structure and character of this complex in the electronically excited state. These are the first time-resolved IR studies on a trinuclear Pd complex. Based on the interplay between the computational results and those from the IR studies a (3)A state is identified as the lowest lying triplet state which has C2 symmetry. PMID:25959720

  7. Full Genotyping of a Highly Polymorphic Human Gene Trait by Time-Resolved Fluorescence Resonance Energy Transfer

    PubMed Central

    Totè, Edoardo; Lamperti, Marco; Bondani, Maria; Salerno, Domenico; Cassina, Valeria; Nardo, Luca

    2014-01-01

    The ability of detecting the subtle variations occurring, among different individuals, within specific DNA sequences encompassed in highly polymorphic genes discloses new applications in genomics and diagnostics. DQB1 is a gene of the HLA-II DQ locus of the Human Leukocyte Antigens (HLA) system. The polymorphisms of the trait of the DQB1 gene including codons 52–57 modulate the susceptibility to a number of severe pathologies. Moreover, the donor-receiver tissue compatibility in bone marrow transplantations is routinely assessed through crossed genotyping of DQB and DQA. For the above reasons, the development of rapid, reliable and cost-effective typing technologies of DQB1 in general, and more specifically of the codons 52–57, is a relevant although challenging task. Quantitative assessment of the fluorescence resonance energy transfer (FRET) efficiency between chromophores labelling the opposite ends of gene-specific oligonucleotide probes has proven to be a powerful tool to type DNA polymorphisms with single-nucleotide resolution. The FRET efficiency can be most conveniently quantified by applying a time-resolved fluorescence analysis methodology, i.e. time-correlated single-photon counting, which allows working on very diluted template specimens and in the presence of fluorescent contaminants. Here we present a full in-vitro characterization of the fluorescence responses of two probes when hybridized to oligonucleotide mixtures mimicking all the possible genotypes of the codons 52–57 trait of DQB1 (8 homozygous and 28 heterozygous). We show that each genotype can be effectively tagged by the combination of the fluorescence decay constants extrapolated from the data obtained with such probes. PMID:25215592

  8. Cellular Oxygen and Nutrient Sensing in Microgravity Using Time-Resolved Fluorescence Microscopy

    NASA Technical Reports Server (NTRS)

    Szmacinski, Henryk

    2003-01-01

    Oxygen and nutrient sensing is fundamental to the understanding of cell growth and metabolism. This requires identification of optical probes and suitable detection technology without complex calibration procedures. Under this project Microcosm developed an experimental technique that allows for simultaneous imaging of intra- and inter-cellular events. The technique consists of frequency-domain Fluorescence Lifetime Imaging Microscopy (FLIM), a set of identified oxygen and pH probes, and methods for fabrication of microsensors. Specifications for electronic and optical components of FLIM instrumentation are provided. Hardware and software were developed for data acquisition and analysis. Principles, procedures, and representative images are demonstrated. Suitable lifetime sensitive oxygen, pH, and glucose probes for intra- and extra-cellular measurements of analyte concentrations have been identified and tested. Lifetime sensing and imaging have been performed using PBS buffer, culture media, and yeast cells as a model systems. Spectral specifications, calibration curves, and probes availability are also provided in the report.

  9. Fluorescence Correlation Spectroscopy

    NSDL National Science Digital Library

    Haustein, Elke

    This paper, which was previously published as part of an online biophysics textbook, provides detailed information about concepts related to fluorescence correlation spectroscopy. Sections of the document include writing on experimental realization, theoretical concepts, and applications of this technology.

  10. Laser-induced time-resolved spectroscopy of visible broad luminescence bands in zircon

    Microsoft Academic Search

    M. Gaft; I. Shinno; G. Panczer; R. Reisfeld

    2002-01-01

    Summary  ?This work examines the luminescence of zircon studied by laser-induced time-resolved methods. This method allows the differentiation\\u000a between luminescence centers of similar emission wavelengths, but different decay times. Samples include a suite of natural\\u000a zircons, nominally pure synthetic ZrSiO4, and ZrSiO4 artificially doped by Mn, Fe, Cr, Ni, Co, Pb, Sb, Ti, Ta, V, Sc, U, U-P, and Th-P. In

  11. Time-resolved fluorescence imaging of slab gels for lifetime base-calling in DNA sequencing applications.

    PubMed

    Lassiter, S J; Stryjewski, W; Legendre, B L; Erdmann, R; Wahl, M; Wurm, J; Peterson, R; Middendorf, L; Soper, S A

    2000-11-01

    A compact time-resolved near-IR fluorescence imager was constructed to obtain lifetime and intensity images of DNA sequencing slab gels. The scanner consisted of a microscope body with f/1.2 relay optics onto which was mounted a pulsed diode laser (repetition rate 80 MHz, lasing wavelength 680 nm, average power 5 mW), filtering optics, and a large photoactive area (diameter 500 microns) single-photon avalanche diode that was actively quenched to provide a large dynamic operating range. The time-resolved data were processed using electronics configured in a conventional time-correlated single-photon-counting format with all of the counting hardware situated on a PC card resident on the computer bus. The microscope head produced a timing response of 450 ps (fwhm) in a scanning mode, allowing the measurement of subnano-second lifetimes. The time-resolved microscope head was placed in an automated DNA sequencer and translated across a 21-cm-wide gel plate in approximately 6 s (scan rate 3.5 cm/s) with an accumulation time per pixel of 10 ms. The sampling frequency was 0.17 Hz (duty cycle 0.0017), sufficient to prevent signal aliasing during the electrophoresis separation. Software (written in Visual Basic) allowed acquisition of both the intensity image and lifetime analysis of DNA bands migrating through the gel in real time. Using a dual-labeling (IRD700 and Cy5.5 labeling dyes)/two-lane sequencing strategy, we successfully read 670 bases of a control M13mp18 ssDNA template using lifetime identification. Comparison of the reconstructed sequence with the known sequence of the phage indicated the number of miscalls was only 2, producing an error rate of approximately 0.3% (identification accuracy 99.7%). The lifetimes were calculated using maximum likelihood estimators and allowed on-line determinations with high precision, even when short integration times were used to construct the decay profiles. Comparison of the lifetime base calling to a single-dye/four-lane sequencing strategy indicated similar results in terms of miscalls, but reduced insertion and deletion errors using lifetime identification methods, improving the overall read accuracy. PMID:11080890

  12. A time-resolved fluorescence immunoassay for the ultrasensitive determination of diethylstilbestrol based on the double-codified gold nanoparticles.

    PubMed

    Wang, Longjun; Zhang, Yuanfu; Liu, Guofu; Zhang, Chunyan; Wang, Shuhao

    2014-11-01

    An ultrasensitive and selective method is presented for the determination of diethylstilbestrol (DES) using time-resolved fluorescence immunoassay (TRFIA) based on double-codified gold nanoparticles (DC-AuNPs). In this system, the DC-AuNPs, that are gold nanoparticles (AuNPs) modified with anti-DES antibody and SH-dsDNA-biotin, was regarded as signal amplifier. A competitive immunoreaction was performed on polystyrene microtitration plates, where the DES compete with the immobilized DES-ovalbumin on polystyrene microtitration plates to bind to anti-DES antibodies on DC-AuNPs, and the europium(III)-labeled streptavidin was added to link to the SH-dsDNA-biotin as a tracer. Fluorescence signal was amplified via the AuNPs and the biotin-streptavidin double amplification systems. Under the optimized condition, DES can be quantified by TRFIA. The linear range and the limit of detection of DES were 1.0×10(-6)-10ngmL(-1) and 0.4fgmL(-1), respectively. This method was applied to determine DES in beef sample, with the recoveries ranging from 88% to 105%. PMID:25091151

  13. TIME-RESOLVED ULTRAVIOLET SPECTROSCOPY OF THE M-DWARF GJ 876 EXOPLANETARY SYSTEM

    SciTech Connect

    France, Kevin; Froning, Cynthia S. [Center for Astrophysics and Space Astronomy, University of Colorado, 389 UCB, Boulder, CO 80309 (United States); Linsky, Jeffrey L. [JILA, University of Colorado and NIST, 440 UCB, Boulder, CO 80309 (United States); Tian, Feng [Laboratory for Atmospheric and Space Physics, University of Colorado, Boulder, CO 80309 (United States); Roberge, Aki, E-mail: kevin.france@colorado.edu [Exoplanets and Stellar Astrophysics Laboratory, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)

    2012-05-10

    Extrasolar planets orbiting M-stars may represent our best chance to discover habitable worlds in the coming decade. The ultraviolet spectrum incident upon both Earth-like and Jovian planets is critically important for proper modeling of their atmospheric heating and chemistry. In order to provide more realistic inputs for atmospheric models of planets orbiting low-mass stars, we present new near- and far-ultraviolet (NUV and FUV) spectroscopy of the M-dwarf exoplanet host GJ 876 (M4V). Using the COS and STIS spectrographs on board the Hubble Space Telescope, we have measured the 1150-3140 A spectrum of GJ 876. We have reconstructed the stellar H I Ly{alpha} emission line profile, and find that the integrated Ly{alpha} flux is roughly equal to the rest of the integrated flux (1150-1210 A + 1220-3140 A) in the entire ultraviolet bandpass (F(Ly{alpha})/F(FUV+NUV) Almost-Equal-To 0.7). This ratio is {approx}2500 Multiplication-Sign greater than the solar value. We describe the ultraviolet line spectrum and report surprisingly strong fluorescent emission from hot H{sub 2} (T(H{sub 2}) > 2000 K). We show the light curve of a chromospheric + transition region flare observed in several far-UV emission lines, with flare/quiescent flux ratios {>=}10. The strong FUV radiation field of an M-star (and specifically Ly{alpha}) is important for determining the abundance of O{sub 2}-and the formation of biomarkers-in the lower atmospheres of Earth-like planets in the habitable zones of low-mass stars.

  14. Local probing of relaxation time distributions in ferroelectric polymer nanomesas: Time-resolved piezoresponse force spectroscopy and spectroscopic imaging

    SciTech Connect

    Rodriguez, Brian [University College, Dublin] [University College, Dublin; Jesse, Stephen [ORNL] [ORNL; Kim, J. [University of Nebraska, Lincoln] [University of Nebraska, Lincoln; Ducharme, S. [University of Nebraska, Lincoln] [University of Nebraska, Lincoln; Kalinin, Sergei [Oak Ridge National Laboratory (ORNL)] [Oak Ridge National Laboratory (ORNL)

    2008-01-01

    Time-resolved piezoresponse force spectroscopy (TR-PFS) and spectroscopic imaging are developed to probe the spatial variability of relaxation behavior in nanoscale ferroelectric materials and structures. TR-PFS was applied to study polarization dynamics in polyvinylidine fluoride and trifluoroethylene nanomesas. We demonstrate that polarization relaxation in ferroelectric polymers is slow even on the 10 nm length scale of piezoresponse force microscopy (PFM) signal generation. Furthermore, the relaxation times are found to be nonuniform within the nanomesa, indicative of a complex internal structure. The applicability of TR-PFM for studies of polarization dynamics in ferroelectric polymers and relaxors is discussed.

  15. Probing Reaction Dynamics of Transition-Metal Complexes in Solution via Time-Resolved X-ray Spectroscopy

    SciTech Connect

    Huse, Nils; Khalil, Munira; Kim, Tae Kyu; Smeigh, Amanda L.; Jamula, Lindsey; McCusker, James K.; Schoenlein, Robert W.

    2009-05-24

    We report measurements of the photo-induced Fe(II) spin crossover reaction dynamics in solution via time-resolved x-ray absorption spectroscopy. EXAFS measurements reveal that the iron?nitrogen bond lengthens by 0.21+-0.03 Angstrom in the high-spin transient excited state relative to the ground state. XANES measurements at the Fe L-edge show directly the influence of the structural change on the ligand-field splitting of the Fe(II) 3d orbitals associated with the spin transition.

  16. Time-resolved FUV Spectroscopy of a Unique White Dwarf in the Kepler Field

    NASA Astrophysics Data System (ADS)

    Hoard, Donald

    2013-10-01

    We propose to use 4 HST orbits to obtain time-resolved far-UV {FUV} spectra with COS of the rapidly spinning, metal-polluted white dwarf KIC 9535405, in order to explore the distribution of accreted metals over the white dwarf's surface {including the possibility that confinement by the white dwarf's magnetic field is preventing the rapid gravitational settling of heavy elements}. This will enable us to explore details of the largely unknown process through which matter transitions from circumstellar space onto the WD itself. We will also obtain the chemical composition of the parent body of the accreted matter, thereby adding to the limited pool of information on direct measurements of the composition and structure of extrasolar planetary {terrestrial} bodies. The proposed HST observations will be complemented by existing, ongoing, and planned ground- and space-based {Kepler, Spitzer} observations obtained by us.

  17. Vibrationally excited states in carotenoids: picosecond time-resolved anti-Stokes resonance Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Hayashi, H.; Tasumi, M.; Atkinson, G. H.

    1991-03-01

    Transient vibrationally excited, ground-state populations of carotenoids have been observed for in vivo pigment-protein complexes of Chromatium vinosum and in vitro samples of the isolated carotenoid spirilloxanthin in benzene solution using picosecond time-resolved anti-Stokes resonance Raman scattering. These populations are formed under the same excitation conditions recently used to detect the transient populations of the ground 1A g and excited 2 1A g and 3B u electronic states in the same molecular systems. The time-dependent anti-Stokes resonance Raman band intensities show that these populations decay via vibrational relaxation within 50 ps. These data experimentally confirm an excited state relaxation mechanism postulated to describe the population dynamics among the 1A g, 1B u, 2 1A g, and 3B u electronic states in both in vivo and in vitro carotenoids.

  18. Nanosecond time-resolved vacuum ultraviolet spectrometer for ion diode spectroscopy

    NASA Astrophysics Data System (ADS)

    Nash, T.; Noack, D.; Filuk, A. B.

    1993-09-01

    A 1-m normal incidence spectrometer has been modified for use as a diagnostic of ion diode plasmas. To improve instrumental sensitivity, an elliptical mirror images an anode surface plasma onto the entrance slit of an f/10 normal incidence spectrometer. The detector is a time-resolving copper iodide coated microchannel plate stripline framing camera with 60-?m resolution, limiting instrumental resolution to 1 Å with a 600 l/mm grating in first order. Reflectivity of optics and photoelectron efficiency limit the spectral range from 400 to 2000 Å. With a 600-l/mm grating the detector spans a 600-Å range. Applications of the instrument may include ion source divergence measurements from Doppler broadening, electric field measurements from Stark splittings or shifts, electron temperature from mean ionization state, and magnetic field measurements on high-power Z pinches from Zeeman splitting.

  19. Hole-burning and picosecond time-resolved spectroscopy of isolated molecular clusters

    NASA Astrophysics Data System (ADS)

    Wittmeyer, Stacey A.; Kaziska, Andrew J.; Shchuka, Maria I.; Topp, Michael R.

    1991-07-01

    A precolumn derivatization method has been developed for high performance liquid chromatographic (HPLC) analysis of DNA damage using fluorescence detection. The modified nucleotide, having excised enzymatically from the exposed DNA, is enriched from the normal nucleotides and labeled with a fluorescent reagent. The labeling procedure involves phosphoramidation of the nucleotide with ethylenediamine (EDA) followed by conjugation of the free amino end of the phosphoramidate with 5-dimethylaminonaphthalene 1-sulfonyl chloride, commonly known as Dansyl chloride. The dansylated nucleotide can be analyzed with a sub-picomole limit of detection (LOD) by conventional HPLC using a conventional fluorescence detector. By combining microbore HPLC with laser-induced fluorescence (LIF) detection, we present the development of an analytical system that has sub-femtomole LOD for real-time analysis of the dansylated nucleotide. The application of the developed system in fluorescence postlabeling assay of a small alkyl-modified nucleotide (5-methyldCMP) in calf-thymus DNA is discussed.

  20. Dynamics of light-induced activation in the PAS domain proteins LOV2 and PYP probed by time-resolved tryptophan fluorescence.

    PubMed

    Hoersch, Daniel; Bolourchian, Farzin; Otto, Harald; Heyn, Maarten P; Bogomolni, Roberto A

    2010-12-28

    Light-induced activation of the LOV2-J? domain of the photoreceptor phototropin from oat is believed to involve the detachment of the J? helix from the central ?-sheet and its subsequent unfolding. The dynamics of these conformational changes were monitored by time-resolved emission spectroscopy with 100 ns time resolution. Three transitions were detected during the LOV2-J? photocycle with time constants of 3.4 ?s, 500 ?s, and 4.3 ms. The fastest transition is due to the decay of the flavin phosphorescence in the transition of the triplet LOV(L)(660) state to the singlet LOV(S)(390) signaling state. The 500 ?s and 4.3 ms transitions are due to changes in tryptophan fluorescence and may be associated with the dissociation and unfolding of the J? helix, respectively. They are absent in the transient absorption signal of the flavin chromophore. The tryptophan fluorescence signal monitors structural changes outside the chromophore binding pocket and indicates that there are at least three LOV(S)(390) intermediates. Since the 500 ?s and 4.3 ms components are absent in a construct without the J? helix and in the mutant W557S, the fluorescence signal is mainly due to tryptophan 557. The kinetics of the main 500 ?s component is strongly temperature dependent with activation energy of 18.2 kcal/mol suggesting its association with a major structural change. In the structurally related PAS domain protein PYP the N-terminal cap dissociates from the central ?-sheet and unfolds upon signaling state formation with a similar time constant of ?1 ms. Using transient fluorescence we obtained a nearly identical activation energy of 18.5 kcal/mol for this transition. PMID:21090690

  1. Probing reaction dynamics of transition-metal complexes in solution via time-resolved soft x-ray spectroscopy

    SciTech Connect

    Huse, N.; Kim, T.-K.; Khalil, M.; Jamula, L.; McCusker, J.K.; Schoenlein, R.W.

    2008-08-01

    We report the first time-resolved soft x-ray measurements of solvated transition-metal complexes. L-edge spectroscopy directly probes dynamic changes in ligand-field splitting of 3d orbitals associated with the spin transition, and mediated by changes in ligand-bonding. We report the first time-resolved soft x-ray spectroscopy of solution-phase molecular dynamics. Changes in ligand-field splitting and spin-state populations in 3d orbitals of the Fe{sup II} complex are directly probed via transient absorption changes of the Fe L{sub 2} and L{sub 3} edges following photo-induced metal-to-ligand charge transfer. With the emergence of high-flux ultrafast soft x-ray sources, details on interplay between atomic structure, electronic states, and spin contributions will be revealed. Our experimental approach opens the door to femtosecond soft x-ray investigations of liquid phase chemistry that have previously been inaccessible.

  2. Time-Resolved Fluorescence Quenching Measurements of the Aggregation Numbers of Normal Sodium Alkyl Sulfate Micelles Well above the Critical Micelle Concentrations

    E-print Network

    Bales, Barney

    , because most of the interesting uses of micelles occur at finite micelle concentrations. For sodiumTime-Resolved Fluorescence Quenching Measurements of the Aggregation Numbers of Normal Sodium Alkyl, 1998 The aggregation numbers, NA, of normal sodium alkyl sulfate micelles were measured by time

  3. SIMULTANEOUS DETECTION OF ESCHERICHIA COLI 0157:H7 AND SALMONELLA TYPHIMURIUM IN FOODS USING IMMUNOMAGNETIC CAPTURE AND LANTHANIDE TIME-RESOLVED FLUORESCENCE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A time-resolved fluorescence procedure was developed to detect Escherichia coli O157:H7 and Salmonella typhimurium in ground meats. After a 4.5 hour enrichment period, streptavidin coated magnetic beads conjugated with biotin-labeled specific anti-bacteria antibodies were used to capture targeted ...

  4. SIMULTANEOUS DETECTION OF ESCHERICHIA COLI 0157:H7 AND SALMONELLA TYPHIMURIUM IN FOODS USING IMMUNOMAGNETIC CAPTURE AND LANTHANIDE TIME-RESOLVED FLUORESCENCE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A procedure, based on immunomagnetic capture and time-resolved fluorescence, was developed to detect Escherichia coli O157:H7 and Salmonella Typhimurium in ground meats and fresh sprouts. After a brief enrichment period, streptavidin coated magnetic beads conjugated with biotin-labeled specific ant...

  5. Modulation in the solute location in block copolymer-surfactant supramolecular assembly: a time-resolved fluorescence study.

    PubMed

    Singh, Prabhat K; Kumbhakar, Manoj; Pal, Haridas; Nath, Sukhendu

    2009-02-01

    Effect of cosurfactant concentration on the location of a dissolved solute in a block copolymer-surfactant supramolecular system has been investigated using time-resolved fluorescence anisotropy and dynamic Stokes' shift measurements. Pluronic F88 and cosurfactant CTAC have been used to form a supramolecular assembly. The anion of coumarin 343 dye has been used as the solute/probe. It is seen that as the CTAC concentration is increased in the F88-CTAC supramolecular assembly, the microviscosity around the probe gradually increases. The result suggests that the probe undergoes a gradual migration from micellar surface to the interior of the micelle as the concentration of the CTAC is increased. This is also supported by the dynamic Stokes' shift results. It is seen that as the CTAC concentration is increased in the system, the observed Stokes' shift gradually increases due to the movement of the probe away from the bulk water. By comparing the present results with those reported in another pluronic-surfactant system, namely, P123-CTAC, it is indicated that the extent of modulation in the position of the probe in such supramolecular systems is largely determined by the composition of the pluronic, especially on the length of its hydrophilic ethyleneoxide block. PMID:19133741

  6. Time resolved laser absorption spectroscopy in a self-pulsed microplasma.

    NASA Astrophysics Data System (ADS)

    Aubert, X.; Rousseau, A.; Lagrange, J. F.; Sadeghi, N.

    2006-10-01

    It was recently shown that microplasmas of the microhollow cathode type geometry may operate in a self-pulsing regime for intermediate current (0.1-1 mA) [1]. At lower current (< 0.1 mA) the plasma is stable and located inside the hole; at higher current (> 1 mA) , the plasma is also stable but expands outside the hole on the cathode backside region. The self pulsing was attributed to the breakdown of the gas, outside the micro-hole, on the cathode backside. However, the mechanisms of the plasma ignition on the cathode backside are not understood and metastable atoms may play a major role. In the present work, time resolved diode laser absorption measurements have been performed through the micro-hole in the self-pulsing regime; the plasma hole ranges is in the range of 100 ?m and the gas pressure ranges from 50 to 300 Torr; the feed gas is argon and the transition studied is 772.376 nm (Paschen notation 1s5-2p7). The objective is i) to measure the time evolution of the 1s5 metastable density, ii) deduce the gas temperature and plasma density from the absorption line profile. Similar results are performed in 3 electrodes configuration [1] A. Rousseau and X. Aubert J. Phys.D : Appl. Phys. 39 (2006) 1619--1622.

  7. Time-resolved infrared spectroscopy of the lowest triplet state of thymine and thymidine

    NASA Astrophysics Data System (ADS)

    Hare, Patrick M.; Middleton, Chris T.; Mertel, Kristin I.; Herbert, John M.; Kohler, Bern

    2008-05-01

    Vibrational spectra of the lowest energy triplet states of thymine and its 2'-deoxyribonucleoside, thymidine, are reported for the first time. Time-resolved infrared (TRIR) difference spectra were recorded over seven decades of time from 300 fs to 3 ?s using femtosecond and nanosecond pump-probe techniques. The carbonyl stretch bands in the triplet state are seen at 1603 and ˜1700 cm -1 in room-temperature acetonitrile- d3 solution. These bands and additional ones observed between 1300 and 1450 cm -1 are quenched by dissolved oxygen on a nanosecond time scale. Density-functional calculations accurately predict the difference spectrum between triplet and singlet IR absorption cross sections, confirming the peak assignments and elucidating the nature of the vibrational modes. In the triplet state, the C4 dbnd O carbonyl exhibits substantial single-bond character, explaining the large (˜70 cm -1) red shift in this vibration, relative to the singlet ground state. Femtosecond TRIR measurements unambiguously demonstrate that the triplet state is fully formed within the first 10 ps after excitation, ruling out a relaxed 1n? ? state as the triplet precursor.

  8. Time-Resolved HST Spectroscopy of Four Eclipsing Magnetic Cataclysmic Variables

    E-print Network

    Gary D. Schmidt; H. S. Stockman

    2000-10-01

    Time-resolved HST UV eclipse spectrophotometry is presented for the magnetic CVs V1309 Ori, MN Hya, V2301 Oph, and V1432 Aql. Separation of the light curves into wavebands allows the multiple emission components to be distinguished. Photospheric hot spots are detected in V1309 Ori and V2301 Oph. The emission- line spectra of V1309 Ori and MN Hya are unusual, with the strength of N V 1240 and N IV 1718 suggesting an overabundance of nitrogen. Three epochs of observation of the asynchronous V1432 Aql cover ~1/3 of a 50-day lap cycle between the white dwarf spin and binary orbit. The light curves vary from epoch to epoch and as a function of waveband. The dereddened UV spectrum is extremely bright and the spectral energy distribution coupled with the duration of eclipse ingress indicate that the dominant source of energy is a hot (T~35,000K) white dwarf. Undiminished line emission through eclipse indicates that the eclipse is caused by the accretion stream, not the secondary star. The hot white dwarf, combined with its current asynchronous nature and rapid timescale for relocking, suggests that V1432 Aql underwent a nova eruption in the past 75-150 yr. The reversed sense of asynchronism, with the primary star currently spinning up toward synchronism, is not necessarily at odds with this scenario, if the rotation of the magnetic white dwarf can couple to the ejecta during the wind phase of the eruption.

  9. JOURNALDE PHYSIQUE Colloque C1, supplkment au n o2, Tome 40,fkvrier 1979,page (21-63 TIME-RESOLVED LASER SATURATION SPECTROSCOPY

    E-print Network

    Paris-Sud XI, Université de

    -RESOLVED LASER SATURATION SPECTROSCOPY M. DUCLOY Laboratoire de Physique des Lasers, Associd au C rbsolu. On montre que cette technique combinant spectroscopies laser r6solues en temps et en frdquence sources, time- resolved spectroscopy has become a very useful tool for exploring laser interaction

  10. Calculating singlet excited states: Comparison with fast time-resolved infrared spectroscopy of coumarins.

    PubMed

    Hanson-Heine, Magnus W D; Wriglesworth, Alisdair; Uroos, Maliha; Calladine, James A; Murphy, Thomas S; Hamilton, Michelle; Clark, Ian P; Towrie, Michael; Dowden, James; Besley, Nicholas A; George, Michael W

    2015-04-21

    In contrast to the ground state, the calculation of the infrared (IR) spectroscopy of molecular singlet excited states represents a substantial challenge. Here, we use the structural IR fingerprint of the singlet excited states of a range of coumarin dyes to assess the accuracy of density functional theory based methods for the calculation of excited state IR spectroscopy. It is shown that excited state Kohn-Sham density functional theory provides a high level of accuracy and represents an alternative approach to time-dependent density functional theory for simulating the IR spectroscopy of singlet excited states. PMID:25903878

  11. Calculating singlet excited states: Comparison with fast time-resolved infrared spectroscopy of coumarins

    NASA Astrophysics Data System (ADS)

    Hanson-Heine, Magnus W. D.; Wriglesworth, Alisdair; Uroos, Maliha; Calladine, James A.; Murphy, Thomas S.; Hamilton, Michelle; Clark, Ian P.; Towrie, Michael; Dowden, James; Besley, Nicholas A.; George, Michael W.

    2015-04-01

    In contrast to the ground state, the calculation of the infrared (IR) spectroscopy of molecular singlet excited states represents a substantial challenge. Here, we use the structural IR fingerprint of the singlet excited states of a range of coumarin dyes to assess the accuracy of density functional theory based methods for the calculation of excited state IR spectroscopy. It is shown that excited state Kohn-Sham density functional theory provides a high level of accuracy and represents an alternative approach to time-dependent density functional theory for simulating the IR spectroscopy of singlet excited states.

  12. Developments in time-resolved ultrafast imaging and spectroscopy at terahertz frequencies

    E-print Network

    Teo, Stephanie M

    2014-01-01

    Prior to the advent of high energy pulsed femtosecond lasers, the field of terahertz (THz) spectroscopy was stagnated by the lack of both high power THz sources and sensitive THz detectors. Over the past few years, it has ...

  13. Time-resolved spectroscopy and photometry of the dwarf nova FS Aurigae in quiescence

    E-print Network

    V. V. Neustroev

    2001-10-26

    We present results of non-simultaneous time-resolved photometric and spectroscopic observations of the little-studied dwarf nova FS Aur in quiescence. The spectrum of FS Aur shows strong and broad emission lines of hydrogen and HeI, and of weaker HeII 4686 and CIII/NIII blend, similar to other quiescent dwarf novae. All emission lines are single-peaked, however their form varies with orbital phase. Absorption lines from a late-type secondary are not detected. From the radial velocity measurements of the hydrogen lines H$_\\beta$ and H$_\\gamma$ we determined a most probable orbital period P=0.059+-0.002. This period agrees well with the 0.0595+-0.0001 estimate by Thorstensen et al. (1996). On the other hand, the period of photometric modulations is longer than the spectroscopic period and can be estimated as 3 hours. Longer time coverage during a single night is needed to resolve this problem. Using the semi-amplitude of the radial velocities, obtained from measurements of hydrogen and helium lines, and some empirical and theoretical relations we limited the basic parameters of the system: a mass ratio q>=0.22, a primary mass M_1=0.34 - 0.46 M_sun, a secondary mass M_2<= 0.1M_sun, and an inclination angle i=51^{\\circ} - 65^{\\circ}. Doppler tomography has shown at least two bright regions in the accretion disk of FS Aur. The first, brighter spot is located at phase about 0.6. The second spot is located opposite the first one and occupies an extensive area at phases about 0.85 - 1.15.

  14. Infrared Absorption of CH3SONO Detected with Time-Resolved Fourier-Transform Spectroscopy

    NASA Astrophysics Data System (ADS)

    Lee, Yuan-Pern; Chen, Jin-Dah

    2011-06-01

    A step-scan Fourier-transform spectrometer coupled with a 6.4-m multipass absorption cell was employed to detect time-resolved infrared absorption spectra of reaction intermediates produced upon UV irradiation of a flowing mixture of CH3SSCH3 and NO2 in CO2. Irradiation of CH3SSCH3 at 248 nm produces CH3S radicals that subsequently react with NO2. Under a total pressure of 100 Torr, we observed bands near 1560 Cm-1, assignable to mainly the N=O stretching mode of CH3SONO, with a small contribution from CH3SNO2. Calculations with density-functional theory (B3LYP/aug-cc-pVTZ and B3P86/aug-cc-pVTZ) predicted the geometry, vibrational wavenumbers, and rotational parameters of CH3SONO and CH3SNO2. Based on these predicted rotational parameters, the simulated absorption band agrees satisfactorily with experimental results. Under a total pressure of 16 Torr, bands near 1560 and 1260 Cm-1 are assigned to NO2 asymmetric and symmetric stretching modes of CH3SNO2, respectively; the former is overlapped with the N=O stretching mode of CH3SONO. An additional band near 1070 Cm-1 is assigned to the S=O stretching mode of CH3SO, reported previously as a secondary product in the reaction of CH3S + O2. Reaction of CH3S + NO2 at high pressure clearly yields CH3SONO, rather than CH3SNO2, as a major product. L.-K. Chu and Y.-P. Lee, J. Chem. Phys. 133, 184303 (2010).

  15. Time-resolved photocurrent spectroscopy of optically excited superlattices and the prospects for Bloch gain

    NASA Astrophysics Data System (ADS)

    Lisauskas, A.; Demarina, N. V.; Blöser, C.; Sachs, R.; Juozapavi?ius, A.; Valušis, G.; Köhler, K.; Roskos, H. G.

    2006-02-01

    We report on experiment and theory of the evolution of the electric field in undoped GaAs/AlGaAs semiconductor superlattices subjected to femtosecond optical excitation. We performed time-resolved pump-probe experiments and measured the photocurrent generated by spectrally narrowed and wavelength-tuned probe pulses as a function of delay time, pump power and bias field. The drift of the charge carriers, subsequent to the optical excitation, leads to the buildup of an inhomogeneity of the electric field which was traced via the temporal changes of the Wannier-Stark spectra. Although the photocurrent spectra by themselves only yield information on the absorption integrated spatially over the superlattice, we extract information on the local electric fields and the charge-carrier densities by a comparison of the measured data with the results of Monte-Carlo simulations. We find that at moderate excitation densities (10 16-cm -3 range) the superlattice within a few picoseconds splits into two moving field regions, one with strong field gradient and low electron density, the other with partially screened field at low gradient and high electron density. The largest field differences are found just when the last electrons are swept out after 10-30 ps, the exact time depending on the superlattice parameters and excitation conditions. The initial homogeneous field is restored on a much longer time scale of hundreds of picoseconds which is defined basically by the drift of the heavy holes. Our calculations show that Bloch gain in optically excited semiconductor superlattice is expected in spite of the inhomogeneous field if the field in the electron-rich region is not heavily screened. The time window during which Bloch gain exists is determined by the sweep-out of the electrons.

  16. TIME-RESOLVED SPECTROSCOPY OF THE POLAR EU CANCRI IN THE OPEN CLUSTER MESSIER 67

    SciTech Connect

    Williams, Kurtis A. [Department of Physics and Astronomy, Texas A and M University-Commerce, P.O. Box 3011, Commerce, TX 75429 (United States); Howell, Steve B. [NASA Ames Research Center, P.O. Box 1, M/S 244-30, Moffett Field, CA 94035 (United States); Liebert, James; Smith, Paul S. [Steward Observatory, University of Arizona, Tucson, AZ (United States); Bellini, Andrea [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Rubin, Kate H. R. [Max-Planck-Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany); Bolte, Michael, E-mail: kurtis.williams@tamuc.edu, E-mail: steve.b.howell@nasa.gov, E-mail: jamesliebert@gmail.com, E-mail: psmith@as.arizona.edu, E-mail: bellini@stsci.edu, E-mail: rubin@mpia.de, E-mail: bolte@ucolick.org [UCO/Lick Observatory, University of California, 1156 High St., Santa Cruz, CA 95064 (United States)

    2013-05-15

    We present time-resolved spectroscopic and polarimetric observations of the AM Her system EU Cnc. EU Cnc is located near the core of the old open cluster Messier 67; new proper motion measurements indicate that EU Cnc is indeed a member of the star cluster, and this system therefore is useful to constrain the formation and evolution of magnetic cataclysmic variables. The spectra exhibit two-component emission features with independent radial velocity variations as well as time-variable cyclotron emission indicating a magnetic field strength of 41 MG. The period of the radial velocity and cyclotron hump variations are consistent with the previously known photometric period, and the spectroscopic flux variations are consistent in amplitude with previous photometric amplitude measurements. The secondary star is also detected in the spectrum. We also present polarimetric imaging measurements of EU Cnc that show a clear detection of polarization, and the degree of polarization drops below our detection threshold at phases when the cyclotron emission features are fading or not evident. The combined data are all consistent with the interpretation that EU Cnc is a low-state polar in the cluster Messier 67. The mass function of the system gives an estimate of the accretor mass of M{sub WD} {>=} 0.68 M{sub Sun} with M{sub WD} Almost-Equal-To 0.83 M{sub Sun} for an average inclination. We are thus able to place a lower limit on the progenitor mass of the accreting white dwarf of {>=}1.43 M{sub Sun }.

  17. Time-resolved Fourier transform infrared spectroscopy of chemical reactions in solution using a focal plane array detector.

    PubMed

    Kaun, N; Vellekoop, M J; Lendl, B

    2006-11-01

    A Fourier transform infrared (FT-IR) microscope equipped with a single as well as a 64 x 64 element focal plane array MCT detector was used to measure chemical reaction taking place in a microstructured flow cell designed for time-resolved FT-IR spectroscopy. The flow cell allows transmission measurements through aqueous solutions and incorporates a microstructured mixing unit. This unit achieves lamination of the two input streams with a cross-section of 300 x 5 microm each, resulting in fast diffusion-controlled mixing of the two input streams. Microscopic measurement at defined positions along the outlet channel allows time-resolved information of the reaction taking place in the flow cell to be obtained. In this paper we show experimental results on the model reaction between formaldehyde and sulfite. Using the single-point MCT detector, high-quality FT-IR spectra could be obtained from a spot size of 80 x 200 microm whereas the FPA detector allowed recording light from an area of 260 x 260 microm focused on its 64 x 64 detector elements. Therefore, more closely spaced features could be discerned at the expense of a significantly lower signal-to-noise (S/N) ratio per spectrum. Multivariate curve resolution-alternating least squares was used to extract concentration profiles of the reacting species along the outlet channel axis. PMID:17132444

  18. The H + OCS hot atom reaction - CO state distributions and translational energy from time-resolved infrared absorption spectroscopy

    NASA Technical Reports Server (NTRS)

    Nickolaisen, Scott L.; Cartland, Harry E.

    1993-01-01

    Time-resolved infrared diode laser spectroscopy has been used to probe CO internal and translational excitation from the reaction of hot H atoms with OCS. Product distributions should be strongly biased toward the maximum 1.4 eV collision energy obtained from 278 nm pulsed photolysis of HI. Rotations and vibrations are both colder than predicted by statistical density of states theory, as evidenced by large positive surprisal parameters. The bias against rotation is stronger than that against vibration, with measurable population as high as v = 4. The average CO internal excitation is 1920/cm, accounting for only 13 percent of the available energy. Of the energy balance, time-resolved sub-Doppler line shape measurements show that more than 38 percent appears as relative translation of the separating CO and SH fragments. Studies of the relaxation kinetics indicate that some rotational energy transfer occurs on the time scale of our measurements, but the distributions do not relax sufficiently to alter our conclusions. Vibrational distributions are nascent, though vibrational relaxation of excited CO is unusually fast in the OCS bath, with rates approaching 3 percent of gas kinetic for v = 1.

  19. Retrieval procedure for time-resolved near-infrared tissue spectroscopy based on the optimal estimation method.

    PubMed

    Martelli, Fabrizio; Del Bianco, Samuele; Zaccanti, Giovanni

    2012-05-21

    We propose the use of a retrieval procedure for time-resolved near-infrared tissue spectroscopy based on the 'optimal estimation' method. The aim of this retrieval method is to obtain an improved estimate of the target parameters compared with standard nonlinear least-squares routines, since the inverse problem dedicated to retrieve the optical properties of tissue is ill posed. A priori information on target and forward model parameters is used, so that a larger number of target parameters can be retrieved, and/or a better accuracy and precision can be achieved on the retrieved target parameters. The procedure has been tested on time-resolved simulated experiments generated, using solutions of the diffusion equation and with solutions of the radiative transfer equation reconstructed with Monte Carlo simulations. The results obtained show that, by using a priori information on target parameters, we have a smaller difference between retrieved values and true values, and lower retrieved error bars. Similarly, a more correct estimate of the errors of the forward model parameters improves the retrieval of the target parameters. PMID:22516916

  20. Time-Resolved Laser-Induced Fluorescence Measurements of the Ion Velocity Distribution in the H6 Hall Thruster Plume

    NASA Astrophysics Data System (ADS)

    Durot, Christopher; Gallimore, Alec

    2013-10-01

    We developed a technique to recover time-resolved laser-induced fluorescence signals from strong background emission in plasma sources that have a relatively constant spectrum of oscillations in steady-state operation but are not periodically pulsed, such as Hall thrusters. The system was previously validated using a hollow cathode plasma source with forced discharge current oscillations. We present the first results using the new technique to capture oscillations in a Hall thruster. The ion velocity distribution function in the plume of the H6 Hall thruster is interrogated during breathing mode oscillations, which are characterized by an oscillating depletion and replenishment of neutrals at a frequency of 10-25 kHz. We use laser modulation on the order of megahertz, well above the time scale of interest (about 0.1 ms). A combination of band-pass filtering, phase-sensitive detection (with a time constant on the order of microseconds), and averaging over transfer functions is used to recover the signal. This technique has advantages such as a shorter dwell time than other techniques and the lack of a need for triggering averaging in the time domain. The ultimate bandwidth of the system that we implemented is approximately 1 MHz, limited by the speed of the AOM and signal photon rate collected. We developed a technique to recover time-resolved laser-induced fluorescence signals from strong background emission in plasma sources that have a relatively constant spectrum of oscillations in steady-state operation but are not periodically pulsed, such as Hall thrusters. The system was previously validated using a hollow cathode plasma source with forced discharge current oscillations. We present the first results using the new technique to capture oscillations in a Hall thruster. The ion velocity distribution function in the plume of the H6 Hall thruster is interrogated during breathing mode oscillations, which are characterized by an oscillating depletion and replenishment of neutrals at a frequency of 10-25 kHz. We use laser modulation on the order of megahertz, well above the time scale of interest (about 0.1 ms). A combination of band-pass filtering, phase-sensitive detection (with a time constant on the order of microseconds), and averaging over transfer functions is used to recover the signal. This technique has advantages such as a shorter dwell time than other techniques and the lack of a need for triggering averaging in the time domain. The ultimate bandwidth of the system that we implemented is approximately 1 MHz, limited by the speed of the AOM and signal photon rate collected. This work was supported by AFOSR and AFRL through the MACEEP center of excellence grant number FA9550-09-1-0695.

  1. Time-resolved infrared fluorescence studies of the collisional deactivation of CO 2(00 01) by large polyatomic molecules

    NASA Astrophysics Data System (ADS)

    Poel, Kathleen L.; Alwahabi, Zeyad T.; King, Keith D.

    1995-12-01

    The time-resolved infrared fluorescence (IRF) technique has been used to study the vibrational deactivation of CO 2(00 01) by large polyatomic molecules at ambient temperature (295 ± 2 K).The excited CO 2 molecules were prepared by direct pumping with the P(21) line of a pulsed CO 2 laser at 10.6 ?m. The bimolecular rate constant for deactivation by CO 2 was determined to be (0.353 ± 0.026) × 10 3 Torr -1 s -1, in excellent agreement with previous work. The rate constants for deactivation by the large polyatomic molecules, c-C 6H 10, c-C 6H 12, C 6H 6, C 6D 6, C 7H 8, C 7D 8, C 6H 5 F, p-C 6H 4F 2, C 6HF 5 and C 6F 6, were found to be (143 ± 18), (150 ± 12), (120 ± 4), (238 ± 9), (140 ± 5), (234 ± 15), (121 ± 7), (132 ± 23), (132 ± 12), and (94 ± 5) × 10 3 Torr -1 s -1, respectively. Experimental deactivation probabilities and average energies removed per collision are calculated and compared. There is little difference in deactivation probabilities between the acyclic ring compounds and their aromatic analogues but the perfluorinated compound, C 6F 6 is clearly less efficient than its hydrocarbon analogue, C 6H 6. The perdeuterated species, C 6D 6 and C 7D 8 show considerably enhanced deactivation relative to the other species, probably as a result of near-resonant intermolecular V-V energy transfer.

  2. Quantifying surface coverage of colloidal silica by a cationic peptide using a combined centrifugation/time-resolved fluorescence anisotropy approach.

    PubMed

    Tleugabulova, Dina; Brennan, John D

    2006-02-14

    Recent experimental studies have shown that time-resolved fluorescence anisotropy (TRFA) is a promising methodology for in situ characterization of the surface modification of aqueous silica nanocolloids. Here we provide a more fundamental insight into the principle of this approach and discuss how the adsorption parameters for a cationic peptide, Lys-Trp-Lys (denoted using the standard shortform KWK), onto Ludox nanoparticles (NPs) are linked to the rotational dynamics of rhodamine 6G (R6G) dispersed in the KWK/Ludox mixture. First, the adsorption isotherm of KWK on hydrophilic controlled pore glass (CPG-3000) was obtained using the traditional centrifugation method, which provides the total molar amount of KWK per unit surface area of the silica. Assuming that both CPG and Ludox particles possess identical surface properties when suspended in the same aqueous buffer, both materials should also have identical adsorption properties. Thus, the adsorbed amount of KWK per unit area at a given total KWK concentration, as determined by the centrifugation method, can be plotted against the fractions of R6G anisotropy decay components at the same KWK concentration to relate the anisotropy components to the absolute surface coverage. Using this approach, it was determined that the concentration of KWK at which the CPG surface was saturated corresponded to the condition g = 0 in the R6G decay, where g is the fraction of the nondecaying anisotropy component. This condition means that there is no R6G bound to the fraction of Ludox NPs with a radius R > 2.5 nm at maximum KWK coverage, consistent with the adsorbed peptide forming a continuous layer on the Ludox surface. Hence, the g value obtained from TRFA analysis can be used to assess the absolute surface coverage of monolayer coatings on colloidal nanoparticles. PMID:16460117

  3. Time resolved diagnostics in CF4 / H2 plasmas by electron attachment mass spectrometry and optical emission spectroscopy.

    NASA Astrophysics Data System (ADS)

    Wagner, Hans-Erich; Meichsner, Juergen; Kroutilina, Valja; Lerch, Rene

    2000-10-01

    In the case of a parallel plate symmetrical 50 kHz low pressure discharge in CF4 - H2 mixtures (discharge current 10 - 40 mA, total pressure 10 - 30 Pa , hydrogen admixture 0 - 80 %, closed system) the main stable products (e.g. F_2, CF_4, C_2F_6, C_3F_8) of plasma chemical reactions have been time resolved investigated by the electron attachment mass spectrometry (EAMS), investigating them according their resonant electron attachment cross sections. The EAMS was realised by means of a HAL EQP 300 Hiden Analytical system, extended by the (-) RGA mode. The plasma chemical reaction kinetics is characterised by the time dependent consumption of molecular hydrogen and the production of higher molecular fluorocarbons. These measurements were completed by optical emission spectroscopy of electronic excited species (e.g. atomic fluorine, molecular hydrogen).

  4. Determination of s-d exchange coupling in GaMnN by time-resolved Kerr rotation spectroscopy

    NASA Astrophysics Data System (ADS)

    Hsu, Wei-Ting; Hsieh, Ting-Yen; Chen, Hsin-Feng; Huang, Feng-Wen; Chen, Po-Cheng; Sheu, Jinn-Kong; Chang, Wen-Hao

    2014-09-01

    Coherent electron-spin dynamics in Ga1-xMnxN has been investigated by time-resolved Kerr rotation spectroscopy. The effective electron g factor shows a linear increase with the Mn concentration due to the s-d exchange coupling between the conduction electrons and the d-shell electrons of Mn3+ impurities. The magnitude and sign of the s-d exchange constant are determined precisely to be N0? =+0.23±0.02eV, indicative of a ferromagnetic s-d exchange coupling in GaMnN. The determined N0? is consistent with the typical value found in most diluted magnetic semiconductors and reveals that GaMnN is indeed not an exception.

  5. Time-resolved dielectric spectroscopy of protein aggregation performed on model system of hen lysozyme and beta-lactoglobulin

    NASA Astrophysics Data System (ADS)

    Mazzeo, Brian; Flewitt, Andrew

    2009-03-01

    Time-resolved dielectric spectroscopy measurements of solutions containing hen lysozyme and beta-lactoglobulin reveal changes in electrical configuration and hydrodynamic parameters during their interaction. These measurements were performed in a temperature-controlled dielectric cell connected to an HP4194A impedance analyzer. The protein titrations were performed by sequential additions of reacting proteins. Differential spectra reveal the electrical contributions by each species. The computer-controlled measurements and relevant post-processing of the obtained spectra allow quantitative extraction of reaction parameters. This is demonstrated for a model system of proteins consisting of hen lysozyme and beta-lactoglobulin. Reorientation time constants, dielectric increments, and relaxation spread parameters are plotted against time and indicate binding processes. The technique is demonstrated to be a useful analytical tool for monitoring reactions in biological and colloidal systems.

  6. Photoluminescence and time-resolved spectroscopy in multiferroic BiFeO3: Effects of electric fields and sample aging

    NASA Astrophysics Data System (ADS)

    Anshul, Avneesh; Kumar, Ashok; Gupta, Bipin K.; Kotnala, R. K.; Scott, J. F.; Katiyar, R. S.

    2013-06-01

    We report photoluminescence and time-resolved spectroscopy in bismuth ferrite excited with a 325 nm source. The direct-bandgap recombinations near 2.55 eV and indirect-bandgap transitions near 2.67 eV are presented as functions of applied in-plane electric field with recombination time in the microsecond regime. The applied field moves some conduction electrons away from the Brillouin zone center, increasing significantly the intensity of indirect-gap recombination. An aging phenomenon is manifest in specimens stored for more than twelve months under ambient conditions. Effect of external magnetic field on the surface phase transition is negligible up to H = 0.5 T.

  7. Structural changes in bacteriorhodopsin during the photocycle measured by time-resolved polarized Fourier transform infrared spectroscopy.

    PubMed Central

    Kelemen, L; Ormos, P

    2001-01-01

    The structural changes in bacteriorhodopsin during the photocycle are investigated. Time resolved polarized infrared spectroscopy in combination with photoselection is used to determine the orientation and motion of certain structural units of the molecule: Asp-85, Asp-96, Asp-115, the Schiff base, and several amide I vibrations. The results are compared with recently published x-ray diffraction data with atomic resolution about conformational motions during the photocycle. The orientation of the measured vibrations are also calculated from the structure data, and based on the comparison of the values from the two techniques new information is obtained: several amide I bands in the infrared spectrum are assigned, and we can also identify the position of the proton in the protonated Asp residues. PMID:11721018

  8. Local structure of reaction intermediates probed by time-resolved x-ray absorption near edge structure spectroscopy

    SciTech Connect

    Smolentsev, G.; Soldatov, A. V. [Center for Nanoscale Structure of Matter and Faculty of Physics, Southern Federal University, Rostov-on-Don 344090 (Russian Federation); Guilera, G. [ALBA Synchrotron, Barcelona 08193 (Spain); Tromp, M. [University of Southampton, Southampton SO17 1BJ (United Kingdom); Pascarelli, S. [European Synchrotron Radiation Facility, Grenoble 38000 (France)

    2009-05-07

    A method for the analysis of time-resolved x-ray absorption near edge structure (XANES) spectra is proposed. It combines principal component analysis of the series of experimental spectra, multidimensional interpolation of theoretical XANES as a function of structural parameters, and ab initio XANES calculations. It allows to determine the values of structural parameters for intermediates of chemical reactions and the concentrations of different states as a function of time. This approach is tested using numerically generated data and its possibilities and limitations are discussed. The application of this method to a reaction with methylrhenium trioxide catalyst in solution, for which experimental data were measured using stopped-flow energy-dispersive x-ray absorption spectroscopy technique, is demonstrated. Possibilities and limitations of this experimental technique are also discussed.

  9. Dissociation dynamics of CH3I in electric spark induced breakdown revealed by time-resolved laser induced breakdown spectroscopy

    NASA Astrophysics Data System (ADS)

    Wang, Yang; Liu, Wei-long; Song, Yun-fei; Duo, Li-ping; Liu, Yu-qiang; Yang, Yan-qiang

    2015-02-01

    The electric discharge spark dissociation of gas CH3I is found to be similar to its femtosecond laser photodissociation. The almost identical spectra of the two processes show that their initial ionization conditions are very similar. The initial ionization followed by molecular fragmentation is proposed as the dissociation mechanism, in which the characteristic emissions of I+, CH3, CH2, CH, H, and I2 are identified as the dissociation products. The emission band of 505 nm I2 is clearly observed in the time-resolved laser induced breakdown spectroscopy (LIBS). The dynamic curve indicates that I2? molecules are formed after the delay time of ?4.7 ns. The formation of I2? molecule results from the bimolecular collision of the highly excited iodine atom I?(4P) and CH3I molecule. This dynamical information can help understand the process of electric discharge spark dissociation of CH3I.

  10. In situ time-resolved X-ray near-edge absorption spectroscopy of selenite reduction by siderite.

    PubMed

    Badaut, V; Schlegel, M L; Descostes, M; Moutiers, G

    2012-10-01

    The reduction-oxidation reaction between aqueous selenite (SeO(3)(2-)) and siderite (FeCO(3(s))) was monitored by in situ, time-resolved X-ray absorption near-edge structure (XANES) spectroscopy at the selenium K edge in a controlled electrochemical environment. Spectral evolutions showed that more than 60% of selenite was reduced at the siderite surface after 20 h of experiment, at which time the reaction was still incomplete. Fitting of XANES spectra by linear combination of reference spectra showed that selenite reaction with siderite is essentially a two-step process, selenite ions being immobilized on siderite surface prior to their reduction. A kinetic model of the reduction step is proposed, allowing to identify the specific contribution of surface reduction. These results have strong implications for the retention of selenite by corrosion products in nuclear waste repositories and in a larger extent for the fate of selenium in the environment. PMID:22954023

  11. Time-resolved wavelength modulation spectroscopy measurements of HO 2 kinetics

    Microsoft Academic Search

    Craig A. Taatjes; Daniel B. Oh

    1997-01-01

    High-frequency wavelength modulation spectroscopy (WMS) has been applied to the detection of the hydroperoxyl radical (HO 2 ) in a laser photolysis and long-path absorption pump-probe kinetics reactor with a near-infrared distributed feedback diode laser. The HO 2 is formed by the 355-nm photolysis of Cl 2 in the presence of CH 3 OH and O 2 and monitored by

  12. Fiber-based cryogenic and time-resolved spectroscopy of PbS quantum dots

    E-print Network

    Matthew T. Rakher; Ranojoy Bose; Chee Wei Wong; Kartik Srinivasan

    2010-12-01

    PbS quantum dots are promising active emitters for use with high-quality Si nanophotonic devices in the telecommunications-band. Measurements of low quantum dot densities are limited both because of low fluorescence levels and the challenges of single photon detection at these wavelengths. Here, we report on methods using a fiber taper waveguide to efficiently extract PbS quantum dot photoluminescence. Temperature dependent ensemble measurements reveal an increase in emitted photons concomitant with an increase in excited-state lifetime from 58.9 ns at 293 K to 657 ns at 40 K. Measurements are also performed on quantum dots on high-$Q$ ($>10^5$) microdisks using cavity-resonant, pulsed excitation.

  13. Picosecond time-resolved fluorescence studies on excitation energy transfer in a histidine 117 mutant of the D2 protein of photosystem II in Synechocystis 6803.

    PubMed

    Vasil'ev, S; Bruce, D

    2000-11-21

    The role of the peripheral reaction center chlorophyll a molecule associated with His117 of the D2 polypeptide in photosystem II was investigated in Synechocystis sp. PCC 6803 using a combination of steady state, pump-probe, and picosecond time-resolved fluorescence spectroscopy. Data were obtained from intact cells and isolated thylakoid membranes of a control mutant and a D2-H117T mutant, both of which lacked photosystem I. Excitation energy transfer and trapping were investigated by analyzing the data with a kinetic model that used an exact numerical solution of the Pauli master equation, taking into account available photosystem II spectral and structural information. The results of our kinetic analysis revealed the observed difference in excited-state dynamics between the H117T mutant and the control to be consistent with a retardation of the rate of excitation energy transfer from the peripheral chlorophyll of D2 (Chl at His117) to the electron-transfer pigments and an increase of the rate constant for charge recombination in the H117T mutant. The kinetic model was able to account for the experimentally observed changes in absorption cross section and fluorescence decay kinetics between the control and mutant by invoking changes in only these two rate constants. The results rule out quenching of excitation by a chlorophyll cation radical as a mechanism responsible for the lower efficiency of excitation energy utilization in the H117T mutant. Our work also demonstrates the importance of the chlorophyll associated with His117 of the D2 protein for excitation energy transfer to the PSII electron-transfer pigments and for the effective stabilization of the primary radical pair. PMID:11087370

  14. Nanosecond fluorescence spectroscopy

    SciTech Connect

    Leskovar, B.

    1985-03-01

    This article is a summary of a short course lecture given in conjunction with the 1984 Nuclear Science Symposium. Measuring systems for nanosecond fluorescence spectroscopy using single-photon counting techniques are presented. These involve systems based on relaxation-type spark gap light pulser and synchronously pumped mode-locked dye lasers. Furthermore, typical characteristics and optimization of operating conditions of the critical components responsible for the system time resolution are discussed. A short comparison of the most important deconvolution methods for numerical analysis of experimental data is given particularly with respect to the signal-to-noise ratio of the fluorescence signal. 22 refs., 8 figs.

  15. Effect of dynamical spectral weight redistribution on effective interactions in time-resolved spectroscopy

    NASA Astrophysics Data System (ADS)

    Kemper, A. F.; Sentef, M. A.; Moritz, B.; Freericks, J. K.; Devereaux, T. P.

    2014-08-01

    The redistribution of electrons in an ultrafast pump-probe experiment causes significant changes to the spectral distribution of the retarded interaction between electrons and bosonic modes. We study the influence of these changes on pump-probe photoemission spectroscopy for a model electron-phonon coupled system using the nonequilibrium Keldysh formalism. We show that spectral rearrangement due to the driving field preserves an overall sum rule for the electronic self-energy, but modifies the effective electron-phonon scattering as a function of energy. Experimentally, this pump-modified scattering can be tracked by analyzing the fluence or excitation energy dependence of population decay rates and transient changes in dispersion kinks.

  16. Nanosecond time-resolved microscopic spectroscopy for diagnostics of an atmospheric-pressure discharge plasma formed in aqueous solution

    NASA Astrophysics Data System (ADS)

    Banno, Motohiro; Kanno, Kenta; Someya, Yuu; Yui, Hiroharu

    2015-06-01

    Glow discharge plasma formed in solution under atmospheric pressure has been expected to provide reaction fields with characteristic physical and chemical properties owing to the frequent collisions and reactions of reactive particles inside and the rapid quenching of the products by the surrounding cold solutions. In particular, when an aqueous solution is utilized as the surrounding solution, the atmospheric-pressure in-solution glow (ASG) plasma contains hydrogen and hydroxyl radicals showing large activities for reduction and oxidation, respectively. In addition, because the ASG plasma is formed under atmospheric pressure, the collision frequencies between the particles contained in the plasma are higher than those in other plasmas ordinarily formed under low pressure. This feature should result in rapid energy redistribution among particles contained in the plasma. In the present study, time-resolved optical emission spectroscopy with nanosecond time resolution was applied for the diagnostics of the ASG plasma with chemical species selectivity. The time-resolved measurements revealed that the temporal evolutions of the temperatures of blackbody, hydrogen radical, and hydroxyl radical contained in the ASG plasma consist of two stages: initial rise within 0.15 µs (rising stage) and fluctuation around certain values for about 1 µs (fluctuating stage). In the time region corresponding to the rising stage, the electron number density is about ten times larger than the value temporally averaged during the plasma emission. The initial rise should result from frequent collisions between charged particles accelerated by the applied voltage and unexcited particles. In the fluctuating stage, the electron number density strongly correlates with the increase in the radical temperatures. It is concluded that the electron number density, rather than the electron temperature, is a key parameter determining the temperatures of reactive species in the ASG plasma.

  17. Structural dynamics of membrane proteins - time-resolved and surface-enhanced IR spectroscopy

    NASA Astrophysics Data System (ADS)

    Heberle, Joachim

    2013-03-01

    Membrane proteins are the target of more than 50% of all drugs and are encoded by about 30% of the human genome. Electrophysiological techniques, like patch-clamp, unravelled many functional aspects of membrane proteins but suffer from structural sensitivity. We have developed Surface Enhanced Infrared Difference Absorption Spectroscopy (SEIDAS) to probe potential-induced structural changes of a protein on the level of a monolayer. A novel concept is introduced to incorporate membrane proteins into solid supported lipid bilayers in an orientated manner via the affinity of the His-tag to the Ni-NTA terminated gold surface. General applicability of the methodological approach is shown by tethering photosystem II to the gold surface. In conjunction with hydrogenase, the basis is set towards a biomimetic system for hydrogen production. Recently, we succeeded to record IR difference spectra of a monolayer of sensory rhodopsin II under voltage-clamp conditions. This approach opens an avenue towards mechanistic studies of voltage-gated ion channels with unprecedented structural and temporal sensitivity. Initial vibrational studies on the novel light-gated channelrhodopsin-2 (ChR2) will be presented. ChR2 represents a versatile tool in the new field of optogenetics where physiological reactions are controlled by light.

  18. Shape-dependent exciton spin polarization studied by time-resolved magneto-optical spectroscopy

    NASA Astrophysics Data System (ADS)

    Knappenberger, Kenneth; Blumling, Daniel

    2010-03-01

    Shape-dependent exciton spin polarization of semiconducting nanoparticles will be presented. Time- and polarization-resolved magneto-photoluminescence spectroscopy is carried out at low temperature in magnetic fields up to 17.5 Tesla to investigate the extent of spin polarization in CdSe quantum dots and nanorods. One-dimensional CdSe nanorods exhibit a large degree of circular polarization when even small magnetic fields are applied. The large spin polarization achieved in 1-D nanostructures is not observed in 0-D quantum dots. The experimentally measured polarization is attributed to strong mixing of ``dark'' and ``bright'' exciton fine-structure states in 1-D nanostructures, which leads to the formation of spin-polarized excitons. The polarized emission is also confirmed by wavelength-resolved intensity-integrated and time-correlated single-photon counting measurements. The findings may have significant impacts on devices based on the nanocrystals platform, including; solar-to-electric energy conversion, spintronics and chemical lasers.

  19. Effect of sphere to rod transition on the probe microenvironment in sodium dodecyl sulphate micelles: A time resolved fluorescence anisotropy study

    Microsoft Academic Search

    Teena Goel; Manoj Kumbhakar; Tulsi Mukherjee; Haridas Pal

    2010-01-01

    The effect of different hydrotropic salts on the microenvironment at the anionic head group region of sodium dodecyl sulphate (SDS) micelle has been studied through time-resolved fluorescence anisotropy measurements of a solubilized probe, coumarin-153 (C153). The organic cations of the hydrotropic salts used in this study, i.e. aniline hydrochloride (AHC) and o-, m- and p-toluidine hydrochlorides (OTHC, MTHC and PTHC,

  20. A study of collisional quenching and radiation-trapping kinetics for Rb(5p) in the presence of methane and ethane using time-resolved fluorescence

    Microsoft Academic Search

    Nathan D. Zameroski; Wolfgang Rudolph; Gordon D. Hager; David A. Hostutler

    2009-01-01

    An experimental study using time-resolved fluorescence techniques together with theoretical simulations has been conducted and used to determine the quenching cross-sections of rubidium-methane and rubidium-ethane. Radiation trapping was significant under many of the experimental conditions (temperatures 40-130 °C and pressures 50-700 Torr) and a detailed analysis of the interplay between radiation trapping and quenching kinetics was carried out. Modifications of

  1. A study of collisional quenching and radiation-trapping kinetics for Rb(5p) in the presence of methane and ethane using time-resolved fluorescence

    Microsoft Academic Search

    Nathan D Zameroski; Wolfgang Rudolph; Gordon D Hager; David A Hostutler

    2009-01-01

    An experimental study using time-resolved fluorescence techniques together with theoretical simulations has been conducted and used to determine the quenching cross-sections of rubidium–methane and rubidium–ethane. Radiation trapping was significant under many of the experimental conditions (temperatures 40–130 °C and pressures 50–700 Torr) and a detailed analysis of the interplay between radiation trapping and quenching kinetics was carried out. Modifications of

  2. Synthesis and Characterization of Time-resolved Fluorescence Probes for Evaluation of Competitive Binding to Melanocortin Receptors

    PubMed Central

    Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E.; Elshan, N. G. R. D.; Tafreshi, Narges K.; Brabez, Nabila; Weber, Craig S.; Lynch, Ronald M.; Hruby, Victor J.; Gillies, Robert J.; Morse, David L.; Mash, Eugene A.

    2013-01-01

    Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-?-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-?-MSH exhibited Kd values of 27±3.9 nM and 4.2±0.48 nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-?-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-?-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-?-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. PMID:23890524

  3. Noninvasive observation of skeletal muscle contraction using near-infrared time-resolved reflectance and diffusing-wave spectroscopy

    NASA Astrophysics Data System (ADS)

    Belau, Markus; Ninck, Markus; Hering, Gernot; Spinelli, Lorenzo; Contini, Davide; Torricelli, Alessandro; Gisler, Thomas

    2010-09-01

    We introduce a method for noninvasively measuring muscle contraction in vivo, based on near-infrared diffusing-wave spectroscopy (DWS). The method exploits the information about time-dependent shear motions within the contracting muscle that are contained in the temporal autocorrelation function g(1)(?,t) of the multiply scattered light field measured as a function of lag time, ?, and time after stimulus, t. The analysis of g(1)(?,t) measured on the human M. biceps brachii during repetitive electrical stimulation, using optical properties measured with time-resolved reflectance spectroscopy, shows that the tissue dynamics giving rise to the speckle fluctuations can be described by a combination of diffusion and shearing. The evolution of the tissue Cauchy strain e(t) shows a strong correlation with the force, indicating that a significant part of the shear observed with DWS is due to muscle contraction. The evolution of the DWS decay time shows quantitative differences between the M. biceps brachii and the M. gastrocnemius, suggesting that DWS allows to discriminate contraction of fast- and slow-twitch muscle fibers.

  4. Time-Resolved Laser-Induced Fluorescence Measurements of Ion Velocity Distribution in the Plume of a 6 kW Hall Thruster with Unperturbed Discharge Oscillations

    NASA Astrophysics Data System (ADS)

    Durot, Christopher; Gallimore, Alec

    2014-10-01

    We present laser-induced fluorescence (LIF) measurements of the time-resolved ion velocity distribution in the plume of a 6 kW laboratory Hall thruster. To our knowledge, these are the first measurements of time-resolved ion velocity distribution on completely unperturbed Hall thruster operating conditions. To date, time-resolved LIF measurements have been made on Hall thrusters with oscillations driven or perturbed to be amenable to averaging techniques that assume a periodic oscillation. Natural Hall thruster breathing and spoke oscillations, however, are not periodic due to chaotic variations in amplitude and frequency. Although the system averages over many periods of nonperiodic oscillation, it recovers the time-resolved signal in part by assuming that a constant transfer function exists relating discharge current and LIF signal and averaging over the transfer function itself (http://dx.doi.org/10.1063/1.4856635). The assumption of a constant transfer function has been validated for a Hall thruster and the technique is now applied to a Hall thruster for the first time.

  5. Fluorescence and Raman spectroscopy.

    PubMed

    Wong Kee Song, Louis-Michel; Marcon, Norman E

    2003-04-01

    Table 2 provides a summary of selected in vivo fluorescence and Raman studies performed in BE. Although the findings from these studies appear promising, these techniques are still under development, and it is anticipated that technological refinements will further enhance their diagnostic accuracy. Ultimately, however, large-scale prospective clinical trials are required to determine their true diagnostic potential in BE and other sites. Ideally, the instrumentation of choice would be a real-time endoscopic system that combines excellent diagnostic accuracy with wide-area sampling. In this regard, fluorescence imaging is most appealing, although a variety of issues remain to be resolved, including the choice between autofluorescence versus drug-induced fluorescence and the problematic distinction between dysplastic (true positive) and confounding background metaplastic fluorescence (false positive), among others. It is also not clear whether exogenous fluorophores are necessary to achieve clinically useful sensitivity and specificity for lesion detection in BE. Point spectroscopic techniques, either fluorescence or Raman scattering, are inherently limited by the small volume of tissue (biopsy specimen size) they sample, but more detailed information can be extracted from the spectra, which may increase diagnostic accuracy. Moreover, it may be that the optimal system will be a combination of multiple optical spectroscopic or imaging techniques (multimodality approach), as suggested by Georgakoudi et al. For instance, a lesion could be detected by fluorescence imaging and its dysplastic nature characterized (graded) by Raman spectroscopy. In this era of cost containment, however, the critical challenge is to demonstrate whether an increase in diagnostic accuracy merits investment in costly technology, regardless of the technique used. PMID:12916660

  6. Two-photon resonances in femtosecond time-resolved four-wave mixing spectroscopy: {beta}-carotene

    SciTech Connect

    Namboodiri, V.; Namboodiri, M.; Flachenecker, G.; Materny, A. [Center of Functional Materials and Nanomolecular Science, Jacobs University Bremen, Campus Ring 1, 28759 Bremen (Germany)

    2010-08-07

    Femtosecond time-resolved pump-degenerate four-wave mixing (pump-DFWM) spectroscopy has been used to study the ultrafast dynamics of {beta}-carotene involving several electronic and vibrational states. An initial pump pulse, resonant with the S{sub 0}-to-S{sub 2} transition, excites the molecular system and a DFWM process, resonant with the S{sub 1}-to-S{sub n} transition, is used to probe the relaxation pathways. The transient shows a peculiar decay behavior, which is due to the contributions of resonant DFWM signal of the excited S{sub 1} state, nonresonant DFWM signal of the ground S{sub 0} state and vibrational hot S{sub 0}{sup *} state, and the two-photon resonant DFWM signal of the ground S{sub 0} state. We have used a kinetic model including all the signal contributions to successfully fit the transient. The time constants extracted are in very good agreement with the known values for {beta}-carotene. For comparison, a two-pulse pump-probe experiment was performed measuring the transient absorption at the wavelength of the DFWM experiment.

  7. Elucidating low-frequency vibrational dynamics in calcite and water with time-resolved third-harmonic generation spectroscopy.

    PubMed

    Wang, Liang; Liu, Weimin; Fang, Chong

    2015-06-24

    Low-frequency vibrations are foundational for material properties including thermal conductivity and chemical reactivity. To resolve the intrinsic molecular conformational dynamics in condensed phase, we implement time-resolved third-harmonic generation (TRTHG) spectroscopy to unravel collective skeletal motions in calcite, water, and aqueous salt solution in situ. The lifetime of three Raman-active modes in polycrystalline calcite at 155, 282 and 703 cm(-1) is found to be ca. 1.6 ps, 1.3 ps and 250 fs, respectively. The lifetime difference is due to crystallographic defects and anharmonic effects. By incorporating a home-built wire-guided liquid jet, we apply TRTHG to investigate pure water and ZnCl2 aqueous solution, revealing ultrafast dynamics of water intermolecular stretching and librational bands below 500 cm(-1) and a characteristic 280 cm(-1) vibrational mode in the ZnCl4(H2O)2(2-) complex. TRTHG proves to be a compact and versatile technique that directly uses the 800 nm fundamental laser pulse output to capture ultrafast low-frequency vibrational motion snapshots in condensed-phase materials including the omnipresent water, which provides the important time dimension to spectral characterization of molecular structure-function relationships. PMID:26062639

  8. Testing the Physical Mechanisms of Gamma-Ray Bursts with Multi-Instrument Time-Resolved Spectroscopy

    NASA Technical Reports Server (NTRS)

    Briggs, Michael S.; Preece, Robert E.

    2001-01-01

    We have continued the project of time-resolved spectral analyses of gamma-ray bursts observed jointly by the BATSE and the Wide-Field Camera on board BeppoSAX. We are making progress understanding the systematic differences between the two data sets. These data comprise the most important joint analysis set for our project. In several meetings, we have reported on metal efforts to understand the blackbody portion of the time series of spectra from GRB970111. Clearly, a fading thermal component can provide a 'seed' spectrum for Compton upscattering. It is very likely the X-ray excess that has been observed previously in BATSE data alone continues into the X-ray band observed by the WFC. We have also made progress in joint fitting of BATSE Large Area Detector and Spectroscopy Detector data with that of the Total Absorption Scintillation Calorimeter (TASC) of the EGRET experiment on CGRO. The TASC data are important to understanding the high-energy response of the BATSE data. We have produced time-sequences of spectra for two important GRB with data from both instruments. The Summer workshop on GRBs at the Aspen Center for Physics provided an opportunity for in-depth discussion of our on-going work. To aid our effort, we continue to make improvements in our spectral analysis software, RMFIT (rewritten from WINGSPAN).

  9. Time-resolved and photoluminescence spectroscopy of ?-Al?O? nanowires for promising fast optical sensor applications.

    PubMed

    Gangwar, Jitendra; Gupta, Bipin Kumar; Kumar, Pawan; Tripathi, Surya Kant; Srivastava, Avanish Kumar

    2014-12-01

    Herein, we have demonstrated the high yield facile growth of Al2O3 nanowires of uniform morphology with different polymorph phases (e.g. ?, ? and ?) via a hydrothermal method with varying calcination temperatures. The synthesized ?-Al2O3 nanowires were well characterized by XRD, FTIR, SEM/EDAX, AFM and HRTEM techniques. Microstructural analysis confirmed that the dimensions of the individual ?-Al2O3 nanowires are approximately in the ranges 5-20 nm in width and 40-150 nm in length, and the aspect ratio is up to 20. AFM results evidenced the uniform distribution of the nanowires with controlled morphology. Furthermore, UV-vis spectroscopic data reveal that the estimated optical band gap of the ?-Al2O3 nanowires was ~5.16 eV. The photoluminescence spectrum exhibits blue emission upon excitation at a wavelength of 252 nm. Time-resolved spectroscopy demonstrates that these nanowires illustrate a decay time of ~2.23 nanoseconds. The obtained photoluminescence results with a decay time of nanoseconds suggest that the ?-Al2O3 phase could be an exceptional choice for next generation fast optical sensors. PMID:25300301

  10. Femtosecond time-resolved transient absorption spectroscopy of CH3NH3PbI3 perovskite films: evidence for passivation effect of PbI2.

    PubMed

    Wang, Lili; McCleese, Christopher; Kovalsky, Anton; Zhao, Yixin; Burda, Clemens

    2014-09-01

    CH3NH3PbI3 perovskite layered films deposited on substrates with and without a titania support structure have been prepared and studied using time-resolved femtosecond transient absorption (fs-TA) spectroscopy in the visible light range (450-800 nm). The electron injection dynamics from the photoexcited perovskite layers to the neighboring film structures could be directly monitored via the transient bleaching dynamics of the perovskite at ?750 nm and thus systematically studied as a function of the layer-by-layer architecture. In addition, for the first time we could spectrally distinguish transient bleaching at ?750 nm from laser-induced fluorescence that occurs red-shifted at ?780 nm. We show that an additional bleach feature at ?510 nm appears when PbI2 is present in the perovskite film. The amplitudes of the PbI2 and perovskite TA peaks were compared to estimate relative amounts of PbI2 in the samples. Kinetic analysis reveals that perovskite films with less PbI2 show faster relaxation rates than those containing more PbI2. These fast dynamics are attributed to charge carrier trapping at perovskite grain boundaries, and the slower dynamics in samples containing PbI2 are due to a passivation effect, in line with other recently reported work. PMID:25145978

  11. Electron-hole recombination on ZnO(0001) single-crystal surface studied by time-resolved soft X-ray photoelectron spectroscopy

    SciTech Connect

    Yukawa, R.; Yamamoto, S.; Ogawa, M.; Yamamoto, Sh.; Fujikawa, K.; Hobara, R.; Matsuda, I., E-mail: imatsuda@issp.u-tokyo.ac.jp [Institute for Solid State Physics, The University of Tokyo, Kashiwa, Chiba 277-8581 (Japan); Ozawa, K. [Department of Chemistry and Materials Science, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8551 (Japan); Emori, M.; Sakama, H. [Department of Physics, Sophia University, Chiyoda-ku, Tokyo 102-8554 (Japan); Kitagawa, S.; Daimon, H. [Nara Institute of Science and Technology (NAIST), Ikoma, Nara 630-0192 (Japan)

    2014-10-13

    Time-resolved soft X-ray photoelectron spectroscopy (PES) experiments were performed with time scales from picoseconds to nanoseconds to trace relaxation of surface photovoltage on the ZnO(0001) single crystal surface in real time. The band diagram of the surface has been obtained numerically using PES data, showing a depletion layer which extends to 1??m. Temporal evolution of the photovoltage effect is well explained by a recombination process of a thermionic model, giving the photoexcited carrier lifetime of about 1 ps at the surface under the flat band condition. This lifetime agrees with a temporal range reported by the previous time-resolved optical experiments.

  12. Nonlinear spectroscopy in the near-field: time resolved spectroscopy and subwavelength resolution non-invasive imaging

    NASA Astrophysics Data System (ADS)

    Namboodiri, Mahesh; Khan, Tahirzeb; Karki, Khadga; Kazemi, Mehdi Mohammad; Bom, Sidhant; Flachenecker, Günter; Namboodiri, Vinu; Materny, Arnulf

    2014-04-01

    The combination of near-field microscopy along with nonlinear optical spectroscopic techniques is presented here. The scanning near-field imaging technique can be integrated with nonlinear spectroscopic techniques to improve spatial and axial resolution of the images. Additionally, ultrafast dynamics can be probed down to nano-scale dimension. The review shows some examples for this combination, which resulted in an exciton map and vibrational contrast images with sub-wavelength resolution. Results of two-color femtosecond time-resolved pump-probe experiments using scanning near-field optical microscopy (SNOM) on thin films of the organic semiconductor 3,4,9,10 Perylenetetracarboxylic dianhydride (PTCDA) are presented. While nonlinear Raman techniques have been used to obtain highly resolved images in combination with near-field microscopy, the use of femtosecond laser pulses in electronic resonance still constitutes a big challenge. Here, we present our first results on coherent anti-Stokes Raman scattering (fs-CARS) with femtosecond laser pulses detected in the near-field using SNOM. We demonstrate that highly spatially resolved images can be obtained from poly(3-hexylthiophene) (P3HT) nano-structures where the fs-CARS process was in resonance with the P3HT absorption and with characteristic P3HT vibrational modes without destruction of the samples. Sub-diffraction limited lateral resolution is achieved. Especially the height resolution clearly surpasses that obtained with standard microCARS. These results will be the basis for future investigations of mode-selective dynamics in the near-field.

  13. Vibrational cooling dynamics of a [FeFe]-hydrogenase mimic probed by time-resolved infrared spectroscopy.

    PubMed

    Caplins, Benjamin W; Lomont, Justin P; Nguyen, Son C; Harris, Charles B

    2014-12-11

    Picosecond time-resolved infrared spectroscopy (TRIR) was performed for the first time on a dithiolate bridged binuclear iron(I) hexacarbonyl complex ([Fe?(?-bdt)(CO)?], bdt = benzene-1,2-dithiolate) which is a structural mimic of the active site of the [FeFe]-hydrogenase enzyme. As these model active sites are increasingly being studied for their potential in photocatalytic systems for hydrogen production, understanding their excited and ground state dynamics is critical. In n-heptane, absorption of 400 nm light causes carbonyl loss with low quantum yield (<10%), while the majority (ca. 90%) of the parent complex is regenerated with biexponential kinetics (?? = 21 ps and ?? = 134 ps). In order to understand the mechanism of picosecond bleach recovery, a series of UV-pump TRIR experiments were performed in different solvents. The long time decay (??) of the transient spectra is seen to change substantially as a function of solvent, from 95 ps in THF to 262 ps in CCl?. Broadband IR-pump TRIR experiments were performed for comparison. The measured vibrational lifetimes (T?(avg)) of the carbonyl stretches were found to be in excellent correspondence to the observed ?? decays in the UV-pump experiments, signifying that vibrationally excited carbonyl stretches are responsible for the observed longtime decays. The fast spectral evolution (??) was determined to be due to vibrational cooling of low frequency modes anharmonically coupled to the carbonyl stretches that were excited after electronic internal conversion. The results show that cooling of both low and high frequency vibrational modes on the electronic ground state give rise to the observed picosecond TRIR transient spectra of this compound, without the need to invoke electronically excited states. PMID:25426927

  14. Time Resolved Spectroscopy of SGR J1550-5418 Bursts Detected with Fermi/Gamma-Ray Burst Monitor

    NASA Astrophysics Data System (ADS)

    Younes, G.; Kouveliotou, C.; van der Horst, A. J.; Baring, M. G.; Granot, J.; Watts, A. L.; Bhat, P. N.; Collazzi, A.; Gehrels, N.; Gorgone, N.; Gö?ü?, E.; Gruber, D.; Grunblatt, S.; Huppenkothen, D.; Kaneko, Y.; von Kienlin, A.; van der Klis, M.; Lin, L.; Mcenery, J.; van Putten, T.; Wijers, R. A. M. J.

    2014-04-01

    We report on a time-resolved spectroscopy of the 63 brightest bursts of SGR J1550-5418, detected with the Fermi/Gamma-ray Burst Monitor during its 2008-2009 intense bursting episode. We performed spectral analysis down to 4 ms timescales to characterize the spectral evolution of the bursts. Using a Comptonized model, we find that the peak energy, E peak, anti-correlates with flux, while the low-energy photon index remains constant at ~ - 0.8 up to a flux limit F ? 10-5 erg s-1 cm-2. Above this flux value, the E peak-flux correlation changes sign, and the index positively correlates with the flux reaching ~1 at the highest fluxes. Using a two blackbody model, we find that the areas and fluxes of the two emitting regions correlate positively. Further, we study here for the first time the evolution of the temperatures and areas as a function of flux. We find that the area-kT relation follows the lines of constant luminosity at the lowest fluxes, R 2vpropkT -4, with a break at the higher fluxes (F > 10-5.5 erg s-1 cm-2). The area of the high-kT component increases with the flux while its temperature decreases, which we interpret as being due to an adiabatic cooling process. The area of the low-kT component, on the other hand, appears to saturate at the highest fluxes, toward R max ? 30 km. Assuming that crust quakes are responsible for soft gamma repeater (SGR) bursts and considering R max as the maximum radius of the emitting photon-pair plasma fireball, we relate this saturation radius to a minimum excitation radius of the magnetosphere, and we put a lower limit on the internal magnetic field of SGR J1550-5418, B int >~ 4.5 × 1015 G.

  15. Time resolved infrared spectroscopy: kinetic studies of weakly binding ligands in an iron-iron hydrogenase model compound.

    PubMed

    Muhammad, Sohail; Moncho, Salvador; Brothers, Edward N; Darensbourg, Marcetta Y; Darensbourg, Donald J; Bengali, Ashfaq A

    2012-07-01

    Solution photochemistry of (?-pdt)[Fe(CO)(3)](2) (pdt = ?(2)-S(CH(2))(3)S), a precursor model of the 2-Fe subsite of the H-cluster of the hydrogenase enzyme, has been studied using time-resolved infrared spectroscopy. Following the loss of CO, solvation of the Fe center by the weakly binding ligands cyclohexene, 3-hexyne, THF, and 2,3-dihydrofuran (DHF) occurred. Subsequent ligand substitution of these weakly bound ligands by pyridine or cyclooctene to afford a more stable complex was found to take place via a dissociative mechanism on a seconds time scale with activation parameters consistent with such a pathway. That is, the ?S(‡) values were positive and the ?H(‡) parameters closely agreed with bond dissociation enthalpies (BDEs) obtained from DFT calculations. For example, for cyclohexene replacement by pyridine, experimental ?H(‡) and ?S(‡) values were determined to be 19.7 ± 0.6 kcal/mol (versus a theoretical prediction of 19.8 kcal/mol) and 15 ± 2 eu, respectively. The ambidentate ligand 2,3-DHF was shown to initially bind to the iron center via its oxygen atom followed by an intramolecular rearrangement to the more stable ?(2)-olefin bound species. DFT calculations revealed a transition state structure with the iron atom almost equidistant from the oxygen and one edge of the olefinic bond. The computed ?H(‡) of 10.7 kcal/mol for this isomerization process was found to be in excellent agreement with the experimental value of 11.2 ± 0.3 kcal/mol. PMID:22680284

  16. Microsecond Time-Resolved Absorption Spectroscopy Used to Study CO Compounds of Cytochrome bd from Escherichia coli

    PubMed Central

    Siletsky, Sergey A.; Zaspa, Andrey A.; Poole, Robert K.; Borisov, Vitaliy B.

    2014-01-01

    Cytochrome bd is a tri-heme (b558, b595, d) respiratory oxygen reductase that is found in many bacteria including pathogenic species. It couples the electron transfer from quinol to O2 with generation of an electrochemical proton gradient. We examined photolysis and subsequent recombination of CO with isolated cytochrome bd from Escherichia coli in one-electron reduced (MV) and fully reduced (R) states by microsecond time-resolved absorption spectroscopy at 532-nm excitation. Both Soret and visible band regions were examined. CO photodissociation from MV enzyme possibly causes fast (?<1.5 µs) electron transfer from heme d to heme b595 in a small fraction of the protein, not reported earlier. Then the electron migrates to heme b558 (??16 µs). It returns from the b-hemes to heme d with ??180 µs. Unlike cytochrome bd in the R state, in MV enzyme the apparent contribution of absorbance changes associated with CO dissociation from heme d is small, if any. Photodissociation of CO from heme d in MV enzyme is suggested to be accompanied by the binding of an internal ligand (L) at the opposite side of the heme. CO recombines with heme d (??16 µs) yielding a transient hexacoordinate state (CO-Fe2+-L). Then the ligand slowly (??30 ms) dissociates from heme d. Recombination of CO with a reduced heme b in a fraction of the MV sample may also contribute to the 30-ms phase. In R enzyme, CO recombines to heme d (??20 µs), some heme b558 (??0.2–3 ms), and finally migrates from heme d to heme b595 (??24 ms) in ?5% of the enzyme population. Data are consistent with the recent nanosecond study of Rappaport et al. conducted on the membranes at 640-nm excitation but limited to the Soret band. The additional phases were revealed due to differences in excitation and other experimental conditions. PMID:24755641

  17. Early Amyloidogenic Oligomerization Studied through Fluorescence Lifetime Correlation Spectroscopy

    PubMed Central

    Paredes, Jose M.; Casares, Salvador; Ruedas-Rama, Maria J.; Fernandez, Elena; Castello, Fabio; Varela, Lorena; Orte, Angel

    2012-01-01

    Amyloidogenic protein aggregation is a persistent biomedical problem. Despite active research in disease-related aggregation, the need for multidisciplinary approaches to the problem is evident. Recent advances in single-molecule fluorescence spectroscopy are valuable for examining heterogenic biomolecular systems. In this work, we have explored the initial stages of amyloidogenic aggregation by employing fluorescence lifetime correlation spectroscopy (FLCS), an advanced modification of conventional fluorescence correlation spectroscopy (FCS) that utilizes time-resolved information. FLCS provides size distributions and kinetics for the oligomer growth of the SH3 domain of ?-spectrin, whose N47A mutant forms amyloid fibrils at pH 3.2 and 37 °C in the presence of salt. The combination of FCS with additional fluorescence lifetime information provides an exciting approach to focus on the initial aggregation stages, allowing a better understanding of the fibrillization process, by providing multidimensional information, valuable in combination with other conventional methodologies. PMID:22949804

  18. Lifetime fluorescence spectroscopy for in situ investigation of osteogenic differentiation

    NASA Astrophysics Data System (ADS)

    Marcu, Laura; Elbarbary, Amir; Zuk, Patricia; De Ugarte, Daniel A.; Benhaim, Prosper; Kurt, Hamza; Hedrick, Marc H.; Ashjian, Peter

    2003-07-01

    Time-Resolved Laser-Induced Fluorescence Spectroscopy (TR-LIFS) represents a potential tool for the in-situ characterization of bioengineered tissues. In this study, we evaluate the application of TR-LIFS to non-intrusive monitoring of matrix composition during osteogenetic differentiation. Human adipose-derived stem cells, harvested from 3 patients, were induced in osteogenic media for 3, 5, and 7 weeks. Samples were subsequently collected and probed for time-resolved fluorescence emission with a pulsed nitrogen laser. Fluorescence parameters, derived from both spectral- and time-domain, were used for sample characterization. The samples were further analyzed using Western blot analysis and computer-based densitometry. A significant change in the fluorescence parameters was detected for samples beyond 3 weeks of osteogenic differentiation. The spectroscopic observations: 1) show increase of collagen I when contrasted against the time-resolved fluorescence spectra of commercially available collagens; and 2) are in agreement with Western blot analysis that demonstrated significant increase in collagen I content between 3- vs. 5-weeks and 3- vs. 7-weeks and no changes for collagens III, IV, and V. Our results suggest that TR-LIFS can be used as a non-invasive means for the detection of specific collagens in maturing connective tissues.

  19. Development and demonstration of table-top synchronized fast-scan femtosecond time-resolved spectroscopy system by single-shot scan photo detector array

    NASA Astrophysics Data System (ADS)

    Yabushita, Atsushi; Kao, Chih-Hsien; Lee, Yu-Hsien; Kobayashi, Takayoshi

    2015-07-01

    Ultrafast dynamics is generally studied by pump–probe method with laser pulse, which scans optical delay by motorized stage step by step. Using ultrashort laser pulse shorter than typical molecular vibration periods, the pump–probe measurement can study both of electronic dynamics and vibration dynamics simultaneously. The probe wavelength dependence of the ultrafast electronic and vibration dynamics (UEVD) helps us to distinguish the signal contributions from the dynamics of the electronic ground state and that of the electronic excited states, which elucidates primary reaction mechanism after photoexcitation. Meanwhile, the measurement time of UEVD spectroscopy takes too long time to be used in realistic application. In our previous work, we have developed multi-channel lock-in amplifying (MLA) detectors to study UEVD at all probe wavelengths simultaneously, and synchronized it with laser and fast-scan delay stage to scan the data in five seconds. It enabled us to study UEVD spectroscopy even for photo-fragile materials. However, the home-made MLA detectors required for the measurement is expensive and massive in size and weight, thus not suitable for general researchers in the field of ultrafast time-resolved spectroscopy. In the present work, we have developed a table-top synchronized fast-scan femtosecond time-resolved spectroscopy system using single shot scan line CCD. This system measures time-resolved trace at all probe wavelengths simultaneously in five seconds. The CCD-based fast-scan time-resolved spectroscopy system enables us to study ultrafast dynamics of various materials even biomaterials, which have been thought to be hard or even impossible to be studied in previous methods.

  20. Trp aporepressor engineered for fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Millar, David P.; Hochstrasser, Remo A.; Chapman, David; Youderian, Philip

    1992-04-01

    The tryptophan repressor from Escherichia coli binds to the trp operator in the presence of L- tryptophan, thereby inhibiting the biosynthesis of L-tryptophan. Site-directed mutagenesis was used to change tryptophan-19 and tryptophan-99 to leucine and methionine, respectively. This mutant protein without tryptophan in its amino acid sequence has wild-type repressor activity and is a suitable model for fluorescence studies of corepressor binding. Both steady-state and time-resolved fluorescence spectroscopy have been used to compare the binding of L- tryptophan, indole-3-propionic acid, indole-3-butyric acid, and indole. In all cases, binding to the mutant aporepressor results in a large blue shift and a change in the intensity of the ligand fluorescence. The decay of the total fluorescence intensity from the complex indicates the presence of three distinct bound states of the ligand. The distribution of ligand binding modes is influenced by the substituent at the 3-position of the indole ring. The rotational correlation time of the complexes formed with L-tryptophan or indole-3-propionic acid indicate that the protein is present as a dimer, whereas with indole or indole-3-butyric acid the correlation times are much lower, suggesting that the protein is present as a monomer.

  1. Excitation relaxation dynamics and energy transfer in fucoxanthin-chlorophyll a/c-protein complexes, probed by time-resolved fluorescence.

    PubMed

    Akimoto, Seiji; Teshigahara, Ayaka; Yokono, Makio; Mimuro, Mamoru; Nagao, Ryo; Tomo, Tatsuya

    2014-09-01

    In algae, light-harvesting complexes contain specific chlorophylls (Chls) and keto-carotenoids; Chl a, Chl c, and fucoxanthin (Fx) in diatoms and brown algae; Chl a, Chl c, and peridinin in photosynthetic dinoflagellates; and Chl a, Chl b, and siphonaxanthin in green algae. The Fx-Chl a/c-protein (FCP) complex from the diatom Chaetoceros gracilis contains Chl c1, Chl c2, and the keto-carotenoid, Fx, as antenna pigments, in addition to Chl a. In the present study, we investigated energy transfer in the FCP complex associated with photosystem II (FCPII) of C. gracilis. For these investigations, we analyzed time-resolved fluorescence spectra, fluorescence rise and decay curves, and time-resolved fluorescence anisotropy data. Chl a exhibited different energy forms with fluorescence peaks ranging from 677 nm to 688 nm. Fx transferred excitation energy to lower-energy Chl a with a time constant of 300fs. Chl c transferred excitation energy to Chl a with time constants of 500-600fs (intra-complex transfer), 600-700fs (intra-complex transfer), and 4-6ps (inter-complex transfer). The latter process made a greater contribution to total Chl c-to-Chl a transfer in intact cells of C. gracilis than in the isolated FCPII complexes. The lower-energy Chl a received excitation energy from Fx and transferred the energy to higher-energy Chl a. This article is part of a special issue entitled: photosynthesis research for sustainability: keys to produce clean energy. PMID:24530875

  2. Time resolved spectroscopy of SGR J1550–5418 bursts detected with Fermi/gamma-ray burst monitor

    SciTech Connect

    Younes, G. [Universities Space Research Association, 6767 Old Madison Pike, Suite 450, Huntsville, AL 35806 (United States); Kouveliotou, C.; Collazzi, A. [Astrophysics Office, ZP 12, NASA-Marshall Space Flight Center, Huntsville, AL 35812 (United States); Van der Horst, A. J.; Watts, A. L.; Huppenkothen, D.; Van der Klis, M.; Van Putten, T. [Astronomical Institute "Anton Pannekoek," University of Amsterdam, Postbus 94249, 1090 GE Amsterdam (Netherlands); Baring, M. G. [Department of Physics and Astronomy, Rice University, MS-108, P.O. Box 1892, Houston, TX 77251 (United States); Granot, J. [Department of Natural Sciences, The Open University of Israel, 1 University Road, P.O. Box 808, Raánana 43537 (Israel); Bhat, P. N.; Gorgone, N. [University of Alabama in Huntsville CSPAR, 320 Sparkman Drive, Huntsville, AL 35805 (United States); Gehrels, N.; Mcenery, J. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Gö?ü?, E.; Kaneko, Y.; Lin, L. [Sabanc? University, Orhanl?-Tuzla, ?stanbul 34956 (Turkey); Gruber, D.; Von Kienlin, A. [Max Planck Institute for Extraterrestrial Physics, Giessenbachstrasse, Postfach 1312, D-85748 Garching (Germany); Grunblatt, S. [University of Hawaii at Manoa, 2500 Campus Road, Honolulu, HI 96822 (United States); and others

    2014-04-10

    We report on a time-resolved spectroscopy of the 63 brightest bursts of SGR J1550–5418, detected with the Fermi/Gamma-ray Burst Monitor during its 2008-2009 intense bursting episode. We performed spectral analysis down to 4 ms timescales to characterize the spectral evolution of the bursts. Using a Comptonized model, we find that the peak energy, E {sub peak}, anti-correlates with flux, while the low-energy photon index remains constant at ? – 0.8 up to a flux limit F ? 10{sup –5} erg s{sup –1} cm{sup –2}. Above this flux value, the E {sub peak}–flux correlation changes sign, and the index positively correlates with the flux reaching ?1 at the highest fluxes. Using a two blackbody model, we find that the areas and fluxes of the two emitting regions correlate positively. Further, we study here for the first time the evolution of the temperatures and areas as a function of flux. We find that the area–kT relation follows the lines of constant luminosity at the lowest fluxes, R {sup 2}?kT {sup –4}, with a break at the higher fluxes (F > 10{sup –5.5} erg s{sup –1} cm{sup –2}). The area of the high-kT component increases with the flux while its temperature decreases, which we interpret as being due to an adiabatic cooling process. The area of the low-kT component, on the other hand, appears to saturate at the highest fluxes, toward R {sub max} ? 30 km. Assuming that crust quakes are responsible for soft gamma repeater (SGR) bursts and considering R {sub max} as the maximum radius of the emitting photon-pair plasma fireball, we relate this saturation radius to a minimum excitation radius of the magnetosphere, and we put a lower limit on the internal magnetic field of SGR J1550–5418, B {sub int} ? 4.5 × 10{sup 15} G.

  3. Time-resolved Fourier transform infrared spectroscopy of the polarizable proton continua and the proton pump mechanism of bacteriorhodopsin.

    PubMed Central

    Wang, J; El-Sayed, M A

    2001-01-01

    Nanosecond-to-microsecond time-resolved Fourier transform infrared (FTIR) spectroscopy in the 3000-1000-cm(-1) region has been used to examine the polarizable proton continua observed in bacteriorhodopsin (bR) during its photocycle. The difference in the transient FTIR spectra in the time domain between 20 ns and 1 ms shows a broad absorption continuum band in the 2100-1800-cm(-1) region, a bleach continuum band in the 2500-2150-cm(-1) region, and a bleach continuum band above 2700 cm(-1). According to Zundel (G., J. Mol. Struct. 322:33-42), these continua appear in systems capable of forming polarizable hydrogen bonds. The formation of a bleach continuum suggests the presence of a polarizable proton in the ground state that changes during the photocycle. The appearance of a transient absorption continuum suggests a change in the polarizable proton or the appearance of new ones. It is found that each continuum has a rise time of less than 80 ns and a decay time component of approximately 300 micros. In addition, it is found that the absorption continuum in the 2100-1800-cm(-1) region has a slow rise component of 190 ns and a fast decay component of approximately 60 micros. Using these results and those of the recent x-ray structural studies of bR(570) and M(412) (H. Luecke, B. Schobert, H.T. Richter, J.-P. Cartailler, and J. K., Science 286:255-260), together with the already known spectroscopic properties of the different intermediates in the photocycle, the possible origins of the polarizable protons giving rise to these continua during the bR photocycle are proposed. Models of the proton pump are discussed in terms of the changes in these polarizable protons and the hydrogen-bonded chains and in terms of previously known results such as the simultaneous deprotonation of the protonated Schiff base (PSB) and Tyr185 and the disappearance of water molecules in the proton release channel during the proton pump process. PMID:11159463

  4. A high-throughput time-resolved mini-silicon photomultiplier with embedded fluorescence lifetime estimation in 0.13 ?m CMOS.

    PubMed

    Tyndall, David; Rae, Bruce R; Li, David Day-Uei; Arlt, Jochen; Johnston, Abigail; Richardson, Justin A; Henderson, Robert K

    2012-12-01

    We describe a miniaturized, high-throughput, time-resolved fluorescence lifetime sensor implemented in a 0.13 m CMOS process, combining single photon detection, multiple channel timing and embedded pre-processing of fluorescence lifetime estimations on a single device. Detection is achieved using an array of single photon avalanche diodes (SPADs) arranged in a digital silicon photomultiplier (SiPM) architecture with 400 ps output pulses and a 10% fill-factor. An array of time-to-digital converters (TDCs) with ?50 ps resolution records up to 8 photon events during each excitation period. Data from the TDC array is then processed using a centre-of-mass method (CMM) pre-calculation to produce fluorescence lifetime estimations in real-time. The sensor is believed to be the first reported implementation of embedded fluorescence lifetime estimation. The system is demonstrated in a practical laboratory environment with measurements of a variety of fluorescent dyes with different single exponential lifetimes, successfully showing the sensor's ability to overcome the classic pile-up limitation of time-correlated single photon counting (TCSPC) by over an order of magnitude. PMID:23853257

  5. Photochemistryand Photobiology, 1996,64(3): 552-563 Comparative Time-Resolved Photosystem II Chlorophyll a Fluorescence

    E-print Network

    Govindjee

    Chlorophyll a Fluorescence Analyses Reveal Distinctive Differences between Photoinhibitory Reaction Center-thylakoid pH gradient (ApH) and the carotenoid pigment interconversions of the xanthophyll cycle. Co

  6. Carrier dynamics in bulk ZnO. II. Transient photoconductivity measured by time-resolved terahertz spectroscopy

    E-print Network

    Carrier dynamics in bulk ZnO. II. Transient photoconductivity measured by time-resolved terahertz in bulk ZnO at temperatures below 100 K. Carrier density and mobility are extracted by fitting the Drude. INTRODUCTION ZnO is a wide band-gap semiconductor Eg=3.37 eV with large exciton binding energy 60 me

  7. Steady-state and time-resolved fluorescence study of some dyes in polymer microspheres showing morphology dependent resonances

    Microsoft Academic Search

    Prem B. Bisht; Kazuhiro Fukuda; Satoshi Hirayama

    1996-01-01

    Fluorescence emission spectra of N,N?-bis(2,5-di-tert-butylphenyl)-3,4:9,10- Perylenebis(dicarboximide) (DBPI), rhodamine 6G (R6G), and cresyl violet (CV) in spherical polymer beads of less than 20 ?m diameter show sharp ripple structures. The observed peak positions and the intervals of the structures are consistent with the calculations of the morphology dependent resonances (MDR). Observed intensities of the MDR in the fluorescence emission spectra are

  8. Density relaxation and particle motion characteristics in a non-ionic deep eutectic solvent (acetamide + urea): time-resolved fluorescence measurements and all-atom molecular dynamics simulations.

    PubMed

    Das, Anuradha; Das, Suman; Biswas, Ranjit

    2015-01-21

    Temperature dependent relaxation dynamics, particle motion characteristics, and heterogeneity aspects of deep eutectic solvents (DESs) made of acetamide (CH3CONH2) and urea (NH2CONH2) have been investigated by employing time-resolved fluorescence measurements and all-atom molecular dynamics simulations. Three different compositions (f) for the mixture [fCH3CONH2 + (1 - f)NH2CONH2] have been studied in a temperature range of 328-353 K which is ?120-145 K above the measured glass transition temperatures (?207 K) of these DESs but much lower than the individual melting temperature of either of the constituents. Steady state fluorescence emission measurements using probe solutes with sharply different lifetimes do not indicate any dependence on excitation wavelength in these metastable molten systems. Time-resolved fluorescence anisotropy measurements reveal near-hydrodynamic coupling between medium viscosity and rotation of a dissolved dipolar solute. Stokes shift dynamics have been found to be too fast to be detected by the time-resolution (?70 ps) employed, suggesting extremely rapid medium polarization relaxation. All-atom simulations reveal Gaussian distribution for particle displacements and van Hove correlations, and significant overlap between non-Gaussian (?2) and new non-Gaussian (?) heterogeneity parameters. In addition, no stretched exponential relaxations have been detected in the simulated wavenumber dependent acetamide dynamic structure factors. All these results are in sharp contrast to earlier observations for ionic deep eutectics with acetamide [Guchhait et al., J. Chem. Phys. 140, 104514 (2014)] and suggest a fundamental difference in interaction and dynamics between ionic and non-ionic deep eutectic solvent systems. PMID:25612718

  9. Density relaxation and particle motion characteristics in a non-ionic deep eutectic solvent (acetamide + urea): Time-resolved fluorescence measurements and all-atom molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Das, Anuradha; Das, Suman; Biswas, Ranjit

    2015-01-01

    Temperature dependent relaxation dynamics, particle motion characteristics, and heterogeneity aspects of deep eutectic solvents (DESs) made of acetamide (CH3CONH2) and urea (NH2CONH2) have been investigated by employing time-resolved fluorescence measurements and all-atom molecular dynamics simulations. Three different compositions (f) for the mixture [fCH3CONH2 + (1 - f)NH2CONH2] have been studied in a temperature range of 328-353 K which is ˜120-145 K above the measured glass transition temperatures (˜207 K) of these DESs but much lower than the individual melting temperature of either of the constituents. Steady state fluorescence emission measurements using probe solutes with sharply different lifetimes do not indicate any dependence on excitation wavelength in these metastable molten systems. Time-resolved fluorescence anisotropy measurements reveal near-hydrodynamic coupling between medium viscosity and rotation of a dissolved dipolar solute. Stokes shift dynamics have been found to be too fast to be detected by the time-resolution (˜70 ps) employed, suggesting extremely rapid medium polarization relaxation. All-atom simulations reveal Gaussian distribution for particle displacements and van Hove correlations, and significant overlap between non-Gaussian (?2) and new non-Gaussian (?) heterogeneity parameters. In addition, no stretched exponential relaxations have been detected in the simulated wavenumber dependent acetamide dynamic structure factors. All these results are in sharp contrast to earlier observations for ionic deep eutectics with acetamide [Guchhait et al., J. Chem. Phys. 140, 104514 (2014)] and suggest a fundamental difference in interaction and dynamics between ionic and non-ionic deep eutectic solvent systems.

  10. Time-resolved fluorescence polarization anisotropy and optical imaging of Cybesin in cancerous and normal prostate tissues

    E-print Network

    Larson-Prior, Linda

    by prostate cancer in the US [1]. Common methods for prostate cancer diagnosis are the prostate specific-resolved polarization-dependent fluorescence of Cybesin in solution and in cancerous and normal prostate tissues were normal tissue. The polarization anisotropy of Cybesin contained in cancerous prostate tissue was found

  11. Electronic Excitations in G-quadruplexes Formed by the Human Telomeric Sequence: A Time-Resolved Fluorescence Study.

    PubMed

    Changenet-Barret, Pascale; Hua, Ying; Gustavsson, Thomas; Markovitsi, Dimitra

    2015-05-01

    The present study deals with G-quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K(+) cations, noted Tel21/K(+) . Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time-correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K(+) is longer and the contribution of charge transfer states is more pronounced than what is observed for G-quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects. PMID:25362994

  12. Highly sensitive detection of human papillomavirus type 16 DNA using time-resolved fluorescence microscopy and long lifetime probes

    Microsoft Academic Search

    Xue F. Wang; Ammasi Periasamy; Pawel Wodnicki; M. Siadat-Pajouh; Brian Herman

    1995-01-01

    We have been interested in the role of Human Papillomavirus (HPV) in cervical cancer and its diagnosis; to that end we have been developing microscopic imaging and fluorescent in situ hybridization (FISH) techniques to genotype and quantitate the amount of HPV present at a single cell level in cervical PAP smears. However, we have found that low levels of HPV

  13. Multichannel, time-resolved picosecond laser ultrasound imaging and spectroscopy with custom complementary metal-oxide-semiconductor detector

    Microsoft Academic Search

    Richard J. Smith; Roger A. Light; Steve D. Sharples; Nicholas S. Johnston; Mark C. Pitter; Mike G. Somekh

    2010-01-01

    This paper presents a multichannel, time-resolved picosecond laser ultrasound system that uses a custom complementary metal-oxide-semiconductor linear array detector. This novel sensor allows parallel phase-sensitive detection of very low contrast modulated signals with performance in each channel comparable to that of a discrete photodiode and a lock-in amplifier. Application of the instrument is demonstrated by parallelizing spatial measurements to produce

  14. Time-resolved fluorescence sensing of pesticides chlorpyrifos, crotoxyphos and endosulfan by the luminescent Eu(III)-8-allyl-3-carboxycoumarin probe.

    PubMed

    Azab, Hassan A; Khairy, Gasser M; Kamel, Rasha M

    2015-09-01

    This work describes the application of time resolved fluorescence in microtiter plates for investigating the interactions of europium-allyl-3-carboxycoumarin with pesticides chlorpyrifos, endosulfan and crotoxyphos. Stern-Volmer studies at different temperatures for chlorpyrifos and crotoxyphos shows dynamic and static quenching mechanisms respectively. Direct methods for the determination of the pesticides under investigation have been developed using the luminescence variations of the probe in solution. The detection limits are 6.53, 0.004, 3.72?mol/L for chlorpyrifos, endosulfan, and crotoxyphos, respectively. The binding constants and thermodynamic parameters of the pesticides with probe were evaluated. A thermodynamic analysis showed that the reaction is spontaneous with negative ?G. Effect of some relevant interferents on the detection of pesticides has been investigated. The new method was applied to the determination of the pesticides in different types of water samples (tap, mineral, and waste water). PMID:25875033

  15. STEADY-STATE AND TIME-RESOLVED FLUORESCENCE QUENCHING WITH TRANSITION METAL IONS AS SHORT-DISTANCE PROBES FOR PROTEIN CONFORMATION

    PubMed Central

    Posokhov, Yevgen O.; Kyrychenko, Alexander; Ladokhin, Alexey S.

    2011-01-01

    A series of model dye-labeled histidine-containing peptides was used to investigate the nature of the quenching mechanism with Cu2+ and Ni2+. The strong reduction in steady-state fluorescence was found to be unaccompanied by any noticeable changes in lifetime kinetics. This static nature of quenching is not consistent with the dynamic FRET phenomenon, which was assumed to dominate the quenching mechanism, and is likely caused by shorter range orbital coupling. Our results indicate that the FRET-like 6th power of distance dependence of quenching cannot be automatically assumed for transition metal ions, and time-resolved measurements should be used to distinguish various quenching mechanisms. PMID:20707982

  16. Effect of Ca²? on the steady-state and time-resolved emission properties of the genetically encoded fluorescent sensor CatchER.

    PubMed

    Zhuo, You; Solntsev, Kyril M; Reddish, Florence; Tang, Shen; Yang, Jenny J

    2015-02-12

    We previously designed a calcium sensor CatchER (a GFP-based Calcium sensor for detecting high concentrations in the high calcium concentration environment such as ER) with a capability for monitoring calcium ion responses in various types of cells. Calcium binding to CatchER induces the ratiometric changes in the absorption spectra, as well as an increase in fluorescence emission at 510 nm upon excitation at both 395 and 488 nm. Here, we have applied the combination of the steady-state and time-resolved optical methods and Hydrogen/Deuterium isotope exchange to understand the origin of such calcium-induced optical property changes of CatchER. We first demonstrated that calcium binding results in a 44% mean fluorescence lifetime increase of the indirectly excited anionic chromophore. Thus, CatchER is the first protein-based calcium indicator with the single fluorescent moiety to show the direct correlation between the lifetime and calcium binding. Calcium exhibits a strong inhibition on the excited-state proton transfer nonadiabatic geminate recombination in protic (vs deuteric) medium. Analysis of CatchER crystal structures and the MD simulations reveal the proton transfer mechanism in which the disrupted proton migration path in CatchER is rescued by calcium binding. Our finding provides important insights for a strategy to design calcium sensors and suggests that CatchER could be a useful probe for FLIM imaging of calcium in situ. PMID:24836743

  17. Probing organometallic reactions by time-resolved infrared spectroscopy in solution and in the solid state using quantum cascade lasers.

    PubMed

    Calladine, James A; Horvath, Raphael; Davies, Andrew J; Wriglesworth, Alisdair; Sun, Xue-Zhong; George, Michael W

    2015-05-01

    The photochemistry and photophysics of metal carbonyl compounds (W(CO)6, Cp*Rh(CO)2 (Cp* = ?(5)-C5Me5), and fac-[Re(CO)3(4,4'-bpy)2Br] [bpy = bipyridine]) have been examined on the nanosecond timescale using a time-resolved infrared spectrometer with an external cavity quantum cascade laser (QCL) as the infrared source. We show the photochemistry of W(CO)6 in alkane solution is easily monitored, and very sensitive measurements are possible with this approach, meaning it can monitor small transients with absorbance changes less than 10(-6) ?OD. The C-H activation of Cp*Rh(CO)(C6H12) to form Cp*Rh(CO)(C6H11)H occurs within the first few tens of nanoseconds following photolysis, and we demonstrate that kinetics obtained following deconvolution are in excellent agreement with those measured using an ultrafast laser-based spectrometer. We also show that the high flux and tunability of QCLs makes them suited for solid-state and time-resolved measurements. PMID:25811673

  18. Time-resolved spectrofluorometer for clinical tissue characterization during endoscopy

    NASA Astrophysics Data System (ADS)

    Glanzmann, Thomas; Ballini, Jean-Pierre; van den Bergh, Hubert; Wagnières, Georges

    1999-10-01

    Time-resolved fluorescence spectroscopy has the potential to provide more information for the detection of early cancer than continuous wave spectroscopy. A new optical fiber-based spectrofluorometer for time-resolved fluorescence spectroscopy of biological tissue during clinical endoscopy is presented. The apparatus is based on a nitrogen laser pumping a dye laser as excitation source and a streak camera coupled with a spectrograph as time-resolved spectrometer. The excitation and fluorescence light is carried by an optical fiber to the tissue under investigation and back to the detector, respectively. This optical fiber can be inserted into the biopsy channel of a conventional endoscope. Hence, the apparatus can be used to perform in situ tissue characterization during endoscopy. The instrument enables the measurement of the decays of entire fluorescence spectra within 15 s with a dynamic range of the spectro-temporal images of up to three orders of magnitude. Luminescence lifetimes from the sub ns up to the ms range can be measured. Spectral and temporal resolution, sensitivity, and dynamic range of the instrumentation were determined. The accuracy of the apparatus was checked by the measurement of the fluorescence lifetimes of various fluorophores with known lifetimes. For the first time, two-dimensional time-resolved spectra with sub-ns temporal resolution of tissue fluorescence of the human bladder, the bronchi, and the esophagus taken during endoscopy are presented as a demonstration of performance of the instrumentation. The excitation wavelengths were 337 nm in the case of the bladder and the esophagus and 480 nm in the case of the bronchi. Lifetime contrasts between normal and neoplastic tissue were found in all three organs. The spectral analysis of the fluorescence decays showed that the fluorescence between 370 and 490 nm, excited at 337 nm, consisted in several overlapping spectra. In the case of the esophagus, the contrast between normal and tumoral tissue was inverse in two different spectral bands proving the importance of the choice of the appropriate spectral range for time-resolved autofluorescence measurements for an optimal contrast. The in vivo fluorescence decay of the photosensitizers 5-aminolevulinic acid hexylester hydrochloride-induced protoporphyrin IX was measured in the human bladder and found to be mono-exponential with a lifetime of 15.9 (±1.2) ns. An in vivo fluorescence lifetime of 8.5 (±0.8) ns was found in the case of the photosensitizer 5, 10, 15, 20-tetra(m-hydroxyphenyl)chlorin (mTHPC) in the esophagus.

  19. Probing Electronic and Vibrational Dynamics in Molecules by Time-Resolved Photoelectron, Auger-Electron, and X-ray Photon Scattering Spectroscopy

    PubMed Central

    Bennett, Kochise; Kowalewski, Markus; Mukamel, Shaul

    2015-01-01

    We present a unified description for time-resolved electron and photon scattering spectroscopies from molecules prepared in nonstationary states. Signals are expressed in terms of superoperator Green’s functions and a systematic procedure for treating various degrees of freedom consistently at different levels of theory is developed. The standard Fermi Golden Rule expressions for photelectron spectra, which are limited to broad, slowly-varying signals, are obtained as a limiting case of our more general theory that applies to broader parameter regimes. PMID:25730500

  20. Time-resolved fluorescence investigation of the human immunodeficiency virus type 1 nucleocapsid protein: influence of the binding of nucleic acids.

    PubMed

    Bombarda, E; Ababou, A; Vuilleumier, C; Gérard, D; Roques, B P; Piémont, E; Mély, Y

    1999-03-01

    Depending on the HIV-1 isolate, MN or BH10, the nucleocapsid protein, NCp7, corresponds to a 55- or 71-amino acid length product, respectively. The MN NCp7 contains a single Trp residue at position 37 in the distal zinc finger motif, and the BH10 NCp7 contains an additional Trp, at position 61 in the C-terminal chain. The time-resolved intensity decay parameters of the zinc-saturated BH10 NCp7 were determined and compared to those of single-Trp-containing derivatives. The fluorescence decay of BH10 NCp7 could be clearly represented as a linear combination (with respect to both lifetimes and fractional intensities) of the individual emitting Trp residues. This suggested the absence of interactions between the two Trp residues, a feature that was confirmed by molecular modeling and fluorescence energy transfer studies. In the presence of tRNAPhe, taken as a RNA model, the same conclusions hold true despite the large fluorescence decrease induced by the binding of tRNAPhe. Indeed, the fluorescence of Trp37 appears almost fully quenched, in keeping with a stacking of this residue with the bases of tRNAPhe. Despite the multiple binding sites in tRNAPhe, the large prevalence of ultrashort lifetimes, associated with the stacking of Trp37, suggests that this stacking constitutes a major feature in the binding process of NCp7 to nucleic acids. In contrast, Trp61 only stacked to a small extent with tRNAPhe. The behavior of this residue in the tRNAPhe-NCp7 complexes appeared to be rather heterogeneous, suggesting that it does not constitute a major determinant in the binding process. Finally, our data suggested that the binding of NCp7 proteins from the two HIV-1 strains to nonspecific nucleic acid sequences was largely similar. PMID:10049336

  1. Time-resolved fluorescence investigation of the human immunodeficiency virus type 1 nucleocapsid protein: influence of the binding of nucleic acids.

    PubMed Central

    Bombarda, E; Ababou, A; Vuilleumier, C; Gérard, D; Roques, B P; Piémont, E; Mély, Y

    1999-01-01

    Depending on the HIV-1 isolate, MN or BH10, the nucleocapsid protein, NCp7, corresponds to a 55- or 71-amino acid length product, respectively. The MN NCp7 contains a single Trp residue at position 37 in the distal zinc finger motif, and the BH10 NCp7 contains an additional Trp, at position 61 in the C-terminal chain. The time-resolved intensity decay parameters of the zinc-saturated BH10 NCp7 were determined and compared to those of single-Trp-containing derivatives. The fluorescence decay of BH10 NCp7 could be clearly represented as a linear combination (with respect to both lifetimes and fractional intensities) of the individual emitting Trp residues. This suggested the absence of interactions between the two Trp residues, a feature that was confirmed by molecular modeling and fluorescence energy transfer studies. In the presence of tRNAPhe, taken as a RNA model, the same conclusions hold true despite the large fluorescence decrease induced by the binding of tRNAPhe. Indeed, the fluorescence of Trp37 appears almost fully quenched, in keeping with a stacking of this residue with the bases of tRNAPhe. Despite the multiple binding sites in tRNAPhe, the large prevalence of ultrashort lifetimes, associated with the stacking of Trp37, suggests that this stacking constitutes a major feature in the binding process of NCp7 to nucleic acids. In contrast, Trp61 only stacked to a small extent with tRNAPhe. The behavior of this residue in the tRNAPhe-NCp7 complexes appeared to be rather heterogeneous, suggesting that it does not constitute a major determinant in the binding process. Finally, our data suggested that the binding of NCp7 proteins from the two HIV-1 strains to nonspecific nucleic acid sequences was largely similar. PMID:10049336

  2. Fluorescence spectroscopy and imaging for noninvasive diagnostics: applications to early cancer detection in the lung

    NASA Astrophysics Data System (ADS)

    Mycek, Mary-Ann; Urayama, Paul; Zhong, Wei; Sloboda, Roger D.; Dragnev, Konstantin H.; Dmitrovsky, Ethan

    2003-10-01

    Tissue fluorescence spectroscopy and imaging are being investigated as potential methods for non-invasive detection of pre-neoplastic change in the lung and other organ systems. A substantial contribution to tissue fluorescence is known to arise from endogenous cellular fluorophores. Using steady-state and time-resolved fluorescence spectroscopy and imaging, we characterized the endogenous fluorescence properties of immortalized and carcinogen-transformed human bronchial epithelial cells. Non-invasive sensing of endogenous molecular biomarkers associated with human bronchial pre-neoplasia will be discussed.

  3. A time-resolved fluorescence resonance energy transfer assay suitable for high-throughput screening for inhibitors of immunoglobulin E-receptor interactions.

    PubMed

    Kim, Beomkyu; Tarchevskaya, Svetlana S; Eggel, Alexander; Vogel, Monique; Jardetzky, Theodore S

    2012-12-15

    The interaction of immunoglobulin E (IgE) antibodies with the high-affinity receptor, Fc?RI, plays a central role in initiating most allergic reactions. The IgE-receptor interaction has been targeted for treatment of allergic diseases, and many high-affinity macromolecular inhibitors have been identified. Small molecule inhibitors would offer significant advantages over current anti-IgE treatment, but no candidate compounds have been identified and fully validated. Here, we report the development of a time-resolved fluorescence resonance energy transfer (TR-FRET) assay for monitoring the IgE-receptor interaction. The TR-FRET assay measures an increase in fluorescence intensity as a donor lanthanide fluorophore is recruited into complexes of site-specific Alexa Fluor 488-labeled IgE-Fc and His-tagged Fc?RI? proteins. The assay can readily monitor classic competitive inhibitors that bind either IgE-Fc or Fc?RI? in equilibrium competition binding experiments. Furthermore, the TR-FRET assay can also be used to follow the kinetics of IgE-Fc-Fc?RI? dissociation and identify inhibitory ligands that accelerate the dissociation of preformed complexes, as demonstrated for an engineered DARPin (designed ankyrin repeat protein) inhibitor. The TR-FRET assay is suitable for high-throughput screening (HTS), as shown by performing a pilot screen of the National Institutes of Health (NIH) Clinical Collection Library in a 384-well plate format. PMID:22995065

  4. Time-resolved laser studies on the proton pump mechanism of bacteriorhodopsin

    Microsoft Academic Search

    1990-01-01

    During the past three years, a number of studies have been made to examine the different properties of bacteriorhodopsin and the effect of the different perturbations on its photocycle. A number of spectroscopic tools were used in these studies: (1) flash optical spectroscopy; (2) tryptophan fluorescence intensity, spectrum and decay; (3) time-resolved resonance Raman spectroscopy on the femtosecond time scale;

  5. Characterization of a hybrid diffuse correlation spectroscopy and time-resolved near-infrared spectroscopy system for real-time monitoring of cerebral blood flow and oxygenation

    NASA Astrophysics Data System (ADS)

    Verdecchia, K.; Diop, M.; Lee, A.; St. Lawrence, K.

    2015-03-01

    The combination of near-infrared spectroscopy (NIRS) and diffuse correlation spectroscopy (DCS) offers the ability to provide real-time monitoring of cerebral oxygenation, blood flow and oxygen consumption. However, measuring these parameters accurately requires depth-sensitive techniques that can remove the effects of signal contamination from extracerebral tissues. Towards this goal, we developed and characterized a hybrid DCS/time-resolved (TR)-NIRS system. Both systems acquire data at three source-detector distances (SDD: 7, 20 and 30 mm) to provide depth sensitivity. The TR-NIRS system uses three pulsed lasers (760, 810, and 830 nm) to quantify tissue optical properties, and DCS uses one continuous-wave, long coherence length (>5 m) laser (785 nm) for blood flow monitoring. The stability of the TR-NIRS system was characterized by continuously measuring the instrument response function (IRF) for four hours, and a warmup period of two hours was required to reduce the coefficient of variation of the extracted optical properties to < 2%. The errors in the measured optical properties were <10% at SDDs of 20 and 30 mm; however, the error at 7 mm was greater due to the effects of the IRF. The number of DCS detectors at each SDD and the minimum count-rate (20 kHz per detector resulting in <10% uncertainty in the extracted blood flow index) were optimized using a homogenous phantom. The depth sensitivity was assessed using a two-layer phantom, with the flow rate in the bottom layer altered to mimic cerebral blood flow.

  6. Depth profiling for the identification of unknown substances and concealed content at remote distances using time-resolved stand-off Raman spectroscopy.

    PubMed

    Zachhuber, Bernhard; Gasser, Christoph; Ramer, Georg; Chrysostom, Engelene t H; Lendl, Bernhard

    2012-08-01

    Time-resolved stand-off Raman spectroscopy was used to determine both the position and identity of substances relative to each other at remote distances (up to tens of meters). Spectral information of three xylene isomers, toluene, and sodium chlorate was obtained at a distance of 12 m from the setup. Pairs and triplets of these samples were placed at varying distances (10-60 cm) relative to each other. Via the photon time of flight the distance between the individual samples was determined to an accuracy of 7% (corresponding to a few cm) of the physically measured distance. Furthermore, at a distance of 40 m, time-resolved Raman depth profiling was used to detect sodium chlorate in a white plastic container that was non-transparent to the human eye. The combination of the ranging capabilities of Raman LIDAR (sample location usually determined using prior knowledge of the analyte of interest) with stand-off Raman spectroscopy (analyte detection at remote distances) provides the capability for depth profile identification of unknown substances and analysis of concealed content in distant objects. To achieve these results, a 532 nm laser with a pulse length of 4.4 ns was synchronized to an intensified charge-coupled device camera with a minimum gate width of 500 ps. For automated data analysis a multivariate curve resolution algorithm was employed. PMID:22800681

  7. A Q-switched Ho:YAG laser assisted nanosecond time-resolved T-jump transient mid-IR absorbance spectroscopy with high sensitivity.

    PubMed

    Li, Deyong; Li, Yunliang; Li, Hao; Wu, Xianyou; Yu, Qingxu; Weng, Yuxiang

    2015-05-01

    Knowledge of dynamical structure of protein is an important clue to understand its biological function in vivo. Temperature-jump (T-jump) time-resolved transient mid-IR absorbance spectroscopy is a powerful tool in elucidating the protein dynamical structures and the folding/unfolding kinetics of proteins in solution. A home-built setup of T-jump time-resolved transient mid-IR absorbance spectroscopy with high sensitivity is developed, which is composed of a Q-switched Cr, Tm, Ho:YAG laser with an output wavelength at 2.09 ?m as the T-jump heating source, and a continuous working CO laser tunable from 1580 to 1980 cm(-1) as the IR probe. The results demonstrate that this system has a sensitivity of 1 × 10(-4) ?OD for a single wavelength detection, and 2 × 10(-4) ?OD for spectral detection in amide I' region, as well as a temporal resolution of 20 ns. Moreover, the data quality coming from the CO laser is comparable to the one using the commercial quantum cascade laser. PMID:26026512

  8. A Q-switched Ho:YAG laser assisted nanosecond time-resolved T-jump transient mid-IR absorbance spectroscopy with high sensitivity

    NASA Astrophysics Data System (ADS)

    Li, Deyong; Li, Yunliang; Li, Hao; Wu, Xianyou; Yu, Qingxu; Weng, Yuxiang

    2015-05-01

    Knowledge of dynamical structure of protein is an important clue to understand its biological function in vivo. Temperature-jump (T-jump) time-resolved transient mid-IR absorbance spectroscopy is a powerful tool in elucidating the protein dynamical structures and the folding/unfolding kinetics of proteins in solution. A home-built setup of T-jump time-resolved transient mid-IR absorbance spectroscopy with high sensitivity is developed, which is composed of a Q-switched Cr, Tm, Ho:YAG laser with an output wavelength at 2.09 ?m as the T-jump heating source, and a continuous working CO laser tunable from 1580 to 1980 cm-1 as the IR probe. The results demonstrate that this system has a sensitivity of 1 × 10-4 ?OD for a single wavelength detection, and 2 × 10-4 ?OD for spectral detection in amide I' region, as well as a temporal resolution of 20 ns. Moreover, the data quality coming from the CO laser is comparable to the one using the commercial quantum cascade laser.

  9. Intraoperative monitoring of depth-dependent hemoglobin concentration changes during carotid endarterectomy by time-resolved spectroscopy

    NASA Astrophysics Data System (ADS)

    Sato, Chie; Yamaguchi, Takekane; Seida, Mitsuru; Ota, Yoshihisa; Yu, Iwae; Iguchi, Yoshinobu; Nemoto, Masahito; Hoshi, Yoko

    2007-05-01

    By measuring the adult human head during carotid endarterectomy, we investigate the depth sensitivity of two methods for deriving the absorption coefficient changes (??a) from time-resolved reflectance data to absorption changes in inhomogeneous media: (1) the curve-fitting method based on the diffusion equation (DE-fit method) and (2) the time-independent calculation based on the modified Lambert-Beer law (MLB method). Remarkable differences in the determined values of ??a caused by clamping the external carotid artery and subsequently clamping the common carotid artery were observed between the methods. The DE-fit method was more sensitive to ?a changes in cerebral tissues, whereas the MLB method was rather sensitive to ?a changes in the extracerebral tissues. Our results indicated that the DE-fit was useful for monitoring the cerebral blood circulation and oxygenation during neurosurgical operations. In addition, the combined evaluation of ?a changes with the DE-fit and MLB methods will provide us with more available information about the hemodynamic changes in the depth direction.

  10. Recent progress in space- and time-resolved x-ray spectroscopy of laser-produced plasmas (abstract)

    NASA Astrophysics Data System (ADS)

    Young, B. K. F.

    1990-10-01

    New diagnostic techniques have provided measurement of relatively gradient-free x-ray spectra from high-powered laser-produced plasmas. Simultaneously space- and time-resolved x-ray spectra were measured from a variety of microdot plasmas using an array of multiframe, imaging, electronically gated x-ray crystal spectrometers with 100 ps time resolution. A multiframed, multicolored gated x-ray pinhole camera provided measurement of the plasma uniformity. A four-frame holographic interferometer was used to measure the electron density profile. Conventional x-ray streaked crystal spectrographs, spatially resolved x-ray (film) spectrometer, and pinhole cameras supplemented these new diagnostics. The instruments allow detailed studies of both the population kinetics of highly charged ions in dense plasmas and the hydrodynamics of laser-produced plasmas for the first time. The new diagnostics are described including data from ongoing experiments. Work was performed in part under the auspices of the U.S. Dept. of Energy by LLNL under Contract No. W-7405-Eng-48.

  11. Time resolved study of the emission enhancement mechanisms in orthogonal double-pulse laser-induced breakdown spectroscopy

    NASA Astrophysics Data System (ADS)

    Sanginés, R.; Sobral, H.

    2013-10-01

    The evolution of laser induced ablation plume on aluminum targets has been investigated in orthogonal pre-ablation double pulse scheme at atmospheric pressure from the earliest stages of plasma evolution. Time-resolved emission spectra from neutrals, singly- and doubly-ionized species obtained with the double pulse experiment have been compared with those from the single pulse configuration. Signal-to-noise enhancement reaches values of up to 15 depending on the analyzed species; and the lower the charge state the later its maximum signal-to-noise ratio is reached. Ablation plume dynamics was monitored from 10 ns after the plasma onset via shadowgraphy and fast-photography with narrow interference filters to follow the evolution of individual species. Results show that ionic species from the target are located at the plasma core while nitrogen from the background air is found at the plume peripheral. Initially both configurations exhibit similar ablation plume sizes and their expansions were successfully fitted with the strong explosion model for the first 500 ns. At later times a good agreement was obtained by using the drag model, which predicts that the plume expansion eventually stops due to interaction with the background gas particles. The emission enhancement measured in the double pulse scheme is discussed in terms of the models describing the plume dynamics.

  12. Proton tunneling of tropolone in durene single crystal as studied by time-resolved EPR detected excitation spectroscopy

    NASA Astrophysics Data System (ADS)

    Ikoma, Tadaaki; Akiyama, Kimio; Tero-Kubota, Shozo; Ikegami, Yusaku

    1999-10-01

    We have measured the excitation spectra for tropolone-OH in durene single crystal and tropolone-OD in deuterated durene using a time-resolved electron paramagnetic resonance (TREPR) detection method that makes possible to separate the signals due to magnetically different sites. The tunneling doublet with 3 cm-1 was observed in the sharp zero-phonon line. The small splitting indicates that the crystal field increases the barrier of double-minimum potential for the proton tunneling in the S1 state. Moderately asymmetric potentials of the S0 and S1 states, where the energetic imbalance between two wells in the S1 state potential is opposite the S0 state potential, reasonably explained the observed unusual intensity ratio of the tunneling doublet (01+<01-). A well-resolved progression of a phonon band with a 15 cm-1 separation was also obtained in durene crystal at very low temperature. From a Franck-Condon analysis of the relative intensity of the phonon band, it was clarified that the stable configuration of the excited state tropolone in durene differed from that of the ground state.

  13. Time-resolved step-scan Fourier transform infrared spectroscopy reveals differences between early and late M intermediates of bacteriorhodopsin.

    PubMed Central

    Rödig, C; Chizhov, I; Weidlich, O; Siebert, F

    1999-01-01

    In this report, from time-resolved step-scan Fourier transform infrared investigations from 15 ns to 160 ms, we provide evidence for the subsequent rise of three different M states that differ in their structures. The first state rises with approximately 3 microseconds to only a small percentage. Its structure as judged from amide I/II bands differs in small but well-defined aspects from the L state. The next M state, which appears in approximately 40 microseconds, has almost all of the characteristics of the "late" M state, i.e., it differs considerably from the first one. Here, the L left arrow over right arrow M equilibrium is shifted toward M, although some percentage of L still persists. In the last M state (rise time approximately 130 microseconds), the equilibrium is shifted toward full deprotonation of the Schiff base, and only small additional structural changes take place. In addition to these results obtained for unbuffered conditions or at pH 7, experiments performed at lower and higher pH are presented. These results are discussed in terms of the molecular changes postulated to occur in the M intermediate to allow the shift of the L/M equilibrium toward M and possibly to regulate the change of the accessibility of the Schiff base necessary for effective proton pumping. PMID:10233083

  14. Development of a time-resolved fluorescence immunoassay for herpes simplex virus type 1 and type 2 IgG antibodies.

    PubMed

    Liang, Qian-Ni; Zhou, Jian-Wei; Liu, Tian-Cai; Lin, Guan-Feng; Dong, Zhi-Ning; Chen, Zhen-Hua; Chen, Juan-Juan; Wu, Ying-Song

    2015-08-01

    Enzyme-linked immunosorbent assays (ELISA) specific for anti-HSV glycoprotein G (gG) are most commonly used in the clinical diagnosis of HSV infection. But most of them are qualitative and with narrow detection ranges. A novel time-resolved fluoroimmunoassay (TRFIA) methodology was developed for the quantitative determination of HSV IgG in human serum. The assay was based on an indirect immunoassay format, and performed in 96-well microtiter plates. HSV-1 and HSV-2 were used as the coating antigens. Eu(3+) -labeled goat anti-(human IgG) polyclonal antibodies were used as tracers. The fluorescence intensity of each well was measured and serum HSV IgG levels quantified against a calibration curve. The detection range of the novel TRFIA was between 5 and 500?AU/mL. Assay sensitivity was 0.568?AU/mL. The intra- and inter-assay coefficients of variation were 0.59-3.63% and 3.65-6.81%, respectively. Analytical recovery, dilution tests and serum panel tests were performed using TRFIA and the results proved satisfactory. There were no statistically significant differences in sensitivity and specificity between the TRFIA and commercial ELISAs. An effective, sensitive and accurate quantitative HSV type 1 and type 2 IgG TRFIA was successfully developed and provided diagnostic value in clinical use. Copyright © 2014 John Wiley & Sons, Ltd. PMID:25377426

  15. Design and validation of a homogeneous time-resolved fluorescence cell-based assay targeting the ligand-gated ion channel 5-HT3A.

    PubMed

    Blanc, Emilie; Wagner, Patrick; Plaisier, Fabrice; Schmitt, Martine; Durroux, Thierry; Bourguignon, Jean-Jacques; Partiseti, Michel; Dupuis, Elodie; Bihel, Frederic

    2015-09-01

    Ligand-gated ion channels (LGICs) are considered as attractive protein targets in the search for new therapeutic agents. Nowadays, this strategy involves the capability to screen large chemical libraries. We present a new Tag-lite ligand binding assay targeting LGICs on living cells. This technology combines the use of suicide enzyme tags fused to channels of interest with homogeneous time-resolved fluorescence (HTRF) as the detection readout. Using the 5-HT3 receptor as system model, we showed that the pharmacology of the HALO-5HT3 receptor was identical to that of the native receptor. After validation of the assay by using 5-HT3 agonists and antagonists of reference, a pilot screen enabled us to identify azelastine, a well-known histamine H1 antagonist, as a potent 5-HT3 antagonist. This interesting result was confirmed with electrophysiological experiments. The method described here is easy to implement and could be applicable for other LGICs, opening new ways for the screening of chemical libraries. PMID:25998104

  16. Time-resolved plasma spectroscopy of thin foils heated by a relativistic-intensity short-pulse laser.

    PubMed

    Audebert, P; Shepherd, R; Fournier, K B; Peyrusse, O; Price, D; Lee, R W; Springer, P; Gauthier, J-C; Klein, L

    2002-12-01

    Time-resolved K-shell x-ray spectra are recorded from sub-100 nm aluminum foils irradiated by 150-fs laser pulses at relativistic intensities of Ilambda(2)=2 x 10(18) W microm(2)/cm(2). The thermal penetration depth is greater than the foil thickness in these targets so that uniform heating takes place at constant density before hydrodynamic motion occurs. The high-contrast, high-intensity laser pulse, broad spectral band, and short time resolution utilized in this experiment permit a simplified interpretation of the dynamical evolution of the radiating matter. The observed spectrum displays two distinct phases. At early time, < or =500 fs after detecting target emission, a broad quasicontinuous spectral feature with strong satellite emission from multiply excited levels is seen. At a later time, the He-like resonance line emission is dominant. The time-integrated data is in accord with previous studies with time resolution greater than 1 ps. The early time satellite emission is shown to be a signature of an initial large area, high density, low-temperature plasma created in the foil by fast electrons accelerated by the intense radiation field in the laser spot. We conclude that, because of this early time phenomenon and contrary to previous predictions, a short, high-intensity laser pulse incident on a thin foil does not create a uniform hot and dense plasma. The heating mechanism has been studied as a function of foil thickness, laser pulse length, and intensity. In addition, the spectra are found to be in broad agreement with a hydrodynamic expansion code postprocessed by a collisional-radiative model based on superconfiguration average rates and on the unresolved transition array formalism. PMID:12513417

  17. Validation of a high-power, time-resolved, near-infrared spectroscopy system for measurement of superficial and deep muscle deoxygenation during exercise.

    PubMed

    Koga, Shunsaku; Barstow, Thomas J; Okushima, Dai; Rossiter, Harry B; Kondo, Narihiko; Ohmae, Etsuko; Poole, David C

    2015-06-01

    Near-infrared assessment of skeletal muscle is restricted to superficial tissues due to power limitations of spectroscopic systems. We reasoned that understanding of muscle deoxygenation may be improved by simultaneously interrogating deeper tissues. To achieve this, we modified a high-power (?8 mW), time-resolved, near-infrared spectroscopy system to increase depth penetration. Precision was first validated using a homogenous optical phantom over a range of inter-optode spacings (OS). Coefficients of variation from 10 measurements were minimal (0.5-1.9%) for absorption (?a), reduced scattering, simulated total hemoglobin, and simulated O2 saturation. Second, a dual-layer phantom was constructed to assess depth sensitivity, and the thickness of the superficial layer was varied. With a superficial layer thickness of 1, 2, 3, and 4 cm (?a = 0.149 cm(-1)), the proportional contribution of the deep layer (?a = 0.250 cm(-1)) to total ?a was 80.1, 26.9, 3.7, and 0.0%, respectively (at 6-cm OS), validating penetration to ?3 cm. Implementation of an additional superficial phantom to simulate adipose tissue further reduced depth sensitivity. Finally, superficial and deep muscle spectroscopy was performed in six participants during heavy-intensity cycle exercise. Compared with the superficial rectus femoris, peak deoxygenation of the deep rectus femoris (including the superficial intermedius in some) was not significantly different (deoxyhemoglobin and deoxymyoglobin concentration: 81.3 ± 20.8 vs. 78.3 ± 13.6 ?M, P > 0.05), but deoxygenation kinetics were significantly slower (mean response time: 37 ± 10 vs. 65 ± 9 s, P ? 0.05). These data validate a high-power, time-resolved, near-infrared spectroscopy system with large OS for measuring the deoxygenation of deep tissues and reveal temporal and spatial disparities in muscle deoxygenation responses to exercise. PMID:25840439

  18. Signaling-State Formation Mechanism of a BLUF Protein PapB from the Purple Bacterium Rhodopseudomonas palustris Studied by Femtosecond Time-Resolved Absorption Spectroscopy.

    PubMed

    Fujisawa, Tomotsumi; Takeuchi, Satoshi; Masuda, Shinji; Tahara, Tahei

    2014-12-10

    We studied the signaling-state formation of a BLUF (blue light using FAD) protein, PapB, from the purple bacterium Rhodopseudomonas palustris, using femtosecond time-resolved absorption spectroscopy. Upon photoexcitation of the dark state, FADH(•) (neutral flavin semiquinone FADH radical) was observed as the intermediate before the formation of the signaling state. The kinetic analysis based on singular value decomposition showed that FADH(•) mediates the signaling-state formation, showing that PapB is the second example of FADH(•)-mediated formation of the signaling state after Slr1694 (M. Gauden et al. Proc. Natl. Acad. Sci. U.S.A. 2006, 103, 10895-10900). The mechanism of the signaling-state formation is discussed on the basis of the comparison between femtosecond time-resolved absorption spectra of the dark state and those obtained by exciting the signaling state. FADH(•) was observed also with excitation of the signaling state, and surprisingly, the kinetics of FADH(•) was indistinguishable from the case of exciting the dark state. This result suggests that the hydrogen bond environment in the signaling state is realized before the formation of FADH(•) in the photocycle of PapB. PMID:25406769

  19. Time-Resolved Spectroscopy of the 3 Brightest and Hardest Short Gamma-Ray Bursts Observed with the FGST Gamma-Ray Burst Monitor

    E-print Network

    Guiriec, Sylvain; Connaugthon, Valerie; Kara, Erin; Daigne, Frederic; Kouveliotou, Chryssa; van der Horst, Alexander J; Paciesas, William; Meegan, Charles A; Bhat, P N; Foley, Suzanne; Bissaldi, Elisabetta; Burgess, Michael; Chaplin, Vandiver; Diehl, Roland; Fishman, Gerald; Gibby, Melissa; Giles, Misty; Goldstein, Adam; Greiner, Jochen; Gruber, David; von Kienlin, Andreas; Kippen, Marc; McBreen, Sheila; Preece, Robert; Rau, Arne; Tierney, Dave; Wilson-Hodge, Colleen

    2010-01-01

    From July 2008 to October 2009, the Gamma-ray Burst Monitor (GBM) on board the Fermi Gamma-ray Space Telescope (FGST) has detected 320 Gamma-Ray Bursts (GRBs). About 20% of these events are classified as short based on their T90 duration below 2 s. We present here for the first time time-resolved spectroscopy at timescales as short as 2 ms for the three brightest short GRBs observed with GBM. The time-integrated spectra of the events deviate from the Band function, indicating the existence of an additional spectral component, which can be fit by a power-law with index ~-1.5. The time-integrated Epeak values exceed 2 MeV for two of the bursts, and are well above the values observed in the brightest long GRBs. Their Epeak values and their low-energy power-law indices ({\\alpha}) confirm that short GRBs are harder than long ones. We find that short GRBs are very similar to long ones, but with light curves contracted in time and with harder spectra stretched towards higher energies. In our time-resolved spectrosco...

  20. Concentration measurement of gas embedded in scattering media by employing absorption and time-resolved laser spectroscopy.

    PubMed

    Somesfalean, Gabriel; Sjöholm, Mikael; Alnis, Janis; af Klinteberg, Claes; Andersson-Engels, Stefan; Svanberg, Sune

    2002-06-20

    Diode-laser-based absorption spectroscopy for the evaluation of embedded gas concentrations in porous materials is demonstrated in measurements of molecular oxygen dispersed throughout scattering polystyrene foam, used here as a generic test material. The mean path length of light scattered in the material is determined with the temporal characteristics of the radiation transmitted through the sample. This combined with sensitive gas-absorption measurements employing wavelength-modulation spectroscopy yields an oxygen concentration in polystyrene foam of 20.4% corresponding to a foam porosity of 98%, which is consistent with manufacturing specifications. This feasibility study opens many possibilities for quantitative measurements by using the method of gas-in-scattering-media absorption spectroscopy. PMID:12078678

  1. Time-resolved x-ray photoelectron spectroscopy techniques for real-time studies of interfacial charge transfer dynamics

    SciTech Connect

    Shavorskiy, Andrey; Hertlein, Marcus; Guo Jinghua; Tyliszczak, Tolek [Advanced Light Source, Lawrence Berkeley National Laboratory (United States); Cordones, Amy; Vura-Weis, Josh [Department of Chemistry, University of California Berkeley (United States); Siefermann, Katrin; Slaughter, Daniel; Sturm, Felix; Weise, Fabian; Khurmi, Champak; Belkacem, Ali; Weber, Thorsten; Gessner, Oliver [Ultrafast X-ray Science Laboratory, Chemical Sciences Division, Lawrence Berkeley National Laboratory (United States); Bluhm, Hendrik [Chemical Sciences Division, Lawrence Berkeley National Laboratory (United States); Strader, Matthew; Cho, Hana; Coslovich, Giacomo; Kaindl, Robert A. [Materials Sciences Division, Lawrence Berkeley National Laboratory (United States); Lin, Ming-Fu [Department of Chemistry, University of California Berkeley (United States); Ultrafast X-ray Science Laboratory, Chemical Sciences Division, Lawrence Berkeley National Laboratory (United States); and others

    2013-04-19

    X-ray based spectroscopy techniques are particularly well suited to gain access to local oxidation states and electronic dynamics in complex systems with atomic pinpoint accuracy. Traditionally, these techniques are applied in a quasi-static fashion that usually highlights the steady-state properties of a system rather than the fast dynamics that often define the system function on a molecular level. Novel x-ray spectroscopy techniques enabled by free electron lasers (FELs) and synchrotron based pump-probe schemes provide the opportunity to monitor intramolecular and interfacial charge transfer processes in real-time and with element and chemical specificity. Two complementary time-domain xray photoelectron spectroscopy techniques are presented that are applied at the Linac Coherent Light Source (LCLS) and the Advanced Light Source (ALS) to study charge transfer processes in N3 dye-sensitized ZnO semiconductor nanocrystals, which are at the heart of emerging light-harvesting technologies.

  2. Real-time monitoring of airborne beryllium, at OSHA limit levels, by time-resolved laser-induced breakdown spectroscopy

    SciTech Connect

    Radziemski, L.J.; Loree, T.R.; Cremers, D.A.

    1982-01-01

    Real-time detection of beryllium particulate is being investigated by the new technique of laser-induced breakdown spectroscopy. For beryllium detection we monitor the 313.1-nm feature of once ionized beryllium (Be II). Numerous publications describe the technique, our beryllium results, and other applications. Here we summarize the important points and describe our experiments with beryllium.

  3. Femtosecond time-resolved photoelectron spectroscopy with a vacuum-ultraviolet photon source based on laser high-order harmonic generation.

    PubMed

    Wernet, Philippe; Gaudin, Jérôme; Godehusen, Kai; Schwarzkopf, Olaf; Eberhardt, Wolfgang

    2011-06-01

    A laser-based tabletop approach to femtosecond time-resolved photoelectron spectroscopy with photons in the vacuum-ultraviolet (VUV) energy range is described. The femtosecond VUV pulses are produced by high-order harmonic generation (HHG) of an amplified femtosecond Ti:sapphire laser system. Two generations of the same setup and results from photoelectron spectroscopy in the gas phase are discussed. In both generations, a toroidal grating monochromator was used to select one harmonic in the photon energy range of 20-30 eV. The first generation of the setup was used to perform photoelectron spectroscopy in the gas phase to determine the bandwidth of the source. We find that our HHG source has a bandwidth of 140 ± 40 meV. The second and current generation is optimized for femtosecond pump-probe photoelectron spectroscopy with high flux and a small spot size at the sample of the femtosecond probe pulses. The VUV radiation is focused into the interaction region with a toroidal mirror to a spot smaller than 100 × 100 ?m(2) and the flux amounts to 10(10) photons/s at the sample at a repetition rate of 1 kHz. The duration of the monochromatized VUV pulses is determined to be 120 fs resulting in an overall pump-probe time resolution of 135 ± 5 fs. We show how this setup can be used to map the transient valence electronic structure in molecular dissociation. PMID:21721681

  4. Photoinduced insulator-metal phase transition and the metallic phase propagation in VO2 films investigated by time-resolved terahertz spectroscopy

    NASA Astrophysics Data System (ADS)

    Xue, Xin; Jiang, Meng; Li, Gaofang; Lin, Xian; Ma, Guohong; Jin, Ping

    2013-11-01

    The particle size and film thickness dependence of the photoinduced insulator-metal phase transition in VO2 films has been studied systematically by time-resolved terahertz spectroscopy at room temperature. It is found that the dynamical photoinduced phase transition from insulator to metal consists of two processes: a 1.7 ps fast process and a slow process with a typical time constant of 40 ps. Both of the two processes show particle size independence. The 40 ps slow process is revealed to arise from the longitudinal propagation of the metallic phase from the photoexcited surface to the interior of the VO2 film. A phase boundary propagation speed with a magnitude of ˜2400 m/s is obtained, which is close to the velocity of sound in solid materials and coincides with the prediction of diffusionless phase transformation. Our experimental results clearly establish the entire procedure of photoinduced phase change in the VO2 film.

  5. Direct measurement of S-branch N2-H2 Raman linewidths using time-resolved pure rotational coherent anti-Stokes Raman spectroscopy.

    PubMed

    Bohlin, A; Nordström, E; Patterson, B D; Bengtsson, P-E; Kliewer, C J

    2012-08-21

    S-branch N(2)-H(2) Raman linewidths have been measured in the temperature region 294-1466 K using time-resolved dual-broadband picosecond pure rotational coherent anti-Stokes Raman spectroscopy (RCARS). Data are extracted by mapping the dephasing rates of the CARS signal temporal decay. The J-dependent coherence decays are detected in the time domain by following the individual spectral lines as a function of probe delay. The linewidth data set was employed in spectral fits of N(2) RCARS spectra recorded in binary mixtures of N(2) and H(2) at calibrated temperature conditions up to 661 K using a standard nanosecond RCARS setup. In this region, the set shows a deviation of less than 2% in comparison with thermocouples. The results provide useful knowledge for the applicability of N(2) CARS thermometry on the fuel-side of H(2) diffusion flames. PMID:22920115

  6. Femtosecond time-resolved optical pump-probe spectroscopy at kilohertz-scan-rates over nanosecond-time-delays without mechanical delay line

    NASA Astrophysics Data System (ADS)

    Bartels, A.; Hudert, F.; Janke, C.; Dekorsy, T.; Köhler, K.

    2006-01-01

    We demonstrate a technique for femtosecond time-resolved optical pump-probe spectroscopy that allows to scan over a nanosecond time delay at a kilohertz scan rate without mechanical delay line. Two mode-locked femtosecond lasers with approximately 1 GHz repetition rate are linked at a fixed difference frequency of ?fR=11kHz. One laser delivers the pump pulses, the other provides the probe pulses. The relative time delay is linearly ramped between zero and the inverse laser repetition frequency at a rate ?fR, enabling high-speed scanning over a 1 ns time delay. The advantages of this method for all-optical pump-probe experiments become evident in an observation of coherent acoustic phonons in a semiconductor superlattice via transient reflectivity changes. A detection shot-noise limited signal resolution of 7×10-8 is obtained with a total measurement time of 250 s. The time resolution is 230 fs.

  7. Direct Observation of the Surface Segregation of Cu in Pd by Time-Resolved Positron-Annihilation-Induced Auger Electron Spectroscopy

    SciTech Connect

    Mayer, J.; Hugenschmidt, C.; Schreckenbach, K. [ZWE FRM II, Lichtenbergstrasse 1, 85747 Garching (Germany); Physik Department E21, Technische Universitaet Muenchen, James Franck Strasse, 85748 Garching (Germany)

    2010-11-12

    Density functional theory calculations predict the surface segregation of Cu in the second atomic layer of Pd which has not been unambiguously confirmed by experiment so far. We report measurements on Pd surfaces covered with three and six monolayers of Cu using element selective positron-annihilation-induced Auger electron spectroscopy (PAES) which is sensitive to the topmost atomic layer. Moreover, time-resolved PAES, which was applied for the first time, enables the investigation of the dynamics of surface atoms and hence the observation of the segregation process. The time constant for segregation was experimentally determined to {tau}=1.38(0.21) h, and the final segregated configuration was found to be consistent with calculations. Time-dependent PAES is demonstrated to be a novel element selective technique applicable for the investigation of, e.g., heterogeneous catalysis, corrosion, or surface alloying.

  8. Atomic resolution mapping of the excited-state electronic structure of Cu2O with time-resolved x-ray absorption spectroscopy

    SciTech Connect

    Hillyard, P. W.; Kuchibhatla, S. V. N. T.; Glover, T. E.; Hertlein, M. P.; Huse, Nils; Nachimuthu, P.; Saraf, L. V.; Thevuthasan, S.; Gaffney, K. J.

    2010-05-02

    We have used time-resolved soft x-ray spectroscopy to investigate the electronic structure of optically excited cuprous oxide at the O K-edge and the Cu L3-edge. The 400 nm optical excitation shifts the Cu and O absorptions to lower energy, but does not change the integrated x-ray absorption significantly for either edge. The constant integrated x-ray absorption cross-section indicates that the conduction-band and valence-band edges have very similar Cu 3d and O 2p orbital contributions. The 2.1 eV optical band gap of Cu2O significantly exceeds the one eV shift in the Cu L3- and O K-edges absorption edges induced by optical excitation, demonstrating the importance of core-hole excitonic effects and valence electron screening in the x-ray absorption process.

  9. Photodissociation of CH3CHO at 248 nm by time-resolved Fourier-transform infrared emission spectroscopy: Verification of roaming and triple fragmentation

    NASA Astrophysics Data System (ADS)

    Hung, Kai-Chan; Tsai, Po-Yu; Li, Hou-Kuan; Lin, King-Chuen

    2014-02-01

    By using time-resolved Fourier-transform infrared emission spectroscopy, the HCO fragment dissociated from acetaldehyde (CH3CHO) at 248 nm is found to partially decompose to H and CO. The fragment yields are enhanced by the Ar addition that facilitates the collision-induced internal conversion. The channels to CH2CO + H2 and CH3CO + H are not detected significantly. The rotational population distribution of CO, after removing the Ar collision effect, shows a bimodal feature comprising both low- and high-rotational (J) components, sharing a fraction of 19% and 81%, respectively, for the vibrational state v = 1. The low-J component is ascribed to both roaming pathway and triple fragmentation. They are determined to have a branching ratio of <0.13 and >0.06, respectively, relative to the whole v = 1 population. The CO roaming is accompanied by a highly vibrational population of CH4 that yields a vibrational bimodality.

  10. Observation of femtosecond-laser-induced ablation plumes of aluminum using space- and time-resolved soft x-ray absorption spectroscopy

    SciTech Connect

    Okano, Yasuaki; Oguri, Katsuya; Nishikawa, Tadashi; Nakano, Hidetoshi [NTT Basic Research Laboratories, Nippon Telegraph and Telephone Corporation, 3-1 Morinosato Wakamiya, Atsugi, Kanagawa 243-0198 (Japan)

    2006-11-27

    The dynamics of the laser ablation plume expansion of aluminum was investigated by using space- and time-resolved soft x-ray absorption spectroscopy. Blueshifts of the Al L-shell photoabsorption edge indicating the state of aluminum were observed in the plumes, which were generated by irradiating an aluminum target with 120 fs near-infrared pulses at an intensity of 10{sup 14} W/cm{sup 2}. The spatiotemporal evolution of the plumes exhibited a multilayer structure consisting of vaporized aluminum and condensed aluminum particles, following the expansion of plasma, with expansion velocities of 10{sup 4} m/s for the atomic state and 10{sup 3} m/s for the condensed state.

  11. Energy-Gap Dynamics of Superconducting NbN Thin Films Studied by Time-Resolved Terahertz Spectroscopy

    Microsoft Academic Search

    M. Beck; M. Klammer; S. Lang; P. Leiderer; V. V. Kabanov; G. N. Gol'Tsman; J. Demsar

    2011-01-01

    Using time-domain terahertz spectroscopy we performed direct studies of the photoinduced suppression and recovery of the superconducting gap in a conventional BCS superconductor NbN. Both processes are found to be strongly temperature and excitation density dependent. The analysis of the data with the established phenomenological Rothwarf-Taylor model enabled us to determine the bare quasiparticle recombination rate, the Cooper pair-breaking rate

  12. Noninvasive observation of skeletal muscle contraction using near-infrared time-resolved reflectance and diffusing-wave spectroscopy

    Microsoft Academic Search

    Markus Belau; Markus Ninck; Gernot Hering; Lorenzo Spinelli; Davide Contini; Alessandro Torricelli; Thomas Gisler

    2010-01-01

    We introduce a method for noninvasively measuring muscle contraction in vivo, based on near-infrared diffusing-wave spectroscopy (DWS). The method exploits the information about time-dependent shear motions within the contracting muscle that are contained in the temporal autocorrelation function g(1)(tau,t) of the multiply scattered light field measured as a function of lag time, tau, and time after stimulus, t. The analysis

  13. Time-resolved characterization of a filamentary argon discharge at atmospheric pressure in a capillary using emission and absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Schröter, Sandra; Pothiraja, Ramasamy; Awakowicz, Peter; Bibinov, Nikita; Böke, Marc; Niermann, Benedikt; Winter, Jörg

    2013-11-01

    An argon/nitrogen (0.999/0.001) filamentary pulsed discharge operated at atmospheric pressure in a quartz tube is characterized using voltage-current measurements, microphotography, optical emission spectroscopy (OES) and absorption spectroscopy. Nitrogen is applied as a sensor gas for the purpose of OES diagnostic. The density of argon metastable atoms Ar(3P2) is determined using tunable diode laser absorption spectroscopy (TDLAS). Using a plasma chemical model the measured OES data are applied for the characterization of the plasma conditions. Between intense positive pulses the discharge current oscillates with a damped amplitude. It is established that an electric current flows in this discharge not only through a thin plasma filament that is observed in the discharge image but also through the whole cross section of the quartz tube. A diffuse plasma fills the quartz tube during a time between intense current pulses. Ionization waves are propagating in this plasma between the spike and the grounded area of the tube producing thin plasma channels. The diameter of these channels increases during the pause between the propagation of ionization waves probably because of thermal expansion and diffusion. Inside the channels electron densities of ˜2 × 1013 cm-3, argon metastable densities ˜1014 cm-3 and a reduced electric field about 10 Td are determined.

  14. Homogeneous Time-Resolved Fluorescence-Based Assay to Monitor Extracellular Signal-Regulated Kinase Signaling in a High-Throughput Format

    PubMed Central

    Ayoub, Mohammed Akli; Trebaux, Julien; Vallaghe, Julie; Charrier-Savournin, Fabienne; Al-Hosaini, Khaled; Gonzalez Moya, Arturo; Pin, Jean-Philippe; Pfleger, Kevin D. G.; Trinquet, Eric

    2014-01-01

    The extracellular signal-regulated kinases (ERKs) are key components of multiple important cell signaling pathways regulating diverse biological responses. This signaling is characterized by phosphorylation cascades leading to ERK1/2 activation and promoted by various cell surface receptors including G protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs). We report the development of a new cell-based Phospho-ERK1/2 assay (designated Phospho-ERK), which is a sandwich proximity-based assay using the homogeneous time-resolved fluorescence technology. We have validated the assay on endogenously expressed ERK1/2 activated by the epidermal growth factor as a prototypical RTK, as well as various GPCRs belonging to different classes and coupling to different heterotrimeric G proteins. The assay was successfully miniaturized in 384-well plates using various cell lines endogenously, transiently, or stably expressing the different receptors. The validation was performed for agonists, antagonists, and inhibitors in dose–response as well as kinetic analysis, and the signaling and pharmacological properties of the different receptors were reproduced. Furthermore, the determination of a Z?-factor value of 0.7 indicates the potential of the Phospho-ERK assay for high-throughput screening of compounds that may modulate ERK1/2 signaling. Finally, our study is of great interest in the current context of investigating ERK1/2 signaling with respect to the emerging concepts of biased ligands, G protein-dependent/independent ERK1/2 activation, and functional transactivation between GPCRs and RTKs, illustrating the importance of considering the ERK1/2 pathway in cell signaling PMID:25002860

  15. Subunit-Selective Interrogation of CO Recombination in Carbonmonoxy Hemoglobin by Isotope-Edited Time-resolved Resonance Raman Spectroscopy

    PubMed Central

    Balakrishnan, Gurusamy; Zhao, Xiaojie; Podstawska, Edyta; Proniewicz, Leonard M.; Kincaid, James R.; Spiro, Thomas G.

    2009-01-01

    Hemoglobin is an allosteric tetrameric protein made up of ?? hetero-dimers. The ? and ? chains are similar, but are chemically and structurally distinct. To investigate dynamical differences between the chains, we have prepared tetramers in which the chains are isotopically distinguishable, via reconstitution with 15N-heme. Ligand recombination and heme structural evolution, following HbCO dissociation, was monitored with chain selectivity by resonance Raman (RR) spectroscopy. For ? but not for ? chains, the frequency of the ?4 porphyrin breathing mode increased on the microsecond time scale. This increase is a manifestation of proximal tension in the Hb T-state, and its time course is parallel to the formation of T contacts, as determined previously by UVRR spectroscopy. Despite the localization of proximal constraint in the ? chains, geminate recombination was found to be equally probable in the two chains, with yields of 39 ± 2 %. We discuss the possibility that this equivalence is coincidental, in the sense that it arises from the evolutionary pressure for cooperativity, or that it reflects mechanical coupling across the ?? interface, evidence for which has emerged from UVRR studies of site-mutants. PMID:19245215

  16. Transmission electron microscopy and time resolved optical spectroscopy study of the electronic and structural interactions of ZnO nanorods with bovine serum albumin.

    PubMed

    Klaumünzer, M; Weichsel, U; Ma?kovi?, M; Spiecker, E; Peukert, W; Kryschi, C

    2013-08-22

    The adsorption behavior and electronic interactions of bovine serum albumin (BSA) with ZnO nanorod surfaces were investigated using high-resolution transmission electron microscopy as well as stationary and time-resolved optical spectroscopy techniques. Transmission electron microscopy shows that ZnO nanorod surfaces are surrounded by a homogeneous amorphous BSA film with thicknesses between ~2.5 and 5.0 nm. The electronic structure and adsorption geometry of BSA were examined using high-angle annular dark field scanning transmission electron microscopy combined with electron energy loss spectroscopy. The adsorption process was observed to result into an unfolded conformation of BSA becoming predominantly bound in the side-on orientation at the ZnO surface. This adsorption mode of the BSA molecules allows for a strong interaction with surface states of the ZnO nanorods. This is obvious from its efficient quenching of the defect-center photoluminescence of ZnO. Complementary information of electronic interactions across the ZnO nanorod interface was obtained from femtosecond transient absorption spectroscopy experiments. The rise dynamics of the measured transients revealed altered hole trapping dynamics and, thus, indicated to heterogeneous charge transfer as emerging from adsorbed BSA molecules to defect centers of the ZnO interface. PMID:23889004

  17. Comparison of TiO? and ZnO solar cells sensitized with an indoline dye: time-resolved laser spectroscopy studies of partial charge separation processes.

    PubMed

    Sobu?, Jan; Burdzi?ski, Gotard; Karolczak, Jerzy; Idígoras, Jesús; Anta, Juan A; Zió?ek, Marcin

    2014-03-11

    Time-resolved laser spectroscopy techniques in the time range from femtoseconds to seconds were applied to investigate the charge separation processes in complete dye-sensitized solar cells (DSC) made with iodide/iodine liquid electrolyte and indoline dye D149 interacting with TiO2 or ZnO nanoparticles. The aim of the studies was to explain the differences in the photocurrents of the cells (3-4 times higher for TiO2 than for ZnO ones). Electrochemical impedance spectroscopy and nanosecond flash photolysis studies revealed that the better performance of TiO2 samples is not due to the charge collection and dye regeneration processes. Femtosecond transient absorption results indicated that after first 100 ps the number of photoinduced electrons in the semiconductor is 3 times higher for TiO2 than for ZnO solar cells. Picosecond emission studies showed that the lifetime of the D149 excited state is about 3 times longer for ZnO than for TiO2 samples. Therefore, the results indicate that lower performance of ZnO solar cells is likely due to slower electron injection. The studies show how to correlate the laser spectroscopy methodology with global parameters of the solar cells and should help in better understanding of the behavior of alternative materials for porous electrodes for DSC and related devices. PMID:24568536

  18. Nonresonant ionization of oxygen molecules by femtosecond pulses: Plasma dynamics studied by time-resolved terahertz spectroscopy

    SciTech Connect

    Mics, Zoltan; Kadlec, Filip; Kuzel, Petr; Jungwirth, Pavel; Bradforth, Stephen E.; Apkarian, V. Ara [Institute of Physics, Academy of Sciences of the Czech Republic, and Center for Biomolecules and Complex Molecular Systems, Na Slovance 2, 182 21 Prague 8 (Czech Republic); Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic (Czech Republic); Center for Biomolecules and Complex Molecular Systems, Flemingovo nam. 2, 166 10 Prague 6 (Czech Republic); Department of Chemistry, University of Southern California, Los Angeles, California 90089 (United States); Department of Chemistry, University of California, Irvine, California 92697 (United States)

    2005-09-08

    We show that optical pump-terahertz probe spectroscopy is a direct experimental tool for exploring laser-induced ionization and plasma formation in gases. Plasma was produced in gaseous oxygen by focused amplified femtosecond pulses. The ionization mechanisms at 400- and 800-nm excitation wavelengths differ significantly being primarily of a multiphoton character in the former case and a strong-field process in the latter case. The generation of the plasma in the focal volume of the laser and its expansion on subnanosecond time scale is directly monitored through its density-dependent susceptibility. A Drude model used to evaluate the plasma densities and electron-scattering rates successfully captures the observations for a wide range of pump intensities. In addition, rotational fingerprints of molecular and ionic species were also observed in the spectra.

  19. Time-Resolved Fluorescence Anisotropy of Bicyclo[1.1.1]pentane/Tolane-Based Molecular Rods Included in Tris(o-phenylenedioxy)cyclotriphosphazene (TPP)

    PubMed Central

    2015-01-01

    We examine the fluorescence anisotropy of rod-shaped guests held inside the channels of tris(o-phenylenedioxy)cyclotriphosphazene (TPP) host nanocrystals, characterized by powder X-ray diffraction and solid state NMR spectroscopy. We address two issues: (i) are light polarization measurements on an aqueous colloidal solution of TPP nanocrystals meaningful, or is depolarization by scattering excessive? (ii) Can measurements of the rotational mobility of the included guests be performed at low enough loading levels to suppress depolarization by intercrystallite energy transfer? We find that meaningful measurements are possible and demonstrate that the long axis of molecular rods included in TPP channels performs negligible vibrational motion. PMID:25937858

  20. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg?1 min?1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ?1 and 0.01 s?1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm?1), ADP (1101 and 1205 cm?1), and free phosphate (1078 cm?1). Cleavage of the ?-phosphate–?-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  1. Time resolved visible spectroscopy studies of the plasma sheath evolution in a low energy plasma focus device

    NASA Astrophysics Data System (ADS)

    Avaria, G.; Cuadrado, O.; Moreno, J.; Soto, L.

    2015-03-01

    We present the study of the evolution of the ionization degree of the plasma sheath in a low energy plasma focus device with time and spatial resolution, by means of visible spectroscopy. The measurements were developed in the low energy plasma focus device PF-400J (176-539 J, 880 nF, 20-35 kV, quarter period ?300 ns) [1], using an ANDOR Shamrock 500i visible spectrometer with an ICCD that enabled the acquisition of spectra with time resolution in the order of tens of nanosecond. The use of a lens system improved spatial resolution, allowing the study of the plasma sheath in different stages of the discharge dynamic. In this work we present results from the pinch volume to study the evolution of the ionization degree of the plasma. The results include discharges in pure Hydrogen and a mixture of noble gases and Hydrogen, such as Neon and Helium, which were introduced in the discharge by small percentages ranging from 2 to 5%.

  2. Fluorescence Spectroscopy in a Shoebox

    NASA Astrophysics Data System (ADS)

    Farooq Wahab, M.

    2007-08-01

    This article describes construction of a simple, inexpensive fluorometer. It utilizes a flashlight or sunlight source, highlighter marker ink, bowl of water with mirror as dispersing element, and colored cellophane sheets as filters. The human eye is used as a detector. This apparatus is used to demonstrate important concepts related to fluorescence spectroscopy. Using ink from a highlighter marker, one can demonstrate the difference between light scattering and fluorescence emission, the need for an intense light source, phenomenon of the Stokes shift, the choice of filters, the preferred geometry of excitation source and emission detector, and the low detection limits that can be achieved by fluorescence measurements. By reflecting the fluorescence emission from a compact disk, it can be seen that the light emitted by molecules is not monochromatic. Furthermore, a spectrofluorometer is constructed using gratings made from a DVD or a CD. The shoebox fluorometer and spectrofluorometer can serve as useful teaching aids in places where commercial instruments are not available, and it avoids the black box problem of modern instruments.

  3. Pulse laser photolysis of aqueous ozone in the microsecond range studied by time-resolved far-ultraviolet absorption spectroscopy.

    PubMed

    Goto, Takeyoshi; Morisawa, Yusuke; Higashi, Noboru; Ikehata, Akifumi; Ozaki, Yukihiro

    2013-05-01

    Chemical dynamics of an ozone (O3) pulse-photolytic reaction in aqueous solutions were studied with pump-probe transient far-ultraviolet (FUV) absorption spectroscopy. With a nanosecond pulse laser of 266 nm as pump light, transient spectra of O3 aqueous solutions (78-480 ?M, pH 2.5-11.3) were acquired in the time range from -50 to 50 ?s in the wavelength region from 190 to 225 nm. The measured transient spectra were linearly decomposed into the molar absorption coefficients and the concentration-time profiles of constituted chemical components with a multivariate curve resolution method. From the dependences of the time-averaged concentrations for 20 ?s of the constituted chemicals on the initial concentration of O3, it was found that the transient spectra involve the decomposition of O3 and the formation of hydrogen peroxide (H2O2) and a third component that is assigned to hydroxyl radical (OH) or perhydroxyl radical (HO2). Furthermore, the pH dependence of the time-averaged concentration of the third components indicates that HO2 is more probable than OH as the third component. The time-averaged concentration ratio of each chemical component to the initial O3 concentration depends on the pH conditions from -0.95 to -0.60 for O3, 0.98 to 1.2 for H2O2, 0.002 to 0.29 for OH, and 0.012 to 0.069 for HO2. PMID:23560681

  4. Diffusion and molecular interactions in a methanol/polyimide system probed by coupling time-resolved FTIR spectroscopy with gravimetric measurements

    PubMed Central

    Musto, Pellegrino; Galizia, Michele; La Manna, Pietro; Pannico, Marianna; Mensitieri, Giuseppe

    2013-01-01

    In this contribution the diffusion of methanol in a commercial polyimide (PMDA-ODA) is studied by coupling gravimetric measurements with in-situ, time-resolved FTIR spectroscopy. The spectroscopic data have been treated with two complementary techniques, i.e., difference spectroscopy (DS) and least-squares curve fitting (LSCF). These approaches provided information about the overall diffusivity, the nature of the molecular interactions among the system components and the dynamics of the various molecular species. Additional spectroscopic measurements on thin film samples (about 2 ?m) allowed us to identify the interaction site on the polymer backbone and to propose likely structures for the H-bonding aggregates. Molar absorptivity values from a previous literature report allowed us to estimate the population of first-shell and second-shell layers of methanol in the polymer matrix. In terms of diffusion kinetics, the gravimetric and spectroscopic estimates of the diffusion coefficients were found to be in good agreement with each other and with previous literature reports. A Fickian behavior was observed throughout, with diffusivity values markedly affected by the total concentration of sorbed methanol. PMID:24809042

  5. Sensitivity correction for the influence of the fat layer on muscle oxygenation and estimation of fat thickness by time-resolved spectroscopy

    NASA Astrophysics Data System (ADS)

    Ohmae, Etsuko; Nishio, Shinichiro; Oda, Motoki; Suzuki, Hiroaki; Suzuki, Toshihiko; Ohashi, Kyoichi; Koga, Shunsaku; Yamashita, Yutaka; Watanabe, Hiroshi

    2014-06-01

    Near-infrared spectroscopy (NIRS) has been used for noninvasive assessment of oxygenation in living tissue. For muscle measurements by NIRS, the measurement sensitivity to muscle (S) is strongly influenced by fat thickness (FT). In this study, we investigated the influence of FT and developed a correction curve for S with an optode distance (3 cm) sufficiently large to probe the muscle. First, we measured the hemoglobin concentration in the forearm (n=36) and thigh (n=6) during arterial occlusion using a time-resolved spectroscopy (TRS) system, and then FT was measured by ultrasound. The correction curve was derived from the ratio of partial mean optical path length of the muscle layer to observed mean optical path length . There was good correlation between FT and at rest, and could be used to estimate FT. The estimated FT was used to validate the correction curve by measuring the forearm blood flow (FBF) by strain-gauge plethysmography (SGP_FBF) and TRS (TRS_FBF) simultaneously during a reactive hyperemia test with 16 volunteers. The corrected TRS_FBF results were similar to the SGP_FBF results. This is a simple method for sensitivity correction that does not require use of ultrasound.

  6. Interaction of recombinant human epidermal growth factor with phospholipid vesicles. A steady-state and time-resolved fluorescence study of the bis-tryptophan sequence (TRP 49 TRP 50 )

    Microsoft Academic Search

    Ines M. Sierra; Michel Vincent; Gabriel Padron; Jacques Gallay

    1992-01-01

    The interaction of recombinant human epidermal growth factor with small unilamellar phospholipid vesicles was studied by steady-state and time-resolved fluorescence of the bis-tryptophan sequence (Trp49-Trp50). Steady-state anisotropy measurements demonstrate that strong binding occurred with small unilamellar vesicles made up of acidic phospholipids at acidic pH only (pH= 4.7). An apparent stoichiometry for 1,2-dimyristoyl-sn-phosphoglycerol of about 12 phospholipid molecules per molecule

  7. Time-resolved UV-IR pump-stimulated emission pump spectroscopy to probe collisional relaxation of $8p\\,^2P_{3/2}$ Cs I

    E-print Network

    Salahuddin, Mohammed; McFarland, Jacob; Bayram, S Burcin

    2015-01-01

    We describe and use a time-resolved pump-stimulated emission pump spectroscopic technique to measure collisional relaxation in a high-lying energy level of atomic cesium. Aligned $8p\\,^2P_{3/2}$ cesium atoms were produced by a pump laser. A second laser, the stimulated emission pump, promoted the population exclusively to the $5d\\,^2D_{5/2}$ level. The intensity of the $5d\\,^2D_{5/2}\\rightarrow6s\\,^2S_{1/2}$ cascade fluorescence at 852.12 nm was monitored. The linear polarization dependence of the $6s\\,^2S_{1/2}\\rightarrow8p\\,^2P_{3/2}\\rightarrow5d\\,^2S_{5/2}$ transition was measured in the presence of argon gas at various pressures. From the measurement, we obtained the disalignment cross section value for the $8p\\,^2P_{3/2}$ level due to collisions with ground-level argon atoms.

  8. Femtosecond time-resolved X-ray absorption spectroscopy of liquid using a hard X-ray free electron laser in a dual-beam dispersive detection method.

    PubMed

    Obara, Yuki; Katayama, Tetsuo; Ogi, Yoshihiro; Suzuki, Takayuki; Kurahashi, Naoya; Karashima, Shutaro; Chiba, Yuhei; Isokawa, Yusuke; Togashi, Tadashi; Inubushi, Yuichi; Yabashi, Makina; Suzuki, Toshinori; Misawa, Kazuhiko

    2014-01-13

    We present femtosecond time-resolved X-ray absorption spectroscopy of aqueous solution using a hard x-ray free electron laser (SACLA) and a synchronized Ti:sapphire laser. The instrumental response time is 200 fs, and the repetition rate of measurement is 10 Hz. A cylindrical liquid beam 100 ?m in diameter of aqueous ammonium iron(III) oxalate solution is photoexcited at 400 nm, and the transient X-ray absorption spectra are measured in the K-edge region of iron, 7.10 - 7.26 keV, using a dual X-ray beam dispersive detection method. Each of the dual beams has the pulse energy of 1.4 ?J, and pump-induced absorbance change on the order of 10(-3) is successfully detected. The photoexcited iron complex exhibits a red shifted iron K-edge with the appearance time constant of 260 fs. The X-ray absorption difference spectra, with and without the pump pulses, are independent of time delay after 1.5 ps up to 100 ps, indicating that the photoexcited species is long-lived. PMID:24515070

  9. Charge Photoinjection in Intercalated and Covalently Bound [Re(CO)3(dppz)(py)]+-DNA Constructs Monitored by Time Resolved Visible and Infrared Spectroscopy

    PubMed Central

    Olmon, Eric D.; Sontz, Pamela A.; Blanco-Rodríguez, Ana María; Towrie, Michael; Clark, Ian P.; Vl?ek, Antonín; Barton, Jacqueline K.

    2011-01-01

    The complex [Re(CO)3(dppz)(py?-OR)]+ (dppz = dipyrido[3,2-a:2?,3?-c]phenazine; py?-OR = 4-functionalized pyridine) offers IR sensitivity and can oxidize DNA directly from the excited state, making it a promising probe for the study of DNA-mediated charge transport (CT). The behavior of several covalent and noncovalent Re-DNA constructs was monitored by time-resolved IR (TRIR) and UV/visible spectroscopies, as well as biochemical methods, confirming the long-range oxidation of DNA by the excited complex. Optical excitation of the complex leads to population of MLCT and at least two distinct intraligand states. Experimental observations that are consistent with charge injection from these excited states include similarity between long-time TRIR spectra and the reduced state spectrum observed by spectroelectrochemistry, the appearance of a guanine radical signal in TRIR spectra, and the eventual formation of permanent guanine oxidation products. The majority of reactivity occurs on the ultrafast timescale, although processes dependent on slower conformational motions of DNA, such as the accumulation of oxidative damage at guanine, are also observed. The ability to measure events on such disparate timescales, its superior selectivity in comparison to other spectroscopic techniques, and the ability to simultaneously monitor carbonyl ligand and DNA IR absorption bands makes TRIR a valuable tool for the study of CT in DNA. PMID:21827149

  10. Statistical Time-resolved Spectroscopy: A Higher Fraction of Short-period Binaries for Metal-rich F-type Dwarfs in SDSS

    NASA Astrophysics Data System (ADS)

    Hettinger, T.; Badenes, C.; Strader, J.; Bickerton, S. J.; Beers, T. C.

    2015-06-01

    Stellar multiplicity lies at the heart of many problems in modern astrophysics, including the physics of star formation, the observational properties of unresolved stellar populations, and the rates of interacting binaries such as cataclysmic variables, X-ray binaries, and SNe Ia. However, little is known about the stellar multiplicity of field stars in the Milky Way (MW), in particular about the differences in the multiplicity characteristics between metal-rich disk stars and metal-poor halo stars. In this study we perform a statistical analysis of ?14,000 F-type dwarf stars in the MW through time-resolved spectroscopy with the sub-exposures archived in the Sloan Digital Sky Survey. We obtain absolute radial velocity (RV) measurements through template cross-correlation of individual sub-exposures with temporal baselines varying from minutes to years. These sparsely sampled RV curves are analyzed using Markov chain Monte Carlo techniques to constrain the very short-period binary fraction for field F-type stars in the MW. Metal-rich disk stars were found to be 30% more likely to have companions with periods shorter than 12 days than metal-poor halo stars.

  11. Statistical Time-Resolved Spectroscopy: A higher fraction of short-period binaries for metal-rich F-type dwarfs in SDSS

    E-print Network

    Hettinger, T; Strader, J; Bickerton, S J; Beers, T C

    2015-01-01

    Stellar multiplicity lies at the heart of many problems in modern astrophysics, including the physics of star formation, the observational properties of unresolved stellar populations, and the rates of interacting binaries such as cataclysmic variables, X-ray binaries, and Type Ia supernovae. However, little is known about the stellar multiplicity of field stars in the Milky Way, in particular about the differences in the multiplicity characteristics between metal-rich disk stars and metal-poor halo stars. In this study we perform a statistical analysis of ~15,000 F-type dwarf stars in the Milky Way through time-resolved spectroscopy with the sub-exposures archived in the Sloan Digital Sky Survey. We obtain absolute radial velocity measurements through template cross-correlation of individual sub-exposures with temporal baselines varying from minutes to years. These sparsely sampled radial velocity curves are analyzed using Markov chain Monte Carlo techniques to constrain the very short-period binary fraction...

  12. Generation and characterization of the selenocysteinyl radical: direct evidence from time-resolved UV/Vis, electron paramagnetic resonance, and Fourier transform infrared spectroscopy.

    PubMed

    Kolano, Christoph; Bucher, Götz; Schade, Olaf; Grote, Dirk; Sander, Wolfram

    2005-08-19

    The selenocysteinyl radical 1 has been generated for the first time by laser flash photolysis (lambda(exc) = 266 nm) of dimethyl bis(N-tert-butoxycarbonyl)-l-selenocystine 2 and of [(9-fluorenylideneamino)oxycarbonyl]methyl(N-tert-butoxycarbonyl)-l-selenocysteine 3 in acetonitrile and characterized by time-resolved (TR) UV/Vis, Fourier transform infrared (FTIR), and electron paramagnetic spectroscopy in combination with theoretical methods. A detailed product study was conducted using gas chromatography and one- and two-dimensional NMR spectroscopy. In the case of [(9-fluorenylideneamino)oxycarbonyl]methyl(N-tert-butoxycarbonyl)-l-selenocysteine 3, the (9-fluorenylideneamino)oxycarbonyl moiety serves as a photolabile protection group providing a "caged selenocysteinyl radical" suitable for biophysical applications. Cleavage of the diselenide bridge or the selenium-carbonyl bond by irradiation is possible in high quantum yields. Because of the lack of a good IR chromophore in the mid-IR region, the selenocysteinyl radical 1 cannot be monitored directly by TR FTIR spectroscopy. TR UV/Vis spectroscopy revealed the formation of the selenocysteinyl radical 1 from both precursors. The selenocysteinyl radical 1 has a lifetime tau approximately 63 mus and exhibits a strong band located at lambda(max) = 335 nm. Calculated UV absorptions of the selenocysteinyl radical (UB3LYP/6-311G(d,p)) are in good agreement with the experimental results. The use of TR UV/Vis spectroscopy permitted the determination of the decay rates of the selenocysteinyl radical in the presence of two quenchers. The product studies demonstrated the reversible photoreaction of dimethyl bis(N-tert-butoxycarbonyl)-l-selenocystine 2. Products of the photolysis of the "caged selenocysteinyl radical" precursor 3 are dimethyl bis(N-tert-butoxycarbonyl)-l-selenocystine 2, carbon dioxide, and some further smaller fragments. In addition, the photodecomposition of the (9-fluorenylideneamino)oxycarbonyl moiety produced 9-fluorenone-oxime 4, 9-fluoren-imine 5, and 6 and 7 as products of the dimerization of two 9-fluorenoneiminoxy radicals 8. PMID:16095277

  13. Photo-Induced Spin-State Conversion in Solvated Transition Metal Complexes Probed via Time-Resolved Soft X-ray Spectroscopy

    SciTech Connect

    Huse, Nils; Kim, Tae Kyu; Jamula, Lindsey; McCusker, James K.; de Groot, Frank M. F.; Schoenlein, Robert W.

    2010-04-30

    Solution-phase photoinduced low-spin to high-spin conversion in the FeII polypyridyl complex [Fe(tren(py)3)]2+ (where tren(py)3 is tris(2-pyridylmethyliminoethyl)amine) has been studied via picosecond soft X-ray spectroscopy. Following 1A1 --> 1MLCT (metal-to-ligand charge transfer) excitation at 560 nm, changes in the iron L2- and L3-edges were observed concomitant with formation of the transient high-spin 5T2 state. Charge-transfer multiplet calculations coupled with data acquired on low-spin and high-spin model complexes revealed a reduction in ligand field splitting of 1 eV in the high-spin state relative to the singlet ground state. A significant reduction in orbital overlap between the central Fe-3d and the ligand N-2p orbitals was directly observed, consistent with the expected ca. 0.2 Angstrom increase in Fe-N bond length upon formation of the high-spin state. The overall occupancy of the Fe-3d orbitals remains constant upon spin crossover, suggesting that the reduction in sigma-donation is compensated by significant attenuation of pi-back-bonding in the metal-ligand interactions. These results demonstrate the feasibility and unique potential of time-resolved soft X-ray absorption spectroscopy to study ultrafast reactions in the liquid phase by directly probing the valence orbitals of first-row metals as well as lighter elements during the course of photochemical transformations.

  14. Intermolecular Hydrogen Bonds Formed Between Amino Acid Molecules in Aqueous Solution Investigated by Temperature-jump Nanosecond Time-resolved Transient Mid-IR Spectroscopy

    NASA Astrophysics Data System (ADS)

    Ye, Man-ping; Li, Heng; Zhang, Qing-li; Weng, Yu-xiang; Qiu, Xiang-gang

    2007-08-01

    Carboxyl (COO-) vibrational modes of two amino acids histidine and glycine in D2O solution were investigated by temperature-dependent FTIR spectroscopy and temperature-jump nanosecond time-resolved IR difference absorbance spectroscopy. The results show that hydrogen bonds are formed between amino acid molecules as well as between the amino acid molecule and the solvent molecules. The asymmetric vibrational frequency of COO- around 1600-1610 cm-1 is blue shifted when raising temperature, indicating that the strength of the hydrogen bonds becomes weaker at higher temperature. Two bleaching peaks at 1604 and 1612 cm-1 were observed for histidine in response to a temperature jump from 10 °C to 20 °C. The lower vibrational frequency at 1604 cm-1 is assigned to the chain COO- group which forms the intermolecular hydrogen bond with NH3+ group, while the higher frequency at 1612 cm-1 is assigned to the end COO- group forming hydrogen bonds with the solvent molecules. This is because that the hydrogen bonds in the former are expected to be stronger than the latter. In addition the intensities of these two bleaching peaks are almost the same. In contrast, only the lower frequency at 1604 cm-1 bleaching peak has been observed for glycine. The fact indicates that histidine molecules form a dimer-like intermolecular chain while glycine forms a relatively longer chain in the solution. The rising phase of the IR absorption kinetics in response to the temperature-jump detected at 1604 cm-1 for histidine is about 30+/-10 ns, within the resolution limit of our instrument, indicating that breaking or weakening the hydrogen bond is a very fast process.

  15. Soft X-ray Laser Microscopy of Lipid Rafts towards GPCR-Based Drug Discovery Using Time-Resolved FRET Spectroscopy

    PubMed Central

    Baba, Motoyoshi; Kozasa, Tohru; Hamakubo, Takao; Kuroda, Hiroto; Masuda, Kazuyuki; Yoneya, Shin; Kodama, Tatsuhiko

    2011-01-01

    Many signaling molecules involved in G protein-mediated signal transduction, which are present in the lipid rafts and believed to be controlled spatially and temporally, influence the potency and efficacy of neurotransmitter receptors and transporters. This has focus interest on lipid rafts and the notion that these microdomains acts as a kind of signaling platform and thus have an important role in the expression of membrane receptor-mediated signal transduction, cancer, immune responses, neurotransmission, viral infections and various other phenomena due to specific and efficient signaling according to extracellular stimuli. However, the real structure of lipid rafts has not been observed so far due to its small size and a lack of sufficiently sophisticated observation systems. A soft X-ray microscope using a coherent soft X-ray laser in the water window region (2.3–4.4 nm) should prove to be a most powerful tool to observe the dynamic structure of lipid rafts of several tens of nanometers in size in living cells. We have developed for the X-ray microscope a new compact soft X-ray laser using strongly induced plasma high harmonic resonance. We have also developed a time-resolved highly sensitive fluorescence resonance energy transfer (FRET) system and confirmed protein-protein interactions coupled with ligands. The simultaneous use of these new tools for observation of localization of G-protein coupled receptors (GPCRs) in rafts has become an important and optimum tool system to analyze the dynamics of signal transduction through rafts as signaling platform. New technology to visualize rafts is expected to lead to the understanding of those dynamics and innovative development of drug discovery that targets GPCRs localized in lipid rafts.

  16. Time-resolved fluorescence studies of tryptophan mutants of Escherichia coli glutamine synthetase: conformational analysis of intermediates and transition-state complexes.

    PubMed Central

    Atkins, W. M.; Villafranca, J. J.

    1992-01-01

    Single tryptophan-containing mutants of low adenylylation state Escherichia coli glutamine synthetase have been studied by frequency-domain fluorescence spectroscopy in the presence of various substrates and inhibitors. At pH 6.5, the Mn-bound wild-type enzyme (wild type has two tryptophans/subunit) and the mutant enzymes exhibit heterogeneous fluorescence decay kinetics; the individual tryptophans are adequately described by a triple exponential decay scheme. The recovered lifetime values are 5.9 ns, 2.6 ns, and 0.4 ns for Trp-57 and 5.8 ns, 2.3 ns, and 0.4 ns for Trp-158. These values are nearly identical to the previously reported results at pH 7.5 (Atkins, W.M., Stayton, P.S., & Villafranca, J.J., 1991, Biochemistry 30, 3406-3416). In addition, Trp-57 and Trp-158 both exhibit an ATP-induced increase in the relative fraction of the long lifetime component, whereas only Trp-57 is affected by this ligand at pH 7.5. The transition-state analogue L-methionine-(R,S)-sulfoximine (MSOX) causes a dramatic increase in the fractional intensity of the long lifetime component of Trp-158. This ligand has no effect on the W158S mutant protein and causes a small increase in the fractional intensity of the long lifetime component of the W158F mutant protein. Addition of glutamate to the ATP complex, which affords the gamma-glutamylphosphate-ADP complex, results in the presence of new lifetime components at 7, 3.2, and 0.5 ns for Trp-158, but has no effect on Trp-57. Similar results were obtained when ATP was added to the MSOX complex; Trp-57 exhibits heterogeneous fluorescence decay with lifetimes of 7, 3.5, and 0.8 ns. Decay kinetics of Trp-158 are best fit to a nearly homogeneous decay with a lifetime of 5.5 ns in the MSOX-ATP inactivated complex. These results provide a model for the sequence of structural and dynamic changes that take place at the Trp-57 loop and the central loop (Trp-158) during several intermediate stages of catalysis. PMID:1363912

  17. Reduction of V?O2 slow component by priming exercise: novel mechanistic insights from time-resolved near-infrared spectroscopy.

    PubMed

    Fukuoka, Yoshiyuki; Poole, David C; Barstow, Thomas J; Kondo, Narihiko; Nishiwaki, Masato; Okushima, Dai; Koga, Shunsaku

    2015-06-01

    Novel time-resolved near-infrared spectroscopy (TR-NIRS), with adipose tissue thickness correction, was used to test the hypotheses that heavy priming exercise reduces the V?O2 slow component (V?O2SC) (1) by elevating microvascular [Hb] volume at multiple sites within the quadriceps femoris (2) rather than reducing the heterogeneity of muscle deoxygenation kinetics. Twelve subjects completed two 6-min bouts of heavy work rate exercise, separated by 6 min of unloaded cycling. Priming exercise induced faster overall V?O2 kinetics consequent to a substantial reduction in the V?O2SC (0.27 ± 0.12 vs. 0.11 ± 0.09 L·min(-1), P < 0.05) with an unchanged primary V?O2 time constant. An increased baseline for the primed bout [total (Hb + Mb)] (197.5 ± 21.6 vs. 210.7 ± 22.5 ?mol L(-1), P < 0.01), reflecting increased microvascular [Hb] volume, correlated significantly with the V?O2SC reduction. At multiple sites within the quadriceps femoris, priming exercise reduced the baseline and slowed the increase in [deoxy (Hb + Mb)]. Changes in the intersite coefficient of variation in the time delay and time constant of [deoxy (Hb + Mb)] during the second bout were not correlated with the V?O2SC reduction. These results support a mechanistic link between priming exercise-induced increase in muscle [Hb] volume and the reduced V?O2SC that serves to speed overall V?O2 kinetics. However, reduction in the heterogeneity of muscle deoxygenation kinetics does not appear to be an obligatory feature of the priming response. PMID:26109190

  18. Radiolytic oxidation of 1,2,4-benzenetriol. An application of time-resolved resonance Raman spectroscopy to kinetic studies of reaction intermediates

    SciTech Connect

    Qin, L.; Tripathi, G.N.R.; Schuler, R.H.

    1987-03-26

    In acidic solution, 1,2,4-benzenetriol is rapidly oxidized by OH or N/sub 3/ to form a mixture of neutral 2,4- and 3,4-dihydroxyphenoxyl radicals. At higher pH these radicals deprotonate (pK/sub a/(1) = 4.75) to form the 2-hydroxy-p-benzosemiquinone radical anion which exhibits a prominent resonance Raman band at 1625 cm/sup -1/ attributable to the Wilson 8a ring stretching mode. In basic solutions this radical subsequently reacts with OH/sup -/ to form the radical dianion (pK/sub a/(2) = 8.85) in which the 8a band is shifted to an appreciably lower frequency (1587 cm/sup -1/). While the absorption spectra of these latter radicals are very similar and do not allow ready examination of their interconversion by absorption spectrophotometry, the difference between these 8a frequencies is sufficiently great that the Raman method can be used to examine the acid-base equilibrium between the two forms of the radical and to follow the deprotonation kinetics. It is shown that even at high pH the radical monoanion is initially formed on oxidation by N/sub 3/ and that deprotonation subsequently occurs by its reaction with base with a rate constant of (9.6 +/- 1.5) x 10/sup 9/ M/sup -1/ d/sup -1/. These studies illustrate very well the application of time-resolved resonance Raman spectroscopy as a complement to kinetic spectrophotometry in sorting out the details of secondary processes in pulse radiolysis studies.

  19. Subpicosecond oxygen trapping in the heme pocket of the oxygen sensor FixL observed by time-resolved resonance Raman spectroscopy.

    PubMed

    Kruglik, Sergei G; Jasaitis, Audrius; Hola, Klara; Yamashita, Taku; Liebl, Ursula; Martin, Jean-Louis; Vos, Marten H

    2007-05-01

    Dissociation of oxygen from the heme domain of the bacterial oxygen sensor protein FixL constitutes the first step in hypoxia-induced signaling. In the present study, the photodissociation of the heme-O2 bond was used to synchronize this event, and time-resolved resonance Raman (TR(3)) spectroscopy with subpicosecond time resolution was implemented to characterize the heme configuration of the primary photoproduct. TR(3) measurements on heme-oxycomplexes are highly challenging and have not yet been reported. Whereas in all other known six-coordinated heme protein complexes with diatomic ligands, including the oxymyoglobin reported here, heme iron out-of-plane motion (doming) occurs faster than 1 ps after iron-ligand bond breaking; surprisingly, no sizeable doming is observed in the oxycomplex of the Bradyrhizobium japonicum FixL sensor domain (FixLH). This assessment is deduced from the absence of the iron-histidine band around 217 cm(-1) as early as 0.5 ps. We suggest that efficient ultrafast oxygen rebinding to the heme occurs on the femtosecond time scale, thus hindering heme doming. Comparing WT oxy-FixLH, mutant proteins FixLH-R220H and FixLH-R220Q, the respective carbonmonoxy-complexes, and oxymyoglobin, we show that a hydrogen bond of the terminal oxygen atom with the residue in position 220 is responsible for the observed behavior; in WT FixL this residue is arginine, crucially implicated in signal transmission. We propose that the rigid O2 configuration imposed by this residue, in combination with the hydrophobic and constrained properties of the distal cavity, keep dissociated oxygen in place. These results uncover the origin of the "oxygen cage" properties of this oxygen sensor protein. PMID:17446273

  20. Stark-assisted population control of coherent CS(2) 4f and 5p Rydberg wave packets studied by femtosecond time-resolved photoelectron spectroscopy.

    PubMed

    Knappenberger, Kenneth L; Lerch, Eliza-Beth W; Wen, Patrick; Leone, Stephen R

    2007-09-28

    A two-color (3+1(')) pump-probe scheme is employed to investigate Rydberg wave packet dynamics in carbon disulfide (CS(2) (*)). The state superpositions are created within the 4f and 5p Rydberg manifolds by three photons of the 400 nm pump pulse, and their temporal evolution is monitored with femtosecond time-resolved photoelectron spectroscopy using an 800 nm ionizing probe pulse. The coherent behavior of the non-stationary superpositions are observed through wavepacket revivals upon ionization to either the upper (12) or lower (32) spin-orbit components of CS(2) (+). The results show clearly that the composition of the wavepacket can be efficiently controlled by the power density of the excitation pulse over a range from 500 GWcm(2) to 10 TWcm(2). The results are consistent with the anticipated ac-Stark shift for 400 nm light and demonstrate an effective method for population control in molecular systems. Moreover, it is shown that Rydberg wavepackets can be formed in CS(2) with excitation power densities up to 10 TWcm(2) without significant fragmentation. The exponential 1e population decay (T(1)) of specific excited Rydberg states are recovered by analysis of the coherent part of the signal. The dissociation lifetimes of these states are typically 1.5 ps. However, a region exhibiting a more rapid decay ( approximately 800 fs) is observed for states residing in the energy range of 74 450-74 550 cm(-1), suggestive of an enhanced surface crossing in this region. PMID:17902914

  1. Time-Resolved Measurements in Optoelectronic Microbioanalysis

    NASA Technical Reports Server (NTRS)

    Bearman, Gregory; Kossakovski, Dmitri

    2003-01-01

    A report presents discussion of time-resolved measurements in optoelectronic microbioanalysis. Proposed microbioanalytical laboratory-on-a-chip devices for detection of microbes and toxic chemicals would include optoelectronic sensors and associated electronic circuits that would look for fluorescence or phosphorescence signatures of multiple hazardous biomolecules in order to detect which ones were present in a given situation. The emphasis in the instant report is on gating an active-pixel sensor in the time domain, instead of filtering light in the wavelength domain, to prevent the sensor from responding to a laser pulse used to excite fluorescence or phosphorescence while enabling the sensor to respond to the decaying fluorescence or phosphorescence signal that follows the laser pulse. The active-pixel sensor would be turned on after the laser pulse and would be used to either integrate the fluorescence or phosphorescence signal over several lifetimes and many excitation pulses or else take time-resolved measurements of the fluorescence or phosphorescence. The report also discusses issues of multiplexing and of using time-resolved measurements of fluorophores with known different fluorescence lifetimes to distinguish among them.

  2. Fluorescence spectroscopy applied to orange trees

    NASA Astrophysics Data System (ADS)

    Marcassa, L. G.; Gasparoto, M. C. G.; Belasque, J., Jr.; Lins, E. C.; Dias Nunes, F.; Bagnato, V. S.

    2006-05-01

    In this work, we have applied laser-induced fluorescence spectroscopy to investigate biological processes in orange trees (Citrus aurantium L.). We have chosen to investigate water stress and Citrus Canker, which is a disease caused by the Xanthomonas axonopodis pv. citri bacteria. The fluorescence spectroscopy was investigated by using as an excitation source a 442-nm 15-mW HeCd gas multimode discharge laser and a 532-nm 10-mW Nd3+:YAG laser. The stress manifestation was detected by the variation of fluorescence ratios of the leaves at different wavelengths. The fluorescence ratios present a significant variation, showing the possibility to observe water stress by fluorescence spectrum. The Citrus Canker’s contaminated leaves were discriminated from the healthy leaves using a more complex analysis of the fluorescence spectra. However, we were unable to discriminate it from another disease, and new fluorescence experiments are planned for the future.

  3. Quantification of cerebral hemoglobin as a function of oxygenation using near-infrared time-resolved spectroscopy in a piglet model of hypoxia.

    PubMed

    Ijichi, Sonoko; Kusaka, Takashi; Isobe, Kenich; Islam, Fahmida; Okubo, Kensuke; Okada, Hitoshi; Namba, Masanori; Kawada, Kou; Imai, Tadashi; Itoh, Susumu

    2005-01-01

    Near-infrared spectroscopy (NIRS) has been used for measurement of cerebral hemoglobin (Hb) concentrations in neonates to study cerebral oxygenation and hemodynamics. We perform measurements by portable three-wavelength NIR time-resolved spectroscopy (TRS) in a piglet hypoxia model with various degrees of oxygenation to estimate the absorption coefficient (mu(a)) and reduced scattering coefficient (mu(s)') of the head. Measurements of absolute values of mu(a) at three wavelengths enable estimation of Hb concentration and Hb oxygen saturation in the head (SO2). However, there is a problem concerning which background absorption should be used to estimate Hb concentration in the head derived from mu(a) at three wavelengths because it is different from a simple in vitro model. Therefore, we use two different background absorption values with the assumption that background absorption is due only to 85% (by volume) water or that background absorption is equal to absorption of the piglet head with blood exchange transfusion by fluorocarbon (FC), and we compared SO2 measured by TRS with arterial Hb oxygen saturation (SaO2) and sagittal sinus venous Hb oxygen saturation (SvO2) measured by a co-oximeter at several inspired fractional O2(FI(O2)) concentrations. We find that SO2 values using the absorption (abs) of the piglet head with blood exchange transfusion (BET) by FC are not significantly different from SO2 values using the water-only background at FI(O2) in the range of 15 to 100%, but that the values using abs of the head with BET by FC are lower than the values using the water-only background at FI(O2) in the range of 12 to 4%. The SO2 values calculated from the water-only background are higher than those of SaO2 at FI(O2) in the range of 10 to 4%. However, SO2 values using the abs of the head with BET by FC are between those of SaO2 and SvO2 over the whole range of FI(O2). Therefore, abs of the head with BET by FC is more useful for estimation of the absolute values of oxyHb and deoxyHb of the piglet head. PMID:15910099

  4. Hydrogen-bond network probed by time-resolved optoacoustic spectroscopy: photoactive yellow protein and the effect of E46Q and E46A mutations.

    PubMed

    Losi, Aba; Gensch, Thomas; van der Horst, Michael A; Hellingwerf, Klaas J; Braslavsky, Silvia E

    2005-05-21

    The enthalpy and structural volume changes (delta Hi and delta Vi) produced upon photoinduced formation and decay of the red-shifted intermediate (pR = I1) in the photoactive yellow protein (WT-PYP) from Halorhodospira halophila and the mutated E46Q-PYP and E46A-PYP, were determined by laser-induced optoacoustic spectroscopy (LIOAS) using the two-temperatures method, at pH 8.5. These mutations alter the hydrogen bond between the phenolate oxygen of the chromophore and the residue at position 46. Hydrogen bonding is still possible in E46Q-PYP via the delta-NH2 group of glutamine, whereas it is no longer possible with the methyl group of alanine in E46A-PYP. In all three proteins, pR decays within hundreds of ns to micros into the next intermediate, pR'. The delta H values for the formation of pR (delta H pR) and for its decay into pR'(delta H pR-->pR') are negligibly affected by the E46Q and the E46A substitution. In all three proteins the large delta H pR value drives the photocycle. Whereas delta V pR is a similar contraction of ca. 15 ml mol(-1) for E46Q-PYP and WT-PYP, attributed to strengthening the hydrogen bond network (between 4 and 5 hydrogen bonds) inside the protein chromophore cavity, an expansion is observed for E46A-PYP, indicating just an enlargement of the chromophore cavity upon chromophore isomerization. The results are discussed in the light of the recent time-resolved room temperature, crystallographic studies with WT-PYP and E46Q-PYP. Formation of pR' is somewhat slower for E46Q-PYP and much slower for E46A-PYP. The structural volume change for this transition, delta V pR-->pR', is relatively small and positive for WT-PYP, slightly larger for E46Q-PYP, and definitely larger for the hydrogen-bond lacking E46A-PYP. This indicates a larger entropic change for this transition in E46A-PYP, reflected in the large pre-exponential factor for the pR to pR' decay rate constant determined in the 5-30 degrees C temperature range. This decay also shows an activation entropy that compensates the larger activation energy in E46A-PYP, as compared to the values for WT-PYP and E46Q-PYP. PMID:19791418

  5. Structural changes and thermal stability of charged LiNixMnyCozO? cathode materials studied by combined in situ time-resolved XRD and mass spectroscopy

    DOE PAGESBeta

    Bak, Seong-Min [Brookhaven National Lab. (BNL), Upton, NY (United States); Hu, Enyuan [Brookhaven National Lab. (BNL), Upton, NY (United States); Zhou, Yongning [Brookhaven National Lab. (BNL), Upton, NY (United States); Yu, Xiqian [Brookhaven National Lab. (BNL), Upton, NY (United States); Senanayake, Sanjaya D. [Brookhaven National Lab. (BNL), Upton, NY (United States); Cho, Sung-Jin [Johnson Control Advanced Power Solution, Milwaukee, WI (United States); North Carolina A&T State Univ., Greensboro, NC (United States); Kim, Kwang-Bum [Yonsei Univ., Seoul (Republic of Korea); Chung, Kyung Yoon [Korea Inst. of Science and Technology, Seoul (Republic of Korea); Yang, Xiao-Qing [Brookhaven National Lab. (BNL), Upton, NY (United States); Nam, Kyung-Wan [Dongguk Univ., Seoul (Republic of Korea)

    2014-12-24

    Thermal stability of charged LiNixMnyCozO? (NMC with x+y+z=1, x:y:z = 4:3:3 (NMC433), 5:3:2 (NMC532), 6:2:2 (NMC622), and 8:1:1 (NMC811)) cathode materials is systematically studied using combined in situ time resolved X-ray diffraction and mass spectroscopy (TR- XRD/MS) techniques upon heating up to 600 °C. The TR-XRD/MS results indicate that the content of Ni, Co, and Mn significantly affects both the structural changes and the oxygen release features during heating: the more Ni and less Co and Mn, the lower the onset temperature of the phase transition (i.e., thermal decomposition) and the larger amount of oxygen release. Interestingly, the NMC532 seems to be the optimized composition to maintain a reasonably good thermal stability comparable to the low Ni-content materials (e.g., NMC333 and NMC433) while having a high capacity close to the high Ni-content materials (e.g., NMC811 and NMC622). The origin of the thermal decomposition of NMC cathode materials was elucidated by the changes in the oxidation states of each transition metal (TM) cations (i.e., Ni, Co and Mn) and their site preferences during thermal decomposition. It is revealed that Mn ions mainly occupy the 3a octahedral sites of layered structure (R3m ) but Co ions prefer to migrate to the 8a tetrahedral sites of spinel structure (Fd3m ) during the thermal decomposition. Such elemental dependent cation migration plays a very important role for the thermal stability of NMC cathode materials. The reasonably good thermal stability and high capacity characteristics of the NMC532 composition is originated from the well-balanced ratio of Ni- to Mn- and Co- contents. This systematic study provides insight into the rational design of NMC based cathode materials with a desired balance between thermal stability and high energy density

  6. Sub-nanosecond time-resolved ambient-pressure X-ray photoelectron spectroscopy setup for pulsed and constant wave X-ray light sources.

    PubMed

    Shavorskiy, Andrey; Neppl, Stefan; Slaughter, Daniel S; Cryan, James P; Siefermann, Katrin R; Weise, Fabian; Lin, Ming-Fu; Bacellar, Camila; Ziemkiewicz, Michael P; Zegkinoglou, Ioannis; Fraund, Matthew W; Khurmi, Champak; Hertlein, Marcus P; Wright, Travis W; Huse, Nils; Schoenlein, Robert W; Tyliszczak, Tolek; Coslovich, Giacomo; Robinson, Joseph; Kaindl, Robert A; Rude, Bruce S; Ölsner, Andreas; Mähl, Sven; Bluhm, Hendrik; Gessner, Oliver

    2014-09-01

    An apparatus for sub-nanosecond time-resolved ambient-pressure X-ray photoelectron spectroscopy studies with pulsed and constant wave X-ray light sources is presented. A differentially pumped hemispherical electron analyzer is equipped with a delay-line detector that simultaneously records the position and arrival time of every single electron at the exit aperture of the hemisphere with ~0.1 mm spatial resolution and ~150 ps temporal accuracy. The kinetic energies of the photoelectrons are encoded in the hit positions along the dispersive axis of the two-dimensional detector. Pump-probe time-delays are provided by the electron arrival times relative to the pump pulse timing. An average time-resolution of (780 ± 20) ps (FWHM) is demonstrated for a hemisphere pass energy E(p) = 150 eV and an electron kinetic energy range KE = 503-508 eV. The time-resolution of the setup is limited by the electron time-of-flight (TOF) spread related to the electron trajectory distribution within the analyzer hemisphere and within the electrostatic lens system that images the interaction volume onto the hemisphere entrance slit. The TOF spread for electrons with KE = 430 eV varies between ~9 ns at a pass energy of 50 eV and ~1 ns at pass energies between 200 eV and 400 eV. The correlation between the retarding ratio and the TOF spread is evaluated by means of both analytical descriptions of the electron trajectories within the analyzer hemisphere and computer simulations of the entire trajectories including the electrostatic lens system. In agreement with previous studies, we find that the by far dominant contribution to the TOF spread is acquired within the hemisphere. However, both experiment and computer simulations show that the lens system indirectly affects the time resolution of the setup to a significant extent by inducing a strong dependence of the angular spread of electron trajectories entering the hemisphere on the retarding ratio. The scaling of the angular spread with the retarding ratio can be well approximated by applying Liouville's theorem of constant emittance to the electron trajectories inside the lens system. The performance of the setup is demonstrated by characterizing the laser fluence-dependent transient surface photovoltage response of a laser-excited Si(100) sample. PMID:25273702

  7. Temperature Dependent Kinetics of the OH/HO2/O3 Chain Reaction by Time-Resolved IR Laser Absorption Spectroscopy

    E-print Network

    Nizkorodov, Sergey

    of ozone chain loss in the lower stratosphere. I. Introduction The so-called catalytic odd hydrogen (HOx: January 11, 2000 This paper presents an extensive temperature dependent kinetic study of the catalytic HOx ozone cycle, (1) OH + O3 f HO2 + O2 and (2) HO2 + O3 f OH + 2 O2, based on time-resolved, Doppler

  8. Analysis of co-eluted isomers of high-molecular weight polycyclic aromatic hydrocarbons in high performance liquid chromatography fractions via solid-phase nanoextraction and time-resolved Shpol'skii spectroscopy.

    PubMed

    Wilson, Walter B; Campiglia, Andres D

    2011-09-28

    We present an accurate method for the determination of isomers of high-molecular weight polycyclic aromatic hydrocarbons co-eluted in HPLC fractions. The feasibility of this approach is demonstrated with two isomers of molecular weight 302 with identical mass fragmentation patterns, namely dibenzo[a,i]pyrene and naphtho[2,3-a]pyrene. Qualitative and quantitative analysis is carried out via laser-excited time-resolved Shpol'skii spectroscopy at liquid helium temperature. Unambiguous identification of co-eluted isomers is based on their characteristic 4.2 K line-narrowed spectra in n-octane as well as their fluorescence lifetimes. Pre-concentration of HPLC fractions prior to spectroscopic analysis is performed with the aid of gold nanoparticles via an environmentally friendly procedure. In addition to the two co-eluted isomers, the analytical figures of merit of the entire procedure were evaluated with dibenzo[a,l]pyrene, dibenzo[a,h]pyrene and dibenzo[a,e]pyrene. The analytical recoveries from drinking water samples varied between 98.2±5.5 (dibenzo[a,l]pyrene) and 102.7±3.2% (dibenzo[a,i]pyrene). The limits of detection ranged from 51.1 ng L(-1) (naphtho[2,3-a]pyrene) to 154 ng L(-1) (dibenzo[a,e]pyrene). The excellent analytical figures of merit associated to its HPLC compatibility makes this approach an attractive alternative for the analysis of co-eluted isomers with identical mass spectra. PMID:21872256

  9. CONDENSED MATTER: ELECTRONICSTRUCTURE, ELECTRICAL, MAGNETIC, AND OPTICALPROPERTIES: Steady State and Time-Resolved Fluorescence Dynamics of Triphenylamine Based Oligomers with Phenylene/Thiophene/Furan in Solvents

    NASA Astrophysics Data System (ADS)

    Zeng, Qi; Liu, Ying-Liang; Meng, Kang; Zhao, Xiang-Jie; Wang, Shu-Feng; Gong, Qi-Huang

    2009-07-01

    We investigate the photo-physical properties of a series of triphenylamine-based oligomers by steady-state and picosecond transient fluorescence measurements in solvents. The oligomers are composed alternatively with triphenylamine and phenylene/thiophene/furan group, bridged by vinyl group (PNB/PNT/PNF). Their fluorescence spectra show bathochromic phenomenon with solvent polarity and viscosity increasing. The fluorescence decays are bi-exponential for PNB and PNT, and tri-exponential for PNF in THF and aniline. The strong viscosity dependence suggests conformational relaxation along the PNF chain after photo excitation.

  10. Development of soft x-ray time-resolved photoemission spectroscopy system with a two-dimensional angle-resolved time-of-flight analyzer at SPring-8 BL07LSU

    NASA Astrophysics Data System (ADS)

    Ogawa, Manami; Yamamoto, Susumu; Kousa, Yuka; Nakamura, Fumitaka; Yukawa, Ryu; Fukushima, Akiko; Harasawa, Ayumi; Kondoh, Hiroshi; Tanaka, Yoshihito; Kakizaki, Akito; Matsuda, Iwao

    2012-02-01

    We have developed a soft x-ray time-resolved photoemission spectroscopy system using synchrotron radiation (SR) at SPring-8 BL07LSU and an ultrashort pulse laser system. Two-dimensional angle-resolved measurements were performed with a time-of-flight-type analyzer. The photoemission spectroscopy system is synchronized to light pulses of SR and laser using a time control unit. The performance of the instrument is demonstrated by mapping the band structure of a Si(111) crystal over the surface Brillouin zones and observing relaxation of the surface photo-voltage effect using the pump (laser) and probe (SR) method.

  11. Development of soft x-ray time-resolved photoemission spectroscopy system with a two-dimensional angle-resolved time-of-flight analyzer at SPring-8 BL07LSU

    SciTech Connect

    Ogawa, Manami; Yamamoto, Susumu; Nakamura, Fumitaka; Yukawa, Ryu; Fukushima, Akiko; Harasawa, Ayumi; Kakizaki, Akito; Matsuda, Iwao [Institute for Solid State Physics, University of Tokyo, 5-1-5 Kashiwanoha, Chiba 277-8581 (Japan); Kousa, Yuka; Kondoh, Hiroshi [Department of Chemistry, Keio University, Yokohama 223-8522 (Japan); Tanaka, Yoshihito [RIKEN/SPring-8 Center, 1-1-1, Kouto, Sayo-cho, Sayo-gun, Hyogo 679-5148 (Japan)

    2012-02-15

    We have developed a soft x-ray time-resolved photoemission spectroscopy system using synchrotron radiation (SR) at SPring-8 BL07LSU and an ultrashort pulse laser system. Two-dimensional angle-resolved measurements were performed with a time-of-flight-type analyzer. The photoemission spectroscopy system is synchronized to light pulses of SR and laser using a time control unit. The performance of the instrument is demonstrated by mapping the band structure of a Si(111) crystal over the surface Brillouin zones and observing relaxation of the surface photo-voltage effect using the pump (laser) and probe (SR) method.

  12. Development of a time-resolved fluorescence immunoassay for Epstein-Barr virus Zta IgA antibodies in human serum.

    PubMed

    Chen, Juanjuan; Liu, Tiancai; Chen, Zhenhua; Hou, Jingyuan; Wu, Yingsong; Li, Ming

    2015-04-01

    The Epstein-Barr virus (EBV) transactivator protein (ZEBRA) is an immediate-early protein that plays an important role in the switch from latency to productive cycle in EBV virus. ZEBRA is an important marker of EBV reactivation. In order to diagnose EBV infection status correctly and timely, a novel immunoassay was developed based on an indirect time-resolved fluoroimmunoassay (TRFIA) for Zta IgA, which used recombinant Zta antigen as solid-phase antigen and Eu(3+)-labeled mouse antihuman IgA as corresponding probe. The precision, sensitivity, specificity test, and stability of the TRFIA kit were evaluated, and comparison with the traditional enzyme-linked immunosorbent assay (ELISA) was also investigated. The cutoff value for the TRFIA was 2.5. Intra- and interassay coefficients of variation for the TRFIA were 2.45-3.30% and 3.38-4.61% respectively. There was no cross-reactivity with the antibodies of cytomegalovirus (CMV) or herpes simplex virus (HSV) types 1 and 2, or other potential interferences. The established assay kit also behaved better in sensitivity and stability than the ELISA one. Additionally, the results in 382 serum samples using two analytical methods showed there was good agreement between the TRFIA and commercial ELISA kit. In the current study, the results demonstrated that the TRFIA that was developed for Zta IgA detection was more sensitive and reliable for the diagnosis of EBV infection and had potential value in automation and high-throughput screening. PMID:25651045

  13. Time resolved single photon imaging in Nanometer Scale CMOS technology 

    E-print Network

    Richardson, Justin Andrew

    2010-06-28

    Time resolved imaging is concerned with the measurement of photon arrival time. It has a wealth of emerging applications including biomedical uses such as fluorescence lifetime microscopy and positron emission tomography, ...

  14. Effect of nanosize micelles of ionic and neutral surfactants on the photophysics of protonated 6-methoxyquinoline: time-resolved fluorescence study.

    PubMed

    Tej Varma, Y; Joshi, Sunita; Pant, Debi D

    2015-03-01

    The excited state dynamic studies have been carried out to investigate the effects of micellar surface charge on the photophysics of protonated 6-methoxyquinoline (6MQ(+)) in anionic, sodium dodecylsulphate (SDS), cationic, cetyltrimethylammonium bromide (CTAB) and neutral, triton X-100 (TX100) surfactant at premicellar, micellar and postmicellar concentrations in aqueous phase at room temperature. At premicellar concentrations of SDS, there is a slight decrease in emission intensity and at micellar and postmicellar concentrations, increase in emission intensity and blue shift of spectrum has been observed. The blue shift in fluorescence spectrum and slight increase in quantum yield are attributed to incorporation of solute molecule to the micelles. Edge excitation red shift (EERS) in fluorescence maximum of 6MQ(+) has been observed in all the surfactant solutions studied. The EERS has been ascribed in terms of solvent relaxation process. In SDS surfactant system, due to heterogeneous restricted motion of solvent molecules, the solvent viscosity increases which results in an increase in net magnitude of EERS. The fluorescence decay components of 6MQ(+) fit with multi exponential functions in all the micellar systems studied. The location of the probe molecule in micellar systems is justified by a variety of spectral parameters such as refractive index, dielectric constant, ET (30), EERS, average fluorescence decay time, radiative and non radiative rate constants, and rotational relaxation time. PMID:25434640

  15. Effect of nanosize micelles of ionic and neutral surfactants on the photophysics of protonated 6-methoxyquinoline: Time-resolved fluorescence study

    NASA Astrophysics Data System (ADS)

    Tej Varma, Y.; Joshi, Sunita; Pant, Debi D.

    2015-03-01

    The excited state dynamic studies have been carried out to investigate the effects of micellar surface charge on the photophysics of protonated 6-methoxyquinoline (6MQ+) in anionic, sodium dodecylsulphate (SDS), cationic, cetyltrimethylammonium bromide (CTAB) and neutral, triton X-100 (TX100) surfactant at premicellar, micellar and postmicellar concentrations in aqueous phase at room temperature. At premicellar concentrations of SDS, there is a slight decrease in emission intensity and at micellar and postmicellar concentrations, increase in emission intensity and blue shift of spectrum has been observed. The blue shift in fluorescence spectrum and slight increase in quantum yield are attributed to incorporation of solute molecule to the micelles. Edge excitation red shift (EERS) in fluorescence maximum of 6MQ+ has been observed in all the surfactant solutions studied. The EERS has been ascribed in terms of solvent relaxation process. In SDS surfactant system, due to heterogeneous restricted motion of solvent molecules, the solvent viscosity increases which results in an increase in net magnitude of EERS. The fluorescence decay components of 6MQ+ fit with multi exponential functions in all the micellar systems studied. The location of the probe molecule in micellar systems is justified by a variety of spectral parameters such as refractive index, dielectric constant, ET (30), EERS, average fluorescence decay time, radiative and non radiative rate constants, and rotational relaxation time.

  16. Reorientational motion of a cross-link junction in a poly(dimethylsiloxane) network measured by time-resolved fluorescence depolarization

    NASA Astrophysics Data System (ADS)

    Stein, Alan D.; Hoffman, D. A.; Frank, C. W.; Fayer, M. D.

    1992-02-01

    The reorientational dynamics of a cross-link junction in poly(dimethylsiloxane) networks, measured by the fluorescence anisotropy decay of a chromophore tagged to the cross-link, have been investigated over a range of temperatures from Tg+75 to Tg+150. The probe chromophore, 1-dimethylamino-5-sulfonylnaphthalene amide (dansyl amide), is pendant to a trifunctional silane that acts as a cross-linking molecule. In cyclohexanol, the fluorescence anisotropy decay is in agreement with Debye-Stokes-Einstein hydrodynamic theory (rotational diffusion) demonstrating that the cross-linker can be used as a probe of orientational relaxation. The fluorescence anisotropy decays at a rapid rate in an end-linked poly(dimethyl siloxane) network reflecting fast reorientational motion of the cross-link junction. This reorientation appears diffusive and has a temperature dependence in accord with the Williams-Landel-Ferry equation. A model is proposed that suggests that reorientation and translational motion of the cross-link occur simultaneously and are both coupled to fluctuations of the polymer chain ends.

  17. Online fluorescence suppression in modulated Raman spectroscopy.

    PubMed

    De Luca, Anna Chiara; Mazilu, Michael; Riches, Andrew; Herrington, C Simon; Dholakia, Kishan

    2010-01-15

    Label-free chemical characterization of single cells is an important aim for biomedical research. Standard Raman spectroscopy provides intrinsic biochemical markers for noninvasive analysis of biological samples but is often hindered by the presence of fluorescence background. In this paper, we present an innovative modulated Raman spectroscopy technique to filter out the Raman spectra from the fluorescence background. The method is based on the principle that the fluorescence background does not change whereas the Raman scattering is shifted by the periodical modulation of the laser wavelength. Exploiting this physical property and importantly the multichannel lock-in detection of the Raman signal, the modulation technique fulfills the requirements of an effective fluorescence subtraction method. Indeed, once the synchronization and calibration procedure is performed, minimal user intervention is required, making the method online and less time-consuming than the other fluorescent suppression methods. We analyze the modulated Raman signal and shifted excitation Raman difference spectroscopy (SERDS) signal of 2 mum-sized polystyrene beads suspended in a solution of fluorescent dye as a function of modulation rate. We show that the signal-to-noise ratio of the modulated Raman spectra at the highest modulation rate is 3 times higher than the SERDS one. To finally evaluate the real benefits of the modulated Raman spectroscopy, we apply our technique to Chinese hamster ovary cells (CHO). Specifically, by analyzing separate spectra from the membrane, cytoplasm, and nucleus of CHO cells, we demonstrate the ability of this method to obtain localized sensitive chemical information from cells, away from the interfering fluorescence background. In particular, statistical analysis of the Raman data and classification using PCA (principal component analysis) indicate that our method allows us to distinguish between different cell locations with higher sensitivity and specificity, avoiding potential misinterpretation of the data obtained using standard background procedures. PMID:20017474

  18. Time-Resolved Fluorescence Imaging Reveals Differential Interactions of N-Glycan Processing Enzymes across the Golgi Stack in Planta1[W][OA

    PubMed Central

    Schoberer, Jennifer; Liebminger, Eva; Botchway, Stanley W.; Strasser, Richard; Hawes, Chris

    2013-01-01

    N-Glycan processing is one of the most important cellular protein modifications in plants and as such is essential for plant development and defense mechanisms. The accuracy of Golgi-located processing steps is governed by the strict intra-Golgi localization of sequentially acting glycosidases and glycosyltransferases. Their differential distribution goes hand in hand with the compartmentalization of the Golgi stack into cis-, medial-, and trans-cisternae, which separate early from late processing steps. The mechanisms that direct differential enzyme concentration are still unknown, but the formation of multienzyme complexes is considered a feasible Golgi protein localization strategy. In this study, we used two-photon excitation-Förster resonance energy transfer-fluorescence lifetime imaging microscopy to determine the interaction of N-glycan processing enzymes with differential intra-Golgi locations. Following the coexpression of fluorescent protein-tagged amino-terminal Golgi-targeting sequences (cytoplasmic-transmembrane-stem [CTS] region) of enzyme pairs in leaves of tobacco (Nicotiana spp.), we observed that all tested cis- and medial-Golgi enzymes, namely Arabidopsis (Arabidopsis thaliana) Golgi ?-mannosidase I, Nicotiana tabacum ?1,2-N-acetylglucosaminyltransferase I, Arabidopsis Golgi ?-mannosidase II (GMII), and Arabidopsis ?1,2-xylosyltransferase, form homodimers and heterodimers, whereas among the late-acting enzymes Arabidopsis ?1,3-galactosyltransferase1 (GALT1), Arabidopsis ?1,4-fucosyltransferase, and Rattus norvegicus ?2,6-sialyltransferase (a nonplant Golgi marker), only GALT1 and medial-Golgi GMII were found to form a heterodimer. Furthermore, the efficiency of energy transfer indicating the formation of interactions decreased considerably in a cis-to-trans fashion. The comparative fluorescence lifetime imaging of several full-length cis- and medial-Golgi enzymes and their respective catalytic domain-deleted CTS clones further suggested that the formation of protein-protein interactions can occur through their amino-terminal CTS region. PMID:23400704

  19. Ultrafast Fluorescence Spectroscopy via Upconversion: Applications to Biophysics

    PubMed Central

    Xu, Jianhua; Knutson, Jay R.

    2012-01-01

    This chapter reviews basic concepts of nonlinear fluorescence upconversion, a technique whose temporal resolution is essentially limited only by the pulse width of the ultrafast laser. Design aspects for upconversion spectrophotofluorometers are discussed, and a recently developed system is described. We discuss applications in biophysics, particularly the measurement of time-resolved fluorescence spectra of proteins (with subpicosecond time resolution). Application of this technique to biophysical problems such as dynamics of tryptophan, peptides, proteins, and nucleic acids is reviewed. PMID:19152860

  20. Intramolecular charge transfer of 4-(dimethylamino)benzonitrile probed by time-resolved fluorescence and transient absorption: No evidence for two ICT states and a pisigma( *) reaction intermediate.

    PubMed

    Zachariasse, Klaas A; Druzhinin, Sergey I; Kovalenko, Sergey A; Senyushkina, Tamara

    2009-12-14

    For the double exponential fluorescence decays of the locally excited (LE) and intramolecular charge transfer (ICT) states of 4-(dimethylamino)benzonitrile (DMABN) in acetonitrile (MeCN) the same times tau(1) and tau(2) are observed. This means that the reversible LE<==>ICT reaction, starting from the initially excited LE state, can be adequately described by a two state mechanism. The most important factor responsible for the sometimes experimentally observed differences in the nanosecond decay time, with tau(1)(LE)fluorescence response functions with a time resolution of 0.5 ps/channel in 1200 channels reliable kinetic and thermodynamic data can be obtained. The arguments presented in the literature in favor of a pisigma( *) state with a bent CN group as an intermediate in the ICT reaction of DMABN are discussed. From the appearance of an excited state absorption (ESA) band in the spectral region between 700 and 800 nm in MeCN for N,N-dimethylanilines with CN, Br, F, CF(3), and C(=O)OC(2)H(2) p-substituents, it is concluded that this ESA band cannot be attributed to a pisigma( *) state, as only the C-C[Triple Bond]N group can undergo the required 120 degrees bending. PMID:20001042

  1. A high-peak-power UV picosecond-pulse light source based on a gain-switched 1.55 microm laser diode and its application to time-resolved spectroscopy of blue-violet materials.

    PubMed

    Sato, Aya; Kono, Shunsuke; Saito, Kyosuke; Sato, Ki-ichi; Yokoyama, Hiroyuki

    2010-02-01

    We generated sub-kilowatt peak-power and 6-ps duration 390-nm optical pulses via the fourth harmonic generation of amplified optical output from a gain-switched 1.55-microm laser diode. We obtained a power-conversion-efficiency of 12% from 1.55-microm to 390-nm light, and subsequently applied the ultraviolet pulses to time-resolved spectroscopy of blue-violet luminescent materials, including a Coumarine dye solution and nitride semiconductor materials using single-photon and two-photon excitation schemes. PMID:20174080

  2. Biomolecular shape and interactions determined by fluorescence correlation spectroscopy

    E-print Network

    Rippe, Karsten

    Biomolecular shape and interactions determined by fluorescence correlation spectroscopy J monitor an optical parameter such as absorbance, fluorescence intensity or depolarization, or circular 10 8 M -1 can be measured only with great difficulty because of the limited sensitivity. Fluorescence

  3. A study of the time-resolved fluorescence spectrum and red edge effect of ANF in a room-temperature ionic liquid.

    PubMed

    Hu, Zhonghan; Margulis, Claudio J

    2006-06-15

    In a recent article, we have analyzed using molecular dynamics simulations the steady-state red edge effect (REE) observed by Samanta and co-workers when the fluorescent probe 2-amino-7-nitrofluorene (ANF) is photoexcited at different wavelengths in 1-butyl-3-methylimidazolium ([BMIM+]) hexafluorophosphate ([PF6-]). In this letter, we predict the time- and wavelength-dependent emission spectra of ANF in the same ionic solvent. From the analysis of our simulated data, we are able to derive an approximate time scale for reorganization of the solvent around the solute probe. The effect that slow varying local liquid environments have on the overall time-dependent signal is also discussed. PMID:16771357

  4. Time-Resolved Optical Measurements of Detonation and Combustion Products

    NASA Astrophysics Data System (ADS)

    Carney, Joel R.; Wilkinson, John; Lightstone, James M.

    2007-12-01

    A first attempt at measuring the species evolution in the opaque post-detonation combustion product environment of a fuel-rich explosive using time-resolved absorption spectroscopy is presented. The time-resolved concentration of these species is helpful in identifying the rate and location of the extra energy released in the post-detonation phase due to the aluminum combustion, thus shedding light on the factors affecting the overall efficiency of air and internal-blast explosions. The methodology and results of time-resolved absorption spectroscopy are compared to previous emission spectroscopy investigations. The experimental arrangement and preliminary results of time-resolved absorption spectroscopy based on atomic aluminum in the post detonation environment of aluminized pressed PETN charges are presented. An assessment of the experimental approach and its usefulness in future detonation experiments is discussed.

  5. Comparison of microenvironments of aqueous sodium dodecyl sulfate micelles in the presence of inorganic and organic salts: a time-resolved fluorescence anisotropy approach.

    PubMed

    Dutt, G B

    2005-11-01

    Microenvironments of aqueous sodium dodecyl sulfate (SDS) micelles was examined in the presence of additives such as sodium chloride and p-toluidine hydrochloride (PTHC) by monitoring the fluorescence anisotropy decays of two hydrophobic probes, 2,5-dimethyl-1,4-dioxo-3,6-diphenylpyrrolo[3,4-c]pyrrole (DMDPP) and coumarin 6 (C6). It has been well-established that SDS micelles undergo a sphere-to-rod transition and that their mean hydrodynamic radius increases from 19 to 100 A upon the addition of 0.0-0.7 M NaCl at 298 K. A similar size and shape transition is induced by PTHC at concentrations that are 20 times lower compared to that of NaCl. This study was undertaken to find out how the microviscosity of the micelles is influenced under these circumstances. It was noticed that the microviscosity of the SDS/NaCl system increased by approximately 45%, whereas there was a less than 10% variation in the microviscosity of the SDS/PTHC system. The large increase in the microviscosity of the former system with salt concentration has been rationalized on the basis of the high concentration of sodium ions in the headgroup region of the micelles and their ability to strongly coordinate with the water present in this region, which decreases the mobility of the probe molecules. PMID:16262297

  6. Reflectance and fluorescence spectroscopies in photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Finlay, Jarod C.

    In vivo fluorescence spectroscopy during photodynamic therapy (PDT) has the potential to provide information on the distribution and degradation of sensitizers, the formation of fluorescent photoproducts and changes in tissue autofluorescence induced by photodynamic treatment. Reflectance spectroscopy allows quantification of light absorption and scattering in tissue. We present the results of several related studies of fluorescence and reflectance spectroscopy and their applications to photodynamic dosimetry. First, we develop and test an empirical method for the correction of the distortions imposed on fluorescence spectra by absorption and scattering in turbid media. We characterize the irradiance dependence of the in vivo photobleaching of three sensitizers, protoporphyrin IX (PpIX), Photofrin and mTHPC, in a rat skin model. The photobleaching and photoproduct formation of PpIX exhibit irradiance dependence consistent with singlet oxygen (1O2)-mediated bleaching. The bleaching of mTHPC occurs in two phases, only one of which is consistent with a 1O 2-mediated mechanism. Photofrin's bleaching is independent of irradiance, although its photoproduct formation is not. This can be explained by a mixed-mechanism bleaching model. Second, we develop an algorithm for the determination of tissue optical properties using diffuse reflectance spectra measured at a single source-detector separation and demonstrate the recovery of the hemoglobin oxygen dissociation curve from tissue-simulating phantoms containing human erythrocytes. This method is then used to investigate the heterogeneity of oxygenation response in murine tumors induced by carbogen inhalation. We find that while the response varies among animals and within each tumor, the majority of tumors exhibit an increase in blood oxygenation during carbogen breathing. We present a forward-adjoint model of fluorescence propagation that uses the optical property information acquired from reflectance spectroscopy to obtain the undistorted fluorescence spectrum over a wide range of optical properties. Finally, we investigate the ability of the forward-adjoint theory to extract undistorted fluorescence and optical property information simultaneously from a single measured fluorescence spectrum. This method can recover the hemoglobin oxygen dissociation curve in tissue-simulating phantoms with an accuracy comparable to that of reflectance-based methods while correcting distortions in the fluorescence over a wide range of absorption and scattering coefficients.

  7. Ultraviolet, Visible, and Fluorescence Spectroscopy

    NASA Astrophysics Data System (ADS)

    Penner, Michael H.

    Spectroscopy in the ultraviolet-visible (UV-Vis) range is one of the most commonly encountered laboratory techniques in food analysis. Diverse examples, such as the quantification of macrocomponents (total carbohydrate by the phenol-sulfuric acid method), quantification of microcomponents, (thiamin by the thiochrome fluorometric procedure), estimates of rancidity (lipid oxidation status by the thiobarbituric acid test), and surveillance testing (enzyme-linked immunoassays), are presented in this text. In each of these cases, the analytical signal for which the assay is based is either the emission or absorption of radiation in the UV-Vis range. This signal may be inherent in the analyte, such as the absorbance of radiation in the visible range by pigments, or a result of a chemical reaction involving the analyte, such as the colorimetric copper-based Lowry method for the analysis of soluble protein.

  8. Kinetic measurements of the C2H5O2 radical using time-resolved cavity ring-down spectroscopy with a continuous source.

    PubMed

    Melnik, Dmitry; Miller, Terry A

    2013-09-01

    We report on the design of a time-resolved, high duty-factor cavity ring-down apparatus utilizing a continuous laser and detail a technique for the accurate and precise measurement of effective reaction rate constants with it. This report complements an earlier paper concerning the measurement of the absolute absorption cross-sections, ?P, of reactive intermediates. To demonstrate the performance of the new technique, we have measured the decay rate of ethyl peroxy radicals by monitoring the A??X? origin band of the G-conformer of these species. A measured value kobs??P = 1.827(45) × 10(7) cm/s was determined and it, along with the previously measured value of ?P, was used to derive the value of kobs = 9.66(44)×10(-14) cm(3)/s, for the effective rate constant for ethyl peroxy self-reaction (all uncertainties are 1 ?). The present value of kobs is compared to those previously reported, and sources of systematic errors and their impact are discussed. PMID:24028110

  9. Detection of Structural Changes upon One-Electron Oxidation and Reduction of Stilbene Derivatives by Time-Resolved Resonance Raman Spectroscopy during Pulse Radiolysis and Theoretical Calculations.

    PubMed

    Fujitsuka, Mamoru; Cho, Dae Won; Choi, Jungkweon; Tojo, Sachiko; Majima, Tetsuro

    2015-07-01

    Stilbene (St) derivatives have been investigated for many years because of their interesting photochemical reactions such as cis-trans isomerization in the excited states and charged states and their relation to poly(p-phenylenevinylene)s. To clarify their charged state properties, structural information is indispensable. In the present study, radical cations and radical anions of St derivatives were investigated by radiation chemical methods. Absorption spectra of radical ion states were obtained by transient absorption measurements during pulse radiolysis; theoretical calculations that included the solvent effect afforded reasonable assignments. The variation in the peak position was explained by using HOMO and LUMO energy levels. Structural changes upon one-electron oxidation and reduction were detected by time-resolved resonance Raman measurements during pulse radiolysis. Significant downshifts were observed with the CC stretching mode of the ethylenic groups, indicative of the decrease in the bonding order. It was confirmed that the downshifts observed with reduction were larger than those with oxidation. On the other hand, the downshift caused by oxidation depends significantly on the electron-donating or electron-withdrawing nature of the substituents. PMID:26052901

  10. In vivo measurement of tissue oxygenation by time-resolved luminescence spectroscopy: advantageous properties of dichlorotris(1, 10-phenanthroline)-ruthenium(II) hydrate

    NASA Astrophysics Data System (ADS)

    Huntosova, Veronika; Gay, Sandrine; Nowak-Sliwinska, Patrycja; Rajendran, Senthil Kumar; Zellweger, Matthieu; van den Bergh, Hubert; Wagnières, Georges

    2014-07-01

    Measuring tissue oxygenation in vivo is of interest in fundamental biological as well as medical applications. One minimally invasive approach to assess the oxygen partial pressure in tissue (pO2) is to measure the oxygen-dependent luminescence lifetime of molecular probes. The relation between tissue pO and the probes' luminescence lifetime is governed by the Stern-Volmer equation. Unfortunately, virtually all oxygen-sensitive probes based on this principle induce some degree of phototoxicity. For that reason, we studied the oxygen sensitivity and phototoxicity of dichlorotris(1, 10-phenanthroline)-ruthenium(II) hydrate [Ru(Phen)] using a dedicated optical fiber-based, time-resolved spectrometer in the chicken embryo chorioallantoic membrane. We demonstrated that, after intravenous injection, Ru(Phen)'s luminescence lifetime presents an easily detectable pO dependence at a low drug dose (1 mg/kg) and low fluence (120 mJ/cm2 at 470 nm). The phototoxic threshold was found to be at 10 J/cm2 with the same wavelength and drug dose, i.e., about two orders of magnitude larger than the fluence necessary to perform a pO measurement. Finally, an illustrative application of this pO measurement approach in a hypoxic tumor environment is presented.

  11. Time-resolved spectral characterization of ring cavity surface emitting and ridge-type distributed feedback quantum cascade lasers by step-scan FT-IR spectroscopy.

    PubMed

    Brandstetter, Markus; Genner, Andreas; Schwarzer, Clemens; Mujagic, Elvis; Strasser, Gottfried; Lendl, Bernhard

    2014-02-10

    We present the time-resolved comparison of pulsed 2nd order ring cavity surface emitting (RCSE) quantum cascade lasers (QCLs) and pulsed 1st order ridge-type distributed feedback (DFB) QCLs using a step-scan Fourier transform infrared (FT-IR) spectrometer. Laser devices were part of QCL arrays and fabricated from the same laser material. Required grating periods were adjusted to account for the grating order. The step-scan technique provided a spectral resolution of 0.1 cm(-1) and a time resolution of 2 ns. As a result, it was possible to gain information about the tuning behavior and potential mode-hops of the investigated lasers. Different cavity-lengths were compared, including 0.9 mm and 3.2 mm long ridge-type and 0.97 mm (circumference) ring-type cavities. RCSE QCLs were found to have improved emission properties in terms of line-stability, tuning rate and maximum emission time compared to ridge-type lasers. PMID:24663557

  12. Long Range Surface Plasmon Fluorescence Spectroscopy

    NASA Astrophysics Data System (ADS)

    Kasry, Amal; Knoll, Wolfgang

    2007-03-01

    Surface plasmon modes, excited at the two sides of a thin metal layer surrounded by two (nearly) identical dielectric media interact via the overlap of their electromagnetic fields. This overlap results in two new-coupled modes, a short and a long-range surface plasmon (LRSP). We demonstrate that combining the LRSP optics with fluorescence spectroscopy can result in a huge enhancement of the fluorescence signal due to the enhanced optical field of the LRSP at the metal dielectric interface, and to its increased evanescent depth into the analyte. This was demonstrated for the detection of the fluorescence intensity of chromophore labeled protein bound to the surface sensor. Beside that, some fundamentals were studied leading to some interesting difference between SPFS and LRSPFS.

  13. Measurement of Intrinsic Dirac Fermion Cooling on the Surface of the Topological Insulator Bi2Se3 Using Time-Resolved and Angle-Resolved Photoemission Spectroscopy

    E-print Network

    Wang, Y. H.

    We perform time- and angle-resolved photoemission spectroscopy of a prototypical topological insulator (TI) Bi[subscript 2]Se[subscript 3] to study the ultrafast dynamics of surface and bulk electrons after photoexcitation. ...

  14. Frequency-domain fluorescence spectroscopy: instrumentation and applications to the biosciences

    NASA Astrophysics Data System (ADS)

    Lakowicz, Joseph R.; Gryczynski, Ignacy; Malak, Henryk M.; Johnson, Michael L.; Laczko, Gabor; Wiczk, Wieslaw M.; Szmacinski, Henryk; Kusba, Jozef

    1991-07-01

    Measurements of time-resolved fluorescence are increasingly used for research in biophysics, biochemistry, cell biology and medicine. Advances in the technology of light sources and detectors are resulting in more reliable and/or advanced instrumentation, which is resulting in the expanding applications of fluorescence spectroscopy. Time-resolved measurements are often performed by direct measurements in the time-domain. In this article the authors describe the alternative method of frequency-domain fluorometry. The frequency-response of the emission to intensity-modulated excitation can be used to recover the time-dependent decay. Commercial instrumentation now allows measurements to an upper light modulation frequency limit of 200 MHz. This laboratory has developed second and third generation instruments which allows measurements to 2 GHz and subsequently to 10 GHz. The frequency-domain data from such instrumentation provides excellent resolution of picosecond decays of intensity and anisotropy. Additionally, the frequency-domain method appears to provide remarkable resolution of complex decays which are often observed for biochemical samples. In this article the authors describe this instrumentation and applications of this method. Examples are shown using probes with ps decay and correlation times, the intrinsic fluorescence of proteins, and the measurement of end-to-end diffusion in proteins and/or flexible molecules.

  15. Theory and applications of fluorescence spectroscopy in food research

    Microsoft Academic Search

    Gale M. Strasburg; Richard D. Ludescher

    1995-01-01

    Fluorescence spectroscopy is a rapid, sensitive method for characterizing molecular environments and events. In spite of its utility, food researchers have been slow to adopt fluorescence methodology, partly because its value has gone unrecognized. This article presents a brief overview of the theory of fluorescence spectroscopy, together with some examples of applications of this technique to illustrate its potential for

  16. X-ray structure and conformational dynamics of the HIV-1 protease in complex with the inhibitor SDZ283-910: agreement of time-resolved spectroscopy and molecular dynamics simulations.

    PubMed

    Ringhofer, S; Kallen, J; Dutzler, R; Billich, A; Visser, A J; Scholz, D; Steinhauser, O; Schreiber, H; Auer, M; Kungl, A J

    1999-03-01

    Based on the X-ray structure of the human immunodeficiency virus type-1 (HIV-1) protease in complex with the statine-derived inhibitor SDZ283-910, a 542 ps molecular dynamics trajectory was computed. For comparison with the 805 ps trajectory obtained for the uncomplexed enzyme, the theoretical fluorescence anisotropy decay of the unliganded protease and the inhibitor complex was calculated from the trajectories of the Trp6A/Trp6B and Trp42A/Trp42B transition dipole moments. This enabled us to directly compare the simulated data with the experimental picosecond time-resolved fluorescence data. Fitting both experimental and simulated data to the Kohlrausch-Williams-Watts (KWW) function exp(-t/tauk)beta revealed a very good agreement for the uncomplexed protease as well as for the SDZ283-910 complex. Binding of the inhibitor induced a faster decay of both the experimental and the computed protease fluorescence anisotropy decay. By this integrative approach, the atomic detail of inhibitor-induced changes in the conformational dynamics of the HIV-1 protease was experimentally verified and will be used for further inhibitor optimisation. PMID:10047488

  17. Towards in situ fluorescence spectroscopy and microscopy investigations of asphaltene precipitation kinetics.

    PubMed

    Franco, Juliana C; Gonçalves, Grasiele; Souza, Monique S; Rosa, Samantha B C; Thiegue, Larissa M; Atvars, Teresa D Z; Rosa, Paulo T V; Nome, René A

    2013-12-16

    We perform a spectroscopic analysis of asphaltene in solution and in crude oil with the goal of designing an optical probe of asphaltene precipitation inside high-pressure cells. Quantitative analysis of steady-state spectroscopic data is employed to identify fluorescence and Raman contributions to the observed signals. Time-resolved fluorescence spectroscopy indicates that fluorescence lifetime can be used as a spectroscopic probe of asphaltene in crude oil. Quantitative confocal laser-scanning microscopy studies of asphaltene in n-heptane are used to calculate particle-size distributions as a function of time, both at the sample surface and asphaltene interior. The resulting precipitation kinetics is well described by stochastic numerical simulations of diffusion-limited aggregation. Based on these results, we present the design and construction of an apparatus to optically probe the in situ precipitation of asphaltene suitable for studies inside high pressure cells. Design considerations include the use of a spatial light modulator for aberration correction in microscopy measurements, together with the design of epi-fluorescence spectrometer, both fiber-based and for remote sensing fluorescence spectroscopy. PMID:24514660

  18. Fluorescence Spectroscopy of Human Nonmalignant and Malignant Cells and Tissues.

    NASA Astrophysics Data System (ADS)

    Glassman, Wenling Sha

    This thesis explores steady state and time resolved fluorescence spectroscopy from human malignant and non -malignant cells and tissues. The focus of these studies are the analysis of the excitation spectra, emission spectra, and decay time based on the contribution from several key intrinsic fluorophors: NAD(P)H, flavins, tryptophan, elastin and collagen that exist in different amounts in the human tissues and cells. The comparison between the spectra from malignant and non-malignant cells and tissues gives information on the changes that occur from non-malignancy to malignancy in the cells and tissues. The spectra of tissues and cells are also compared to help in understanding what fluorophors are responsible for fluorescence spectral differences between the malignant and non-malignant tissues and cells. The results in this thesis show that the spectral differences between the normal and cancerous tissues and cells exist in various wavelength ranges. The experimental data from GYN tissues have shown with over 95% of the sensitivity and specificity to separate malignant from non-malignant tissues using 300nm excitation. The 340nm band, which is mostly in response to intrinsic fluorophor (amino acid tryptophan), from malignant tissues were relatively higher then that from the non-malignant tissues. This might have been caused by the higher concentration of free tryptophan in the malignant tumor when compared to that of the normal tissue. This has been found in medical clinical study. The experimental data in this thesis also show that the fluorescence intensities around 450nm-460nm, which are mostly due to the intrinsic fluorophor coenzyme NADH, from both malignant cells in vitro and tissues in vitro are relatively higher than from non-malignant cells in vitro and tissues in vitro. These findings are reinforced by the faster decay time of the NADH fluorescence from normal cells in vitro than from neoplasm cells in vitro. Thus, the NADH in the mitochondria might be bound less tight in the malignant cells then that in the non-malignant cells because of metabolism changes from non-malignance to malignance. This thesis contributes to the new field of "mediphotonics" in life science.

  19. Time-resolved spectroscopy of BD+46°442: Gas streams and jet creation in a newly discovered evolved binary with a disk

    NASA Astrophysics Data System (ADS)

    Gorlova, N.; Van Winckel, H.; Gielen, C.; Raskin, G.; Prins, S.; Pessemier, W.; Waelkens, C.; Frémat, Y.; Hensberge, H.; Dumortier, L.; Jorissen, A.; Van Eck, S.

    2012-06-01

    Context. Previous studies have shown that many post-asymptotic giant branch (AGB) stars with dusty disks are associated with single-lined binary stars. The inferred orbital separations are too small to accommodate a fully grown AGB star, hence these systems represent a new evolutionary channel that bypasses a full AGB evolution. Aims: We wish to verify the binarity hypothesis for a larger sample establish the nature of the companions, and probe the disk structure and eventually the disk formation mechanisms in binary stars. To achieve these aims, we started a high-resolution spectral monitoring of ~40 field giants whose binarity had been suspected based on either a light curve, an infrared excess, or a peculiar chemical composition. Methods: Starting from the spring of 2009, we monitored the programme stars with the fibre echelle spectrometer HERMES. We measure their radial velocities (RVs) with a precision of ~0.2 km s-1, perform detailed photospheric abundance analyses, and analyse the time-resolved high-resolution spectra to search for line-profile variability. Results: Here we report on the discovery of periodic RV variations in BD+46°442, a high Galactic latitude F giant with a disk. We infer that the variations are caused by the motion around a faint companion, and deduce the orbital parameters Porb = 140.77 ± 0.02d,e = 0.083 ± 0.002, and asini = 0.31 AU. We find that it is a moderately metal-poor star ([M/H] = -0.7) without a strong depletion pattern in its photospheric abundances. Interestingly, many lines indeed show periodic changes with the orbital phase: H? switches between a double-peak emission line and a P Cyg-like profile, while strong metal lines appear to be split at the maximum redshift. Similar effects are likely visible in the spectra of other post-AGB binaries, but their regularity is not always apparent owing to sporadic observations. We propose that these features result from an ongoing mass transfer from the evolved giant to the companion. In particular, the blue-shifted absorption in H?, which occurs only at superior conjunction, may result from a jet originating in the accretion disk around the companion and that is seen in absorption towards the luminous primary. Based on observations made with the Mercator Telescope, operated on the island of La Palma by the Flemish Community, at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofísica de Canarias.Appendix A is available in electronic form at http://www.aanda.org

  20. Electronic structure studies of Ba/ EuFe 2 As 2 based superconductors by angle and time-resolved photoemission spectroscopy

    NASA Astrophysics Data System (ADS)

    Fink, Joerg

    2011-03-01

    We report high-resolution ARPES studies on the evolution of the electronic structure of Ba/ EuFe 2 As 2 compounds upon n-type doping by replacing Fe by Co and applying chemical pressure by substituting As by P. In particular, we have investigated the nesting conditions between the hole pockets in the centre and the electron pocket at the corner of the Brillouin zone (BZ) for various wave vectors perpendicular to the FeAs layers. In the case of chemically doped systems we observe a shift of the Fermi level in an almost rigid band system. These changes of the electronic structure upon doping cause a reduction of the nesting conditions, possibly yielding a microscopic explanation of the phase diagrams in which antiferromagnetic (AF) order is destroyed, followed by the appearance and disappearance of superconductivity at higher doping concentration. On the basis of the almost equivalent phase diagram obtained upon chemically pressurizing the compound, one expects a similar change of the electronic structure. However, in this case, with increasing P concentration, we observe a non-rigid-band-like change of the electronic structure in the centre of the BZ. In spite of this difference, also here the nesting conditions decrease with increasing P substitution, possibly providing a microscopic explanation for the phase diagram. Finally, we have performed femtosecond time-resolved ARPES studies on undoped and doped Ba/ EuFe 2 As 2 after optical pumping. Regarding the relaxation processes we obtain information on the complex dynamics of the excited electronic state in these semi metallic systems. Furthermore, we derive a small electron-phonon coupling constant making electron-phonon coupling an unlikely candidate for the mechanism of high-Tc superconductivity in these compounds. This work is performed in collaboration with S. Thirupathaiah, E. Rienks, H. A. Dürr, S. de Jong, E. van Heumen, E. Slooten, Y. Huang, R. Huisman, M. S. Golden, L. Rettig, R. Cortes, U. Bovensiepen, M. Wolf, A. Erb, T. Wolf, H.S. Jeevan, P. Gegenwart.

  1. Effect of Fresnel reflection on time-resolved transmission measurements

    Microsoft Academic Search

    Yukari Takahashi; Yukio Yamada; Yasuo Hasegawa

    1995-01-01

    Time-resolved spectroscopy in the near-infrared wavelength range is a promising technology for the development of optical tomography to measure the profiles of oxygenation state in living tissues. Many investigators have reported the experimental results of time-resolved reflectance and transmittance of ultra-short light pulses incident on tissue samples and phantoms. However, none of them has reported the effect of the boundary

  2. Millifluidics for chemical synthesis and time-resolved mechanistic studies.

    PubMed

    Krishna, Katla Sai; Biswas, Sanchita; Navin, Chelliah V; Yamane, Dawit G; Miller, Jeffrey T; Kumar, Challa S S R

    2013-01-01

    Procedures utilizing millifluidic devices for chemical synthesis and time-resolved mechanistic studies are described by taking three examples. In the first, synthesis of ultra-small copper nanoclusters is described. The second example provides their utility for investigating time resolved kinetics of chemical reactions by analyzing gold nanoparticle formation using in situ X-ray absorption spectroscopy. The final example demonstrates continuous flow catalysis of reactions inside millifluidic channel coated with nanostructured catalyst. PMID:24327099

  3. Non-destructive analysis of anthocyanins in cherries by means of Lambert–Beer and multivariate regression based on spectroscopy and scatter correction using time-resolved analysis

    Microsoft Academic Search

    Manuela Zude; Michael Pflanz; Lorenzo Spinelli; Carsten Dosche; Alessandro Torricelli

    In high-value sweet cherry (Prunus avium), the red coloration – determined by the anthocyanins content – is correlated with the fruit ripeness stage and market value. Non-destructive spectroscopy has been introduced in practice and may be utilized as a tool to assess the fruit pigments in the supply chain processes. From the fruit spectrum in the visible (Vis) wavelength range,

  4. A von Hamos x-ray spectrometer based on a segmented-type diffraction crystal for single-shot x-ray emission spectroscopy and time-resolved resonant inelastic x-ray scattering studies

    NASA Astrophysics Data System (ADS)

    Szlachetko, J.; Nachtegaal, M.; de Boni, E.; Willimann, M.; Safonova, O.; Sa, J.; Smolentsev, G.; Szlachetko, M.; van Bokhoven, J. A.; Dousse, J.-Cl.; Hoszowska, J.; Kayser, Y.; Jagodzinski, P.; Bergamaschi, A.; Schmitt, B.; David, C.; Lücke, A.

    2012-10-01

    We report on the design and performance of a wavelength-dispersive type spectrometer based on the von Hamos geometry. The spectrometer is equipped with a segmented-type crystal for x-ray diffraction and provides an energy resolution in the order of 0.25 eV and 1 eV over an energy range of 8000 eV-9600 eV. The use of a segmented crystal results in a simple and straightforward crystal preparation that allows to preserve the spectrometer resolution and spectrometer efficiency. Application of the spectrometer for time-resolved resonant inelastic x-ray scattering and single-shot x-ray emission spectroscopy is demonstrated.

  5. A von Hamos x-ray spectrometer based on a segmented-type diffraction crystal for single-shot x-ray emission spectroscopy and time-resolved resonant inelastic x-ray scattering studies

    SciTech Connect

    Szlachetko, J. [Paul Scherrer Institut, 5232 Villigen PSI (Switzerland); Institute of Physics, Jan Kochanowski University, 25-406 Kielce (Poland); Nachtegaal, M.; Boni, E. de; Willimann, M.; Safonova, O.; Sa, J.; Smolentsev, G.; Szlachetko, M.; Bergamaschi, A.; Schmitt, B.; David, C.; Luecke, A. [Paul Scherrer Institut, 5232 Villigen PSI (Switzerland); Bokhoven, J. A. van [Paul Scherrer Institut, 5232 Villigen PSI (Switzerland); Institute for Chemical and Bioengineering, ETH Zurich, 8093 Zuerich (Switzerland); Dousse, J.-Cl.; Hoszowska, J.; Kayser, Y. [Department of Physics, University of Fribourg, 1700 Fribourg (Switzerland); Jagodzinski, P. [University of Technology, Kielce (Poland)

    2012-10-15

    We report on the design and performance of a wavelength-dispersive type spectrometer based on the von Hamos geometry. The spectrometer is equipped with a segmented-type crystal for x-ray diffraction and provides an energy resolution in the order of 0.25 eV and 1 eV over an energy range of 8000 eV-9600 eV. The use of a segmented crystal results in a simple and straightforward crystal preparation that allows to preserve the spectrometer resolution and spectrometer efficiency. Application of the spectrometer for time-resolved resonant inelastic x-ray scattering and single-shot x-ray emission spectroscopy is demonstrated.

  6. Two-Photon Fluorescence Correlation Spectroscopy

    NASA Technical Reports Server (NTRS)

    Zimmerli, Gregory A.; Fischer, David G.

    2002-01-01

    We will describe a two-photon microscope currently under development at the NASA Glenn Research Center. It is composed of a Coherent Mira 900 tunable, pulsed Titanium:Sapphire laser system, an Olympus Fluoview 300 confocal scanning head, and a Leica DM IRE inverted microscope. It will be used in conjunction with a technique known as fluorescence correlation spectroscopy (FCS) to study intracellular protein dynamics. We will briefly explain the advantages of the two-photon system over a conventional confocal microscope, and provide some preliminary experimental results.

  7. Time-resolved surface infrared spectroscopy during atomic layer deposition of TiO{sub 2} using tetrakis(dimethylamido)titanium and water

    SciTech Connect

    Sperling, Brent A., E-mail: brent.sperling@nist.gov; Hoang, John; Kimes, William A.; Maslar, James E. [Chemical Sciences Division, National Institute of Standards and Technology, 100 Bureau Dr., Stop 8320, Gaithersburg, Maryland 20899-8320 (United States); Steffens, Kristen L. [Biomolecular Measurement Division, National Institute of Standards and Technology, 100 Bureau Dr., Stop 8362, Gaithersburg, Maryland 20899-8362 (United States); Nguyen, Nhan V. [Semiconductor and Dimensional Metrology Division, National Institute of Standards and Technology, 100 Bureau Dr., Stop 8120, Gaithersburg, Maryland 20899-8120 (United States)

    2014-05-15

    Atomic layer deposition of titanium dioxide using tetrakis(dimethylamido)titanium (TDMAT) and water vapor is studied by reflection-absorption infrared spectroscopy (RAIRS) with a time resolution of 120?ms. At 190?°C and 240?°C, a decrease in the absorption from adsorbed TDMAT is observed without any evidence of an adsorbed product. Ex situ measurements indicate that this behavior is not associated with an increase in the impurity concentration or a dramatic change in the growth rate. A desorbing decomposition product is consistent with these observations. RAIRS also indicates that dehydroxylation of the growth surface occurs only among one type of surface hydroxyl groups. Molecular water is observed to remain on the surface and participates in reactions even at a relatively high temperature (110?°C) and with long purge times (30?s)

  8. Time-resolved photocurrent spectroscopy of the evolution of the electric field in optically excited superlattices and the prospects for Bloch gain

    NASA Astrophysics Data System (ADS)

    Lisauskas, Alvydas; Blöser, Claudia; Sachs, Robert; Roskos, Hartmut G.; Juozapavi?ius, Aušrius; Valušis, Gintaras; Köhler, Klaus

    2005-03-01

    We report on photocurrent spectroscopy on undoped GaAs /AlGaAs semiconductor superlattices subjected to femtosecond optical excitation. The evolution of the carrier-drift-induced inhomogeneity of the electric field is studied by tracing the shifting and broadening of Wannier-Stark transitions as a function of delay time and bias field. Based on experimental data and results of numerical simulations, we find that the superlattice rapidly splits into two moving field regions, one with strong field gradient and low electron density, the other with partially screened field at low gradient and high electron density. Concerning future Bloch-gain measurements, we find that gain is expected in spite of the inhomogeneous field if the electron-rich region is not heavily screened. The time window during which Bloch gain exists is determined by the sweep out of the electrons (10-30ps).

  9. Time resolved FRET measurement in various heterogeneous media using merocyanine dye as a donor

    NASA Astrophysics Data System (ADS)

    Kedia, Niraja; Bagchi, Sanjib

    2015-06-01

    Ultrafast fluorescence resonance energy transfer (FRET) from a merocyanine dye to a Rhodamine 6G (R6G) molecule in micelles formed by the surfactants SDS and DTAB and also in a catanionic vesicle formed by SDS and DTAB has been studied by picosecond time resolved emission spectroscopy. Here the dye acts as a donor molecule and R6G acts as the acceptor molecule. Multiple timescales of FRET have been detected, namely, an ultrafast component of 100-500 ps and relatively long component (1800-3300 ps). The different time scales are attributed to different donor-acceptor distances.

  10. Fluorescence lifetime spectroscopy for breast cancer margins assessment

    NASA Astrophysics Data System (ADS)

    Gorpas, Dimitris; Fatakdawala, Hussain; Zhang, Yanhong; Bold, Richard; Marcu, Laura

    2015-03-01

    During breast conserving surgery (BCS), which is the preferred approach to treat most early stage breast cancers, the surgeon attempts to excise the tumor volume, surrounded by thin margin of normal tissue. The intra-operative assessment of cancerous areas is a challenging procedure, with the surgeon usually relying on visual or tactile guidance. This study evaluates whether time-resolved fluorescence spectroscopy (TRFS) presents the potential to address this problem. Point TRFS measurements were obtained from 19 fresh tissue slices (7 patients) and parameters that characterize the transient signals were quantified via constrained least squares deconvolution scheme. Fibrotic tissue (FT, n=69), adipose tissue (AT, n=76), and invasive ductal carcinoma (IDC, n=27) were identified in histology and univariate statistical analysis, followed by multi-comparison test, was applied to the corresponding lifetime data. Significant differentiation between the three tissue types exists at 390 nm and 500 nm bands. The average lifetime is 3.23+/-0.74 ns for AT, 4.21+/-0.83 ns for FT and 4.71+/-0.35 ns (p<0.05) for IDC at 390 nm. Due to the smaller contribution of collagen in AT the average lifetime value is different from FT and IDC. Additionally, although intensity measurements do not show difference between FT and IDC, lifetime can distinguish them. Similarly, in 500 nm these values are 7.01+/-1.08 ns, 5.43+/-1.05 ns and 4.39+/-0.88 ns correspondingly (p<0.05) and this contrast is due to differentiation in retinol or flavins relative concentration, mostly contributing to AT. Results demonstrate the potential of TRFS to intra-operatively characterize BCS breast excised tissue in real-time and assess tumor margins.

  11. Time-resolved fluorescence resonance energy transfer (TR-FRET) to analyze the disruption of EGFR/HER2 dimers: a new method to evaluate the efficiency of targeted therapy using monoclonal antibodies.

    PubMed

    Gaborit, Nadège; Larbouret, Christel; Vallaghe, Julie; Peyrusson, Frédéric; Bascoul-Mollevi, Caroline; Crapez, Evelyne; Azria, David; Chardès, Thierry; Poul, Marie-Alix; Mathis, Gérard; Bazin, Hervé; Pèlegrin, André

    2011-04-01

    In oncology, simultaneous inhibition of epidermal growth factor receptor (EGFR) and HER2 by monoclonal antibodies (mAbs) is an efficient therapeutic strategy but the underlying mechanisms are not fully understood. Here, we describe a time-resolved fluorescence resonance energy transfer (TR-FRET) method to quantify EGFR/HER2 heterodimers on cell surface to shed some light on the mechanism of such therapies. First, we tested this antibody-based TR-FRET assay in NIH/3T3 cell lines that express EGFR and/or HER2 and in various tumor cell lines. Then, we used the antibody-based TR-FRET assay to evaluate in vitro the effect of different targeted therapies on EGFR/HER2 heterodimers in the ovarian carcinoma cell line SKOV-3. A simultaneous incubation with Cetuximab (anti-EGFR) and Trastuzumab (anti-HER2) disturbed EGFR/HER2 heterodimers resulting in a 72% reduction. Cetuximab, Trastuzumab or Pertuzumab (anti-HER2) alone induced a 48, 44, or 24% reduction, respectively. In contrast, the tyrosine kinase inhibitors Erlotinib and Lapatinib had very little effect on EGFR/HER2 dimers concentration. In vivo, the combination of Cetuximab and Trastuzumab showed a better therapeutic effect (median survival and percentage of tumor-free mice) than the single mAbs. These results suggest a correlation between the extent of the mAb-induced EGFR/HER2 heterodimer reduction and the efficacy of such mAbs in targeted therapies. In conclusion, quantifying EGFR/HER2 heterodimers using our antibody-based TR-FRET assay may represent a useful method to predict the efficacy and explain the mechanisms of action of therapeutic mAbs, in addition to other commonly used techniques that focus on antibody-dependent cellular cytotoxicity, phosphorylation, and cell proliferation. PMID:21282108

  12. A direct interaction between the sigma-1 receptor and the hERG voltage-gated K+ channel revealed by atomic force microscopy and homogeneous time-resolved fluorescence (HTRF®).

    PubMed

    Balasuriya, Dilshan; D'Sa, Lauren; Talker, Ronel; Dupuis, Elodie; Maurin, Fabrice; Martin, Patrick; Borgese, Franck; Soriani, Olivier; Edwardson, J Michael

    2014-11-14

    The sigma-1 receptor is an endoplasmic reticulum chaperone protein, widely expressed in central and peripheral tissues, which can translocate to the plasma membrane and modulate the function of various ion channels. The human ether-à-go-go-related gene encodes hERG, a cardiac voltage-gated K(+) channel that is abnormally expressed in many human cancers and is known to interact functionally with the sigma-1 receptor. Our aim was to investigate the nature of the interaction between the sigma-1 receptor and hERG. We show that the two proteins can be co-isolated from a detergent extract of stably transfected HEK-293 cells, consistent with a direct interaction between them. Atomic force microscopy imaging of the isolated protein confirmed the direct binding of the sigma-1 receptor to hERG monomers, dimers, and tetramers. hERG dimers and tetramers became both singly and doubly decorated by sigma-1 receptors; however, hERG monomers were only singly decorated. The distribution of angles between pairs of sigma-1 receptors bound to hERG tetramers had two peaks, at ?90 and ?180° in a ratio of ?2:1, indicating that the sigma-1 receptor interacts with hERG with 4-fold symmetry. Homogeneous time-resolved fluorescence (HTRF®) allowed the detection of the interaction between the sigma-1 receptor and hERG within the plane of the plasma membrane. This interaction was resistant to sigma ligands, but was decreased in response to cholesterol depletion of the membrane. We suggest that the sigma-1 receptor may bind to hERG in the endoplasmic reticulum, aiding its assembly and trafficking to the plasma membrane. PMID:25266722

  13. Fluorescence Correlation Spectroscopy: Past, Present, Future

    PubMed Central

    Elson, Elliot L.

    2011-01-01

    In recent years fluorescence correlation spectroscopy (FCS) has become a routine method for determining diffusion coefficients, chemical rate constants, molecular concentrations, fluorescence brightness, triplet state lifetimes, and other molecular parameters. FCS measures the spatial and temporal correlation of individual molecules with themselves and so provides a bridge between classical ensemble and contemporary single-molecule measurements. It also provides information on concentration and molecular number fluctuations for nonlinear reaction systems that complement single-molecule measurements. Typically implemented on a fluorescence microscope, FCS samples femtoliter volumes and so is especially useful for characterizing small dynamic systems such as biological cells. In addition to its practical utility, however, FCS provides a window on mesoscopic systems in which fluctuations from steady states not only provide the basis for the measurement but also can have important consequences for the behavior and evolution of the system. For example, a new and potentially interesting field for FCS studies could be the study of nonequilibrium steady states, especially in living cells. PMID:22208184

  14. Dynamics of CO in Mesoporous Silica Monitored by Time ResolvedStep-Scan and Rapid-Scan FT-IR Spectroscopy

    SciTech Connect

    Andersen, Lars K.; Frei, Heinz

    2007-12-05

    Carbon monoxide molecules generated in the channels ofmesoporous MCM-41 silica sieve from a precursor (diphenyl cyclopropenone)by photodissociation with a nanosecond laser pulse were monitored by timeresolved FT-infrared spectroscopy using the step-scan and rapid-scanmethods. A very broad absorption of CO is observed in the region 2200 to2080 cm-1 at room temperature that decays in a biphasic mode. Two-thirdsof the band intensity decays on the hundreds of microsecond scale(lifetime 344 + 70 ?s). The process represents the escape of themolecules through the mesopores into the surrounding gas phase, and adiffusion constant of 1.5 x 10-9 m2/sec is derived. The broad profile ofthe absorption is attributed to contact of the random hopping CO withsiloxaneand silanol groups of the pore surface. Measurements usingMCM-41 with the silanols partially capped by trimethyl silyl groups gavefurther insight into the nature of the infrared band profile. These arethe first observations on the diffusion behavior of carbon monoxide in amesoporous material at room temperature. The residual carbon monoxideremains much longer in the pores and features distinct peaks at 2167 and2105 cm-1 characteristic for CO adsorbed on SiOH groups C end on and Oend on, respectively. The bands decrease with time constants of 113 + 3ms (2167 cm-1) and 155 + 15 ms (2105 cm-1) suggesting that CO in thesesites is additionally trapped by surrounding diphenyl acetyleneco-product and/or precursor molecules.

  15. Time-resolved x-ray spectroscopy of deeply buried tracer layers as a density and temperature diagnostic for the fast ignitor

    SciTech Connect

    Nikitenko, A. I., Lebedev Physical Institute, Russian Academy of Sciences

    1997-03-26

    The fast igniter concept for inertial confinement fusion relies on the generation of hot electrons, produced by a short-pulse ultra-high intensity laser, which propagate through high-density plasma to deposit their energy in the compressed fuel core and heat it to ignition. In preliminary experiments designed to investigate deep heating of high density matter, we used a 20 joule, 0.5-30 ps laser to heat solid targets, and used emission spectroscopy to measure plasma temperatures and densities achieved at large depths (2-20 microns) away from the initial target surface. The targets consisted of an Al tracer layer buried within a massive CH slab H-like and He-like line emission was then used to diagnose plasma conditions. We observe spectra from tracer layers buried up to 20 microns deep, measure emission durations of up to 200 ps, measure plasma temperatures up to T{sub c} = 650 eV, and measure electron densities near 10{sup 23} cm{sup -3}. Analysis is in progress, but the data appear to be in reasonable agreement with simulations when space-charge induced inhibition is included in hot-electron transport.

  16. In vivo swine myocardial tissue characterization and monitoring during open chest surgery by time-resolved diffuse near-infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Spinelli, Lorenzo; Contini, Davide; Farina, Andrea; Torricelli, Alessandro; Pifferi, Antonio; Cubeddu, Rinaldo; Ascari, Luca; Potì, Luca; Trivella, Maria Giovanna; L'Abbate, Antonio; Puzzuoli, Stefano

    2011-03-01

    Cardiovascular diseases are the main cause of death in industrialized countries. Worldwide, a large number of patients suffering from cardiac diseases are treated by surgery. Despite the advances achieved in the last decades with myocardial protection, surgical failure can still occur. This is due at least in part to the imperfect control of the metabolic status of the heart in the various phases of surgical intervention. At present, this is indirectly controlled by the electrocardiogram and the echographic monitoring of cardiac mechanics as direct measurements are lacking. Diffuse optical technologies have recently emerged as promising tools for the characterization of biological tissues like breast, muscles and bone, and for the monitoring of important metabolic parameters such as blood oxygenation, volume and flow. As a matter of fact, their utility has been demonstrated in a variety of applications for functional imaging of the brain, optical mammography and monitoring of muscle metabolism. However, due to technological and practical difficulties, their potential for cardiac monitoring has not yet been exploited. In this work we show the feasibility of the in-vivo determination of absorption and scattering spectra of the cardiac muscle in the 600-1100 nm range, and of monitoring myocardial tissue hemodynamics by time domain near-infrared spectroscopy at 690 nm and 830 nm. Both measurements have been performed on the exposed beating heart during open chest surgery in pigs, an experimental model closely mimicking the clinical cardio-surgical setting.

  17. Pinpointing the extent of electronic delocalization in the Re(I)-to-tetrazine charge-separated excited state using time-resolved infrared spectroscopy.

    PubMed

    Li, Guifeng; Parimal, Kumar; Vyas, Shubham; Hadad, Christopher M; Flood, Amar H; Glusac, Ksenija D

    2009-08-26

    Femtosecond mid-IR transient absorption spectroscopy (TRIR) and time-dependent density functional theory (TD-DFT) calculations on Re(CO)(3)Cl(Me(2)BPTZ) [Me(2)BPTZ = 3,6-bis(5-methyl-2-pyridine)-1,2,4,5-tetrazine] are used to demonstrate that the lowest excited state of the complex is a triplet metal-to-ligand charge-transfer ((3)MLCT) state with a lifetime of 225 ps. The short excited-state lifetime is explained by the energy-gap law. Vibrational cooling of the (3)MLCT state shows up as early-time dynamics (3.6 ps). The structural changes in the excited state are deduced from the frequency shifts in the TRIR vibrational bands. The vibrational frequencies of the CO groups increase upon excitation as a result of decreased back-bonding between the CO ligands and the oxidized Re center in the (3)MLCT state. The vibrational frequencies of the central tetrazine ring of Me(2)BPTZ decrease because of the decrease in the bond order upon reduction of the Me(2)BPTZ ligand in the (3)MLCT state. Interestingly, the TRIR signals from the pyridine moieties of Me(2)BPTZ were not detected. These results can be explained by localization of the electronic charge on the central tetrazine ring in the (3)MLCT state of Re(CO)(3)Cl(Me(2)BPTZ), as supported by TD-DFT calculations. PMID:19653686

  18. Proton transfer and protein conformation dynamics in photosensitive proteins by time-resolved step-scan Fourier-transform infrared spectroscopy.

    PubMed

    Lórenz-Fonfría, Víctor A; Heberle, Joachim

    2014-01-01

    Monitoring the dynamics of protonation and protein backbone conformation changes during the function of a protein is an essential step towards understanding its mechanism. Protonation and conformational changes affect the vibration pattern of amino acid side chains and of the peptide bond, respectively, both of which can be probed by infrared (IR) difference spectroscopy. For proteins whose function can be repetitively and reproducibly triggered by light, it is possible to obtain infrared difference spectra with (sub)microsecond resolution over a broad spectral range using the step-scan Fourier transform infrared technique. With -10(2)-10(3) repetitions of the photoreaction, the minimum number to complete a scan at reasonable spectral resolution and bandwidth, the noise level in the absorption difference spectra can be as low as -10(-) (4), sufficient to follow the kinetics of protonation changes from a single amino acid. Lower noise levels can be accomplished by more data averaging and/or mathematical processing. The amount of protein required for optimal results is between 5-100 µg, depending on the sampling technique used. Regarding additional requirements, the protein needs to be first concentrated in a low ionic strength buffer and then dried to form a film. The protein film is hydrated prior to the experiment, either with little droplets of water or under controlled atmospheric humidity. The attained hydration level (g of water / g of protein) is gauged from an IR absorption spectrum. To showcase the technique, we studied the photocycle of the light-driven proton-pump bacteriorhodopsin in its native purple membrane environment, and of the light-gated ion channel channelrhodopsin-2 solubilized in detergent. PMID:24998200

  19. Proton Transfer and Protein Conformation Dynamics in Photosensitive Proteins by Time-resolved Step-scan Fourier-transform Infrared Spectroscopy

    PubMed Central

    Lórenz-Fonfría, Víctor A.; Heberle, Joachim

    2014-01-01

    Monitoring the dynamics of protonation and protein backbone conformation changes during the function of a protein is an essential step towards understanding its mechanism. Protonation and conformational changes affect the vibration pattern of amino acid side chains and of the peptide bond, respectively, both of which can be probed by infrared (IR) difference spectroscopy. For proteins whose function can be repetitively and reproducibly triggered by light, it is possible to obtain infrared difference spectra with (sub)microsecond resolution over a broad spectral range using the step-scan Fourier transform infrared technique. With ~102-103 repetitions of the photoreaction, the minimum number to complete a scan at reasonable spectral resolution and bandwidth, the noise level in the absorption difference spectra can be as low as ~10-4, sufficient to follow the kinetics of protonation changes from a single amino acid. Lower noise levels can be accomplished by more data averaging and/or mathematical processing. The amount of protein required for optimal results is between 5-100 µg, depending on the sampling technique used. Regarding additional requirements, the protein needs to be first concentrated in a low ionic strength buffer and then dried to form a film. The protein film is hydrated prior to the experiment, either with little droplets of water or under controlled atmospheric humidity. The attained hydration level (g of water / g of protein) is gauged from an IR absorption spectrum. To showcase the technique, we studied the photocycle of the light-driven proton-pump bacteriorhodopsin in its native purple membrane environment, and of the light-gated ion channel channelrhodopsin-2 solubilized in detergent. PMID:24998200

  20. Probing protein oligomerization in living cells with fluorescence fluctuation spectroscopy

    Microsoft Academic Search

    Yan Chen; Li-Na Wei; Joachim D. Müller

    2003-01-01

    Fluorescence fluctuation spectroscopy provides information about protein interactions in the intercellular environment from naturally occurring equilibrium fluctuations. We determine the molecular brightness of fluorescent proteins from the fluctuations by analyzing the photon counting histogram (PCH) or its moments and demonstrate the use of molecular brightness in probing the oligomerization state of proteins. We report fluorescence fluctuation measurements of enhanced GFP

  1. Optimizing Disinfection Pretreatment using Excitation-emission Matrix Fluorescence Spectroscopy

    Microsoft Academic Search

    Katherine Y. Bell; Juan Sánez; Martha J. M. Wells

    2012-01-01

    Excitation-emission matrix fluorescence spectroscopy (EEM) can be used to characterize organic matter present in water samples. When excited, the intensity of fluorescence emitted can be used to generate a representation of organic matter makes it possible to localize fluorescence centers related to particular groups, which can ‘fingerprint’ a sample. The technique is applicable to wastewater samples to identify contributors of

  2. Using the finite-difference time-domain pulse propagation method to simulate time-resolved THz experiments

    E-print Network

    Using the finite-difference time-domain pulse propagation method to simulate time-resolved THz The finite-difference time-domain FDTD method has been applied to time-resolved THz spectroscopy TRTS experiments. Time-resolved THz spectroscopy utilizes an optical pump pulse to excite the sample, followed

  3. Fluorescence Spectroscopy Investigations of Cutaneous Tissues

    NASA Astrophysics Data System (ADS)

    Borisova, E.; Bliznakova, I.; Momchilov, N.; Troyanova, P.; Avramov, L.

    2007-04-01

    Fluorescence Spectroscopy of the human skin is very prominent for early diagnosis and differentiation of cutaneous diseases. Selection of proper excitation sources and sensitive detectors gives wide range of possibilities related to real-time determination of existing pathological conditions. A problem with using laser as an excitation source is the high expenses associated with the operation of these types of installations. This is why we test capability of a cheaper excitation sources - ultraviolet and blue light-emitting diodes. Initially, we investigate the spectral response of normal skin from different anatomic areas, as well as from different phototypes volunteers. Our first results obtained demonstrated promising possibility to implement an inexpensive system for detection of cutaneous lesions with wide clinical applications. The results achieved will be introduced in development of diagnostic algorithms for improvement of diagnostic sensitivity of benign and malignant tumor lesions determination.

  4. A fluorescence lifetime spectroscopy study of matrix metalloproteinases -2 and -9 in human atherosclerotic plaque

    PubMed Central

    Phipps, Jennifer E.; Hatami, Nisa; Galis, Zorina S.; Baker, J. Dennis; Fishbein, Michael C.; Marcu, Laura

    2011-01-01

    Matrix metalloproteinase (MMP) -2 and -9 play important roles in the progression of atherosclerosis. This study aims to determine whether MMP-2 and -9 content in the fibrotic caps of atherosclerotic plaque is correlated with plaque autofluorescence. A time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) system was used to measure the autofluorescence and assess the biochemical composition of human plaques obtained from carotid endarterectomy. Results presented here demonstrate for the first time the ability to characterize the biochemical composition as it relates to MMP-2 and -9 content in the atherosclerotic plaque cap using a label-free imaging technique implemented with a fiberoptic TR-LIFS system. PMID:21770037

  5. Imaging of the fluorescence spectrum of a single fluorescent molecule by prism-based spectroscopy

    Microsoft Academic Search

    Yoshikazu Suzuki; Tomomi Tani; Kazuo Sutoh; Shinji Kamimura

    2002-01-01

    We have devised a novel method to visualize the fluorescence spectrum of a single fluorescent molecule using prism-based spectroscopy. Equiping a total internal reflection microscope with a newly designed wedge prism, we obtained a spectral image of a single rhodamine red molecule attached to an essential light chain of myosin. We also obtained a spectral image of single-pair fluorescence resonance

  6. Spectral decomposition of NAD(P)H fluorescence components recorded by multi-wavelength fluorescence lifetime spectroscopy in living cardiac cells

    NASA Astrophysics Data System (ADS)

    Chorvatova, Alzbeta; Mateasik, Anton; Chorvat, Dusan, Jr.

    2013-12-01

    We report a novel analytical approach to identify individual components of a cell’s endogenous fluorescence, recorded by spectrally-resolved time-correlated single photon counting (TCSPC). Time-resolved area-normalized emission spectroscopy (TRANES) and principal component analysis (PCA) were applied to estimate the number of spectral components after metabolic modulation of cardiac cells following excitation with a 375 nm picosecond laser. Linear unmixing of TCSPC data spectrally decomposed individual components in living cells, while using characteristics of endogenously fluorescing molecules in solvents as a reference spectral database. Our data demonstrate the presence of three individual components, corresponding to the nicotinamide adenine dinucleotide (phosphate) (NAD(P)H) in organic and inorganic solvents and to the residual flavoprotein fluorescence. The presented analytical approach offers a new alternative for the spectral separation of multi-wavelength fluorescence lifetime spectroscopy data to the conventional analysis, and opens a new possibility for the use of pattern recognition for fast resolution of components in 2D fluorescence lifetime microscopy images.

  7. Time-to-digital converter card for multichannel time-resolved single-photon counting applications

    NASA Astrophysics Data System (ADS)

    Tamborini, Davide; Portaluppi, Davide; Tisa, Simone; Tosi, Alberto

    2015-03-01

    We present a high performance Time-to-Digital Converter (TDC) card that provides 10 ps timing resolution and 20 ps (rms) timing precision with a programmable full-scale-range from 160 ns to 10 ?s. Differential Non-Linearity (DNL) is better than 1.3% LSB (rms) and Integral Non-Linearity (INL) is 5 ps rms. Thanks to the low power consumption (400 mW) and the compact size (78 mm x 28 mm x 10 mm), this card is the building block for developing compact multichannel time-resolved instrumentation for Time-Correlated Single-Photon Counting (TCSPC). The TDC-card outputs the time measurement results together with the rates of START and STOP signals and the number of valid TDC conversions. These additional information are needed by many TCSPC-based applications, such as: Fluorescence Lifetime Imaging (FLIM), Time-of-Flight (TOF) ranging measurements, time-resolved Positron Emission Tomography (PET), single-molecule spectroscopy, Fluorescence Correlation Spectroscopy (FCS), Diffuse Optical Tomography (DOT), Optical Time-Domain Reflectometry (OTDR), quantum optics, etc.

  8. Genesis of Gold Clusters from Mononuclear Gold Complexes on TiO[subscript 2]: Reduction and Aggregation of Gold Characterized by Time-Resolved X-Ray Absorption Spectroscopy

    SciTech Connect

    Fierro-Gonzalez, Juan C.; Gates, Bruce C. (UCD)

    2010-07-19

    Mononuclear gold complexes bonded to TiO{sub 2} were synthesized from Au(CH{sub 3}){sub 2}(C{sub 5}H{sub 7}O{sub 2}), and their decomposition and conversion into gold nanoclusters on the TiO{sub 2} surface were characterized by time-resolved X-ray absorption and infrared spectroscopies as the temperature of the sample in flowing helium was ramped up. Mass spectra of the evolved gases were also measured during this process. The results show (a) the onset of formation of CH{sub 4} as a decomposition product, (b) the reduction of Au{sup III} to Au{sup 0}, and (c) the formation of Au-Au bonds, all occurring in approximately the same temperature range (about 335-353 K), indicating that the reduction and aggregation of the supported gold are simultaneous processes facilitated by the removal of methyl ligands initially bonded to the gold. IR spectra recorded during the treatment indicate that water on the TiO{sub 2} surface may be involved in the process by reacting with methyl groups bonded to Au{sup III} to give CH{sub 4}.

  9. Implementation of Spatio-Time-Resolved Cathodoluminescence Spectroscopy for Studying Local Carrier Dynamics in a Low Dislocation Density m-Plane In0.05Ga0.95N Epilayer Grown on a Freestanding GaN Substrate

    NASA Astrophysics Data System (ADS)

    Kagaya, Munehito; Corfdir, Pierre; Ganière, Jean-Daniel; Deveaud-Plédran, Benoît; Grandjean, Nicolas; Chichibu, Shigefusa F.

    2011-11-01

    Spatio-time-resolved cathodoluminescence (STRCL) spectroscopy is implemented to assess the local carrier dynamics in a 70-nm-thick, very low threading dislocation (TD) density, pseudomorphic m-plane In0.05Ga0.95N epilayer grown on a freestanding GaN substrate by metalorganic vapor phase epitaxy. Although TDs or stacking faults are absent, sub-micrometer-wide zonary patterns parallel to the c-axis and 2-µm-long-axis figure-of-8 patterns parallel to the a-axis are clearly visualized in the monochromatic cathodoluminescence intensity images. Because the STRCL measurement reveals very little spatial variation of low-temperature radiative lifetime, the considerable peak energy variation is interpreted to originate from nonidentical In-incorporation efficiency for the growing surfaces exhibiting various miscut angles. The figure-of-8 patterns are ascribed to originate from the anisotropic, severe m-plane tilt mosaic along the a-axis of the GaN substrate, and the zonary patterns may originate from the m-plane tilt mosaic along the c-axis.

  10. Thermal stability in the blended lithium manganese oxide – Lithium nickel cobalt manganese oxide cathode materials: An in situ time-resolved X-Ray diffraction and mass spectroscopy study

    DOE PAGESBeta

    Hu, Enyuan; Bak, Seong Min; Senanayake, Sanjaya D.; Yang, Xiao-Qing; Nam, Kyung-Wan; Zhang, Lulu; Shao, Minhua

    2015-03-01

    Thermal stabilities of a series of blended LiMn2O4(LMO)-LiNi1/3Co1/3Mn1/3O2 (NCM) cathode materials with different weight ratios were studied by in situ time-resolved X-ray diffraction (XRD) combined with mass spectroscopy in the temperature range of 25°C-580°C under helium atmosphere. Upon heating, the electrochemically delithiated LMO changed into Mn3O4 phase at around 250°C. Formation of MnO with rocksalt structure started at 520°C. This observation is in contrast to the previous report for chemically delithiate LMO in air, in which a process of ?-MnO2 transforming to ?-MnO2 was observed. Oxygen peak was not observed in all cases, presumably as a result of either consumptionmore »by the carbon or detection limit. CO2 profile correlates well with the phase transition and indirectly suggests the oxygen release of the cathode. Introducing NCM into LMO has two effects: first, it makes the high temperature rock-salt phase formation more complicated with more peaks in CO2 profile due to different MO (M = Ni, Mn, Co) phases; secondly, the onset temperature of CO2 release is lowered, implying lowered oxygen release temperature. Upon heating, XRD patterns indicate the NCM part reacts first, followed by the LMO part. This confirms the better thermal stability of LMO over NCM.« less

  11. Thermal stability in the blended lithium manganese oxide - Lithium nickel cobalt manganese oxide cathode materials: An in situ time-resolved X-Ray diffraction and mass spectroscopy study

    NASA Astrophysics Data System (ADS)

    Hu, Enyuan; Bak, Seong Min; Senanayake, Sanjaya D.; Yang, Xiao-Qing; Nam, Kyung-Wan; Zhang, Lulu; Shao, Minhua

    2015-03-01

    Thermal stabilities of a series of blended LiMn2O4 (LMO)-LiNi1/3Co1/3Mn1/3O2 (NCM) cathode materials with different weight ratios were studied by in situ time-resolved X-ray diffraction (XRD) combined with mass spectroscopy in the temperature range of 25 °C-580 °C under helium atmosphere. Upon heating, the electrochemically delithiated LMO changed into Mn3O4 phase at around 250 °C. Formation of MnO with rock-salt structure started at 520 °C. This observation is in contrast to the previous report for chemically delithiated LMO in air, in which a process of ?-MnO2 transforming to ?-MnO2 was observed. Oxygen peak was not observed in all cases, presumably as a result of either consumption by the carbon or detection limit. CO2 profile correlates well with the phase transition and indirectly suggests the oxygen release of the cathode. Introducing NCM into LMO has two effects: first, it makes the high temperature rock-salt phase formation more complicated with more peaks in CO2 profile due to different MO (M = Ni, Mn, Co) phases; secondly, the onset temperature of CO2 release is lowered, implying lowered oxygen release temperature. Upon heating, XRD patterns indicate the NCM part reacts first, followed by the LMO part. This confirms the better thermal stability of LMO over NCM.

  12. Guest-host interactions investigated by time-resolved X?ray spectroscopies and scattering at MHz rates: solvation dynamics and photoinduced spin transition in aqueous Fe(bipy)3(2+).

    PubMed

    Haldrup, K; Vankó, G; Gawelda, W; Galler, A; Doumy, G; March, A M; Kanter, E P; Bordage, A; Dohn, A; van Driel, T B; Kjær, K S; Lemke, H T; Canton, S E; Uhlig, J; Sundström, V; Young, L; Southworth, S H; Nielsen, M M; Bressler, C

    2012-10-11

    We have studied the photoinduced low spin (LS) to high spin (HS) conversion of [Fe(bipy)(3)](2+) in aqueous solution. In a laser pump/X-ray probe synchrotron setup permitting simultaneous, time-resolved X-ray diffuse scattering (XDS) and X-ray spectroscopic measurements at a 3.26 MHz repetition rate, we observed the interplay between intramolecular dynamics and the intermolecular caging solvent response with better than 100 ps time resolution. On this time scale, the initial ultrafast spin transition and the associated intramolecular geometric structure changes are long completed, as is the solvent heating due to the initial energy dissipation from the excited HS molecule. Combining information from X-ray emission spectroscopy and scattering, the excitation fraction as well as the temperature and density changes of the solvent can be closely followed on the subnanosecond time scale of the HS lifetime, allowing the detection of an ultrafast change in bulk solvent density. An analysis approach directly utilizing the spectroscopic data in the XDS analysis effectively reduces the number of free parameters, and both combined permit extraction of information about the ultrafast structural dynamics of the caging solvent, in particular, a decrease in the number of water molecules in the first solvation shell is inferred, as predicted by recent theoretical work. PMID:22970732

  13. Attosecond Time-Resolved Autoionization of Argon Michael Chini,1

    E-print Network

    Thumm, Uwe

    Fano profiles as a function of the photoelectron energy. However, made possible by significant recent) Autoionization of argon atoms was studied experimentally by transient absorption spectroscopy with isolated progress in short-pulse laser technology [15], time- resolved transient XUV photoabsorption measurements

  14. Planetary Surface Analysis Using Fast Laser Spectroscopic Techniques: Combined Microscopic Raman, LIBS, and Fluorescence Spectroscopy

    NASA Astrophysics Data System (ADS)

    Blacksberg, J.; Rossman, G. R.; Maruyama, Y.; Charbon, E.

    2011-12-01

    In situ exploration of planetary surfaces has to date required multiple techniques that, when used together, yield important information about their formation histories and evolution. We present a time-resolved laser spectroscopic technique that could potentially collect complementary sets of data providing information on mineral structure, composition, and hydration state. Using a picosecond-scale pulsed laser and a fast time-resolved detector we can simultaneously collect spectra from Raman, Laser Induced Breakdown Spectroscopy (LIBS), and fluorescence emissions that are separated in time due to the unique decay times of each process. The use of a laser with high rep rate (40 KHz) and low pulse energy (1 ?J/pulse) allows us to rapidly collect high signal to noise Raman spectra while minimizing sample damage. Increasing the pulse energy by about an order of magnitude creates a microscopic plasma near the surface and enables the collection of LIBS spectra at an unusually high rep rate and low pulse energy. Simultaneously, broader fluorescence peaks can be detected with lifetimes varying from nanosecond to microsecond. We will present Raman, LIBS, and fluorescence spectra obtained on natural mineral samples such as sulfates, clays, pyroxenes and carbonates that are of interest for Mars mineralogy. We demonstrate this technique using a photocathode-based streak camera detector as well as a newly-developed solid state Single Photon Avalanche Diode (SPAD) sensor array based on Complementary Metal-Oxide Semiconductor (CMOS) technology. We will discuss the impact of system design and detector choice on science return of a potential planetary surface mission, with a specific focus on size, weight, power, and complexity. The research described here was carried out at the Jet Propulsion Laboratory, California Institute of Technology, under a contract with the National Aeronautics and Space Administration (NASA).

  15. Intramolecular and intermolecular dynamics in molecular liquids through femtosecond time-resolved impulsive stimulated scattering

    E-print Network

    Paris-Sud XI, Université de

    résultats expérimentaux récents sur la diffusion stimulée impulsionnelle (ISS) résolue aux temps la spectroscopie résolue en temps des molécules vibrationnellement distordues dans des configurations vibrational and orientational dynamics. These experiments make possible time-resolved spectroscopy

  16. Europium Uptake and Partitioning in Oat (Avena sativa) Roots as studied By Laser-Induced Fluorescence Spectroscopy and Confocal Microscopy Profiling Technique

    SciTech Connect

    Fellows, Robert J.; Wang, Zheming; Ainsworth, Calvin C.

    2003-11-15

    The uptake of Eu3+ by elongating oat plant roots was studied by fluorescence spectroscopy, fluorescence lifetime measurement, as well as laser excitation time-resolved confocal fluorescence profiling technique. The results of this work indicated that the initial uptake of Eu(III) by oat root was most evident within the apical meristem of the root just proximal to the root cap. Distribution of assimilated Eu(III) within the roots differentiation and elongation zone was non-uniform. Higher concentrations were observed within the vascular cylinder, specifically in the phloem and developing xylem parenchyma. Elevated levels of the metal were also observed in the root hairs of the mature root. The concentration of assimilated Eu3+ dropped sharply from the apical meristem to the differentiation and elongation zone and then gradually decreased as the distance from the root cap increased. Fluorescence spectroscopic characteristics of the assimilated Eu3+ suggested that the Eu3+ exists a s inner-sphere mononuclear complexes inside the root. This work has also demonstrated the effectiveness of a time-resolved Eu3+ fluorescence spectroscopy and confocal fluorescence profiling techniques for the in vivo, real-time study of metal[Eu3+] accumulation by a functioning intact plant root. This approach can prove valuable for basic and applied studies in plant nutrition and environmental uptake of actinide radionuclides.

  17. Time-resolved crystallography using the Hadamard transform.

    PubMed

    Yorke, Briony A; Beddard, Godfrey S; Owen, Robin L; Pearson, Arwen R

    2014-11-01

    We describe a method for performing time-resolved X-ray crystallographic experiments based on the Hadamard transform, in which time resolution is defined by the underlying periodicity of the probe pulse sequence, and signal/noise is greatly improved over that for the fastest pump-probe experiments depending on a single pulse. This approach should be applicable on standard synchrotron beamlines and will enable high-resolution measurements of protein and small-molecule structural dynamics. It is also applicable to other time-resolved measurements where a probe can be encoded, such as pump-probe spectroscopy. PMID:25282611

  18. Steady-state and time-resolved study of two-dimensional Foerster energy transfer between 4-heptadecyl-7-hydroxycoumarin and RhB-DPPE in phospholipid air-water monolayers

    SciTech Connect

    Urquhart, R.; Grieser, F.; Thistlethwaite, P. [Univ. of Melbourne, Parkville (Australia)] [and others

    1992-09-17

    This study utilizes the Foerster energy transfer technique to examine the state of aggregation of the phospholipid N-[[(lissamine rhodamine B)sulfonyl]dipalmitoyl]-L-{alpha}-phosphatidylethanolamine triethylammonium salt in dipalmitoyl-L-{alpha}-phosphatidylcholine matrices in various phases using time-resolved and steady-state fluorescence spectroscopy.

  19. Photoconversion mechanism of a green/red photosensory cyanobacteriochrome AnPixJ: time-resolved optical spectroscopy and FTIR analysis of the AnPixJ-GAF2 domain.

    PubMed

    Fukushima, Yoshimasa; Iwaki, Masayo; Narikawa, Rei; Ikeuchi, Masahiko; Tomita, Yusuke; Itoh, Shigeru

    2011-07-26

    The photoconversion mechanism of a green/red sensory cyanobacteriochrome AnPixJ was studied. The phycocyanobilin-binding second GAF domain of AnPixJ of Anabaena sp. PCC 7120 was expressed in Escherichia coli cells. The His-tagged AnPixJ-GAF2 domain exhibited photoconversion between the green- and red-absorbing forms, APg(543) and APr(648), respectively. We detected four intermediate states in the photocycle between them, as follows: APr(648) ? red light ? APr(648)* ? (with a rise time constant ?(r) of <100 ns) R1(650-80) (with a decay time constant ?(d) of <1 ?s) ? R2(610) (?(d) = 920 ?s) ? APg(543) ? green light ? APg(543)* ? (?(r) < 50 ns) G1(570) (?(d) = 190 ?s) ? G2(630) (?(d) = 1.01 ms) ? APr(648). These intermediates were named for their absorption peak wavelengths, which were estimated on the basis of the time-resolved difference spectra and global analysis of the time courses. The absorption spectrum of APr(648) resembles that of the Pr form of the phytochrome, while all the other states showed peaks at 530-650 nm and had wider bandwidths with smaller peak amplitudes. The fastest decay phases of fluorescence from APr(648)* and APg(543)* gave lifetimes of 200 and 42 ps, respectively, suggesting fast primary reactions. The APg(543)-minus-APr(648) difference FTIR spectrum in an H(2)O medium was significantly different from those reported for the Pfr/Pr difference spectra in phytochromes. Most of the peaks in the difference spectrum were shifted in the D(2)O medium, suggesting the high accessibility to the aqueous phase. The interactions of the phycocyanobilin chromophore with the surrounding amino acid residues, which are fairly different from those in the GAF domain of phytochromes, realize the unique green/red photocycle of AnPixJ. PMID:21714499

  20. Time-resolved FRET reveals the structural mechanism of SERCAPLB Xiaoqiong Dong a

    E-print Network

    Thomas, David D.

    Time-resolved FRET reveals the structural mechanism of SERCA­PLB regulation Xiaoqiong Dong May 2014 Keywords: Phospholamban SERCA Phosphorylation FRET a b s t r a c t We have used time-resolved fluorescence resonance energy transfer (TR-FRET) to characterize the inter- action between phospholamban (PLB

  1. [Synthesis of byrazoline fluorescent compounds and studies by infrared spectroscopy].

    PubMed

    Xian, Yuan-fang; Li, Dong-feng; Li, Hai-dong; Yu, Bao-hui

    2005-03-01

    Benzothiazole compounds with byrazoline group or benximidazole group are new fluorescent compounds. The fluorescent compounds have been used in many fields, but their development has beeo slow. According to Schellhammer theory on the relation between chemical structure and fluorescent quality, the authors designed now fluorescent compounds with benximidazole group or the byrazoline group in the 1-benzothiazole and with biphenyl in the 3,5-benzothiazole, and their possess fluorescent nature. Two new benximidazole and benzothiazole fluorescent compounds were synthesized. All these compounds were characterized by elemental analysis and infrared spectroscopy. The excitation wavelength of the two compounds is about 441-446 nm. The fluorescence spectra show that the compounds have good blue and green fluorescence. The characteristic peaks of t he absorption spectra of these compounds werefound by IR spectral analysis, which can be used to deduce the structures of chemical compounds. PMID:16013314

  2. Photochemistry and Photobiology, 2006, 82: 380388 Symposium-in-Print: Green Fluorescent Protein and Homologs

    E-print Network

    van Stokkum, Ivo

    of photoactive proteins, which can serve to harvest the energy of incident light, or to sense or transmit and solvation processes. Time-resolved fluorescence spectroscopy is a powerful tool to investigate the dynamical: a fast iner

  3. Fluorescence spectroscopy for rapid detection and classification of bacterial pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study deals with the rapid detection and classification of three bacteria, Escherichia coli, Salmonella, and Campylobacter, using fluorescence spectroscopy and multivariative analysis. Each bacterial sample was diluted in physiologic saline for analysis. Fluoroscence spectra were collected ...

  4. Effect of probe pressure on cervical fluorescence spectroscopy measurements

    E-print Network

    Nath, Audrey

    Fluorescence spectroscopy is a promising technology for detection of epithelial precancers and cancers. While age and menopausal status influence measurements in the cervix, other variables do not significantly affect the ...

  5. Quantitative Determination of DNA-Ligand Binding Using Fluorescence Spectroscopy

    ERIC Educational Resources Information Center

    Healy, Eamonn F.

    2007-01-01

    The effective use of fluorescence spectroscopy for determining the binding of the intercalcating agent crhidium bromide to DNA is being described. The analysis used simple measurement techniques and hence can be easily adopted by the students for a better understanding.

  6. Assaying protein import into mitochondria using fluorescence spectroscopy

    E-print Network

    Cargill, Holly Beth

    2006-08-16

    chemical crosslinking of Su9- DHFR Cys mutants. The use of fluorescence spectroscopy, in association with chemical crosslinking, to analyze the mitochondrial protein import pathways will prove a useful tool to probe the environment of the nascent chain...

  7. Time-domain laser-induced fluorescence spectroscopy apparatus for clinical diagnostics

    NASA Astrophysics Data System (ADS)

    Fang, Qiyin; Papaioannou, Thanassis; Jo, Javier A.; Vaitha, Russel; Shastry, Kumar; Marcu, Laura

    2004-01-01

    We report the design and development of a compact optical fiber-based apparatus for in situ time-resolved laser-induced fluorescence spectroscopy (tr-LIFS) of biological systems. The apparatus is modular, optically robust, and compatible with the clinical environment. It incorporates a dual output imaging spectrograph, a gated multichannel plate photomultiplier (MCP-PMT), an intensified charge-coupled-device (ICCD) camera, and a fast digitizer. It can accommodate various types of light sources and optical fiber probes for selective excitation and remote light delivery/collection as required by different applications. The apparatus allows direct recording of the entire fluorescence decay with high sensitivity (nM range fluorescein dye concentration with signal-to-noise ratio of 46) and with four decades dynamic range. It is capable of resolving a broad range of fluorescence lifetimes from hundreds of picoseconds (as low as 300 ps) using the MCP-PMT coupled to the digitizer to milliseconds using the ICCD. The data acquisition and analysis process is fully automated, enabling fast recording of fluorescence intensity decay across the entire emission spectrum (0.8 s per wavelength or ˜40 s for a 200 nm wavelength range at 5 nm increments). The spectral and temporal responses of the apparatus were calibrated and its performance was validated using fluorescence lifetime standard dyes (Rhodamin B, 9-cyanoanthracene, and rose Bengal) and tissue endogenous fluorophores (elastin, collagen, nicotinamide adenine dinucleotide, and flavin adenine dinucleotide). Fluorescence decay lifetimes and emission spectra of all tested compounds measured with the current tr-LIFS apparatus were found in good agreement with the values reported in the literature. The design and performance of tr-LIFS apparatus have enabled in vivo studies of atherosclerotic plaques and brain tumors.

  8. Recent Advances in Fluorescence Cross-correlation Spectroscopy

    Microsoft Academic Search

    Ling Chin Hwang; Thorsten Wohland

    2007-01-01

    Fluorescence cross-correlation spectroscopy (FCCS) is a method that measures the temporal fluorescence fluctuations coming\\u000a from two differently labeled molecules diffusing through a small sample volume. Cross-correlation analysis of the fluorescence\\u000a signals from separate detection channels extracts information of the dynamics of the dual-labeled molecules. FCCS has become\\u000a an essential tool for the characterization of diffusion coefficients, binding constants, kinetic rates

  9. Investigation of the role of protonation of benzophenone and its derivatives in acidic aqueous solutions using time-resolved resonance Raman spectroscopy: how are ketyl radicals formed in aqueous solutions?

    PubMed

    Li, Ming-De; Huang, Jinqing; Liu, Mingyue; Li, Songbo; Ma, Jiani; Phillips, David Lee

    2015-02-12

    The formation mechanism of ketyl radicals and several other selective photoreactions of benzophenone and its derivatives are initiated by the protonation of their triplet state and have been investigated using nanosecond time-resolved resonance Raman spectroscopy (ns-TR(3)) in solutions of varying conditions. Evidence is found that the ketyl radical is generated by the combined action of a ketone protonation and a subsequent electron transfer based on the results from previous studies on the photochemistry and photophysics of benzophenone and the ns-TR(3) results reported here for benzophenone, 1,4-dibenzoylbenzene, 3-(hydroxymethyl)benzophenone, and ketoprofen in neutral and acidic solution. In order to better understand the role of the protonated ketone, results are summarized for some selective photochemical reactions of benzophenone and its derivatives induced by protonation in acidic solutions. For the parent benzophenone, the protonation of the ketone leads to the photohydration reactions at the ortho- and meta-positions of the benzene ring in acidic aqueous solutions. For 3-(hydroxymethyl)benzophenone, the protonation promotes an interesting photoredox reaction to become very efficient and the predominant reaction in a pH = 2 aqueous solution. While for ketoprofen, the protonation can initiate a solvent-mediated excited-state intramolecular proton transfer (ESIPT) from the carboxyl group to the carbonyl group that then leads to a decarboxylation reaction in a pH = 0 acidic aqueous solution. We briefly discuss the key role of the protonation of the ketone in the photochemistry of these aromatic ketones. PMID:25141023

  10. Time-resolved spectroscopy in LiCaAlF(6) doped with Cr(3+): dynamical Jahn-Teller effect and thermal shifts associated with the (4)T(2) excited state.

    PubMed

    Sanz-Ortiz, M N; Rodríguez, F; Valiente, R

    2010-03-31

    This work investigates the centre distribution of the Cr(3+) impurity, the dynamical Jahn-Teller effect in the first (4)T(2) excited state and the thermal shifts of the absorption and emission peaks in LiCaAlF(6):Cr(3+) by means of time-resolved emission spectroscopy. The electronic and vibrational fine structure observed in both the absorption and emission spectra at low temperature are assigned according to the vibrational modes of the internal (CrF(6))(3-) complex and the lattice modes. Zero-phonon lines associated with (4)T(2) --> (4)A(2) and (2)E --> (4)A(2) transitions were detected and assigned on the basis of available high pressure data in LiCaAlF(6):Cr(3+). We have identified the vibrational coupled modes responsible for the vibrational structure of the low temperature emission spectrum and the reduction of the zero-phonon line (ZPL) splitting caused by the dynamical Jahn-Teller effect in the (4)T(2) excited state (Huang-Rhys factor, S(e) = 0.92). In addition, from the temperature variation of the emission intensity I(T), transition energy E(T) and bandwidth H(T), we obtained the vibrational modes that are coupled to the emitting state. We have evaluated the two main contributions to the photoluminescence thermal shift through thermal expansion and high pressure measurements: the implicit contribution induced by changes of thermal population and the explicit contribution induced by thermal expansion effects--40% and 60% of the total shift, respectively. PMID:21389489

  11. Time-resolved spectroscopy in LiCaAlF6 doped with Cr3+: dynamical Jahn-Teller effect and thermal shifts associated with the 4T2 excited state

    NASA Astrophysics Data System (ADS)

    Sanz-Ortiz, M. N.; Rodríguez, F.; Valiente, R.

    2010-03-01

    This work investigates the centre distribution of the Cr3 + impurity, the dynamical Jahn-Teller effect in the first 4T2 excited state and the thermal shifts of the absorption and emission peaks in LiCaAlF6:Cr3 + by means of time-resolved emission spectroscopy. The electronic and vibrational fine structure observed in both the absorption and emission spectra at low temperature are assigned according to the vibrational modes of the internal (CrF6)3 - complex and the lattice modes. Zero-phonon lines associated with ^4\\mathrm {T_2} \\to {}^4\\mathrm {A}_2 and ^2\\mathrm {E} \\to {}^4\\mathrm {A}_2 transitions were detected and assigned on the basis of available high pressure data in LiCaAlF6:Cr3 + . We have identified the vibrational coupled modes responsible for the vibrational structure of the low temperature emission spectrum and the reduction of the zero-phonon line (ZPL) splitting caused by the dynamical Jahn-Teller effect in the 4T2 excited state (Huang-Rhys factor, Se = 0.92). In addition, from the temperature variation of the emission intensity I(T), transition energy E(T) and bandwidth H(T), we obtained the vibrational modes that are coupled to the emitting state. We have evaluated the two main contributions to the photoluminescence thermal shift through thermal expansion and high pressure measurements: the implicit contribution induced by changes of thermal population and the explicit contribution induced by thermal expansion effects—40% and 60% of the total shift, respectively.

  12. Unfolding Features of Bovine Testicular Hyaluronidase Studied by Fluorescence Spectroscopy and Fourier Transformed Infrared Spectroscopy

    Microsoft Academic Search

    Nina Pan; Xiaoqiang Cai; Kai Tang; Guolin Zou

    2005-01-01

    Chemical unfolding of bovine testicular hyaluronidase (HAase) has been studied by fluorescence spectroscopy and Fourier transformed\\u000a infrared spectroscopy (FTIR). Thermodynamic parameters were determined for unfolding HAase from changes in the intrinsic fluorescence\\u000a emission intensity and the formations of several possible unfolding intermediates have been identified. This was further confirmed\\u000a by representation of fluorescence data in terms of ‘phase diagram’. The

  13. Fluorescence Correlation Spectroscopy: A Review of Biochemical and Microfluidic Applications

    PubMed Central

    Tian, Yu; Martinez, Michelle M.

    2011-01-01

    Over the years fluorescence correlation spectroscopy (FCS) has proven to be a useful technique that has been utilized in several fields of study. Although FCS initially suffered from poor signal to noise ratios, the incorporation of confocal microscopy has overcome this drawback and transformed FCS into a sensitive technique with high figures of merit. In addition, tandem methods have evolved to include dual-color cross-correlation, total internal reflection fluorescence correlation, and fluorescence lifetime correlation spectroscopy combined with time-correlated single photon counting. In this review, we discuss several applications of FSC for biochemical, microfluidic, and cellular investigations. PMID:21396180

  14. Development of a single-shot CCD-based data acquisition system for time-resolved X-ray photoelectron spectroscopy at an X-ray free-electron laser facility.

    PubMed

    Oura, Masaki; Wagai, Tatsuya; Chainani, Ashish; Miyawaki, Jun; Sato, Hiromi; Matsunami, Masaharu; Eguchi, Ritsuko; Kiss, Takayuki; Yamaguchi, Takashi; Nakatani, Yasuhiro; Togashi, Tadashi; Katayama, Tetsuo; Ogawa, Kanade; Yabashi, Makina; Tanaka, Yoshihito; Kohmura, Yoshiki; Tamasaku, Kenji; Shin, Shik; Ishikawa, Tetsuya

    2014-01-01

    In order to utilize high-brilliance photon sources, such as X-ray free-electron lasers (XFELs), for advanced time-resolved photoelectron spectroscopy (TR-PES), a single-shot CCD-based data acquisition system combined with a high-resolution hemispherical electron energy analyzer has been developed. The system's design enables it to be controlled by an external trigger signal for single-shot pump-probe-type TR-PES. The basic performance of the system is demonstrated with an offline test, followed by online core-level photoelectron and Auger electron spectroscopy in 'single-shot image', 'shot-to-shot image (image-to-image storage or block storage)' and `shot-to-shot sweep' modes at soft X-ray undulator beamline BL17SU of SPring-8. In the offline test the typical repetition rate for image-to-image storage mode has been confirmed to be about 15?Hz using a conventional pulse-generator. The function for correcting the shot-to-shot intensity fluctuations of the exciting photon beam, an important requirement for the TR-PES experiments at FEL sources, has been successfully tested at BL17SU by measuring Au 4f photoelectrons with intentionally controlled photon flux. The system has also been applied to hard X-ray PES (HAXPES) in `ordinary sweep' mode as well as shot-to-shot image mode at the 27?m-long undulator beamline BL19LXU of SPring-8 and also at the SACLA XFEL facility. The XFEL-induced Ti 1s core-level spectrum of La-doped SrTiO3 is reported as a function of incident power density. The Ti 1s core-level spectrum obtained at low power density is consistent with the spectrum obtained using the synchrotron source. At high power densities the Ti 1s core-level spectra show space-charge effects which are analysed using a known mean-field model for ultrafast electron packet propagation. The results successfully confirm the capability of the present data acquisition system for carrying out the core-level HAXPES studies of condensed matter induced by the XFEL. PMID:24365935

  15. In vivo time-resolved multidistance near infra-red spectroscopy of adult heads: time shift tolerance of measured reflectance to suppress the coupling between absorption and reduced scattering coefficients

    NASA Astrophysics Data System (ADS)

    Tanifuji, T.; Sakai, D.

    2015-03-01

    The absorption and reduced scattering coefficients ( ?a and ?'s) of adult heads were determined by multidistance timeresolved reflectance measurements. The finite difference time domain analysis was used to calculate the time-resolved reflectance from adult head models. In vivo time-resolved reflectances of human heads was measured at wavelengths of 680 and 780 nm. By minimizing the objective functions that compare the theoretical and experimental time-resolved reflectances, ?a and ?'s of the brains were determined. The results show that the time shift tolerance of measured reflectance for reducing to less than 10% the deviations in ?a and ?'s due to their coupling from the values obtained by optimum time shifts is more than 20 ps at both wavelengths.

  16. Fluorescent properties and spontaneous Raman spectroscopy of new ketocyanine probes in organic solvents

    NASA Astrophysics Data System (ADS)

    Nemkovich, N. A.; Sobchuk, A. N.; Khodasevich, I. A.

    2006-11-01

    We have used fluorescence spectroscopy and spontaneous Raman spectroscopy to study the characteristics of two ketocyanine dyes: 2,5-di[(E)-1-(4-diethylaminophenyl)methylidene]-1-cyclopentanone (CPET) and 2-[(E)-1-(4-diethylaminophenyl)methylidene]-5-{(E)-1-[4-(4,7,10,13-tetraoxa-1-azacyclopentadecalin) phenyl]methylidene}-1-cyclopentanone (CPMR) in organic solvents. The position of their electronic spectra depends strongly on the polarity of the solvent. We measured the dipole moments of the dyes in the equilibrium ground state and the Franck-Condon excited state. In mixtures of neutral nonpolar toluene with aprotic polar dimethylsulfoxide, we observe inhomogeneous broadening of the electronic spectra for the indicated compounds, due to fluctuations in solution of the intermolecular interaction energy. The time-resolved characteristics of fluorescence obtained suggest formation of an intermolecular hydrogen bond between the dye and the surrounding medium in a toluene-ethanol mixture. We measured the Raman spectra of CPET and CPMR in different organic solvents. The most intense lines in the 1582 1591 cm-1 region can be assigned to stretching of the phenyl rings of the molecules; the lines in the 831 842 cm-1 region can be assigned to a cyclopentanone ring mode; the lines at 1186 1195 cm-1 can be assigned to stretching of the =C-C-bond of the phenyl ring and rocking of the H atoms of the phenyl ring. We have observed that the position and width of the lines for the stretching vibrations of the ketocyanines depend substantially on the polarity of the surrounding medium. The studied dyes can be used as probes for studying different biological systems by site-selective laser spectroscopy and Raman spectroscopy. The fact that these two methods can be used simultaneously for diagnostics of biosystems is an important advantage of ketocyanine dyes compared with other known probes.

  17. Monitoring of singlet oxygen luminescence and mitochondrial autofluorescence after illumination of hypericin/mitochondria complex: a time-resolved study

    NASA Astrophysics Data System (ADS)

    Petrovajova, D.; Jancura, D.; Miskovsky, P.; Chorvat, D., Jr.; Chorvatova, A.; Ragas, X.; Garcia-Diaz, M.; Nonell, S.; Nadova, Z.

    2013-07-01

    A study of hypericin (Hyp) interaction with mitochondria isolated from U-87 MG glioma cells as well as the time-resolved measurement of singlet oxygen (1O2) formation and annihilation after illumination of the Hyp/mitochondria complex is presented in this work. Interaction between Hyp and mitochondria was studied by steady-state and time-resolved UV–vis absorption and fluorescence spectroscopy. A high concentration of Hyp leads to the aggregation of this compound inside the mitochondria and the relative population of the monomeric (biologically active) form of Hyp decreases concomitantly to approximately 10% at the highest used Hyp bulk concentration. Photosensitized production of 1O2 in mitochondria after illumination of the Hyp/mitochondria complex is characterized by a rise lifetime of ˜8 ?s and shows saturation behaviour with respect to Hyp concentration. The lifetime of 1O2 depends on the composition of the medium where the mitochondria are suspended, ranging from about 3.0 ?s in pure water to 26 ?s in H2O–D2O (1:9) phosphate buffer. Our results confirm that only the monomeric form of Hyp is able to produce its excited triplet state, which consequently leads to 1O2 production. An influence of photoactivated Hyp on the mitochondria respiration chain was evaluated by the monitoring of time-resolved NAD(P)H fluorescence. We have demonstrated the rise of the NAD(P)H content after illumination of the Hyp/mitochondria complex.

  18. Structural Changes and Thermal Stability of Charged LiNix Mny CozO2 Cathode Materials Studied by Combined In Situ Time-Resolved XRD and Mass Spectroscopy

    DOE PAGESBeta

    Bak, Seong-Min; Hu, Enyuan; Zhou, Yongning; Yu, Xiqian; Senanayake, Sanjaya D.; Cho, Sung-Jin; Kim, Kwang-Bum; Chung, Kyung Yoon; Yang, Xiao-Qing; Nam, Kyung-Wan

    2014-12-24

    Thermal stability of charged LiNixMnyCozO2 (NMC, with x + y + z = 1, x:y:z = 4:3:3 (NMC433), 5:3:2 (NMC532), 6:2:2 (NMC622), and 8:1:1 (NMC811)) cathode materials is systematically studied using combined in situ time- resolved X-ray diffraction and mass spectroscopy (TR-XRD/MS) techniques upon heating up to 600 °C. The TR-XRD/MS results indicate that the content of Ni, Co, and Mn significantly affects both the structural changes and the oxygen release features during heating: the more Ni and less Co and Mn, the lower the onset temperature of the phase transition (i.e., thermal decomposition) and the larger amount of oxygenmore »release. Interestingly, the NMC532 seems to be the optimized composition to maintain a reasonably good thermal stability, comparable to the low-nickel-content materials (e.g., NMC333 and NMC433), while having a high capacity close to the high-nickel-content materials (e.g., NMC811 and NMC622). The origin of the thermal decomposition of NMC cathode materials was elucidated by the changes in the oxidation states of each transition metal (TM) cations (i.e., Ni, Co, and Mn) and their site preferences during thermal decomposition. It is revealed that Mn ions mainly occupy the 3a octahedral sites of a layered structure (R3?-m) but Co ions prefer to migrate to the 8a tetrahedral sites of a spinel structure (Fd3-m) during the thermal decomposition. Such element-dependent cation migration plays a very important role in the thermal stability of NMC cathode materials. The reasonably good thermal stability and high capacity characteristics of the NMC532 composition is originated from the well-balanced ratio of nickel content to manganese and cobalt contents. This systematic study provides insight into the rational design of NMC-based cathode materials with a desired balance between thermal stability and high energy density.« less

  19. Structural Changes and Thermal Stability of Charged LiNix Mny CozO2 Cathode Materials Studied by Combined In Situ Time-Resolved XRD and Mass Spectroscopy

    DOE PAGESBeta

    Bak, Seong-Min [Brookhaven National Lab. (BNL), Upton, NY (United States); Hu, Enyuan [Brookhaven National Lab. (BNL), Upton, NY (United States); Zhou, Yongning [Brookhaven National Lab. (BNL), Upton, NY (United States); Yu, Xiqian [Brookhaven National Lab. (BNL), Upton, NY (United States); Senanayake, Sanjaya D. [Brookhaven National Lab. (BNL), Upton, NY (United States); Cho, Sung-Jin [Johnson Control Advanced Power Solution, Milwaukee, WI (United States); North Carolina A&T Univ., Greensboro, NC (United States). Joint School of Nano Science and Nano Engineering; Kim, Kwang-Bum [Yonsei Univ., Seoul, (Korea, Republic of). Dept of Material Science and Engineering; Chung, Kyung Yoon [Korea Inst. of Science and Technology (KIST), Seoul (Korea, Republic of); Yang, Xiao-Qing [Brookhaven National Lab. (BNL), Upton, NY (United States); Nam, Kyung-Wan [Dongguk Univ., Seoul (Korea, Republic of); Dept. of Energy and Materials Engineering

    2014-12-24

    Thermal stability of charged LiNixMnyCozO2 (NMC, with x + y + z = 1, x:y:z = 4:3:3 (NMC433), 5:3:2 (NMC532), 6:2:2 (NMC622), and 8:1:1 (NMC811)) cathode materials is systematically studied using combined in situ time- resolved X-ray diffraction and mass spectroscopy (TR-XRD/MS) techniques upon heating up to 600 °C. The TR-XRD/MS results indicate that the content of Ni, Co, and Mn significantly affects both the structural changes and the oxygen release features during heating: the more Ni and less Co and Mn, the lower the onset temperature of the phase transition (i.e., thermal decomposition) and the larger amount of oxygen release. Interestingly, the NMC532 seems to be the optimized composition to maintain a reasonably good thermal stability, comparable to the low-nickel-content materials (e.g., NMC333 and NMC433), while having a high capacity close to the high-nickel-content materials (e.g., NMC811 and NMC622). The origin of the thermal decomposition of NMC cathode materials was elucidated by the changes in the oxidation states of each transition metal (TM) cations (i.e., Ni, Co, and Mn) and their site preferences during thermal decomposition. It is revealed that Mn ions mainly occupy the 3a octahedral sites of a layered structure (R3?-m) but Co ions prefer to migrate to the 8a tetrahedral sites of a spinel structure (Fd3-m) during the thermal decomposition. Such element-dependent cation migration plays a very important role in the thermal stability of NMC cathode materials. The reasonably good thermal stability and high capacity characteristics of the NMC532 composition is originated from the well-balanced ratio of nickel content to manganese and cobalt contents. This systematic study provides insight into the rational design of NMC-based cathode materials with a desired balance between thermal stability and high energy density.

  20. Structural changes and thermal stability of charged LiNixMnyCozO? cathode materials studied by combined in situ time-resolved XRD and mass spectroscopy

    SciTech Connect

    Bak, Seong-Min [Brookhaven National Lab. (BNL), Upton, NY (United States); Hu, Enyuan [Brookhaven National Lab. (BNL), Upton, NY (United States); Zhou, Yongning [Brookhaven National Lab. (BNL), Upton, NY (United States); Yu, Xiqian [Brookhaven National Lab. (BNL), Upton, NY (United States); Senanayake, Sanjaya D. [Brookhaven National Lab. (BNL), Upton, NY (United States); Cho, Sung-Jin [Johnson Control Advanced Power Solution, Milwaukee, WI (United States); North Carolina A& T State Univ., Greensboro, NC (United States); Kim, Kwang-Bum [Yonsei Univ., Seoul (Republic of Korea); Chung, Kyung Yoon [Korea Inst. of Science and Technology, Seoul (Republic of Korea); Yang, Xiao-Qing [Brookhaven National Lab. (BNL), Upton, NY (United States); Nam, Kyung-Wan [Dongguk Univ., Seoul (Republic of Korea)

    2014-12-24

    Thermal stability of charged LiNixMnyCozO? (NMC with x+y+z=1, x:y:z = 4:3:3 (NMC433), 5:3:2 (NMC532), 6:2:2 (NMC622), and 8:1:1 (NMC811)) cathode materials is systematically studied using combined in situ time resolved X-ray diffraction and mass spectroscopy (TR- XRD/MS) techniques upon heating up to 600 °C. The TR-XRD/MS results indicate that the content of Ni, Co, and Mn significantly affects both the structural changes and the oxygen release features during heating: the more Ni and less Co and Mn, the lower the onset temperature of the phase transition (i.e., thermal decomposition) and the larger amount of oxygen release. Interestingly, the NMC532 seems to be the optimized composition to maintain a reasonably good thermal stability comparable to the low Ni-content materials (e.g., NMC333 and NMC433) while having a high capacity close to the high Ni-content materials (e.g., NMC811 and NMC622). The origin of the thermal decomposition of NMC cathode materials was elucidated by the changes in the oxidation states of each transition metal (TM) cations (i.e., Ni, Co and Mn) and their site preferences during thermal decomposition. It is revealed that Mn ions mainly occupy the 3a octahedral sites of layered structure (R3m ) but Co ions prefer to migrate to the 8a tetrahedral sites of spinel structure (Fd3m ) during the thermal decomposition. Such elemental dependent cation migration plays a very important role for the thermal stability of NMC cathode materials. The reasonably good thermal stability and high capacity characteristics of the NMC532 composition is originated from the well-balanced ratio of Ni- to Mn- and Co- contents. This systematic study provides insight into the rational design of NMC based cathode materials with a desired balance between thermal stability and high energy density

  1. Time-resolved optical studies of 3-5 semiconductors

    Microsoft Academic Search

    Andrew Gregory

    1991-01-01

    This study uses the technique of sub-picosecond time-resolved luminescence spectroscopy in order to investigate the relaxation of hot photo-excited charge carriers in III-V semiconductors. A review is provided of the physical background to the area, along with a discussion of the knowledge already obtained. The luminescence upconversion technique is used which enables measurements to be made with a time-resolution that

  2. Detection of colorectal cancer using time-resolved autofluorescence spectrometer

    NASA Astrophysics Data System (ADS)

    Fu, Sheng; Kwek, Leong-Chuan; Chia, Teck-Chee; Lim, Chu-Sing; Tang, Choong-Leong; Ang, Wuan-Suan; Zhou, Miao-Chang; Loke, Po-Ling

    2006-04-01

    As we know Quantum mechanics is a mathematical theory that can describe the behavior of objects that are at microscopic level. Time-resolved autofluorescence spectrometer monitors events that occur during the lifetime of the excited state. This time ranges from a few picoseconds to hundreds of nanoseconds. That is an extremely important advance as it allows environmental parameters to be monitored in a spatially defined manner in the specimen under study. This technique is based on the application of Quantum Mechanics. This principle is applied in our project as we are trying to use different fluorescence spectra to detect biological molecules commonly found in cancerous colorectal tissue and thereby differentiate the cancerous and non-cancerous colorectal polyps more accurately and specifically. In this paper, we use Fluorescence Lifetime Spectrometer (Edinburgh Instruments FL920) to measure decay time of autofluorescence of colorectal cancerous and normal tissue sample. All specimens are from Department of Colorectal Surgery, Singapore General Hospital. The tissues are placed in the time-resolved autofluorescence instrument, which records and calculates the decay time of the autofluorescence in the tissue sample at the excitation and emission wavelengths pre-determined from a conventional spectrometer. By studying the decay time,?, etc. for cancerous and normal tissue, we aim to present time-resolved autofluorescence as a feasible technique for earlier detection of malignant colorectal tissues. By using this concept, we try to contribute an algorithm even an application tool for real time early diagnosis of colorectal cancer for clinical services.

  3. Laser-induced fluorescence spectroscopy at endoscopy

    NASA Astrophysics Data System (ADS)

    Qu, Jianan Y.; MacAulay, Calum E.; Lam, Stephen; Palcic, Branko

    1994-07-01

    A spectrofluorometry system has been developed for the collection of laser induced fluorescense spectra of tissue during endoscopy. In this system, a catheter with seven optical fibers was used to deliver the excitation light and collect the emitted fluorescence. The system enables one to switch from regular endoscopy into fluorescence measurement in 50 ms using a computerized shutter system. The fluorescence spectra can be recorded in 100 ms. This spectrofluorometry system has been used to obtain spectra from bronchial, larynx and nasopharyngeal tissues when employed with the appropriate endoscopes. The results demonstrate that laser induced fluorescence can be used to differentiate abnormal tissue from normal tissue. The illumination and fluorescence collection patterns of this system have been modeled using a Monte Carlo simulation. The Monte Carlo simulation data shows that the spectra recorded by our collection pattern is very close to the intrinsic spectra of tissue. The experimental results and the Monte Carlo simulation suggest that changes in fluorescence intensity are more robust for the detection of early cancers than the differences in spectral characteristics.

  4. Laser-induced fluorescence spectroscopy in tissue local necrosis detection

    NASA Astrophysics Data System (ADS)

    Cip, Ondrej; Buchta, Zdenek; Lesundak, Adam; Randula, Antonin; Mikel, Bretislav; Lazar, Josef; Veverkova, Lenka

    2014-03-01

    The recent effort leads to reliable imaging techniques which can help to a surgeon during operations. The fluorescence spectroscopy was selected as very useful online in vivo imaging method to organics and biological materials analysis. The presented work scopes to a laser induced fluorescence spectroscopy technique to detect tissue local necrosis in small intestine surgery. In first experiments, we tested tissue auto-fluorescence technique but a signal-to-noise ratio didn't express significant results. Then we applied a contrast dye - IndoCyanine Green (ICG) which absorbs and emits wavelengths in the near IR. We arranged the pilot experimental setup based on highly coherent extended cavity diode laser (ECDL) used for stimulating of some critical areas of the small intestine tissue with injected ICG dye. We demonstrated the distribution of the ICG exciter with the first file of shots of small intestine tissue of a rabbit that was captured by high sensitivity fluorescent cam.

  5. [Rapid identification of hogwash oil by using synchronous fluorescence spectroscopy].

    PubMed

    Sun, Yan-Hui; An, Hai-Yang; Jia, Xiao-Li; Wang, Juan

    2012-10-01

    To identify hogwash oil quickly, the characteristic delta lambda of hogwash oil was analyzed by three dimensional fluorescence spectroscopy with parallel factor analysis, and the model was built up by using synchronous fluorescence spectroscopy with support vector machines (SVM). The results showed that the characteristic delta lambda of hogwash oil was 60 nm. Collecting original spectrum of different samples under the condition of characteristic delta lambda 60 nm, the best model was established while 5 principal components were selected from original spectrum and the radial basis function (RBF) was used as the kernel function, and the optimal penalty factor C and kernel function g were 512 and 0.5 respectively obtained by the grid searching and 6-fold cross validation. The discrimination rate of the model was 100% for both training sets and prediction sets. Thus, it is quick and accurate to apply synchronous fluorescence spectroscopy to identification of hogwash oil. PMID:23285875

  6. Low-temperature and time-resolved spectroscopic characterization of the LOV2 domain of Avena sativa phototropin

    SciTech Connect

    Gauden, Magdalena; Crosson, Sean; van Stokkum, I.H.; Grondelle, Rienkvan; Moffat, Keith; Kennis, John T. (UC)

    2004-12-13

    The phototropins are plant blue-light receptors that base their light-dependent action on the reversible formation of a covalent bond between a flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in light, oxygen or voltage (LOV) domains. The spectroscopic properties of the LOV2 domain of phototropin 1 of Avena sativa (oat) have been investigated by means of low-temperature absorption and fluorescence spectroscopy and by time-resolved fluorescence spectroscopy. The low-temperature absorption spectrum of the LOV2 domain showed a fine structure around 473 nm, indicating heterogeneity in the flavin binding pocket. The fluorescence quantum yield of the flavin cofactor increased from 0.13 to 0.41 upon cooling the sample from room temperature to 77 K. A pronounced phosphorescence emission around 600 nm was observed in the LOV2 domain between 77 and 120 K, allowing for an accurate positioning of the flavin triplet state in the LOV2 domain at 16900 cm{sup -1}. Fluorescence from the cryotrapped covalent adduct state was extremely weak, with a fluorescence spectrum showing a maximum at 440 nm. Time-resolved fluorescence experiments utilizing a synchroscan streak camera revealed a singlet-excited state lifetime of the LOV2 domain of 2.4 ns. FMN dissolved in aqueous solution showed a pH-dependent lifetime ranging between 2.9 ns at pH 2.0 to 4.7 ns at pH 8.0. No spectral shifting of the flavin emission was observed in the LOV2 domain nor in FMN in aqueous solution.

  7. Low-temperature and time-resolved spectroscopic characterization of the LOV2 domain of Avena sativa phototropin 1

    NASA Astrophysics Data System (ADS)

    Gauden, Magdalena; Crosson, Sean; van Stokkum, I. H. M.; van Grondelle, Rienk; Moffat, Keith; Kennis, John T. M.

    2004-09-01

    The phototropins are plant blue-light receptors that base their light-dependent action on the reversible formation of a covalent bond between a flavin mononucleotide (FMN) cofactor and a conserved cysteine residue in light, oxygen or voltage (LOV) domains. The spectroscopic properties of the LOV2 domain of phototropin 1 of Avena sativa (oat) have been investigated by means of low-temperature absorption and fluorescence spectroscopy and by time-resolved fluorescence spectroscopy. The low-temperature absorption spectrum of the LOV2 domain showed a fine structure around 473 nm, indicating heterogeneity in the flavin binding pocket. The fluorescence quantum yield of the flavin cofactor increased from 0.13 to 0.41 upon cooling the sample from room temperature to 77 K. A pronounced phosphorescence emission around 600 nm was observed in the LOV2 domain between 77 and 120 K, allowing for an accurate positioning of the flavin triplet state in the LOV2 domain at 16900 cm-1. Fluorescence from the cryotrapped covalent adduct state was extremely weak, with a fluorescence spectrum showing a maximum at 440 nm. Time-resolved fluorescence experiments utilizing a synchroscan streak camera revealed a singlet-excited state lifetime of the LOV2 domain of 2.4 ns. FMN dissolved in aqueous solution showed a pH-dependent lifetime ranging between 2.9 ns at pH 2.0 to 4.7 ns at pH 8.0. No spectral shifting of the flavin emission was observed in the LOV2 domain nor in FMN in aqueous solution.

  8. Fluorescence spectroscopy characteristics of nasopharyngeal carcinoma cells

    NASA Astrophysics Data System (ADS)

    Li, Buhong; Zhang, Zhenxi; Xie, Shusen; Lin, Huiyun

    2005-01-01

    The spectroscopic characteristics of autofluorescence for the nasopharyngeal carcinoma in vitro and nasopharyngeal carcinoma cells (CNE cells) were investigated, respectively. The characteristics of fluorescence agree with the results that deduced from the nasopharyngeal carcinoma in vivo, and the optimal excitation-emission wavelength was found at 350-500 nm. Secondly, the selectivity and optimal time for optical diagnosis of nasopharyngeal carcinoma by using the new photosensitizer of Hematoporphyrin Monomethyl Ether (HMME) has been demonstrated and determined by incubated CNE cells with HMME. The fluorescence emission peaks of 615 and 675 nm characterized the selective accumulation of HMME in CNE cells, and the optimal time for optical diagnostics with HMME was about 140 mins after clinic intravenous administration. Moreover, when the concentration of HMME in CNE cells below 32 ?g/mL, the fluorescence intensity versus HMME concentration reveals an obvious linearity. Finally, the fluorescence intensity of CNE cells increases linearly with concentration over the entire range up to 9.0E+05 cells/mL. These results can be used to helpfully improve the accuracy of optical diagnosis for nasopharyngeal carcinoma.

  9. Time-resolved transillumination and optical tomography

    NASA Astrophysics Data System (ADS)

    de Haller, Emmanuel B.

    1996-01-01

    In response to an invitation by the editor-in-chief, I would like to present the current status of time-domain imaging. With exciting new photon diffusion techniques being developed in the frequency domain and promising optical coherence tomography, time-resolved transillumination is in constant evolution and the subject of passionate discussions during the numerous conferences dedicated to this subject. The purpose of time-resolved optical tomography is to provide noninvasive, high-resolution imaging of the interior of living bodies by the use of nonionizing radiation. Moreover, the use of visible to near-infrared wavelength yields metabolic information. Breast cancer screening is the primary potential application for time-resolved imaging. Neurology and tissue characterization are also possible fields of applications. Time- resolved transillumination and optical tomography should not only improve diagnoses, but the welfare of the patient. As no overview of this technique has yet been presented to my knowledge, this paper briefly describes the various methods enabling time-resolved transillumination and optical tomography. The advantages and disadvantages of these methods, as well as the clinical challenges they face are discussed. Although an analytic and computable model of light transport through tissues is essential for a meaningful interpretation of the transillumination process, this paper will not dwell on the mathematics of photon propagation.

  10. Time-resolved optical spectrometer based on a monolithic array of high-precision TDCs and SPADs

    NASA Astrophysics Data System (ADS)

    Tamborini, Davide; Markovic, Bojan; Di Sieno, Laura; Contini, Davide; Bassi, Andrea; Tisa, Simone; Tosi, Alberto; Zappa, Franco

    2013-12-01

    We present a compact time-resolved spectrometer suitable for optical spectroscopy from 400 nm to 1 ?m wavelengths. The detector consists of a monolithic array of 16 high-precision Time-to-Digital Converters (TDC) and Single-Photon Avalanche Diodes (SPAD). The instrument has 10 ps resolution and reaches 70 ps (FWHM) timing precision over a 160 ns full-scale range with a Differential Non-Linearity (DNL) better than 1.5 % LSB. The core of the spectrometer is the application-specific integrated chip composed of 16 pixels with 250 ?m pitch, containing a 20 ?m diameter SPAD and an independent TDC each, fabricated in a 0.35 ?m CMOS technology. In front of this array a monochromator is used to focus different wavelengths into different pixels. The spectrometer has been used for fluorescence lifetime spectroscopy: 5 nm spectral resolution over an 80 nm bandwidth is achieved. Lifetime spectroscopy of Nile blue is demonstrated.

  11. Trp aporepressor engineered for fluorescence spectroscopy

    Microsoft Academic Search

    David P. Millar; Remo A. Hochstrasser; David R. Chapman; Philip Youderian

    1992-01-01

    The tryptophan repressor from Escherichia coli binds to the trp operator in the presence of L- tryptophan, thereby inhibiting the biosynthesis of L-tryptophan. Site-directed mutagenesis was used to change tryptophan-19 and tryptophan-99 to leucine and methionine, respectively. This mutant protein without tryptophan in its amino acid sequence has wild-type repressor activity and is a suitable model for fluorescence studies of

  12. Multimodal, multiplex, Raman spectroscopy of alcohol in diffuse, fluorescent media

    Microsoft Academic Search

    Scott T. McCain; Michael E. Gehm; Yanqia Wang

    2005-01-01

    Optical diagnostics in biological materials are hindered by fluorescence and scattering. We have developed a multimodal, multiplex, coded-aperture Raman spectrometer to detect alcohol in a lipid tissue phantom solution. Raman spectroscopy is a powerful diagnostic tool due to its high specificity and possibility for in vivo applications. At the same time, its very weak signal strength and incoherent scattering properties

  13. "FluSpec": A Simulated Experiment in Fluorescence Spectroscopy

    ERIC Educational Resources Information Center

    Bigger, Stephen W.; Bigger, Andrew S.; Ghiggino, Kenneth P.

    2014-01-01

    The "FluSpec" educational software package is a fully contained tutorial on the technique of fluorescence spectroscopy as well as a simulator on which experiments can be performed. The procedure for each of the experiments is also contained within the package along with example analyses of results that are obtained using the software.

  14. Fibre optic fluorescence spectroscopy for monitoring fish freshness

    NASA Astrophysics Data System (ADS)

    Wu, Chi-Wu; Hsiao, Tzu-Chien; Chu, Shou-Chia; Hu, Hung-Hsi; Chen, Jyh-Cheng

    2012-01-01

    In this study, a portable Y-type fibreoptic fluorescence spectroscopy measurement system was used to evaluate the freshness of eight cobias (Rachycentron canadum). The results showed that the ratio of fluorescent intensity, which F480 nm/Fexci+50 nm was belong with the range of collagen type I and type V characteristic spectra, was positive correlated to the frozen time by hours. It was a strong approach to be a potential index for differentiating the fish freshness during delivery process. Besides, the different pattern results of dorsum and abdomen were shown in this study. In further, fibreoptic fluorescence spectroscopy could be a way not only to measure and quantify the freshness of different fish body but also to verify the level of taste.

  15. Sucrose monoester micelles size determined by Fluorescence Correlation Spectroscopy (FCS).

    PubMed

    Sanchez, Susana A; Gratton, Enrico; Zanocco, Antonio L; Lemp, Else; Gunther, German

    2011-01-01

    One of the several uses of sucrose detergents, as well as other micelle forming detergents, is the solubilization of different membrane proteins. Accurate knowledge of the micelle properties, including size and shape, are needed to optimize the surfactant conditions for protein purification and membrane characterization. We synthesized sucrose esters having different numbers of methylene subunits on the substituent to correlate the number of methylene groups with the size of the corresponding micelles. We used Fluorescence Correlation Spectroscopy (FCS) and two photon excitation to determine the translational D of the micelles and calculate their corresponding hydrodynamic radius, R(h). As a fluorescent probe we used LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene), a dye highly fluorescent when integrated in the micelle and non-fluorescent in aqueous media. We found a linear correlation between the size of the tail and the hydrodynamic radius of the micelle for the series of detergents measured. PMID:22216230

  16. Fluorescence fluctuation spectroscopy and its artifacts: simulations and tests

    NASA Astrophysics Data System (ADS)

    Meng, Fanbo; Chen, Bo; Liu, Guang; Ding, Jianying; Ma, Hui

    2005-05-01

    Fluorescence fluctuation spectroscopy (FFS) technique is capable of monitoring changes in concentration, mass, size and structure of fluorescent-labeled bio-molecules in microscopic volume and is suitable for measuring biological interactions in living cells. FFS data may be affected by many experimental factors in complicated biological systems. Using a Monte Carlo approach, we generate fluorescence fluctuation data for different experimental systems. This approach helps to separate the contributions by different experimental factors in a complicated fluorescence fluctuation spectrum. It also helps to validate new theoretical models and new fitting formulations. We describe the algorithm of the simulation program and tests on its statistical performance. The program is then used successfully to study the effects of several experimental factors on FFS detection.

  17. Fluorescence spectroscopy of tissue: recovery of intrinsic fluorescence from measured fluorescence

    NASA Astrophysics Data System (ADS)

    Gardner, Craig M.; Jacques, Steven L.; Welch, Ashley J.

    1996-04-01

    We present a method for recovering the intrinsic fluorescence coefficient, defined as the product of the fluorophore absorption coefficient and the fluorescence energy yield, of an optically thick, homogeneous, turbid medium from a surface measurement of fluorescence and from knowledge of medium optical properties. The measured fluorescence signal is related to the intrinsic fluorescence coefficient by an optical property dependent path-length factor. A simple expression was developed for the path-length factor, which characterizes the penetration of excitation light and the escape of fluorescence from the medium. Experiments with fluorescent tissue phantoms demonstrated that intrinsic fluorescence line shape could be recovered and that fluorophore concentration could be estimated within +/-15%, over a wide range of optical properties. transport, photodynamic therapy, photosensitizer.

  18. Singlet internal conversion processes in the order of 1Bu+?3Ag-?1Bu-?2Ag-?1Ag- in all- trans-spheroidene and lycopene as revealed by subpicosecond time-resolved Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Rondonuwu, Ferdy S.; Kakitani, Yoshinori; Tamura, Hiroshi; Koyama, Yasushi

    2006-09-01

    Key Raman lines ascribable to the 1Bu+, 3Ag-, 1Bu- and 2Ag- states were identified in the subpicosecond time-resolved Raman spectra of spheroidene and lycopene having 10 and 11 conjugated double bonds, respectively. The sequential rise-and-decay of the key Raman lines showed the internal conversion processes of 1Bu+?3Ag-?1Bu-?2Ag-?1Ag- (ground). The time constant in each step of internal conversion reflects the energy gap between the relevant states that had been determined by measurement of resonance - Raman excitation profiles [K. Furuichi, T. Sashima, Y. Koyama, Chem. Phys. Lett. 356 (2002) 547].

  19. Laser induced fluorescence spectroscopy of ruthenium monoboride

    NASA Astrophysics Data System (ADS)

    Wang, Na; Ng, Y. W.; Cheung, A. S.-C.

    2012-09-01

    Laser induced fluorescence spectrum of ruthenium monoboride (RuB) in the visible region between 500 and 575 nm was studied. RuB molecule was produced by reacting laser ablated ruthenium atom with 0.5% diborane (B2H6) seeded in argon. Three transition bands of the [18.4]2.5-X2?5/2 transition were recorded and rotationally analyzed. The ground state symmetry and bond length, ro, were determined to be X2?5/2 state and 1.7099 Å, respectively, which is consistent with a 2?i state predicted from electronic configuration using a molecular orbital energy level diagram. This work represents the first experimental investigation of the spectrum of the RuB molecule.

  20. Ultrasensitive molecular fluorescence spectroscopy in levitated microdroplets

    SciTech Connect

    Ramsey, J.M.; Whitten, W.B. (Oak Ridge National Lab., TN (USA)); Arnold, S. (Polytechnic Univ., Brooklyn, NY (USA)); Bronk, B.V. (Chemical Research, Development and Engineering Center, Aberdeen Proving Ground, MD (USA))

    1990-01-01

    The extreme sensitivity of fluorescence spectrophotometry results from the fact that a molecule can undergo many excitation-emission cycles before destruction by photochemical degradation. For example, Rhodamine 6G (R6G) can emit in excess of 10{sup 5} photons before photolysis takes place. The fraction of emitted photons collected and converted to countable pulses can be as high as 10{sup {minus}3}, although 10{sup {minus}4} is more readily attainable. Therefore, sufficient signal exists for single molecules to be detectable. Detection limits for molecules in solution have been limited by background signal from solvent Raman scattering and fluorescence. This background signal adds noise to the measurement and has effectively restricted the detectable concentration to about 10{sup {minus}13} M. Over the past decade, advances in detection of fewer molecules have all been made by reducing the measurement volume and/or increasing the measuring time. Given the above concentration detection limit a reduction of the measurement volume to 1 pL leads to a minimum observable quantity of {approx}1 molecule. The ability to detect a single molecule in condensed phase could have many important applications in addition to being an interesting problem. The obvious application of this approach is to situations where small quantities of material are available for analysis. The capability to reliably detect a single fluorophore might also allow the screening and/or sorting of a collection of molecules. Such abilities would have application to many biological problems such as DNA sequencing and detection of DNA adducts.

  1. Fluorescence correlation spectroscopy: Diagnostics for sparse?molecules

    PubMed Central

    Maiti, Sudipta; Haupts, Ulrich; Webb, Watt W.

    1997-01-01

    The robust glow of molecular fluorescence renders even sparse molecules detectable and susceptible to analysis for concentration, mobility, chemistry, and photophysics. Correlation spectroscopy, a statistical-physics-based tool, gleans quantitative information from the spontaneously fluctuating fluorescence signals obtained from small molecular ensembles. This analytical power is available for studying molecules present at minuscule concentrations in liquid solutions (less than one nanomolar), or even on the surfaces of living cells at less than one macromolecule per square micrometer. Indeed, routines are becoming common to detect, locate, and examine individual molecules under favorable conditions. PMID:9342306

  2. Time-resolved photoconductivity of PbSe nanocrystal arrays.

    PubMed

    Murphy, James E; Beard, Matthew C; Nozik, Arthur J

    2006-12-21

    We report the sub-picosecond photoconductivity dynamics of chemically treated PbSe nanocrystal arrays utilizing time-resolved terahertz spectroscopy (TRTS). TRTS allows both the degree of interdot electronic coupling and the carrier dynamics to be extracted simultaneously. The following capping ligands bonded to the quantum dot surface were studied: hydrazine, ethylenediamine, butlyamine, and aniline. In addition, the arrays were treated with NaOH. We find that the treatments affect both the degree of electronic coupling and the carrier dynamics. PMID:17165993

  3. Rapid high-resolution spin- and time-resolved ARPES

    NASA Astrophysics Data System (ADS)

    Lin, Chiu-Yun; Gotlieb, Kenneth; Jozwiak, Chris; Hussain, Zahid; Bostwick, Aaron; Lanzara, Alessandra; Advanced Light Source, Lawrence Berkeley National Laboratory Collaboration; Graduate Group in Applied Science; Technology, University of California, Berkeley Collaboration

    2015-03-01

    A high-efficiency spin- and angle-resolved photoemission spectroscopy (spin-ARPES) spectrometer, coupled with a lab-based 6 eV laser, will be presented in this talk. Combining time-of-flight(TOF) energy measurements with low-energy exchange scattering spin polarimetry, spin-TOF ARPES achieves unprecedented measurements of near-EF physics rapidly. In addition, the successful integration of the spectrometer with the pulsed laser system demonstrates its potential for simultaneous spin- and time-resolved ARPES with pump-probe based measurements.

  4. Surface-plasmon field-enhanced fluorescence spectroscopy

    Microsoft Academic Search

    Thorsten Liebermann; Wolfgang Knoll

    2000-01-01

    We describe the combination of surface plasmon- and fluorescence spectroscopy for sensor applications. The resonant excitation of PSP modes at a metal\\/buffer-interface in a flow cell results in optical field intensities largely enhanced compared to the incoming laser light: a factor of 16, calculated for a Au\\/water interface by Fresnel formulas was experimentally confirmed. This field enhancement can be used

  5. Infrared spectroscopic discrimination between the loop and alpha-helices and determination of the loop diffusion kinetics by temperature-jump time-resolved infrared spectroscopy for cytochrome c.

    PubMed

    Ye, Manping; Zhang, Qing-Li; Li, Heng; Weng, Yu-Xiang; Wang, Wei-Chi; Qiu, Xiang-Gang

    2007-10-15

    The infrared (IR) absorption of the amide I band for the loop structure may overlap with that of the alpha-helices, which can lead to the misassignment of the protein secondary structures. A resolution-enhanced Fourier transform infrared (FTIR) spectroscopic method and temperature-jump (T-jump) time-resolved IR absorbance difference spectra were used to identify one specific loop absorption from the helical IR absorption bands of horse heart cytochrome c in D2O at a pD around 7.0. This small loop consists of residues 70-85 with Met-80 binding to the heme Fe(III). The FTIR spectra in amide I' region indicate that the loop and the helical absorption bands overlap at 1653 cm(-1) at room temperature. Thermal titration of the amide I' intensity at 1653 cm(-1) reveals that a transition in loop structural change occurs at lower temperature (Tm=45 degrees C), well before the global unfolding of the secondary structure (Tm approximately 82 degrees C). This loop structural change is assigned as being triggered by the Met-80 deligation from the heme Fe(III). T-jump time-resolved IR absorbance difference spectra reveal that a T-jump from 25 degrees C to 35 degrees C breaks the Fe-S bond between the Met-80 and the iron reversibly, which leads to a loop (1653 cm(-1), overlap with the helical absorption) to random coil (1645 cm(-1)) transition. The observed unfolding rate constant interpreted as the intrachain diffusion rate for this 16 residue loop was approximately 3.6x10(6) s(-1). PMID:17557782

  6. The spectroscopic basis of Fluorescence Triple Correlation Spectroscopy

    PubMed Central

    Ridgeway, William K.; Millar, David P.; Williamson, James R.

    2012-01-01

    We have developed Fluorescence Triple Correlation Spectroscopy (F3CS) as an extension of the widely-used fluorescence microscopy technique Fluorescence Correlation Spectroscopy. F3CS correlates three signals at once and provides additional capabilities for the study of systems with complex stoichiometry, kinetic processes and irreversible reactions. A general theory of F3CS was developed to describe the interplay of molecular dynamics and microscope optics, leading to an analytical function to predict experimental triple correlations of molecules that freely diffuse through the tight focus of the microscope. Experimental correlations were calculated from raw fluorescence data using triple correlation integrals that extend multiple-tau correlation theory to delay times in two dimensions. The quality of experimental data was improved by tuning specific spectroscopic parameters and employing multiple independent detectors to minimize optoelectronic artifacts. Experiments with the reversible system of freely-diffusing 16S rRNA revealed that triple correlation functions contain symmetries predicted from time-reversal arguments. Irreversible systems are shown to break these symmetries and correlation strategies were developed to detect time-reversal asymmetries in a comprehensive way with respect to two delay times, each spanning many orders of magnitude in time. The correlation strategies, experimental approaches and theory developed here enable studies of the composition and dynamics of complex systems using F3CS. PMID:22229664

  7. In Vivo Fluorescence Correlation and Cross-Correlation Spectroscopy

    NASA Astrophysics Data System (ADS)

    Mütze, Jörg; Ohrt, Thomas; Petrášek, Zden?k; Schwille, Petra

    In this manuscript, we describe the application of Fluorescence Correlation Spectroscopy (FCS), Fluorescence Cross-Correlation Spectroscopy (FCCS), and scanning FCS (sFCS) to two in vivo systems. In the first part, we describe the application of two-photon standard and scanning FCS in Caenorhabditis elegans embryos. The differentiation of a single fertilized egg into a complex organism in C. elegans is regulated by a number of protein-dependent processes. The oocyte divides asymmetrically into two daughter cells of different developmental fate. Two of the involved proteins, PAR-2 and NMY-2, are studied. The second investigated system is the mechanism of RNA interference in human cells. An EGFP based cell line that allows to study the dynamics and localization of the RNA-induced silencing complex (RISC) with FCS in vivo is created, which has so far been inaccessible with other experimental methods. Furthermore, Fluorescence Cross-Correlation Spectroscopy is employed to highlight the asymmetric incorporation of labeled siRNAs into RISC.

  8. Steady-state and time-resolved investigations on pyrene-based chemosensors.

    PubMed

    Fernández-Lodeiro, Javier; Núñez, Cristina; de Castro, Catherine S; Bértolo, Emilia; Seixas de Melo, J Sérgio; Capelo, José Luis; Lodeiro, Carlos

    2013-01-01

    Two novel fluorescent probes bearing a single (P) and two (a podand-like structure, L) pyrene units derived from 1,5-bis(2-aminophenoxy)-3-oxopentane have been synthesized and investigated in dioxane using UV-vis absorption, and steady-state and time-resolved (in a picosecond time scale) emission spectroscopy; in the gas phase, matrix-assisted laser desorption ionization mass spectrometry was employed. In dioxane, the absorption and emission spectra of P present a unique band with maxima at 361 and 392 nm, which have been associated with the monomer absorption and emission bands, respectively. In dioxane, for compound L, an additional band with a maximum at ?525 nm is observed; upon the addition of water, an emissive band (with maxima varying from 405 to 490 nm) appears in both P and L spectra; this is discussed in terms of the emission of a species with charge character. Upon metal addition (Cu(2+), Zn(2+), and Ag(+)) to P, a gradual quenching effect of the monomer emission is observed and found to be more pronounced with Cu(2+). In the case of L, upon the addition of metal cations, the long emission band (?550 nm) decreases and the monomer emission band increases (with an isoemissive point at ?450 nm) and no evidence for the intermediate band (at ?405-490 nm) now exists. Time-resolved data in dioxane/water mixtures showed that for P and L these two fit double- and triple-exponential decay laws, respectively. With P, this has been attributed to a two-state system, which involves the monomer and a charged species, with its emission maxima varying with the polarity of the media (here mirrored by its dielectric constant), which can potentially be addressed to an exciplex-like species, whereas with L, it has been attributed to a three-state system involving, in addition to these two species, an excimer. From absorption and fluorescence excitation and time-resolved data, evidence is given for the presence of intramolecular dimer formation in the ground state. PMID:23231666

  9. Ultrasensitive fluorescence correlation spectroscopy of highly parallelized microfluidic devices

    NASA Astrophysics Data System (ADS)

    Canfield, Brian K.; King, Jason K.; Robinson, William N.; Hofmeister, William H.; Soper, Steven A.; Davis, Lloyd M.

    2012-02-01

    Reducing reagent needs and costs while increasing throughput constitute important needs for assays in pharmaceutical drug discovery. We are developing an ultrasensitive, fluorescence-based detection system in highly parallel microfluidic channels with kHz readout rates in each channel. Prototype microfluidic devices with an array of >150 microchannels have been fabricated by direct femtosecond laser machining of fused silica substrates. A device is placed in a custombuilt, wide-field microscope where a line-generating red diode laser provides uniform epi-illumination just a few microns high across a 500 micron field of view. Single-molecule levels in the probe volumes can be attained by flowing suitably dilute aqueous solutions (~pM) of fluorescently labeled biomolecules through the microchannels. Fluorescence is detected with an electron-multiplying CCD camera allowing readout rates up to 7 kHz for each microchannel. Rapid initial assessment of detected fluorescence signals is performed through digital filtering derived from simulations based on experimental parameters. Fluorescence correlation spectroscopy can then provide more detailed analysis of the sample within each microchannel. Optimized microfluidic devices could be mass-produced in low-cost polymers using imprint lithography.

  10. Synchronous fluorescence spectroscopy for analysis of wine and wine distillates

    NASA Astrophysics Data System (ADS)

    Andreeva, Ya.; Borisova, E.; Genova, Ts.; Zhelyazkova, Al.; Avramov, L.

    2015-01-01

    Wine and brandies are multicomponent systems and conventional fluorescence techniques, relying on recording of single emission or excitation spectra, are often insufficient. In such cases synchronous fluorescence spectra can be used for revealing the potential of the fluorescence techniques. The technique is based on simultaneously scanning of the excitation and emission wavelength with constant difference (??) maintained between them. In this study the measurements were made using FluoroLog3 spectrofluorimeter (HORIBA Jobin Yvon, France) and collected for excitation and emission in the wavelength region 220 - 700 nm using wavelength interval ?? from 10 to 100 nm in 10 nm steps. This research includes the results obtained for brandy and red wine samples. Fluorescence analysis takes advantage in the presence of natural fluorophores in wines and brandies, such as gallic, vanillic, p-coumaric, syringic, ferulic acid, umbelliferone, scopoletin and etc. Applying of synchronous fluorescence spectroscopy for analysis of these types of alcohols allows us to estimate the quality of wines and also to detect adulteration of brandies like adding of a caramel to wine distillates for imitating the quality of the original product aged in oak casks.

  11. Fluorescence Fluctuation Spectroscopy of mCherry in Living Cells

    PubMed Central

    Wu, Bin; Chen, Yan; Müller, Joachim D.

    2009-01-01

    The red fluorescent protein mCherry is of considerable interest for fluorescence fluctuation spectroscopy (FFS), because the wide separation in color between mCherry and green fluorescent protein provides excellent conditions for identifying protein interactions inside cells. This two-photon study reveals that mCherry exists in more than a single brightness state. Unbiased analysis of the data needs to account for the presence of multiple states. We introduce a two-state model that successfully describes the brightness and fluctuation amplitude of mCherry. The properties of the two states are characterized by FFS and fluorescence lifetime experiments. No interconversion between the two states was observed over the experimentally probed timescales. The effect of fluorescence resonance energy transfer between enhanced green fluorescent protein (EGFP) and mCherry is incorporated into the two-state model to describe protein hetero-oligomerization. The model is verified by comparing the predicted and measured brightness and fluctuation amplitude of several fusion proteins that contain mCherry and EGFP. In addition, hetero-fluorescence resonance energy transfer between mCherry molecules in different states is detected, but its influence on FFS parameters is small enough to be negligible. Finally, the two-state model is applied to study protein oligomerization in living cells. We demonstrate that the model successfully describes the homodimerization of nuclear receptors. In addition, we resolved a mixture of interacting and noninteracting proteins labeled with EGFP and mCherry. These results provide the foundation for quantitative applications of mCherry in FFS studies. PMID:19289064

  12. Bilayer localization of membrane-active peptides studied in biomimetic vesicles by visible and fluorescence spectroscopies

    Microsoft Academic Search

    Tanya Sheynis; Jan Sykora; Ales Benda; Sofiya Kolusheva; Martin Hof; Raz Jelinek

    2003-01-01

    Depth of bilayer penetration and effects on lipid mobility conferred by the membrane-active peptides magainin, melit- tin, and a hydrophobic helical sequence KKA(LA)7KK (denoted KAL), were investigated by colorimetric and time-resolved fluorescence techniques in biomimetic phos- pholipid\\/poly(diacetylene)vesicles. The experiments dem- onstrated that the extent of bilayer permeation and peptide localization within the membrane was dependent upon the bilayer composition, and

  13. The study of blue LED to induce fluorescence spectroscopy and fluorescence imaging for oral carcinoma detection

    NASA Astrophysics Data System (ADS)

    Zheng, Longjiang; Hu, Yuanting

    2009-07-01

    Fluorescence spectroscopy and fluorescence imaging diagnosis of malignant lesions provides us with a new method to diagnose diseases in precancerous stage. Early diagnosis of disease has significant importance in cancer treatment, because most cancers can be cured well in precancerous, especially when the diffusion of cancer is limited in a restricted region. In this study, Golden hamster models were applied to 5% 9, 10 dimethyl-1, 2-benzanthracene (DMBA) to induce hamster buccal cheek pouch carcinoma three times a week. Rose Bengal, which has been used in clinican for years and avoids visible side-effect to human was chosen as photosensitizer. 405 nm blue LED was used to induce the fluorescence of photosensitizer. After topical application of photosensitizer, characteristic red emission fluorescence peak was observed around 600nm. Similar, normal oral cavity has special luminescence around 480nm. Fluorescence spectroscopy technology is based on analysing emission peaks of photosensitizer in the areas of oral carcinoma, moreover, red-to-green (IR/IG) intensity ratio is also applied as a diagnostic algorithm. A CCD which is connected with a computer is used to take pictures at carcinoma areas through different filters. Fluorescence images from normal hamster buccal cheek pouch are compared with those from carcinogen-induced models of carcinoma, and morphological differences between normal and lesion tissue can be distinguished. The pictures are analyzed by Matlab and shown on the screen of computer. This paper demonstrates that Rose Bengal could be used as photosensitizer to detect oral carcinoma, and blue LED as excitation source could not only have a good effect to diagnose oral carcinoma, but also decrease cost greatly.

  14. Solvent effects on the a sub g C double bond C stretching mode in the 2 sup 1 A sub g sup minus excited state of. beta. -carotene and two derivatives: Picosecond time-resolved resonance Raman spectroscopy

    SciTech Connect

    Noguchi, T.; Hayashi, H. (Univ. of Arizona, Tucson (United States) Univ. of Tokyo (Japan)); Tasumi, M. (Univ. of Tokyo (Japan)); Atkinson, G.H. (Univ. of Arizona, Tucson (United States) Hebrew Univ., Jerusalem (Israel))

    1991-04-18

    Picosecond time-resolved resonance Raman spectra in the C{double bond}C stretching region are presented for {beta}-carotene and two of its derivatives, {beta}-apo-8{prime}-carotenal and ethyl {beta}-apo-8{prime}-carotenoate. The solvent effects on the Franck-Condon-active a{sub g} C{double bond}C stretching mode in the {sup 1}A{sub g}{sup {minus}} ground state (S{sub 0}) and the 2{sup 1}A{sub g}{sup {minus}} excited state (S{sub 1}) of each carotenoid are described. The C{double bond}C stretching frequencies in S{sub 1} are affected by the solvent and show a correlation with the absorption maxima of the S{sub 2} ({sup 1}B{sub u}{sup +}) {l arrow} S{sub 0} transition, while those in S{sub 0} are not significantly affected. These results are interpreted in terms of the vibronic coupling among the S{sub 0}, S{sub 1}, and S{sub 2} electronic states, the solvent effect on the energy of the S{sub 1} and S{sub 2} states, and the structures of carotenoid molecules.

  15. Total Internal Reflection with Fluorescence Correlation Spectroscopy: Combined Surface Reaction and Solution Diffusion

    Microsoft Academic Search

    Tammy E. Starr; Nancy L. Thompson

    2001-01-01

    Total internal reflection with fluorescence correlation spectroscopy (TIR-FCS) is a method for measuring the surface association\\/dissociation rates and absolute densities of fluorescent molecules at the interface of solution and a planar substrate. This method can also report the apparent diffusion coefficient and absolute concentration of fluorescent molecules very close to the surface. An expression for the fluorescence fluctuation autocorrelation function

  16. Transient Fluorescence Spectroscopy and laser induced fluorescence lifetimes of terbium doped dipicolinic acid

    NASA Astrophysics Data System (ADS)

    Makoui, Anali

    We have investigated the use of deep UV laser induced fluorescence for the sensitive detection and spectroscopic lifetime studies of terbium doped dipicolinic acid (DPA-Tb) and used this to study the optical characteristics of DPA which is a chemical surrounding most bacterial spores. Background absorption spectra, fluorescence spectra, and Excitation Emission Matrix (EEM) spectra were made of the DPA-Tb complex, using both fixed 266 nm wavelength and tunable (220 nm--280 nm) UV laser excitations. Of importance, the fluorescence lifetimes of the four main fluorescence peaks (488 nm, 543 nm, 581 nm, and 618 nm) of the DPA-Tb complex have been measured for the first time to our knowledge. The lifetimes of all the fluorescing lines have been measured as a function of DPA-Tb concentration, solvent pH, and solvent composition, including that for the weakest fluorescing line of DPA-Tb at 618 nm. In addition, a new spectroscopic lifetime measurement technique, which we call "Transient Fluorescence Spectroscopy", was developed. In this technique, a weak, quasi-CW, amplitude modulated UV laser (8.5 kHz) was used to measure the lifetimes of the fluorescence lines, and yields insight into energy transfer and excitation lifetimes within the system. This technique is especially useful when a high power laser is not either available or not suitable. In the latter case, this would be when a high power pulsed deep-UV laser could produce bleaching or destruction of the biological specimen. In addition, this technique simulated the excitation and fluorescence emission of the DPA-Tb using a 4-level energy model, and solved the dynamic transient rate equations to predict the temporal behavior of the DPA-Tb emitted fluorescence. Excellent agreement between the experiments and the simulation were found. This technique has the potential to provide a more accurate value for the fluorescence lifetime values. In addition, with the use of asymmetric excitation waveforms, the dynamic transient rate equation analysis may allow for detailed studies of selected transfer mechanisms in a wide range of other spectroscopic applications including rare-earth solid-state lasing materials and biological samples.

  17. Time-resolved x-ray diagnostics

    SciTech Connect

    Lyons, P.B.

    1981-01-01

    Techniques for time-resolved x-ray diagnostics will be reviewed with emphasis on systems utilizing x-ray diodes or scintillators. System design concerns for high-bandwidth (> 1 GHz) diagnostics will be emphasized. The limitations of a coaxial cable system and a technique for equalizing to improve bandwidth of such a system will be reviewed. Characteristics of new multi-GHz amplifiers will be presented. An example of a complete operational system on the Los Alamos Helios laser will be presented which has a bandwidth near 3 GHz over 38 m of coax. The system includes the cable, an amplifier, an oscilloscope, and a digital camera readout.

  18. Single-molecule fluorescence spectroscopy in (bio)catalysis

    PubMed Central

    Roeffaers, Maarten B. J.; De Cremer, Gert; Uji-i, Hiroshi; Muls, Benîot; Sels, Bert F.; Jacobs, Pierre A.; De Schryver, Frans C.; De Vos, Dirk E.; Hofkens, Johan

    2007-01-01

    The ever-improving time and space resolution and molecular detection sensitivity of fluorescence microscopy offer unique opportunities to deepen our insights into the function of chemical and biological catalysts. Because single-molecule microscopy allows for counting the turnover events one by one, one can map the distribution of the catalytic activities of different sites in solid heterogeneous catalysts, or one can study time-dependent activity fluctuations of individual sites in enzymes or chemical catalysts. By experimentally monitoring individuals rather than populations, the origin of complex behavior, e.g., in kinetics or in deactivation processes, can be successfully elucidated. Recent progress of temporal and spatial resolution in single-molecule fluorescence microscopy is discussed in light of its impact on catalytic assays. Key concepts are illustrated regarding the use of fluorescent reporters in catalytic reactions. Future challenges comprising the integration of other techniques, such as diffraction, scanning probe, or vibrational methods in single-molecule fluorescence spectroscopy are suggested. PMID:17664433

  19. Investigation of asphaltene association by front-face fluorescence spectroscopy.

    PubMed

    Albuquerque, Flávio Cortiñas; Nicodem, David E; Rajagopal, Krishnaswamy

    2003-07-01

    The tendency of asphaltenes to aggregate and form clusters in solvents was studied by fluorescence spectroscopy. This was done by evaluating the relative fluorescence quantum yield of asphaltenes diluted at several concentrations in toluene and by studying the changes in the fluorescence spectra of asphaltene solutions as the composition of the solvent, toluene and cyclohexane, is changed. The asphaltene fraction (heptane insoluble) was collected from a Brazilian heavy crude oil, and solutions of this material varying from 0.016 g/L up to 10 g/L were prepared in toluene. Front-face emission spectra were obtained in two wavelength ranges, from 310 to 710 nm, excited at 300 nm (short range), and from 410 to 710 nm, excited at 400 nm (long range). Severe quenching was observed at concentrations above about 0.1 g/L. Stern-Volmer plots (reciprocal of quantum yield against concentration) exhibited nonlinear, downward-curved behavior, indicating that a more complex suppression mechanism, probably influenced by the association of the asphaltene molecules, is taking place. The same asphaltenes were dissolved (0.1 g/L) in binary mixtures of toluene and cyclohexane, and emission spectra in both the short range and long range were obtained. Fluorescence was progressively quenched at longer wavelengths of the spectra as the proportion of cyclohexane in the solvent grew. Cyclohexane, a poor asphaltene solvent, is probably inducing static quenching through association of asphaltenes. PMID:14658659

  20. Fluorescence spectroscopy for endogenous porphyrins in human facial skin

    NASA Astrophysics Data System (ADS)

    Seo, I.; Tseng, S. H.; Cula, G. O.; Bargo, P. R.; Kollias, N.

    2009-02-01

    The activity of certain bacteria in skin is known to correlate to the presence of porphyrins. In particular the presence of coproporphyrin produced by P.acnes inside plugged pores has been correlated to acne vulgaris. Another porphyrin encountered in skin is protoporphyrin IX, which is produced by the body in the pathway for production of heme. In the present work, a fluorescence spectroscopy system was developed to measure the characteristic spectrum and quantify the two types of porphyrins commonly present in human facial skin. The system is comprised of a Xe lamp both for fluorescence excitation and broadband light source for diffuse reflectance measurements. A computer-controlled filter wheel enables acquisition of sequential spectra, first excited by blue light at 405 nm then followed by the broadband light source, at the same location. The diffuse reflectance spectrum was used to correct the fluorescence spectrum due to the presence of skin chromophores, such as blood and melanin. The resulting fluorescence spectra were employed for the quantification of porphyrin concentration in a population of healthy subjects. The results show great variability on the concentration of these porphyrins and further studies are being conducted to correlate them with skin conditions such as inflammation and acne vulgaris.