Sample records for upstream start codons

  1. ABC50 mutants modify translation start codon selection.

    PubMed

    Stewart, Joanna D; Cowan, Joanne L; Perry, Lisa S; Coldwell, Mark J; Proud, Christopher G

    2015-04-15

    ATP-binding cassette 50 (ABC50; also known as ABCF1) binds to eukaryotic initiation factor 2 (eIF2) and is required for efficient translation initiation. An essential step of this process is accurate recognition and selection of the initiation codon. It is widely accepted that the presence and movement of eIF1, eIF1A and eIF5 are key factors in modulating the stringency of start-site selection, which normally requires an AUG codon in an appropriate sequence context. In the present study, we show that expression of ABC50 mutants, which cannot hydrolyse ATP, decreases general translation and relaxes the discrimination against the use of non-AUG codons at translation start sites. These mutants do not appear to alter the association of key initiation factors to 40S subunits. The stringency of start-site selection can be restored through overexpression of eIF1, consistent with the role of that factor in enhancing stringency. The present study indicates that interfering with the function of ABC50 influences the accuracy of initiation codon selection. PMID:25597744

  2. Translational Initiation at a Non-AUG Start Codon for Human and Mouse Negative Elongation Factor-B

    PubMed Central

    Pan, Haihui; Zhao, Xiayan; Zhang, Xiaowen; Abouelsoud, Mohamed; Sun, Jianlong; April, Craig; Amleh, Asma; Fan, Jian-Bing; Hu, Yanfen; Li, Rong

    2015-01-01

    Negative elongation factor (NELF), a four-subunit protein complex in metazoan, plays an important role in regulating promoter-proximal pausing of RNA polymerase II (RNAPII). Genetic studies demonstrate that the B subunit of mouse NELF (NELF-B) is critical for embryonic development and homeostasis in adult tissue. We report here that both human and mouse NELF-B proteins are translated from a non-AUG codon upstream of the annotated AUG. This non-AUG codon sequence is conserved in mammalian NELF-B but not NELF-B orthologs of lower metazoan. The full-length and a truncated NELF-B that starts at the first AUG codon both interact with the other three NELF subunits. Furthermore, these two forms of NELF-B have a similar impact on the transcriptomics and proliferation of mouse embryonic fibroblasts. These results strongly suggest that additional amino acid sequence upstream of the annotated AUG is dispensable for the essential NELF function in supporting cell growth in vitro. The majority of mouse adult tissues surveyed express the full-length NELF-B protein, and some contain a truncated NELF-B protein with the same apparent size as the AUG-initiated version. This result raises the distinct possibility that translational initiation of mouse NELF-B is regulated in a tissue-dependent manner. PMID:26010750

  3. The Effect of an Alternate Start Codon on Heterologous Expression of a PhoA Fusion Protein in Mycoplasma gallisepticum

    PubMed Central

    Panicker, Indu S.; Browning, Glenn F.; Markham, Philip F.

    2015-01-01

    While the genomes of many Mycoplasma species have been sequenced, there are no collated data on translational start codon usage, and the effects of alternate start codons on gene expression have not been studied. Analysis of the annotated genomes found that ATG was the most prevalent translational start codon among Mycoplasma spp. However in Mycoplasma gallisepticum a GTG start codon is commonly used in the vlhA multigene family, which encodes a highly abundant, phase variable lipoprotein adhesin. Therefore, the effect of this alternate start codon on expression of a reporter PhoA lipoprotein was examined in M. gallisepticum. Mutation of the start codon from ATG to GTG resulted in a 2.5 fold reduction in the level of transcription of the phoA reporter, but the level of PhoA activity in the transformants containing phoA with a GTG start codon was only 63% of that of the transformants with a phoA with an ATG start codon, suggesting that GTG was a more efficient translational initiation codon. The effect of swapping the translational start codon in phoA reporter gene expression was less in M. gallisepticum than has been seen previously in Escherichia coli or Bacillus subtilis, suggesting the process of translational initiation in mycoplasmas may have some significant differences from those used in other bacteria. This is the first study of translational start codon usage in mycoplasmas and the impact of the use of an alternate start codon on expression in these bacteria. PMID:26010086

  4. Amino Termini of Many Yeast Proteins Map to Downstream Start Codons

    PubMed Central

    Fournier, Claire T.; Cherny, Justin J.; Truncali, Kris; Robbins-Pianka, Adam; Lin, Miin S.; Krizanc, Danny; Weir, Michael P.

    2012-01-01

    Comprehensive knowledge of proteome complexity is crucial to understanding cell function. Amino termini of yeast proteins were identified through peptide mass spectrometry on glutaraldehyde-treated cell lysates as well as a parallel assessment of publicly-deposited spectra. An unexpectedly large fraction of detected amino-terminal peptides (35%) mapped to translation initiation at AUG codons downstream of the annotated start codon. Many of the implicated genes have suboptimal sequence contexts for translation initiation near their annotated AUG, and their ribosome profiles show elevated tag densities consistent with translation initiation at downstream AUGs as well as their annotated AUGs. These data suggest that a significant fraction of the yeast proteome derives from initiation at downstream AUGs, increasing significantly the repertoire of encoded proteins and their potential functions and cellular localizations. PMID:23140384

  5. Discrimination of 5?-terminal start codons by translation initiation factor 3 is mediated by ribosomal protein S1

    Microsoft Academic Search

    Isabella Moll; Armin Resch; Udo Bläsi

    1998-01-01

    The interrelation between ribosomal protein S1 and IF3 in recognition\\/discrimination of 5?-terminal start codons by 30S ribosomes has been studied using in vitro toeprinting. The study has been performed with two naturally occurring leaderless mRNAs, ? cI and phage r1t rro mRNA, as well as with an artificial leaderless mRNA derived from the E. coli ompA gene. We show that

  6. A start codon CMT1X mutation associated with transient encephalomyelitis causes complete loss of Cx32.

    PubMed

    Sargiannidou, Irene; Kim, Gun-Ha; Kyriakoudi, Styliana; Eun, Baik-Lin; Kleopa, Kleopas A

    2015-07-01

    X-linked Charcot-Marie-Tooth disease (CMTX1) results from numerous mutations in the GJB1 gene encoding the gap junction protein connexin32 (Cx32) and is one of the commonest forms of inherited neuropathy. Owing to the expression of Cx32 not only in Schwann cells but also in oligodendrocytes, a subset of CMT1X patients develops central nervous system (CNS) clinical manifestations in addition to peripheral neuropathy. While most GJB1 mutations appear to cause peripheral neuropathy through loss of Cx32 function, the cellular mechanisms underlying the CNS manifestations remain controversial. A novel start codon GJB1 mutation (p.Met1Ile) has been found in a CMT1X patient presenting with recurrent episodes of transient encephalomyelitis without apparent signs of peripheral neuropathy. In order to clarify the functional consequences of this mutation, we examined the cellular expression of two different constructs cloned from genomic DNA including the mutated start codon. None of the cloned constructs resulted in detectable expression of Cx32 by immunocytochemistry or immunoblot, although mRNA was produced at normal levels. Furthermore, co-expression with the other major oligodendrocyte connexin, Cx47, had no negative effect on GJ formation by Cx47. Finally, lysosomal and proteasomal inhibition in cells expressing the start codon mutant constructs failed to recover any detection of Cx32 as a result of impaired protein degradation. Our results indicate that the Cx32 start codon mutation is equivalent to a complete loss of the protein with failure of translation, although transcription is not impaired. Thus, complete loss of Cx32 function is sufficient to produce CNS dysfunction with clinical manifestations. PMID:25771809

  7. The Enterococcus faecalis EbpA Pilus Protein: Attenuation of Expression, Biofilm Formation, and Adherence to Fibrinogen Start with the Rare Initiation Codon ATT

    PubMed Central

    Montealegre, Maria Camila; La Rosa, Sabina Leanti; Roh, Jung Hyeob; Harvey, Barrett R.

    2015-01-01

    ABSTRACT The endocarditis and biofilm-associated pili (Ebp) are important in Enterococcus faecalis pathogenesis, and the pilus tip, EbpA, has been shown to play a major role in pilus biogenesis, biofilm formation, and experimental infections. Based on in silico analyses, we previously predicted that ATT is the EbpA translational start codon, not the ATG codon, 120 bp downstream of ATT, which is annotated as the translational start. ATT is rarely used to initiate protein synthesis, leading to our hypothesis that this codon participates in translational regulation of Ebp production. To investigate this possibility, site-directed mutagenesis was used to introduce consecutive stop codons in place of two lysines at positions 5 and 6 from the ATT, to replace the ATT codon in situ with ATG, and then to revert this ATG to ATT; translational fusions of ebpA to lacZ were also constructed to investigate the effect of these start codons on translation. Our results showed that the annotated ATG does not start translation of EbpA, implicating ATT as the start codon; moreover, the presence of ATT, compared to the engineered ATG, resulted in significantly decreased EbpA surface display, attenuated biofilm, and reduced adherence to fibrinogen. Corroborating these findings, the translational fusion with the native ATT as the initiation codon showed significantly decreased expression of ?-galactosidase compared to the construct with ATG in place of ATT. Thus, these results demonstrate that the rare initiation codon of EbpA negatively regulates EbpA surface display and negatively affects Ebp-associated functions, including biofilm and adherence to fibrinogen. PMID:26015496

  8. The Influenza A PB1-F2 and N40 Start Codons Are Contained within an RNA Pseudoknot.

    PubMed

    Priore, Salvatore F; Kauffmann, Andrew D; Baman, Jayson R; Turner, Douglas H

    2015-06-01

    Influenza A is a negative-sense RNA virus with an eight-segment genome. Some segments encode more than one polypeptide product, but how the virus accesses alternate internal open reading frames (ORFs) is not completely understood. In segment 2, ribosomal scanning produces two internal ORFs, PB1-F2 and N40. Here, chemical mapping reveals a Mg(2+)-dependent pseudoknot structure that includes the PB1-F2 and N40 start codons. The results suggest that interactions of the ribosome with the pseudoknot may affect the level of translation for PB1-F2 and N40. PMID:25996464

  9. The C-terminal domain of eukaryotic initiation factor 5 promotes start codon recognition by its dynamic interplay with eIF1 and eIF2?.

    PubMed

    Luna, Rafael E; Arthanari, Haribabu; Hiraishi, Hiroyuki; Nanda, Jagpreet; Martin-Marcos, Pilar; Markus, Michelle A; Akabayov, Barak; Milbradt, Alexander G; Luna, Lunet E; Seo, Hee-Chan; Hyberts, Sven G; Fahmy, Amr; Reibarkh, Mikhail; Miles, David; Hagner, Patrick R; O'Day, Elizabeth M; Yi, Tingfang; Marintchev, Assen; Hinnebusch, Alan G; Lorsch, Jon R; Asano, Katsura; Wagner, Gerhard

    2012-06-28

    Recognition of the proper start codon on mRNAs is essential for protein synthesis, which requires scanning and involves eukaryotic initiation factors (eIFs) eIF1, eIF1A, eIF2, and eIF5. The carboxyl terminal domain (CTD) of eIF5 stimulates 43S preinitiation complex (PIC) assembly; however, its precise role in scanning and start codon selection has remained unknown. Using nuclear magnetic resonance (NMR) spectroscopy, we identified the binding sites of eIF1 and eIF2? on eIF5-CTD and found that they partially overlapped. Mutating select eIF5 residues in the common interface specifically disrupts interaction with both factors. Genetic and biochemical evidence indicates that these eIF5-CTD mutations impair start codon recognition and impede eIF1 release from the PIC by abrogating eIF5-CTD binding to eIF2?. This study provides mechanistic insight into the role of eIF5-CTD's dynamic interplay with eIF1 and eIF2? in switching PICs from an open to a closed state at start codons. PMID:22813744

  10. Start codon targeted (SCoT) and target region amplification polymorphism (TRAP) for evaluating the genetic relationship of Dendrobium species.

    PubMed

    Feng, Shangguo; He, Refeng; Yang, Sai; Chen, Zhe; Jiang, Mengying; Lu, Jiangjie; Wang, Huizhong

    2015-08-10

    Two molecular marker systems, start codon targeted (SCoT) and target region amplification polymorphism (TRAP), were used for genetic relationship analysis of 36 Dendrobium species collected from China. Twenty-two selected SCoT primers produced 337 loci, of which 324 (96%) were polymorphic, whereas 13 TRAP primer combinations produced a total of 510 loci, with 500 (97.8%) of them being polymorphic. An average polymorphism information content of 0.953 and 0.983 was detected using the SCoT and TRAP primers, respectively, showing that a high degree of genetic diversity exists among Chinese Dendrobium species. The partition of clusters in the unweighted pair group method with arithmetic mean dendrogram and principal coordinate analysis plot based on the SCoT and TRAP markers was similar and clustered the 36 Dendrobium species into four main groups. Our results will provide useful information for resource protection and will also be useful to improve the current Dendrobium breeding programs. Our results also demonstrate that SCoT and TRAP markers are informative and can be used to evaluate genetic relationships between Dendrobium species. PMID:25936992

  11. The antibiotic Furvina® targets the P-site of 30S ribosomal subunits and inhibits translation initiation displaying start codon bias.

    PubMed

    Fabbretti, Attilio; Brandi, Letizia; Petrelli, Dezemona; Pon, Cynthia L; Castañedo, Nilo R; Medina, Ricardo; Gualerzi, Claudio O

    2012-11-01

    Furvina®, also denominated G1 (MW 297), is a synthetic nitrovinylfuran [2-bromo-5-(2-bromo-2-nitrovinyl)-furan] antibiotic with a broad antimicrobial spectrum. An ointment (Dermofural®) containing G1 as the only active principle is currently marketed in Cuba and successfully used to treat dermatological infections. Here we describe the molecular target and mechanism of action of G1 in bacteria and demonstrate that in vivo G1 preferentially inhibits protein synthesis over RNA, DNA and cell wall synthesis. Furthermore, we demonstrate that G1 targets the small ribosomal subunit, binds at or near the P-decoding site and inhibits its function interfering with the ribosomal binding of fMet-tRNA during 30S initiation complex (IC) formation ultimately inhibiting translation. Notably, this G1 inhibition displays a bias for the nature (purine vs. pyrimidine) of the 3'-base of the codon, occurring efficiently only when the mRNA directing 30S IC formation and translation contains the canonical AUG initiation triplet or the rarely found AUA triplet, but hardly occurs when the mRNA start codon is either one of the non-canonical triplets AUU or AUC. This codon discrimination by G1 is reminiscent, though of opposite type of that displayed by IF3 in its fidelity function, and remarkably does not occur in the absence of this factor. PMID:22941660

  12. Consequences of germline variation disrupting the constitutional translational initiation codon start sites of MLH1 and BRCA2: Use of potential alternative start sites and implications for predicting variant pathogenicity.

    PubMed

    Parsons, Michael T; Whiley, Phillip J; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A; Marquart, Louise; Hopper, John L; Jenkins, Mark A; Brown, Melissa A; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D; Spurdle, Amanda B

    2015-07-01

    Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However, few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. © 2013 Wiley Periodicals, Inc. PMID:24302565

  13. Start codon targeted (SCoT) polymorphism reveals genetic diversity in wild and domesticated populations of ramie (Boehmeria nivea L. Gaudich.), a premium textile fiber producing species.

    PubMed

    Satya, Pratik; Karan, Maya; Jana, Sourav; Mitra, Sabyasachi; Sharma, Amit; Karmakar, P G; Ray, D P

    2015-02-01

    Twenty-four start codon targeted (SCoT) markers were used to assess genetic diversity and population structure of indigenous, introduced and domesticated ramie (Boehmeria nivea L. Gaudich.). A total of 155 genotypes from five populations were investigated for SCoT polymorphism, which produced 136 amplicons with 87.5% polymorphism. Polymorphism information content and resolving power of the SCoT markers were 0.69 and 3.22, respectively. The Indian ramie populations exhibited high SCoT polymorphism (> 50%), high genetic differentiation (GST = 0.27) and moderate gene flow (Nm = 1.34). Analysis of molecular variance identified significant differences for genetic polymorphism among the populations explaining 13.1% of the total variation. The domesticated population exhibited higher genetic polymorphism and heterozygosity compared to natural populations. Cluster analysis supported population genetic analysis and suggested close association between introduced and domesticated genotypes. The present study shows effectiveness of employing SCoT markers in a cross pollinated heterozygous species like Boehmeria, and would be useful for further studies in population genetics, conservation genetics and cultivar improvement. PMID:25750860

  14. Start codon targeted (SCoT) polymorphism reveals genetic diversity in wild and domesticated populations of ramie (Boehmeria nivea L. Gaudich.), a premium textile fiber producing species

    PubMed Central

    Satya, Pratik; Karan, Maya; Jana, Sourav; Mitra, Sabyasachi; Sharma, Amit; Karmakar, P.G.; Ray, D.P.

    2015-01-01

    Twenty-four start codon targeted (SCoT) markers were used to assess genetic diversity and population structure of indigenous, introduced and domesticated ramie (Boehmeria nivea L. Gaudich.). A total of 155 genotypes from five populations were investigated for SCoT polymorphism, which produced 136 amplicons with 87.5% polymorphism. Polymorphism information content and resolving power of the SCoT markers were 0.69 and 3.22, respectively. The Indian ramie populations exhibited high SCoT polymorphism (> 50%), high genetic differentiation (GST = 0.27) and moderate gene flow (Nm = 1.34). Analysis of molecular variance identified significant differences for genetic polymorphism among the populations explaining 13.1% of the total variation. The domesticated population exhibited higher genetic polymorphism and heterozygosity compared to natural populations. Cluster analysis supported population genetic analysis and suggested close association between introduced and domesticated genotypes. The present study shows effectiveness of employing SCoT markers in a cross pollinated heterozygous species like Boehmeria, and would be useful for further studies in population genetics, conservation genetics and cultivar improvement. PMID:25750860

  15. Multiple enhancer regions located at significant distances upstream of the transcriptional start site mediate RANKL gene expression in response to 1,25-dihydroxyvitamin D 3

    Microsoft Academic Search

    Sungtae Kim; Miwa Yamazaki; Lee A. Zella; Mark B. Meyer; Jackie A. Fretz; Nirupama K. Shevde; J. Wesley Pike

    2007-01-01

    One of the primary regulators of receptor activator of NF-?B ligand (RANKL) is 1,25-dihydoxyvitamin D3 (1,25(OH)2D3). To elucidate the mechanism whereby 1,25(OH)2D3 activates RANKL expression we screened some 300kb of the RANKL gene locus using a ChIP on chip analysis and identified five potential regulatory regions lying significant distances upstream of the transcription start site (TSS), the farthest over 70kb

  16. Comprehensive Analysis of Transcript Start Sites in Ly49 Genes Reveals an Unexpected Relationship with Gene Function and a Lack Of Upstream Promoters

    Microsoft Academic Search

    Frances Gays; Alan S. C. Koh; Katarzyna M. Mickiewicz; Jonathan G. Aust; Colin G. Brooks; Jason Barbour

    2011-01-01

    Comprehensive analysis of the transcription start sites of the Ly49 genes of C57BL\\/6 mice using the oligo-capping 5?-RACE technique revealed that the genes encoding the “missing self” inhibitory receptors, Ly49A, C, G, and I, were transcribed from multiple broad regions in exon 1, in the intron1\\/exon2 region, and upstream of exon -1b. Ly49E was also transcribed in this manner, and

  17. Small, synthetic, GC-rich mRNA stem-loop modules 5? proximal to the AUG start-codon predictably tune gene expression in yeast

    PubMed Central

    2013-01-01

    Background A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5? UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Results Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5? UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (?G = ?15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (?G = ?4.4 kcal/mol) inhibited Cdr1p expression by ~50%. Conclusion We have developed a simple cloning strategy to fine-tune protein expression levels in yeast that has many potential applications in metabolic engineering and the optimization of protein expression in yeast. This study also highlights the importance of considering the use of multiple cloning-sites carefully to preclude unwanted effects on gene expression. PMID:23895661

  18. MULTIPLE ENHANCER REGIONS LOCATED AT SIGNIFICANT DISTANCES UPSTREAM OF THE TRANSCRIPTIONAL START SITE MEDIATE RANKL GENE EXPRESSION IN RESPONSE TO 1,25-DIHYDROXYVITAMIN D3

    PubMed Central

    Kim, Sungtae; Yamazaki, Miwa; Zella, Lee A.; Meyer, Mark B.; Fretz, Jackie A.; Shevde, Nirupama K.; Pike, J. Wesley

    2007-01-01

    One of the primary regulators of Receptor activator of NF-?B ligand (RANKL) is 1,25-dihydoxyvitamin D3 (1,25(OH)2D3). To elucidate the mechanism whereby 1,25(OH)2D3 activates RANKL expression we screened some 300 kb of the RANKL gene locus using a ChIP on chip analysis and identified five potential regulatory regions lying significant distances upstream of the transcription start site (TSS), the farthest over 70 kb from the TSS. A direct ChIP analysis confirmed the presence of the VDR/RXR heterodimer at these sites. The binding of the VDR was associated with histone modification and enhanced entry of RNA polymerase II, indicating an important functional consequence to the localization of these transcription factors in response to 1,25(OH)2D3. The region -76kb upstream from the TSS, termed D5, was capable of mediating VDR-dependent transcriptional output in response to 1,25(OH)2D3 in luciferase assays. The identified VDRE in this region was able to confer dramatic 1,25(OH)2D3 sensitivity to heterologous promoters. This region was highly evolutionarily conserved and functionally active in the human RANKL gene as well. We propose that the RANKL gene is regulated via multiple enhancers that while located at significant distances from the TSS, likely form a chromatin hub centered on the RankL promoter. PMID:17197168

  19. Multiple enhancer regions located at significant distances upstream of the transcriptional start site mediate RANKL gene expression in response to 1,25-dihydroxyvitamin D3.

    PubMed

    Kim, Sungtae; Yamazaki, Miwa; Zella, Lee A; Meyer, Mark B; Fretz, Jackie A; Shevde, Nirupama K; Pike, J Wesley

    2007-03-01

    One of the primary regulators of receptor activator of NF-kappaB ligand (RANKL) is 1,25-dihydoxyvitamin D(3) (1,25(OH)(2)D(3)). To elucidate the mechanism whereby 1,25(OH)(2)D(3) activates RANKL expression we screened some 300kb of the RANKL gene locus using a ChIP on chip analysis and identified five potential regulatory regions lying significant distances upstream of the transcription start site (TSS), the farthest over 70kb from the TSS. A direct ChIP analysis confirmed the presence of the VDR/RXR heterodimer at these sites. The binding of the VDR was associated with histone modification and enhanced entry of RNA polymerase II, indicating an important functional consequence to the localization of these transcription factors in response to 1,25(OH)(2)D(3). The region -76kb upstream from the TSS, termed D5, was capable of mediating VDR-dependent transcriptional output in response to 1,25(OH)(2)D(3) in luciferase assays. The identified VDRE in this region was able to confer dramatic 1,25(OH)(2)D(3) sensitivity to heterologous promoters. This region was highly evolutionarily conserved and functionally active in the human RANKL gene as well. We propose that the RANKL gene is regulated via multiple enhancers that while located at significant distances from the TSS, likely form a chromatin hub centered on the RankL promoter. PMID:17197168

  20. Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers.

    PubMed

    Heikrujam, Monika; Kumar, Jatin; Agrawal, Veena

    2015-09-01

    To detect genetic variations among different Simmondsia chinensis genotypes, two gene targeted markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) were employed in terms of their informativeness and efficiency in analyzing genetic relationships among different genotypes. A total of 15 SCoT and 17 CBDP primers detected genetic polymorphism among 39 Jojoba genotypes (22 females and 17 males). Comparatively, CBDP markers proved to be more effective than SCoT markers in terms of percentage polymorphism as the former detecting an average of 53.4% and the latter as 49.4%. The Polymorphic information content (PIC) value and marker index (MI) of CBPD were 0.43 and 1.10, respectively which were higher than those of SCoT where the respective values of PIC and MI were 0.38 and 1.09. While comparing male and female genotype populations, the former showed higher variation in respect of polymorphic percentage and PIC, MI and Rp values over female populations. Nei's diversity (h) and Shannon index (I) were calculated for each genotype and found that the genotype "MS F" (in both markers) was highly diverse and genotypes "Q104 F" (SCoT) and "82-18 F" (CBDP) were least diverse among the female genotype populations. Among male genotypes, "32 M" (CBDP) and "MS M" (SCoT) revealed highest h and I values while "58-5 M" (both markers) was the least diverse. Jaccard's similarity co-efficient of SCoT markers ranged from 0.733 to 0.922 in female genotypes and 0.941 to 0.746 in male genotype population. Likewise, CBDP data analysis also revealed similarity ranging from 0.751 to 0.958 within female genotypes and 0.754 to 0.976 within male genotype populations thereby, indicating genetically diverse Jojoba population. Employing the NTSYS (Numerical taxonomy and multivariate analysis system) Version 2.1 software, both the markers generated dendrograms which revealed that all the Jojoba genotypes were clustered into two major groups, one group consisting of all female genotypes and another group comprising of all male genotypes. During the present investigation, CBDP markers proved more informative in studying genetic diversity among Jojoba. Such genetically diverse genotypes would thus be of great significance for breeding, management and conservation of elite (high yielding) Jojoba germplasm. PMID:26110116

  1. Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers

    PubMed Central

    Heikrujam, Monika; Kumar, Jatin; Agrawal, Veena

    2015-01-01

    To detect genetic variations among different Simmondsia chinensis genotypes, two gene targeted markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) were employed in terms of their informativeness and efficiency in analyzing genetic relationships among different genotypes. A total of 15 SCoT and 17 CBDP primers detected genetic polymorphism among 39 Jojoba genotypes (22 females and 17 males). Comparatively, CBDP markers proved to be more effective than SCoT markers in terms of percentage polymorphism as the former detecting an average of 53.4% and the latter as 49.4%. The Polymorphic information content (PIC) value and marker index (MI) of CBPD were 0.43 and 1.10, respectively which were higher than those of SCoT where the respective values of PIC and MI were 0.38 and 1.09. While comparing male and female genotype populations, the former showed higher variation in respect of polymorphic percentage and PIC, MI and Rp values over female populations. Nei's diversity (h) and Shannon index (I) were calculated for each genotype and found that the genotype “MS F” (in both markers) was highly diverse and genotypes “Q104 F” (SCoT) and “82–18 F” (CBDP) were least diverse among the female genotype populations. Among male genotypes, “32 M” (CBDP) and “MS M” (SCoT) revealed highest h and I values while “58-5 M” (both markers) was the least diverse. Jaccard's similarity co-efficient of SCoT markers ranged from 0.733 to 0.922 in female genotypes and 0.941 to 0.746 in male genotype population. Likewise, CBDP data analysis also revealed similarity ranging from 0.751 to 0.958 within female genotypes and 0.754 to 0.976 within male genotype populations thereby, indicating genetically diverse Jojoba population. Employing the NTSYS (Numerical taxonomy and multivariate analysis system) Version 2.1 software, both the markers generated dendrograms which revealed that all the Jojoba genotypes were clustered into two major groups, one group consisting of all female genotypes and another group comprising of all male genotypes. During the present investigation, CBDP markers proved more informative in studying genetic diversity among Jojoba. Such genetically diverse genotypes would thus be of great significance for breeding, management and conservation of elite (high yielding) Jojoba germplasm. PMID:26110116

  2. Codon usage patterns in Chinese bayberry (Myrica rubra) based on RNA-Seq data

    PubMed Central

    2013-01-01

    Background Codon usage analysis has been a classical topic for decades and has significances for studies of evolution, mRNA translation, and new gene discovery, etc. While the codon usage varies among different members of the plant kingdom, indicating the necessity for species-specific study, this work has mostly been limited to model organisms. Recently, the development of deep sequencing, especial RNA-Seq, has made it possible to carry out studies in non-model species. Result RNA-Seq data of Chinese bayberry was analyzed to investigate the bias of codon usage and codon pairs. High frequency codons (AGG, GCU, AAG and GAU), as well as low frequency ones (NCG and NUA codons) were identified, and 397 high frequency codon pairs were observed. Meanwhile, 26 preferred and 141 avoided neighboring codon pairs were also identified, which showed more significant bias than the same pairs with one or more intervening codons. Codon patterns were also analyzed at the plant kingdom, organism and gene levels. Changes during plant evolution were evident using RSCU (relative synonymous codon usage), which was even more significant than GC3s (GC content of 3rd synonymous codons). Nine GO categories were differentially and independently influenced by CAI (codon adaptation index) or GC3s, especially in 'Molecular function’ category. Within a gene, the average CAI increased from 0.720 to 0.785 in the first 50 codons, and then more slowly thereafter. Furthermore, the preferred as well as avoided codons at the position just following the start codon AUG were identified and discussed in relation to the key positions in Kozak sequences. Conclusion A comprehensive codon usage Table and number of high-frequency codon pairs were established. Bias in codon usage as well as in neighboring codon pairs was observed, and the significance of this in avoiding DNA mutation, increasing protein production and regulating protein synthesis rate was proposed. Codon usage patterns at three levels were revealed and the significance in plant evolution analysis, gene function classification, and protein translation start site predication were discussed. This work promotes the study of codon biology, and provides some reference for analysis and comprehensive application of RNA-Seq data from other non-model species. PMID:24160180

  3. A Comprehensive Analysis of Codon Usage Patterns in Blunt Snout Bream (Megalobrama amblycephala) Based on RNA-Seq Data

    PubMed Central

    Duan, Xiaoke; Yi, Shaokui; Guo, Xianwu; Wang, Weimin

    2015-01-01

    Blunt snout bream (Megalobrama amblycephala) is an important fish species for its delicacy and high economic value in China. Codon usage analysis could be helpful to understand its codon biology, mRNA translation and vertebrate evolution. Based on RNA-Seq data for M. amblycephala, high-frequency codons (CUG, AGA, GUG, CAG and GAG), as well as low-frequency ones (NUA and NCG codons) were identified. A total of 724 high-frequency codon pairs were observed. Meanwhile, 14 preferred and 199 avoided neighboring codon pairs were also identified, but bias was almost not shown with one or more intervening codons inserted between the same pairs. Codon usage bias in the regions close to start and stop codons indicated apparent heterogeneity, which even occurs in the flanking nucleotide sequence. Codon usage bias (RSCU and SCUO) was related to GC3 (GC content of 3rd nucleotide in codon) bias. Six GO (Gene ontology) categories and the number of methylation targets were influenced by GC3. Codon usage patterns comparison among 23 vertebrates showed species specificities by using GC contents, codon usage and codon context analysis. This work provided new insights into fish biology and new information for breeding projects. PMID:26016504

  4. Primary acute lymphoblastic leukemia cells use a novel promoter and 5'noncoding exon for the human reduced folate carrier that encodes a modified carrier translated from an upstream translational start.

    PubMed

    Flatley, Robin M; Payton, Scott G; Taub, Jeffrey W; Matherly, Larry H

    2004-08-01

    The human reduced folate carrier (hRFC) is reported to be regulated by up to seven alternatively spliced noncoding exons (A1, A2, A, B, C, D, and E). Noncoding exon and promoter usage was analyzed in RNAs from 27 childhood acute lymphoblastic leukemia (ALL) specimens by real-time PCR and/or 5' rapid amplification of cDNA ends (5' RACE) assay. By real-time PCR, total hRFC transcripts in ALL spanned a 289-fold range. Over 90% of hRFC transcripts were transcribed with A1, A2, and B 5' untranslated regions (UTRs). Analysis of 5' RACE clones showed that the A1 + A2 5'UTRs contained A1 sequence alone or a fusion of A1 and A2, implying the existence of a single, alternatively spliced 1021-bp A1/A2 noncoding region. High frequency sequence polymorphisms (AGG deletion, C/T transition) identified in the A1/A2 region by 5'RACE were confirmed in normal DNAs. By reporter assays in HepG2 hepatoma and Jurkat leukemia cells, A1/A2 promoter activity was localized to a 134-bp minimal region. Translation from an upstream AUG in the A1/A2 noncoding region in-frame with the normal translation start resulted in synthesis of a larger ( approximately 7 kDa) hRFC protein with transport properties altered from those for wild-type hRFC. Although there was no effect on transcript or protein stabilities, in vitro translation from A1/A2 transcripts was decreased compared with those with the B 5'UTR. Our results document the importance of the hRFC A1/A2 upstream region in childhood ALL and an intricate transcriptional and posttranscriptional regulation of hRFC-A1/A2 mRNAs. Furthermore, they suggest that use of the A1/A2 5'UTR may confer a transport phenotype distinct from the other 5'UTRs due to altered translation efficiency and transport properties. PMID:15297414

  5. Site-specific codon bias in bacteria.

    PubMed

    Smith, J M; Smith, N H

    1996-03-01

    Sequences of the gapA and ompA genes from 10 genera of enterobacteria have been analyzed. There is strong bias in codon usage, but different synonymous codons are preferred at different sites in the same gene. Site-specific preference for unfavored codons is not confined to the first 100 codons and is usually manifest between two codons utilizing the same tRNA. Statistical analyses, based on conclusions reached in an accompanying paper, show that the use of an unfavored codon at a given site in different genera is not due to common descent and must therefore be caused either by sequence-specific mutation or sequence-specific selection. Reasons are given for thinking that sequence-specific mutation cannot be responsible. We are unable to explain the preference between synonymous codons ending in C or T, but synonymous choice between A and G at third sites is largely explained by avoidance of AG-G (where the hyphen indicates the boundary between codons). We also observed that the preferred codon for proline in Enterobacter cloacea has changed from CCG to CCA. PMID:8849909

  6. The Role of eIF1 in Translation Initiation Codon Selection in Caenorhabditis elegans

    PubMed Central

    Maduzia, Lisa L.; Moreau, Anais; Poullet, Nausicaa; Chaffre, Sebastien; Zhang, Yinhua

    2010-01-01

    The selection of a proper AUG start codon requires the base-pairing interactions between the codon on the mRNA and the anticodon of the initiator tRNA. This selection process occurs in a pre-initiation complex that includes multiple translation initiation factors and the small ribosomal subunit. To study how these initiation factors are involved in start codon recognition in multicellular organisms, we isolated mutants that allow the expression of a GFP reporter containing a non-AUG start codon. Here we describe the characterization of mutations in eif-1, which encodes the Caenorhabditis elegans translation initiation factor 1 (eIF1). Two mutations were identified, both of which are substitutions of amino acid residues that are identical in all eukaryotic eIF1 proteins. These residues are located in a structural region where the amino acid residues affected by the Saccharomyces cerevisiae eIF1 mutations are also localized. Both C. elegans mutations are dominant in conferring a non-AUG translation initiation phenotype and lead to growth arrest defects in homozygous animals. By assaying reporter constructs that have base changes at the AUG start codon, these mutants are found to allow expression from most reporters that carry single base changes within the AUG codon. This trend of non-AUG mediated initiation was also observed previously for C. elegans eIF2? mutants, indicating that these two factors play a similar role. These results support that eIF1 functions in ensuring the fidelity of AUG start codon recognition in a multicellular organism. PMID:20855569

  7. Influence of modification next to the anticodon in tRNA on codon context sensitivity of translational suppression and accuracy.

    PubMed Central

    Bouadloun, F; Srichaiyo, T; Isaksson, L A; Björk, G R

    1986-01-01

    Effects on translation in vivo by modification deficiencies for 2-methylthio-N6-isopentenyladenosine (ms2i6A) (Escherichia coli) or 2-methylthio-N6-(4-hydroxyisopentenyl)adenosine (ms2io6A) (Salmonella typhimurium) in tRNA were studied in mutant strains. These hypermodified nucleosides are present on the 3' side of the anticodon (position 37) in tRNA reading codons starting with uridine. In E. coli, translational error caused by tRNA was strongly reduced in the case of third-position misreading of a tryptophan codon (UGG) in a particular codon context but was not affected in the case of first-position misreading of an arginine codon (CGU) in another codon context. Misreading of UGA nonsense codons at two different positions was codon context dependent. The efficiencies of some tRNA nonsense suppressors were decreased in a tRNA-dependent manner. Suppressor tRNA which lacks ms2i6A-ms2io6A becomes more sensitive to codon context. Our results therefore indicate that, besides improving translational efficiency, ms2i6A37 and ms2io6A37 modifications in tRNA are also involved in decreasing the intrinsic codon reading context sensitivity of tRNA. Possible consequences for regulation of gene expression are discussed. PMID:3086285

  8. Quality control of transcription start site selection by nonsense-mediated-mRNA decay.

    PubMed

    Malabat, Christophe; Feuerbach, Frank; Ma, Laurence; Saveanu, Cosmin; Jacquier, Alain

    2015-01-01

    Nonsense-mediated mRNA decay (NMD) is a translation-dependent RNA quality-control pathway targeting transcripts such as messenger RNAs harboring premature stop-codons or short upstream open reading frame (uORFs). Our transcription start sites (TSSs) analysis of Saccharomyces cerevisiae cells deficient for RNA degradation pathways revealed that about half of the pervasive transcripts are degraded by NMD, which provides a fail-safe mechanism to remove spurious transcripts that escaped degradation in the nucleus. Moreover, we found that the low specificity of RNA polymerase II TSSs selection generates, for 47% of the expressed genes, NMD-sensitive transcript isoforms carrying uORFs or starting downstream of the ATG START codon. Despite the low abundance of this last category of isoforms, their presence seems to constrain genomic sequences, as suggested by the significant bias against in-frame ATGs specifically found at the beginning of the corresponding genes and reflected by a depletion of methionines in the N-terminus of the encoded proteins. PMID:25905671

  9. Studying Codon Usage: From sequence to function

    NASA Astrophysics Data System (ADS)

    Hwa, Terry; Klumpp, Stefan; Dong, Jiajia

    2007-03-01

    Protein coding sequences exhibit strong variances in the use of codons. Highly expressed genes such as those encoding ribosomal proteins use codons corresponding to the highly abundant tRNAs (``optimized codons''). High expression of heterologous genes also requires codon optimization, but even the codon usage of very weakly expressed genes tends to be far from random. To understand this biased choice of codon usage, we develop a theory based on the concept of ``ribosomal load.'' Ribosome is the key limiting commodity for rapidly growing organisms so that the use of ``non-optimal'' codons in any gene prolongs the translational elongation time, thus reducing the effective ribosome concentration. This presents a fitness cost, the magnitude of which depends on the amount of that protein being translated. We formulated and solved an evolution equation based on the above ingredients. This provides a quantitative relation between codon usage and protein abundance, which is found to be in good agreement with the available data for E.coli. This result suggests a convenient way to quantitatively predict protein abundances based on genome sequence data.

  10. Context specific misreading of phenylalanine codons

    Microsoft Academic Search

    James Precup; Amy K. Ulrich; Osha Roopnarine; Jack Parker

    1989-01-01

    It has previously been shown that the phenylalanine codon UUC encoding residue 8 of the Escherichia coli argI gene product, ornithine transcarbamylase, is misread as leucine at a high frequency during phenylalanine starvation. However, no misreading of the UUU encoding residue 3 was observed under these conditions. Using oligonucleotide-directed, site-specific mutagenesis, we have constructed mutants where these codons have been

  11. Regularities of context-dependent codon bias in eukaryotic genes

    PubMed Central

    Fedorov, Alexei; Saxonov, Serge; Gilbert, Walter

    2002-01-01

    Nucleotides surrounding a codon influence the choice of this particular codon from among the group of possible synonymous codons. The strongest influence on codon usage arises from the nucleotide immediately following the codon and is known as the N1 context. We studied the relative abundance of codons with N1 contexts in genes from four eukaryotes for which the entire genomes have been sequenced: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana. For all the studied organisms it was found that 90% of the codons have a statistically significant N1 context-dependent codon bias. The relative abundance of each codon with an N1 context was compared with the relative abundance of the same 4mer oligonucleotide in the whole genome. This comparison showed that in about half of all cases the context-dependent codon bias could not be explained by the sequence composition of the genome. Ranking statistics were applied to compare context-dependent codon biases for codons from different synonymous groups. We found regularities in N1 context-dependent codon bias with respect to the codon nucleotide composition. Codons with the same nucleotides in the second and third positions and the same N1 context have a statistically significant correlation of their relative abundances. PMID:11861911

  12. Regularities of context-dependent codon bias in eukaryotic genes.

    PubMed

    Fedorov, Alexei; Saxonov, Serge; Gilbert, Walter

    2002-03-01

    Nucleotides surrounding a codon influence the choice of this particular codon from among the group of possible synonymous codons. The strongest influence on codon usage arises from the nucleotide immediately following the codon and is known as the N1 context. We studied the relative abundance of codons with N1 contexts in genes from four eukaryotes for which the entire genomes have been sequenced: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana. For all the studied organisms it was found that 90% of the codons have a statistically significant N1 context-dependent codon bias. The relative abundance of each codon with an N1 context was compared with the relative abundance of the same 4mer oligonucleotide in the whole genome. This comparison showed that in about half of all cases the context-dependent codon bias could not be explained by the sequence composition of the genome. Ranking statistics were applied to compare context-dependent codon biases for codons from different synonymous groups. We found regularities in N1 context-dependent codon bias with respect to the codon nucleotide composition. Codons with the same nucleotides in the second and third positions and the same N1 context have a statistically significant correlation of their relative abundances. PMID:11861911

  13. Codon Bias Signatures, Organization of Microorganisms in Codon Space, and Lifestyle

    E-print Network

    Carbone, Alessandra

    Codon Bias Signatures, Organization of Microorganisms in Codon Space, and Lifestyle A. Carbone,* F, Bd de l'Ho^pital, 75013 Paris, France; ATelier de Ge´nomique Cognitive, CNRS ESA 8071/Genopole, 523 tendencies toward content bias, translational bias, and strand bias. These criteria can be applied to all

  14. Estrogen receptor codon 594 and HER2 codon 655 polymorphisms and breast cancer risk

    Microsoft Academic Search

    Elif Akisik; Nejat Dalay

    2004-01-01

    The estrogen receptor (ER) and the human epithelial growth factor receptor 2 (HER2) genes have been implicated in the development and prognosis of breast cancer. Several genetic polymorphic sites in these genes have been identified and associated with the risk of breast cancer. We have investigated the association between the estrogen receptor codon 594 (ACA to ACG) and HER2 codon

  15. Hand gesture recognition by analysis of codons

    NASA Astrophysics Data System (ADS)

    Ramachandra, Poornima; Shrikhande, Neelima

    2007-09-01

    The problem of recognizing gestures from images using computers can be approached by closely understanding how the human brain tackles it. A full fledged gesture recognition system will substitute mouse and keyboards completely. Humans can recognize most gestures by looking at the characteristic external shape or the silhouette of the fingers. Many previous techniques to recognize gestures dealt with motion and geometric features of hands. In this thesis gestures are recognized by the Codon-list pattern extracted from the object contour. All edges of an image are described in terms of sequence of Codons. The Codons are defined in terms of the relationship between maxima, minima and zeros of curvature encountered as one traverses the boundary of the object. We have concentrated on a catalog of 24 gesture images from the American Sign Language alphabet (Letter J and Z are ignored as they are represented using motion) [2]. The query image given as an input to the system is analyzed and tested against the Codon-lists, which are shape descriptors for external parts of a hand gesture. We have used the Weighted Frequency Indexing Transform (WFIT) approach which is used in DNA sequence matching for matching the Codon-lists. The matching algorithm consists of two steps: 1) the query sequences are converted to short sequences and are assigned weights and, 2) all the sequences of query gestures are pruned into match and mismatch subsequences by the frequency indexing tree based on the weights of the subsequences. The Codon sequences with the most weight are used to determine the most precise match. Once a match is found, the identified gesture and corresponding interpretation are shown as output.

  16. Downstream Labeling and Upstream Competition

    Microsoft Academic Search

    Olivier BONROY; Stéphane LEMARIÉ; INRA SFER CIRAD

    Abstract This paper,analyses the impact,of labeling in a context where,the products,come from a supply chain. We consider a case where there is an information,problem,about product quality in the downstream part of the chain, but not in the upstream part. We show that the implementation,of a label to solve this information,problem,affects competition in the upstream part of the chain. In particular,

  17. The Codon-Degeneracy Model of Molecular Evolution

    Microsoft Academic Search

    David A. McClellan

    2000-01-01

    .   Mitochondrial genetic codons can be categorized by four patterns of nucleotide-site degeneracy based on varying combinations\\u000a of twofold- or nondegenerate sites at first codon positions and twofold- or fourfold-degenerate sites at third codon positions.\\u000a Herein, a model of molecular evolution is introduced that uses these patterns to calculate expected substitution frequencies\\u000a for each codon position and substitution type relative

  18. Efficient expression of gene variants that harbour AGA codons next to the initiation codon

    PubMed Central

    Zamora-Romo, Efraín; Cruz-Vera, Luis Rogelio; Vivanco-Domínguez, Serafín; Magos-Castro, Marco Antonio; Guarneros, Gabriel

    2007-01-01

    In an effort to improve the knowledge about the rules which direct the effect of the early ORF sequences on translation efficiency, we have analyzed the effect of pairs of the six arginine codons at the second and third positions on the expression of lacZ variants. Whereas the pairs of identical AGA or AGG codons were favorable for the gene expression, identical pairs of each of the four CGN codons were very inefficient. This result was unexpected because tandems of AGA or AGG codons located in more internal gene positions provoke deficient expression whilst internally located CGU and CGC are the most abundant and efficiently translated arginine codons. The mixed combinations of AGA and each of the CGN codons usually resulted in efficient rates of lacZ expression independently of the peptidyl-tRNA propensity to dissociate from the ribosome. Thus, the variant harboring the pair of AGA codons was expressed as efficiently as the variant carrying a pair of AAA codons in the same positions, a configuration reported as one of the most common and efficient for gene expression. We explain these results assuming that the presence of adenines in these early positions enhance gene expression. As expected, specific mRNA levels correlated with the intensity of lacZ expression for each variant. However, the induction of lacZ AGA AGA gene in pth cells accumulated peptidyl-tRNAArg4 as well as a short 5?-proximal lacZ mRNA fragment suggesting ribosome stalling due to depletion of aminoacylated-tRNAArg4. PMID:17726048

  19. Hydraulic jumps with upstream shear

    NASA Astrophysics Data System (ADS)

    Ogden, Kelly; Helfrich, Karl

    2013-11-01

    Hydraulic jumps in flows with background shear are investigated, motivated by applications such as the flow over sills in Knight Inlet and the Pre-Bosphorus Channel. The full solution space and allowable solutions to several two-layer theories for hydraulic jumps with upstream shear are identified. The two-layer theories considered, including a recent theory by Borden et al. (JFM, 2012), are distinguished by how dissipation is partitioned between the layers. It is found that upstream shear with a faster and thinner lower layer causes an increase in bore speed, for a given jump height. Further, these two-layer solutions only exist for a limited range of upstream shear. 2D numerical simulations are conducted, guided by the two-layer theory solution space, and the results are compared to the theories. The simulations show the qualitative types of hydraulic transitions that occur, including undular bores, fully turbulent jumps, and conjugate state-like solutions; the type depends on the jump height and upstream shear for fixed upstream layer depths. Numerical simulations are used to investigate the mixing. Finally, a few 3D numerical simulations were made and are found to be consistent with the 2D results.

  20. Codon optimization of genes for efficient protein expression in mammalian cells by selection of only preferred human codons.

    PubMed

    Inouye, Satoshi; Sahara-Miura, Yuiko; Sato, Jun-ichi; Suzuki, Takahiro

    2015-05-01

    A simple design method for codon optimization of genes to express a heterologous protein in mammalian cells is described. Codon optimization was performed by choosing only codons preferentially used in humans and with over 60% GC content, and the method was named the "preferred human codon-optimized method." To test our simple rule for codon optimization, the preferred human codon-optimized genes for six proteins containing photoproteins (aequorin and clytin II) and luciferases (Gaussia luciferase, Renilla luciferase, and firefly luciferases from Photinus pyralis and Luciola cruciata) were chemically synthesized and transiently expressed in Chinese hamster ovary-K1 cells. All preferred human codon-optimized genes showed higher luminescence activity than the corresponding wild-type genes. Our simple design method could be used to improve protein expression in mammalian cells efficiently. PMID:25665506

  1. Selective pressure dominates the synonymous codon usage in parvoviridae.

    PubMed

    Shi, Sheng-Lin; Jiang, Yi-Ren; Liu, Yan-Qun; Xia, Run-Xi; Qin, Li

    2013-02-01

    Parvoviridae is a family of small non-enveloped viruses and divided into two subfamilies. The family members infect a wide range of organisms from insects to humans and some of the members (e.g., nonpathogenic adeno-associated viruses) are effective gene therapy delivery vectors. We detailed the synonymous codon usage pattern of Parvoviridae family from the available 58 sequenced genomes through multivariate statistical methods. Our results revealed that nine viruses showed some degree of strong codon bias, and the others possessed a general weak trend of codon bias. ENc-plot and neutrality plot results showed that selective pressure dominated over mutation in shapes coding sequence's composition. The overall GC content and GC content at the third synonymous codon position were the principal determinants behind the variations within the codon usage patterns, as they both significantly correlated with the first axis of correspondence analysis. In addition, gene length had no direct influence on the codon usage pattern. Densovirinae subfamily and Parvovirinae subfamily possessed nine identical preferred codons, though most of the two subfamilies codon usage frequencies were significantly different. The result of cluster analysis based on synonymous codon usage was discordant with that of taxonomic classification. Adeno-associated viruses formed a separated clade far from other Parvoviridae members in the dendrogram. Thus, we concluded that natural selection rather than mutation pressure accounts for the main factor that affects the codon bias in Parvoviridae family. PMID:22996735

  2. The Mechanisms of Codon Reassignments in Mitochondrial Genetic Codes

    PubMed Central

    Sengupta, Supratim; Yang, Xiaoguang

    2007-01-01

    Many cases of nonstandard genetic codes are known in mitochondrial genomes. We carry out analysis of phylogeny and codon usage of organisms for which the complete mitochondrial genome is available, and we determine the most likely mechanism for codon reassignment in each case. Reassignment events can be classified according to the gain-loss framework. The “gain” represents the appearance of a new tRNA for the reassigned codon or the change of an existing tRNA such that it gains the ability to pair with the codon. The “loss” represents the deletion of a tRNA or the change in a tRNA so that it no longer translates the codon. One possible mechanism is codon disappearance (CD), where the codon disappears from the genome prior to the gain and loss events. In the alternative mechanisms the codon does not disappear. In the unassigned codon mechanism, the loss occurs first, whereas in the ambiguous intermediate mechanism, the gain occurs first. Codon usage analysis gives clear evidence of cases where the codon disappeared at the point of the reassignment and also cases where it did not disappear. CD is the probable explanation for stop to sense reassignments and a small number of reassignments of sense codons. However, the majority of sense-to-sense reassignments cannot be explained by CD. In the latter cases, by analysis of the presence or absence of tRNAs in the genome and of the changes in tRNA sequences, it is sometimes possible to distinguish between the unassigned codon and the ambiguous intermediate mechanisms. We emphasize that not all reassignments follow the same scenario and that it is necessary to consider the details of each case carefully. Electronic supplementary material The online version of this article (doi:10.1007/s00239-006-0284-7) contains supplementary material, which is available to authorized users. PMID:17541678

  3. Analysis of codon usage in bovine viral diarrhea virus

    Microsoft Academic Search

    Meng WangJie; Jie Zhang; Jian-hua Zhou; Hao-tai Chen; Li-na Ma; Yao-zhong Ding; Wen-qian Liu; Yong-sheng Liu

    2011-01-01

    Bovine viral diarrhea virus (BVDV) is a widespread virus in beef and dairy herds. BVDV has been grouped into two genotypes,\\u000a genotype 1 and genotype 2. In this study, the relative synonymous codon usage (RSCU) values, effective number of codon (ENC)\\u000a values and nucleotide content were investigated, and a comparative analysis of codon usage patterns for open reading frames\\u000a (ORFs)

  4. TrimerDimer: an oligonucleotide-based saturation mutagenesis approach that removes redundant and stop codons

    PubMed Central

    Gaytán, Paul; Contreras-Zambrano, Casandra; Ortiz-Alvarado, Mónica; Morales-Pablos, Alfredo; Yáñez, Jorge

    2009-01-01

    9-fluorenylmethoxycarbonyl (Fmoc) and 4,4?-dimethoxytrityl (DMTr) are orthogonal hydroxyl protecting groups that have been used in conjunction to assemble oligonucleotide libraries whose variants contain wild-type and mutant codons randomly interspersed throughout a focused DNA region. Fmoc is labile to organic bases and stable to weak acids, whereas DMTr behaves oppositely. Based on these chemical characteristics, we have now devised TrimerDimer, a novel codon-based saturation mutagenesis approach that removes redundant and stop codons during the assembly of degenerate oligonucleotides. In this approach, five DMTr-protected trinucleotide phosphoramidites (dTGG, dATG, dTTT, dTAT and dTGC) and five Fmoc-protected dinucleotide phosphoramidites (dAA, dTT, dAT, dGC and dCG) react simultaneously with a starting oligonucleotide growing on a solid support. The Fmoc group is then removed and the incorporated dimers react with a mixture of three DMTr-protected monomer phosphoramidites (dC, dA and dG) to produce 15 trinucleotides: dCAA, dAAA, dGAA, dCTT, dATT, dGTT, dCAT, dAAT, dGAT, dCGC, dAGC, dGGC, dCCG, dACG and dGCG. After one mutagenic cycle, 20 codons are generated encoding the 20 natural amino acids. TrimerDimer was tested by randomizing the four contiguous codons that encode amino acids L64–G67 of an engineered, nonfluorescent GFP protein. Sequencing of 89 nonfluorescent mutant clones and isolation of two fluorescent mutants confirmed the principle. PMID:19783828

  5. The importance of codon-anticodon interactions in translation elongation.

    PubMed

    Saint-Léger, Adélaïde; Ribas de Pouplana, Lluís

    2015-07-01

    Translation is the process by which genetic information is turned into amino acid sequence, following the instructions of the genetic code. The formation of a correct codon-anticodon pair is essential to ensure efficiency and fidelity during translation. Here we review the influence that codon-anticodon interactions play over the elongation phase of translation; including the role of this interaction in cognate tRNA selection by ribosomes, the importance of relative codon frequencies in the cell, and the roles of tRNA modifications in the process of codon-anticodon recognition. PMID:25921436

  6. Analysis of synonymous codon usage bias in Chlamydia.

    PubMed

    Lü, Hui; Zhao, Wei-Ming; Zheng, Yan; Wang, Hong; Qi, Mei; Yu, Xiu-Ping

    2005-01-01

    Chlamydiae are obligate intracellular bacterial pathogens that cause ocular and sexually transmitted diseases, and are associated with cardiovascular diseases. The analysis of codon usage may improve our understanding of the evolution and pathogenesis of Chlamydia and allow reengineering of target genes to improve their expression for gene therapy. Here, we analyzed the codon usage of C. muridarum, C. trachomatis (here indicating biovar trachoma and LGV), C. pneumoniae, and C. psittaci using the codon usage database and the CUSP (Create a codon usage table) program of EMBOSS (The European Molecular Biology Open Software Suite). The results show that the four genomes have similar codon usage patterns, with a strong bias towards the codons with A and T at the third codon position. Compared with Homo sapiens, the four chlamydial species show discordant seven or eight preferred codons. The ENC (effective number of codons used in a gene)-plot reveals that the genetic heterogeneity in Chlamydia is constrained by the G+C content, while translational selection and gene length exert relatively weaker influences. Moreover, mutational pressure appears to be the major determinant of the codon usage variation among the chlamydial genes. In addition, we compared the codon preferences of C. trachomatis with those of E. coli, yeast, adenovirus and Homo sapiens. There are 23 codons showing distinct usage differences between C. trachomatis and E. coli, 24 between C. trachomatis and adenovirus, 21 between C. trachomatis and Homo sapiens, but only six codons between C. trachomatis and yeast. Therefore, the yeast system may be more suitable for the expression of chlamydial genes. Finally, we compared the codon preferences of C. trachomatis with those of six eukaryotes, eight prokaryotes and 23 viruses. There is a strong positive correlation between the differences in coding GC content and the variations in codon bias (r=0.905, P<0.001). We conclude that the variation of codon bias between C. trachomatis and other organisms is much less influenced by phylogenetic lineage and primarily determined by the extent of disparities in GC content. PMID:15645075

  7. Directional next-generation RNA sequencing and examination of premature termination codon mutations in endoglin/hereditary haemorrhagic telangiectasia.

    PubMed

    Govani, F S; Giess, A; Mollet, I G; Begbie, M E; Jones, M D; Game, L; Shovlin, C L

    2013-04-01

    Hereditary haemorrhagic telangiectasia (HHT) is a disease characterised by abnormal vascular structures, and most commonly caused by mutations in ENG, ACVRL1 or SMAD4 encoding endothelial cell-expressed proteins involved in TGF-? superfamily signalling. The majority of mutations reported on the HHT mutation database are predicted to lead to stop codons, either due to frameshifts or direct nonsense substitutions. The proportion is higher for ENG (67%) and SMAD4 (65%) than for ACVRL1 (42%), p < 0.0001. Here, by focussing on ENG, we report why conventional views of these mutations may need to be revised. Of the 111 stop codon-generating ENG mutations, on ExPASy translation, all except one were premature termination codons (PTCs), sited at least 50-55 bp upstream of the final exon-exon boundary of the main endoglin isoform, L-endoglin. This strongly suggests that the mutated RNA species will undergo nonsense-mediated decay. We provide new in vitro expression data to support dominant negative activity of stable truncated endoglin proteins but suggest these will not generate HHT: the single natural stop codon mutation in L-endoglin (sited within 50-55 nucleotides of the final exon-exon boundary) is unlikely to generate functional protein since it replaces the entire transmembrane domain, as would 8 further natural stop codon mutations, if the minor S-endoglin isoform were implicated in HHT pathogenesis. Finally, next-generation RNA sequencing data of 7 different RNA libraries from primary human endothelial cells demonstrate that multiple intronic regions of ENG are transcribed. The potential consequences of heterozygous deletions or duplications of such regions are discussed. These data support the haploinsufficiency model for HHT pathogenesis, explain why final exon mutations have not been detected to date in HHT, emphasise the potential need for functional examination of non-PTC-generating mutations, and lead to proposals for an alternate stratification system of mutational types for HHT genotype-phenotype correlations. PMID:23801935

  8. [Codon usage bias in the straw mushroom Volvariella volvacea].

    PubMed

    Jiang, Wei; Lü, Beibei; He, Jianhua; Wang, Jinbin; Wu, Xiao; Wu, Guogan; Bao, Dapeng; Chen, Mingjie; Zhang, Jinsong; Tan, Qi; Tang, Xueming

    2014-09-01

    We analyzed the whole genome coding sequence of Volvariella volvacea to study the pattern utilization of codons by Codon W 1.4.2. As results, 24 optimal codons were identified. Moreover, the frequency of codons usage was calculated by CUSP program. We compared the frequency of codons usage of V. volvacea with other organisms including 6 modal value species (Homo sapiens, Saccharomys cerevisiae, Arabidopsis thalian, Mus musculus, Danio rerio and Drosophila melanogaster) and 4 edible fungi (Coprinopsis cinerea, Agaricus bisporus, Lentinula edodes and Pleurotus ostreatus). We found that there were less differences in 3 edible fungi (excluding Pleurotus ostreatus) than 6 modal value species, comparing with the frequency of codons usage of V. volvacea. With software SPSS16.0, cluster analysis which showed differences in the size of codon bias, reflects the evolutionary relationships between species, which can be used as a reference of evolutionary relationships of species. This was the first time for analysis the codon preference among the whole coding sequences of edible fungi, serving as theoretical basis to apply genetic engineering of V. volvacea. PMID:25720157

  9. The Start of Head Start

    ERIC Educational Resources Information Center

    Neugebauer, Roger

    2010-01-01

    The creation of the Head Start program occurred at break-neck speed with many dramatic turns and many colorful players. No one tells the story better than Edward Zigler in "Head Start: The Inside Story of America's Most Successful Educational Experiment"--a detailed and personal, behind the scenes look at the program's inception. From this…

  10. A Novel Mutation in the Upstream Open Reading Frame of the CDKN1B Gene Causes a MEN4 Phenotype

    PubMed Central

    Occhi, Gianluca; Regazzo, Daniela; Trivellin, Giampaolo; Boaretto, Francesca; Ciato, Denis; Bobisse, Sara; Ferasin, Sergio; Cetani, Filomena; Pardi, Elena; Korbonits, Márta; Pellegata, Natalia S.; Sidarovich, Viktoryia; Quattrone, Alessandro; Opocher, Giuseppe; Mantero, Franco; Scaroni, Carla

    2013-01-01

    The CDKN1B gene encodes the cyclin-dependent kinase inhibitor p27KIP1, an atypical tumor suppressor playing a key role in cell cycle regulation, cell proliferation, and differentiation. Impaired p27KIP1 expression and/or localization are often observed in tumor cells, further confirming its central role in regulating the cell cycle. Recently, germline mutations in CDKN1B have been associated with the inherited multiple endocrine neoplasia syndrome type 4, an autosomal dominant syndrome characterized by varying combinations of tumors affecting at least two endocrine organs. In this study we identified a 4-bp deletion in a highly conserved regulatory upstream ORF (uORF) in the 5?UTR of the CDKN1B gene in a patient with a pituitary adenoma and a well-differentiated pancreatic neoplasm. This deletion causes the shift of the uORF termination codon with the consequent lengthening of the uORF–encoded peptide and the drastic shortening of the intercistronic space. Our data on the immunohistochemical analysis of the patient's pancreatic lesion, functional studies based on dual-luciferase assays, site-directed mutagenesis, and on polysome profiling show a negative influence of this deletion on the translation reinitiation at the CDKN1B starting site, with a consequent reduction in p27KIP1 expression. Our findings demonstrate that, in addition to the previously described mechanisms leading to reduced p27KIP1 activity, such as degradation via the ubiquitin/proteasome pathway or non-covalent sequestration, p27KIP1 activity can also be modulated by an uORF and mutations affecting uORF could change p27KIP1 expression. This study adds the CDKN1B gene to the short list of genes for which mutations that either create, delete, or severely modify their regulatory uORFs have been associated with human diseases. PMID:23555276

  11. Evidence of efficient stop codon readthrough in four mammalian genes

    E-print Network

    Loughran, Gary

    Stop codon readthrough is used extensively by viruses to expand their gene expression. Until recent discoveries in Drosophila, only a very limited number of readthrough cases in chromosomal genes had been reported. Analysis ...

  12. Heterologous Stop Codon Readthrough of Metazoan Readthrough Candidates in Yeast

    E-print Network

    Jungreis, Irwin

    Recent analysis of genomic signatures in mammals, flies, and worms indicates that functional translational stop codon readthrough is considerably more abundant in metazoa than previously recognized, but this analysis ...

  13. Analysis of synonymous codon usage patterns in different plant mitochondrial genomes.

    PubMed

    Zhou, Meng; Li, Xia

    2009-11-01

    Codon usage in mitochondrial genome of the six different plants was analyzed to find general patterns of codon usage in plant mitochondrial genomes. The neutrality analysis indicated that the codon usage patterns of mitochondrial genes were more conserved in GC content and no correlation between GC12 and GC3. T and A ending codons were detected as the preferred codons in plant mitochondrial genomes. The Parity Rule 2 plot analysis showed that T was used more frequently than A. The EN(C)-plot showed that although a majority of the points with low EN(C) values were lying below the expected curve, a few genes lied on the expected curve. Correspondence analysis of relative synonymous codon usage yielded a first axis that explained only a partial amount of variation of codon usage. These findings suggest that natural selection is likely to be playing a large role in codon usage bias in plant mitochondrial genomes, but not only natural selection but also other several factors are likely to be involved in determining the selective constraints on codon bias in plant mitochondrial genomes. Meantime, 1 codon (P. patens), 6 codons (Z. mays), 9 codons (T. aestivum), 15 codons (A. thaliana), 15 codons (M. polymorpha) and 15 codons (N. tabacum) were defined as the preferred codons of the six plant mitochondrial genomes. PMID:19005776

  14. Start Young!

    ERIC Educational Resources Information Center

    Rubin, Penni

    2002-01-01

    Discusses the importance of early interest in science and how effective it is on career choice in adult stages of life. Recommends starting mathematics and science activities in preschool and kindergarten. Describes how to create a career-oriented learning center in the classroom with examples of kitchen chemistry, nutrition/botany, zoology,…

  15. The association of p53 mutations and p53 codon 72, Her 2 codon 655 and MTHFR C677T polymorphisms with breast cancer in Northern Greece

    Microsoft Academic Search

    Theodora G. Kalemi; Alexandros F. Lambropoulos; Maria Gueorguiev; Sofia Chrisafi; Konstantinos T. Papazisis; Alexandros Kotsis

    2005-01-01

    The aim of this study was to explore a possible association between p53 codon 72, Her 2 codon 655 and MTHFR C677T polymorphisms and breast cancer in Northern Greece. We examined 42 women with breast cancer and 51 controls. A total of 42 women with breast cancer as well as healthy controls were investigated and results showed that p53 codon

  16. Getting Started

    NSDL National Science Digital Library

    Marianne E. Krasny

    2001-01-01

    Before starting any of the activities in this guide, we strongly recommend that you read the information in this section. Here we cover the critically important issues of how to handle amphibians and reptiles, and safety issues concerning these animals and field activities in general. We also discuss permits and regulations relating to the collecting, handling, and raising of herps. This free selection also includes the Table of Contents, Preface, and Introduction.

  17. Patterns of codon usage bias in Silene latifolia.

    PubMed

    Qiu, Suo; Bergero, Roberta; Zeng, Kai; Charlesworth, Deborah

    2011-01-01

    Patterns of codon usage bias (CUB) convey useful information about the selection on synonymous codons induced by gene expression and contribute to an understanding of substitution patterns observed at synonymous sites. They can also be informative about the distinctive evolutionary properties of sex chromosomes such as genetic degeneration of the Y chromosome, dosage compensation, and hemizygosity of the X chromosome in males, which can affect the selection on codon usage. Here, we study CUB in Silene latifolia, a species of interest for studying the early stages of sex chromosome evolution. We have obtained a large expressed sequence tag data set containing more than 1,608 sequence fragments by 454 sequencing. Using three different methods, we conservatively define 21 preferred codons. Interestingly, the preferred codons in S. latifolia are almost identical to those in Arabidopsis thaliana, despite their long divergence time (we estimate average nonsynonymous site divergence to be 0.216, and synonymous sites are saturated). The agreement suggests that the nature of selection on codon usage has not changed significantly during the long evolutionary time separating the two species. As in many other organisms, the frequency of preferred codons is negatively correlated with protein length. For the 43 genes with both exon and intron sequences, we find a positive correlation between gene expression levels and GC content at third codon positions, but a strong negative correlation between expression and intron GC content, suggesting that the CUB we detect in S. latifolia is more likely to be due to natural selection than to mutational bias. Using polymorphism data, we detect evidence of ongoing natural selection on CUB, but we find little support for effects of biased gene conversion. An analysis of ten sex-linked genes reveals that the X chromosome has experienced significantly more unpreferred to preferred than preferred to unpreferred substitutions, suggesting that it may be evolving higher CUB. In contrast, numbers of substitutions between preferred and unpreferred codons are similar in both directions in the Y-linked genes, contrary to the expectation of genetic degeneration. PMID:20855431

  18. UPSTREAM MOTIONS IN STRATIFIED FLOW (JOURNAL VERSION)

    EPA Science Inventory

    In the paper experimental measurements of the time-dependent velocity and density perturbations upstream of obstacles in linearly stratified flow are presented. Attention is concentrated on obstacles which generate turbulent separated wakes at Froude numbers, based on velocity an...

  19. Whistler waves observed upstream from collisionless shocks

    Microsoft Academic Search

    D. H. Fairfield

    1974-01-01

    Waves in the frequency range 0.5-4. Hz have been studied in the region upstream of the earth's bow shock with data from the flux-gate magnetic field experiment on Imp 6. Such waves are invariably detected adjacent to the shock, persisting upstream for intervals often less than a minute but occasionally of the order of many hours. Analysis of 150 examples

  20. The Upstream Detectors of the FIRST Experiment at GSI

    NASA Astrophysics Data System (ADS)

    Paoloni, A.; Anelli, M.; Iarocci, E.; Patera, V.; Piersanti, L.; Sarti, A.; Sciubba, A.

    FIRST (FragmentationofIonsRelevantforSpaceandTherapy)isanexperimentdevotedtoaprecise measurementofion fragmentation for space radiation protection and hadron therapyapplications. Afirst run dedicated to the fragmentation of fully stripped 12Cions on a thin graphite target has been already performed during August 2011 at GSI. The experiment is composed of already existing detectors complemented by a newly designed interaction region, including the so -called Upstream Detectors: a Start Counter and a Beam Monitor. The Start Counter is used to trigger the beam and to give a precise time reference for time of flight measurements, while the Beam Monitor is needed to track ions before their interaction in the target. In this paper we present their description and the results of the tests performed on different beams to validate their performances before the installation at GSI.

  1. Differential Codon Adaptation between dsDNA and ssDNA Phages in Escherichia coli

    PubMed Central

    Chithambaram, Shivapriya; Prabhakaran, Ramanandan; Xia, Xuhua

    2014-01-01

    Because phages use their host translation machinery, their codon usage should evolve toward that of highly expressed host genes. We used two indices to measure codon adaptation of phages to their host, rRSCU (the correlation in relative synonymous codon usage [RSCU] between phages and their host) and Codon Adaptation Index (CAI) computed with highly expressed host genes as the reference set (because phage translation depends on host translation machinery). These indices used for this purpose are appropriate only when hosts exhibit little mutation bias, so only phages parasitizing Escherichia coli were included in the analysis. For double-stranded DNA (dsDNA) phages, both rRSCU and CAI decrease with increasing number of transfer RNA genes encoded by the phage genome. rRSCU is greater for dsDNA phages than for single-stranded DNA (ssDNA) phages, and the low rRSCU values are mainly due to poor concordance in RSCU values for Y-ending codons between ssDNA phages and the E. coli host, consistent with the predicted effect of C?T mutation bias in the ssDNA phages. Strong C?T mutation bias would improve codon adaptation in codon families (e.g., Gly) where U-ending codons are favored over C-ending codons (“U-friendly” codon families) by highly expressed host genes but decrease codon adaptation in other codon families where highly expressed host genes favor C-ending codons against U-ending codons (“U-hostile” codon families). It is remarkable that ssDNA phages with increasing C?T mutation bias also increased the usage of codons in the “U-friendly” codon families, thereby achieving CAI values almost as large as those of dsDNA phages. This represents a new type of codon adaptation. PMID:24586046

  2. FLUID MODELING OF BLOCKING AND UPSTREAM INFLUENCES OF STABLE FLOW OVER TWO-DIMENSIONAL HILLS

    EPA Science Inventory

    Evidence of upstream influences observed in towing-tank experiments of stable flow over two-dimensional hills is presented. The influences take the forms of blocked fluid and columnar disturbance modes. Two hill shapes were used and the start-up method and depth of linear stratif...

  3. Adaptation studied with the self-consistent codon index: genomic spaces, metabolic network

    E-print Network

    Carbone, Alessandra

    are formed out of 20 amino-acids which are coded in triplets of nucleotides, called codons. The four or CAI for short, which expresses its synonymous codon bias (see appendix for the definition). The idea

  4. All-codon scanning identifies p53 cancer rescue mutations

    E-print Network

    Lathrop, Richard H.

    strategies are valuable tools to identify critical residues in proteins and to generate proteins of Microbiology and Molecular Genetics, 4 Department of Chemical Engineering and Materials Science, 5 Department with modified properties. We describe the fast and simple All- Codon Scanning (ACS) strategy that creates

  5. Transcription, Translation and Mutation Given this list of codons

    E-print Network

    Prestwich, Ken

    Transcription, Translation and Mutation GenBio1 Fall 2011 Given this list of codons: Consider the sequence below as if you were the ribosome. 5' ACUCUUAAUGAAUUGGAGGUGCAGUCCCUGAGUGAU 3' 1. Translate the m, if any, would this mutation have on the protein? 3. Once again make reference to the mRNA at the top

  6. Use and misuse of correspondence analysis in codon usage studies

    E-print Network

    Thioulouse, Jean

    different examples taken from the genomes of B.subtilis, E.coli, B.burgdorferi and M) and in rodents (22), for analysing trends in amino acid composition in E.coli (23) and for detecting sequencing still is) very popular for analysing codon usage biases in microbial genomes: it has been applied

  7. A PECULIAR CODON USAGE PATTERN REVEALED AFTER REMOVING THE EFFECT OF DNA METHYLATION

    Microsoft Academic Search

    Xuhua Xia

    Summary DNA methylation and deamination increases the C?T mutation rate in CpG dinucleotides, especially in vertebrate genomes. This has profound effect on codon usage in heavily vertebrate genomes, and may obscure the effect of other factors on codon usage bias. We have classified the sense codons into three groups: those decreased by DNA methylation (i.e., CpG-containing codons), those increased by

  8. Animal products and K-ras codon 12 and 13 mutations in colon carcinomas

    Microsoft Academic Search

    E. Kampman; D. W. Voskuil; Kraats van A. A; H. F. Balder; Muijen van G. N. P; R. S. Goldbohm; Veer van't P

    2000-01-01

    K-ras gene mutations (codons 12 and 13) were determined by PCR-based mutant allele-specific amplification (MASA) in tumour tissue of 185 colon cancer patients: 36?arboured mutations, of which 82 ere located in codon 12. High intakes of animal protein, calcium and poultry were differently associated with codon 12 and 13 mutations: odds ratios (OR) and 95?onfidence intervals (95?I) for codon 12

  9. Prokaryotic Gene Finding Based on Physicochemical Characteristics of Codons Calculated from Molecular Dynamics Simulations

    E-print Network

    Jayaram, Bhyravabotla

    Prokaryotic Gene Finding Based on Physicochemical Characteristics of Codons Calculated from An ab initio model for gene prediction in prokaryotic genomes is proposed based on physicochemical prediction in prokaryotic genomes based on a set of three physicochemical characteristics of codons--by codon

  10. Intragenic spatial patterns of codon usage bias in prokaryotic and eukaryotic Hong Qin*,1

    E-print Network

    Wu, Wei-Biao

    1 Intragenic spatial patterns of codon usage bias in prokaryotic and eukaryotic genomes Hong Qin*,1 distribution of synonymous codon usage bias in four prokaryotic (Escherichia coli, Bacillus subtilis pattern using isotonic regression, we show that in yeast and prokaryotic genomes, codon usage bias

  11. Variation in synonymous codon use and DNA polymorphism within the Drosophila genome

    Microsoft Academic Search

    N. BIERNE; A. EYRE-WALKER

    2006-01-01

    A strong negative correlation between the rate of amino-acid substitution and codon usage bias in Drosophila has been attributed to interference between positive selection at nonsynonymous sites and weak selection on codon usage. To further explore this possibility we have investigated polymorphism and divergence at three kinds of sites: synonymous, nonsynonymous and intronic in relation to codon bias in D.

  12. Synonymous codon usage bias in 16 Staphylococcus aureus phages: Implication in phage therapy

    Microsoft Academic Search

    K. Sau; S. K. Gupta; S. Sau; T. C. Ghosh

    2005-01-01

    To reveal the factors influencing architecture of protein-coding genes in staphylococcal phages, relative synonymous codon usage variation has been investigated in 920 protein-coding genes of 16 staphylococcal phages. As expected for AT rich genomes, there are predominantly A and T ending codons in all 16 phages. Both Nc plot and correspondence analysis on relative synonymous codon usage indicates that mutation

  13. Genome-Wide Analysis of Codon Usage and Influencing Factors in Chikungunya Viruses

    PubMed Central

    Tong, Yigang

    2014-01-01

    Chikungunya virus (CHIKV) is an arthropod-borne virus of the family Togaviridae that is transmitted to humans by Aedes spp. mosquitoes. Its genome comprises a 12 kb single-strand positive-sense RNA. In the present study, we report the patterns of synonymous codon usage in 141 CHIKV genomes by calculating several codon usage indices and applying multivariate statistical methods. Relative synonymous codon usage (RSCU) analysis showed that the preferred synonymous codons were G/C and A-ended. A comparative analysis of RSCU between CHIKV and its hosts showed that codon usage patterns of CHIKV are a mixture of coincidence and antagonism. Similarity index analysis showed that the overall codon usage patterns of CHIKV have been strongly influenced by Pan troglodytes and Aedes albopictus during evolution. The overall codon usage bias was low in CHIKV genomes, as inferred from the analysis of effective number of codons (ENC) and codon adaptation index (CAI). Our data suggested that although mutation pressure dominates codon usage in CHIKV, patterns of codon usage in CHIKV are also under the influence of natural selection from its hosts and geography. To the best of our knowledge, this is first report describing codon usage analysis in CHIKV genomes. The findings from this study are expected to increase our understanding of factors involved in viral evolution, and fitness towards hosts and the environment. PMID:24595095

  14. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    PubMed

    Mathew, Suneeth F; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S; McKinney, Cushla; Poole, Elizabeth S; Tate, Warren P

    2015-01-01

    HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon') contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1. PMID:25807539

  15. The Highly Conserved Codon following the Slippery Sequence Supports ?1 Frameshift Efficiency at the HIV-1 Frameshift Site

    PubMed Central

    Mathew, Suneeth F.; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S.; McKinney, Cushla; Poole, Elizabeth S.; Tate, Warren P.

    2015-01-01

    HIV-1 utilises ?1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating ?1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the ‘intercodon’) contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules—eRF1 protein or a cognate suppressor tRNA—were able to access and decode the intercodon prior to ?1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1. PMID:25807539

  16. THE PRINCIPLE OF NEGLECTING UPSTREAM REACTIONS

    Microsoft Academic Search

    Árpád Á

    This paper presents a practical principle, which states that in the case of modifying a flow boundary (e.g. adjusting a blade angle), upstream of the modi- fication the flow is affected to a very small extent, what is usually negligible, while the downstream effect of the modification is large, usually not negligible. This is not a new statement; in special

  17. Upstream urbanization exacerbates urban heat island effects

    Microsoft Academic Search

    Da-Lin Zhang; Yi-Xuan Shou; Russell R. Dickerson

    2009-01-01

    Urban Heat Island (UHI) effects adversely impact weather, air quality, and climate. Previous studies have attributed UHI effects to localized, surface processes. Based on an observational and modeling study of an extreme UHI (heat wave) episode in the Baltimore metropolitan region, we find that upstream urbanization exacerbates UHI effects and that meteorological consequences of extra-urban development can cascade well downwind.

  18. Downstream labeling and upstream price competition

    Microsoft Academic Search

    Olivier Bonroy; Stéphane Lemarié

    2012-01-01

    This paper analyses the economic consequences of labeling in a setting with two vertically related markets. Labeling on the downstream market affects upstream price competition through two effects: a differentiation effect and a ranking effect. The magnitude of these two effects determines who in the supply chain will receive the benefits and who will bear the burden of labeling. For

  19. Local slowdown of translation by nonoptimal codons promotes nascent-chain recognition by SRP in vivo

    PubMed Central

    Pechmann, Sebastian; Chartron, Justin W; Frydman, Judith

    2015-01-01

    The genetic code allows most amino acids a choice of optimal and nonoptimal codons. We report that synonymous codon choice is tuned to promote interaction of nascent polypeptides with the signal recognition particle (SRP), which assists in protein translocation across membranes. Cotranslational recognition by the SRP in vivo is enhanced when mRNAs contain nonoptimal codon clusters 35–40 codons downstream of the SRP-binding site, the distance that spans the ribosomal polypeptide exit tunnel. A local translation slowdown upon ribosomal exit of SRP-binding elements in mRNAs containing these nonoptimal codon clusters is supported experimentally by ribosome profiling analyses in yeast. Modulation of local elongation rates through codon choice appears to kinetically enhance recognition by ribosome-associated factors. We propose that cotranslational regulation of nascent-chain fate may be a general constraint shaping codon usage in the genome. PMID:25420103

  20. Codon Optimisation Is Key for Pernisine Expression in Escherichia coli

    PubMed Central

    Šnajder, Marko; Miheli?, Marko; Turk, Dušan; Ulrih, Nataša Poklar

    2015-01-01

    Background Pernisine is an extracellular serine protease from the hyperthermophilic Archaeon Aeropyrum pernix K1. Low yields from the natural host and expression problems in heterologous hosts have limited the potential applications of pernisine in industry. Methodology/ Principal Findings The challenges of pernisine overexpression in Escherichia coli were overcome by codon preference optimisation and de-novo DNA synthesis. The following forms of the pernisine gene were cloned into the pMCSGx series of vectors and expressed in E. coli cells: wild-type (pernisinewt), codon-optimised (pernisineco), and codon-optimised with a S355A mutation of a predicted active site (pernisineS355Aco). The fusion-tagged pernisines were purified using fast protein liquid chromatography equipped with Ni2+ chelate and gel filtration chromatography columns. The identities of the resultant proteins were confirmed with N-terminal sequencing, tandem mass spectrometry analysis, and immunodetection. Pernisinewt was not expressed in E. coli at detectable levels, while pernisineco and pernisineS355Aco were expressed and purified as 55-kDa proforms with yields of around 10 mg per litre E. coli culture. After heat activation of purified pernisine, the proteolytic activity of the mature pernisineco was confirmed using zymography, at a molecular weight of 36 kDa, while the mutant pernisineS355Aco remained inactive. Enzymatic performances of pernisine evaluated under different temperatures and pHs demonstrate that the optimal enzymatic activity of the recombinant pernisine is ca. 100°C and pH 7.0, respectively. Conclusions/ Significance These data demonstrate that codon optimisation is crucial for pernisine overexpression in E. coli, and that the proposed catalytic Ser355 has an important role in pernisine activity, but not in its activation process. Pernisine is activated by autoproteolytical cleavage of its N-terminal proregion. We have also confirmed that the recombinant pernisine retains the characteristics of native pernisine, as a calcium modulated thermostable serine protease. PMID:25856104

  1. Utilization of internal AUG codons for initiation of protein synthesis directed by mRNAs from normal and mutant genes encoding herpes simplex virus-specified thymidine kinase.

    PubMed Central

    Haarr, L; Marsden, H S; Preston, C M; Smiley, J R; Summers, W C; Summers, W P

    1985-01-01

    Previous studies (H.S. Marsden, L. Haarr, and C.M. Preston, J. Virol. 46:434-445, 1983) have shown that at least three polypeptides, with molecular weights of 43,000, 39,000, and 38,000, are encoded by the herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) gene. It has been suggested that the 39,000- and 38,000-molecular-weight polypeptides arise from preinitiation complexes bypassing the first and second AUG codons before commencement of translation since, according to previous work (M. Kozak, Nucleic Acids Res. 9:5233-5252, 1981), these codons are not of the most efficient structure for initiation. This possibility was investigated by using specific herpes simplex virus mutants with alterations in the TK gene. Mutant TK4 has an amber mutation between the first and second AUG codons, whereas mutant delta 1 has a deletion which removes the first AUG codon but leaves other AUG codons, as well as transcriptional promoter sequences, intact. Both mutants synthesized only the 39,000- and 38,000-molecular-weight polypeptides, and the amounts produced were normal in TK4-infected cells but increased in delta 1-infected cells. Furthermore, the levels of TK produced after infection with the mutant viruses correlated with the amounts of the 39,000- and 38,000-molecular-weight polypeptides synthesized. The 43,000-, 39,000-, and 38,000-molecular-weight polypeptides were shown to be related by their positive reaction with anti-TK serum in both immunoprecipitation and immunoblotting experiments. The production of the 39,000- and 38,000-molecular-weight polypeptides through bypassing of the first AUG codon was examined by hybrid arrest experiments with a DNA fragment complementary to only 50 bases at the 5' terminus of TK mRNA. This fragment arrested the synthesis of the 30,000- and 38,000-molecular-weight polypeptides when annealed to mRNA from wild-type HSV-1- or TK4-infected cells, showing that those polypeptides arise from an mRNA initiated upstream from the first AUG codon. mRNA from cells infected with mutant delta 1, which lacks DNA sequences upstream from the first AUG, was not affected by the 50-base-pair fragment. The data therefore confirm that three polypeptides encoded by the HSV-1 TK gene arise by differential use of in-phase AUG codons for the initiation of protein synthesis. This mechanism for the production of related but distinct polypeptides has not previously been demonstrated in a eucaryotic system, and the implications for the regulation of TK enzyme activities are discussed. Images PMID:2997472

  2. Inducible suppression of global translation by overuse of rare codons.

    PubMed

    Kobayashi, Hideki

    2015-04-01

    Recently, artificial gene networks have been developed in synthetic biology to control gene expression and make organisms as controllable as robots. Here, I present an artificial posttranslational gene-silencing system based on the codon usage bias and low tRNA content corresponding to minor codons. I engineered the green fluorescent protein (GFP) gene to inhibit translation indirectly with the lowest-usage codons to monopolize various minor tRNAs (lgfp). The expression of lgfp interfered nonspecifically with the growth of Escherichia coli, Saccharomyces cerevisiae, human HeLa cervical cancer cells, MCF7 breast cancer cells, and HEK293 kidney cells, as well as phage and adenovirus expansion. Furthermore, insertion of lgfp downstream of a phage response promoter conferred phage resistance on E. coli. Such engineered gene silencers could act as components of biological networks capable of functioning with suitable promoters in E. coli, S. cerevisiae, and human cells to control gene expression. The results presented here show general suppressor artificial genes for live cells and viruses. This robust system provides a gene expression or cell growth control device for artificially synthesized gene networks. PMID:25636849

  3. Computational codon optimization of synthetic gene for protein expression

    PubMed Central

    2012-01-01

    Background The construction of customized nucleic acid sequences allows us to have greater flexibility in gene design for recombinant protein expression. Among the various parameters considered for such DNA sequence design, individual codon usage (ICU) has been implicated as one of the most crucial factors affecting mRNA translational efficiency. However, previous works have also reported the significant influence of codon pair usage, also known as codon context (CC), on the level of protein expression. Results In this study, we have developed novel computational procedures for evaluating the relative importance of optimizing ICU and CC for enhancing protein expression. By formulating appropriate mathematical expressions to quantify the ICU and CC fitness of a coding sequence, optimization procedures based on genetic algorithm were employed to maximize its ICU and/or CC fitness. Surprisingly, the in silico validation of the resultant optimized DNA sequences for Escherichia coli, Lactococcus lactis, Pichia pastoris and Saccharomyces cerevisiae suggests that CC is a more relevant design criterion than the commonly considered ICU. Conclusions The proposed CC optimization framework can complement and enhance the capabilities of current gene design tools, with potential applications to heterologous protein production and even vaccine development in synthetic biotechnology. PMID:23083100

  4. Evolution of Advection Upstream Splitting Method Schemes

    NASA Technical Reports Server (NTRS)

    Liou, Meng-Sing

    2010-01-01

    This paper focuses on the evolution of advection upstream splitting method(AUSM) schemes. The main ingredients that have led to the development of modern computational fluid dynamics (CFD) methods have been reviewed, thus the ideas behind AUSM. First and foremost is the concept of upwinding. Second, the use of Riemann problem in constructing the numerical flux in the finite-volume setting. Third, the necessity of including all physical processes, as characterised by the linear (convection) and nonlinear (acoustic) fields. Fourth, the realisation of separating the flux into convection and pressure fluxes. The rest of this review briefly outlines the technical evolution of AUSM and more details can be found in the cited references. Keywords: Computational fluid dynamics methods, hyperbolic systems, advection upstream splitting method, conservation laws, upwinding, CFD

  5. Admissible upstream conditions for slender compressible vortices

    NASA Technical Reports Server (NTRS)

    Liu, C. H.; Krause, E.; Menne, S.

    1986-01-01

    The influence of the compressibility on the flow in slender vortices is being studied. The dependence of the breakdown of the slender-vortex approximation on the upstream conditions is demonstrated for various Reynolds numbers and Mach numbers. Compatibility conditions, which have to be satisfied if the vortex is to remain slender, are discussed in detail. The general discussions are supplemented by several sample calculations.

  6. Bow Shock and Upstream Phenomena at Mars

    NASA Astrophysics Data System (ADS)

    Mazelle, C.; Winterhalter, D.; Sauer, K.; Trotignon, J. G.; Acuña, M. H.; Baumgärtel, K.; Bertucci, C.; Brain, D. A.; Brecht, S. H.; Delva, M.; Dubinin, E.; Øieroset, M.; Slavin, J.

    2004-03-01

    Mars Global Surveyor is the sixth spacecraft to return measurements of the Martian bow shock. The earlier missions were Mariner 4 (1964), Mars 2 and 3 (1972), Mars 5 (1975) and Phobos 2 (1989) (see reviews by Gringauz, 1981; Slavin and Holzer, 1982; Russell, 1985; Vaisberg, 1992a,b; Zakharov, 1992). Previous investigations of planetary bow shocks have established that their position, shape and jump conditions are functions of the upstream flow parameters and the nature of the solar wind — planet interaction (Spreiter and Stahara, 1980; Slavin et al., 1983; Russell, 1985). At Mars, however, the exact nature of the solar wind interaction was elusive due to the lack of low altitude plasma and magnetic field measurements (e.g., Axford, 1991). In fact our knowledge of the nature of the interaction of Mars with the solar wind was incomplete until the arrival of MGS and the acquisition of close-in magnetic field data (Acuña et al., 1998). As detailed by a series of review papers in this monograph, the Mars Global Surveyor (MGS) mission has now shown that the Mars environment is very complex with strong, highly structured crustal magnetic remnants in the southern hemisphere, while the northern hemisphere experiences the direct impingement of solar wind plasma. This review paper first presents a survey of the observations on the Martian bow shock and the upstream phenomena in the light of results from all the missions to date. It also discusses the kinetic properties of the Martian bow shock compared to the predictions of simulations studies. Then it examines the current status of understanding of these phenomena, including the possible sources of upstream low-frequency waves and the interpretations of localized disturbances in the upstream solar wind around Mars. Finally, it briefly discusses the open issues and questions that require further study.

  7. Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

    Microsoft Academic Search

    R. Medori; H. J. Tritschler

    1993-01-01

    Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of

  8. [Analysis of codon usage in potato and its application in the modification of t-PA gene].

    PubMed

    Bai, Xi; Xu, Jian-Zhen; Li, Lin; Guo, Zheng; Li, Jie; Zhu, Yan-Ming

    2004-01-01

    Bioperl-1.0 was used under Hongqi LINUX system to program the codon analysis software. According to the analysis of 98 codon DNA sequences with this software, the codon usage in potato was calculated and 4 codons have been inferred to the optimal codons. The codons of tissue plasminogen activator (t-PA) gene sequence have been reconstructed according to the results. The t-PA gene sequence containing the optimal codons of potato will be used for t-PA production by potato bioreactor. PMID:15626672

  9. Mapping codon usage in sequence regions flanking cleavage positions in the hepatitis A virus polyprotein.

    PubMed

    Ma, X-X; Feng, Y-P; Chen, L; Zhao, Y-Q; Liu, J-L; Guo, J-Z; Guo, P-H; Yang, J-T; Lu, J-X; Chen, S-E; Ma, Z-R

    2013-01-01

    To analyze the synonymous codon usage patterns of sequence regions flanking cleavage sites in the hepatitis A virus (HAV) polyprotein, the codon usage bias at codon positions and the synonymous codon usage in the target contexts of 30 virus strains were estimated by two simple methods that were based on the values for relative synonymous codon usage. In addition, the pattern of synonymous codon usage was compared between the genomic sequences in HAV and those of its human host. Our results indicated that HAV adopts a combination of coincidence and antagonism with the synonymous codon usage in humans. This characteristic may help HAV to efficiently use the translational machinery in its human host. We also observed that codon usage exhibited a strong bias in some specific positions in these contexts, and that the underrepresented synonymous codons, CUA for Leu, ACG for Thr, GUA for Val, and UCG for Ser, are preferentially used in these positions. These underrepresented synonymous codons likely play roles in regulating the rate of protein translation and influencing the secondary structure of the sequence regions flanking the cleavage sites. PMID:23884773

  10. Control of translation efficiency in yeast by codon-anticodon interactions.

    PubMed

    Letzring, Daniel P; Dean, Kimberly M; Grayhack, Elizabeth J

    2010-12-01

    The choice of synonymous codons used to encode a polypeptide contributes to substantial differences in translation efficiency between genes. However, both the magnitude and the mechanisms of codon-mediated effects are unknown, as neither the effects of individual codons nor the parameters that modulate codon-mediated regulation are understood, particularly in eukaryotes. To explore this problem in Saccharomyces cerevisiae, we performed the first systematic analysis of codon effects on expression. We find that the arginine codon CGA is strongly inhibitory, resulting in progressively and sharply reduced expression with increased CGA codon dosage. CGA-mediated inhibition of expression is primarily due to wobble decoding of CGA, since it is nearly completely suppressed by coexpression of an exact match anticodon-mutated tRNA(Arg(UCG)), and is associated with generation of a smaller RNA fragment, likely due to endonucleolytic cleavage at a stalled ribosome. Moreover, CGA codon pairs are more effective inhibitors of expression than individual CGA codons. These results directly implicate decoding by the ribosome and interactions at neighboring sites within the ribosome as mediators of codon-specific translation efficiency. PMID:20971810

  11. Patterns of Synonymous Codon Usage on Human Metapneumovirus and Its Influencing Factors

    PubMed Central

    Zhong, Qiao; Xu, Weidong; Wu, Yuanjian; Xu, Hongxing

    2012-01-01

    Human metapneumovirus (HMPV) is an important agent of acute respiratory tract infection in children, while its pathogenicity and molecular evolution are lacking. Herein, we firstly report the synonymous codon usage patterns of HMPV genome. The relative synonymous codon usage (RSCU) values, effective number of codon (ENC) values, nucleotide contents, and correlation analysis were performed among 17 available whole genome of HMPV, including different genotypes. All preferred codons in HMPV are ended with A/U nucleotide and exhibited a great association with its high proportion of these two nucleotides in their genomes. Mutation pressure rather than natural selection is the main influence factor that determines the bias of synonymous codon usage in HMPV. The complementary pattern of codon usage bias between HMPV and human cell was observed, and this phenomenon suggests that host cells might be also act as an important factor to affect the codon usage bias. Moreover, the codon usage biases in each HMPV genotypes are separated into different clades, which suggest that phylogenetic distance might involve in codon usage bias formation as well. These analyses of synonymous codon usage bias in HMPV provide more information for better understanding its evolution and pathogenicity. PMID:23193361

  12. Characterization of Codon usage bias in the newly identified DEV UL18 gene

    NASA Astrophysics Data System (ADS)

    Chen, Xiwen; Cheng, Anchun; Wang, Mingshu; Xiang, Jun

    2011-10-01

    In this study, Codon usage bias (CUB) of DEV UL18 gene was analyzed, the results showed that codon usage bias in the DEV UL18 gene was strong bias towards the synonymous codons with A and T at the third codon position. Phylogenetic tree based on the amino acid sequences of the DEV UL18 gene and the 27 other herpesviruses revealed that UL18 gene of the DEV CHv strain and some fowl herpesviruses such as MeHV-1, GaHV-2 and GaHV-3 were clustered within a monophyletic clade and grouped within alphaherpesvirinae. The ENC-GC3S plot indicated that codon usage bias has strong species-specificity between DEV and 27 reference herpesviruses, and suggests that factors other than gene composition, such as translational selection leading to the codon usage variation among genes in different organisms, contribute to the codon usage among the different herpesviruses. Comparison of codon preferences of DEV UL18 gene with those of E. coli , yeast and humans showed that there were 20 codons showing distinct usage differences between DEV UL18 and yeast, 22 between DEV UL18 and humans, 23 between DEV UL18 and E.coli, which indicated the codon usage bias pattern in the DEV UL18 gene was similar to that of yeast. It is infered that the yeast expression system may be more suitable for the DEV UL18 expression.

  13. Pandemic influenza A virus codon usage revisited: biases, adaptation and implications for vaccine strain development

    PubMed Central

    2012-01-01

    Background Influenza A virus (IAV) is a member of the family Orthomyxoviridae and contains eight segments of a single-stranded RNA genome with negative polarity. The first influenza pandemic of this century was declared in April of 2009, with the emergence of a novel H1N1 IAV strain (H1N1pdm) in Mexico and USA. Understanding the extent and causes of biases in codon usage is essential to the understanding of viral evolution. A comprehensive study to investigate the effect of selection pressure imposed by the human host on the codon usage of an emerging, pandemic IAV strain and the trends in viral codon usage involved over the pandemic time period is much needed. Results We performed a comprehensive codon usage analysis of 310 IAV strains from the pandemic of 2009. Highly biased codon usage for Ala, Arg, Pro, Thr and Ser were found. Codon usage is strongly influenced by underlying biases in base composition. When correspondence analysis (COA) on relative synonymous codon usage (RSCU) is applied, the distribution of IAV ORFs in the plane defined by the first two major dimensional factors showed that different strains are located at different places, suggesting that IAV codon usage also reflects an evolutionary process. Conclusions A general association between codon usage bias, base composition and poor adaptation of the virus to the respective host tRNA pool, suggests that mutational pressure is the main force shaping H1N1 pdm IAV codon usage. A dynamic process is observed in the variation of codon usage of the strains enrolled in these studies. These results suggest a balance of mutational bias and natural selection, which allow the virus to explore and re-adapt its codon usage to different environments. Recoding of IAV taking into account codon bias, base composition and adaptation to host tRNA may provide important clues to develop new and appropriate vaccines. PMID:23134595

  14. Traffic-flow-prediction systems based on upstream traffic

    Microsoft Academic Search

    A. G. Hobeika; Chang Kyun Kim

    1994-01-01

    Network-based model were developed to predict short term future traffic volume based on current traffic, historical average, and upstream traffic. It is presumed that upstream traffic volume can be used to predict the downstream traffic in a specific time period. Three models are developed for traffic flow prediction: a combination of historical average and upstream traffic, a combination of current

  15. Sequences Required for Paramutation of the Maize B Gene Map to a Region Containing the Promoter and Upstream Sequences

    PubMed Central

    Patterson, G. I.; Kubo, K. M.; Shroyer, T.; Chandler, V. L.

    1995-01-01

    The b gene encodes a transcriptional regulator of the maize anthocyanin biosynthetic pathway. Certain b alleles participate in paramutation, an allele-specific interaction that heritably alters transcription. The moderately transcribed B' allele heritably reduces the transcription of the highly transcribed B-I allele in a B'/B-I heterozygote, such that the B-I allele becomes B'. To identify the cis-acting sequences required for paramutation, we used B' or B-I alleles to isolate intragenic recombinants with B-Peru, an allele that is insensitive to paramutation and has distinct tissue-specific regulation. Physical mapping of the recombinant alleles showed that most of the crossovers were in a small region near the 5' end of the b-transcribed region. Analysis of the recombinant alleles revealed that the ability to cause and respond to paramutation and the control of tissue-specific expression both localize to the 5' region of the gene. The 3' boundary of these functions lies just upstream of the translation initiation codon. The 5' boundary has been estimated to be no more than 0.1 cM further upstream (1-150 kb). Thus, sequences critical for paramutation lie upstream of the b coding sequences and may include transcriptional regulatory sequences. PMID:7498778

  16. Manufacturing Technician-Upstream: John Condosta

    NSDL National Science Digital Library

    This online video in Windows Media (wmv) format is a brief lecture from a biopharmaceutical manufacturing operator about his job experience. John Condosta was a microbiology major in college and now enjoys working 12-hour days in upstream processing. He gives advice about job searching, resumes, and how to interview before taking questions from the audience. He describes his typical day working with fermentation or purification. Everyday is a new learning experience for him due to new products and new processes. This video would be useful for college or technical students who are interested in hearing a firsthand account of the work-life in the field of biopharmaceutics and bio-manufacturing.

  17. Comparative Analysis of Codon Usage Bias Patterns in Microsporidian Genomes

    PubMed Central

    Xiang, Heng; Zhang, Ruizhi; Butler, Robert R.; Liu, Tie; Zhang, Li; Pombert, Jean-François; Zhou, Zeyang

    2015-01-01

    The sub-3 Mbp genomes from microsporidian species of the Encephalitozoon genus are the smallest known among eukaryotes and paragons of genomic reduction and compaction in parasites. However, their diminutive stature is not characteristic of all Microsporidia, whose genome sizes vary by an order of magnitude. This large variability suggests that different evolutionary forces are applied on the group as a whole. In this study, we have compared the codon usage bias (CUB) between eight taxonomically distinct microsporidian genomes: Encephalitozoon intestinalis, Encephalitozoon cuniculi, Spraguea lophii, Trachipleistophora hominis, Enterocytozoon bieneusi, Nematocida parisii, Nosema bombycis and Nosema ceranae. While the CUB was found to be weak in all eight Microsporidia, nearly all (98%) of the optimal codons in S. lophii, T. hominis, E. bieneusi, N. parisii, N. bombycis and N. ceranae are fond of A/U in third position whereas most (64.6%) optimal codons in the Encephalitozoon species E. intestinalis and E. cuniculi are biased towards G/C. Although nucleotide composition biases are likely the main factor driving the CUB in Microsporidia according to correlation analyses, directed mutational pressure also likely affects the CUB as suggested by ENc-plots, correspondence and neutrality analyses. Overall, the Encephalitozoon genomes were found to be markedly different from the other microsporidians and, despite being the first sequenced representatives of this lineage, are uncharacteristic of the group as a whole. The disparities observed cannot be attributed solely to differences in host specificity and we hypothesize that other forces are at play in the lineage leading to Encephalitozoon species. PMID:26057384

  18. Exploring codon context bias for synthetic gene design of a thermostable invertase in Escherichia coli.

    PubMed

    Pek, Han Bin; Klement, Maximilian; Ang, Kok Siong; Chung, Bevan Kai-Sheng; Ow, Dave Siak-Wei; Lee, Dong-Yup

    2015-01-01

    Various isoforms of invertases from prokaryotes, fungi, and higher plants has been expressed in Escherichia coli, and codon optimisation is a widely-adopted strategy for improvement of heterologous enzyme expression. Successful synthetic gene design for recombinant protein expression can be done by matching its translational elongation rate against heterologous host organisms via codon optimization. Amongst the various design parameters considered for the gene synthesis, codon context bias has been relatively overlooked compared to individual codon usage which is commonly adopted in most of codon optimization tools. In addition, matching the rates of transcription and translation based on secondary structure may lead to enhanced protein folding. In this study, we evaluated codon context fitness as design criterion for improving the expression of thermostable invertase from Thermotoga maritima in Escherichia coli and explored the relevance of secondary structure regions for folding and expression. We designed three coding sequences by using (1) a commercial vendor optimized gene algorithm, (2) codon context for the whole gene, and (3) codon context based on the secondary structure regions. Then, the codon optimized sequences were transformed and expressed in E. coli. From the resultant enzyme activities and protein yield data, codon context fitness proved to have the highest activity as compared to the wild-type control and other criteria while secondary structure-based strategy is comparable to the control. Codon context bias was shown to be a relevant parameter for enhancing enzyme production in Escherichia coli by codon optimization. Thus, we can effectively design synthetic genes within heterologous host organisms using this criterion. PMID:26047917

  19. Why Are Translationally SubOptimal Synonymous Codons Used in Escherichia coli ?

    Microsoft Academic Search

    Nick G. C. Smith; Adam Eyre-Walker

    2001-01-01

    .   Natural selection favors certain synonymous codons which aid translation in Escherichia coli, yet codons not favored by translational selection persist. We use the frequency distributions of synonymous polymorphisms\\u000a to test three hypotheses for the existence of translationally sub-optimal codons: (1) selection is a relatively weak force,\\u000a so there is a balance between mutation, selection, and drift; (2) at some

  20. Decoding properties of tRNA leave a detectable signal in codon usage bias

    PubMed Central

    Roth, Alexander C.

    2012-01-01

    Motivation: The standard genetic code translates 61 codons into 20 amino acids using fewer than 61 transfer RNAs (tRNAs). This is possible because of the tRNA's ability to ‘wobble’ at the third base to decode more than one codon. Although the anticodon–codon mapping of tRNA to mRNA is a prerequisite for certain codon usage indices and can contribute to the understanding of the evolution of alternative genetic codes, it is usually not determined experimentally because such assays are prohibitively expensive and elaborate. Instead, the codon reading is approximated from theoretical inferences of nucleotide binding, the wobble rules. Unfortunately, these rules fail to capture all of the nuances of codon reading. This study addresses the codon reading properties of tRNAs and their evolutionary impact on codon usage bias. Results: Using three different computational methods, the signal of tRNA decoding in codon usage bias is identified. The predictions by the methods generally agree with each other and compare well with experimental evidence of codon reading. This analysis suggests a revised codon reading for cytosolic tRNA in the yeast genome (Saccharomyces cerevisiae) that is more accurate than the common assignment by wobble rules. The results confirm the earlier observation that the wobble rules are not sufficient for a complete description of codon reading, because they depend on genome-specific factors. The computational methods presented here are applicable to any fully sequenced genome. Availability: By request from the author. Contact: alexander.roth@isb-sib.ch PMID:22962450

  1. Synonymous Codon Usage in TTSuV2: Analysis and Comparison with TTSuV1

    PubMed Central

    Dai, Dingzhen

    2013-01-01

    Two species of the DNA virus Torque teno sus virus (TTSuV), TTSuV1 and TTSuV2, have become widely distributed in pig-farming countries in recent years. In this study, we performed a comprehensive analysis of synonymous codon usage bias in 41 available TTSuV2 coding sequences (CDS), and compared the codon usage patterns of TTSuV2 and TTSuV1. TTSuV codon usage patterns were found to be phylogenetically conserved. Values for the effective number of codons (ENC) indicated that the overall extent of codon usage bias in both TTSuV2 and TTSuV1 was not significant, the most frequently occurring codons had an A or C at the third codon position. Correspondence analysis (COA) was performed and TTSuV2 and TTSuV1 sequences were located in different quadrants of the first two major axes. A plot of the ENC revealed that compositional constraint was the major factor determining the codon usage bias for TTSuV2. In addition, hierarchical cluster analysis of 41 TTSuV2 isolates based on relative synonymous codon usage (RSCU) values suggested that there was no association between geographic distribution and codon bias of TTSuV2 sequences. Finally, the comparison of RSCU for TTSuV2, TTSuV1 and the corresponding host sequence indicated that the codon usage pattern of TTSuV2 was similar to that of TTSuV1. However the similarity was low for each virus and its host. These conclusions provide important insight into the synonymous codon usage pattern of TTSuV2, as well as better understangding of the molecular evolution of TTSuV2 genomes. PMID:24303050

  2. Do anticodons of misacylated tRNAs preferentially mismatch codons coding for the misloaded amino acid?

    Microsoft Academic Search

    Hervé Seligmann

    2010-01-01

    BACKGROUND: Accurate amino acid insertion during peptide elongation requires tRNAs loaded by cognate amino acids and that anticodons match codons. However, tRNA misloading does not necessarily cause misinsertions: misinsertion is avoided when anticodons mismatch codons coding for misloaded amino acids. PRESENTATION OF THE HYPOTHESIS: Occasional compensation of misacylation by codon-anticodon mismatch necessarily occurs. Putatively, occasional error compensation may be enhanced

  3. Features of Recent Codon Evolution: A Comparative Polymorphism-Fixation Study

    PubMed Central

    Zhao, Zhongming; Jiang, Cizhong

    2010-01-01

    Features of amino-acid and codon changes can provide us important insights on protein evolution. So far, investigators have often examined mutation patterns at either interspecies fixed substitution or intraspecies nucleotide polymorphism level, but not both. Here, we performed a unique analysis of a combined set of intra-species polymorphisms and inter-species substitutions in human codons. Strong difference in mutational pattern was found at codon positions 1, 2, and 3 between the polymorphism and fixation data. Fixation had strong bias towards increasing the rarest codons but decreasing the most frequently used codons, suggesting that codon equilibrium has not been reached yet. We detected strong CpG effect on CG-containing codons and subsequent suppression by fixation. Finally, we detected the signature of purifying selection against A?U dinucleotides at synonymous dicodon boundaries. Overall, fixation process could effectively and quickly correct the volatile changes introduced by polymorphisms so that codon changes could be gradual and directional and that codon composition could be kept relatively stable during evolution. PMID:20622912

  4. Control of ribosome traffic by position-dependent choice of synonymous codons

    E-print Network

    Namiko Mitarai; Steen Pedersen

    2013-09-04

    Messenger RNA encodes a sequence of amino acids by using codons. For most amino acids there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the messenger RNA (mRNA) but also might have an effect on nearby ribosomes by affecting the appearance of "traffic jams" where multiple ribosomes collide and form queues. To test this "context effect" further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild type sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the wild type sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  5. Features of recent codon evolution: a comparative polymorphism-fixation study.

    PubMed

    Zhao, Zhongming; Jiang, Cizhong

    2010-01-01

    Features of amino-acid and codon changes can provide us important insights on protein evolution. So far, investigators have often examined mutation patterns at either interspecies fixed substitution or intraspecies nucleotide polymorphism level, but not both. Here, we performed a unique analysis of a combined set of intra-species polymorphisms and inter-species substitutions in human codons. Strong difference in mutational pattern was found at codon positions 1, 2, and 3 between the polymorphism and fixation data. Fixation had strong bias towards increasing the rarest codons but decreasing the most frequently used codons, suggesting that codon equilibrium has not been reached yet. We detected strong CpG effect on CG-containing codons and subsequent suppression by fixation. Finally, we detected the signature of purifying selection against Amid R:U dinucleotides at synonymous dicodon boundaries. Overall, fixation process could effectively and quickly correct the volatile changes introduced by polymorphisms so that codon changes could be gradual and directional and that codon composition could be kept relatively stable during evolution. PMID:20622912

  6. A Study of the purine\\/pyrimidine codon occurrence with a reduced centered variable and an evaluation compared to the frequency statistic

    Microsoft Academic Search

    CHRISTIAN J. MICHEL

    1989-01-01

    With the three-letter alphabet {R,Y,N} (R = purine, Y = pyrimidine, N= R or Y), there are 26 codons (NNN being excluded): RNN, . ,NNY (six codons at two unspecified bases N), RRN,. ,NYY (12 codons at one unspecified base N), RRR ,.._, YYY (eight specified codons). A statistical methodology that uses the codon frequency and a reduced centered variable

  7. Structural polymers in upstream production service

    SciTech Connect

    Dismukes, J.P.; Lustiger, A.; Chang, J.; Abrams, P.I.; Chiu, A.S. [Exxon Res. & Eng. Co., Annadale, NJ (United States)

    1993-12-31

    Polymers in the form of coatings, seals and composites for corrosion resistant and secondary load-bearing applications have been used in oilfield production operations for a number of years in specialty applications. The increasing needs of the industry for corrosion resistant piping, and for structural components combining corrosion resistance with high specific strength and weight, have now made the potential for use of polymer composites of increasing interest, for pipe and tubing and for load-bearing structural members. The purpose of this paper is to review the current status of structural polymer usage in the upstream, and to highlight major application areas where there is a strong economic incentive to evaluate the benefits for applying polymer composite. In addition, the underlying science and technology affecting composite properties, application life, environmental resistance and economics are assessed, since these issues need to be addressed in considering the decision to design-in composites, as compared to commonly used metals and alloys.

  8. Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

    SciTech Connect

    Medori, R.; Tritschler, H.J. (Universita di Bologna (Italy))

    1993-10-01

    Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of French ancestry. Three family members who are under 40 years of age and who inherited the mutation showed only reduced perfusion in the basal ganglia on single photon emission computerized tomography. Some FFI features differ from the clinical and neuropathologic findings associated with 178[sup Asn] reported elsewhere. However, additional intragenic mutations accounting for the phenotypic differences were not observed in two affected individuals. In other sporadic and familial forms of Creutzfeldt-Jakob disease and Gerstmann-Straeussler syndrome, Met or Val homozygosity at polymorphic codon 129 is associated with a more severe phenotype, younger age at onset, and faster progression. In FFI, young and old individuals at disease onset had 129[sup Met/Val]. Moreover, of five 178[sup Asn] individuals who are above age-at-onset range and who are well, two have 129[sup Met] and three have 129[sup Met/Val], suggesting that polymorphic site 129 does not modulate FFI phenotypic expression. Genetic heterogeneity and environment may play an important role in inter- and intrafamilial variability of the 178[sup Asn] mutation. 32 refs., 5 figs., 1 tab.

  9. tRNA 1 Ser(G 34) with the anticodon GGA can recognize not only UCC and UCU codons but also UCA and UCG codons

    Microsoft Academic Search

    Yuko Yamada; Jitsuhiro Matsugi; Hisayuki Ishikura

    2003-01-01

    The tRNA1Ser (anticodon VGA, V=uridin-5-oxyacetic acid) is essential for translation of the UCA codon in Escherichia coli. Here, we studied the translational abilities of serine tRNA derivatives, which have different bases from wild type at the first positions of their anticodons, using synthetic mRNAs containing the UCN (N=A, G, C, or U) codon. The tRNA1Ser(G34) having the anticodon GGA was

  10. Translational Termination Efficiency in Mammals is Influenced by the Base Following the Stop Codon

    Microsoft Academic Search

    Kim K. McCaughan; Chris M. Brown; Mark E. Dalphin; Marla J. Berry; Warren P. Tate

    1995-01-01

    The base following stop codons in mammalian genes is strongly biased, suggesting that it might be important for the termination event. This proposal has been tested experimentally both in vivo by using the human type I iodothyronine deiodinase mRNA and the recoding event at the internal UGA codon and in vitro by measuring the ability of each of the 12

  11. Why Are Translationally Sub-Optimal Synonymous Codons Used in Escherichia coli?

    E-print Network

    Eyre-Walker, Adam

    Why Are Translationally Sub-Optimal Synonymous Codons Used in Escherichia coli? Nick G.C. Smith, Adam Eyre-Walker Centre for the Study of Evolution and School of Biological Sciences, University still be referred to as a sub-optimal codon.Correspondence to: N.G.C. Smith; email: n.g.c.smith

  12. Comprehensive analysis of the overall codon usage patterns in equine infectious anemia virus

    PubMed Central

    2013-01-01

    Background Equine infectious anemia virus (EIAV) is an important animal model for understanding the relationship between viral persistence and the host immune response during lentiviral infections. Comparison and analysis of the codon usage model between EIAV and its hosts is important for the comprehension of viral evolution. In our study, the codon usage pattern of EIAV was analyzed from the available 29 full-length EIAV genomes through multivariate statistical methods. Finding Effective number of codons (ENC) suggests that the codon usage among EIAV strains is slightly biased. The ENC-plot analysis demonstrates that mutation pressure plays a substantial role in the codon usage pattern of EIAV, whereas other factors such as geographic distribution and host translation selection also take part in the process of EIAV evolution. Comparative analysis of codon adaptation index (CAI) values among EIAV and its hosts suggests that EIAV utilize the translational resources of horse more efficiently than that of donkey. Conclusion The codon usage bias in EIAV is slight and mutation pressure is the main factor that affects codon usage variation in EIAV. These results suggest that EIAV genomic biases are the result of the co-evolution of genome composition and the ability to evade the host’s immune response. PMID:24359511

  13. Compositional Correlation Studies among the Three Different Codon Positions in 12 Bacterial Genomes

    Microsoft Academic Search

    S. Majumdar; S. K. Gupta; V. S. Sundararajan; T. C. Ghosh

    1999-01-01

    Compositional distributions in the three codon positions of the coding sequences of 12 fully sequenced prokaryotic genomes, which are publicly available, were investigated. A universal compositional correlation was observed in most of the genomes under investigation irrespective of their overall genomic GC contents. In all the genomes, the GC contents at the first codon positions are always greater than the

  14. Lie superalgebras and the multiplet structure of the genetic code. I. Codon representations

    E-print Network

    Forger, Frank Michael

    a table connecting codons base triplets with the amino acids they represent, but a complete understand that the degeneracy of the genetic code, i.e., the phenomenon that different codons base triplets of DNA are transcribed into the same amino acid, may be interpreted as the result of a symmetry breaking process

  15. The Effect of Mutation and Selection on Codon Adaptation in Escherichia coli Bacteriophage

    PubMed Central

    Chithambaram, Shivapriya; Prabhakaran, Ramanandan; Xia, Xuhua

    2014-01-01

    Studying phage codon adaptation is important not only for understanding the process of translation elongation, but also for reengineering phages for medical and industrial purposes. To evaluate the effect of mutation and selection on phage codon usage, we developed an index to measure selection imposed by host translation machinery, based on the difference in codon usage between all host genes and highly expressed host genes. We developed linear and nonlinear models to estimate the C?T mutation bias in different phage lineages and to evaluate the relative effect of mutation and host selection on phage codon usage. C?T-biased mutations occur more frequently in single-stranded DNA (ssDNA) phages than in double-stranded DNA (dsDNA) phages and affect not only synonymous codon usage, but also nonsynonymous substitutions at second codon positions, especially in ssDNA phages. The host translation machinery affects codon adaptation in both dsDNA and ssDNA phages, with a stronger effect on dsDNA phages than on ssDNA phages. Strand asymmetry with the associated local variation in mutation bias can significantly interfere with codon adaptation in both dsDNA and ssDNA phages. PMID:24583580

  16. Analysis of codon use features of stearoyl-acyl carrier protein desaturase gene in Camellia sinensis.

    PubMed

    Pan, Lu-Lu; Wang, Yu; Hu, Jian-Hui; Ding, Zhao-Tang; Li, Chen

    2013-10-01

    The stearoyl-acyl carrier protein desaturase (SAD) gene widely exists in all kinds of plants. In this paper, the Camellia sinensis SAD gene (CsSAD) sequence was firstly analyzed by Codon W, CHIPS, and CUSP programs online, and then compared with genomes of the tea plant, other species and SAD genes from 11 plant species. The results show that the CsSAD gene and the selected 73 of C. sinensis genes have similar codon usage bias. The CsSAD gene has a bias toward the synonymous codons with A and T at the third codon position, the same as the 73 of C. sinensis genes. Compared with monocotyledons such as Triticum aestivum and Zea mays, the differences in codon usage frequency between the CsSAD gene and dicotyledons such as Arabidopsis thaliana and Nicotiana tobacum are less. Therefore, A. thaliana and N. tobacum expression systems may be more suitable for the expression of the CsSAD gene. The analysis result of SAD genes from 12 plant species also shows that most of the SAD genes are biased toward the synonymous codons with G and C at the third codon position. We believe that the codon usage bias analysis presented in this study will be essential for providing a theoretical basis for discussing the structure and function of the CsSAD gene. PMID:23774066

  17. Toward the experimental codon reassignment in vivo: protein building with an expanded amino acid repertoire

    Microsoft Academic Search

    NEDILJKO BUDISA; CAROLINE MINKS; STEFAN ALEFELDER; WALTRAUD WENGER; FUMIN DONG; LUIS MORODER; ROBERT HUBER

    The high precision and fidelity of the genetic message transmission are ensured by numer- ous proofreading steps, from DNA replication and transcription to protein translation. The key event for translational fidelity is the proper codon assignment for 20 canonical amino acids. An experimental codon reassignment is possible for noncanonical amino ac- ids in vivo using artificially constructed expression hosts under

  18. A General Model of Codon Bias Due to GC Mutational Gareth A. Palidwor1

    E-print Network

    Xia, Xuhua

    A General Model of Codon Bias Due to GC Mutational Bias Gareth A. Palidwor1 *, Theodore J. Perkins1 synonymous GC content changing substitutions in the third codon position, the overall GC bias of a genome or genomic region is highly correlated with GC3, a measure of third position GC content. For individual amino

  19. Probable relationship between partitions of the set of codons and the origin of the genetic code.

    PubMed

    Salinas, Dino G; Gallardo, Mauricio O; Osorio, Manuel I

    2014-03-01

    Here we study the distribution of randomly generated partitions of the set of amino acid-coding codons. Some results are an application from a previous work, about the Stirling numbers of the second kind and triplet codes, both to the cases of triplet codes having four stop codons, as in mammalian mitochondrial genetic code, and hypothetical doublet codes. Extending previous results, in this work it is found that the most probable number of blocks of synonymous codons, in a genetic code, is similar to the number of amino acids when there are four stop codons, as well as it could be for a primigenious doublet code. Also it is studied the integer partitions associated to patterns of synonymous codons and it is shown, for the canonical code, that the standard deviation inside an integer partition is one of the most probable. We think that, in some early epoch, the genetic code might have had a maximum of the disorder or entropy, independent of the assignment between codons and amino acids, reaching a state similar to "code freeze" proposed by Francis Crick. In later stages, maybe deterministic rules have reassigned codons to amino acids, forming the natural codes, such as the canonical code, but keeping the numerical features describing the set partitions and the integer partitions, like a "fossil numbers"; both kinds of partitions about the set of amino acid-coding codons. PMID:24495914

  20. Housekeeping genes tend to show reduced upstream sequence conservation

    PubMed Central

    Farré, Domènec; Bellora, Nicolás; Mularoni, Loris; Messeguer, Xavier; Albà, M Mar

    2007-01-01

    Background Understanding the constraints that operate in mammalian gene promoter sequences is of key importance to understand the evolution of gene regulatory networks. The level of promoter conservation varies greatly across orthologous genes, denoting differences in the strength of the evolutionary constraints. Here we test the hypothesis that the number of tissues in which a gene is expressed is related in a significant manner to the extent of promoter sequence conservation. Results We show that mammalian housekeeping genes, expressed in all or nearly all tissues, show significantly lower promoter sequence conservation, especially upstream of position -500 with respect to the transcription start site, than genes expressed in a subset of tissues. In addition, we evaluate the effect of gene function, CpG island content and protein evolutionary rate on promoter sequence conservation. Finally, we identify a subset of transcription factors that bind to motifs that are specifically over-represented in housekeeping gene promoters. Conclusion This is the first report that shows that the promoters of housekeeping genes show reduced sequence conservation with respect to genes expressed in a more tissue-restricted manner. This is likely to be related to simpler gene expression, requiring a smaller number of functional cis-regulatory motifs. PMID:17626644

  1. Expression of human Hemojuvelin (HJV) is tightly regulated by two upstream open reading frames in HJV mRNA that respond to iron overload in hepatic cells.

    PubMed

    Onofre, Cláudia; Tomé, Filipa; Barbosa, Cristina; Silva, Ana Luísa; Romão, Luísa

    2015-04-01

    The gene encoding human hemojuvelin (HJV) is one of the genes that, when mutated, can cause juvenile hemochromatosis, an early-onset inherited disorder associated with iron overload. The 5' untranslated region of the human HJV mRNA has two upstream open reading frames (uORFs), with 28 and 19 codons formed by two upstream AUGs (uAUGs) sharing the same in-frame stop codon. Here we show that these uORFs decrease the translational efficiency of the downstream main ORF in HeLa and HepG2 cells. Indeed, ribosomal access to the main AUG is conditioned by the strong uAUG context, which results in the first uORF being translated most frequently. The reach of the main ORF is then achieved by ribosomes that resume scanning after uORF translation. Furthermore, the amino acid sequences of the uORF-encoded peptides also reinforce the translational repression of the main ORF. Interestingly, when iron levels increase, translational repression is relieved specifically in hepatic cells. The upregulation of protein levels occurs along with phosphorylation of the eukaryotic initiation factor 2?. Nevertheless, our results support a model in which the increasing recognition of the main AUG is mediated by a tissue-specific factor that promotes uORF bypass. These results support a tight HJV translational regulation involved in iron homeostasis. PMID:25666510

  2. Evidence for stabilizing selection on codon usage in chromosomal rearrangements of Drosophila pseudoobscura.

    PubMed

    Fuller, Zachary L; Haynes, Gwilym D; Zhu, Dianhui; Batterton, Matthew; Chao, Hsu; Dugan, Shannon; Javaid, Mehwish; Jayaseelan, Joy C; Lee, Sandra; Li, Mingmei; Ongeri, Fiona; Qi, Sulan; Han, Yi; Doddapaneni, Harshavardhan; Richards, Stephen; Schaeffer, Stephen W

    2014-12-01

    There has been a renewed interest in investigating the role of stabilizing selection acting on genome-wide traits such as codon usage bias. Codon bias, when synonymous codons are used at unequal frequencies, occurs in a wide variety of taxa. Standard evolutionary models explain the maintenance of codon bias through a balance of genetic drift, mutation and weak purifying selection. The efficacy of selection is expected to be reduced in regions of suppressed recombination. Contrary to observations in Drosophila melanogaster, some recent studies have failed to detect a relationship between the recombination rate, intensity of selection acting at synonymous sites, and the magnitude of codon bias as predicted under these standard models. Here, we examined codon bias in 2798 protein coding loci on the third chromosome of D. pseudoobscura using whole-genome sequences of 47 individuals, representing five common third chromosome gene arrangements. Fine-scale recombination maps were constructed using more than 1 million segregating sites. As expected, recombination was demonstrated to be significantly suppressed between chromosome arrangements, allowing for a direct examination of the relationship between recombination, selection, and codon bias. As with other Drosophila species, we observe a strong mutational bias away from the most frequently used codons. We find the rate of synonymous and nonsynonymous polymorphism is variable between different amino acids. However, we do not observe a reduction in codon bias or the strength of selection in regions of suppressed recombination as expected. Instead, we find that the interaction between weak stabilizing selection and mutational bias likely plays a role in shaping the composition of synonymous codons across the third chromosome in D. pseudoobscura. PMID:25326424

  3. Evidence for Stabilizing Selection on Codon Usage in Chromosomal Rearrangements of Drosophila pseudoobscura

    PubMed Central

    Fuller, Zachary L.; Haynes, Gwilym D.; Zhu, Dianhui; Batterton, Matthew; Chao, Hsu; Dugan, Shannon; Javaid, Mehwish; Jayaseelan, Joy C.; Lee, Sandra; Li, Mingmei; Ongeri, Fiona; Qi, Sulan; Han, Yi; Doddapaneni, Harshavardhan; Richards, Stephen; Schaeffer, Stephen W.

    2014-01-01

    There has been a renewed interest in investigating the role of stabilizing selection acting on genome-wide traits such as codon usage bias. Codon bias, when synonymous codons are used at unequal frequencies, occurs in a wide variety of taxa. Standard evolutionary models explain the maintenance of codon bias through a balance of genetic drift, mutation and weak purifying selection. The efficacy of selection is expected to be reduced in regions of suppressed recombination. Contrary to observations in Drosophila melanogaster, some recent studies have failed to detect a relationship between the recombination rate, intensity of selection acting at synonymous sites, and the magnitude of codon bias as predicted under these standard models. Here, we examined codon bias in 2798 protein coding loci on the third chromosome of D. pseudoobscura using whole-genome sequences of 47 individuals, representing five common third chromosome gene arrangements. Fine-scale recombination maps were constructed using more than 1 million segregating sites. As expected, recombination was demonstrated to be significantly suppressed between chromosome arrangements, allowing for a direct examination of the relationship between recombination, selection, and codon bias. As with other Drosophila species, we observe a strong mutational bias away from the most frequently used codons. We find the rate of synonymous and nonsynonymous polymorphism is variable between different amino acids. However, we do not observe a reduction in codon bias or the strength of selection in regions of suppressed recombination as expected. Instead, we find that the interaction between weak stabilizing selection and mutational bias likely plays a role in shaping the composition of synonymous codons across the third chromosome in D. pseudoobscura. PMID:25326424

  4. Gene Expression Regulation by Upstream Open Reading Frames and Human Disease

    PubMed Central

    Barbosa, Cristina; Peixeiro, Isabel; Romão, Luísa

    2013-01-01

    Upstream open reading frames (uORFs) are major gene expression regulatory elements. In many eukaryotic mRNAs, one or more uORFs precede the initiation codon of the main coding region. Indeed, several studies have revealed that almost half of human transcripts present uORFs. Very interesting examples have shown that these uORFs can impact gene expression of the downstream main ORF by triggering mRNA decay or by regulating translation. Also, evidence from recent genetic and bioinformatic studies implicates disturbed uORF-mediated translational control in the etiology of many human diseases, including malignancies, metabolic or neurologic disorders, and inherited syndromes. In this review, we will briefly present the mechanisms through which uORFs regulate gene expression and how they can impact on the organism's response to different cell stress conditions. Then, we will emphasize the importance of these structures by illustrating, with specific examples, how disturbed uORF-mediated translational control can be involved in the etiology of human diseases, giving special importance to genotype-phenotype correlations. Identifying and studying more cases of uORF-altering mutations will help us to understand and establish genotype-phenotype associations, leading to advancements in diagnosis, prognosis, and treatment of many human disorders. PMID:23950723

  5. The impact of upstream wind direction on wake flow

    Microsoft Academic Search

    G. N. Petersen; H. Ólafsson; J. E. Kristjánsson

    2003-01-01

    A series of idealized simulations is conducted in order to investigate how the wind direction affects the airflow past an elliptical mountain of Greenland's size. The initial conditions are simple, the upstream stability and wind speed are constant, and the wind direction is varied from southwest to northwest between simulations. Preliminary results indicate that for upstream winds from the northwest,

  6. Versatile Dual Reporter Gene Systems for Investigating Stop Codon Readthrough in Plants

    PubMed Central

    Lao, Nga T.; Maloney, Alan P.; Atkins, John F.; Kavanagh, Tony A.

    2009-01-01

    Background Translation is most often terminated when a ribosome encounters the first in-frame stop codon (UAA, UAG or UGA) in an mRNA. However, many viruses (and some cellular mRNAs) contain “stop” codons that cause a proportion of ribosomes to terminate and others to incorporate an amino acid and continue to synthesize a “readthrough”, or C-terminally extended, protein. This dynamic redefinition of codon meaning is dependent on specific sequence context. Methodology We describe two versatile dual reporter systems which facilitate investigation of stop codon readthrough in vivo in intact plants, and identification of the amino acid incorporated at the decoded stop codon. The first is based on the reporter enzymes NAN and GUS for which sensitive fluorogenic and histochemical substrates are available; the second on GST and GFP. Conclusions We show that the NAN-GUS system can be used for direct in planta measurements of readthrough efficiency following transient expression of reporter constructs in leaves, and moreover, that the system is sufficiently sensitive to permit measurement of readthrough in stably transformed plants. We further show that the GST-GFP system can be used to affinity purify readthrough products for mass spectrometric analysis and provide the first definitive evidence that tyrosine alone is specified in vivo by a ‘leaky’ UAG codon, and tyrosine and tryptophan, respectively, at decoded UAA, and UGA codons in the Tobacco mosaic virus (TMV) readthrough context. PMID:19816579

  7. Codon usage in Caenorhabditis elegans: delineation of translational selection and mutational biases.

    PubMed Central

    Stenico, M; Lloyd, A T; Sharp, P M

    1994-01-01

    Synonymous codon usage varies considerably among Caenorhabditis elegans genes. Multivariate statistical analyses reveal a single major trend among genes. At one end of the trend lie genes with relatively unbiased codon usage. These genes appear to be lowly expressed, and their patterns of codon usage are consistent with mutational biases influenced by the neighbouring nucleotide. At the other extreme lie genes with extremely biased codon usage. These genes appear to be highly expressed, and their codon usage seems to have been shaped by selection favouring a limited number of translationally optimal codons. Thus, the frequency of these optimal codons in a gene appears to be correlated with the level of gene expression, and may be a useful indicator in the case of genes (or open reading frames) whose expression levels (or even function) are unknown. A second, relatively minor trend among genes is correlated with the frequency of G at synonymously variable sites. It is not yet clear whether this trend reflects variation in base composition (or mutational biases) among regions of the C.elegans genome, or some other factor. Sequence divergence between C.elegans and C.briggsae has also been studied. PMID:8041603

  8. A Comparative Analysis of Synonymous Codon Usage Bias Pattern in Human Albumin Superfamily

    PubMed Central

    Mirsafian, Hoda; Mat Ripen, Adiratna; Singh, Aarti; Teo, Phaik Hwan; Merican, Amir Feisal; Mohamad, Saharuddin Bin

    2014-01-01

    Synonymous codon usage bias is an inevitable phenomenon in organismic taxa across the three domains of life. Though the frequency of codon usage is not equal across species and within genome in the same species, the phenomenon is non random and is tissue-specific. Several factors such as GC content, nucleotide distribution, protein hydropathy, protein secondary structure, and translational selection are reported to contribute to codon usage preference. The synonymous codon usage patterns can be helpful in revealing the expression pattern of genes as well as the evolutionary relationship between the sequences. In this study, synonymous codon usage bias patterns were determined for the evolutionarily close proteins of albumin superfamily, namely, albumin, ?-fetoprotein, afamin, and vitamin D-binding protein. Our study demonstrated that the genes of the four albumin superfamily members have low GC content and high values of effective number of codons (ENC) suggesting high expressivity of these genes and less bias in codon usage preferences. This study also provided evidence that the albumin superfamily members are not subjected to mutational selection pressure. PMID:24707212

  9. High codon adaptation in citrus tristeza virus to its citrus host

    PubMed Central

    2012-01-01

    Background Citrus tristeza virus (CTV), a member of the genus Closterovirus within the family Closteroviridae, is the causal agent of citrus tristeza disease. Previous studies revealed that the negative selection, RNA recombination and gene flow were the most important forces that drove CTV evolution. However, the CTV codon usage was not studied and thus its role in CTV evolution remains unknown. Results A detailed comparative analysis of CTV codon usage pattern was done in this study. Results of the study show that although in general CTV does not have a high degree of codon usage bias, the codon usage of CTV has a high level of resemblance to its host codon usage. In addition, our data indicate that the codon usage resemblance is only observed for the woody plant-infecting closteroviruses but not the closteroviruses infecting the herbaceous host plants, suggesting the existence of different virus-host interactions between the herbaceous plant-infecting and woody plant-infecting closteroviruses. Conclusion Based on the results, we suggest that in addition to RNA recombination, negative selection and gene flow, host plant codon usage selection can also affect CTV evolution. PMID:22698086

  10. Genome-Wide Patterns of Codon Bias Are Shaped by Natural Selection in the Purple Sea Urchin, Strongylocentrotus purpuratus

    PubMed Central

    Kober, Kord M.; Pogson, Grant H.

    2013-01-01

    Codon usage bias has been documented in a wide diversity of species, but the relative contributions of mutational bias and various forms of natural selection remain unclear. Here, we describe for the first time genome-wide patterns of codon bias at 4623 genes in the purple sea urchin, Strongylocentrotus purpuratus. Preferred codons were identified at 18 amino acids that exclusively used G or C at third positions, which contrasted with the strong AT bias of the genome (overall GC content is 36.9%). The GC content of third positions and coding regions exhibited significant correlations with the magnitude of codon bias. In contrast, the GC content of introns and flanking regions was indistinguishable from the genome-wide background, which suggested a limited contribution of mutational bias to synonymous codon usage. Five distinct clusters of genes were identified that had significantly different synonymous codon usage patterns. A significant correlation was observed between codon bias and mRNA expression supporting translational selection, but this relationship was driven by only one highly biased cluster that represented only 8.6% of all genes. In all five clusters preferred codons were evolutionarily conserved to a similar degree despite differences in their synonymous codon usage distributions and magnitude of codon bias. The third positions of preferred codons in two codon usage groups also paired significantly more often in stems than in loops of mRNA secondary structure predictions, which suggested that codon bias might also affect mRNA stability. Our results suggest that mutational bias has played a minor role in determining codon bias in S. purpuratus and that preferred codon usage may be heterogeneous across different genes and subject to different forms of natural selection. PMID:23637123

  11. The Effect of Multiple Evolutionary Selections on Synonymous Codon Usage of Genes in the Mycoplasma bovis Genome

    PubMed Central

    Zhou, Jian-hua; Ding, Yao-zhong; He, Ying; Chu, Yue-feng; Zhao, Ping; Ma, Li-ya; Wang, Xin-jun; Li, Xue-rui; Liu, Yong-sheng

    2014-01-01

    Mycoplasma bovis is a major pathogen causing arthritis, respiratory disease and mastitis in cattle. A better understanding of its genetic features and evolution might represent evidences of surviving host environments. In this study, multiple factors influencing synonymous codon usage patterns in M. bovis (three strains’ genomes) were analyzed. The overall nucleotide content of genes in the M. bovis genome is AT-rich. Although the G and C contents at the third codon position of genes in the leading strand differ from those in the lagging strand (p<0.05), the 59 synonymous codon usage patterns of genes in the leading strand are highly similar to those in the lagging strand. The over-represented codons and the under-represented codons were identified. A comparison of the synonymous codon usage pattern of M. bovis and cattle (susceptible host) indicated the independent formation of synonymous codon usage of M. bovis. Principal component analysis revealed that (i) strand-specific mutational bias fails to affect the synonymous codon usage pattern in the leading and lagging strands, (ii) mutation pressure from nucleotide content plays a role in shaping the overall codon usage, and (iii) the major trend of synonymous codon usage has a significant correlation with the gene expression level that is estimated by the codon adaptation index. The plot of the effective number of codons against the G+C content at the third codon position also reveals that mutation pressure undoubtedly contributes to the synonymous codon usage pattern of M. bovis. Additionally, the formation of the overall codon usage is determined by certain evolutionary selections for gene function classification (30S protein, 50S protein, transposase, membrane protein, and lipoprotein) and translation elongation region of genes in M. bovis. The information could be helpful in further investigations of evolutionary mechanisms of the Mycoplasma family and heterologous expression of its functionally important proteins. PMID:25350396

  12. Why Kids Start

    MedlinePLUS

    ... Home > Stop Smoking > About Smoking > Preventing Smoking Why Kids Start Almost 70% of adult smokers began smoking ... the time they turn 14. So why do kids start smoking in the first place? Their parents ...

  13. The Head Start Debates

    ERIC Educational Resources Information Center

    Zigler, Edward, Ed.; Styfco, Sally J., Ed.

    2004-01-01

    The future of Head Start depends on how well people learn from and apply the lessons from its past. That's why everyone involved in early education needs this timely, forward-thinking book from the leader of Head Start. The first book to capture the Head Start debates in all their complexity and diversity, this landmark volume brings together the…

  14. Nevada Head Start, 2002.

    ERIC Educational Resources Information Center

    Biagi, Kathy

    This pamphlet describes the current services of the Nevada Head Start program. Information is provided on program eligibility requirements, the number of children and families served during the 2001-2002 program year, the counties served by Head Start programs, health services provided, demographic characteristics of families served by Head Start

  15. Suppression of Premature Termination Codons as a Therapeutic Approach

    PubMed Central

    Keeling, Kim M.; Wang, Dan; Conard, Sara E.; Bedwell, David M.

    2012-01-01

    In this review, we describe our current understanding of translation termination and pharmacological agents that influence the accuracy of this process. A number of drugs have been identified that induce suppression of translation termination at in-frame premature termination codons (PTCs; also known as nonsense mutations) in mammalian cells. We discuss efforts to utilize these drugs to suppress disease-causing PTCs that result in the loss of protein expression and function. In-frame PTCs represent a genotypic subset of mutations that make up ~11% of all known mutations that cause genetic diseases, and millions of patients have diseases attributable to PTCs. Current approaches aimed at reducing the efficiency of translation termination at PTCs (referred to as PTC suppression therapy) have the goal of alleviating the phenotypic consequences of a wide range of genetic diseases. Suppression therapy is currently in clinical trials for treatment of several genetic diseases caused by PTCs, and preliminary results suggest that some patients have shown clinical improvements. While current progress is promising, we discuss various approaches that may further enhance the efficiency of this novel therapeutic approach. PMID:22672057

  16. Pyrrolysine is not hardwired for cotranslational insertion at UAG codons

    PubMed Central

    Ambrogelly, Alexandre; Gundllapalli, Sarath; Herring, Stephanie; Polycarpo, Carla; Frauer, Carina; Söll, Dieter

    2007-01-01

    Pyrrolysine (Pyl), the 22nd naturally encoded amino acid, gets acylated to its distinctive UAG suppressor tRNAPyl by the cognate pyrrolysyl-tRNA synthetase (PylRS). Here we determine the RNA elements required for recognition and aminoacylation of tRNAPyl in vivo by using the Pyl analog N-?-cyclopentyloxycarbonyl-l-lysine. Forty-two Methanosarcina barkeri tRNAPyl variants were tested in Escherichia coli for suppression of the lac amber A24 mutation; then relevant tRNAPyl mutants were selected to determine in vivo binding to M. barkeri PylRS in a yeast three-hybrid system and to measure in vitro tRNAPyl aminoacylation. tRNAPyl identity elements include the discriminator base, the first base pair of the acceptor stem, the T-stem base pair G51:C63, and the anticodon flanking nucleotides U33 and A37. Transplantation of the tRNAPyl identity elements into the mitochondrial bovine tRNASer scaffold yielded chimeric tRNAs active both in vitro and in vivo. Because the anticodon is not important for PylRS recognition, a tRNAPyl variant could be constructed that efficiently suppressed the lac opal U4 mutation in E. coli. These data suggest that tRNAPyl variants may decode numerous codons and that tRNAPyl:PylRS is a fine orthogonal tRNA:synthetase pair that facilitated the late addition of Pyl to the genetic code. PMID:17360621

  17. Evidence of abundant stop codon readthrough in Drosophila and other Metazoa

    E-print Network

    Jungreis, Irwin

    While translational stop codon readthrough is often used by viral genomes, it has been observed for only a handful of eukaryotic genes. We previously used comparative genomics evidence to recognize protein-coding regions ...

  18. RESEARCH ARTICLE Open Access Increased incidence of rare codon clusters at 5'

    E-print Network

    Clark, Patricia L.

    that rare codons are enriched at the 5' and 3' termini of genes from E. coli and other prokaryotes. GenesRNA secondary structure, especially within the first 40 nucleotides at the 5' end of an open reading frame

  19. OmniChange: The Sequence Independent Method for Simultaneous Site-Saturation of Five Codons

    PubMed Central

    Marienhagen, Jan; Schwaneberg, Ulrich

    2011-01-01

    Focused mutant library generation methods have been developed to improve mainly “localizable” enzyme properties such as activity and selectivity. Current multi-site saturation methods are restricted by the gene sequence, require subsequent PCR steps and/or additional enzymatic modifications. Here we report, a multiple site saturation mutagenesis method, OmniChange, which simultaneously and efficiently saturates five independent codons. As proof of principle, five chemically cleaved DNA fragments, each carrying one NNK-degenerated codon, were generated and assembled to full gene length in a one-pot-reaction without additional PCR-amplification or use of restriction enzymes or ligases. Sequencing revealed the presence of up to 27 different codons at individual positions, corresponding to 84.4% of the theoretical diversity offered by NNK-degeneration. OmniChange is absolutely sequence independent, does not require a minimal distance between mutated codons and can be accomplished within a day. PMID:22039444

  20. Precise manipulation of chromosomes in vivo enables genome-wide codon replacement.

    PubMed

    Isaacs, Farren J; Carr, Peter A; Wang, Harris H; Lajoie, Marc J; Sterling, Bram; Kraal, Laurens; Tolonen, Andrew C; Gianoulis, Tara A; Goodman, Daniel B; Reppas, Nikos B; Emig, Christopher J; Bang, Duhee; Hwang, Samuel J; Jewett, Michael C; Jacobson, Joseph M; Church, George M

    2011-07-15

    We present genome engineering technologies that are capable of fundamentally reengineering genomes from the nucleotide to the megabase scale. We used multiplex automated genome engineering (MAGE) to site-specifically replace all 314 TAG stop codons with synonymous TAA codons in parallel across 32 Escherichia coli strains. This approach allowed us to measure individual recombination frequencies, confirm viability for each modification, and identify associated phenotypes. We developed hierarchical conjugative assembly genome engineering (CAGE) to merge these sets of codon modifications into genomes with 80 precise changes, which demonstrate that these synonymous codon substitutions can be combined into higher-order strains without synthetic lethal effects. Our methods treat the chromosome as both an editable and an evolvable template, permitting the exploration of vast genetic landscapes. PMID:21764749

  1. Selection on synonymous codons in mammalian rhodopsins: a possible role in optimizing translational processes

    PubMed Central

    2014-01-01

    Background Synonymous codon usage can affect many cellular processes, particularly those associated with translation such as polypeptide elongation and folding, mRNA degradation/stability, and splicing. Highly expressed genes are thought to experience stronger selection pressures on synonymous codons. This should result in codon usage bias even in species with relatively low effective population sizes, like mammals, where synonymous site selection is thought to be weak. Here we use phylogenetic codon-based likelihood models to explore patterns of codon usage bias in a dataset of 18 mammalian rhodopsin sequences, the protein mediating the first step in vision in the eye, and one of the most highly expressed genes in vertebrates. We use these patterns to infer selection pressures on key translational mechanisms including polypeptide elongation, protein folding, mRNA stability, and splicing. Results Overall, patterns of selection in mammalian rhodopsin appear to be correlated with post-transcriptional and translational processes. We found significant evidence for selection at synonymous sites using phylogenetic mutation-selection likelihood models, with C-ending codons found to have the highest relative fitness, and to be significantly more abundant at conserved sites. In general, these codons corresponded with the most abundant tRNAs in mammals. We found significant differences in codon usage bias between rhodopsin loops versus helices, though there was no significant difference in mean synonymous substitution rate between these motifs. We also found a significantly higher proportion of GC-ending codons at paired sites in rhodopsin mRNA secondary structure, and significantly lower synonymous mutation rates in putative exonic splicing enhancer (ESE) regions than in non-ESE regions. Conclusions By focusing on a single highly expressed gene we both distinguish synonymous codon selection from mutational effects and analytically explore underlying functional mechanisms. Our results suggest that codon bias in mammalian rhodopsin arises from selection to optimally balance high overall translational speed, accuracy, and proper protein folding, especially in structurally complicated regions. Selection at synonymous sites may also be contributing to mRNA stability and splicing efficiency at exonic-splicing-enhancer (ESE) regions. Our results highlight the importance of investigating highly expressed genes in a broader phylogenetic context in order to better understand the evolution of synonymous substitutions. PMID:24884412

  2. Characterization of codon usage bias in the gI gene of duck enteritis virus

    Microsoft Academic Search

    Lijuan Li; Anchun Cheng; Mingshu Wang; Shunchuan Zhang; Dekang Zhu; Renyong Jia; Qihui Luo; Yi Zhou; Zhengli Chen; Xiaoyue Chen

    2010-01-01

    The analysis on codon usage bias of gI gene of duck enteritis virus (DEV) may provide a basis for understanding the evolution and molecular characteristic of DEV, and for selecting appropriate host expression systems to improve the expression of target gene. A comparative analysis of the codon usage bias of the DEV gI gene and 22 other refrence herpesviruses gI-like

  3. GUG is an efficient initiation codon to translate the human mitochondrial ATP6 gene

    Microsoft Academic Search

    A Dubot; C Godinot; V Dumur; B Sablonnière; T Stojkovic; J. M Cuisset; A Vojtiskova; P Pecina; P Jesina; J Houstek

    2004-01-01

    A maternally inherited and practically homoplasmic mitochondrial (mtDNA) mutation, 8527A>G, changing the initiation codon AUG into GUG, normally coding for a valine, was observed in the ATP6 gene encoding the ATPase subunit a. No alternate Met codon could replace the normal translational initiator. The patient harboring this mutation exhibited clinical symptoms suggesting a mitochondrial disease but his mother who carried

  4. tRNA slippage at the tmRNA resume codon

    Microsoft Academic Search

    MICHAEL J. TRIMBLE; AMY MINNICUS; KELLY P. WILLIAMS

    2004-01-01

    The bacterial ribosome does not initiate translation on the mRNA portion of tmRNA; instead translation that had begun on a separate mRNA molecule resumes at a particular triplet on tmRNA (the resume codon). For at least two tRNAs that could pair with both the resume and ?2 triplets on mutant tmRNAs, UAA (stop) as the second codon induced high-frequency ?2

  5. Codon Usage Bias Covaries With Expression Breadth and the Rate of Synonymous Evolution in Humans, but This Is Not Evidence for Selection

    Microsoft Academic Search

    Araxi O. Urrutia; Laurence D. Hurst

    In numerous species, from bacteria to Drosophila, evidence suggests that selection acts even on synony- mous codon usage: codon bias is greater in more abundantly expressed genes, the rate of synonymous evolution is lower in genes with greater codon bias, and there is consistency between genes in the same species in which codons are preferred. In contrast, in mammals, while

  6. Translation initiation factor eIF3 promotes programmed stop codon readthrough

    PubMed Central

    Beznosková, Petra; Wagner, Susan; Jansen, Myrte Esmeralda; von der Haar, Tobias; Valášek, Leoš Shivaya

    2015-01-01

    Programmed stop codon readthrough is a post-transcription regulatory mechanism specifically increasing proteome diversity by creating a pool of C-terminally extended proteins. During this process, the stop codon is decoded as a sense codon by a near-cognate tRNA, which programs the ribosome to continue elongation. The efficiency of competition for the stop codon between release factors (eRFs) and near-cognate tRNAs is largely dependent on its nucleotide context; however, the molecular mechanism underlying this process is unknown. Here, we show that it is the translation initiation (not termination) factor, namely eIF3, which critically promotes programmed readthrough on all three stop codons. In order to do so, eIF3 must associate with pre-termination complexes where it interferes with the eRF1 decoding of the third/wobble position of the stop codon set in the unfavorable termination context, thus allowing incorporation of near-cognate tRNAs with a mismatch at the same position. We clearly demonstrate that efficient readthrough is enabled by near-cognate tRNAs with a mismatch only at the third/wobble position. Importantly, the eIF3 role in programmed readthrough is conserved between yeast and humans. PMID:25925566

  7. Translation initiation factor eIF3 promotes programmed stop codon readthrough.

    PubMed

    Beznosková, Petra; Wagner, Susan; Jansen, Myrte Esmeralda; von der Haar, Tobias; Valášek, Leoš Shivaya

    2015-05-26

    Programmed stop codon readthrough is a post-transcription regulatory mechanism specifically increasing proteome diversity by creating a pool of C-terminally extended proteins. During this process, the stop codon is decoded as a sense codon by a near-cognate tRNA, which programs the ribosome to continue elongation. The efficiency of competition for the stop codon between release factors (eRFs) and near-cognate tRNAs is largely dependent on its nucleotide context; however, the molecular mechanism underlying this process is unknown. Here, we show that it is the translation initiation (not termination) factor, namely eIF3, which critically promotes programmed readthrough on all three stop codons. In order to do so, eIF3 must associate with pre-termination complexes where it interferes with the eRF1 decoding of the third/wobble position of the stop codon set in the unfavorable termination context, thus allowing incorporation of near-cognate tRNAs with a mismatch at the same position. We clearly demonstrate that efficient readthrough is enabled by near-cognate tRNAs with a mismatch only at the third/wobble position. Importantly, the eIF3 role in programmed readthrough is conserved between yeast and humans. PMID:25925566

  8. 7. Chandler Falls, looking upstream (from north). Golf tee of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. Chandler Falls, looking upstream (from north). Golf tee of the Mesa Country Club on right. Photographer: Mark Durben, February 1989. Source: SRPA - Tempe Canal, South Side Salt River in Tempe, Mesa & Phoenix, Tempe, Maricopa County, AZ

  9. 4. SPILLWAY DRUM GATES AND CHANNEL, LOOKING NORTHEAST (upstream face ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. SPILLWAY DRUM GATES AND CHANNEL, LOOKING NORTHEAST (upstream face and Control House in background) - Tieton Dam, Spillway & Drum Gates, South & East side of State Highway 12, Naches, Yakima County, WA

  10. 18. DETAIL VIEW OF BUCKLED VERTICAL MEMBER ON UPSTREAM TRUSS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. DETAIL VIEW OF BUCKLED VERTICAL MEMBER ON UPSTREAM TRUSS AT SOUTH CANTILEVER TOWER, LOOKING SOUTH - Smith River Bridge, CA State Highway 199 Spanning Smith River, Crescent City, Del Norte County, CA

  11. 10. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE: MISCELLANEOUS METAL DETAILS. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE: MISCELLANEOUS METAL DETAILS. Sheet A-22, November, 1940. File no. SA 342/31. - Prado Dam, Embankment, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

  12. 10. UPSTREAM SIDE OF UPPER MITER GATES SHOWING STOWED LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. UPSTREAM SIDE OF UPPER MITER GATES SHOWING STOWED LEFT WING OF UPPER GUARD GATE (FAR LEFT). VIEW TO NORTHWEST. - Starved Rock Locks & Dam, Illinois Waterway River mile 231, Peru, La Salle County, IL

  13. 15. OVERALL VIEW OF UPSTREAM FACE OF LIFT GATE SECTION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. OVERALL VIEW OF UPSTREAM FACE OF LIFT GATE SECTION WITH TAINTER GATE SECTION OF SPILLWAY TO THE LEFT. VIEW TO SOUTHWEST. - Starved Rock Locks & Dam, Illinois Waterway River mile 231, Peru, La Salle County, IL

  14. 1. OVERALL VIEW OF UPSTREAM FACE OF DAM; SPILLWAY IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERALL VIEW OF UPSTREAM FACE OF DAM; SPILLWAY IN FOREGROUND, LOCK IN BACKGROUND ON NORTH RIVER BANK. VIEW TO NORTH. - Starved Rock Locks & Dam, Illinois Waterway River mile 231, Peru, La Salle County, IL

  15. 2. VIEW SHOWING UPSTREAM FACE, WITH OUTLET GATE IN BACKGROUND, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. VIEW SHOWING UPSTREAM FACE, WITH OUTLET GATE IN BACKGROUND, LOOKING NORTHEAST - High Mountain Dams in Upaco Unit, Superior Lake Dam, Ashley National Forest, 12.4 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  16. 3. VIEW SHOWING UPSTREAM FACE OF DAM, WITH OUTLET GATE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW SHOWING UPSTREAM FACE OF DAM, WITH OUTLET GATE IN BACKGROUND, LOOKING NORTH - High Mountain Dams in Upalco Unit, Drift Lake Dam, Ashley National Forest, 11.4 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  17. 3. VIEW OF UPSTREAM FACE OF DAM, SHOWING OUTLET GATE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW OF UPSTREAM FACE OF DAM, SHOWING OUTLET GATE, LOOKING NORTHEAST - High Mountain Dams in Upalco Unit, Island Lake Dam, Ashley National Forest, 4.8 miles North of Miners Gulch Campground, Mountain Home, Duchesne County, UT

  18. 2. VIEW SHOWING UPSTREAM FACE OF DAM, WITHOUT OUTLET GATE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. VIEW SHOWING UPSTREAM FACE OF DAM, WITHOUT OUTLET GATE IN BACKGROUND, LOOKING NORTHEAST - High Mountain Dams in Upalco Unit, Five Point Lake Dam, Ashley National Forest, 12 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  19. 2. VIEW OF UPSTREAM FACE OF DAM, LOOKING EAST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. VIEW OF UPSTREAM FACE OF DAM, LOOKING EAST - High Mountain Dams in Upalco Unit, East Timothy Lake Dam, Ashley National Forest, 8.4 miles North of Swift Creek Campground, Mountain Home, Duchesne County, UT

  20. 3. VIEW SHOWING UPSTREAM FACE OF DAM, WITH SPILLWAY IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW SHOWING UPSTREAM FACE OF DAM, WITH SPILLWAY IN BACKGROUND, LOOKING SOUTHWEST - High Mountain Dams in Upalco Unit, East Timothy Lake Dam, Ashley National Forest, 8.4 miles North of Swift Creek Campground, Mountain Home, Duchesne County, UT

  1. 2. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE, LOOKING SOUTH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE, LOOKING SOUTH - High Mountain Dams in Upalco Unit, Milk Lake Dam, Ashley National Forest, 9.4 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  2. 1. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE, WITH SPILLWAY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE, WITH SPILLWAY IN FOREGROUND, LOOKING SOUTHWEST - High Mountain Dams in Upalco Unit, Deer Lake Dam, Ashley National Forest, 5.8 miles North of Swift Creek Campground, Mountain Home, Duchesne County, UT

  3. DETAIL VIEW OF TOP OF DAM GATE STRUCTURE. UPSTREAM LOCK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAIL VIEW OF TOP OF DAM GATE STRUCTURE. UPSTREAM LOCK GATE AT RIGHT REAR. LOOKING WEST. - Illinois Waterway, La Grange Lock and Dam, 3/4 mile south of Country 795N at Illinois River, Versailles, Brown County, IL

  4. 2. UPSTREAM SIDE OF DIVERSION DAM ON THE SNAKE RIVER, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. UPSTREAM SIDE OF DIVERSION DAM ON THE SNAKE RIVER, LOOKING SOUTH-SOUTHWEST. NOTE BANK REINFORCEMENT ON LEFT AND SPILLWAY ON RIGHT. - Snake River Ditch, Headgate on north bank of Snake River, Dillon, Summit County, CO

  5. OVERALL VIEW OF CASCADE CANAL COMPANY CRIB DAM, LOOKING UPSTREAM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OVERALL VIEW OF CASCADE CANAL COMPANY CRIB DAM, LOOKING UPSTREAM FROM DIRECTION OF KACHESS DAM. VIEW TO NORTH - Kachess Dam, 1904 Cascade Canal Company Crib Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA

  6. 11. DETAIL OF UPSTREAM FACE OF SLUICE GATE CONTROLS FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. DETAIL OF UPSTREAM FACE OF SLUICE GATE CONTROLS FROM CATWALK, SHOWING GATE LIFTING GEARS (TOP) AND GEAR SHAFTS (BOTTOM). VIEW TO SOUTHWEST. - Boise Project, Boise River Diversion Dam, Across Boise River, Boise, Ada County, ID

  7. UPSTREAM LOCK GATE DETAIL AND DOG HOUSE. NOTE ARM AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    UPSTREAM LOCK GATE DETAIL AND DOG HOUSE. NOTE ARM AND GEARING FOR CONTROLLING LOCK GATE. LOOKING WEST SOUTHWEST. - Illinois Waterway, Brandon Road Lock and Dam , 1100 Brandon Road, Joliet, Will County, IL

  8. DOG HOUSE AT UPSTREAM LOCK GATE. ALSO SEEN AT LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DOG HOUSE AT UPSTREAM LOCK GATE. ALSO SEEN AT LEFT IN PHOTO NO. IL-164-A-23. - Illinois Waterway, La Grange Lock and Dam, 3/4 mile south of Country 795N at Illinois River, Versailles, Brown County, IL

  9. View of upstream face of Lake Sabrina Dam showing redwood ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of upstream face of Lake Sabrina Dam showing redwood planks and boulders in Lake Sabrina Basin, view north - Bishop Creek Hydroelectric System, Plant 2, Lake Sabrina Dam, Bishop Creek, Bishop, Inyo County, CA

  10. View of upstream face of Lake Sabrina Dam showing the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of upstream face of Lake Sabrina Dam showing the redwood planks and base of dam from Lake Sabrina Basin, view north - Bishop Creek Hydroelectric System, Plant 2, Lake Sabrina Dam, Bishop Creek, Bishop, Inyo County, CA

  11. 58. AERIAL VIEW OF UPSTREAM FACE OF OWYEE DAM. VIEW ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    58. AERIAL VIEW OF UPSTREAM FACE OF OWYEE DAM. VIEW TO NORTHWEST. Photocopy of photograph by Glade Walker, U.S. Bureau of Reclamation, Pacific Northwest Region, September 22, 1977. - Owyhee Dam, Across Owyhee River, Nyssa, Malheur County, OR

  12. AERIAL VIEW OF UPSTREAM FACE, GATEHOUSE AND TOWER, 1936 SPILLWAY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    AERIAL VIEW OF UPSTREAM FACE, GATEHOUSE AND TOWER, 1936 SPILLWAY AND OUTLET CHANNEL OF KACHESS DAM, VIEW EAST - Kachess Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA

  13. 10. DETAIL OF UPSTREAM FACE OF NEW YORK CANAL HEADWORKS, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. DETAIL OF UPSTREAM FACE OF NEW YORK CANAL HEADWORKS, SHOWING GATE LIFTING GEARS (TOP), WORM GEAR SHAFTS (CENTER) AND SLIDE GATES (BOTTOM). VIEW TO NORTHWEST. - Boise Project, Boise River Diversion Dam, Across Boise River, Boise, Ada County, ID

  14. 46. INTAKE DAM NO. 2, VIEW LOOKING UPSTREAM. THIS WAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    46. INTAKE DAM NO. 2, VIEW LOOKING UPSTREAM. THIS WAS FORMERLY THE MAIN INTAKE FOR THE SYSTEM. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  15. 30. WAIALEIA STREAM CROSSING (30") LOOKING UPSTREAM. PIPE IS EXPOSED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. WAIALEIA STREAM CROSSING (30") LOOKING UPSTREAM. PIPE IS EXPOSED AT LEFT OF CONCRETE STRUCTURE. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  16. 6. CREST ROAD ON UPPER EMBANKMENT, SHOWING MASONRY UPSTREAM PARAPET ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. CREST ROAD ON UPPER EMBANKMENT, SHOWING MASONRY UPSTREAM PARAPET WALL (LEFT) AND ENTRANCE TO DEER FLAT NAMPA CANAL HEADWORKS (ALSO LEFT). VIEW TO WEST. - Boise Project, Deer Flat Embankments, Lake Lowell, Nampa, Canyon County, ID

  17. 23. VIEW LOOKING UPSTREAM FROM WEST BANK OF HEADRACE SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW LOOKING UPSTREAM FROM WEST BANK OF HEAD-RACE SHOWING RECONSTRUCTED MAIN AND DIVERSION DAMS; HEAD-RACE IS JUST OUT OF PICTURE AT LEFT. - Forge Creek Dam-John Cable Mill, Townsend, Blount County, TN

  18. 2. OVERALL VIEW OF DRIFT LAKE AND UPSTREAM FACE OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. OVERALL VIEW OF DRIFT LAKE AND UPSTREAM FACE OF DAM, LOOKING EAST - High Mountain Dams in Upalco Unit, Drift Lake Dam, Ashley National Forest, 11.4 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  19. 3. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE AND OUTLET ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE AND OUTLET GATE, LOOKING NORTH - High Mountain Dams in Upalco Unit, Bluebell Lake Dam, Ashley National Forest, 11.2 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  20. 2. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE AND OUTLET ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. OVERALL VIEW OF DAM, SHOWING UPSTREAM FACE AND OUTLET GATE, LOOKING SOUTHEAST - High Mountain Dams in Upalco Unit, Bluebell Lake Dam, Ashley National Forest, 11.2 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  1. 1. OVERALL VIEW OF DRIFT LAKE AND UPSTREAM FACE OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERALL VIEW OF DRIFT LAKE AND UPSTREAM FACE OF DAM, LOOKING NORTHWEST - High Mountain Dams in Upalco Unit, Drift Lake Dam, Ashley National Forest, 11.4 miles Northwest of Swift Creek Campground, Mountain Home, Duchesne County, UT

  2. 3. VIEW SHOWING CREST AND UPSTREAM FACE OF DAM, LOOKING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW SHOWING CREST AND UPSTREAM FACE OF DAM, LOOKING SOUTH - High Mountain Dams in Upalco Unit, Brown Duck Lake Dam, Ashley National Forest, 4.4 miles North of Miners Gulch Campground, Mountain Home, Duchesne County, UT

  3. 2. OVERALL VIEW OF CLEMENTS LAKE AND UPSTREAM FACE OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. OVERALL VIEW OF CLEMENTS LAKE AND UPSTREAM FACE OF DAM, LOOKING NORTHWEST - High Mountain Dams in Upalco Unit, Clements Lake Dam, Ashley National Forest, 6.5 miles North of Miners Gulch Campground, Mountain Home, Duchesne County, UT

  4. Implementing and Testing Upstream Corner Balance Methods in PDT 

    E-print Network

    Seager, Robert John

    2013-10-01

    coarser mesh is significant. Upstream corner balance (UCB) methods are a specific family of spatial discretization methods that have some advantages over other methods. This research assesses the strengths and weaknesses of UCB by implementing, testing...

  5. 24. VIEW FROM EAST BANK, LOOKING UPSTREAM, SHOWING RECONSTRUCTED MAIN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    24. VIEW FROM EAST BANK, LOOKING UPSTREAM, SHOWING RECONSTRUCTED MAIN AND DIVERSION DAMS IN BACKGROUND WITH WATER-GATE AND BEGINNING OF HEAD-RACE IN LEFT FOREGROUND. - Forge Creek Dam-John Cable Mill, Townsend, Blount County, TN

  6. Influence of a river valley constriction on upstream sedimentation

    E-print Network

    Kinnebrew, Quin

    1988-01-01

    INFLUENCE OF A RIVER VALLEY CONSTRICTION ON UPSTREAM SEDIMENTATION A Thesis by QUIN KINNEBREW Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE... December 1988 Major Subject: Geology INFLUENCE OF A RIVER VALLEY CONSTRICTION ON UPSTREAM SEDIMENTATION A Thesis by QUIN KINNEBREW Approved as to style and content by: (Chairman of Committee) Kenneth L. White (Member) Earl R. Hoskins (Member...

  7. The characteristics of rare codon clusters in the genome and proteins of hepatitis C virus; a bioinformatics look.

    PubMed

    Fattahi, Mohammadreza; Malekpour, Abdorrasoul; Mortazavi, Mojtaba; Safarpour, Alireza; Naseri, Nasrin

    2014-10-01

    BACKGROUND Recent studies suggest that rare codon clusters are functionally important for protein activity. METHODS Here, for the first time we analyzed and reported rare codon clusters in Hepatitis C Virus (HCV) genome and then identified the location of these rare codon clusters in the structure of HCV protein. This analysis was performed using the Sherlocc program that detects statistically relevant conserved rare codon clusters. RESULTS By this program, we identified the rare codon cluster in three regions of HCV genome; NS2, NS3, and NS5A coding sequence of HCV genome. For further understanding of the role of these rare codon clusters, we studied the location of these rare codon clusters and critical residues in the structure of NS2, NS3 and NS5A proteins. We identified some critical residues near or within rare codon clusters. It should be mentioned that characteristics of these critical residues such as location and situation of side chains are important in assurance of the HCV life cycle. CONCLUSION The characteristics of these residues and their relative status showed that these rare codon clusters play an important role in proper folding of these proteins. Thus, it is likely that these rare codon clusters may have an important role in the function of HCV proteins. This information is helpful in development of new avenues for vaccine and treatment protocols. PMID:25349685

  8. New insights into the incorporation of natural suppressor tRNAs at stop codons in Saccharomyces cerevisiae

    PubMed Central

    Blanchet, Sandra; Cornu, David; Argentini, Manuela; Namy, Olivier

    2014-01-01

    Stop codon readthrough may be promoted by the nucleotide environment or drugs. In such cases, ribosomes incorporate a natural suppressor tRNA at the stop codon, leading to the continuation of translation in the same reading frame until the next stop codon and resulting in the expression of a protein with a new potential function. However, the identity of the natural suppressor tRNAs involved in stop codon readthrough remains unclear, precluding identification of the amino acids incorporated at the stop position. We established an in vivo reporter system for identifying the amino acids incorporated at the stop codon, by mass spectrometry in the yeast Saccharomyces cerevisiae. We found that glutamine, tyrosine and lysine were inserted at UAA and UAG codons, whereas tryptophan, cysteine and arginine were inserted at UGA codon. The 5? nucleotide context of the stop codon had no impact on the identity or proportion of amino acids incorporated by readthrough. We also found that two different glutamine tRNAGln were used to insert glutamine at UAA and UAG codons. This work constitutes the first systematic analysis of the amino acids incorporated at stop codons, providing important new insights into the decoding rules used by the ribosome to read the genetic code. PMID:25056309

  9. Head Start in Transition.

    ERIC Educational Resources Information Center

    Lubeck, Sally; And Others

    1997-01-01

    Explores history of Head Start and, to create another way of conceiving of the organization, shifting definitions and conflicting interpretations of parental involvement and staff development. Also draws on interviews with women involved with Head Start and concludes that the certainty and stability characterizing public policy since Enlightenment…

  10. Advantages of a Mechanistic Codon Substitution Model for Evolutionary Analysis of Protein-Coding Sequences

    PubMed Central

    Miyazawa, Sanzo

    2011-01-01

    Background A mechanistic codon substitution model, in which each codon substitution rate is proportional to the product of a codon mutation rate and the average fixation probability depending on the type of amino acid replacement, has advantages over nucleotide, amino acid, and empirical codon substitution models in evolutionary analysis of protein-coding sequences. It can approximate a wide range of codon substitution processes. If no selection pressure on amino acids is taken into account, it will become equivalent to a nucleotide substitution model. If mutation rates are assumed not to depend on the codon type, then it will become essentially equivalent to an amino acid substitution model. Mutation at the nucleotide level and selection at the amino acid level can be separately evaluated. Results The present scheme for single nucleotide mutations is equivalent to the general time-reversible model, but multiple nucleotide changes in infinitesimal time are allowed. Selective constraints on the respective types of amino acid replacements are tailored to each gene in a linear function of a given estimate of selective constraints. Their good estimates are those calculated by maximizing the respective likelihoods of empirical amino acid or codon substitution frequency matrices. Akaike and Bayesian information criteria indicate that the present model performs far better than the other substitution models for all five phylogenetic trees of highly-divergent to highly-homologous sequences of chloroplast, mitochondrial, and nuclear genes. It is also shown that multiple nucleotide changes in infinitesimal time are significant in long branches, although they may be caused by compensatory substitutions or other mechanisms. The variation of selective constraint over sites fits the datasets significantly better than variable mutation rates, except for 10 slow-evolving nuclear genes of 10 mammals. An critical finding for phylogenetic analysis is that assuming variable mutation rates over sites lead to the overestimation of branch lengths. PMID:22220197

  11. Barriers impede upstream spawning migration of flathead chub

    USGS Publications Warehouse

    Walters, David M.; Zuellig, Robert E.; Crockett, Harry J.; Bruce, James F.; Lukacs, Paul M.; Fitzpatrick, Ryan M.

    2014-01-01

    Many native cyprinids are declining throughout the North American Great Plains. Some of these species require long reaches of contiguous, flowing riverine habitat for drifting eggs or larvae to develop, and their declining populations have been attributed to habitat fragmentation or barriers (e.g., dams, dewatered channels, and reservoirs) that restrict fish movement. Upstream dispersal is also needed to maintain populations of species with passively drifting eggs or larvae, and prior researchers have suggested that these fishes migrate upstream to spawn. To test this hypothesis, we conducted a mark–recapture study of Flathead Chub Platygobio gracilis within a 91-km reach of continuous riverine habitat in Fountain Creek, Colorado. We measured CPUE, spawning readiness (percent of Flathead Chub expressing milt), and fish movement relative to a channel-spanning dam. Multiple lines of evidence indicate that Flathead Chub migrate upstream to spawn during summer. The CPUE was much higher at the base of the dam than at downstream sites; the seasonal increases in CPUE at the dam closely tracked seasonal increases in spawning readiness, and marked fish moved upstream as far as 33 km during the spawning run. The upstream migration was effectively blocked by the dam. The CPUE of Flathead Chub was much lower upstream of the OHDD than at downstream sites, and <0.2% of fish marked at the dam were recaptured upstream. This study provides the first direct evidence of spawning migration for Flathead Chub and supports the general hypothesis that barriers limit adult dispersal of these and other plains fishes.

  12. Health and safety in small workplaces: refocusing upstream.

    PubMed

    Eakin, Joan M; Champoux, Danièle; MacEachen, Ellen

    2010-01-01

    Small workplaces have particular injury risks and are enduringly difficult for the occupational health and safety (OHS) system to reach. This paper puts forward an "upstream" perspective on OHS in small workplaces that moves beyond the attributes of the workplace and those who work there. The paper draws on and synthesizes ideas and findings from emerging upstream OHS research, our own empirical investigations in Ontario and Quebec, and our collected research experience in small workplace health. Upstream structures and processes (regulations, policies, services, interventions, professional practices) are often misaligned with the conditions of work and social relations of small workplaces. Key upstream factors include regulatory exemption, subcontracting, unionization levels, the changing character of small enterprise, joint management, service and inspection constraints, competing institutional accountabilities, institutional orientation to large business, and inappropriate service and policy. Misalignment of the OHS system with the nature and practical realities of small workplaces can undermine prevention and the management of ill health and injury. To address such misalignments, the paper calls for: 1) restructuring of data collection and consultation processes to increase the visibility, voice and credibility of small workplaces; 2) "audits" of OHS-related legislation, policy and interventions to assess and address implications for small workplaces; 3) reflection on current terms and concepts that render workers invisible and capture poorly the essence and (increasing) diversity of these workplaces; and 4) extension of the upstream gaze to the global level. PMID:20629444

  13. Clustering in large networks does not promote upstream reciprocity.

    PubMed

    Masuda, Naoki

    2011-01-01

    Upstream reciprocity (also called generalized reciprocity) is a putative mechanism for cooperation in social dilemma situations with which players help others when they are helped by somebody else. It is a type of indirect reciprocity. Although upstream reciprocity is often observed in experiments, most theories suggest that it is operative only when players form short cycles such as triangles, implying a small population size, or when it is combined with other mechanisms that promote cooperation on their own. An expectation is that real social networks, which are known to be full of triangles and other short cycles, may accommodate upstream reciprocity. In this study, I extend the upstream reciprocity game proposed for a directed cycle by Boyd and Richerson to the case of general networks. The model is not evolutionary and concerns the conditions under which the unanimity of cooperative players is a Nash equilibrium. I show that an abundance of triangles or other short cycles in a network does little to promote upstream reciprocity. Cooperation is less likely for a larger population size even if triangles are abundant in the network. In addition, in contrast to the results for evolutionary social dilemma games on networks, scale-free networks lead to less cooperation than networks with a homogeneous degree distribution. PMID:21998641

  14. Connection between stop codon reassignment and frequent use of shifty stop frameshifting

    PubMed Central

    Vallabhaneni, Haritha; Fan-Minogue, Hua; Bedwell, David M.; Farabaugh, Philip J.

    2009-01-01

    Ciliated protozoa of the genus Euplotes have undergone genetic code reassignment, redefining the termination codon UGA to encode cysteine. In addition, Euplotes spp. genes very frequently employ shifty stop frameshifting. Both of these phenomena involve noncanonical events at a termination codon, suggesting they might have a common cause. We recently demonstrated that Euplotes octocarinatus peptide release factor eRF1 ignores UGA termination codons while continuing to recognize UAA and UAG. Here we show that both the Tetrahymena thermophila and E. octocarinatus eRF1 factors allow efficient frameshifting at all three termination codons, suggesting that UGA redefinition also impaired UAA/UAG recognition. Mutations of the Euplotes factor restoring a phylogenetically conserved motif in eRF1 (TASNIKS) reduced programmed frameshifting at all three termination codons. Mutation of another conserved residue, Cys124, strongly reduces frameshifting at UGA while actually increasing frameshifting at UAA/UAG. We will discuss these results in light of recent biochemical characterization of these mutations. PMID:19329535

  15. Two-codon T-box riboswitch binding two tRNAs

    PubMed Central

    Saad, Nizar Y.; Stamatopoulou, Vassiliki; Brayé, Mélanie; Drainas, Denis; Stathopoulos, Constantinos; Becker, Hubert Dominique

    2013-01-01

    T-box riboswitches control transcription of downstream genes through the tRNA-binding formation of terminator or antiterminator structures. Previously reported T-boxes were described as single-specificity riboswitches that can bind specific tRNA anticodons through codon–anticodon interactions with the nucleotide triplet of their specifier loop (SL). However, the possibility that T-boxes might exhibit specificity beyond a single tRNA had been overlooked. In Clostridium acetobutylicum, the T-box that regulates the operon for the essential tRNA-dependent transamidation pathway harbors a SL with two potential overlapping codon positions for tRNAAsn and tRNAGlu. To test its specificity, we performed extensive mutagenic, biochemical, and chemical probing analyses. Surprisingly, both tRNAs can efficiently bind the SL in vitro and in vivo. The dual specificity of the T-box is allowed by a single base shift on the SL from one overlapping codon to the next. This feature allows the riboswitch to sense two tRNAs and balance the biosynthesis of two amino acids. Detailed genomic comparisons support our observations and suggest that “flexible” T-box riboswitches are widespread among bacteria, and, moreover, their specificity is dictated by the metabolic interconnection of the pathways under control. Taken together, our results support the notion of a genome-dependent codon ambiguity of the SLs. Furthermore, the existence of two overlapping codons imposes a unique example of tRNA-dependent regulation at the transcriptional level. PMID:23858450

  16. Start School Later

    NSDL National Science Digital Library

    Last month, Pediatrics, the official journal of the American Academy of Pediatrics (AAP), issued a formal policy statement concerning School Start Times for Adolescents (http://pediatrics.aappublications.org/content/early/2014/08/19/peds.2014-1697.abstract?sid=3f739b0e-a552-4a4a-bd0a-907809e20255). In essence, the AAP called for schools to start later, citing sleep deprivation among teenagers as â??an important public health issue.â? This site from Start School Later, a group advocating for â??health, safety and equity in education,â? provides good, if somewhat one-sided, information on the topic. If youâ??re unfamiliar, start with Research & Info, which provides links to a number of informative sites about adolescent sleep needs and the impact of early school start times. Success Stories takes readers to schools around the country that have experimented with, and benefited from, later start times. If you're inspired, you can also Get Involved. Whatever your position on the issue, this is an informative and interesting site.

  17. DNA sequence elements located immediately upstream of the –10 hexamer in Escherichia coli promoters: a systematic study

    PubMed Central

    Burr, Tom; Mitchell, Jennie; Kolb, Annie; Minchin, Steve; Busby, Steve

    2000-01-01

    We have made a systematic study of how the activity of an Escherichia coli promoter is affected by the base sequence immediately upstream of the –10 hexamer. Starting with an activator-independent promoter, with a 17 bp spacing between the –10 and –35 hexamer elements, we constructed derivatives with all possible combinations of bases at positions –15 and –14. Promoter activity is greatest when the ‘non-template’ strand carries T and G at positions –15 and –14, respectively. Promoter activity can be further enhanced by a second T and G at positions –17 and –16, respectively, immediately upstream of the first ‘TG motif’. Our results show that the base sequence of the DNA segment upstream of the –10 hexamer can make a significant contribution to promoter strength. Using published collections of characterised E.coli promoters, we have studied the frequency of occurrence of ‘TG motifs’ upstream of the promoters’ –10 elements. We conclude that correctly placed ‘TG motifs’ are found at over 20% of E.coli promoters. PMID:10756184

  18. Codon choice in genes depends on flanking sequence information—implications for theoretical reverse translation

    PubMed Central

    Sivaraman, Karthikeyan; Seshasayee, AswinSaiNarain; Tarwater, Patrick M.; Cole, Alexander M.

    2008-01-01

    Algorithms for theoretical reverse translation have direct applications in degenerate PCR. The conventional practice is to create several degenerate primers each of which variably encode the peptide region of interest. In the current work, for each codon we have analyzed the flanking residues in proteins and determined their influence on codon choice. From this, we created a method for theoretical reverse translation that includes information from flanking residues of the protein in question. Our method, named the neighbor correlation method (NCM) and its enhancement, the consensus-NCM (c-NCM) performed significantly better than the conventional codon-usage statistic method (CSM). Using the methods NCM and c-NCM, we were able to increase the average sequence identity from 77% up to 81%. Furthermore, we revealed a significant increase in coverage, at 80% identity, from < 20% (CSM) to > 75% (c-NCM). The algorithms, their applications and implications are discussed herein. PMID:18203741

  19. GC constituents and relative codon expressed amino acid composition in cyanobacterial phycobiliproteins.

    PubMed

    Kannaujiya, Vinod K; Rastogi, Rajesh P; Sinha, Rajeshwar P

    2014-08-10

    The genomic as well as structural relationship of phycobiliproteins (PBPs) in different cyanobacterial species are determined by nucleotides as well as amino acid composition. The genomic GC constituents influence the amino acid variability and codon usage of particular subunit of PBPs. We have analyzed 11 cyanobacterial species to explore the variation of amino acids and causal relationship between GC constituents and codon usage. The study at the first, second and third levels of GC content showed relatively more amino acid variability on the levels of G3+C3 position in comparison to the first and second positions. The amino acid encoded GC rich level including G rich and C rich or both correlate the codon variability and amino acid availability. The fluctuation in amino acids such as Arg, Ala, His, Asp, Gly, Leu and Glu in ? and ? subunits was observed at G1C1 position; however, fluctuation in other amino acids such as Ser, Thr, Cys and Trp was observed at G2C2 position. The coding selection pressure of amino acids such as Ala, Thr, Tyr, Asp, Gly, Ile, Leu, Asn, and Ser in ? and ? subunits of PBPs was more elaborated at G3C3 position. In this study, we observed that each subunit of PBPs is codon specific for particular amino acid. These results suggest that genomic constraint linked with GC constituents selects the codon for particular amino acids and furthermore, the codon level study may be a novel approach to explore many problems associated with genomics and proteomics of cyanobacteria. PMID:24933001

  20. TP53 codon 72 polymorphism and glioma risk: A meta-analysis

    PubMed Central

    SHI, MINGHAN; HUANG, RUISHAN; PEI, CHUNYING; JIA, XIUZHI; JIANG, CHUANLU; REN, HUAN

    2011-01-01

    TP53 codon 72 polymorphism has been reported to affect regulatory networks central to glioma development. Although a number of published studies noted the association between TP53 codon 72 polymorphism and glioma risk, their conclusions were inconsistent. A meta-analysis was used to assess the possible association between TP53 codon 72 polymorphism and glioma risk. The PubMed databases were searched, relevant articles were identified and data were retrieved based on the inclusion criteria. The odds ratio (OR) and 95% confidence interval (95% CI) were determined on the pooled dataset. We retrieved eight different studies including 2,260 glioma cases and 3,506 controls. However, no association was found between the TP53 codon 72 polymorphism and glioma risk regarding the comparison between glioma cases and the controls. By further stratification based on criteria such as tumor grade, and the geographical location of the patients and the relevant controls, we found a significant association in the subgroup of patients with high-grade glioma in Europeans compared to controls in two models of TP53 codon 72 polymorphism, which include the dominant model [C/C + G/C vs. G/G: OR=1.35, 95% CI (1.14, 1.59), P=0.0005, Ph=0.13] and the additive model [C allele vs. G allele: OR=1.16, 95% CI (1.02, 1.33), P=0.03, Ph=0.37]. Our analysis suggests that TP53 codon 72 polymorphism is associated with an increased risk of high-grade glioma development in Europeans. PMID:22740959

  1. Upstream particle events close to the bow shock and 200 earth radii upstream - ISEE-1 and ISEE-3 observations

    NASA Technical Reports Server (NTRS)

    Scholer, M.; Hovestadt, D.; Klecker, B.; Ipavich, F. M.; Gloeckler, G.

    1980-01-01

    Two energetic particle events (28 keV - 145 keV) upstream of the earth's bow shock have been investigated with two identical experiments of the Max-Planck-Institut/University of Maryland on ISEE-1 and ISEE-3. Close to the bow shock the particle distribution is more or less isotropic and indicates strong scattering of these particles in the upstream wave field. At ISEE-3 the particles move essentially scatter-free from the general bow shock direction. The temporal evolution of the particle bursts is discussed in terms of the interplanetary magnetic field topology and the scattering conditions.

  2. 18. View to southwest. Detail, bearing shoe, upstream side of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. View to southwest. Detail, bearing shoe, upstream side of east pier. Copy negative made from 35mm color transparency made with with 135mm lens by John Snyder, due to lack of sufficiently long lens for 4x5 camera. - South Fork Trinity River Bridge, State Highway 299 spanning South Fork Trinity River, Salyer, Trinity County, CA

  3. 9. Detail, typical bearing, upstream side of west end of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Detail, typical bearing, upstream side of west end of Bridge Number 301.85, view to east, 210mm lens with electronic flash fill. - Southern Pacific Railroad Shasta Route, Bridge No. 301.85, Milepost 301.85, Pollard Flat, Shasta County, CA

  4. Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters

    E-print Network

    Bolshoy, Alexander

    Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters Alexander Bolshoy1 of the distribution of predicted intrinsic curvature along all available complete prokaryotic genomes, the genomes were divided into two groups. Curvature distribution in all prokaryotes of the first group indicated

  5. A Facilitator Method for Upstream Design Activities with Diverse Stakeholders

    E-print Network

    Wolf, Alexander L.

    A Facilitator Method for Upstream Design Activities with Diverse Stakeholders Regina M. Gonzales­ velop a product. The method centers on the role of the facilitator, an independent agent whose purpose developing the product determine what the product looks like. A product is designed based on a combination

  6. 9. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE: REINFORCEMENT DETAILS OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE: REINFORCEMENT DETAILS OF VALVE CONTROL STRUCTURE. Sheet A-20, July, 1939. File no. SA 342/29. - Prado Dam, Embankment, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

  7. 32. AERIAL VIEW OF TIETON DAM, UPSTREAM FACE OF DAM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. AERIAL VIEW OF TIETON DAM, UPSTREAM FACE OF DAM (Trashrack-structure for outlet at lower left in reservoir, spillway at upper left. Reservoir nearly empty due to drought.) - Tieton Dam, South & East of State Highway 12, Naches, Yakima County, WA

  8. Recommendations for the Implementation of Upstream Interventions in Sc hools

    Microsoft Academic Search

    Melanie Pescud; Simone Pettigrew

    2011-01-01

    In light of the childhood obesity problems affecting Australia and other developed nations, this study investigated parents' attitudes to a school food policy recently introduced into Western Australian government schools. The aim of the study was to develop recommendations for future efforts to implement upstream interventions in school settings. In total, 612 parents of primary and secondary school students responded

  9. View of upstream face of the forebay dam of Grand ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of upstream face of the forebay dam of Grand Coulee Dam, looking west. Construction of the forebay dam, which replaced the eastern end of the original Grand Coulee Dam, was completed in 1974. - Columbia Basin Project, Grand Coulee Dam & Franklin D. Roosevelt Lake, Across Columbia River, Southeast of Town of Grand Coulee, Grand Coulee, Grant County, WA

  10. 2. UPSTREAM SIDE OF DAM AND BRIDGE WITH ABANDONED SAN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. UPSTREAM SIDE OF DAM AND BRIDGE WITH ABANDONED SAN TAN FLOOD-WATER HEADGATE IN FOREGROUND. TAKEN FROM NORTH END OF DAM - San Carlos Irrigation Project, Sacaton Dam & Bridge, Gila River, T4S R6E S12/13, Coolidge, Pinal County, AZ

  11. Exploiting Common Mode signals for FEXT cancellation in upstream VDSL

    Microsoft Academic Search

    Arun Kumar; S. M. Zafaruddin; Shankar Prakriya; Surendra Prasad

    2008-01-01

    In this paper, we study the utility of the Common Mode (CM) signal for Far End Crosstalk (FEXT) cancellation in upstream Very high-speed Digital Subscriber Line (VDSL). We begin by extending the stochastic channel model developed for Differential Mode (DM) signals to model the channels of both CM and DM signals. The characteristics of the resulting CM-DM joint channel are

  12. 4. AERATOR AT 525, CONSTRUCTED 19371938, VIEW FROM UPSTREAM (TRASH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. AERATOR AT 525, CONSTRUCTED 1937-1938, VIEW FROM UPSTREAM (TRASH SCREEN REMOVED FOR CLARITY), WATER FROM INTAKE FLOWS THROUGH FLUME, THEN DAMS, AND SPILLS OVER STEPS TO MIX WITH OXYGEN, THUS REDUCING ACIDITY LEVELS. ACID INDUCES FASTER CORROSION OF PIPES AND SPOILS TASTE. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  13. View of Stehr Lake from FS 502 looking upstream (northeast). ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of Stehr Lake from FS 502 looking upstream (northeast). Vehicle at right center is parked on earthen Upper Stehr Lake Dam. - Childs-Irving Hydroelectric Project, Childs System, Stehr Lake & Dams, Forest Service Road 708/502, Camp Verde, Yavapai County, AZ

  14. 3. FORMER INTAKE DAM NO. 2, VIEW LOOKING UPSTREAM AT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. FORMER INTAKE DAM NO. 2, VIEW LOOKING UPSTREAM AT LEFT IS RUBBLE MASONRY COVERING INTERSECTION OF THE TWO IRON PIPES FROM NEW DAM ENTERING OLD INTAKE OPENING AT RIGHT IS BOX FLUME LEADING TO AERATOR. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  15. 18. WAIKOLU STREAM CROSSING NO. 2, VIEW UPSTREAM. IRON PIPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. WAIKOLU STREAM CROSSING NO. 2, VIEW UPSTREAM. IRON PIPE RUNS WITHIN CONCRETE AND RUBBLE STRUCTURE AND CONTINUES BURIED UNTIL REACHING PIERS UNDER THE PALL. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  16. VIEW OF UPSTREAM (EAST) SIDES OF UPPER (EAST) END OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW OF UPSTREAM (EAST) SIDES OF UPPER (EAST) END OF LOCK, SOUTHEAST AND NORTHEAST CONTROL HOUSES, LOCK UNDER REPAIR, BUILDING NOS. 51, 52 AND SOUTHWEST CONTROL HOUSE IN BACKGROUND, VIEW TOWARDS WEST-NORTHWEST - Ortona Lock, Lock No. 2, Machinery and Control Houses, Caloosahatchee River, Cross-State Canal, Okeechobee Intracoastal Waterway, Ortona, Glades County, FL

  17. Specific Bacterial Suppressors of MAMP Signaling Upstream of MAPKKK

    E-print Network

    Sheen, Jen

    @molbio.mgh.harvard.edu DOI 10.1016/j.cell.2006.02.047 SUMMARY Plants and animals possess innate immune sys- tems to prevent MAMP-mediated signaling upstream of MAPKKK at the plasma membrane linked to the receptor. In transgenic) marker-gene activation. We performed a cell-based genetic screen of viru- lence factors and identified

  18. 6. AERATOR VIEWED UPSTREAM. DETAIL OF FLUSH VALVE AND VIEW ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. AERATOR VIEWED UPSTREAM. DETAIL OF FLUSH VALVE AND VIEW INTO BOX FLUME. NOTE WRENCH TO OPEN VALVE AND REMAINS OF OLD SHOVEL USED FOR MAINTENANCE. TRASH SCREEN MESH IS SEEN AT BOTTOM LEFT. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  19. 1. OVERALL VIEW OF WHITE MILLER LAKE AND UPSTREAM FACE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. OVERALL VIEW OF WHITE MILLER LAKE AND UPSTREAM FACE OF DAM, LOOKING NORTH - High Mountain Dams in Upalco Unit, White Miller Lake Dam, Ashley National Forest, 6.9 miles North of Swift Creek Campground, Mountain Home, Duchesne County, UT

  20. 1. VIEW NORTH FROM UPSTREAM WITH IMPOUNDED LAKE AND (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. VIEW NORTH FROM UPSTREAM WITH IMPOUNDED LAKE AND (LEFT TO RIGHT): EARTHEN DIKE, HYDROELECTRIC GENERATING FACILITY, AND DAM - Middle Creek Hydroelectric Dam, On Middle Creek, West of U.S. Route 15, 3 miles South of Selinsgrove, Selinsgrove, Snyder County, PA

  1. 23. VIEW LOOKING UPSTREAM AND TOWARD LEFT ABUTMENT OF DAM. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW LOOKING UPSTREAM AND TOWARD LEFT ABUTMENT OF DAM. NOTE FORMS FOR LEFT GRAVITY ABUTMENT AT UPPER RIGHT CORNER OF PICTURE. ARCHES 3, 4, 5, AND 7 COMPLETED TO ELEVATION 1795. 5 OR 7.5 FEET BELOW TOP OF PARAPET WALL. November 29, 1938 - Bartlett Dam, Verde River, Phoenix, Maricopa County, AZ

  2. 25. UPSTREAM VIEW OF LOWER END OF OUTLET STRUCTURE SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. UPSTREAM VIEW OF LOWER END OF OUTLET STRUCTURE SHOWING FORMS IN PLACE FOR GRAVITY WALL SECTIONS.... Volume XVI, No. 16, August 16, 1939. - Prado Dam, Outlet Works, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

  3. 6. GENERAL VIEW OF DAM, LOOKING UPSTREAM TOWARD RIGHT ABUTMENT. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. GENERAL VIEW OF DAM, LOOKING UPSTREAM TOWARD RIGHT ABUTMENT. LEVEL PART OF TRUSSED WALKWAY IS AT ELEVATION 1740. BUTTRESSES 3 (ON EXTREME LEFT), 4, 5, 6 AND 7 COMPLETED TO ELEVATION 1690. May 30, 1938 - Bartlett Dam, Verde River, Phoenix, Maricopa County, AZ

  4. 13. Detail, upper chord connection point on upstream side of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. Detail, upper chord connection point on upstream side of truss, showing connection of upper chord, laced vertical compression member, knee-braced strut, counters, and laterals. - Red Bank Creek Bridge, Spanning Red Bank Creek at Rawson Road, Red Bluff, Tehama County, CA

  5. 42. VIEW OF STAGE RECORDER AT END OF UPSTREAM GUIDE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. VIEW OF STAGE RECORDER AT END OF UPSTREAM GUIDE WALL, LOOKING NORTHEAST. (Several hours after this view was taken, the stage recorder was hit a~d heavily damaged by a grain barge.) - Upper Mississippi River 9-Foot Channel, Lock & Dam No. 9, Lynxville, Crawford County, WI

  6. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    ERIC Educational Resources Information Center

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  7. Nonsense ?-thalassemia mutation at codon 37 (TGG>TGA), detected for the first time in three Turkish cases.

    PubMed

    Bozdogan, Sevcan Tug; Unsal, Cagatay; Erkman, Hakan; Genc, Ahmet; Yuregir, Ozge Ozalp; Muslumanoglu, Muhammed Hamza; Aslan, Huseyin

    2012-01-01

    Thalassemias are genetically heterogeneous group of disorders with reduced or absent production of globin. ?-Thalassemia major can be caused by homozygosity or compound heterozygosity for ?-globin gene mutation. Here we report, for the first time in Turkey, three cases who carry the nonsense ?-thalassemia (?-thal) mutation at codon 37 (TGG>TGA; Trp?Stop) causing premature stop codon. PMID:22385009

  8. Unexpected correlations between gene expression and codon usage bias from microarray data for the whole Escherichia coli K-12 genome

    Microsoft Academic Search

    Mario dos Reis; Lorenz Wernisch; Renos Savva

    2003-01-01

    Escherichia coli has long been regarded as a model organism in the study of codon usage bias (CUB). However, most studies in this organism regarding this topic have been computational or, when experi- mental, restricted to small datasets; particularly poor attention has been given to genes with low CUB. In this work, correspondence analysis on codon usage is used to

  9. Analysis of Synonymous Codon Usage Bias in Pseudomonas Syringae Phages: Implication in Phage Therapy for Halo Blight Disease

    Microsoft Academic Search

    Shashank Sharma; Ambrish Sharan Vidyarthi; Raju Poddar

    2008-01-01

    Halo blight disease caused due Pseudomonas syringae results extensive losses in dry Beans. Phage therapy can be tried as an alternative treatment. For evaluation of synonymous codon usage and codon variation, 20 phages of Pseudomonas has been taken for testing. The effect of GC concentration in the phages can be consid- ered for analyzing virulence in these phages. Mutational biasing

  10. Hill-Robertson Interference is a Minor Determinant of Variations in Codon Bias Across Drosophila melanogaster and Caenorhabditis elegans Genomes

    Microsoft Academic Search

    Gabriel Marais; Gwenael Piganeau

    According to population genetics models, genomic regions with lower crossing-over rates are expected to experience less effective selection because of Hill-Robertson interference (HRi). The effect of genetic linkage is thought to be particularly important for a selection of weak intensity such as selection affecting codon usage. Consistent with this model, codon bias correlates positively with recombination rate in Drosophila melanogaster

  11. On the Limitations of Using Ribosomal Genes as References for the Study of Codon Usage: A Rebuttal

    E-print Network

    Petrov, Dmitri

    , used ribosomal genes as a reference set for the study of patterns of codon usage. We discuss here Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided codon bias (reviewed in [1,2]). The nucleotide content of the genome at large is explained by background

  12. Turning point Getting started

    E-print Network

    Uppsala Universitet

    Turning point Getting started To use clickers the program TurningPoint is used. TurningPoint is compatible with Powerpoint and to access TurningPoints functions simple open any powerpoint file through TurningPoint. You don't need to create the presentation in TurningPoint, apart from the questions. You can

  13. Getting started information)

    E-print Network

    Mumby, Peter J.

    in this workbook do not hesitate to ask your manager/supervisor. CASUAL INDUCTION WORKBOOK Print Services #12;Print Print Services What will you be doing? The type of tasks you will be carrying out will include. Page 2 Getting Started #12;Applying for shifts Page 3 Print Services Induction Workbook Please fill

  14. Start a Rock Collection

    NSDL National Science Digital Library

    American Museum of Natural History

    2012-06-26

    Learners follow a three-step process to start their own rock collection. Learners will collect rocks, record information about each rock on a Rock Chart, observe and sort their rocks, and create a rock display. This activity also includes a book list with resources for rock classification.

  15. Starting in School

    ERIC Educational Resources Information Center

    Albertine, Susan

    2012-01-01

    Through its signature initiative, Liberal Education and America's Promise (LEAP), the Association of American Colleges and Universities (AAC&U) is promoting a vision for learning that begins in school: Starting in School . . . Rigorous and rich curriculum focused on the essential learning outcomes; comprehensive, individualized, and…

  16. "New Start at 45."

    ERIC Educational Resources Information Center

    Greenstein, Pearl

    1989-01-01

    New Start at 45, operated by Fujitsu Ltd. in Japan, is a management development course for 45-year-old adults in management or supervisory positions. Two components are a 6-week liberal arts curriculum and a 2-week, intensive course in either international management, sales management, or subsidiaries management. Benefits include increased…

  17. Starting A Program.

    ERIC Educational Resources Information Center

    Costello, Phillip M.

    Many instructors and managers of adventure programs come to a time in their careers when they consider starting a program. In all cases, such a consideration begins with an idea. Evaluation of an idea's feasibility involves: (1) development of a program description that includes goals and objectives; (2) review of the proposal by others; (3)…

  18. StartMe

    NSDL National Science Digital Library

    The StartMe application gives Internet users the opportunity to create their own personal browser startpage with their favorite bookmarks and RSS feeds. The drag and drop interface is user-friendly, particularly for computer neophytes. Visitors can also incorporate extensions for popular browsers or tweak the appearance of their startpage as they see fit. This version is compatible with all operating systems.

  19. Mean velocities and Reynolds stresses upstream of a simulated wing-fuselage juncture

    NASA Technical Reports Server (NTRS)

    Mcmahon, H.; Hubbartt, J.; Kubendran, L. R.

    1983-01-01

    Values of three mean velocity components and six turbulence stresses measured in a turbulent shear layer upstream of a simulated wing-fuselage juncture and immediately downstream of the start of the juncture are presented nd discussed. Two single-sensor hot-wire probes were used in the measurements. The separated region just upstream of the wing contains an area of reversed flow near the fuselage surface where the turbulence level is high. Outside of this area the flow skews as it passes around the body, and in this skewed region the magnitude and distribution of the turbulent normal and shear stresses within the shear layer are modified slightly by the skewing and deceleration of the flow. A short distance downstream of the wing leading edge the secondary flow vortext is tightly rolled up and redistributes both mean flow and turbulence in the juncture. The data acquisition technique employed here allows a hot wire to be used in a reversed flow region to indicate flow direction.

  20. A complex androgen-responsive enhancer resides 2 kilobases upstream of the mouse Slp gene.

    PubMed Central

    Loreni, F; Stavenhagen, J; Kalff, M; Robins, D M

    1988-01-01

    Neighboring genes encoding the mouse sex-limited protein (Slp) and fourth component of complement (C4) show extensive homology. In contrast to C4, however, Slp is regulated by androgen. One region of the Slp gene capable of hormonal response following transfection was located about 2 kilobases upstream of the transcription start site, where the C4 and Slp sequences diverge. This region, delimited here to a 0.75-kilobase fragment, showed cryptic promoter activity as well as androgen responsiveness in either orientation in front of the bacterial chloramphenicol acetyltransferase coding region. When this fragment was placed upstream of a viral long terminal repeat, increased chloramphenicol acetyltransferase expression derived from the viral promoter. Proteins from nuclear extracts specifically bound to four sequences within the region, near sites that are DNase I hypersensitive in vivo and reflect the hormonal and developmental regulation of Slp. Like several other cellular enhancers, this androgen-responsive element seems to be modular in nature and complex in its function. Images PMID:3165490

  1. Sucrose Control of Translation Mediated by an Upstream Open Reading Frame-Encoded Peptide1[W][OA

    PubMed Central

    Rahmani, Fatemeh; Hummel, Maureen; Schuurmans, Jolanda; Wiese-Klinkenberg, Anika; Smeekens, Sjef; Hanson, Johannes

    2009-01-01

    Regulation of gene expression through translational control is common in many organisms. The Arabidopsis (Arabidopsis thaliana) transcription factor bZIP11 is translational repressed in response to sucrose (Suc), resulting in Suc-regulated changes in amino acid metabolism. The 5? leader of the bZIP11 mRNA harbors several upstream open reading frames (uORFs), of which the second uORF is well conserved among bZIP11 homologous genes. The uORF2 element encodes a Suc control peptide (SC-peptide) of 28 residues that is sufficient for imposing Suc-induced repression of translation (SIRT) on a heterologous mRNA. Detailed analysis of the SC-peptide suggests that it functions as an attenuator peptide. Results suggest that the SC-peptide inhibits bZIP11 translation in response to high Suc levels by stalling the ribosome on the mRNA. The conserved noncanonical AUG contexts of bZIP11 uORFs allow inefficient translational initiation of the uORF, resulting in translation initiation of the scanning ribosome at the AUG codon of the bZIP11 main ORF. The results presented show that Suc-dependent signaling mediates differential translation of mRNAs containing SC-peptides encoding uORFs. PMID:19403731

  2. Translation of the human erythropoietin transcript is regulated by an upstream open reading frame in response to hypoxia

    PubMed Central

    Barbosa, Cristina; Romão, Luísa

    2014-01-01

    Erythropoietin (EPO) is a key mediator hormone for hypoxic induction of erythropoiesis that also plays important nonhematopoietic functions. It has been shown that EPO gene expression regulation occurs at different levels, including transcription and mRNA stabilization. In this report, we show that expression of EPO is also regulated at the translational level by an upstream open reading frame (uORF) of 14 codons. As judged by comparisons of protein and mRNA levels, the uORF acts as a cis-acting element that represses translation of the main EPO ORF in unstressed HEK293, HepG2, and HeLa cells. However, in response to hypoxia, this repression is significantly released, specifically in HeLa cells, through a mechanism that involves processive scanning of ribosomes from the 5? end of the EPO transcript and enhanced ribosome bypass of the uORF. In addition, we demonstrate that in HeLa cells, hypoxia induces the phosphorylation of eukaryotic translation initiation factor 2? (eIF2?) concomitantly with a significant increase of EPO protein synthesis. These findings provide a framework for understanding that production of high levels of EPO induced by hypoxia also involves regulation at the translational level. PMID:24647661

  3. Selection on GGU and CGU codons in the high expression genes in bacteria.

    PubMed

    Satapathy, Siddhartha Sankar; Powdel, Bhesh Raj; Dutta, Malay; Buragohain, Alak Kumar; Ray, Suvendra Kumar

    2014-01-01

    The fourfold degenerate site (FDS) in coding sequences is important for studying the effect of any selection pressure on codon usage bias (CUB) because nucleotide substitution per se is not under any such pressure at the site due to the unaltered amino acid sequence in a protein. We estimated the frequency variation of nucleotides at the FDS across the eight family boxes (FBs) defined as Um(g), the unevenness measure of a gene g. The study was made in 545 species of bacteria. In many bacteria, the Um(g) correlated strongly with Nc'-a measure of the CUB. Analysis of the strongly correlated bacteria revealed that the U-ending codons (GGU, CGU) were preferred to the G-ending codons (GGG, CGG) in Gly and Arg FBs even in the genomes with G+C % higher than 65.0. Further evidence suggested that these codons can be used as a good indicator of selection pressure on CUB in genomes with higher G+C %. PMID:24271854

  4. Predicting Gene Expression Level from Relative Codon Usage Bias: An Application to Escherichia coli Genome

    PubMed Central

    Roymondal, Uttam; Das, Shibsankar; Sahoo, Satyabrata

    2009-01-01

    We present an expression measure of a gene, devised to predict the level of gene expression from relative codon bias (RCB). There are a number of measures currently in use that quantify codon usage in genes. Based on the hypothesis that gene expressivity and codon composition is strongly correlated, RCB has been defined to provide an intuitively meaningful measure of an extent of the codon preference in a gene. We outline a simple approach to assess the strength of RCB (RCBS) in genes as a guide to their likely expression levels and illustrate this with an analysis of Escherichia coli (E. coli) genome. Our efforts to quantitatively predict gene expression levels in E. coli met with a high level of success. Surprisingly, we observe a strong correlation between RCBS and protein length indicating natural selection in favour of the shorter genes to be expressed at higher level. The agreement of our result with high protein abundances, microarray data and radioactive data demonstrates that the genomic expression profile available in our method can be applied in a meaningful way to the study of cell physiology and also for more detailed studies of particular genes of interest. PMID:19131380

  5. Serine tRNA complementary to the nonuniversal serine codon CUG in Candida cylindracea: evolutionary implications.

    PubMed Central

    Yokogawa, T; Suzuki, T; Ueda, T; Mori, M; Ohama, T; Kuchino, Y; Yoshinari, S; Motoki, I; Nishikawa, K; Osawa, S

    1992-01-01

    In the asporogenic yeast Candida cylindracea, the codon CUG is read as serine instead of leucine. This is an unusual instance in which the amino acid assignment of a codon deviates from the universal code. To infer the evolutionary process of this change, the tRNA with the anticodon sequence CAG, which is complementary to and thus responsible for translation of the codon CUG, has been identified. Indeed, this tRNA translates an in-frame CUG codon in a synthetic mRNA as serine in an in vitro translation system. The gene for the tRNA is interrupted by an intron in the anticodon loop. Sequence comparisons of the tRNA and its gene suggest that a single cytidine was inserted into the anticodon loop of the gene for tRNA(Ser)IGA during evolution to produce tRNA(Ser)CAG. The tRNA(Ser)CAG may be produced from its precursor molecule containing the cytidine insertion by splicing. PMID:1502151

  6. Strong short-range correlations and dichotomic codon classes in coding DNA sequences

    NASA Astrophysics Data System (ADS)

    Gonzalez, Diego Luis; Giannerini, Simone; Rosa, Rodolfo

    2008-11-01

    The study of correlation structures in DNA sequences is of great interest because it allows us to obtain structural and functional information about underlying genetic mechanisms. In this paper we present a study of the correlation structure of protein coding sequences of DNA based on a recently developed mathematical representation of the genetic code. A fundamental consequence of such representation is that codons can be assigned a parity class (odd-even). Such parity can be obtained by means of a nonlinear algorithm acting on the chemical character of the codon bases. In the same setting the Rumer’s class can be naturally described and a new dichotomic class, the hidden class, can be defined. Moreover, we show that the set of DNA’s base transformations associated to the three dichotomic classes can be put in a compact group-theoretic framework. We use the dichotomic classes as a coding scheme for DNA sequences and study the mutual dependence between such classes. The same analysis is carried out also on the chemical dichotomies of DNA bases. In both cases, the statistical analysis is performed by using an entropy-based dependence metric possessing many desirable properties. We obtain meaningful tests for mutual dependence by using suitable resampling techniques. We find strong short-range correlations between certain combinations of dichotomic codon classes. These results support our previous hypothesis that codon classes might play an active role in the organization of genetic information.

  7. Strong short-range correlations and dichotomic codon classes in coding DNA sequences.

    PubMed

    Gonzalez, Diego Luis; Giannerini, Simone; Rosa, Rodolfo

    2008-11-01

    The study of correlation structures in DNA sequences is of great interest because it allows us to obtain structural and functional information about underlying genetic mechanisms. In this paper we present a study of the correlation structure of protein coding sequences of DNA based on a recently developed mathematical representation of the genetic code. A fundamental consequence of such representation is that codons can be assigned a parity class (odd-even). Such parity can be obtained by means of a nonlinear algorithm acting on the chemical character of the codon bases. In the same setting the Rumer's class can be naturally described and a new dichotomic class, the hidden class, can be defined. Moreover, we show that the set of DNA's base transformations associated to the three dichotomic classes can be put in a compact group-theoretic framework. We use the dichotomic classes as a coding scheme for DNA sequences and study the mutual dependence between such classes. The same analysis is carried out also on the chemical dichotomies of DNA bases. In both cases, the statistical analysis is performed by using an entropy-based dependence metric possessing many desirable properties. We obtain meaningful tests for mutual dependence by using suitable resampling techniques. We find strong short-range correlations between certain combinations of dichotomic codon classes. These results support our previous hypothesis that codon classes might play an active role in the organization of genetic information. PMID:19113166

  8. Viral adaptation to host: a proteome-based analysis of codon usage and amino acid preferences

    Microsoft Academic Search

    Iris Bahir; Menachem Fromer; Yosef Prat; Michal Linial

    2009-01-01

    Viruses differ markedly in their specificity toward host organisms. Here, we test the level of general sequence adaptation that viruses display toward their hosts. We compiled a representative data set of viruses that infect hosts ranging from bacteria to humans. We consider their respective amino acid and codon usages and compare them among the viruses and their hosts. We show

  9. Conservation of CFTR codon frequency through primates suggests synonymous mutations could have a functional effect.

    PubMed

    Pizzo, Lucilla; Iriarte, Andrés; Alvarez-Valin, Fernando; Marín, Mónica

    2015-05-01

    Cystic fibrosis is an inherited chronic disease that affects the lungs and digestive system, with a prevalence of about 1:3000 people. Cystic fibrosis is caused by mutations in CFTR gene, which lead to a defective function of the chloride channel, the cystic fibrosis transmembrane conductance regulator (CFTR). Up-to-date, more than 1900 mutations have been reported in CFTR. However for an important proportion of them, their functional effects and the relation to disease are still not understood. Many of these mutations are silent (or synonymous), namely they do not alter the encoded amino acid. These synonymous mutations have been considered as neutral to protein function. However, more recent evidence in bacterial and human proteins has put this concept under revision. With the aim of understanding possible functional effects of synonymous mutations in CFTR, we analyzed human and primates CFTR codon usage and divergence patterns. We report the presence of regions enriched in rare and frequent codons. This spatial pattern of codon preferences is conserved in primates, but this cannot be explained by sequence conservation alone. In sum, the results presented herein suggest a functional implication of these regions of the gene that may be maintained by purifying selection acting to preserve a particular codon usage pattern along the sequence. Overall these results support the idea that several synonymous mutations in CFTR may have functional importance, and could be involved in the disease. PMID:25839760

  10. HER2 Codon 655 Polymorphism and Risk of Breast Cancer in African Americans and Whites

    Microsoft Academic Search

    Robert Millikan; Allison Eaton; Kendra Worley; Lorna Biscocho; Elizabeth Hodgson; Wen-Yi Huang; Joseph Geradts; Mary Iacocca; David Cowan; Kathleen Conway; Lynn Dressler

    2003-01-01

    Background. Several recent epidemiologic studies examined the association between breast cancer risk and an inherited, single-nucleotide polymorphism in the HER2 gene, codon 655 G to A, which leads to an amino acid substitution of Ile to Val. Results of previous studies have been mixed, with most studies showing no association but some suggesting an association in younger women or women

  11. Translation efficiency is determined by both codon bias and folding energy

    E-print Network

    Ruppin, Eytan

    . There is a significant association between codon bias and translation efficiency across all endoge- nous genes in E. coli a genome-scale study aiming at dissecting the determi- nants of translation efficiency the genomic profiles of ribosomal density and genomic profiles of folding energy across mRNA, suggesting

  12. Unusual base pairing during the decoding of a stop codon by the ribosome.

    PubMed

    Fernández, Israel S; Ng, Chyan Leong; Kelley, Ann C; Wu, Guowei; Yu, Yi-Tao; Ramakrishnan, V

    2013-08-01

    During normal translation, the binding of a release factor to one of the three stop codons (UGA, UAA or UAG) results in the termination of protein synthesis. However, modification of the initial uridine to a pseudouridine (?) allows efficient recognition and read-through of these stop codons by a transfer RNA (tRNA), although it requires the formation of two normally forbidden purine-purine base pairs. Here we determined the crystal structure at 3.1?Å resolution of the 30S ribosomal subunit in complex with the anticodon stem loop of tRNA(Ser) bound to the ?AG stop codon in the A site. The ?A base pair at the first position is accompanied by the formation of purine-purine base pairs at the second and third positions of the codon, which show an unusual Watson-Crick/Hoogsteen geometry. The structure shows a previously unsuspected ability of the ribosomal decoding centre to accommodate non-canonical base pairs. PMID:23812587

  13. Analysis of leaky viral translation termination codons in vivo by transient expression of improved ?-glucuronidase vectors

    Microsoft Academic Search

    James M. Skuzeski; Lindy M. Nichols; Raymond F. Gesteland

    1990-01-01

    Plant RNA viruses commonly exploit leaky translation termination signals in order to express internal protein coding regions. As a first step to elucidate the mechanism(s) by which ribosomes bypass leaky stop codons in vivo, we have devised a system in which readthrough is coupled to the transient expression of ß-glucuronidase (GUS) in tobacco protoplasts. GUS vectors that contain the stop

  14. Protein elemental sparing and codon usage bias are correlated among bacteria

    E-print Network

    Wagner, Andreas

    , in terms of the quantities of carbon (C), nitrogen (N) or sulphur (S) atoms they contain. This `elemental that are relatively poor in elements that can be growth limiting (carbon, nitrogen or sulphur). As evidenceProtein elemental sparing and codon usage bias are correlated among bacteria JASON G. BRAGG

  15. PAL2NAL: robust conversion of protein sequence alignments into the corresponding codon alignments

    Microsoft Academic Search

    Mikita Suyama; David Torrents; Peer Bork

    2006-01-01

    PAL2NAL is a web server that constructs a multiple codonalignmentfromthecorrespondingalignedpro- tein sequences. Such codon alignments can be used to evaluate the type and rate of nucleotide substitu- tions in coding DNA for a wide range of evolutionary analyses, such as the identification of levels of selective constraint acting on genes, or to perform DNA-based phylogenetic studies. The server takes a

  16. Is DNA Code Periodicity Only Due to CUF - Codons Usage Frequency?

    Microsoft Academic Search

    Mariusz Zoltowski; Nicolaus Copernicus

    2007-01-01

    The triplet code for proteins and functional RNA has been either from the universal pattern of ancient RNA (- HI) [1], with a key role of an uneven codon usage frequency (CUF) in the periodic patterns origination, or a reading frame monitoring device (RFMD -H2) [2- 4]. HI has lately been upheld [1] but in a single sequence sensitive way

  17. Codon conservation in the influenza A virus genome defines RNA packaging signals

    Microsoft Academic Search

    Julia R. Gog; Emmanuel Dos Santos Afonso; Rosa M. Dalton; India Leclercq; Laurence Tiley; Debra Elton; Johann C. von Kirchbach; Nadia Naffakh; Nicolas Escriou; Paul Digard

    2007-01-01

    Genome segmentation facilitates reassortment and rapid evolution of influenza A virus. However, segmentation complicates particle assembly as virions must contain all eight vRNA species to be infectious. Specific packaging signals exist that extend into the coding regions of most if not all segments, but these RNA motifs are poorly defined. We measured codon variability in a large dataset of sequences

  18. Genomic adaptation of the ISA virus to Salmo salar codon usage

    PubMed Central

    2013-01-01

    Background The ISA virus (ISAV) is an Orthomyxovirus whose genome encodes for at least 10 proteins. Low protein identity and lack of genetic tools have hampered the study of the molecular mechanism behind its virulence. It has been shown that viral codon usage controls several processes such as translational efficiency, folding, tuning of protein expression, antigenicity and virulence. Despite this, the possible role that adaptation to host codon usage plays in virulence and viral evolution has not been studied in ISAV. Methods Intergenomic adaptation between viral and host genomes was calculated using the codon adaptation index score with EMBOSS software and the Kazusa database. Classification of host genes according to GeneOnthology was performed using Blast2go. A non parametric test was applied to determine the presence of significant correlations among CAI, mortality and time. Results Using the codon adaptation index (CAI) score, we found that the encoding genes for nucleoprotein, matrix protein M1 and antagonist of Interferon I signaling (NS1) are the ISAV genes that are more adapted to host codon usage, in agreement with their requirement for production of viral particles and inactivation of antiviral responses. Comparison to host genes showed that ISAV shares CAI values with less than 0.45% of Salmo salar genes. GeneOntology classification of host genes showed that ISAV genes share CAI values with genes from less than 3% of the host biological process, far from the 14% shown by Influenza A viruses and closer to the 5% shown by Influenza B and C. As well, we identified a positive correlation (p<0.05) between CAI values of a virus and the duration of the outbreak disease in given salmon farms, as well as a weak relationship between codon adaptation values of PB1 and the mortality rates of a set of ISA viruses. Conclusions Our analysis shows that ISAV is the least adapted viral Salmo salar pathogen and Orthomyxovirus family member less adapted to host codon usage, avoiding the general behavior of host genes. This is probably due to its recent emergence among farmed Salmon populations. PMID:23829271

  19. Analysis of Low Frequency Protein Truncating Stop-Codon Variants and Fasting Concentration of Growth Hormone

    PubMed Central

    Hallengren, Erik; Almgren, Peter; Engström, Gunnar; Persson, Margaretha; Melander, Olle

    2015-01-01

    Background The genetic background of Growth Hormone (GH) secretion is not well understood. Mutations giving rise to a stop codon have a high likelihood of affecting protein function. Objectives To analyze likely functional stop codon mutations that are associated with fasting plasma concentration of Growth Hormone. Methods We analyzed stop codon mutations in 5451 individuals in the Malmö Diet and Cancer study by genotyping the Illumina Exome Chip. To enrich for stop codon mutations with likely functional effects on protein function, we focused on those disrupting >80% of the predicted amino acid sequence, which were carried by ?10 individuals. Such mutations were related to GH concentration, measured with a high sensitivity assay (hs-GH) and, if nominally significant, to GH related phenotypes, using linear regression analysis. Results Two stop codon mutations were associated with the fasting concentration of hs-GH. rs121909305 (NP_005370.1:p.R93*) [Minor Allele Frequency (MAF) = 0.8%] in the Myosin 1A gene (MYO1A) was associated with a 0.36 (95%CI, 0.04 to 0.54; p=0.02) increment of the standardized value of the natural logarithm of hs-GH per 1 minor allele and rs35699176 (NP_067040.1:p.Q100*) in the Zink Finger protein 77 gene (ZNF77) (MAF = 4.8%) was associated with a 0.12 (95%CI, 0.02 to 0.22; p = 0.02) increase of hs-GH. The mutated high hs-GH associated allele of MYO1A was related to lower BMI (?-coefficient, -0.22; p = 0.05), waist (?-coefficient, -0.22; p = 0.04), body fat percentage (?-coefficient, -0.23; p = 0.03) and with higher HDL (?-coefficient, 0.23; p = 0.04). The ZNF77 stop codon was associated with height (?-coefficient, 0.11; p = 0.02) but not with cardiometabolic risk factors. Conclusion We here suggest that a stop codon of MYO1A, disrupting 91% of the predicted amino acid sequence, is associated with higher hs-GH and GH-related traits suggesting that MYO1A is involved in GH metabolism and possibly body fat distribution. However, our results are preliminary and need replication in independent populations. PMID:26086970

  20. When to Start Antiretroviral Therapy

    MedlinePLUS

    ... circumstances. What factors influence the decision to start ART? When to start ART depends on the following ... an important factor in deciding when to start ART? A CD4 count measures the number of CD4 ...

  1. Codon optimization enhances the expression of porcine ?-defensin-2 in Escherichia coli.

    PubMed

    Gao, C Y; Xu, T T; Zhao, Q J; Li, C L

    2015-01-01

    Porcine ?-defensin-2 (pBD2) is a cationic antimicrobial peptide that has therapeutic potential. The amount of pBD2 in nature is limited, and the expression of pBD2 in Escherichia coli is low, probably because a different gene codon is used by prokaryotic organisms to that used by eukaryotes. Codon preference optimization is one of the ways to increase heterologous expression of pBD2. To achieve high expression of pBD2, the pBD2 gene was redesigned according to the preferred codon in E. coli without altering the amino acid sequence. The optimized gene was inserted into expression vector pET-30a and transformed into E. coli BL21 (DE3) plysS. Our results showed that pBD2 was expressed as His-Tag fusion protein at a level that was approximately 4-6 times greater than from the native gene, based on total protein expression. Expressed fusion pBD2 showed antimicrobial activity against both E. coli and Staphylococcus aureus. Moreover, pBD2 showed weak hemolytic activity and strong heat resistance. These results indicate that fusion pBD2 is functional and has similar properties to those of pBD2 from the native gene. Our current study demonstrated that codon optimization could enhance pBD2 expression in E. coli without altering its function. Therefore, the expression of pBD2 after codon optimization in heterologous host cells might be useful and is worthy of further research. PMID:25966273

  2. The GlueX Start Counter

    NASA Astrophysics Data System (ADS)

    Llodra, Anthony; Pooser, Eric; GlueX Collaboration

    2015-04-01

    The GlueX experiment, which is online as of October of 2014, will study meson photo production with unprecedented precision. This experiment will use the coherent bremsstrahlung technique to produce a 9 GeV linearly polarized photon beam incident on a liquid H2 target kept at a few degrees Kelvin. A Start Counter detector has been fabricated to identify the accelerator electron beam buckets, approximately 2 nanoseconds apart, and to provide accurate timing information. This detector is designed to operate at photon intensities of up to 108 ?/s in the coherent peak and provide a timing resolution of less than 350 picoseconds so as to provide successful identification of the electron beam buckets. It consists of a cylindrical array of 30 scintillators with pointed ends that bend towards the beam at the downstream end. The EJ-200 scintillator is best suited for the Start Counter due to its fast decay time on the order of 2 nanoseconds and long attenuation length. Silicon Photo Multiplier (SiPM) detectors have been selected as the readout system and are to be placed as close as possible, less than 300 micron, to the upstream end of each scintillator. The methods/details of the assembly and the optimization of the surface quality of scintillator paddles are discussed. This work was supported in part by DoE Contracts DE-FG02-99ER41065 and DE-AC05-06OR23177.

  3. Methods for selecting fixed-effect models for heterogeneous codon evolution, with comments on their application to gene and genome data

    Microsoft Academic Search

    Le Bao; Hong Gu; Katherine A Dunn; Joseph P Bielawski

    2007-01-01

    BACKGROUND: Models of codon evolution have proven useful for investigating the strength and direction of natural selection. In some cases, a priori biological knowledge has been used successfully to model heterogeneous evolutionary dynamics among codon sites. These are called fixed-effect models, and they require that all codon sites are assigned to one of several partitions which are permitted to have

  4. A Start-up company to start your career

    E-print Network

    is not a `for-profit' business · But still must recoup costs · Harvard typically takes ~8% in equity · CompanyA Start-up company to start your career Professional Development Seminar March 6, 2013 #12;What is a start-up company? · Small, just started · Typically 1-5 years old · Often no products, no sales

  5. Addressing poor nutrition to promote heart health: moving upstream.

    PubMed

    Raine, Kim D

    2010-01-01

    Current dietary recommendations for cardiovascular disease prevention suggest dietary patterns that promote achieving healthy weight, emphasize vegetables, legumes, fruit, whole grains, fish and nuts, substituting mono-unsaturated fats for saturated fats and restricting dietary sodium to less than 2300 mg/day. However, trends in nutrient intake and food consumption patterns suggest that the need for improvement in the dietary patterns of Canadians is clear. Influencing eating behaviour requires more than addressing nutrition knowledge and perceptions of healthy eating - it requires tackling the context within which individuals make choices. A comprehensive approach to improving nutrition includes traditional downstream strategies such as counselling to improve knowledge and skills; midstream strategies such as using the media to change social norms; and upstream strategies such as creating supportive environments through public policy including regulatory measures. While the evidence base for more upstream strategies continues to grow, key examples of comprehensive approaches to population change provide a call to action. PMID:20847988

  6. Addressing poor nutrition to promote heart health: Moving upstream

    PubMed Central

    Raine, Kim D

    2010-01-01

    Current dietary recommendations for cardiovascular disease prevention suggest dietary patterns that promote achieving healthy weight, emphasize vegetables, legumes, fruit, whole grains, fish and nuts, substituting mono-unsaturated fats for saturated fats and restricting dietary sodium to less than 2300 mg/day. However, trends in nutrient intake and food consumption patterns suggest that the need for improvement in the dietary patterns of Canadians is clear. Influencing eating behaviour requires more than addressing nutrition knowledge and perceptions of healthy eating – it requires tackling the context within which individuals make choices. A comprehensive approach to improving nutrition includes traditional downstream strategies such as counselling to improve knowledge and skills; midstream strategies such as using the media to change social norms; and upstream strategies such as creating supportive environments through public policy including regulatory measures. While the evidence base for more upstream strategies continues to grow, key examples of comprehensive approaches to population change provide a call to action. PMID:20847988

  7. Retail Zone Pricing and Simulated Price Effects of Upstream Mergers

    Microsoft Academic Search

    Geoffrey M. Pofahl; ORAL CAPPS JR.; H. Alan Love

    2006-01-01

    Despite the oft?recognized reality of zone pricing by food retailers, this form of price discrimination has received very little attention within the context of upstream merger analysis. Promoting this issue to ‘center stage’, we relax the conventional merger simulation assumption of uniform pass?through by retailers. Relaxing this assumption allows us to explore the potential impacts of zone pricing on post?merger

  8. 8. SEDIMENTATION CHAMBER, VIEW UPSTREAM (PLANK COVER REMOVED FOR CLARITY). ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. SEDIMENTATION CHAMBER, VIEW UPSTREAM (PLANK COVER REMOVED FOR CLARITY). BOX FLUME DROPS SLIGHTLY INTO CHAMBER ON LEFT SIDE. CHAMBER IS A SERIES OF BAFFLES DESIGNED TO SLOW THE FLOW OF WATER. FLOW IS REDUCED TO ALLOW PARTICULATES TO SETTLE TO THE BOTTOM. TWO SCREENS (NOT SHOWN) FILTER LARGER DEBRIS. - Kalaupapa Water Supply System, Waikolu Valley to Kalaupapa Settlement, Island of Molokai, Kalaupapa, Kalawao County, HI

  9. 12. Detail, lower chord connection point on upstream side of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Detail, lower chord connection point on upstream side of truss, showing pinned connection of lower chord eye bars, laced vertical compression member, diagonal eye bar tension members, turnbuckled diagonal counters, and floor beam. Note also timber floor stringers supported by floor beam, and exposed ends of timber deck members visible at left above lower chord eye bar. View to northwest. - Red Bank Creek Bridge, Spanning Red Bank Creek at Rawson Road, Red Bluff, Tehama County, CA

  10. Upstream versus downstream control of meltwater plumes under ice shelves

    NASA Astrophysics Data System (ADS)

    Wells, Andrew

    2013-11-01

    In many locations the Greenland and Antarctic ice sheets discharge into the ocean through ice shelves floating on top of a warm salty ocean. The turbulent buoyancy-driven flow of meltwater beneath the sloping ice-shelf base enhances heat transfer and provides a feedback on ice melting rates, with consequences for ice sheet dynamics and predictions of sea-level rise. Previous steady-state models of meltwater plumes under ice shelves have solved for the development of flow along the slope from an initial source, corresponding to solely upstream control of the plume dynamics. I re-interpret the plume dynamics embedded within the framework of a time-dependent model, and show that the flow exhibits distinct regimes depending on the source conditions. Solutions with upstream control are physically consistent for certain source conditions, but the plume is influenced by a combination of upstream and downstream conditions in other regions of parameter space. The dynamics are illustrated for flow underneath a two-dimensional ice shelf of initially constant basal slope, and stable attracting states are determined. The implications for modelling meltwater flow under ice shelves are discussed.

  11. Upstream regulation of the hippo size control pathway.

    PubMed

    Grusche, Felix A; Richardson, Helena E; Harvey, Kieran F

    2010-07-13

    The newly discovered Salvador-Warts-Hippo (SWH) pathway is a key regulator of tissue growth during both development and disease. The first identified components of this pathway represent core downstream effector proteins: the kinases Warts and Hippo; the adaptor proteins Salvador and Mats; and the transcriptional co-activator Yorkie. More recently, a surprising number of proteins have been implicated as upstream regulators of the SWH pathway, including: the planar cell polarity cadherins Fat and Dachsous; the FERM-domain proteins Expanded and Merlin; the WW-domain protein Kibra; the Ras-association family protein dRASSF; and the apicobasal polarity proteins lethal giant larvae, atypical protein kinase C and Crumbs. The identification of a large cohort of upstream regulatory proteins suggests that core SWH pathway proteins are poised to respond to diverse stimuli that must be integrated in a coordinated fashion. Here, we review the existing knowledge of upstream SWH pathway proteins and discuss possible mechanisms of action and signal integration. PMID:20619814

  12. Interaction of upstream flow distortions with high Mach number cascades

    NASA Technical Reports Server (NTRS)

    Englert, G. W.

    1981-01-01

    Features of the interaction of flow distortions, such as gusts and wakes with blade rows of advance type fans and compressors having high tip Mach numbers are modeled. A typical disturbance was assumed to have harmonic time dependence and was described, at a far upstream location, in three orthogonal spatial coordinates by a double Fourier series. It was convected at supersonic relative to a linear cascade described as an unrolled annulus. Conditions were selected so that the component of this velocity parallel to the axis of the turbomachine was subsonic, permitting interaction between blades through the upstream as well as downstream flow media. A strong, nearly normal shock was considered in the blade passages which was allowed curvature and displacement. The flows before and after the shock were linearized relative to uniform mean velocities in their respective regions. Solution of the descriptive equations was by adaption of the Wiener-Hopf technique, enabling a determination of distortion patterns through and downstream of the cascade as well as pressure distributions on the blade and surfaces. Details of interaction of the disturbance with the in-passage shock were discussed. Infuences of amplitude, wave length, and phase of the disturbance on lifts and moments of cascade configurations are presented. Numerical results are clarified by reference to an especially orderly pattern of upstream vertical motion in relation to the cascade parameters.

  13. Experimental determination of translational starts using peptide mass mapping and tandem mass spectrometry within the proteome of Mycobacterium tuberculosis

    Microsoft Academic Search

    Stuart C. G. Rison; Jens Mattow; Peter R. Jungblut; Neil G. Stoker

    2007-01-01

    Identification of protein translation start sites is largely a bioinformatics exercise, with relatively few confirmed by N-terminal sequencing. Translation start site determination is critical for defining both the protein sequence and the upstream DNA which may contain regulatory motifs. It is demonstrated here that translation start sites can be determined during routine protein identification, using MALDI-MS and MS\\/MS data to

  14. StartUpNation

    NSDL National Science Digital Library

    It would seem that more and more people are interested in developing their own business, and a number of websites are dedicated to helping these persons achieve that goal. One valuable website in that realm is StartUpNation. Created by Jeff and Rich Sloan, the site contains a well-designed homepage that includes links to sections dedicated to areas of interest to the prospective entrepreneur, including those that deal with customer service and creating strategic marketing plans. A good place to start is the â??Lean from the Expertsâ? area, located on the left-hand side of the homepage. Here, visitors can learn from successful individuals, such as Glenn Coggeshell of Black Dot Coffee. Along the same side, visitors can also read about how to choose a business for themselves and also how to plan to make this business a reality. In keeping with the times, the site also affords users the opportunity to sign up for RSS feeds and the ability to listen (and download) a number of podcasts.

  15. Amino-acid substitutions at codon 13 of the N-ras oncogene in human acute myeloid leukaemia

    NASA Astrophysics Data System (ADS)

    Bos, Johannes L.; Toksoz, Deniz; Marshall, Christopher J.; Verlaan-de Vries, Matty; Veeneman, Gerrit H.; van der Eb, Alex J.; van Boom, Jacques H.; Janssen, Johannes W. G.; Steenvoorden, Ada C. M.

    1985-06-01

    DNAs from four out of five patients with acute myeloid leukaemia (AML) tested by an in vivo selection assay in nude mice using transfected mouse NIH 3T3 cells were found to contain an activated N-ras oncogene. Using a set of synthetic oligonucleotide probes, we have detected a mutation at codon 13 in all four genes. The same codon is mutated in an additional AML DNA that is positive in the focus-formation assay on 3T3 cells. DNA from the peripheral blood of one patient in remission does not contain a codon 13 mutation.

  16. The upstream-propagating Alfvénic fluctuations with power law spectra in the upstream region of the Earth's bow shock

    NASA Astrophysics Data System (ADS)

    Wang, Xin; Tu, Chuanyi; Wang, Linghua; He, Jiansen; Marsch, Eckart

    2015-05-01

    Based on theories, the beam instability induced by shock-accelerated ions can generate upstream-propagating Alfvén waves (UPAWs) with a power spectral bump near 0.03 Hz, while the nonlinear wave-wave interaction favors an inverse cascade to create a power law spectrum. Here we present the first observational evidence for the upstream-propagating Alfvénic fluctuations (UPAFs) with power law spectra. We utilize a new criterion to identify the upstream-propagating Alfvénic intervals: the propagation direction is opposite to that of solar wind strahl electron outflow. Besides 35 UPAWs, we find 47 UPAFs with power law spectra, and ˜47% of these UPAFs are associated with energetic ion events (>30 keV). These UPAWs and UPAFs are mostly observed in the slow solar wind. However, their occurrence rate and power behave differently in dependence on the radial distance from the Earth. These results provide new clues on understanding the dynamic equilibrium between the nonlinear inverse cascade and the linear ion beam instability.

  17. The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

    PubMed Central

    2014-01-01

    Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

  18. Start Smart: Steps to Starting a Business Workshop Registration The Start Smart workshop will cover

    E-print Network

    Collins, Gary S.

    . ----------------------------------------------------------------------------------------------------------------------------------------------- START SMART REGISTRATION Name Daytime phone Address E-mail address City State Zip Optional: NameStart Smart: Steps to Starting a Business Workshop Registration The Start Smart workshop will cover and mail it with your check* or credit card information to: WSU Tri-Cities Business LINKS 2710 Crimson Way

  19. The Effects of Downstream Distributor Chains on Upstream Producer Entry: A Bargaining Perspective

    Microsoft Academic Search

    Suchan Chae; Paul Heidhues

    1999-01-01

    This paper studies the effects of integration among downstream local distributors on the entry of upstream producers in a bargaining theoretic framework. We show that integration of downstream distributors may increase their bargaining power vis-à-vis upstream producers and thus lower incentives for entry in the upstream production industry. In order to explain price formation in such a market, we use

  20. Ethnic variation in the HER2 codon 655 genetic polymorphism previously associated with breast cancer

    Microsoft Academic Search

    Margaret-Mary Ameyaw; Mohammed Tayeb; Nadia Thornton; Gbolahan Folayan; Mohammed Tariq; Abeer Mobarek; David A. Price Evans; David Ofori-Adjei; Howard L. McLeod

    2002-01-01

    HER-2, a protooncogene located on chromosome 17q21, encodes a transmembrane glycoprotein (p185) with tyrosine kinase activity.\\u000a Alterations of the HER-2 gene have been implicated in the carcinogenesis and prognosis of breast cancer and other solid tumors. It is also a cancer-therapeutic\\u000a target for antibody-based therapy against the HER-2 protein. A single-nucleotide polymorphism (SNP) at codon 655, resulting in a G-to-A

  1. SHORT REPORT: CODON 125 POLYMORPHISM OF CD31 AND SUSCEPTIBILITY TO MALARIA

    Microsoft Academic Search

    CLIMENT CASALS-PASCUAL; STEVEN ALLEN; ANGELA ALLEN; OSCAR KAI; BRETT LOWE; ARNAB PAIN; DAVID J. ROBERTS

    Platelet-endothelial cell adhesion molecule 1 (PECAM-1\\/CD31) has been identified as an endothelial cell receptor of Plasmodium falciparum -infected erythrocytes. The significance of adhesion of infected erythrocytes to this receptor in malaria infection has not been determined. We have therefore studied the association of the functional mutation CTG? GTG (Leu? Val) in codon 125 of the Cd31 gene with severe disease

  2. Mining prokaryotic genomes for unknown amino acids: a stop-codon-based approach

    PubMed Central

    Fujita, Masashi; Mihara, Hisaaki; Goto, Susumu; Esaki, Nobuyoshi; Kanehisa, Minoru

    2007-01-01

    Background Selenocysteine and pyrrolysine are the 21st and 22nd amino acids, which are genetically encoded by stop codons. Since a number of microbial genomes have been completely sequenced to date, it is tempting to ask whether the 23rd amino acid is left undiscovered in these genomes. Recently, a computational study addressed this question and reported that no tRNA gene for unknown amino acid was found in genome sequences available. However, performance of the tRNA prediction program on an unknown tRNA family, which may have atypical sequence and structure, is unclear, thereby rendering their result inconclusive. A protein-level study will provide independent insight into the novel amino acid. Results Assuming that the 23rd amino acid is also encoded by a stop codon, we systematically predicted proteins that contain stop-codon-encoded amino acids from 191 prokaryotic genomes. Since our prediction method relies only on the conservation patterns of primary sequences, it also provides an opportunity to search novel selenoproteins and other readthrough proteins. It successfully recovered many of currently known selenoproteins and pyrrolysine proteins. However, no promising candidate for the 23rd amino acid was detected, and only one novel selenoprotein was predicted. Conclusion Our result suggests that the unknown amino acid encoded by stop codons does not exist, or its phylogenetic distribution is rather limited, which is in agreement with the previous study on tRNA. The method described here can be used in future studies to explore novel readthrough events from complete genomes, which are rapidly growing. PMID:17597547

  3. Self-catalytic DNA Depurination Underlies Human ?-Globin Gene Mutations at Codon 6 That Cause Anemias and Thalassemias*

    PubMed Central

    Alvarez-Dominguez, Juan R.; Amosova, Olga; Fresco, Jacques R.

    2013-01-01

    The human ?-globin gene contains an 18-nucleotide coding strand sequence centered at codon 6 and capable of forming a stem-loop structure that can self-catalyze depurination of the 5?G residue of that codon. The resultant apurinic lesion is subject to error-prone repair, consistent with the occurrence about this codon of mutations responsible for 6 anemias and ?-thalassemias and additional substitutions without clinical consequences. The 4-residue loop of this stem-loop-forming sequence shows the highest incidence of mutation across the gene. The loop and first stem base pair-forming residues appeared early in the mammalian clade. The other stem-forming segments evolved more recently among primates, thereby conferring self-depurination capacity at codon 6. These observations indicate a conserved molecular mechanism leading to ?-globin variants underlying phenotypic diversity and disease. PMID:23457306

  4. Does the clinical phenotype of fatal familial insomnia depend on PRNP codon 129 methionine-valine polymorphism?

    PubMed

    Rupprecht, Sven; Grimm, Alexander; Schultze, Torsten; Zinke, Jan; Karvouniari, Panagiota; Axer, Hubertus; Witte, Otto W; Schwab, Matthias

    2013-01-01

    Fatal familial insomnia (FFI) is a rare, hereditary prion-protein disease. Methionine-valine polymorphism at codon 129 of the prion-protein gene (PRNP) determines the phenotype in other hereditary prion-protein diseases, but association with the clinical phenotype in FFI remains uncertain. Early clinical findings in FFI comprise disturbances of the sleep-wake cycle and mild neuropsychiatric changes which typically emerge during middle to late adulthood. Here we describe an unusually early onset and rapid progression of FFI associated with dorsal midbrain involvement in a female patient with PRNP mutation at codon 178 and homozygote methionine polymorphism at codon 129. Early dorsal midbrain involvement became apparent by total loss of REM sleep and isolated bilateral trochlear nerve palsy. Early onset and rapid progression disease type associated with dorsal midbrain involvement may indicate a different spatiotemporal distribution of the neurodegenerative process in FFI patients with PRNP mutation and codon 129 methionine homozygosity compared to methioninevaline heterozygosity. PMID:24340298

  5. amino acid. In bacteria, the reassignment occurs with the opal UGA stop codon, whereas in the eukaryotes, it is the

    E-print Network

    Huang, Jing

    . The largest number of recoding events appeared in a sulfidic groundwater sample and in the human oral microbiome. In an artful use of reassignment, it appears that some phages use codon reassignment to hijack

  6. Codon Optimization Significantly Improves the Expression Level of a Keratinase Gene in Pichia pastoris

    PubMed Central

    Hu, Hong; Gao, Jie; He, Jun; Yu, Bing; Zheng, Ping; Huang, Zhiqing; Mao, Xiangbing; Yu, Jie; Han, Guoquan; Chen, Daiwen

    2013-01-01

    The main keratinase (kerA) gene from the Bacillus licheniformis S90 was optimized by two codon optimization strategies and expressed in Pichia pastoris in order to improve the enzyme production compared to the preparations with the native kerA gene. The results showed that the corresponding mutations (synonymous codons) according to the codon bias in Pichia pastoris were successfully introduced into keratinase gene. The highest keratinase activity produced by P. pastoris pPICZ?A-kerAwt, pPICZ?A-kerAopti1 and pPICZ?A-kerAopti2 was 195 U/ml, 324 U/ml and 293 U/ml respectively. In addition, there was no significant difference in biomass concentration, target gene copy numbers and relative mRNA expression levels of every positive strain. The molecular weight of keratinase secreted by recombinant P. pastori was approx. 39 kDa. It was optimally active at pH 7.5 and 50°C. The recombinant keratinase could efficiently degrade both ?-keratin (keratin azure) and ?-keratin (chicken feather meal). These properties make the P. pastoris pPICZ?A-kerAopti1 a suitable candidate for industrial production of keratinases. PMID:23472192

  7. Enhanced expression of codon optimized Mycobacterium avium subsp. paratuberculosis antigens in Lactobacillus salivarius

    PubMed Central

    Johnston, Christopher D.; Bannantine, John P.; Govender, Rodney; Endersen, Lorraine; Pletzer, Daniel; Weingart, Helge; Coffey, Aidan; O'Mahony, Jim; Sleator, Roy D.

    2014-01-01

    It is well documented that open reading frames containing high GC content show poor expression in A+T rich hosts. Specifically, G+C-rich codon usage is a limiting factor in heterologous expression of Mycobacterium avium subsp. paratuberculosis (MAP) proteins using Lactobacillus salivarius. However, re-engineering opening reading frames through synonymous substitutions can offset codon bias and greatly enhance MAP protein production in this host. In this report, we demonstrate that codon-usage manipulation of MAP2121c can enhance the heterologous expression of the major membrane protein (MMP), analogous to the form in which it is produced natively by MAP bacilli. When heterologously over-expressed, antigenic determinants were preserved in synthetic MMP proteins as shown by monoclonal antibody mediated ELISA. Moreover, MMP is a membrane protein in MAP, which is also targeted to the cellular surface of recombinant L. salivarius at levels comparable to MAP. Additionally, we previously engineered MAP3733c (encoding MptD) and show herein that MptD displays the tendency to associate with the cytoplasmic membrane boundary under confocal microscopy and the intracellularly accumulated protein selectively adheres to the MptD-specific bacteriophage fMptD. This work demonstrates there is potential for L. salivarius as a viable antigen delivery vehicle for MAP, which may provide an effective mucosal vaccine against Johne's disease. PMID:25237653

  8. Codon-usage bias versus gene conversion in the evolution of yeast duplicate genes

    PubMed Central

    Lin, Yeong-Shin; Byrnes, Jake K.; Hwang, Jenn-Kang; Li, Wen-Hsiung

    2006-01-01

    Many Saccharomyces cerevisiae duplicate genes that were derived from an ancient whole-genome duplication (WGD) unexpectedly show a small synonymous divergence (KS), a higher sequence similarity to each other than to orthologues in Saccharomyces bayanus, or slow evolution compared with the orthologue in Kluyveromyces waltii, a non-WGD species. This decelerated evolution was attributed to gene conversion between duplicates. Using ?300 WGD gene pairs in four species and their orthologues in non-WGD species, we show that codon-usage bias and protein-sequence conservation are two important causes for decelerated evolution of duplicate genes, whereas gene conversion is effective only in the presence of strong codon-usage bias or protein-sequence conservation. Furthermore, we find that change in mutation pattern or in tDNA copy number changed codon-usage bias and increased the KS distance between K. waltii and S. cerevisiae. Intriguingly, some proteins showed fast evolution before the radiation of WGD species but little or no sequence divergence between orthologues and paralogues thereafter, indicating that functional conservation after the radiation may also be responsible for decelerated evolution in duplicates. PMID:16971485

  9. Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon.

    PubMed

    Mukai, Takahito; Hoshi, Hiroko; Ohtake, Kazumasa; Takahashi, Mihoko; Yamaguchi, Atsushi; Hayashi, Akiko; Yokoyama, Shigeyuki; Sakamoto, Kensaku

    2015-01-01

    Escherichia coli is a widely used host organism for recombinant technology, and the bacterial incorporation of non-natural amino acids promises the efficient synthesis of proteins with novel structures and properties. In the present study, we developed E. coli strains in which the UAG codon was reserved for non-natural amino acids, without compromising the reproductive strength of the host cells. Ninety-five of the 273 UAG stop codons were replaced synonymously in the genome of E. coli BL21(DE3), by exploiting the oligonucleotide-mediated base-mismatch-repair mechanism. This genomic modification allowed the safe elimination of the UAG-recognizing cellular component (RF-1), thus leaving the remaining 178 UAG codons with no specific molecule recognizing them. The resulting strain B-95.?A grew as vigorously as BL21(DE3)?in rich medium at 25-42°C, and its derivative B-95.?A?fabR was better adapted to low temperatures and minimal media than B-95.?A. UAG was reassigned to synthetic amino acids by expressing the specific pairs of UAG-reading tRNA and aminoacyl-tRNA synthetase. Due to the preserved growth vigor, the B-95.?A strains showed superior productivities for hirudin molecules sulfonated on a particular tyrosine residue, and the Fab fragments of Herceptin containing multiple azido groups. PMID:25982672

  10. Comparison of two codon optimization strategies enhancing recombinant Sus scrofa lysozyme production in Pichia pastoris.

    PubMed

    Zhu, D; Cai, G; Wu, D; Lu, J

    2015-01-01

    Lysozyme has played an important role in animal feed additive industry, food additive industry and biological engineering. For improving expression efficiency of recombinant lysozyme from Sus scrofa, two genes respectively designed by the most used codon optimization strategies, "one amino acid one codon" and "codon randomization", were synthesized and expressed in Pichia pastoris X—33. At shaking flask level, Sus scrofa lysozyme (SSL) under two conditions had a highest activity of 153.33±10.41 and 538.33±15.18 U/mL after a 5 days induction of 1% methanol, with secreted protein concentration 80.03±1.94 and 239.60±4.16 mg/L, respectively. Compared with the original SSL gene, the expression of optimized SSL gene by the second strategy showed a 2.6 fold higher level, while the first method had no obvious improvement in production. In total secreted protein, the proportions of recombinant SSL encoded by the original gene, first method optimized gene and the second—strategy optimized one were 75.06±0.25%, 74.56±0.14% and 79.00±0.14%, respectively, with the same molecular weight about 18 kDa, optimum acidity pH 6.0 and optimum temperature 35degC. PMID:26025401

  11. Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon

    PubMed Central

    Mukai, Takahito; Hoshi, Hiroko; Ohtake, Kazumasa; Takahashi, Mihoko; Yamaguchi, Atsushi; Hayashi, Akiko; Yokoyama, Shigeyuki; Sakamoto, Kensaku

    2015-01-01

    Escherichia coli is a widely used host organism for recombinant technology, and the bacterial incorporation of non-natural amino acids promises the efficient synthesis of proteins with novel structures and properties. In the present study, we developed E. coli strains in which the UAG codon was reserved for non-natural amino acids, without compromising the reproductive strength of the host cells. Ninety-five of the 273 UAG stop codons were replaced synonymously in the genome of E. coli BL21(DE3), by exploiting the oligonucleotide-mediated base-mismatch-repair mechanism. This genomic modification allowed the safe elimination of the UAG-recognizing cellular component (RF-1), thus leaving the remaining 178 UAG codons with no specific molecule recognizing them. The resulting strain B-95.?A grew as vigorously as BL21(DE3)?in rich medium at 25–42°C, and its derivative B-95.?A?fabR was better adapted to low temperatures and minimal media than B-95.?A. UAG was reassigned to synthetic amino acids by expressing the specific pairs of UAG-reading tRNA and aminoacyl-tRNA synthetase. Due to the preserved growth vigor, the B-95.?A strains showed superior productivities for hirudin molecules sulfonated on a particular tyrosine residue, and the Fab fragments of Herceptin containing multiple azido groups. PMID:25982672

  12. Optimization of Codon Translation Rates via tRNA Modifications Maintains Proteome Integrity

    PubMed Central

    Nedialkova, Danny D.; Leidel, Sebastian A.

    2015-01-01

    Summary Proteins begin to fold as they emerge from translating ribosomes. The kinetics of ribosome transit along a given mRNA can influence nascent chain folding, but the extent to which individual codon translation rates impact proteome integrity remains unknown. Here, we show that slower decoding of discrete codons elicits widespread protein aggregation in vivo. Using ribosome profiling, we find that loss of anticodon wobble uridine (U34) modifications in a subset of tRNAs leads to ribosome pausing at their cognate codons in S. cerevisiae and C. elegans. Cells lacking U34 modifications exhibit gene expression hallmarks of proteotoxic stress, accumulate aggregates of endogenous proteins, and are severely compromised in clearing stress-induced protein aggregates. Overexpression of hypomodified tRNAs alleviates ribosome pausing, concomitantly restoring protein homeostasis. Our findings demonstrate that modified U34 is an evolutionarily conserved accelerator of decoding and reveal an unanticipated role for tRNA modifications in maintaining proteome integrity. PMID:26052047

  13. Mutational and Selective Pressures on Codon and Amino Acid Usage in Buchnera, Endosymbiotic Bacteria of Aphids

    PubMed Central

    Rispe, Claude; Delmotte, François; van Ham, Roeland C.H.J.; Moya, Andres

    2004-01-01

    We have explored compositional variation at synonymous (codon usage) and nonsynonymous (amino acid usage) positions in three complete genomes of Buchnera, endosymbiotic bacteria of aphids, and also in their orthologs in Escherichia coli, a close free-living relative. We sought to discriminate genes of variable expression levels in order to weigh the relative contributions of mutational bias and selection in the genomic changes following symbiosis. We identified clear strand asymmetries, distribution biases (putative high-expression genes were found more often on the leading strand), and a residual slight codon bias within each strand. Amino acid usage was strongly biased in putative high-expression genes, characterized by avoidance of aromatic amino acids, but above all by greater conservation and resistance to AT enrichment. Despite the almost complete loss of codon bias and heavy mutational pressure, selective forces are still strong at nonsynonymous sites of a fraction of the genome. However, Buchnera from Baizongia pistaciae appears to have suffered a stronger symbiotic syndrome than the two other species. PMID:14672975

  14. HER2 codon 655 polymorphism and breast cancer: results from kin-cohort and case–control analyses

    Microsoft Academic Search

    Robert C. Millikan; Amanda J. Hummer; Mary S. Wolff; Asahi Hishida; Colin B. Begg

    2005-01-01

    Summary  Several published epidemiologic studies show increased breast cancer risk for carriers of the Val-allele at codon 655 of the HER2 gene. We conducted additional analyses using data from three studies, including case–control analyses stratified on age and kin-cohort analyses using relatives of cases and controls. The results provide additional evidence that HER2 codon 655 genotype may predispose to early-onset breast

  15. Codon and amino-acid specificities of a transfer RNA are both converted by a single post-transcriptional modification

    Microsoft Academic Search

    Tomonari Muramatsu; Kazuya Nishikawa; Fumiko Nemoto; Yoshiyuki Kuchino; Susumu Nishimura; Tatsuo Miyazawa; Shigeyuki Yokoyama

    1988-01-01

    An Escherichia coli isoleucine transfer RNA specific for the codon AUA (tRNA2Ile or tRNAminorIle (ref. 1) has a novel modified nucleo-side, lysidine (L; ref. 2) (Fig. la) in the first position of the anticodon (position 34), which is essential for the specific recognition of the codon AUA (ref. 1). We isolated the gene for tRNA2Ile (ileX) and found that the

  16. Apolipoprotein B48 is the Product of a Messenger RNA with an Organ-Specific In-Frame Stop Codon

    Microsoft Academic Search

    San-Hwan Chen; Geetha Habib; Chao-Yuh Yang; Zi-Wei Gu; Bo Rong Lee; Shi-Ai Weng; Steven R. Silberman; Sheng-Jian Cai; J. P. Deslypere; Maryvonne Rosseneu; Antonio M. Gotto; Wen-Hsiung Li; Lawrence Chan

    1987-01-01

    The primary structure of human apolipoprotein (apo) B-48 has been deduced and shown by a combination of DNA excess hybridization, sequencing of tryptic peptides, cloned complementary DNAs, and intestinal messenger RNAs (mRNAs) to be the product of an intestinal mRNA with an in-frame UAA stop codon resulting from a C to U change in the codon CAA encoding Gln2153 in

  17. Hybrid simulation codes with application to shocks and upstream waves

    NASA Technical Reports Server (NTRS)

    Winske, D.

    1985-01-01

    Hybrid codes in which part of the plasma is represented as particles and the rest as a fluid are discussed. In the past few years such codes with particle ions and massless, fluid electrons have been applied to space plasmas, especially to collisionless shocks. All of these simulation codes are one-dimensional and similar in structure, except for how the field equations are solved. The various approaches that are used (resistive Ohm's law, predictor-corrector, Hamiltonian) are described in detail and results from the various codes are compared with examples taken from collisionless shocks and low frequency wave phenomena upstream of shocks.

  18. Swimming upstream: the strengths of women who survive homelessness.

    PubMed

    Montgomery, C

    1994-03-01

    A study of the strengths and personal resources of women who had overcome homelessness revealed that the experience of homelessness for these women was a temporary state of disruption resulting from an effort to free themselves from conditions associated with despair, such as abuse or addictions, and to search for a better life. Personal, interpersonal, and transpersonal categories of strengths were identified that enabled these women to move in a positive direction toward health and self-actualization. The synthesizing metaphor "swimming upstream" describes the stoic determination required to go against the overwhelming negative forces of their environment. PMID:7515608

  19. Hybrid simulation codes with application to shocks and upstream waves

    SciTech Connect

    Winske, D.

    1985-02-03

    Hybrid codes in which part of the plasma is represented as particles and the rest as fluid are discussed. In the past few years such codes with particle ions and massless, fluid electrons have been applied to space plasmas, especially to collisionless shocks. All of these simulation codes are one-dimensional and similar in structure, except for how the field equation are solved. We describe in detail the various approaches that are used (resistive Ohm's law, predictor-corrector, Hamiltonian) and compare results from the various codes with examples taken from collisionless shocks and low frequency wave phenomena upstream of shocks.

  20. Hydraulic type starting clutch

    SciTech Connect

    Ohzono, K.; Hayashi, K.; Saito, M.; Kato, M.; Yoshida, Y.

    1987-07-14

    This patent describes a hydraulic type starting clutch comprising: an input shaft; an input rotating member arranged for rotation in unison with the input shaft; an output shaft; an output rotating member arranged for rotation in unison with the output shaft; friction plates interposed between the input rotating member and the output rotating member for engagement to transmit torque from the input rotating member to the output rotating member; urging means interposed between the friction plates and the output rotating member for urging the friction plates to cause the transmission of torque from the input rotating member to the output rotating member; a hydraulic pressure chamber defined between the urging means and the output rotating member and disposed to be supplied with a hydraulic fluid for acting upon the urging means to urge the friction plates; a hydraulic fluid source for supplying the hydraulic fluid to the hydraulic pressure chamber; pressure regulating valve means for regulating the pressure of the hydraulic fluid in the hydraulic pressure chamber; and control means for controlling the pressure regulating valve means to regulate the pressure of the hydraulic fluid in the hydraulic pressure chamber so as to increase with an increase in the rotational speed of the input shaft, the control means.

  1. Two Functionally Distinct Regions Upstream of the cbbI Operon of Rhodobacter sphaeroides Regulate Gene Expression

    PubMed Central

    Dubbs, James M.; Tabita, F. Robert

    1998-01-01

    A number of cbbFI::lacZ translational fusion plasmids containing various lengths of sequence 5? to the form I (cbbI) Calvin-Benson-Bassham cycle operon (cbbFIcbbPIcbbAIcbbLIcbbSI) of Rhodobacter sphaeroides were constructed. Expression of ?-galactosidase was monitored under a variety of growth conditions. It was found that 103 bp of sequence upstream of the cbbFI transcription start was sufficient to confer low levels of regulated cbbI promoter expression; this activity was dependent on the presence of an intact cbbR gene. Additionally, R. sphaeroides CbbR was shown to bind to the region between 9 and 100 bp 5? to the cbbFI transcription start. Inclusion of an additional upstream sequence, from 280 to 636 bp 5? to cbbFI, resulted in a significant increase in regulated cbbI promoter expression under all growth conditions tested. A 50-bp region responsible for the majority of this increase occurs between 280 and 330 bp 5? to cbbFI. The additional 306 bp of upstream sequence from 330 to 636 bp also appears to play a positive regulatory role. A 4-bp deletion 281 to 284 bp 5? to cbbFI significantly reduced cbbI expression while the proper regulatory pattern was retained. These studies provide evidence for the presence of two functionally distinct regions of the cbbI promoter, with the distal domain providing significant regulated promoter activity that adheres to the normal pattern of expression. PMID:9733694

  2. Synonymous codon bias and functional constraint on GC3-related DNA backbone dynamics in the prokaryotic nucleoid

    PubMed Central

    Babbitt, Gregory A.; Alawad, Mohammed A.; Schulze, Katharina V.; Hudson, André O.

    2014-01-01

    While mRNA stability has been demonstrated to control rates of translation, generating both global and local synonymous codon biases in many unicellular organisms, this explanation cannot adequately explain why codon bias strongly tracks neighboring intergene GC content; suggesting that structural dynamics of DNA might also influence codon choice. Because minor groove width is highly governed by 3-base periodicity in GC, the existence of triplet-based codons might imply a functional role for the optimization of local DNA molecular dynamics via GC content at synonymous sites (?GC3). We confirm a strong association between GC3-related intrinsic DNA flexibility and codon bias across 24 different prokaryotic multiple whole-genome alignments. We develop a novel test of natural selection targeting synonymous sites and demonstrate that GC3-related DNA backbone dynamics have been subject to moderate selective pressure, perhaps contributing to our observation that many genes possess extreme DNA backbone dynamics for their given protein space. This dual function of codons may impose universal functional constraints affecting the evolution of synonymous and non-synonymous sites. We propose that synonymous sites may have evolved as an ‘accessory’ during an early expansion of a primordial genetic code, allowing for multiplexed protein coding and structural dynamic information within the same molecular context. PMID:25200075

  3. Evaluation of codon biology in citrus and Poncirus trifoliata based on genomic features and frame corrected expressed sequence tags.

    PubMed

    Ahmad, Touqeer; Sablok, Gaurav; Tatarinova, Tatiana V; Xu, Qiang; Deng, Xiu-Xin; Guo, Wen-Wu

    2013-04-01

    Citrus, as one of the globally important fruit trees, has been an object of interest for understanding genetics and evolutionary process in fruit crops. Meta-analyses of 19 Citrus species, including 4 globally and economically important Citrus sinensis, Citrus clementina, Citrus reticulata, and 1 Citrus relative Poncirus trifoliata, were performed. We observed that codons ending with A- or T- at the wobble position were preferred in contrast to C- or G- ending codons, indicating a close association with AT richness of Citrus species and P. trifoliata. The present study postulates a large repertoire of a set of optimal codons for the Citrus genus and P. trifoliata and demonstrates that GCT and GGT are evolutionary conserved optimal codons. Our observation suggested that mutational bias is the dominating force in shaping the codon usage bias (CUB) in Citrus and P. trifoliata. Correspondence analysis (COA) revealed that the principal axis [axis 1; COA/relative synonymous codon usage (RSCU)] contributes only a minor portion (?10.96%) of the recorded variance. In all analysed species, except P. trifoliata, Gravy and aromaticity played minor roles in resolving CUB. Compositional constraints were found to be strongly associated with the amino acid signatures in Citrus species and P. trifoliata. Our present analysis postulates compositional constraints in Citrus species and P. trifoliata and plausible role of the stress with GC3 and coevolution pattern of amino acid. PMID:23315666

  4. Involving Parents in Head Start.

    ERIC Educational Resources Information Center

    Leik, Robert K.; Chalkley, Mary Anne

    1989-01-01

    The Head Start Family Impact Project involved a one-year study of 81 single mothers and their children from the Hennepin County Head Start Program. This program was planned to test the notion that parent-child interaction in the context of Head Start would be the most beneficial form of parental involvement. An assessment session, which measured…

  5. Maryland Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012

    2012-01-01

    Since 2000, Maryland has provided state supplemental funds to Head Start and Early Head Start (EHS) programs to improve access. Local EHS programs may use funds, through child care partnerships, to extend the EHS day or year. Maryland's approach to building on EHS includes: (1) Increase the capacity of existing Head Start and EHS programs to…

  6. Context-dependent codon partition models provide significant increases in model fit in atpB and rbcL protein-coding genes

    PubMed Central

    2011-01-01

    Background Accurate modelling of substitution processes in protein-coding sequences is often hampered by the computational burdens associated with full codon models. Lately, codon partition models have been proposed as a viable alternative, mimicking the substitution behaviour of codon models at a low computational cost. Such codon partition models however impose independent evolution of the different codon positions, which is overly restrictive from a biological point of view. Given that empirical research has provided indications of context-dependent substitution patterns at four-fold degenerate sites, we take those indications into account in this paper. Results We present so-called context-dependent codon partition models to assess previous empirical claims that the evolution of four-fold degenerate sites is strongly dependent on the composition of its two flanking bases. To this end, we have estimated and compared various existing independent models, codon models, codon partition models and context-dependent codon partition models for the atpB and rbcL genes of the chloroplast genome, which are frequently used in plant systematics. Such context-dependent codon partition models employ a full dependency scheme for four-fold degenerate sites, whilst maintaining the independence assumption for the first and second codon positions. Conclusions We show that, both in the atpB and rbcL alignments of a collection of land plants, these context-dependent codon partition models significantly improve model fit over existing codon partition models. Using Bayes factors based on thermodynamic integration, we show that in both datasets the same context-dependent codon partition model yields the largest increase in model fit compared to an independent evolutionary model. Context-dependent codon partition models hence perform closer to codon models, which remain the best performing models at a drastically increased computational cost, compared to codon partition models, but remain computationally interesting alternatives to codon models. Finally, we observe that the substitution patterns in both datasets are drastically different, leading to the conclusion that combined analysis of these two genes using a single model may not be advisable from a context-dependent point of view. PMID:21619569

  7. Experimental Measurements of Starting Loads and Model Behaviors in the Indraft Supersonic Wind Tunnel

    NASA Astrophysics Data System (ADS)

    Minato, Ryojiro; Mizobata, Kazuhide; Kuwata, Komei

    Measurements of starting load in the indraft supersonic wind tunnel of Muroran Institute of Technology were conducted for Mach 2, 3 and 4 conditions with the AGARD-B model. The high-speed photographs covering the behaviors of the wind tunnel model from the start to end of the operation were taken. Those photographs make clear that the oscillations of the model coincide with the measured starting load oscillation and starting loads were caused by two shock waves. The first shock wave is the reflection shock, generated at the nozzle throat by expansion wave reflection. The second wave is comprised asymmetric oblique shock waves (AOS) coming from upstream. AOS can generate asymmetric conical shock (ACS) around the nose cone of the model, which would have directly caused the starting loads on the wind tunnel model. Based on these observations, propose a conical shock theory, as an alternative starting load prediction theory instead of the normal shock theory.

  8. A study of the purine/pyrimidine codon occurrence with a reduced centered variable and an evaluation compared to the frequency statistic.

    PubMed

    Michel, C J

    1989-12-01

    With the three-letter alphabet [R,Y,N] (R = purine, Y = pyrimidine, N = R or Y), there are 26 codons (NNN being excluded): RNN,...,NNY (six codons at two unspecified bases N), RRN,...,NYY (12 codons at one unspecified base N), RRR,...,YYY (eight specified codons). A statistical methodology that uses the codon frequency and a reduced centered variable leads to similar results for a codon occurrence study, regardless of gene function and regardless of a particular protein coding gene taxonomic population. Therefore, this variable can be considered a new codon usage index, whose use removes certain nonsignificant results found with the frequency statistic. This methodology identifies the common and rare codons (i.e., the codons having the highest and lowest occurrence) and leads to a model of codon evolution at three successive states: RNN, then RNY, and finally RYY. Some biological relations between this model and the YRY(N)6YRY preferential occurrence are also presented. PMID:2520209

  9. Identification of TTA codon containing genes in Frankia and exploration of the role of tRNA in regulating these genes.

    PubMed

    Sen, Arnab; Thakur, Subarna; Bothra, Asim K; Sur, Saubashya; Tisa, Louis S

    2012-01-01

    The TTA codon, one of the six available codons for the amino acid leucine, is the rarest codon among the high GC genomes of Actinobacteria including Frankia. This codon has been implicated in various regulatory mechanisms involving secondary metabolism and morphological development. TTA-mediated gene regulation is well documented in Streptomyces coelicolor, but that role has not been investigated in other Actinobacteria including Frankia. Among the various Actinomycetes with a GC content of more than 70%, Frankia genomes had the highest percentages of TTA-containing genes ranging from 5.2 to 10.68% of the genome. In contrast, TTA-bearing genes comprised 1.7, 3.4 and 4.1% of the Streptomyces coelicolor, S. avermitilis and Nocardia farcinia genomes, respectively. We analyzed their functional role, evolutionary significance, horizontal acquisition and the codon-anticodon interaction. The TTA-bearing genes were found to be well represented in metabolic genes involved in amino acid transport and secondary metabolism. A reciprocal Blast search reveal that many of the TTA-bearing genes have orthologs in the other Frankia genomes, and some of these orthologous genes also have a TTA codon in them. The gene expression level of TTA-containing genes was estimated by the use of the codon adaption index (CAI), and the CAI values were found to have a positive correlation with the GC3 (GC content at the 3rd codon position). A full-atomic 3D model of the leucine tRNA recognizing the TTA (UUA) codon was generated and utilized for in silico docking to determine binding affinity in codon-anticodon interaction. We found a proficient codon-anticodon interaction for this codon which is perhaps why so many genes hold on to this rare codon without compromising their translational efficiency. PMID:21773800

  10. Limitations of the 'ambush hypothesis' at the single-gene scale: what codon biases are to blame?

    PubMed

    Bertrand, Robert L; Abdel-Hameed, Mona; Sorensen, John L

    2015-04-01

    Ribosomal frameshifting, a translational error, catastrophically alters the amino acid composition of the nascent protein by shifting the reading frame from the intended contiguous trinucleotide reading. Frameshift events waste energy and resources, and peptide products have unpredictable cytotoxic effects. The 'Ambush Hypothesis' (Seligmann and Pollock 2004, DNA Cell Biol 23:701-5) suggests there is a selective pressure favouring the evolution of out-of-frame ('hidden') stop codons. Although this hypothesis has gained empirical support through whole-genome studies, it is presently unknown whether it can be applied at a single-gene scale. Herein, we report such an investigation using the gene, polyketide synthase (PKS), among species of fungi. Contrary to expectation, genes presented with significantly lower number of hidden stop codons than expected in a selection-neutral model (p < 0.0005), suggesting both non-adherence to the ambush hypothesis as well as suppression of hidden stop codon evolution. It is known that there are multiple adaptive considerations determining codon selection during evolution, and that the information-holding potential of the genetic code is finite. We hypothesize that the reason for low hidden stops in PKS genes is due to competing 'codon biases' that are prioritized over the selective pressure favouring the emergence of hidden stops. Future studies of the ambush hypothesis in the context of other drivers of codon bias may allow this hypothesis to be molded into a comprehensive genetic theory that can be integrated within the broader genetic theory of codon bias and applied to the genetic code at any scale of analysis. PMID:25307067

  11. The Effect of Upstream Vane Wakes on Annular Diffuser Flows

    NASA Astrophysics Data System (ADS)

    Cherry, Erica; Padilla, Angelina; Elkins, Christopher; Eaton, John

    2008-11-01

    Experiments were performed to determine the sensitivity to inlet conditions of the flow in two annular diffusers. One of the diffusers was a conservative design typical of a diffuser directly upstream of the combustor in a jet engine. The other had the same length and inlet shape as the first diffuser but a larger area ratio and was meant to operate on the verge of separation. Each diffuser was connected to two different inlets, one containing a fully-developed channel flow, the other containing wakes from a row of airfoils. Three-component velocity measurements were taken on the flow in each inlet/diffuser combination using Magnetic Resonance Velocimetry. Results will be presented on the 3D velocity fields in the two diffusers and the effect of the airfoil wakes on separation and secondary flows.

  12. Upstream and downstream processing of recombinant IgA.

    PubMed

    Reinhart, David; Kunert, Renate

    2015-02-01

    Immunoglobulin A (IgA) is the most abundant antibody class in the human body and has a unique role in mediating immunity. The ever-increasing knowledge about the potential of IgAs has renewed interest in this antibody class for therapeutic use against a variety of infectious and malignant diseases, and as a preventive agent for mucosal pathogens. Despite the considerable therapeutic potential of IgA the exploration thereof has often been hampered due to difficulties in producing and purifying desired quantities. Large amounts of pure IgA will be required for in vivo studies. This work reviews current achievements and bottlenecks in upstream and downstream processing of recombinant IgA from a biotechnological point of view. We also highlight recent accomplishments with diverse expression systems and presents different affinity techniques for the capture of recombinant IgA to compare their purification potential. PMID:25257601

  13. Measurements of bow shock particles far upstream from the earth

    NASA Technical Reports Server (NTRS)

    Anderson, K. A.

    1981-01-01

    Electrons and ions moving upstream frequently appear at distances up to 240 earth radii from earth at times when the direction of the interplanetary magnetic field allows their propagation from the bow shock. Strong asymmetries in the ion angular pitch angle distribution are often observed, a consequence of the sharp gradient in guiding center density and very weak scattering. The gradient is due to the restricted spatial region over which these particles are accelerated. The solar wind electric field acts on these particles and produces striking effects in both the ion angular distributions and the ion energy spectra. The frequent occurrence of these effects implies that the source region of the diffuse ions at the bow shock is not more than a few tens of thousands of km.

  14. 5. Looking west upstream, towards the location of the erstwhile ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. Looking west upstream, towards the location of the erstwhile intake flume into canal from the upper reaches of the Potomac River above the Great Falls, on the old Potowmack Canal built by George Washington. The plan contemplated canal navigation around the Great Falls of the Potomac River, located on the Virginia side of the Potomac, about 15 miles above Washington, D.C. The Company was organized in 1785, and by 1802, this and three or four smaller canals were substantially completed and raft-like boats began operation with materials from the west to the city of Georgetown. 'Although the canals and locks of the Potomac Canal were considered a great engineering accomplishment, the improvements to the river channel were inadequate. Disappointment ... - Potowmack Company: Great Falls Canal & Locks, Great Falls, Fairfax County, VA

  15. Salomon Bros. survey shows flat upstream spending for 1992

    SciTech Connect

    Not Available

    1992-01-27

    The yearly survey by Salomon Bros., New York of upstream spending by the international petroleum industry shows little change for 1992 from 1991. This paper reports that a substantial shift from U.S. to non U.S. exploration and production will continue, the firm's 10th and largest survey-241 companies-shows only 1 1.3% increase in worldwide exploration and production spending to $53.7 billion in 1992 from $53.1 billion estimated in 1991. The amount estimated for last year's spending is less than the sum forecast at midyear 1991. That, in turn, is lower than what was budgeted for 1991 in December 1990. Budgets in 1991 were significantly underspent in the U.S. and Canada but not elsewhere.

  16. An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

    PubMed Central

    Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

    2014-01-01

    Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis ?(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

  17. Correlation between upstream human activities and riverine antibiotic resistance genes.

    PubMed

    Pruden, Amy; Arabi, Mazdak; Storteboom, Heather N

    2012-11-01

    Antimicrobial resistance remains a serious and growing human health challenge. The water environment may represent a key dissemination pathway of resistance elements to and from humans. However, quantitative relationships between landscape features and antibiotic resistance genes (ARGs) have not previously been identified. The objective of this study was to examine correlations between ARGs and putative upstream anthropogenic sources in the watershed. sul1 (sulfonamide) and tet(W) (tetracycline) were measured using quantitative polymerase chain reaction in bed and suspended sediment within the South Platte River Basin, which originates from a pristine region in the Rocky Mountains and runs through a gradient of human activities. A geospatial database was constructed to delineate surface water pathways from animal feeding operations, wastewater treatment plants, and fish hatchery and rearing units to river monitoring points. General linear regression models were compared. Riverine sul1 correlated with upstream capacities of animal feeding operations (R(2) = 0.35, p < 0.001) and wastewater treatment plants (R(2) = 0.34, p < 0.001). Weighting for the inverse distances from animal feeding operations along transport pathways strengthened the observed correlations (R(2) = 0.60-0.64, p < 0.001), suggesting the importance of these pathways in ARG dissemination. Correlations were upheld across the four sampling events during the year, and averaging sul1 measurements in bed and suspended sediments over all events yielded the strongest correlation (R(2) = 0.92, p < 0.001). Conversely, a significant relationship with landscape features was not evident for tet(W), which, in contrast to sul1, is broadly distributed in the pristine region and also relatively more prevalent in animal feeding operation lagoons. The findings highlight the need to focus attention on quantifying the contribution of water pathways to the antibiotic resistance disease burden in humans and offer insight into potential strategies to control the spread of ARGs. PMID:23035771

  18. Explosion Clad for Upstream Oil and Gas Equipment

    SciTech Connect

    Banker, John G. [Dynamic Materials Corp., 5405 Spine Rd., Boulder, CO 80301 (United States); Massarello, Jack [Global Metallix, Consultant to DMC, 5405 Spine Rd., Boulder, CO 80301 (United States); Pauly, Stephane [DMC., Nobelclad Business Unit, 1 Allee Alfred NOBEL, 66600 Rivesaltes (France)

    2011-01-17

    Today's upstream oil and gas facilities frequently involve the combination of high pressures, high temperatures, and highly corrosive environments, requiring equipment that is thick wall, corrosion resistant, and cost effective. When significant concentrations of CO{sub 2} and/or H{sub 2}S and/or chlorides are present, corrosion resistant alloys (CRA) can become the material of choice for separator equipment, piping, related components, and line pipe. They can provide reliable resistance to both corrosion and hydrogen embrittlement. For these applications, the more commonly used CRA's are 316L, 317L and duplex stainless steels, alloy 825 and alloy 625, dependent upon the application and the severity of the environment. Titanium is also an exceptional choice from the technical perspective, but is less commonly used except for heat exchangers. Explosion clad offers significant savings by providing a relatively thin corrosion resistant alloy on the surface metallurgically bonded to a thick, lower cost, steel substrate for the pressure containment. Developed and industrialized in the 1960's the explosion cladding technology can be used for cladding the more commonly used nickel based and stainless steel CRA's as well as titanium. It has many years of proven experience as a reliable and highly robust clad manufacturing process. The unique cold welding characteristics of explosion cladding reduce problems of alloy sensitization and dissimilar metal incompatibility. Explosion clad materials have been used extensively in both upstream and downstream oil, gas and petrochemical facilities for well over 40 years. The explosion clad equipment has demonstrated excellent resistance to corrosion, embrittlement and disbonding. Factors critical to insure reliable clad manufacture and equipment design and fabrication are addressed.

  19. Attenuation of human respiratory syncytial virus by genome-scale codon-pair deoptimization.

    PubMed

    Le Nouën, Cyril; Brock, Linda G; Luongo, Cindy; McCarty, Thomas; Yang, Lijuan; Mehedi, Masfique; Wimmer, Eckard; Mueller, Steffen; Collins, Peter L; Buchholz, Ursula J; DiNapoli, Joshua M

    2014-09-01

    Human respiratory syncytial virus (RSV) is the most important viral agent of serious pediatric respiratory-tract disease worldwide. A vaccine or generally effective antiviral drug is not yet available. We designed new live attenuated RSV vaccine candidates by codon-pair deoptimization (CPD). Specifically, viral ORFs were recoded by rearranging existing synonymous codons to increase the content of underrepresented codon pairs. Amino acid coding was completely unchanged. Four CPD RSV genomes were designed in which the indicated ORFs were recoded: Min A (NS1, NS2, N, P, M, and SH), Min B (G and F), Min L (L), and Min FLC (all ORFs except M2-1 and M2-2). Surprisingly, the recombinant CPD viruses were temperature-sensitive for replication in vitro (level of sensitivity: Min FLC > Min L > Min B > Min A). All of the CPD mutants grew less efficiently in vitro than recombinant wild-type (WT) RSV, even at the typically permissive temperature of 32 °C (growth efficiency: WT > Min L > Min A > Min FLC > Min B). CPD of the ORFs for the G and F surface glycoproteins provided the greatest restrictive effect. The CPD viruses exhibited a range of restriction in mice and African green monkeys comparable with that of two attenuated RSV strains presently in clinical trials. This study provided a new type of attenuated RSV and showed that CPD can rapidly generate vaccine candidates against nonsegmented negative-strand RNA viruses, a large and expanding group that includes numerous pathogens of humans and animals. PMID:25157129

  20. HER2 codon 655 polymorphism and breast cancer risk: a meta-analysis

    Microsoft Academic Search

    Weiyang Tao; Chunyang Wang; Ruifa Han; Hongchi Jiang

    2009-01-01

    To evaluate the association between HER2 codon 655 polymorphism and breast cancer risk in this meta-analysis. A comprehensive search was performed to identify all\\u000a case–control studies investigating such association. Statistical analyses were conducted with software MIX 1.54. Twenty eligible\\u000a reports, including 10,642 cases\\/11,259 controls, were identified. In overall analysis, the Val allele frequency in cases was\\u000a significantly higher than that

  1. Exploring Codon Optimization and Response Surface Methodology to Express Biologically Active Transmembrane RANKL in E. coli

    PubMed Central

    Bok, Jin-Duck; Kim, Jeong-In; Jiang, Tao; Cho, Chong-Su; Kang, Sang-Kee; Choi, Yun-Jaie

    2014-01-01

    Receptor activator of nuclear factor (NF)-?B ligand (RANKL), a master cytokine that drives osteoclast differentiation, activation and survival, exists in both transmembrane and extracellular forms. To date, studies on physiological role of RANKL have been mainly carried out with extracellular RANKL probably due to difficulties in achieving high level expression of functional transmembrane RANKL (mRANKL). In the present study, we took advantage of codon optimization and response surface methodology to optimize the soluble expression of mRANKL in E. coli. We optimized the codon usage of mRANKL sequence to a preferred set of codons for E. coli changing its codon adaptation index from 0.64 to 0.76, tending to increase its expression level in E. coli. Further, we utilized central composite design to predict the optimum combination of variables (cell density before induction, lactose concentration, post-induction temperature and post-induction time) for the expression of mRANKL. Finally, we investigated the effects of various experimental parameters using response surface methodology. The best combination of response variables was 0.6 OD600, 7.5 mM lactose, 26°C post-induction temperature and 5 h post-induction time that produced 52.4 mg/L of fusion mRANKL. Prior to functional analysis of the protein, we purified mRANKL to homogeneity and confirmed the existence of trimeric form of mRANKL by native gel electrophoresis and gel filtration chromatography. Further, the biological activity of mRANKL to induce osteoclast formation on RAW264.7 cells was confirmed by tartrate resistant acid phosphatase assay and quantitative real-time polymerase chain reaction assays. Importantly, a new finding from this study was that the biological activity of mRANKL is higher than its extracellular counterpart. To the best of our knowledge, this is the first time to report heterologous expression of mRANKL in soluble form and to perform a comparative study of functional properties of both forms of RANKL. PMID:24809485

  2. Adenine-containing codons enhance protein synthesis by promoting mRNA binding to ribosomal 30S subunits provided that specific tRNAs are not exhausted

    Microsoft Academic Search

    M. A. Castillo-Méndez; E. Jacinto-Loeza; J. J. Olivares-Trejo; G. Guarneros-Peña; J. Hernández-Sánchez

    Adenines downstream of the initiation codon promote protein synthesis; however, some adenine-containing codons (AGA, AGG and AUA) at early positions inhibit protein synthesis when cognate tRNA is exhausted. It has also been reported, although not convincingly, the presence of adenines enhancing mRNA binding to the ribosome. To understand these apparent inconsistencies we analyzed the effect of these codons in mRNA-ribosome binding

  3. Estimating Gene Expression and Codon-Specific Translational Efficiencies, Mutation Biases, and Selection Coefficients from Genomic Data Alone.

    PubMed

    Gilchrist, Michael A; Chen, Wei-Chen; Shah, Premal; Landerer, Cedric L; Zaretzki, Russell

    2015-01-01

    Extracting biologically meaningful information from the continuing flood of genomic data is a major challenge in the life sciences. Codon usage bias (CUB) is a general feature of most genomes and is thought to reflect the effects of both natural selection for efficient translation and mutation bias. Here we present a mechanistically interpretable, Bayesian model (ribosome overhead costs Stochastic Evolutionary Model of Protein Production Rate [ROC SEMPPR]) to extract meaningful information from patterns of CUB within a genome. ROC SEMPPR is grounded in population genetics and allows us to separate the contributions of mutational biases and natural selection against translational inefficiency on a gene-by-gene and codon-by-codon basis. Until now, the primary disadvantage of similar approaches was the need for genome scale measurements of gene expression. Here, we demonstrate that it is possible to both extract accurate estimates of codon-specific mutation biases and translational efficiencies while simultaneously generating accurate estimates of gene expression, rather than requiring such information. We demonstrate the utility of ROC SEMPPR using the Saccharomyces cerevisiae S288c genome. When we compare our model fits with previous approaches we observe an exceptionally high agreement between estimates of both codon-specific parameters and gene expression levels ([Formula: see text] in all cases). We also observe strong agreement between our parameter estimates and those derived from alternative data sets. For example, our estimates of mutation bias and those from mutational accumulation experiments are highly correlated ([Formula: see text]). Our estimates of codon-specific translational inefficiencies and tRNA copy number-based estimates of ribosome pausing time ([Formula: see text]), and mRNA and ribosome profiling footprint-based estimates of gene expression ([Formula: see text]) are also highly correlated, thus supporting the hypothesis that selection against translational inefficiency is an important force driving the evolution of CUB. Surprisingly, we find that for particular amino acids, codon usage in highly expressed genes can still be largely driven by mutation bias and that failing to take mutation bias into account can lead to the misidentification of an amino acid's "optimal" codon. In conclusion, our method demonstrates that an enormous amount of biologically important information is encoded within genome scale patterns of codon usage, accessing this information does not require gene expression measurements, but instead carefully formulated biologically interpretable models. PMID:25977456

  4. Viral Proteins Originated De Novo by Overprinting Can Be Identified by Codon Usage: Application to the “Gene Nursery” of Deltaretroviruses

    PubMed Central

    Pavesi, Angelo; Magiorkinis, Gkikas; Karlin, David G.

    2013-01-01

    A well-known mechanism through which new protein-coding genes originate is by modification of pre-existing genes, e.g. by duplication or horizontal transfer. In contrast, many viruses generate protein-coding genes de novo, via the overprinting of a new reading frame onto an existing (“ancestral”) frame. This mechanism is thought to play an important role in viral pathogenicity, but has been poorly explored, perhaps because identifying the de novo frames is very challenging. Therefore, a new approach to detect them was needed. We assembled a reference set of overlapping genes for which we could reliably determine the ancestral frames, and found that their codon usage was significantly closer to that of the rest of the viral genome than the codon usage of de novo frames. Based on this observation, we designed a method that allowed the identification of de novo frames based on their codon usage with a very good specificity, but intermediate sensitivity. Using our method, we predicted that the Rex gene of deltaretroviruses has originated de novo by overprinting the Tax gene. Intriguingly, several genes in the same genomic region have also originated de novo and encode proteins that regulate the functions of Tax. Such “gene nurseries” may be common in viral genomes. Finally, our results confirm that the genomic GC content is not the only determinant of codon usage in viruses and suggest that a constraint linked to translation must influence codon usage. PMID:23966842

  5. Tackling codon usage bias for heterologous expression in Rhodobacter sphaeroides by supplementation of rare tRNAs.

    PubMed

    Cheng, Danhui; Wang, Ri; Prather, Kristala Jones; Chow, King Lau; Hsing, I-Ming

    2015-05-01

    The photosynthetic Rhodobacter species are promising alternative expression hosts in bioproduction and biorefinery due to their unique metabolic capacities. With prominent inner membrane areas and efficient endogenous translocation machineries, they are especially attractive for membrane protein expression. However, codon usage bias could be a limitation in the engineering of Rhodobacter species and has seldom been investigated. In this study, we tackled the codon bias of Rhodobacter by functionally expressing 8 rare tRNAs of Rhodobacter sphaeroides with a multi-copy vector. The impact of tRNA supplementation was evaluated through monitoring expression levels of two heterologous proteins with different phylogenetic origins, a membrane subunit of the riboflavin transporter, RibU, from Lactobacillus acidophilus La-14 and a decaheme cytochrome, MtrA, from Shewanella oneidensis. Our results showed that the performances were closely related to medium composition and rare codon percentages of raw DNA sequences. Provision of rare tRNAs has increased RibU production by 7.7-folds and 2.86-fold in minimal medium and rich medium, respectively, while MtrA levels were increased by 1-fold in minimal medium. The present study confirms the presence of codon bias in R. sphaeroides and offers a facile tool for improving heterologous expression of rare-codon containing genes. We anticipate that this tRNA supplementation system can be further extended to other species of Rhodobacter, and thus will facilitate the engineering of purple bacteria for interesting applications in microbial technology. PMID:25837504

  6. Association of TP53 codon 72 polymorphism and the outcome of adjuvant therapy in breast cancer patients

    PubMed Central

    Toyama, Tatsuya; Zhang, Zhenhuan; Nishio, Mariko; Hamaguchi, Maho; Kondo, Naoto; Iwase, Hirotaka; Iwata, Hiroji; Takahashi, Satoru; Yamashita, Hiroko; Fujii, Yoshitaka

    2007-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) in codon 72 of the TP53 (also known as p53) gene (rs1042522) and in the promoter region of the MDM2 gene (SNP309; rs2279744) have been suggested to play roles in many cancers. We investigated whether these SNPs were associated with patient outcome and the effect of adjuvant systemic therapy. Methods The genotypes of TP53 codon 72 and MDM2 SNP309 were defined among 557 primary Japanese breast cancer patients (median follow-up, 61.7 months). The effects of several variables on survival were tested by Cox's proportional hazards regression analysis. Results We showed that the Pro/Pro genotype of TP53 codon 72 was associated with poorer disease-free survival (DFS) than other genotypes by Kaplan-Meier analysis (P = 0.049) and multivariate Cox's proportional hazards regression analysis (P = 0.047, risk ratio of recurrence = 1.67), whereas MDM2 SNP309 status was not associated with DFS. The association of the Pro/Pro TP53 genotype with poorer DFS was especially significant in patients who received adjuvant chemotherapy (P = 0.009). In contrast, among the patients who had received adjuvant hormonal therapy or no adjuvant systemic therapy, TP53 codon 72 genotype was not associated with DFS. Conclusion The Pro/Pro genotype of TP53 codon 72 appears to be an independent prognostic marker in breast cancer patients. PMID:17537232

  7. A premature termination codon within an alternative exon affecting only the metabolism of transcripts that retain this exon.

    PubMed

    Maillet, P; Dalla Venezia, N; Lorenzo, F; Morinière, M; Bozon, M; Noël, B; Delaunay, J; Baklouti, F

    1999-01-01

    Protein 4.1 pre-mRNA splicing is regulated in tissue- and development-specific manners. Exon 16, which encodes the N-terminal region of the spectrin/actin-binding domain, is one of the alternatively spliced sequence motifs. It is present in late differentiated erythroid cells but absent from early erythroblasts and from lymphoid cells. We describe a single nucleotide deletion of the erythroid protein 4.1 gene associated with hereditary elliptocytosis. The deletion located in exon 16 leads to a frameshift and a premature termination codon within the same exon. In an effort to examine the premature stop codon effect in relationship with exon 16 alternative splicing, we analyzed erythroid and lymphoid protein 4.1 mRNAs using the mutation and a linked downstream polymorphism as markers. We found that the premature stop codon does not affect the tissue-specific alternative splicing among the two cell types analyzed and that the resulting alteration of mRNA metabolism correlates with the retention of exon 16 in reticulocytes. Conversely, skipping of exon 16 in lymphoid cells converts the mutant mRNA to a normal lymphoid-specific mRNA isoform, hence bypassing the nonsense codon. Consistent with data obtained on constitutive nonsense exons, our observations argue in favor of a stop codon recognition mechanism that occurs after the regulated splicing status of the nonsense exon has been achieved. PMID:10425037

  8. Upstream migration of two pre-spawning shortnose sturgeon passed upstream of Pinopolis Dam, Cooper River, South Carolina

    USGS Publications Warehouse

    Finney, S.T.; Isely, J.J.; Cooke, D.W.

    2006-01-01

    Two shortnose sturgeon were artificially passed above the Pinopolis Lock and Dam into the Santee-Cooper Lakes in order to simulate the use of a fish-passage mechanism. Movement patterns and spawning behavior were studied to determine the potential success of future shortnose sturgeon migrations if and when a fish-migration bypass structure is installed. In addition to movement patterns, water temperature was monitored in areas that shortnose sturgeons utilized. Shortnose sturgeon migrated through a large static system to a known shortnose sturgeon spawning area more than 160 km upstream where water temperatures were consistent with known shortnose sturgeon spawning temperatures. No specific movement patterns in the reservoir system were recorded during downstream migrations.

  9. Experimental Measurements of Starting Loads and Model Behaviors in the Indraft Supersonic Wind Tunnel

    NASA Astrophysics Data System (ADS)

    Minato, Ryojiro; Mizobata, Kazuhide; Kuwata, Komei

    Measurements of starting load in the indraft supersonic wind tunnel of Muroran Institute of Technology were conducted for Mach 2, 3 and 4 conditions with AGARD-B model. The high speed photographs were taken for the behaviors of the wind tunnel model. Those photographs make clear that the oscillations of the model coincide with the measured starting load oscillation and starting loads were caused by two shock waves. The first shock wave is the reflection shock, which is generated at the nozzle throat by expansion wave reflection. The second one is asymmetric oblique shock waves (AOS) coming from the upstream. AOS can generate the asymmetric conical shock (ACS) around the nose cone of the model, which would have directly caused the starting loads on the wind tunnel model. Based on those observations, the authors presented the conical shock theory, which is the alternative starting load prediction theory to the normal shock theory.

  10. Starting Mechanisms for High Contraction Ratio Hypersonic Inlets

    NASA Astrophysics Data System (ADS)

    Grainger, A.; Tirtey, S. C.; Boyce, R. R.; Paris, S.; Paniagua, G.

    2011-08-01

    A coupled numerical/experimental study of two, variable geometry mechanisms for starting high contraction ratio hypersonic inlets has been conducted within the framework of the SCRAMSPACE Scramjet- based Access-to-Space Systems project. The first of the two mechanisms investigated involves opening and closing two doors on the inner inlet wall, and is intended to be integrated into the planned SCRAMSPACE I scramjet flight experiment. The second method investigated involves sliding two oblique doors, located upstream of the inlet entrance, up over the body of the scramjet. Successful inlet starting at a flight Mach number of 8 at a low altitude and 0° angle of attack was achieved when utilising the opening doors inlet starting mechanism. Additional simulations of the performance of this mechanism at various altitudes along the SCRAMSPACE descent trajectory have been performed, to investigate the effects of more viscous inlet flows at rarefied conditions. These results show that it is possible to ensure a started inlet flow for the entire trajectory when utilising variable geometry.

  11. Nebraska: Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012

    2012-01-01

    Since 1999, Nebraska's Early Head Start Infant/Toddler Quality Initiative has supported Early Head Start (EHS) and community child care partnerships to improve the quality and professionalism of infant and toddler care. EHS programs apply to receive funding to establish partnerships with center-based or home-based child care.The initiative has…

  12. Head Start Embraces Language Diversity

    ERIC Educational Resources Information Center

    David, Judy, Comp.

    2005-01-01

    Over its 40 years, Head Start has evolved from serving a population of primarily Spanish-speaking English-language learners to working with children and families who speak more than 140 different languages. In some Head Start classrooms, as many as 10 different languages are used by the children. In other classrooms, a majority of the…

  13. Kansas: Early Head Start Initiative

    ERIC Educational Resources Information Center

    Center for Law and Social Policy, Inc. (CLASP), 2012

    2012-01-01

    Kansas Early Head Start (KEHS) provides comprehensive services following federal Head Start Program Performance Standards for pregnant women and eligible families with children from birth to age 4. KEHS was implemented in 1998 using Child Care and Development Block Grant (CCDBG) quality set-aside dollars augmented by a transfer of federal…

  14. Codon optimisation improves the expression of Trichoderma viride sp. endochitinase in Pichia pastoris

    PubMed Central

    Yu, Ping; Yan, Yuan; Gu, Qing; Wang, Xiangyang

    2013-01-01

    The mature cDNA of endochitinase from Trichoderma viride sp. was optimised based on the codon bias of Pichia pastoris GS115 and synthesised by successive PCR; the sequence was then transformed into P. pastoris GS115 via electroporation. The transformant with the fastest growth rate on YPD plates containing 4?mg/mL G418 was screened and identified. This transformant produced 23.09?U/mL of the recombinant endochitinase, a 35% increase compared to the original strain bearing the wild-type endochitinase cDNA. The recombinant endochitinase was sequentially purified by ammonia sulphate precipitation, DE-52 anion-exchange chromatography and Sephadex G-100 size-exclusion chromatography. Thin-layer chromatography indicated that the purified endochitinase could hydrolyse chito-oligomers or colloidal chitin to generate diacetyl-chitobiose (GlcNAc)2 as the main product. This study demonstrates (1) a means for high expression of Trichoderma viride sp. endochitinase in P. pastoris using codon optimisation and (2) the preparation of chito-oligomers using endochitinase. PMID:24154717

  15. Impact of the MLL1 morphemes on codon utilization and preservation in CpG Islands.

    PubMed

    Bina, Minou; Wyss, Phillip

    2015-09-01

    Previous studies have shown that Mixed Lineage Leukemia 1 (MLL1 or MLL) binds a group of CpG-rich motifs known as morphemes. To examine whether occurrences of MLL1 morphemes in genomic DNA may influence codon utilization, we analyzed the frequency of various 9-mers in human cDNAs and in total human genomic DNA. We uncovered preferential utilization of GGC for Gly, GCG for Ala, CCG for Pro, and TCG for Ser, in coding sequences (CDSs) that included MLL1 morphemes. We also examined weighted occurrences of CDS 9-mers in a 30-base window that moved along each human chromosome. In plots, we observed peaks with fluctuating intensities. High intensity peaks appeared within promoter and exons localized in CpG islands, encompassing sequences that included MLL1 morphemes. High intensity peaks included CCG/GGC repeats, whose expansion may cause neurological disorders and congenital malformations. Such repeats are generated from overlap of a morpheme (CGCCG/CGGCG), which depending on reading frame and orientation would produce runs of Ala, Gly, or Pro in proteins. Overall, our results point to a role for morpheme occurrences on synonymous codon utilization in human genomic DNA and indicate that regulatory instructions are dispersed not only in promoters but also in exons of human genes. © 2015 Wiley Periodicals, Inc. Biopolymers 103: 480-490, 2015. PMID:25991579

  16. Codon optimization for high level expression of human bone morphogenetic protein-2 in Escherichia coli.

    PubMed

    Retnoningrum, Debbie S; Pramesti, H T; Santika, P Y; Valerius, O; Asjarie, S; Suciati, T

    2012-08-01

    Codons in the open reading frame (ORF) encoding for human bone morphogenetic protein-2 (hBMP-2) were optimized to reach high level expression in Escherichia coli. The optimization was done by the computer programs DNA works and DNA Star according to Thermodynamically Balanced Inside Out (TBIO) approach. The ORF consisting of 342 base pairs (bp) was assembled using two-steps Polymerase Chain Reaction, cloned into a pGEM-T vector with a mutation rate of 6.38 bp per kb and transformed into E. coli JM109. After a DNA sequence confirmation, mutation-free ORF was subcloned into pET32b and transformed into E. coli BL21(DE3). The rhBMP-2 was produced as a thioredoxin-his-tag fusion protein at relatively high level, approximately 60% of total intracellular proteins as inclusion bodies (IB), with a yield of 1.39 g per liter culture. Solubilization of IB gave soluble monomer rhBMP-2 with a recovery of 13.6% and refolding of soluble rhBMP-2 produced dimeric forms with a yield of 8.7%. The size and identity of the purified rhBMP-2 was confirmed by nano-LC-MS/MS2 analysis. Our work demonstrates for the first time that by using TBIO approach, a codon-optimized ORF encoding for rhBMP-2 protein can be expressed at high level in E. coli expression system. PMID:22691543

  17. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster

    PubMed Central

    Dunn, Joshua G; Foo, Catherine K; Belletier, Nicolette G; Gavis, Elizabeth R; Weissman, Jonathan S

    2013-01-01

    Ribosomes can read through stop codons in a regulated manner, elongating rather than terminating the nascent peptide. Stop codon readthrough is essential to diverse viruses, and phylogenetically predicted to occur in a few hundred genes in Drosophila melanogaster, but the importance of regulated readthrough in eukaryotes remains largely unexplored. Here, we present a ribosome profiling assay (deep sequencing of ribosome-protected mRNA fragments) for Drosophila melanogaster, and provide the first genome-wide experimental analysis of readthrough. Readthrough is far more pervasive than expected: the vast majority of readthrough events evolved within D. melanogaster and were not predicted phylogenetically. The resulting C-terminal protein extensions show evidence of selection, contain functional subcellular localization signals, and their readthrough is regulated, arguing for their importance. We further demonstrate that readthrough occurs in yeast and humans. Readthrough thus provides general mechanisms both to regulate gene expression and function, and to add plasticity to the proteome during evolution. DOI: http://dx.doi.org/10.7554/eLife.01179.001 PMID:24302569

  18. A codon-optimized green fluorescent protein for live cell imaging in Zymoseptoria tritici?

    PubMed Central

    Kilaru, S.; Schuster, M.; Studholme, D.; Soanes, D.; Lin, C.; Talbot, N.J.; Steinberg, G.

    2015-01-01

    Fluorescent proteins (FPs) are powerful tools to investigate intracellular dynamics and protein localization. Cytoplasmic expression of FPs in fungal pathogens allows greater insight into invasion strategies and the host-pathogen interaction. Detection of their fluorescent signal depends on the right combination of microscopic setup and signal brightness. Slow rates of photo-bleaching are pivotal for in vivo observation of FPs over longer periods of time. Here, we test green-fluorescent proteins, including Aequorea coerulescens GFP (AcGFP), enhanced GFP (eGFP) from Aequorea victoria and a novel Zymoseptoria tritici codon-optimized eGFP (ZtGFP), for their usage in conventional and laser-enhanced epi-fluorescence, and confocal laser-scanning microscopy. We show that eGFP, expressed cytoplasmically in Z. tritici, is significantly brighter and more photo-stable than AcGFP. The codon-optimized ZtGFP performed even better than eGFP, showing significantly slower bleaching and a 20–30% further increase in signal intensity. Heterologous expression of all GFP variants did not affect pathogenicity of Z. tritici. Our data establish ZtGFP as the GFP of choice to investigate intracellular protein dynamics in Z. tritici, but also infection stages of this wheat pathogen inside host tissue. PMID:26092799

  19. Kras gene codon 12 mutation detection enabled by gold nanoparticles conducted in a nanobioarray chip.

    PubMed

    Sedighi, Abootaleb; Li, Paul C H

    2014-03-01

    This study employs a nanobioarray (NBA) chip for multiple biodetection of single base pair mutations at the Kras gene codon 12. To distinguish between the mutant and wild-type target DNAs, current bioarray methods use high-temperature hybridization of the targets to the allele-specific probes. However, these techniques need prior temperature optimization and become harder to implement in the case of the detection of multiple mutations. We aimed to detect these mutations at a single temperature (room temperature), enabled by the use of gold nanoparticles (AuNPs) on the bioarray created within nanofluidic channels. In this method, a low amount of target oligonucleotides (5fmol) and polymerase chain reaction (PCR) products (300pg) were first loaded on the AuNP surface, and then these AuNP-bound targets were introduced into the channels of a polydimethylsiloxane (PDMS) glass chip. The targets hybridized to their complementary probes at the intersection of the target channels to the pre-printed oligonucleotide probe lines on the glass surface, creating a bioarray. Using this technique, fast and high-throughput multiple discrimination of the Kras gene codon 12 were achieved at room temperature using the NBA chip, and the specificity of the method was proved to be as high as that with the temperature stringency method. PMID:24291640

  20. p53 Codon 72 arginine/proline polymorphism and cancer in Sudan.

    PubMed

    Eltahir, Huda A; Adam, Ameera A M; Yahia, Zeinab A; Ali, Noon F; Mursi, Dalia M; Higazi, Ashraaf M; Eid, Nahid A; Elhassan, Ahmed M; Mohammed, Hiba S; Ibrahim, Muntaser E

    2012-12-01

    The aim of this report is to determine frequencies and associations of p53 codon 72 arg/pro polymorphism with different types of cancer in Sudan. p53 codon72 arg/pro polymorphism distribution and allele frequencies in 264 samples of different types of cancers were investigated using PCR. The results were compared to 235 normal controls. The results indicated significant differences in frequency and genotype association between different types of cancers. Breast carcinoma patients most prominently showed excess of homozygous arg genotype as compared to controls with an Odd ratio (OR) of 19.44, 95 %CI: 6.6-78.3, P < 0.0001. Less prominently cervical cancer showed genotype effect of 2.4 OR, 95 %CI: 1.12-5.33, P = 0.015, while esophageal cancer had an OR of 0.57, 95 %CI: 0.23-1.42, P = 0.1. In Burkitt's lymphoma, however, in contrast the homozygous arg accounted for only 6.9 %, (OR 0.18, 95 %CI: 0.02-0.89, P = 0.018). We concluded that p53 arg/pro polymorphism has different pattern of frequency in different types of cancer among Sudanese patients, indicating perhaps different etiology and biology of these tumours. PMID:23053979

  1. Codon optimization enhances protein expression of Bombyx mori nucleopolyhedrovirus DNA polymerase in E. coli.

    PubMed

    Song, Huifang; Li, Guohui; Mai, Weijun; Huang, Guoping; Chen, Keping; Zhou, Yajing; Chen, Huiqing

    2014-03-01

    Bombyx mori nucleopolyhedrovirus (BmNPV) is a major viral agent that causes deadly grasserie disease in silkworms, while BmNPV DNA polymerase (BmNPV-pol), encoded by ORF53 gene, plays a central role in viral DNA replication. Efficacy studies of BmNPV-POL are limited because of poor heterologous protein expression in E. coli. Here, we redesigned the BmNPV-pol to preferentially match codon frequencies of E. coli without altering the amino acid sequence. Following de novo synthesis, codon-optimized BmNPV-pol (co-BmNPV-pol) gene was cloned into pET32a and pGEX-4T-2 vector. The expression of co-BmNPV-POL in E. coli was significantly increased when BmNPV-POL was fused with GST protein rather than a His-tag. The co-BmNPV-POL fusion proteins were isolated using GST affinity chromatography and Mono Q iron exchange chromatography. Protein purity and identity were confirmed by western blot and MALDI-TOF analyses. The biological activity of purified proteins was measured on a poly(dA)/oligo(dT) primer/template. The specific polymerasing activity of the recombinant BmNPV-POL was 6,329 units/mg at optimal conditions. Thus, a large amount of purified protein as a soluble form with high activity would provide many benefits for the functional research and application of BmNPV-POL. PMID:24129839

  2. Real-time tRNA transit on single translating ribosomes at codon resolution

    PubMed Central

    Uemura, Sotaro; Aitken, Colin Echeverría; Korlach, Jonas; Flusberg, Benjamin A.; Turner, Stephen W.; Puglisi, Joseph D.

    2015-01-01

    Translation by the ribosome occurs by a complex mechanism involving the coordinated interaction of multiple nucleic acid and protein ligands. Here we have used zero-mode waveguides (ZMWs) and sophisticated detection instrumentation to allow real-time observation of translation at physiologically-relevant (?M) ligand concentrations. Translation at each codon is monitored by stable binding of tRNAs – labeled with distinct fluorophores – to translating ribosomes, allowing direct detection of the identity of tRNA molecules bound to the ribosome, and therefore, the underlying mRNA sequence. We observe the transit of tRNAs on single translating ribosomes and have determined the number of tRNA molecules simultaneously bound to the ribosome, at each codon of an mRNA. Our results show that ribosomes are only briefly occupied by two tRNAs and that release of deacylated tRNA from the E site is uncoupled from binding of A-site tRNA and occurs rapidly after translocation. The methods outlined here have broad application to the study of mRNA sequences, and the mechanism and regulation of translation. PMID:20393556

  3. Mutation-Specific RAS Oncogenicity Explains N-RAS Codon 61 Selection in Melanoma

    PubMed Central

    Burd, Christin E.; Liu, Wenjin; Huynh, Minh V.; Waqas, Meriam A.; Gillahan, James E.; Clark, Kelly S.; Fu, Kailing; Martin, Brit L.; Jeck, William R.; Souroullas, George P.; Darr, David B.; Zedek, Daniel C.; Miley, Michael J.; Baguley, Bruce C.; Campbell, Sharon L.

    2014-01-01

    N-RAS mutation at codon 12, 13 or 61 is associated with transformation; yet, in melanoma, such alterations are nearly exclusive to codon 61. Here, we compared the melanoma susceptibility of an N-RasQ61R knock-in allele to similarly designed K-RasG12D and N-RasG12D alleles. With concomitant p16INK4a inactivation, K-RasG12D or N-RasQ61R expression efficiently promoted melanoma in vivo, whereas N-RasG12D did not. Additionally, N-RasQ61R mutation potently cooperated with Lkb1/Stk11 loss to induce highly metastatic disease. Functional comparisons of N-RasQ61R and N-RasG12D revealed little difference in the ability of these proteins to engage PI3K or RAF. Instead, N-RasQ61R showed enhanced nucleotide binding, decreased intrinsic GTPase activity and increased stability when compared to N-RasG12D. This work identifies a faithful model of human N-RAS mutant melanoma, and suggests that the increased melanomagenecity of N-RasQ61R over N-RasG12D is due to heightened abundance of the active, GTP-bound form rather than differences in the engagement of downstream effector pathways. PMID:25252692

  4. Expression of codon optimized genes in microbial systems: current industrial applications and perspectives

    PubMed Central

    Elena, Claudia; Ravasi, Pablo; Castelli, María E.; Peirú, Salvador; Menzella, Hugo G.

    2014-01-01

    The efficient production of functional proteins in heterologous hosts is one of the major bases of modern biotechnology. Unfortunately, many genes are difficult to express outside their original context. Due to their apparent “silent” nature, synonymous codon substitutions have long been thought to be trivial. In recent years, this dogma has been refuted by evidence that codon replacement can have a significant impact on gene expression levels and protein folding. In the past decade, considerable advances in the speed and cost of gene synthesis have facilitated the complete redesign of entire gene sequences, dramatically improving the likelihood of high protein expression. This technology significantly impacts the economic feasibility of microbial-based biotechnological processes by, for example, increasing the volumetric productivities of recombinant proteins or facilitating the redesign of novel biosynthetic routes for the production of metabolites. This review discusses the current applications of this technology, particularly those regarding the production of small molecules and industrially relevant recombinant enzymes. Suggestions for future research and potential uses are provided as well. PMID:24550894

  5. Codon Optimization Significantly Improves the Expression Level of ?-Amylase Gene from Bacillus licheniformis in Pichia pastoris

    PubMed Central

    Wang, Jian-Rong; Li, Yang-Yuan; Liu, Dan-Ni; Liu, Jing-Shan; Li, Peng; Chen, Li-Zhi; Xu, Shu-De

    2015-01-01

    ?-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant ?-amylase from Bacillus licheniformis (B. licheniformis), the ?-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris) and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C content was increased from 47.6 to 49.2%. The recombinants were cultured in 96-deep-well microplates and screened by a new plate assay method. Compared with the wild-type gene, the optimized gene is expressed at a significantly higher level in P. pastoris after methanol induction for 168?h in 5- and 50-L bioreactor with the maximum activity of 8100 and 11000?U/mL, which was 2.31- and 2.62-fold higher than that by wild-type gene. The improved expression level makes the enzyme a good candidate for ?-amylase production in industrial use. PMID:26171389

  6. Natural reassignment of CUU and CUA sense codons to alanine in Ashbya mitochondria

    PubMed Central

    Ling, Jiqiang; Daoud, Rachid; Lajoie, Marc J.; Church, George M.; Söll, Dieter; Lang, B. Franz

    2014-01-01

    The discovery of diverse codon reassignment events has demonstrated that the canonical genetic code is not universal. Studying coding reassignment at the molecular level is critical for understanding genetic code evolution, and provides clues to genetic code manipulation in synthetic biology. Here we report a novel reassignment event in the mitochondria of Ashbya (Eremothecium) gossypii, a filamentous-growing plant pathogen related to yeast (Saccharomycetaceae). Bioinformatics studies of conserved positions in mitochondrial DNA-encoded proteins suggest that CUU and CUA codons correspond to alanine in A. gossypii, instead of leucine in the standard code or threonine in yeast mitochondria. Reassignment of CUA to Ala was confirmed at the protein level by mass spectrometry. We further demonstrate that a predicted is transcribed and accurately processed in vivo, and is responsible for Ala reassignment. Enzymatic studies reveal that is efficiently recognized by A. gossypii mitochondrial alanyl-tRNA synthetase (AgAlaRS). AlaRS typically recognizes the G3:U70 base pair of tRNAAla; a G3A change in Ashbya abolishes its recognition by AgAlaRS. Conversely, an A3G mutation in Saccharomyces cerevisiae confers tRNA recognition by AgAlaRS. Our work highlights the dynamic feature of natural genetic codes in mitochondria, and the relative simplicity by which tRNA identity may be switched. PMID:24049072

  7. Placing the RPL32 Promoter Upstream of a Second Promoter Results in a Strongly Increased Number of Stably Transfected Mammalian Cell Lines That Display High Protein Expression Levels

    PubMed Central

    Hoeksema, F.; Hamer, K.; Siep, M.; Verhees, J. A.; Otte, A. P.

    2011-01-01

    The use of high stringency selection systems commonly results in a strongly diminished number of stably transfected mammalian cell lines. Here we placed twelve different promoters upstream of an adjacent primary promoter and tested whether this might result in an increased number of colonies; this is in the context of a stringent selection system. We found that only the promoter of the human ribosomal protein, RPL32, induced a high number of colonies in CHO-DG44 cells. This phenomenon was observed when the RPL32 promoter was combined with the CMV, SV40, EF1-?, and the ?-actin promoters. In addition, these colonies displayed high protein expression levels. The RPL32 promoter had to be functionally intact, since the deletion of a small region upstream of the transcription start site demolished its positive action. We conclude that adding the RPL32 promoter to an expression cassette in cis may be a powerful tool to augment gene expression levels. PMID:21350661

  8. Placing the RPL32 Promoter Upstream of a Second Promoter Results in a Strongly Increased Number of Stably Transfected Mammalian Cell Lines That Display High Protein Expression Levels.

    PubMed

    Hoeksema, F; Hamer, K; Siep, M; Verhees, J A; Otte, A P

    2011-01-01

    The use of high stringency selection systems commonly results in a strongly diminished number of stably transfected mammalian cell lines. Here we placed twelve different promoters upstream of an adjacent primary promoter and tested whether this might result in an increased number of colonies; this is in the context of a stringent selection system. We found that only the promoter of the human ribosomal protein, RPL32, induced a high number of colonies in CHO-DG44 cells. This phenomenon was observed when the RPL32 promoter was combined with the CMV, SV40, EF1-?, and the ?-actin promoters. In addition, these colonies displayed high protein expression levels. The RPL32 promoter had to be functionally intact, since the deletion of a small region upstream of the transcription start site demolished its positive action. We conclude that adding the RPL32 promoter to an expression cassette in cis may be a powerful tool to augment gene expression levels. PMID:21350661

  9. Ancestral Inference and the Study of Codon Bias Evolution: Implications for Molecular Evolutionary Analyses of the Drosophila melanogaster Subgroup

    PubMed Central

    Akashi, Hiroshi; Goel, Piyush; John, Anoop

    2007-01-01

    Reliable inference of ancestral sequences can be critical to identifying both patterns and causes of molecular evolution. Robustness of ancestral inference is often assumed among closely related species, but tests of this assumption have been limited. Here, we examine the performance of inference methods for data simulated under scenarios of codon bias evolution within the Drosophila melanogaster subgroup. Genome sequence data for multiple, closely related species within this subgroup make it an important system for studying molecular evolutionary genetics. The effects of asymmetric and lineage-specific substitution rates (i.e., varying levels of codon usage bias and departures from equilibrium) on the reliability of ancestral codon usage was investigated. Maximum parsimony inference, which has been widely employed in analyses of Drosophila codon bias evolution, was compared to an approach that attempts to account for uncertainty in ancestral inference by weighting ancestral reconstructions by their posterior probabilities. The latter approach employs maximum likelihood estimation of rate and base composition parameters. For equilibrium and most non-equilibrium scenarios that were investigated, the probabilistic method appears to generate reliable ancestral codon bias inferences for molecular evolutionary studies within the D. melanogaster subgroup. These reconstructions are more reliable than parsimony inference, especially when codon usage is strongly skewed. However, inference biases are considerable for both methods under particular departures from stationarity (i.e., when adaptive evolution is prevalent). Reliability of inference can be sensitive to branch lengths, asymmetry in substitution rates, and the locations and nature of lineage-specific processes within a gene tree. Inference reliability, even among closely related species, can be strongly affected by (potentially unknown) patterns of molecular evolution in lineages ancestral to those of interest. PMID:17957249

  10. Detection of codon 12 point mutations of K-ras gene from mouse lung adenocarcinoma by "enriched" PCR.

    SciTech Connect

    Zhang, Y.; Woloschak, G. E.; Center for Mechanistic Biology and Biotechnology

    1998-07-01

    PURPOSE: Recent studies have shown that chemical carcinogens induce a high frequency of point mutations in the K-ras oncogene from mouse lung tumors at codons 12, 13 and 61. These experiments were performed to identify K-ras mutations in tissues from control and radiation-exposed mice. MATERIALS AND METHODS: By modifying the technique of the 'enriched' polymerase chain reaction (PCR), it was possible to detect point mutations at codon 12 of the K-ras oncogene from 25-year-old paraffin-embedded normal lungs and lung adenocarcinomas from mice exposed to radiation. Together, a total of 120 lung tissues were screened for point mutations at codon 12 of the K-ras oncogene in this study. RESULTS: A significant increase in K-ras codon 12 point mutations was observed in the normal lungs from mice exposed to 24 once-weekly neutron irradiations (100%), compared with normal lungs from mice with sham-irradiation (50%) (p<0.05). Lung adenocarcinomas from mice receiving 24 once-weekly neutron irradiations also had a significantly higher frequency of K-ras codon 12 point mutations (100%) than the lung adenocarcinomas of mice receiving 24 or 60 once-weekly gamma-ray irradiations (50%), but the higher frequency was not significantly different from that in spontaneous lung adenocarcinomas from mice (75%; p > 0.05). The validity of the technique was confirmed by sequencing two of the mutants. In doing so, a K-ras 13(Asp) point mutation was observed. CONCLUSIONS: The data suggest that high-linear energy transfer (LET) neutron radiation was more effective than low-LET gamma-rays in inducing K-ras point mutations at codon 12 in the lungs of B6CF1 mice.

  11. Expression of bovine viral diarrhoea virus glycoprotein E2 by bovine herpesvirus-1 from a synthetic ORF and incorporation of E2 into recombinant virions

    Microsoft Academic Search

    Jutta Schmitt; Paul Becher; M. Keil

    1999-01-01

    Expression cassettes containing the codons for the pestivirus E rns signal peptide (Sig) followed by a chemically synthesized ORF that encoded the bovine viral diarrhoea virus (BVDV) strain C86 glycoprotein E2, a class I membrane glycoprotein, were constructed with and without a chimeric intron sequence immediately upstream of the translation start codon, and incorporated into the genome of bovine herpesvirus-1

  12. The surprising negative correlation of gene length and optimal codon use - disentangling translational selection from GC-biased gene conversion in yeast

    PubMed Central

    2011-01-01

    Background Surprisingly, in several multi-cellular eukaryotes optimal codon use correlates negatively with gene length. This contrasts with the expectation under selection for translational accuracy. While suggested explanations focus on variation in strength and efficiency of translational selection, it has rarely been noticed that the negative correlation is reported only in organisms whose optimal codons are biased towards codons that end with G or C (-GC). This raises the question whether forces that affect base composition - such as GC-biased gene conversion - contribute to the negative correlation between optimal codon use and gene length. Results Yeast is a good organism to study this as equal numbers of optimal codons end in -GC and -AT and one may hence compare frequencies of optimal GC- with optimal AT-ending codons to disentangle the forces. Results of this study demonstrate in yeast frequencies of GC-ending (optimal AND non-optimal) codons decrease with gene length and increase with recombination. A decrease of GC-ending codons along genes contributes to the negative correlation with gene length. Correlations with recombination and gene expression differentiate between GC-ending and optimal codons, and also substitution patterns support effects of GC-biased gene conversion. Conclusion While the general effect of GC-biased gene conversion is well known, the negative correlation of optimal codon use with gene length has not been considered in this context before. Initiation of gene conversion events in promoter regions and the presence of a gene conversion gradient most likely explain the observed decrease of GC-ending codons with gene length and gene position. PMID:21481245

  13. Characterization of a thyroid-specific enhancer located 5.5 kilobase pairs upstream of the human thyroid peroxidase gene.

    PubMed Central

    Kikkawa, F; Gonzalez, F J; Kimura, S

    1990-01-01

    A 6.3-kbp segment of DNA, upstream of the human thyroid peroxidase gene, and various deletions thereof were linked to a promoterless bacterial chloramphenicol acetyltransferase reporter gene. These constructs were analyzed by transfection and expression in rat FRTL-5 thyroid cells and in human hepatoma HepG2 cells to localize sequences that are important for thyroid cell-specific expression of the thyroid peroxidase gene. A thyroid-specific enhancer element, capable of activating enhancerless simian virus 40 promoter expression in FRTL-5 cells, was localized to a 230-bp region approximately 5.5 kbp upstream of the human thyroid peroxidase gene transcription start site. DNase I footprinting, using nuclear extracts prepared from FRTL-5 cells, revealed three regions within the 230-bp fragment; none of these regions were protected by nuclear extracts from HepG2 cells. Gel mobility shift assays, using double-stranded oligonucleotides corresponding to the three protected regions, further confirmed the existence of factors in FRTL-5 cells, but not HepG2 cells, able to specifically bind to the enhancer sequences. These results suggest the presence of three cis-acting DNA elements in the human thyroid peroxidase gene enhancer that interact with thyroid-specific trans-acting factors. Images PMID:2174102

  14. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    SciTech Connect

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.; Gartside, C.L.; Hauschka, S.D.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer. This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.

  15. Identification of novel Arabidopsis thaliana upstream open reading frames that control expression of the main coding sequences in a peptide sequence-dependent manner

    PubMed Central

    Ebina, Isao; Takemoto-Tsutsumi, Mariko; Watanabe, Shun; Koyama, Hiroaki; Endo, Yayoi; Kimata, Kaori; Igarashi, Takuya; Murakami, Karin; Kudo, Rin; Ohsumi, Arisa; Noh, Abdul Latif; Takahashi, Hiro; Naito, Satoshi; Onouchi, Hitoshi

    2015-01-01

    Upstream open reading frames (uORFs) are often found in the 5?-leader regions of eukaryotic mRNAs and can negatively modulate the translational efficiency of the downstream main ORF. Although the effects of most uORFs are thought to be independent of their encoded peptide sequences, certain uORFs control translation of the main ORF in a peptide sequence-dependent manner. For genome-wide identification of such peptide sequence-dependent regulatory uORFs, exhaustive searches for uORFs with conserved amino acid sequences have been conducted using bioinformatic analyses. However, whether the conserved uORFs identified by these bioinformatic approaches encode regulatory peptides has not been experimentally determined. Here we analyzed 16 recently identified Arabidopsis thaliana conserved uORFs for the effects of their amino acid sequences on the expression of the main ORF using a transient expression assay. We identified five novel uORFs that repress main ORF expression in a peptide sequence-dependent manner. Mutational analysis revealed that, in four of them, the C-terminal region of the uORF-encoded peptide is critical for the repression of main ORF expression. Intriguingly, we also identified one exceptional sequence-dependent regulatory uORF, in which the stop codon position is not conserved and the C-terminal region is not important for the repression of main ORF expression. PMID:25618853

  16. The START III bargaining space

    SciTech Connect

    Karas, T.H.

    1998-08-01

    The declining state of the Russian military and precarious Russian economic condition will give the US considerable advantages at the START III bargaining table. Taking the US-RF asymmetries into account, this paper discusses a menu of START III measures the US could ask for, and measures it could offer in return, in attempting to negotiate an equitable treaty. Measures the US might seek in a START III treaty include: further reductions in deployed strategic nuclear warheads, irreversibility of reductions through warhead dismantlement; beginning to bring theater nuclear weapons under mutual control, and increased transparency into the Russian nuclear weapons complex. The US may, however, wish to apply its bargaining advantages to attempting to achieve the first steps toward two long-range goals that would enhance US security: bringing theater nuclear weapons into the US-RF arms control arena, and increasing transparency into the Russian nuclear weapons complex. In exchange for measures relating to these objectives, the US might consider offering to Russia: Further strategic weapons reductions approaching levels at which the Russians believe they could maintain a degree of parity with the US; Measures to decrease the large disparities in potential deliver-system uploading capabilities that appear likely under current START II/START III scenarios; and Financial assistance in achieving START II/START III reductions as rapidly as is technically possible.

  17. Large amplitude MHD waves upstream of the Jovian bow shock

    NASA Technical Reports Server (NTRS)

    Goldstein, M. L.; Smith, C. W.; Matthaeus, W. H.

    1983-01-01

    Observations of large amplitude magnetohydrodynamics (MHD) waves upstream of Jupiter's bow shock are analyzed. The waves are found to be right circularly polarized in the solar wind frame which suggests that they are propagating in the fast magnetosonic mode. A complete spectral and minimum variance eigenvalue analysis of the data was performed. The power spectrum of the magnetic fluctuations contains several peaks. The fluctuations at 2.3 mHz have a direction of minimum variance along the direction of the average magnetic field. The direction of minimum variance of these fluctuations lies at approximately 40 deg. to the magnetic field and is parallel to the radial direction. We argue that these fluctuations are waves excited by protons reflected off the Jovian bow shock. The inferred speed of the reflected protons is about two times the solar wind speed in the plasma rest frame. A linear instability analysis is presented which suggests an explanation for many of the observed features of the observations.

  18. Preventing downstream Clostridium difficile infections with upstream antibiotic management.

    PubMed

    Malkan, Alpin D; Scholand, Stephen J

    2012-01-01

    Clostridium difficile infection (CDI) remains a devastating cause of hospital-acquired diarrhea. Treatment modalities have centered traditionally on two antibiotics, metronidazole and oral vancomycin. Both drugs, however, have been associated with variable relapse rates up to 20%. Fidaxomicin, a new oral agent with targeted C. difficile activity, may reduce the chance of relapse, but has not yet entered mainstream clinical practice. CDI is associated with significant morbidity and mortality. In the past decade, the emergence of hypervirulent strains has led to medical management failures and the increased need for surgical intervention. Control of the disease requires excellent infection prevention practices, yet can remain a difficult operational challenge. Selective pressure of antibiotic therapy can increase or lessen the risk depending on the agent used. We believe that antibiotic selection for the treatment of patients with any infectious disease must account for the possibility of subsequent severe CDI. We posit 'upstream' antibiotic selection will prevent 'downstream' CDI and potentially ameliorate deficiencies in infection prevention practices. Formal studies evaluating such an endpoint would be useful in this era of dangerous CDI. PMID:22079651

  19. Upstream oversight assessment for agrifood nanotechnology: a case studies approach.

    PubMed

    Kuzma, Jennifer; Romanchek, James; Kokotovich, Adam

    2008-08-01

    Although nanotechnology is broadly receiving attention in public and academic circles, oversight issues associated with applications for agriculture and food remain largely unexplored. Agrifood nanotechnology is at a critical stage in which informed analysis can help shape funding priorities, risk assessment, and oversight activities. This analysis is designed to help society and policymakers anticipate and prepare for challenges posed by complicated, convergent applications of agrifood nanotechnology. The goal is to identify data, risk assessment, regulatory policy, and engagement needs for overseeing these products so they can be addressed prior to market entry. Our approach, termed upstream oversight assessment (UOA), has potential as a key element of anticipatory governance. It relies on distinct case studies of proposed applications of agrifood nanotechnology to highlight areas that need study and attention. As a tool for preparation, UOA anticipates the types and features of emerging applications; their endpoints of use in society; the extent to which users, workers, ecosystems, or consumers will be exposed; the nature of the material and its safety; whether and where the technologies might fit into current regulatory system(s); the strengths and weaknesses of the system(s) in light of these novel applications; and the possible social concerns related to oversight for them. PMID:18627547

  20. Harbor seal whiskers synchronize with frequency of upstream wake

    NASA Astrophysics Data System (ADS)

    Beem, Heather; Triantafyllou, Michael

    2013-11-01

    Harbor seals are able to use their whiskers to track minute water movements, such as those left in the wake of a fish. The current study is a simple representation of what the whiskers experience as the seal chases a fish. A scaled whisker model (average cross-flow diameter: dw) is first tested in a towing tank by itself and then towed behind a larger cylinder (dc = 2 . 5dw), which serves as a wake generator. A flexing plate attached to the model base allows the whisker to freely vibrate in response to the flow. Measurements from strain gages on the plate are calibrated to tip deflections. While in the cylinder wake, the whisker vibrates with an amplitude up to ten times higher than it does on its own (A /dw = 0 . 15). Also, the whisker synchronizes with the vortex shedding frequency (fs =0/. 2 U dc) of the upstream cylinder over the range of reduced velocities tested, whereas on its own, the whisker oscillates around its own natural frequency in water. Seals may use the difference in vibration amplitude and frequency between these two cases to help detect the presence of a vortex wake.

  1. Rating Curve Estimation from Local Levels and Upstream Discharges

    NASA Astrophysics Data System (ADS)

    Franchini, M.; Mascellani, G.

    2003-04-01

    Current technology allows for low cost and easy level measurements while the discharge measurements are still difficult and expensive. Thus, these are rarely performed and usually not in flood conditions because of lack of safety and difficulty in activating the measurement team in due time. As a consequence, long series of levels are frequently available without the corresponding discharge values. However, for the purpose of planning, management of water resources and real time flood forecasting, discharge is needed and it is therefore essential to convert local levels into discharge values by using the appropriate rating curve. Over this last decade, several methods have been proposed to relate local levels at a site of interest to data recorded at a river section located upstream where a rating curve is available. Some of these methods are based on a routing approach which uses the Muskingum model structure in different ways; others are based on the entropy concepts. Lately, fuzzy logic has been applied more and more frequently in the framework of hydraulic and hydrologic problems and this has prompted to the authors to use it for synthesising the rating curves. A comparison between all these strategies is performed, highlighting the difficulties and advantages of each of them, with reference to a long reach of the Po river in Italy, where several hydrometers and the relevant rating curves are available, thus allowing for both a parameterization and validation of the different strategies.

  2. Resistance to MEK Inhibitors: Should We Co-Target Upstream?

    NSDL National Science Digital Library

    Poulikos I. Poulikakos (Memorial Sloan-Kettering Cancer Center; Program in Molecular Pharmacology and Chemistry REV)

    2011-03-29

    Aberrant activation of the ERK pathway is common in human tumors. This pathway consists of a three-tiered kinase module [comprising the kinases RAF, mitogen-activated protein kinase (MAPK) kinase (MEK), and extracellular signal–regulated kinase (ERK)] that functions as a negative feedback amplifier to confer robustness and stabilization of pathway output. Because this pathway is frequently dysregulated in human cancers, intense efforts are under way to develop selective inhibitors of the ERK pathway as anticancer drugs. Although promising results have been reported in early trials for inhibitors of RAF or MEK, resistance invariably occurs. Amplification of the upstream oncogenic driver of ERK signaling has been identified as a mechanism for MEK inhibitor resistance in cells with mutant BRAF or KRAS. Increased abundance of the oncogenic driver (either KRAS or BRAF in the appropriate cellular context) in response to prolonged drug treatment results in increased flux through the ERK pathway and restoration of ERK activity above the threshold required for cell growth. For patients with BRAF mutant tumors, the results suggest that the addition of a RAF inhibitor to a MEK inhibitor may delay or overcome drug resistance. The data thus provide a mechanistic basis for ongoing trials testing concurrent treatment with RAF and MEK inhibitors.

  3. Thyroid-Disrupting Chemicals: Interpreting Upstream Biomarkers of Adverse Outcomes

    PubMed Central

    Miller, Mark D.; Crofton, Kevin M.; Rice, Deborah C.; Zoeller, R. Thomas

    2009-01-01

    Background There is increasing evidence in humans and in experimental animals for a relationship between exposure to specific environmental chemicals and perturbations in levels of critically important thyroid hormones (THs). Identification and proper interpretation of these relationships are required for accurate assessment of risk to public health. Objectives We review the role of TH in nervous system development and specific outcomes in adults, the impact of xenobiotics on thyroid signaling, the relationship between adverse outcomes of thyroid disruption and upstream causal biomarkers, and the societal implications of perturbations in thyroid signaling by xenobiotic chemicals. Data sources We drew on an extensive body of epidemiologic, toxicologic, and mechanistic studies. Data synthesis THs are critical for normal nervous system development, and decreased maternal TH levels are associated with adverse neuropsychological development in children. In adult humans, increased thyroid-stimulating hormone is associated with increased blood pressure and poorer blood lipid profiles, both risk factors for cardiovascular disease and death. These effects of thyroid suppression are observed even within the “normal” range for the population. Environmental chemicals may affect thyroid homeostasis by a number of mechanisms, and multiple chemicals have been identified that interfere with thyroid function by each of the identified mechanisms. Conclusions Individuals are potentially vulnerable to adverse effects as a consequence of exposure to thyroid-disrupting chemicals. Any degree of thyroid disruption that affects TH levels on a population basis should be considered a biomarker of adverse outcomes, which may have important societal outcomes. PMID:19654909

  4. Rapid acceleration of protons upstream of earthward propagating dipolarization fronts

    PubMed Central

    Ukhorskiy, AY; Sitnov, MI; Merkin, VG; Artemyev, AV

    2013-01-01

    [1] Transport and acceleration of ions in the magnetotail largely occurs in the form of discrete impulsive events associated with a steep increase of the tail magnetic field normal to the neutral plane (Bz), which are referred to as dipolarization fronts. The goal of this paper is to investigate how protons initially located upstream of earthward moving fronts are accelerated at their encounter. According to our analytical analysis and simplified two-dimensional test-particle simulations of equatorially mirroring particles, there are two regimes of proton acceleration: trapping and quasi-trapping, which are realized depending on whether the front is preceded by a negative depletion in Bz. We then use three-dimensional test-particle simulations to investigate how these acceleration processes operate in a realistic magnetotail geometry. For this purpose we construct an analytical model of the front which is superimposed onto the ambient field of the magnetotail. According to our numerical simulations, both trapping and quasi-trapping can produce rapid acceleration of protons by more than an order of magnitude. In the case of trapping, the acceleration levels depend on the amount of time particles stay in phase with the front which is controlled by the magnetic field curvature ahead of the front and the front width. Quasi-trapping does not cause particle scattering out of the equatorial plane. Energization levels in this case are limited by the number of encounters particles have with the front before they get magnetized behind it.

  5. Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam

    Microsoft Academic Search

    Sutham Visutimeteegorn; Kanchit Likitdecharote; Suphat Vongvisessomjai

    Visutimeteegorn, S., Likitdecharote, K. and Vongvisessomjai, S. Effects on the upstream flood inundation caused from the operation of Chao Phraya Dam Songklanakarin J. Sci. Technol., 2007, 29(6) : 1661-1674 During the flooding events, the operation of Chao Phraya Dam to control downstream water dis- charge is one of the causes of the inundation occuring over the upstream area. The purposes

  6. Management background, corporate governance and industrial restructuring: the Japanese upstream petroleum industry

    Microsoft Academic Search

    Gerald Pollio; Koichi Uchida

    1999-01-01

    Japanese upstream companies have consistently underperformed private independents. A recent audit by the Ministry of International Trade and Industry (MITI) underlines the magnitude of financial losses and the necessity for sectoral restructuring. MITI's proposals involve refocusing rather than redefining upstream policy, including recognition that official intervention should be reduced in favour of greater control by the more successful local production

  7. OPTIMAL ALLOCATION OF TRADABLE EMISSION PERMITS UNDER UPSTREAM-DOWNSTREAM STRATEGIC

    E-print Network

    Boyer, Edmond

    regulation by holding a tradable emission permit per unit of (non-abated) pollution generated by goodsOPTIMAL ALLOCATION OF TRADABLE EMISSION PERMITS UNDER UPSTREAM-DOWNSTREAM STRATEGIC INTERACTION-00437645,version1-1Dec2009 #12;Optimal allocation of tradable emission permits under upstream

  8. Analysis of Yeast's ORF Upstream Regions by Parallel Processing, Microarrays, and Computational Methods

    E-print Network

    Kibler, Dennis F.

    Analysis of Yeast's ORF Upstream Regions by Parallel Processing, Microarrays, and Computational­ gions, gene regulation, DNA­microarrays, yeast, motifs, Markov models Abstract We use a network of workstations to compute all pairwise alignments of the 500 bp upstream regions of 6,225 yeast ORFs (Open

  9. Short Wavelength Ion Waves Upstream of the Earth’s Bow Shock

    Microsoft Academic Search

    S. A. Fuselier; D. A. Gurnett

    1984-01-01

    ISEE-1 wide-band electric field data, antenna interference effects have been identified in the ion waves upstream of the earth's bow shock. This identification implies that wavelengths of the upstream ion waves are shorter than the antenna length. The interference effects also provide new measurements of the direction of propagation of the ion waves. The new measurements show that the wave

  10. Langmuir waves upstream of interplanetary shocks: Dependence on shock and plasma parameters

    Microsoft Academic Search

    M. P. Pulupa; S. D. Bale; J. C. Kasper

    2010-01-01

    We have examined 178 interplanetary shocks observed by the Wind spacecraft to establish which shock and plasma parameters are favorable for the production of upstream Langmuir waves and therefore to determine which shocks are likely to generate interplanetary Type II radio bursts. Of the 178 shocks included in this study, 43 produced upstream Langmuir waves, as evinced by enhancements in

  11. A simple model based on mutation and selection explains trends in codon and amino-acid usage and GC composition within and across genomes

    Microsoft Academic Search

    Robin D Knight; Stephen J Freeland; Laura F Landweber

    2001-01-01

    BACKGROUND: Correlations between genome composition (in terms of GC content) and usage of particular codons and amino acids have been widely reported, but poorly explained. We show here that a simple model of processes acting at the nucleotide level explains codon usage across a large sample of species (311 bacteria, 28 archaea and 257 eukaryotes). The model quantitatively predicts responses

  12. Deceleration of the solar wind upstream from the earth's bow shock and the origin of diffuse upstream ions

    NASA Technical Reports Server (NTRS)

    Bame, S. J.; Asbridge, J. R.; Feldman, W. C.; Gosling, J. T.; Paschmann, G.; Skopke, N.

    1980-01-01

    Observations with the Los Alamos Scientific Laboratory/Max-Planck-Institut crossed-fan solar wind ion experiment on ISEE I reveal that the solar wind is decelerated and deflected away from the direction of the earth's bow shock as it enters that portion of the upstream region populated by diffuse bow shock ions and long-period (10-60 s) waves. Typically, the average directed velocity vector changes by 7-10 km/s as it enters the wave region. At times, average speed changes as large as 25-40 km/s are observed. Superposed upon these changes in average flow speed are large amplitude (+ or - 15) fluctuations in flow speed associated with the waves themselves. The observations suggest that the solar wind deceleration is the result of momentum transfer from reflected bow shock ions to the wind via the long-period waves as the reflected ion beams go unstable. The broad angular distributions of the diffuse ions thus appear to be produced as a consequence of the disruption of reflected ion beams.

  13. "Upstream Thinking": the catchment management approach of a water provider

    NASA Astrophysics Data System (ADS)

    Grand-Clement, E.; Ross, M.; Smith, D.; Anderson, K.; Luscombe, D.; Le Feuvre, N.; Brazier, R. E.

    2012-04-01

    Human activities have large impacts on water quality and provision. Water companies throughout the UK are faced with the consequences of poor land management and need to find appropriate solutions to decreasing water quality. This is particularly true in the South West of England, where 93% of the drinking water is sourced from rivers and reservoirs: large areas of drained peatlands (i.e. Exmoor and Dartmoor National Parks) are responsible for a significant input of dissolved organic carbon (DOC) discolouring the water, whilst poorly managed farming activities can lead to diffuse pollution. Alongside the direct environmental implications, poor water quality is partly increasing water treatment costs and will drive significant future investment in additional water treatment, with further repercussions on customers. This highlights the need for water companies throughout the UK, and further afield, to be more involved in catchment management. "Upstream Thinking" is South West Water's (SWW) approach to catchment management, where working with stakeholders to improve water quality upstream aims to avoid increasingly costly solutions downstream. This approach has led the company to invest in two major areas of work: (1) The Farmland programme where problematic farm management practices and potential solutions are identified, typically 40% of the required investment is then offered in exchange for a legal undertaking to maintain the new farm assets in good condition for 25 years; (2) The Mires programme which involves heavy investment in peatland restoration through the blocking of open ditches in order to improve water storage and quality in the long term. From these two projects, it has been clear that stakeholder involvement of groups such as local farmers, the Westcountry Rivers Trust, the Exmoor National Park Authority, the Environment Agency, Natural England and the Exmoor Society is essential, first because it draws in catchment improvement expertise which is not directly held within the company, and second because it shows how local communities and groups are considered and valued by the company. Monitoring changes and providing a solid scientific base is also undertaken to prove the concept and justify any investment. The work carried out so far has highlighted that SWW's collaborative approach to catchment management is changing the relationship between private water suppliers in the UK and stakeholders or groups having an impact on water quality. This results in a progressive move from a situation where the polluter has to pay, to rewarding providers of clean water instead. The value of ecosystem payments of this kind is being discussed with the appropriate authorities (i.e. Natural England, and the Department for Environment, Food and Rural Affairs) so that it can form part of ensuring sustainable water supplies in future, with all the environmental and ecological benefits of clear raw waters in rivers, lakes and streams.

  14. GTG Mutation in the Start Codon of the Androgen Receptor Gene in a Family of Horses with 64,XY Disorder of Sex Development

    Microsoft Academic Search

    T. Révay; D. A. F. Villagómez; D. Brewer; T. Chenier; W. A. King

    2012-01-01

    Genetic sex in mammals is determined by the sex chromosomal composition of the zygote. The X and Y chromosomes are responsible for numerous factors that must work in close concert for the proper development of a healthy sexual phenotype. The role of androgens in case of XY chromosomal constitution is crucial for normal male sex differentiation. The intracellular androgenic action

  15. Mediator Acts Upstream of the Transcriptional Activator Gal4

    PubMed Central

    Ang, Keven; Ee, Gary; Ang, Edwin; Koh, Elvin; Siew, Wee Leng; Chan, Yu Mun; Nur, Sabrina; Tan, Yee Sun; Lehming, Norbert

    2012-01-01

    The proteasome inhibitor MG132 had been shown to prevent galactose induction of the S. cerevisiae GAL1 gene, demonstrating that ubiquitin proteasome-dependent degradation of transcription factors plays an important role in the regulation of gene expression. The deletion of the gene encoding the F-box protein Mdm30 had been reported to stabilize the transcriptional activator Gal4 under inducing conditions and to lead to defects in galactose utilization, suggesting that recycling of Gal4 is required for its function. Subsequently, however, it was argued that Gal4 remains stably bound to the enhancer under inducing conditions, suggesting that proteolytic turnover of Gal4 might not be required for its function. We have performed an alanine-scanning mutagenesis of ubiquitin and isolated a galactose utilization-defective ubiquitin mutant. We have used it for an unbiased suppressor screen and identified the inhibitor Gal80 as a suppressor of the transcriptional defects of the ubiquitin mutant, indicating that the protein degradation of the inhibitor Gal80, and not of the activator Gal4, is required for galactose induction of the GAL genes. We also show that in the absence of Gal80, Mdm30 is not required for Gal4 function, strongly supporting this hypothesis. Furthermore, we have found that Mediator controls the galactose-induced protein degradation of Gal80, which places Mediator genetically upstream of the activator Gal4. Mediator had originally been isolated by its ability to respond to transcriptional activators, and here we have discovered a leading role for Mediator in the process of transcription. The protein kinase Snf1 senses the inducing conditions and transduces the signal to Mediator, which initiates the degradation of the inhibitor Gal80 with the help of the E3 ubiquitin ligase SCFMdm30. The ability of Mediator to control the protein degradation of transcriptional inhibitors indicates that Mediator is actually able to direct its own recruitment to gene promoters. PMID:22479149

  16. Expressions of heparanase and upstream stimulatory factor in hepatocellular carcinoma

    PubMed Central

    2014-01-01

    Background The expression of heparanase (HPSE) was associated with postoperative metastatic recurrence in patients with hepatocellular carcinoma (HCC). The six E-box binding sites in the core promoter of the HPSE gene suggested that transcription factors of E-box such as upstream stimulatory factor (USF) might regulate the transcription of the HPSE gene. The aim of our study is to measure the levels of HPSE and USF expression and investigate the relationship between USF expression and clinicopathological parameters in patients with HCC. Methods HPSE, USF1 and USF2 expressions in human HCC cell lines (BEL-7402, HepG2 and HCCLM3) and 15 fresh human HCC tissue samples were measured by real-time reverse transcriptase-PCR and Western blot analysis. The normal liver cell line QSG7701 or fresh normal liver tissue samples obtained from 15 additional surgical patients with hepatic rupture was used as a control. The protein expressions were determined by immunohistochemistry in paraffin-embedded human HCC tissues and corresponding non-neoplastic tumor surrounding tissues (NTST) of 57 patients. Results HPSE, USF1 and USF2 mRNA expressions were increased in HCC cell lines and HCC tissues compared with normal liver cell line and normal liver tissue. The protein expressions of HPSE, USF1 and USF2 in HCC cell lines and HCC tissues were also increased. Both USF1 and USF2 expressions were positively correlated with HPSE. USF1 and USF2 expressions were increased in patients with liver cirrhosis, worse tissue differentiation, advanced HCC stages and metastatic recurrence. Conclusions Increased USF in HCC is associated with HPSE expression. USF might be an important factor in regulating HPSE expression and act as a novel marker of metastatic recurrence of HCC patients. PMID:25149140

  17. A specific KRAS codon 13 mutation is an independent predictor for colorectal cancer metachronous distant metastases

    PubMed Central

    Feng, Qingyang; Liang, Li; Ren, Li; Chen, Jingwen; Wei, Ye; Chang, Wenju; Zhu, Dexiang; Lin, Qi; Zheng, Peng; Xu, Jianmin

    2015-01-01

    Background: In colorectal cancer, there are significant differences between synchronous and metachronous distant metastases. However in recent studies, synchronous and metachronous metastases were always lumped together, neglecting their clinical and molecular differences. The mechanism of the latency of metachronous metastases is still unclear. We conducted this study to reveal the relationship between EGFR pathways and metachronous metastases, and try to find efficient predictors. Methods: PCRs and pyrosequencing were used to detect KRAS, BRAF, PIK3CA and PTEN mutations in primary tumor tissues in a total of 281 patients from 2002 to 2008. Patients were identified into three groups: no-metastases group, synchronous-metastases group and metachronous-metastases group. Clinical and survival data were collected from a prospective database. Results: KRAS codon 13 mutation was an independent predictor only for metachronous distant metastases (OR = 11.857, P < 0.001), but not for synchronous metastases. Male gender (OR = 2.233, P = 0.024), primary tumor located at rectum (OR = 0.404, P = 0.041), and primary pN2 stage (OR = 3.361, P = 0.01) were also independent predictors for metachronous distant metastases. Different SNPs in KRAS worked significantly different in determining synchronous or metachronous metastases. BRAF mutation (Univariate, OR = 11.5, P = 0.039) and > 200 ng/ml preoperative CEA (Univariate, OR = 41, P = 0.011) potentially predicted metastases within 6 months after primary tumor resection. After metachronous metastases, radical resection (HR = 0.280, P = 0.002) was the most important protective factor for long-term survival. Conclusion: There were significant clinical and molecular differences between synchronous and metachronous metastases. As an independent predictor, KRAS codon 13 mutation might be the key to explain the mechanism of colorectal cancer metachronous distant metastases. Together with clinical characteristics, it could aid in the early detection of metachronous metastases. PMID:25973306

  18. Replicating reoviruses with a transgene replacing the codons for the head domain of the viral spike.

    PubMed

    van den Wollenberg, D J M; Dautzenberg, I J C; Ros, W; Lipi?ska, A D; van den Hengel, S K; Hoeben, R C

    2015-03-01

    The capacity to modify the reovirus genome facilitates generation of new therapeutic reoviruses. We describe a method for generating replication-competent reoviruses carrying a heterologous transgene. The strategy is based on the expanded-tropism reovirus mutant jin-3, which can infect cells independent of the reovirus receptor junction-adhesion molecule A (JAM-A). Jin-3 harbors a mutation in the S1 segment, resulting in a G196R substitution in the tail of the spike protein ?1. The use of the jin-3 tail-encoding S1 segment allows replacing the codons for the JAM-A-binding head domain by up to 522? nucleotides of foreign sequences, without exceeding the size of the wild-type S1 segment. We inserted the codons for the porcine teschovirus-1 2A element fused with those encoding the fluorescent protein iLOV. Replicating rS1His-2A-iLOV reoviruses were generated by co-transfection of expression plasmids for all reovirus segments. These reoviruses contain the S1His-2A-iLOV segment in the absence of the wild-type S1 segment. Density-gradient centrifugation confirmed the association of the ?1-tail fragment with the capsid. Both JAM-A-positive and -negative cells exposed to the rS1His-2A-iLOV reoviruses exhibited iLOV fluorescence, confirming the jin-3-derived expanded-tropism phenotype. These data demonstrated the feasibility of generating decapitated replication-competent T3D reoviruses carrying a heterologous transgene. PMID:25588743

  19. Attenuation of Tick-Borne Encephalitis Virus Using Large-Scale Random Codon Re-encoding

    PubMed Central

    de Fabritus, Lauriane; Nougairède, Antoine; Aubry, Fabien; Gould, Ernest A; de Lamballerie, Xavier

    2015-01-01

    Large-scale codon re-encoding (i.e. introduction of a large number of synonymous mutations) is a novel method of generating attenuated viruses. Here, it was applied to the pathogenic flavivirus, tick-borne encephalitis virus (TBEV) which causes febrile illness and encephalitis in humans in forested regions of Europe and Asia. Using an infectious clone of the Oshima 5–10 strain ("wild-type virus"), a cassette of 1.4kb located in the NS5 coding region, was modified by randomly introducing 273 synonymous mutations ("re-encoded virus"). Whilst the in cellulo replicative fitness of the re-encoded virus was only slightly reduced, the re-encoded virus displayed an attenuated phenotype in a laboratory mouse model of non-lethal encephalitis. Following intra-peritoneal inoculation of either 2.105 or 2.106 TCID50 of virus, the frequency of viraemia, neurovirulence (measured using weight loss and appearance of symptoms) and neuroinvasiveness (detection of virus in the brain) were significantly decreased when compared with the wild-type virus. Mice infected by wild-type or re-encoded viruses produced comparable amounts of neutralising antibodies and results of challenge experiments demonstrated that mice previously infected with the re-encoded virus were protected against subsequent infection by the wild-type virus. This constitutes evidence that a mammalian species can be protected against infection by a virulent wild-type positive-stranded RNA virus following immunisation with a derived randomly re-encoded strain. Our results demonstrate that random codon re-encoding is potentially a simple and effective method of generating live-attenuated vaccine candidates against pathogenic flaviviruses. PMID:25734338

  20. The other codons: Nirenberg and the genetic code, 2D animationSite: DNA Interactive (www.dnai.org)

    NSDL National Science Digital Library

    2008-10-06

    After the easy codons, exact triplets had to be made in order to finish deciphering the rest. Marshall Nirenberg and a group of scientists including Maxine Singer, Marianne Grunberg-Manago, Phil Leder were involved in this process. Har Gobind Khorana also worked on this problem.

  1. Orthogonal combinatorial mutagenesis: a codon-level combinatorial mutagenesis method useful for low multiplicity and amino acid-scanning protocols

    Microsoft Academic Search

    Paul Gaytán; Jorge Yáñez; Filiberto Sánchez; Xavier Soberón

    We describe here a method to generate combinatorial libraries of oligonucleotides mutated at the codon- level, with control of the mutagenesis rate so as to create predictable binomial distributions of mutants. The method allows enrichment of the libraries with single, double or larger multiplicity of amino acid replacements by appropriate choice of the mutagenesis rate, depending on the concentration of

  2. Ile to Val polymorphism at codon 655 of HER2 gene and breast cancer risk in Iranian women

    Microsoft Academic Search

    Eskandar Kamali-Sarvestani; Abdol-Rasoul Talei; Ahmad Merat

    2004-01-01

    The earlier reports on the association between the Ile to Val polymorphism at codon 655 of HER-2 and susceptibility to breast cancer has not been found to hold true for all ethnic populations. Two hundred and four cases and 138 controls were collected to investigate the association of HER-2 Ile655Val polymorphism with the risk of breast cancer development and progression

  3. CODON-BASED DETECTION OF POSITIVE SELECTION CAN BE BIASED BY HETEROGENEOUS DISTRIBUTION OF POLAR AMINO ACIDS ALONG PROTEIN

    E-print Network

    Xia, Xuhua

    1 CODON-BASED DETECTION OF POSITIVE SELECTION CAN BE BIASED BY HETEROGENEOUS DISTRIBUTION OF POLAR AMINO ACIDS ALONG PROTEIN SEQUENCES Xuhua Xia Department of Biology, University of Ottawa 30 Marie Curie selection, are associated with a high frequency of polar amino acids with a high mutability

  4. Reduced Amino Acid Specificity of Mammalian Tyrosyl-tRNA Synthetase Is Associated with Elevated Mistranslation of Tyr Codons*

    PubMed Central

    Raina, Medha; Moghal, Adil; Kano, Amanda; Jerums, Mathew; Schnier, Paul D.; Luo, Shun; Deshpande, Rohini; Bondarenko, Pavel V.; Lin, Henry; Ibba, Michael

    2014-01-01

    Quality control operates at different steps in translation to limit errors to approximately one mistranslated codon per 10,000 codons during mRNA-directed protein synthesis. Recent studies have suggested that error rates may actually vary considerably during translation under different growth conditions. Here we examined the misincorporation of Phe at Tyr codons during synthesis of a recombinant antibody produced in tyrosine-limited Chinese hamster ovary (CHO) cells. Tyr to Phe replacements were previously found to occur throughout the antibody at a rate of up to 0.7% irrespective of the identity or context of the Tyr codon translated. Despite this comparatively high mistranslation rate, no significant change in cellular viability was observed. Monitoring of Phe and Tyr levels revealed that changes in error rates correlated with changes in amino acid pools, suggesting that mischarging of tRNATyr with noncognate Phe by tyrosyl-tRNA synthetase was responsible for mistranslation. Steady-state kinetic analyses of CHO cytoplasmic tyrosyl-tRNA synthetase revealed a 25-fold lower specificity for Tyr over Phe as compared with previously characterized bacterial enzymes, consistent with the observed increase in translation error rates during tyrosine limitation. Functional comparisons of mammalian and bacterial tyrosyl-tRNA synthetase revealed key differences at residues responsible for amino acid recognition, highlighting differences in evolutionary constraints for translation quality control. PMID:24828507

  5. Development of a Premature Stop Codon-detection method based on a bacterial two-hybrid system

    Microsoft Academic Search

    Sebastián M Real; Diego M Marzese; Laura C Gomez; Luis S Mayorga; María Roqué

    2006-01-01

    BACKGROUND: The detection of Premature Stop Codons (PSCs) in human genes is very useful for the genetic diagnosis of different hereditary cancers, e.g. Familial Breast Cancer and Hereditary Non-Polyposis Colorectal Cancer (HNPCC). The products of these PSCs are truncated proteins, detectable in vitro by the Protein Truncation Test and in vivo by using the living translation machinery of yeast or

  6. All six GC-motifs of the SV40 early upstream element contribute to promoter activity in vivo and in vitro.

    PubMed Central

    Barrera-Saldana, H; Takahashi, K; Vigneron, M; Wildeman, A; Davidson, I; Chambon, P

    1985-01-01

    Recombinants in which the six GC-motifs (I-VI) present in the upstream element of the SV40 early promoter region have been point mutated either individually or in pairs were used to determine the possible contribution of each GC-motif to the function of the overlapping early-early and late-early SV40 promoters. GC-motif I, and to a lesser extent, GC-motifs II and III, are critical for initiation at the early-early start sites. GC-motifs IV-VI play a subsidiary role. Mutations in GC-motifs I and II do not decrease the activity of the late-early promoter, whereas mutations in the GC-motifs III-VI have a moderate effect on it. The in vivo phenotype of the GC-motif mutants can be almost fully reproduced in vitro using a nuclear extract. DNase I protection footprinting experiments using wild-type or mutated templates and nuclear extracts indicate that each GC-motif behaves principally as an independent protein-binding site, presumably for transcription factor Sp1. The effect of changing the position of the 21-bp repeat region on initiation from the early-early and late-early start sites indicates that there is little flexibility in the position in which this upstream element can efficiently activate initiation of transcription from these start sites. Images Fig. 3. Fig. 4. Fig. 7. Fig. 8. Fig. 9. PMID:3004974

  7. Aquareovirus effects syncytiogenesis by using a novel member of the FAST protein family translated from a noncanonical translation start site.

    PubMed

    Racine, Trina; Hurst, Tara; Barry, Chris; Shou, Jingyun; Kibenge, Frederick; Duncan, Roy

    2009-06-01

    As nonenveloped viruses, the aquareoviruses and orthoreoviruses are unusual in their ability to induce cell-cell fusion and syncytium formation. While an extraordinary family of fusion-associated small transmembrane (FAST) proteins is responsible for orthoreovirus syncytiogenesis, the basis for aquareovirus-induced syncytiogenesis is unknown. We now report that the S7 genome segment of an Atlantic salmon reovirus is polycistronic and uses a noncanonical CUG translation start codon to produce a 22-kDa integral membrane protein responsible for syncytiogenesis. The aquareovirus p22 protein represents a fourth distinct member of the FAST family with a unique repertoire and arrangement of structural motifs. PMID:19297495

  8. Aquareovirus Effects Syncytiogenesis by Using a Novel Member of the FAST Protein Family Translated from a Noncanonical Translation Start Site?

    PubMed Central

    Racine, Trina; Hurst, Tara; Barry, Chris; Shou, Jingyun; Kibenge, Frederick; Duncan, Roy

    2009-01-01

    As nonenveloped viruses, the aquareoviruses and orthoreoviruses are unusual in their ability to induce cell-cell fusion and syncytium formation. While an extraordinary family of fusion-associated small transmembrane (FAST) proteins is responsible for orthoreovirus syncytiogenesis, the basis for aquareovirus-induced syncytiogenesis is unknown. We now report that the S7 genome segment of an Atlantic salmon reovirus is polycistronic and uses a noncanonical CUG translation start codon to produce a 22-kDa integral membrane protein responsible for syncytiogenesis. The aquareovirus p22 protein represents a fourth distinct member of the FAST family with a unique repertoire and arrangement of structural motifs. PMID:19297495

  9. Functional Analysis of the Interplay between Translation Termination, Selenocysteine Codon Context, and Selenocysteine Insertion Sequence-binding Protein 2*

    PubMed Central

    Gupta, Malavika; Copeland, Paul R.

    2010-01-01

    A selenocysteine insertion sequence (SECIS) element in the 3?-untranslated region and an in-frame UGA codon are the requisite cis-acting elements for the incorporation of selenocysteine into selenoproteins. Equally important are the trans-acting factors SBP2, Sec-tRNA[Ser]Sec, and eEFSec. Multiple in-frame UGAs and two SECIS elements make the mRNA encoding selenoprotein P (Sel P) unique. To study the role of codon context in determining the efficiency of UGA readthrough at each of the 10 rat Sel P Sec codons, we individually cloned 27-nucleotide-long fragments representing each UGA codon context into a luciferase reporter construct harboring both Sel P SECIS elements. Significant differences, spanning an 8-fold range of UGA readthrough efficiency, were observed, but these differences were dramatically reduced in the presence of excess SBP2. Mutational analysis of the “fourth base” of contexts 1 and 5 revealed that only the latter followed the established rules for hierarchy of translation termination. In addition, mutations in either or both of the Sel P SECIS elements resulted in differential effects on UGA readthrough. Interestingly, even when both SECIS elements harbored a mutation of the core region required for Sec incorporation, context 5 retained a significantly higher level of readthrough than context 1. We also show that SBP2-dependent Sec incorporation is able to repress G418-induced UGA readthrough as well as eRF1-induced stimulation of termination. We conclude that a large codon context forms a cis-element that works together with Sec incorporation factors to determine readthrough efficiency. PMID:17954931

  10. PILOT TESTING OF MERCURY OXIDATION CATALYSTS FOR UPSTREAM OF WET FGD SYSTEMS

    SciTech Connect

    Gary M. Blythe

    2003-01-21

    This document summarizes progress on Cooperative Agreement DE-FC26-01NT41185, Pilot Testing of Mercury Oxidation Catalysts for Upstream of Wet FGD Systems, during the time period October 1, 2002 through December 31, 2002. The objective of this project is to demonstrate at pilot scale the use of solid honeycomb catalysts to promote the oxidation of elemental mercury in the flue gas from coal combustion. The project is being funded by the U.S. DOE National Energy Technology Laboratory under Cooperative Agreement DE-FC26-01NT41185. EPRI, Great River Energy (GRE), and City Public Service (CPS) of San Antonio are project co-funders. URS Group is the prime contractor. The mercury catalytic oxidation process under development uses catalyst materials applied to honeycomb substrates to promote the oxidation of elemental mercury in the flue gas from coal-fired power plants that have wet lime or limestone flue gas desulfurization (FGD) systems. Oxidized mercury is removed in the wet FGD absorbers and co-precipitates with the byproducts from the FGD system. The co-precipitated mercury does not appear to adversely affect the disposal or reuse properties of the FGD byproduct. The current project testing previously identified, effective catalyst materials at a larger, pilot scale and in a commercial form, to provide engineering data for future fullscale designs. The pilot-scale tests will continue for up to 14 months at each of two sites to provide longer-term catalyst life data. This is the fifth full reporting period for the subject Cooperative Agreement. During this period, project efforts included starting up the pilot unit with three catalysts at the first site, conducting catalyst activity measurements, completing comprehensive flue gas sampling and analyses, and procuring additional catalysts for the pilot unit. This technical progress report provides an update on these efforts.

  11. PNS algorithm for solving supersonic flows with upstream influences

    NASA Astrophysics Data System (ADS)

    Miller, James Hale

    The goal of this research is to produce a robust, parabolized Navier-Stokes (PNS) code that will significantly reduce the computer time required to calculate flows about complex vehicles with embedded subsonic/separated regions. The major drawback of "current day" PNS codes is that they cannot be used to compute separated regions which occur near canopies, wing-body junctures, etc. As a result, Navier-Stokes (NS) codes are often used to compute the entire flowfield despite the fact that a PNS code requires at least one order of magnitude less computer time and storage. An innovative approach has been developed to permit a PNS code to compute embedded regions that cause upstream influence. In this approach, the embedded region is automatically detected and the streamwise extent is determined prior to the computation or while the computation is in progress. The PNS equations are then solved with an iterative (IPNS) algorithm in this region to duplicate the results that would he obtained with a NS code. Once the embedded region is computed, the algorithm returns to the standard space-marching PNS mode until the next embedded region is encountered. This method has been incorporated into NASA's upwind PNS (UPS) code and validated by applying it to several 2-D test cases. These test cases include flows over compression ramps, shock-boundary-layer interactions, flows over expansion corners, and flow over a general geometry with multiple embedded regions. The results computed using this approach are in excellent agreement with NS computations and experimental data. In addition, new correlation functions have been developed that accurately predict the streamwise extent of the embedded regions for all of the geometries considered. This is the first time that any correlation (theoretical or empirical) has been shown to accurately predict where the single-sweep PNS method is inaccurate for a wide range of flow conditions. These correlation functions in conjunction with the IPNS algorithm permit completely automatic computation of steady, laminar supersonic flowfields with embedded subsonic/separated regions using a space-marching code as the primary flow solver.

  12. Defragged Binary I Ching Genetic Code Chromosomes Compared to Nirenberg’s and Transformed into Rotating 2D Circles and Squares and into a 3D 100% Symmetrical Tetrahedron Coupled to a Functional One to Discern Start From Non-Start Methionines through a Stella Octangula

    PubMed Central

    Castro-Chavez, Fernando

    2012-01-01

    Background Three binary representations of the genetic code according to the ancient I Ching of Fu-Xi will be presented, depending on their defragging capabilities by pairing based on three biochemical properties of the nucleic acids: H-bonds, Purine/Pyrimidine rings, and the Keto-enol/Amino-imino tautomerism, yielding the last pair a 32/32 single-strand self-annealed genetic code and I Ching tables. Methods Our working tool is the ancient binary I Ching's resulting genetic code chromosomes defragged by vertical and by horizontal pairing, reverse engineered into non-binaries of 2D rotating 4×4×4 circles and 8×8 squares and into one 3D 100% symmetrical 16×4 tetrahedron coupled to a functional tetrahedron with apical signaling and central hydrophobicity (codon formula: 4[1(1)+1(3)+1(4)+4(2)]; 5:5, 6:6 in man) forming a stella octangula, and compared to Nirenberg's 16×4 codon table (1965) pairing the first two nucleotides of the 64 codons in axis y. Results One horizontal and one vertical defragging had the start Met at the center. Two, both horizontal and vertical pairings produced two pairs of 2×8×4 genetic code chromosomes naturally arranged (M and I), rearranged by semi-introversion of central purines or pyrimidines (M' and I') and by clustering hydrophobic amino acids; their quasi-identity was disrupted by amino acids with odd codons (Met and Tyr pairing to Ile and TGA Stop); in all instances, the 64-grid 90° rotational ability was restored. Conclusions We defragged three I Ching representations of the genetic code while emphasizing Nirenberg's historical finding. The synthetic genetic code chromosomes obtained reflect the protective strategy of enzymes with a similar function, having both humans and mammals a biased G-C dominance of three H-bonds in the third nucleotide of their most used codons per amino acid, as seen in one chromosome of the i, M and M' genetic codes, while a two H-bond A-T dominance was found in their complementary chromosome, as seen in invertebrates and plants. The reverse engineering of chromosome I' into 2D rotating circles and squares was undertaken, yielding a 100% symmetrical 3D geometry which was coupled to a previously obtained genetic code tetrahedron in order to differentiate the start methionine from the methionine that is acting as a codifying non-start codon. PMID:23431415

  13. HANDBOOK FOR PROJECT HEAD START.

    ERIC Educational Resources Information Center

    GRAHAM, JORY

    THIS BOOKLET WAS DESIGNED TO MEET SOME IMMEDIATE NEEDS FOR THE FIRST SUMMER SESSION OF PROJECT HEAD START. IT CONTAINS SOME OF THE MOST WORKABLE AND PROMISING TEACHING METHODS IN THE ENTIRE FIELD OF COMPENSATORY EDUCATIONS, METHODS THAT HAVE BEEN USED IN PRIVATELY SPONSORED CENTERS AND HAVE PROVED VALUABLE IN COPING WITH PROBLEMS ENCOUNTERED IN…

  14. When Will I Start Developing?

    MedlinePLUS

    ... for Parents for Kids for Teens Teens Home Body Mind Sexual Health Food & Fitness Diseases & Conditions Infections Q&A School & Jobs Drugs & Alcohol Staying Safe Recipes En Español ... Guy's Guide to Body Image When Will I Start Developing? KidsHealth > Teens > ...

  15. Start Where Your Students Are

    ERIC Educational Resources Information Center

    Jackson, Robyn R.

    2010-01-01

    Starting where your students are means understanding how currencies are negotiated and traded in the classroom. Any behavior that students use to acquire the knowledge and skills needed in the classroom functions as currency. Teachers communicate the kinds of currencies they accept in their classrooms, such as getting good grades; students do…

  16. Head Start Dental Health Curriculum.

    ERIC Educational Resources Information Center

    Administration for Children, Youth, and Families (DHHS), Washington, DC. Head Start Bureau.

    This curriculum for Head Start programs provides preschool learning experiences that teach about dental health. The majority of the curriculum guide is devoted to the following lesson plans: (1) "Introduction of 'Smiley the Super Pup'," an optional puppet character which may be used to review the concepts covered in each lesson; (2) "Visiting the…

  17. Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics.

    PubMed

    Lin, Kui; Kuang, Yuyu; Joseph, Jeremiah S; Kolatkar, Prasanna R

    2002-06-01

    Genomics projects have resulted in a flood of sequence data. Functional annotation currently relies almost exclusively on inter-species sequence comparison and is restricted in cases of limited data from related species and widely divergent sequences with no known homologs. Here, we demonstrate that codon composition, a fusion of codon usage bias and amino acid composition signals, can accurately discriminate, in the absence of sequence homology information, cytoplasmic ribosomal protein genes from all other genes of known function in Saccharomyces cerevisiae, Escherichia coli and Mycobacterium tuberculosis using an implementation of support vector machines, SVM(light). Analysis of these codon composition signals is instructive in determining features that confer individuality to ribosomal protein genes. Each of the sets of positively charged, negatively charged and small hydrophobic residues, as well as codon bias, contribute to their distinctive codon composition profile. The representation of all these signals is sensitively detected, combined and augmented by the SVMs to perform an accurate classification. Of special mention is an obvious outlier, yeast gene RPL22B, highly homologous to RPL22A but employing very different codon usage, perhaps indicating a non-ribosomal function. Finally, we propose that codon composition be used in combination with other attributes in gene/protein classification by supervised machine learning algorithms. PMID:12034849

  18. Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics

    PubMed Central

    Lin, Kui; Kuang, Yuyu; Joseph, Jeremiah S.; Kolatkar, Prasanna R.

    2002-01-01

    Genomics projects have resulted in a flood of sequence data. Functional annotation currently relies almost exclusively on inter-species sequence comparison and is restricted in cases of limited data from related species and widely divergent sequences with no known homologs. Here, we demonstrate that codon composition, a fusion of codon usage bias and amino acid composition signals, can accurately discriminate, in the absence of sequence homology information, cytoplasmic ribosomal protein genes from all other genes of known function in Saccharomyces cerevisiae, Escherichia coli and Mycobacterium tuberculosis using an implementation of support vector machines, SVMlight. Analysis of these codon composition signals is instructive in determining features that confer individuality to ribosomal protein genes. Each of the sets of positively charged, negatively charged and small hydrophobic residues, as well as codon bias, contribute to their distinctive codon composition profile. The representation of all these signals is sensitively detected, combined and augmented by the SVMs to perform an accurate classification. Of special mention is an obvious outlier, yeast gene RPL22B, highly homologous to RPL22A but employing very different codon usage, perhaps indicating a non-ribosomal function. Finally, we propose that codon composition be used in combination with other attributes in gene/protein classification by supervised machine learning algorithms. PMID:12034849

  19. Starting apparatus for internal combustion engines

    DOEpatents

    Dyches, G.M.; Dudar, A.M.

    1995-01-01

    This report is a patent description for a system to start an internal combustion engine. Remote starting and starting by hearing impaired persons are addressed. The system monitors the amount of current being drawn by the starter motor to determine when the engine is started. When the engine is started the system automatically deactivates the starter motor. Five figures are included.

  20. 8. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE. Sheet A19, November, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. UPSTREAM EXTENSION TO 60' INFILTRATION PIPE. Sheet A-19, November, 1940. File no. SA 342/13. - Prado Dam, Embankment, Santa Ana River near junction of State Highways 71 & 91, Corona, Riverside County, CA

  1. Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

    NASA Technical Reports Server (NTRS)

    Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

    1989-01-01

    The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

  2. Regulation of the human. beta. -actin promoter by upstream and intron domains

    SciTech Connect

    Ng, Sunyu (Linus Pauling Institute of Science and Medicine, Palo Alto, CA (USA))(Institute of Molecular Biology, Nankang (China)); Gunning, P.; Kedes, L. (Stanford Univ. School of Medicine, Palo Alto, CA (USA)); Liu, Shuhui (Institute of Molecular Biology, Taipei (China) National Tsing Hua Univ., Hsinchu (China)); Leavitt, J. (Linus Pauling Institute of Science and Medicine, Palo Alto, CA (USA))

    1989-01-25

    The authors have identified three regulatory domains of the complex human {beta}-actin gene promoter. They span a region of about 3,000 bases, from not more than {minus}2,011 bases upstream of the mRNA cap site to within the 5{prime} intron (832 bases long). A distal upstream domain contains at least one enhancer-like element. A proximal upstream domain, with a CArG (for CC(A+T rich){sub 6}GG) motif found in all known mammalian actin genes, seems to confer serum, but not growth factor, inducibility. The third domain is within the evolutionarily conserved 3{prime} region of the first intron and contains a 13 base-pair sequence, identical to the upstream sequence with the CArG motif. This domain also contains sequences that are both serum and fibroblast growth inducible.

  3. Seasonal variation of upper-level mobile trough development upstream of the Pacific storm track 

    E-print Network

    Myoung, Boksoon

    2002-01-01

    The purpose of this thesis is to investigate seasonal and interannual statistics of troughs associated with the Pacific storm track and quantify the influence of deformation on trough development upstream of the western Pacific. The goal...

  4. Upstream Financial Review of the Global Oil and Natural Gas Industry

    EIA Publications

    2014-01-01

    This analysis focuses on financial and operating trends of the oil and natural gas production business segment, often referred to as upstream operations, of 42 global oil and natural gas producing companies

  5. Simulation of present and future discharges at the Nile River upstream Lake Nasser

    Microsoft Academic Search

    Martijn J. Booij; Daniël. Tollenaar; Eelco van Beek; Jaap C. J. Kwadijk

    2010-01-01

    The objective of this study is to simulate present and future discharges at the Nile River upstream Lake Nasser. For this purpose a rainfall-runoff model (HBV) is integrated in an existing model which describes the water distribution in the upper Nile (RIBASIM-NILE). RIBASIM-NILE can be used to describe effects of developments upstream the High Aswan Dam on Nile discharges, with

  6. Association of low-frequency waves with suprathermal ions in the upstream solar wind

    Microsoft Academic Search

    G. Paschmann; N. Sckopke; S. J. Bame; J. R. Asbridge; J. T. Gosling; C.T. Russell; E. W. Greenstadt

    1979-01-01

    Observations obtained upstream of the earth's bowshock with the LASL\\/MPI plasma instruments and the UCLA magnetometers on ISEE-1 and 2 have revealed a striking relationship between the presence of low-frequency fluctuations in solar wind density and field strength and the different types of distribution functions of upstream ions. Waves are absent when the ions have the beamlike distribution of the

  7. An Evolutionarily Conserved Protein Binding Sequence Upstream of a Plant Light-Regulated Gene

    Microsoft Academic Search

    G. Giuliano; E. Pichersky; V. S. Malik; M. P. Timko; P. A. Scolnik; A. R. Cashmore

    1988-01-01

    A protein factor, identified in nuclear extracts obtained from tomato (Lycopersicon esculentum, Solanaceae) and Arabidopsis thaliana (Brassicaceae) seedlings, specifically binds upstream sequences from the plant light-regulated gene family encoding the small subunit of ribulose 1,5-bisphosphate carboxylase\\/oxygenase (RBCS). RBCS upstream sequences from tomato, pea (Pisum sativum, Leguminosae), and Arabidopsis are recognized by the factor. The factor recognition occurs via a short

  8. On the separated flow upstream of a jet in a cross flow

    NASA Technical Reports Server (NTRS)

    Krothapalli, A.; Lourenco, L.; Buchlin, J. M.

    1989-01-01

    Flow visualization techniques have been used to investigate the complex flow in the recirculation region upstream of a rectangular jet issuing normally into a uniform cross flow. Two different flow regimes are identified. It is shown that the recirculation region upstream of the jet is unsteady and periodic. Two distinct vortical structures are found for the wake behind the jet, one dominated by a symmetric vortex pair and one with vortices shed alternately from each side of the jet.

  9. Pollutant discharges to coastal areas: Improving upstream source estimates. Final report

    SciTech Connect

    Rohmann, S.O.

    1989-10-01

    The report describes a project NOAA's Strategic Environmental Assessments Division began to improve the estimates of pollutant discharges carried into coastal areas by rivers and streams. These estimates, termed discharges from upstream sources, take into account all pollution discharged by industries, sewage treatment plants, farms, cities, and other pollution-generating operations, as well as natural phenomena such as erosion and weathering which occur inland or upstream of the coastal US.

  10. Propagation characteristics of waves upstream and downstream of quasi-parallel shocks

    NASA Technical Reports Server (NTRS)

    Krauss-Varban, D.; Omidi, N.

    1993-01-01

    The propagation characteristics of waves upstream and downstream of quasi-parallel shocks are investigated by using 2D hybrid simulations. At low Alfven Mach numbers, M(A) below about 2, the shock is initially associated with upstream phase-standing whistlers. At later times, backstreaming ions excite longer-wavelength whistlers via the right-hand resonant ion/ion instability. These waves propagate along the magnetic field at a group velocity no smaller than the upstream flow speed, so that the waves remain in the upstream region. At higher MA (above about 3), these waves are convected back into the shock, causing its reformation and downstream perturbations. Shock transmitted waves mode-convert into Alfven/ion-cyclotron waves which have a wave vector along the shock normal (pointing upstream) and convect downstream. The 2D simulation results confirm our earlier suggestion that the upstream waves should be field aligned, and that their convection into the downstream is associated with linear mode conversion into the Alfven/ion-cyclotron branch.

  11. 30 CFR 75.1913 - Starting aids.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...2010-07-01 2010-07-01 false Starting aids. 75.1913 Section 75.1913 Mineral Resources...Diesel-Powered Equipment § 75.1913 Starting aids. (a) Volatile fuel starting aids shall be used in accordance with...

  12. 30 CFR 75.1913 - Starting aids.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...2011-07-01 2011-07-01 false Starting aids. 75.1913 Section 75.1913 Mineral Resources...Diesel-Powered Equipment § 75.1913 Starting aids. (a) Volatile fuel starting aids shall be used in accordance with...

  13. 30 CFR 75.1913 - Starting aids.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...2013-07-01 2013-07-01 false Starting aids. 75.1913 Section 75.1913 Mineral Resources...Diesel-Powered Equipment § 75.1913 Starting aids. (a) Volatile fuel starting aids shall be used in accordance with...

  14. 30 CFR 75.1913 - Starting aids.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...2014-07-01 2014-07-01 false Starting aids. 75.1913 Section 75.1913 Mineral Resources...Diesel-Powered Equipment § 75.1913 Starting aids. (a) Volatile fuel starting aids shall be used in accordance with...

  15. 30 CFR 75.1913 - Starting aids.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...2012-07-01 2012-07-01 false Starting aids. 75.1913 Section 75.1913 Mineral Resources...Diesel-Powered Equipment § 75.1913 Starting aids. (a) Volatile fuel starting aids shall be used in accordance with...

  16. A search for upstream pressure pulses associated with flux transfer events: An AMPTE/ISEE case study

    NASA Technical Reports Server (NTRS)

    Elphic, R. C.; Baumjohann, W.; Cattell, C. A.; Luehr, H.; Smith, M. F.

    1994-01-01

    On September 19, 1984, the Active Magnetospheric Particle Tracers Explorers (AMPTE) United Kingdom Satellite (UKS) and Ion Release Module (IRM) and International Sun Earth Explorers (ISEE) 1 and 2 spacecraft passed outbound through the dayside magnetopause at about the same time. The AMPTE spacecraft pair crossed first and were in the near-subsolar magnetosheath for more than an hour. Meanwhile the ISEE pair, about 5 R(sub E) to the south, observed flux transfer event (FTE) signatures. We use the AMPTE UKS and IRM plasma and field observations of magnetosheath conditions directly upstream of the subsolar magnetopause to check whether pressure pulses are responsible for the FTE signatures seen at ISEE. Pulses in both the ion thermal pressure and the dynamic pressure are observed in the magnetosheath early on when IRM and UKS are close to the magnetopause, but not later. These large pulses appear to be related to reconnection going on at the magnetopause nearby. AMPTE magnetosheath data far from the magnetopause do not show a pressure pulse correlation with FTEs at ISEE. Moreover, the magnetic pressure and tension effects seen in the ISEE FTEs are much larger than any pressure effects seen in the magnetosheath. A superposed epoch analysis based on small-amplitude peaks in the AMPTE magnetosheath total static pressure (nkT + B(exp 2)/2 mu(sub 0)) hint at some boundary effects, less than 5 nT peak-to-peak variations in the ISEE 1 and 2 B(sub N) signature starting about 1 min after the pressure peak epoch. However, these variations are much smaller than the standard deviations of the B(sub N) field component. Thus the evidence from this case study suggests that upstream magnetosheath pressure pulses do not give rise to FTEs, but may produce very small amplitude signatures in the magnetic field at the magnetopause.

  17. Codon-optimized glucoamylase sGAI of Aspergillus awamori improves starch utilization in an industrial yeast.

    PubMed

    Favaro, Lorenzo; Jooste, Tania; Basaglia, Marina; Rose, Shaunita H; Saayman, Maryna; Görgens, Johann F; Casella, Sergio; van Zyl, Willem H

    2012-08-01

    The development of a yeast that converts raw starch to ethanol in one step (called consolidated bioprocessing) could yield large cost reductions in the bioethanol industry. The aim of this study was to develop an efficient amylolytic Saccharomyces cerevisiae strain suitable for industrial bioethanol production. A native and codon-optimized variant of the Aspergillus awamori glucoamylase gene were expressed in the S. cerevisiae Y294 laboratory strain. Codon optimization resulted to be effective and the synthetic sequence sGAI was then ?-integrated into a S. cerevisiae strain with promising industrial fermentative traits. The mitotically stable recombinant strains showed high enzymatic capabilities both on soluble and raw starch (2425 and 1140 nkat/g dry cell weight, respectively). On raw corn starch, the engineered yeasts exhibited improved fermentative performance with an ethanol yield of 0.42 (g/g), corresponding to 75 % of the theoretical maximum yield. PMID:22450569

  18. SwiftLib: rapid degenerate-codon-library optimization through dynamic programming.

    PubMed

    Jacobs, Timothy M; Yumerefendi, Hayretin; Kuhlman, Brian; Leaver-Fay, Andrew

    2015-03-11

    Degenerate codon (DC) libraries efficiently address the experimental library-size limitations of directed evolution by focusing diversity toward the positions and toward the amino acids (AAs) that are most likely to generate hits; however, manually constructing DC libraries is challenging, error prone and time consuming. This paper provides a dynamic programming solution to the task of finding the best DCs while keeping the size of the library beneath some given limit, improving on the existing integer-linear programming formulation. It then extends the algorithm to consider multiple DCs at each position, a heretofore unsolved problem, while adhering to a constraint on the number of primers needed to synthesize the library. In the two library-design problems examined here, the use of multiple DCs produces libraries that very nearly cover the set of desired AAs while still staying within the experimental size limits. Surprisingly, the algorithm is able to find near-perfect libraries where the ratio of amino-acid sequences to nucleic-acid sequences approaches 1; it effectively side-steps the degeneracy of the genetic code. Our algorithm is freely available through our web server and solves most design problems in about a second. PMID:25539925

  19. Therapeutic suppression of premature termination codons: Mechanisms and clinical considerations (Review)

    PubMed Central

    KARIJOLICH, JOHN; YU, YI-TAO

    2014-01-01

    An estimated one-third of genetic disorders are the result of mutations that generate premature termination codons (PTCs) within protein coding genes. These disorders are phenotypically diverse and consist of diseases that affect both young and old individuals. Various small molecules have been identified that are capable of modulating the efficiency of translation termination, including select antibiotics of the aminoglycoside family and multiple novel synthetic molecules, including PTC124. Several of these agents have proved their effectiveness at promoting nonsense suppression in preclinical animal models, as well as in clinical trials. In addition, it has recently been shown that box H/ACA RNA-guided peudouridylation, when directed to modify PTCs, can also promote nonsense suppression. In this review, we summarize our current understanding of eukaryotic translation termination and discuss various methods for promoting the read-through of disease-causing PTCs, as well as the current obstacles that stand in the way of using the discussed agents broadly in clinical practice. PMID:24939317

  20. Correction of Methylmalonic Aciduria In Vivo Using a Codon-Optimized Lentiviral Vector

    PubMed Central

    Wong, Edward S.Y.; McIntyre, Chantelle; Peters, Heidi L.; Ranieri, Enzo; Anson, Donald S.

    2014-01-01

    Abstract Methylmalonic aciduria is a rare disorder of organic acid metabolism with limited therapeutic options, resulting in high morbidity and mortality. Positive results from combined liver/kidney transplantation suggest, however, that metabolic sink therapy may be efficacious. Gene therapy offers a more accessible approach for the treatment of methylmalonic aciduria than organ transplantation. Accordingly, we have evaluated a lentiviral vector–mediated gene transfer approach in an in vivo mouse model of methylmalonic aciduria. A mouse model of methylmalonic aciduria (Mut?/?MUTh2) was injected intravenously at 8 weeks of age with a lentiviral vector that expressed a codon-optimized human methylmalonyl coenzyme A mutase transgene, HIV-1SDmEF1?murSigHutMCM. Untreated Mut?/?MUTh2 and normal mice were used as controls. HIV-1SDmEF1?murSigHutMCM-treated mice achieved near-normal weight for age, and Western blot analysis demonstrated significant methylmalonyl coenzyme A enzyme expression in their livers. Normalization of liver methylmalonyl coenzyme A enzyme activity in the treated group was associated with a reduction in plasma and urine methylmalonic acid levels, and a reduction in the hepatic methylmalonic acid concentration. Administration of the HIV-1SDmEF1?murSigHutMCM vector provided significant, although incomplete, biochemical correction of methylmalonic aciduria in a mouse model, suggesting that gene therapy is a potential treatment for this disorder. PMID:24568291

  1. Correction of methylmalonic aciduria in vivo using a codon-optimized lentiviral vector.

    PubMed

    Wong, Edward S Y; McIntyre, Chantelle; Peters, Heidi L; Ranieri, Enzo; Anson, Donald S; Fletcher, Janice M

    2014-06-01

    Methylmalonic aciduria is a rare disorder of organic acid metabolism with limited therapeutic options, resulting in high morbidity and mortality. Positive results from combined liver/kidney transplantation suggest, however, that metabolic sink therapy may be efficacious. Gene therapy offers a more accessible approach for the treatment of methylmalonic aciduria than organ transplantation. Accordingly, we have evaluated a lentiviral vector-mediated gene transfer approach in an in vivo mouse model of methylmalonic aciduria. A mouse model of methylmalonic aciduria (Mut(-/-)MUT(h2)) was injected intravenously at 8 weeks of age with a lentiviral vector that expressed a codon-optimized human methylmalonyl coenzyme A mutase transgene, HIV-1SDmEF1?murSigHutMCM. Untreated Mut(-/-)MUT(h2) and normal mice were used as controls. HIV-1SDmEF1?murSigHutMCM-treated mice achieved near-normal weight for age, and Western blot analysis demonstrated significant methylmalonyl coenzyme A enzyme expression in their livers. Normalization of liver methylmalonyl coenzyme A enzyme activity in the treated group was associated with a reduction in plasma and urine methylmalonic acid levels, and a reduction in the hepatic methylmalonic acid concentration. Administration of the HIV-1SDmEF1?murSigHutMCM vector provided significant, although incomplete, biochemical correction of methylmalonic aciduria in a mouse model, suggesting that gene therapy is a potential treatment for this disorder. PMID:24568291

  2. Mechanisms of the tRNA wobble cytidine modification essential for AUA codon decoding in prokaryotes.

    PubMed

    Numata, Tomoyuki

    2015-01-01

    Bacteria and archaea have 2-lysylcytidine (L or lysidine) and 2-agmatinylcytidine (agm(2)C or agmatidine), respectively, at the first (wobble) position of the anticodon of the AUA codon-specific tRNA(Ile). These lysine- or agmatine-conjugated cytidine derivatives are crucial for the precise decoding of the genetic code. L is synthesized by tRNA(Ile)-lysidine synthetase (TilS), which uses l-lysine and ATP as substrates. Agm(2)C formation is catalyzed by tRNA(Ile)-agm(2)C synthetase (TiaS), which uses agmatine and ATP for the reaction. Despite the fact that TilS and TiaS synthesize structurally similar cytidine derivatives, these enzymes belong to non-related protein families. Therefore, these enzymes modify the wobble cytidine by distinct catalytic mechanisms, in which TilS activates the C2 carbon of the wobble cytidine by adenylation, while TiaS activates it by phosphorylation. In contrast, TilS and TiaS share similar tRNA recognition mechanisms, in which the enzymes recognize the tRNA acceptor stem to discriminate tRNA(Ile) and tRNA(Met). PMID:25348586

  3. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences. PMID:25491390

  4. Evidence of codon usage in the nearest neighbor spacing distribution of bases in bacterial genomes

    NASA Astrophysics Data System (ADS)

    Higareda, M. F.; Geiger, O.; Mendoza, L.; Méndez-Sánchez, R. A.

    2012-02-01

    Statistical analysis of whole genomic sequences usually assumes a homogeneous nucleotide density throughout the genome, an assumption that has been proved incorrect for several organisms since the nucleotide density is only locally homogeneous. To avoid giving a single numerical value to this variable property, we propose the use of spectral statistics, which characterizes the density of nucleotides as a function of its position in the genome. We show that the cumulative density of bases in bacterial genomes can be separated into an average (or secular) plus a fluctuating part. Bacterial genomes can be divided into two groups according to the qualitative description of their secular part: linear and piecewise linear. These two groups of genomes show different properties when their nucleotide spacing distribution is studied. In order to analyze genomes having a variable nucleotide density, statistically, the use of unfolding is necessary, i.e., to get a separation between the secular part and the fluctuations. The unfolding allows an adequate comparison with the statistical properties of other genomes. With this methodology, four genomes were analyzed Burkholderia, Bacillus, Clostridium and Corynebacterium. Interestingly, the nearest neighbor spacing distributions or detrended distance distributions are very similar for species within the same genus but they are very different for species from different genera. This difference can be attributed to the difference in the codon usage.

  5. SwiftLib: rapid degenerate-codon-library optimization through dynamic programming

    PubMed Central

    Jacobs, Timothy M.; Yumerefendi, Hayretin; Kuhlman, Brian; Leaver-Fay, Andrew

    2015-01-01

    Degenerate codon (DC) libraries efficiently address the experimental library-size limitations of directed evolution by focusing diversity toward the positions and toward the amino acids (AAs) that are most likely to generate hits; however, manually constructing DC libraries is challenging, error prone and time consuming. This paper provides a dynamic programming solution to the task of finding the best DCs while keeping the size of the library beneath some given limit, improving on the existing integer-linear programming formulation. It then extends the algorithm to consider multiple DCs at each position, a heretofore unsolved problem, while adhering to a constraint on the number of primers needed to synthesize the library. In the two library-design problems examined here, the use of multiple DCs produces libraries that very nearly cover the set of desired AAs while still staying within the experimental size limits. Surprisingly, the algorithm is able to find near-perfect libraries where the ratio of amino-acid sequences to nucleic-acid sequences approaches 1; it effectively side-steps the degeneracy of the genetic code. Our algorithm is freely available through our web server and solves most design problems in about a second. PMID:25539925

  6. Russian joint ventures, upstream deals hit fast clip

    SciTech Connect

    Not Available

    1992-06-29

    This paper reports that Russia is stepping up the pace of joint ventures and imports of petroleum technology and hardware. Among the latest action: Polar Lights, a 50-50 venture of Conoco Timan-Pechora Ltd. and Arkhangelskgeologia (AAG), started drilling in the first new-field oil-development project in Russia to include a US partner; The governments of Oman and the Kazakhstan republic signed an agreement covering oil and gas exploration, field development, and production in Kazakhstan; Phibro Energy Inc., Greenwich, Conn., last week reported the sale and delivery of the first full cargo of Russian crude oil produced and exported by a Russian-American joint venture; Era Aviation Inc., Anchorage, Alas., is sending two helicopters with crewmen to Russia to help assess the feasibility of oil and gas development off Sakhalin Island; In deals involving Canadian companies, SNC-Lavalin Inc., Montreal, received a contract for initial work on a $350 million (US) modernization of the Volvograd refinery in southern Russia.

  7. Synonymous Codon Bias Is Not Caused by Mutation Bias in G1C-Rich Genes in Humans

    Microsoft Academic Search

    Nick G. C. Smith; Adam Eyre-Walker

    It is has been suggested that synonymous codon bias is a consequence of mutation bias in mammals. We tested this hypothesis in humans using single-nucleotide polymorphism data. We found a pattern of polymorphism which was inconsistent with the mutation bias hypothesis in G1C-rich genes. However, the data were consistent with the action of natural selection or biased gene conversion. Similar

  8. Chloroplast ribosomal S14 protein transcript is edited to create a translation initiation codon in the moss Physcomitrella patens

    Microsoft Academic Search

    Yuki Miyata; Chika Sugiura; Yuki Kobayashi; Mitsuru Hagiwara; Mamoru Sugita

    2002-01-01

    The rps14 transcript is edited in the moss Physcomitrella patens chloroplast by a C-to-U transition, to create a translation initiation codon, AUG. The efficiency of RNA editing was low, with ?20% of rps14 transcripts edited. This suggests that the translation of rps14 mRNA is strictly regulated by RNA editing. This is the first report of RNA editing in P. patens

  9. Four-base codon mediated mRNA display to construct peptide libraries that contain multiple nonnatural amino acids

    Microsoft Academic Search

    Norihito Muranaka; Takahiro Hohsaka; Masahiko Sisido

    2006-01-01

    In vitro selection and directed evolution of peptides from mRNA display are powerful strategies to find novel peptide ligands that bind to target bio- molecules. In this study, we expanded the mRNA display method to include multiple nonnatural amino acids by introducing three different four- base codons at a randomly selected single position on the mRNA. Another nonnatural amino acid

  10. Severe nemaline myopathy caused by mutations of the stop codon of the skeletal muscle alpha actin gene ( ACTA1)

    Microsoft Academic Search

    William Wallefeld; Sabine Krause; Kristen J. Nowak; Danielle Dye; Rita Horváth; Zoltán Molnár; Miklós Szabó; Kazuhiro Hashimoto; Cristina Reina; Jose De Carlos; Jordi Rosell; Ana Cabello; Carmen Navarro; Ichizo Nishino; Hanns Lochmüller; Nigel G. Laing

    2006-01-01

    Most nemaline myopathy patients have mutations in the nebulin (NEB) or skeletal muscle ?-actin (ACTA1) genes. Here we report for the first time three patients with severe nemaline myopathy and mutations of the ACTA1 stop codon: TAG>TAT (tyrosine), TAG>CAG (glutamine) and TAG>TGG (tryptophan). All three mutations will cause inclusion of an additional 47 amino acids, translated from the 3? UTR

  11. Use of genotypic selection to detect P53 codon 273 CGT>CTT transversion: Application to an occupationally exposed population

    Microsoft Academic Search

    T. Carton; X. D. Tan; P. Hartemann; M. Joyeux

    2007-01-01

    CGT>CTT transversion in codon 273 of the P53 tumor-suppressor gene is one of the major mutations detected in human tumors. Within an epidemiological framework, we investigated the use of a genotypic selection method to measure this point mutation. The allele-specific polymerase chain reaction (AS-PCR) that was developed was able to detect 10 mutant copies of the gene among a total

  12. Leaky termination at premature stop codons antagonizes nonsense-mediated mRNA decay in S. cerevisiae

    E-print Network

    Bedwell, David M.

    constructs. The [PSI+ ] state is caused by a prion form of the polypeptide chain release factor eRF3 of a single class I release factor (eRF1) that recognizes all three stop codons (UAG, UAA, and UGA; Bertram et al. 2001; Kisselev et al. 2003). A class II release factor (eRF3) forms a complex with eRF1

  13. Apolipoprotein A-I deficiency due to a codon 84 nonsense mutation of the apolipoprotein A-I gene

    SciTech Connect

    Matsunaga, Tomoyuki; Yanagi, Hisako; Hattori, Naoko; Yamakawa, Kimiko; Yamanouchi, Yasuko; Hamaguchi, Hideo (Univ. of Tsukuba (Japan)); Hiasa, Yoshikazu; Maeda, Toshihiro (Komatsushima Red Cross Hospital (Japan)); Tanaka, Isao; Obara, Takashi (Eisai Co., Ltd., Tsukuba (Japan))

    1991-04-01

    The molecular genetic defect of a female patient with apolipoprotein A-I (apoA-I) deficiency and premature atherosclerosis was examined. Her parents were first cousins. Her plasma density fraction from 1.063 to 1.21 g/ml contained no apoA-I on SDS/PAGE and no measurable high density lipoprotein cholesterol. Southern blot hybridization showed no gross abnormality to be present in the patient's apoA-I gene and homozygosity for a haplotype of restriction fragment length polymorphisms in the apoA-I gene region. Sequencing after amplification by PCR revealed a codon 84 nonsense mutation (CAG {r arrow} TAG, Gln {r arrow} stop) of exon 4 and a codon 37 missense mutation (GCC{r arrow} ACC, Ala {r arrow} Thr) of exon 3 in the patient's apoA-I gene. The data from dot-blot hybridization with allele-specific oligonucleotide probes indicated that she was homozygous for the apoA-I gene with regard to the two mutations. The codon 37 missense mutation was also detected in the apoA-I gene of 6 out of 60 controls, who all had normal levels of apoA-I and high density lipoprotein cholesterol, suggesting that the missense mutation is polymorphic and not associated with apoA-I deficiency. These finding indicate that homozygosity for the apoA-I gene with codon 84 nonsense mutation causes the deficiency of apoA-I and of high density lipoprotein cholesterol in the patient.

  14. Translation initiation at non-AUG codons mediated by weakened association of eukaryotic initiation factor (eIF) 2 subunits.

    PubMed Central

    Hashimoto, Nilce N; Carnevalli, Larissa S; Castilho, Beatriz A

    2002-01-01

    The heterotrimeric eukaryotic initiation factor (eIF) 2 binds the initiator methionyl-tRNA in a GTP-dependent mode and delivers it to the 40 S ribosomal subunit. In the present study, we have identified amino acid residues in eIF2beta required for binding to eIF2gamma in yeast. Alteration of six residues in the central region of eIF2beta abolished this interaction, as determined by GST-pull down and two-hybrid assays, and leads to cell lethality. Substitution of (131)Tyr and (132)Ser by alanine residues ((131)YS), although abolishing the binding to eIF2gamma in these assays, resulted in a functional but defective protein in vivo, imparting a temperature-sensitive growth phenotype to cells. A dramatically weakened association of this mutant protein with eIF2gamma in vivo was shown by co-immunoprecipitation. The (131)YS mutation in eIF2beta allows translation to initiate at non-AUG codons, as defined by the ability of cells carrying an initiator codon mutation in the HIS4 mRNA to grow in the absence of histidine. The combination of this mutation with the (264)Ser-->Tyr alteration, a previously isolated suppressor of initiator codon mutations which has been shown to increase the spontaneous GTP hydrolysis in the ternary complex, caused a recessive lethality, suggesting additive defects. Thus the impaired interaction of these two subunits represents a novel type of defect in eIF2 function, providing in vivo evidence that the strength of interaction between eIF2beta and eIF2gamma defines the correct usage of the AUG codon for translation initiation. PMID:12137565

  15. tRNA(2Gln) mutants that translate the CGA arginine codon as glutamine in Escherichia coli.

    PubMed

    Tsai, F; Curran, J F

    1998-12-01

    We present a novel missense suppression system for the selection of tRNA(2GIn) mutants that can efficiently translate the CGA (arginine) codon as glutamine. tRNA(2Gln) mutants were cloned from a partially randomized synthetic gene pool using a plasmid vector that simultaneously expresses the tRNA gene and, to ensure efficient aminoacylation, the glutamine aminoacyl-tRNA synthetase gene (glnS). tRNA mutants that insert glutamine at CGA were selected as missense suppressors of a lacZ mutant (lacZ625(CGA)) that contains CGA substituted for an essential glutamine codon. Preliminary characterizations of four suppressors is presented. All of them contain two anticodon mutations: C-->U at position 34 and U-->C at position 35, which allow for cognate translation of CGA. U35 was previously shown to be an important determinant for glutaminylation of tRNA(2Gln) in vitro; suppression in vivo requires overexpression of the glutaminyl-tRNA synthetase gene (glnS). One tRNA variant contains no further mutations and has the highest missense suppression activity (8%). Three other isolates each contain an additional point mutation that alters suppression efficiency. This system will be useful for further studies of tRNA structure and function. In addition, because relatively efficient translation of the rare CGA codon as glutamine is not toxic for Escherichia coli, it may be possible to translate this sense codon with other alternate meanings, a property which could greatly facilitate protein engineering. PMID:9848650

  16. Transforming growth factor-beta1 polymorphisms in patients with brucellosis: an association between codon 10 and 25 polymorphisms and brucellosis.

    PubMed

    Rafiei, A; Hajilooi, M; Shakib, R J; Alavi, S A

    2007-01-01

    This study examined the association between transforming growth factor (TGF)-beta1 polymorphisms and brucellosis. The TGF-beta1 genotypes at codons 10 and 25 were determined by an amplification refractory mutation system-PCR among 425 brucellosis patients and 213 healthy volunteers. The frequencies of TGF-beta1 codons 10 C and 25 G were significantly higher among patients than among controls, as was that of TGF-beta1 codon 10 C/C. The high-producer haplotype (CG/TG) was more frequent among patients than among controls. The findings suggest that genetic polymorphism in codons 10 and 25 of the TGF-beta1 gene might contribute to the development of brucellosis. PMID:17184296

  17. Codon 249 mutation in exon 7 of p53 gene in plasma DNA: maybe a new early diagnostic marker of hepatocellular carcinoma in Qidong risk area, China

    Microsoft Academic Search

    Xing-Hua Huang; Lu-Hong Sun; Dong-Dong Lu; Yan Sun; Li-Jie Ma; Xi-Ran Zhang; Jian Huang; Long Yu; Qidong Liver Cancer

    2003-01-01

    AIM: One of the characteristics of hepatocellular carcinoma (HCC) in Qidong area is the selective mutation resulting in a serine substitution at codon 249 of the p53 gene (1, 20), and it has been identified as a \\

  18. Identification of the initiation codon for the atpB gene in Chlamydomonas chloroplasts excludes translation of a precursor form of the beta subunit of the ATP synthase.

    PubMed

    Rimbault, B; Esposito, D; Drapier, D; Choquet, Y; Stern, D; Wollman, F A

    2000-11-01

    The chloroplast atpB gene of Chlamydomonas reinhardtii, which encodes the beta subunit of the ATP synthase, contains three in-frame ATGs that are candidate translation initiation codons. An earlier study revealed that the N terminus of the assembled beta subunit maps at the +2 position with respect to the second in-frame methionine codon (Fiedler et al. 1995). Using chloroplast transformation, we have examined the possibility that either of the two additional in-frame ATG codons is competent for translation initiation. We provide evidence that translation of atpB is initiated exclusively at the second ATG codon. We conclude that the beta subunit is not synthesized with an N-terminal leader before its assembly into a functional ATP synthase complex. PMID:11129053

  19. XPC codon 939 polymorphism is associated with susceptibility to DNA damage induced by aflatoxin B1 exposure.

    PubMed

    Long, Xi-Dai; Huang, Hong-Dong; Huang, Xiao-Ying; Yao, Jin-Guang; Xia, Qiang

    2015-01-01

    Aflatoxin B1 (AFB1), resulting in the formation of AFB1-DNA adducts, is a known human carcinogen. AFB1-exposure individuals with inherited susceptible carcinogen-repairing genotypes may experience an increased risk of genotoxicity. This study was aimed to investigate whether DNA repair gene xerodermapigmentosum complementation group C codon 939 polymorphism (rs2228001) affected the levels of AFB1-DNA adducts in Guangxi Population (n = 2558), from an AFB1-exposure area. AFB1-DNA adducts were measured by ELISA, and XPC codon 939 genotypes were identified by TaqMan-PCR. We found that longer AFB1-exposure years significantly increased XPC genotypes with codon 939 Gln alleles (namely, XPC-LG and -GG, odds ratios [95% confidence intervals] were 1.37 (1.15-1.63) and 1.99 (1.55-2.55), respectively) was significantly associated with higher levels of AFB1-DNA adducts. Furthermore, there was a positive joint effect between XPC genotypes and long-year AFB1 exposure in the formation of AFB1-DNA adducts. These results suggest that individuals with susceptible genotypes XPC-LG and -GG may experience an increased risk of DNA damage elicited by AFB1 exposure. PMID:25785113

  20. XPC codon 939 polymorphism is associated with susceptibility to DNA damage induced by aflatoxin B1 exposure

    PubMed Central

    Long, Xi-Dai; Huang, Hong-Dong; Huang, Xiao-Ying; Yao, Jin-Guang; Xia, Qiang

    2015-01-01

    Aflatoxin B1 (AFB1), resulting in the formation of AFB1-DNA adducts, is a known human carcinogen. AFB1-exposure individuals with inherited susceptible carcinogen-repairing genotypes may experience an increased risk of genotoxicity. This study was aimed to investigate whether DNA repair gene xerodermapigmentosum complementation group C codon 939 polymorphism (rs2228001) affected the levels of AFB1-DNA adducts in Guangxi Population (n = 2558), from an AFB1-exposure area. AFB1-DNA adducts were measured by ELISA, and XPC codon 939 genotypes were identified by TaqMan-PCR. We found that longer AFB1-exposure years significantly increased XPC genotypes with codon 939 Gln alleles (namely, XPC-LG and -GG, odds ratios [95% confidence intervals] were 1.37 (1.15-1.63) and 1.99 (1.55-2.55), respectively) was significantly associated with higher levels of AFB1-DNA adducts. Furthermore, there was a positive joint effect between XPC genotypes and long-year AFB1 exposure in the formation of AFB1-DNA adducts. These results suggest that individuals with susceptible genotypes XPC-LG and -GG may experience an increased risk of DNA damage elicited by AFB1 exposure. PMID:25785113

  1. Detection of a germline mutation at codon 918 of the RET proto-oncogene in French MEN 2B families.

    PubMed

    Rossel, M; Schuffenecker, I; Schlumberger, M; Bonnardel, C; Modigliani, E; Gardet, P; Navarro, J; Luo, Y; Romeo, G; Lenoir, G

    1995-04-01

    Multiple endocrine neoplasia type 2A (MEN 2A), type 2B (MEN 2B), and familial medullary thyroid carcinoma (FMTC) are three dominantly inherited disorders linked to the same disease locus on chromosome 10. Two types of germline mutation of the RET proto-onco-gene, which codes for a transmembrane tyrosine kinase, are associated with MEN 2. Missense mutations at cysteine residues in the extra-cytoplasmic domain are exclusively associated with MEN 2A and FMTC. In MEN 2B patients, a single point mutation at codon 918 has recently been characterized, leading to the replacement of a methionine by a threonine within the RET tyrosine kinase domain. We now report the identification of a mutation at codon 918 in the germline of 16 patients out of 18 unrelated MEN 2B families analyzed. In these families we have been able to demonstrate that, in five cases, the mutation arose de novo, and that, in one kindred, it was coinherited with the disease. These results indicate that a unique mutation at codon 918 of the RET gene is the most prevalent genetic defect causing MEN 2B, but also that rare MEN 2B cases are associated with different mutations yet to be defined. PMID:7705835

  2. Codon modification for the DNA sequence of a single-chain Fv antibody against clenbuterol and expression in Pichia pastoris.

    PubMed

    Dong, Jie-Xian; Xie, Xi; Hu, Da-Wei; Chen, Shu-Chi; He, Yong-Sheng; Beier, Ross C; Shen, Yu-Dong; Sun, Yuan-Ming; Xu, Zhen-Lin; Wang, Hong; Yang, Jin-Yi

    2014-04-01

    The expression efficiency was improved for the recombinant single-chain variable fragment (scFv) against clenbuterol (CBL) obtained from mouse and expressed in the methylotrophic yeast Pichia pastoris GS115, by redesigning and synthesizing the DNA sequence encoding for CBL-scFv based on the codon bias of P. pastoris. The codons encoding 124 amino acids were optimized, in which a total of 156 nucleotides were changed, and the G+C ratio was simultaneously decreased from 53 to 47.2 %. Under the optimized expression conditions, the yield of the recombinant CBL-scFv (41 kDa) antibodies was 0.223 g L?¹ in shake culture. Compared to the non-optimized control, the expression level of the optimized recombinant CBL-scFv based on preferred codons in P. pastoris demonstrated a 2.35-fold higher yield. Furthermore, the recombinant CBL-scFv was purified by Ni-NTA column chromatography, and the purity was 95 %. The purified CBL-scFv showed good CBL recognition by a competitive indirect enzyme-linked immunoassay. The average concentration required for 50 % inhibition of binding and the limit of detection for the assay were 5.82 and 0.77 ng mL?¹, respectively. PMID:24190495

  3. Synonymous Codon Usage Bias in Plant Mitochondrial Genes Is Associated with Intron Number and Mirrors Species Evolution

    PubMed Central

    Zhao, Mingming; Yin, Xunhao; Xia, Guangmin; Wang, Mengcheng

    2015-01-01

    Synonymous codon usage bias (SCUB) is a common event that a non-uniform usage of codons often occurs in nearly all organisms. We previously found that SCUB is correlated with both intron number and exon position in the plant nuclear genome but not in the plastid genome; SCUB in both nuclear and plastid genome can mirror the evolutionary specialization. However, how about the rules in the mitochondrial genome has not been addressed. Here, we present an analysis of SCUB in the mitochondrial genome, based on 24 plant species ranging from algae to land plants. The frequencies of NNA and NNT (A- and T-ending codons) are higher than those of NNG and NNC, with the strongest preference in bryophytes and the weakest in land plants, suggesting an association between SCUB and plant evolution. The preference for NNA and NNT is more evident in genes harboring a greater number of introns in land plants, but the bias to NNA and NNT exhibits even among exons. The pattern of SCUB in the mitochondrial genome differs in some respects to that present in both the nuclear and plastid genomes. PMID:26110418

  4. Use of a High-Resolution Melt Assay To Characterize Codon 54 of the cyp51A Gene of Aspergillus fumigatus on a Rotor-Gene 6000 Instrument?

    PubMed Central

    Tuohy, M. J.; Reja, V.; Park, S.; Perlin, D. S.; Wnek, M.; Procop, G. W.; Yen-Lieberman, B.

    2010-01-01

    A high-resolution melt (HRM) assay using a Rotor-Gene 6000 instrument was developed to characterize the codon for glycine 54 in the cyp51A genes from 13 reference isolates and 12 clinical isolates of Aspergillus fumigatus. Mutations in this codon confer reduced susceptibility to itraconazole and posaconazole. The assay is simple to perform, and a result of “wild type” or “mutant” is available after approximately 1 h following DNA extraction using commercially available reagents and conventional primers. PMID:20194699

  5. Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum

    Microsoft Academic Search

    Hubert Charles; Federica Calevro; J. Vinuelas; J.-M. Fayard; Y. Rahbe

    2006-01-01

    Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidi- cola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codon usage in Buchnera has been overcome by the high mutational

  6. Life without tRNAArg–adenosine deaminase TadA: evolutionary consequences of decoding the four CGN codons as arginine in Mycoplasmas and other Mollicutes

    PubMed Central

    Yokobori, Shin-ichi; Kitamura, Aya; Grosjean, Henri; Bessho, Yoshitaka

    2013-01-01

    In most bacteria, two tRNAs decode the four arginine CGN codons. One tRNA harboring a wobble inosine (tRNAArgICG) reads the CGU, CGC and CGA codons, whereas a second tRNA harboring a wobble cytidine (tRNAArgCCG) reads the remaining CGG codon. The reduced genomes of Mycoplasmas and other Mollicutes lack the gene encoding tRNAArgCCG. This raises the question of how these organisms decode CGG codons. Examination of 36 Mollicute genomes for genes encoding tRNAArg and the TadA enzyme, responsible for wobble inosine formation, suggested an evolutionary scenario where tadA gene mutations first occurred. This allowed the temporary accumulation of non-deaminated tRNAArgACG, capable of reading all CGN codons. This hypothesis was verified in Mycoplasma capricolum, which contains a small fraction of tRNAArgACG with a non-deaminated wobble adenosine. Subsets of Mollicutes continued to evolve by losing both the mutated tRNAArgCCG and tadA, and then acquired a new tRNAArgUCG. This permitted further tRNAArgACG mutations with tRNAArgGCG or its disappearance, leaving a single tRNAArgUCG to decode the four CGN codons. The key point of our model is that the A-to-I deamination activity had to be controlled before the loss of the tadA gene, allowing the stepwise evolution of Mollicutes toward an alternative decoding strategy. PMID:23658230

  7. Partial Optimization of the 5-Terminal Codon Increased a Recombination Porcine Pancreatic Lipase (opPPL) Expression in Pichia pastoris

    PubMed Central

    Zhao, Hua; Chen, Dan; Tang, Jiayong; Jia, Gang; Long, Dingbiao; Liu, Guangmang; Chen, Xiaoling; Shang, Haiying

    2014-01-01

    Pancreatic lipase plays a key role in intestinal digestion of feed fat, and is often deficient in young animals such as weaning piglets. The objective of this study was to express and characterize a partial codon optimized porcine pancreatic lipase (opPPL). A 537 bp cDNA fragment encoding N-terminus amino acid residue of the mature porcine pancreatic lipase was synthesized according to the codon bias of Pichia pastoris and ligated to the full-length porcine pancreatic lipase cDNA fragment. The codon optimized PPL was cloned into the pPICZ?A (Invitrogen, Beijing, China) vector. After the resultant opPPL/pPICZ?? plasmid was transformed into P.pastoris, the over-expressed extracellular opPPL containing a His-tag to the C terminus was purified using Ni Sepharose affinity column (GE Healthcare, Piscataway, NJ, USA), and was characterized against the native enzyme (commercial PPL from porcine pancreas, Sigma). The opPPL exhibited a molecular mass of approximately 52 kDa, and showed optimal temperature (40°C), optimal pH (8.0), Km (0.041 mM), and Vmax (2.008 µmol.mg protein ?1.min?1) similar to those of the commercial enzyme with p-NPP as the substrate. The recombinant enzyme was stable at 60°C, but lost 80% (P<0.05) of its activity after exposure to heat ?60°C for 20 min. The codon optimization increased opPPL yield for ca 4 folds (146 mg.L?1 vs 36 mg.L?1) and total enzyme activity increased about 5 folds (1900 IU.L?1 vs 367 IU.L?1) compared with those native naPPL/pPICZ?? tranformant. Comparison of gene copies and mRNA profiles between the two strains indicated the increased rePPL yields may partly be ascribed to the increased protein translational efficiency after codon optimization. In conclusion, we successfully optimized 5-terminal of porcine pancreatic lipase encoding gene and over-expressed the gene in P. pastoris as an extracellular, functional enzyme. The recombination enzyme demonstrates a potential for future use as an animal feed additive for animal improvement. PMID:25544987

  8. Codon-optimized Human Sodium Iodide Symporter (opt-hNIS) as a Sensitive Reporter and Efficient Therapeutic Gene

    PubMed Central

    Kim, Young-Hwa; Youn, Hyewon; Na, Juri; Hong, Kee-Jong; Kang, Keon Wook; Lee, Dong Soo; Chung, June-Key

    2015-01-01

    To generate a more efficient in vivo reporter and therapeutic gene, we optimized the coding sequence of the human sodium/iodide symporter (NIS) gene by replacing NIS DNA codons from wild type to new codons having the highest usage in human gene translation. The Codon Adaptation Index (CAI), representing the number of codons effective for human expression, was much improved (0.79 for hNIS, 0.97 for opt-hNIS). Both wild-type (hNIS) and optimized human NIS (opt-hNIS) were cloned into pcDNA3.1 and pMSCV vectors for transfection. Various cancer cell lines such as thyroid (TPC-1, FRO, B-CPAP), breast (MDA-MB-231), liver (Hep3B), cervical (HeLa), and glioma (U87MG) were transfected with pcDNA3.1/hNIS or pcDNA3.1/opt-hNIS. 125I uptake by opt-hNIS-expressing cells was 1.6 ~ 2.1 times higher than uptake by wild-type hNIS-expressing cells. Stable cell lines were also established by retroviral transduction using pMSCV/hNIS or pMSCV/opt-hNIS, revealing higher NIS protein levels and 125I uptake in opt-hNIS-expressing cells than in hNIS-expressing cells. Moreover, scintigraphic images from cell plates and mouse xenografts showed stronger signals from opt-hNIS-expressing cells than hNIS-expressing cells, and radioactivity uptake by opt-hNIS-expressing tumors was 2.3-fold greater than that by hNIS-expressing tumors. To test the efficacy of radioiodine therapy, mouse xenograft models were established with cancer cells expressing hNIS or opt-hNIS. 131I treatment reduced tumor sizes of hNIS- and opt-hNIS-expressing tumors to 0.57- and 0.27- fold, respectively, compared to their sizes before therapy, suggesting an improved therapeutic effect of opt-hNIS. In summary, this study shows that codon optimization strongly increases hNIS protein levels and radioiodine uptake, thus supporting opt-hNIS as a more sensitive reporter and efficient therapeutic gene. PMID:25553100

  9. Proteomics-based Refinement of Deinococcus deserti Genome Annotation Reveals an Unwonted Use of Non-canonical Translation Initiation Codons*

    PubMed Central

    Baudet, Mathieu; Ortet, Philippe; Gaillard, Jean-Charles; Fernandez, Bernard; Guérin, Philippe; Enjalbal, Christine; Subra, Gilles; de Groot, Arjan; Barakat, Mohamed; Dedieu, Alain; Armengaud, Jean

    2010-01-01

    Deinococcaceae are a family of extremely radiation-tolerant bacteria that are currently subjected to numerous studies aimed at understanding the molecular mechanisms for such radiotolerance. To achieve a comprehensive and accurate annotation of the Deinococcus deserti genome, we performed an N terminus-oriented characterization of its proteome. For this, we used a labeling reagent, N-tris(2,4,6-trimethoxyphenyl)phosphonium acetyl succinimide, to selectively derivatize protein N termini. The large scale identification of N-tris(2,4,6-trimethoxyphenyl)phosphonium acetyl succinimide-modified N-terminal-most peptides by shotgun liquid chromatography-tandem mass spectrometry analysis led to the validation of 278 and the correction of 73 translation initiation codons in the D. deserti genome. In addition, four new genes were detected, three located on the main chromosome and one on plasmid P3. We also analyzed signal peptide cleavages on a genome-wide scale. Based on comparative proteogenomics analysis, we propose a set of 137 corrections to improve Deinococcus radiodurans and Deinococcus geothermalis gene annotations. Some of these corrections affect important genes involved in DNA repair mechanisms such as polA, ligA, and ddrB. Surprisingly, experimental evidences were obtained indicating that DnaA (the protein involved in the DNA replication initiation process) and RpsL (the S12 ribosomal conserved protein) translation is initiated in Deinococcaceae from non-canonical codons (ATC and CTG, respectively). Such use may be the basis of specific regulation mechanisms affecting replication and translation. We also report the use of non-conventional translation initiation codons for two other genes: Deide_03051 and infC. Whether such use of non-canonical translation initiation codons is much more frequent than for other previously reported bacterial phyla or restricted to Deinococcaceae remains to be investigated. Our results demonstrate that predicting translation initiation codons is still difficult for some bacteria and that proteomics-based refinement of genome annotations may be helpful in such cases. PMID:19875382

  10. Codon-optimized human sodium iodide symporter (opt-hNIS) as a sensitive reporter and efficient therapeutic gene.

    PubMed

    Kim, Young-Hwa; Youn, Hyewon; Na, Juri; Hong, Kee-Jong; Kang, Keon Wook; Lee, Dong Soo; Chung, June-Key

    2015-01-01

    To generate a more efficient in vivo reporter and therapeutic gene, we optimized the coding sequence of the human sodium/iodide symporter (NIS) gene by replacing NIS DNA codons from wild type to new codons having the highest usage in human gene translation. The Codon Adaptation Index (CAI), representing the number of codons effective for human expression, was much improved (0.79 for hNIS, 0.97 for opt-hNIS). Both wild-type (hNIS) and optimized human NIS (opt-hNIS) were cloned into pcDNA3.1 and pMSCV vectors for transfection. Various cancer cell lines such as thyroid (TPC-1, FRO, B-CPAP), breast (MDA-MB-231), liver (Hep3B), cervical (HeLa), and glioma (U87MG) were transfected with pcDNA3.1/hNIS or pcDNA3.1/opt-hNIS. 125I uptake by opt-hNIS-expressing cells was 1.6~2.1 times higher than uptake by wild-type hNIS-expressing cells. Stable cell lines were also established by retroviral transduction using pMSCV/hNIS or pMSCV/opt-hNIS, revealing higher NIS protein levels and 125I uptake in opt-hNIS-expressing cells than in hNIS-expressing cells. Moreover, scintigraphic images from cell plates and mouse xenografts showed stronger signals from opt-hNIS-expressing cells than hNIS-expressing cells, and radioactivity uptake by opt-hNIS-expressing tumors was 2.3-fold greater than that by hNIS-expressing tumors. To test the efficacy of radioiodine therapy, mouse xenograft models were established with cancer cells expressing hNIS or opt-hNIS. 131I treatment reduced tumor sizes of hNIS- and opt-hNIS-expressing tumors to 0.57- and 0.27- fold, respectively, compared to their sizes before therapy, suggesting an improved therapeutic effect of opt-hNIS. In summary, this study shows that codon optimization strongly increases hNIS protein levels and radioiodine uptake, thus supporting opt-hNIS as a more sensitive reporter and efficient therapeutic gene. PMID:25553100

  11. Characterization and expression of codon optimized soybean phytase gene in E. coli.

    PubMed

    Singh, Pritee; Punjabi, Mansi; Jolly, Monica; Rai, R D; Sachdev, Archana

    2013-12-01

    Phytic acid, the major storage form of phosphorus in plant seeds is degraded by the phytases to yield inositol and free phosphate, contributing thereby to the improved bioavailability of phytate phosphorus and essential minerals in plant foods and simultaneous reduction in phosphorus pollution of the terrestrial and aquatic ecosystems. As a possible strategy for altering seed phytate levels, the approach involving reduction of phytate content by ectopically expressing endogenous phytase gene during seed development of soybean (Glycine max L. cv. Pusa-20) was attempted in the present study. Semi-quantitative RT-PCR revealed the maximum expression of phytase gene transcripts in germinating cotyledons (approximately 10 days after germinations), compared to other vegetative tissues. A full-length phytase cDNA was amplified from the germinating seedlings by splicing by overlap extension (SOE)-PCR and its sequence analysis revealed an open-reading-frame of 1644 bp, including an N terminal signal peptide of 28 amino acids. Predicted amino acid sequence (547-aa) of molecular mass 62 kDa on alignment with related purple acid phosphatases in other plants shared five conserved domains and seven invariant amino acids involved in coordination of the metals in the binuclear center of purple acid phosphatases. Owing to a large number of E. coli low-usage codons in soybean phytase gene, the modified gene was cloned into a prokaryotic expression vector pET-28a (+) and its expression in E. coli was confirmed by SDS-PAGE and Western blot analysis. Bioassay of the crude expression product in E. coli revealed a functional phytase gene, showing a great potential for developing low phytate transgenic soybean through its seed-specific overexpression in the early stages of seed development. PMID:24772979

  12. Analytical expression of the purine/pyrimidine codon probability after and before random mutations.

    PubMed

    Arquès, D G; Michel, C J

    1993-11-01

    Recently, we proposed a new model of DNA sequence evolution (Arquès and Michel. 1990b. Bull. math. Biol. 52, 741-772) according to which actual genes on the purine/pyrimidine (R/Y) alphabet (R = purine = adenine or guanine, Y = pyrimidine = cytosine or thymine) are the result of two successive evolutionary genetic processes: (i) a mixing (independent) process of non-random oligonucleotides (words of base length less than 10: YRY(N)6, YRYRYR and YRYYRY are so far identified; N = R or Y) leading to primitive genes (words of several hundreds of base length) and followed by (ii) a random mutation process, i.e., transformations of a base R (respectively Y) into the base Y (respectively R) at random sites in these primitive genes. Following this model the problem investigated here is the study of the variation of the 8 R/Y codon probabilities RRR, ..., YYY under random mutations. Two analytical expressions solved here allow analysis of this variation in the classical evolutionary sense (from the past to the present, i.e., after random mutations), but also in the inverted evolutionary sense (from the present to the past, i.e., before random mutations). Different properties are also derived from these formulae. Finally, a few applications of these formulae are presented. They prove the proposition in Arquès and Michel (1990b. Bull. math. Biol. 52, 741-772), Section 3.3.2, with the existence of a maximal mean number of random mutations per base of the order 0.3 in the protein coding genes. They also confirm the mixing process of oligonucleotides by excluding the purine/pyrimidine contiguous and alternating tracts from the formation process of primitive genes. PMID:8281128

  13. Gene polymorphism in transforming growth factor-beta codon 10 is associated with susceptibility to Giardiasis.

    PubMed

    Taherkhani, H; Hajilooi, M; Fallah, M; Khyabanchi, O; Haidari, M

    2009-12-01

    Secretory immunoglobulin A (S-IgA) antibodies have a central role in anti-Giardial defence. It has been demonstrated that transforming growth factor-beta1 (TGF-beta1) stimulates B lymphocytes to produce and secrete S-IgA. We sought to determine the association between TGF-beta1 polymorphism (T+869C) with susceptibility to Giardiasis. The TGF-beta1 genotypes and levels of salivary (S-IgA) were analysed in individuals with Giardiasis (97 symptomatic and 57 asymptomatic) and controls (n = 92). Individuals with symptomatic Giardiasis had the lowest levels of S-IgA compared to individuals in asymptomatic Giardiasis and control groups (97%, 73% and 43%, <1 g L(-1), respectively, P = 0.002). The frequency of allele C and CC genotypes of TGF-beta1 polymorphism was significantly higher among symptomatic patients than asymptomatic and control groups. Logistic regression analysis demonstrated that the individuals homozygous for allele C of TGF-beta1 had a significantly higher risk for symptomatic Giardiasis with odds ratio of 2.76 (95% CI: 3.88, 1.71, P = 0.007). Among the participants with TT genotype per cent of individuals with S-IgA level of more than 1 g L(-1) was almost twice the percentage in CC genotype individuals (14% versus 7% respectively P = 0.01). Our data suggest that CC genotype of TGF-beta1 polymorphism at codon 10 is associated with occurrence of Giardiasis. PMID:19703231

  14. Successful expression and purification of DPPD using a codon optimized synthetic gene*

    PubMed Central

    Kashino, Suely S.; Campos-Neto, Antonio

    2012-01-01

    DPPD (Rv0061) is a difficult to express protein of Mycobacterium tuberculosis that elicits strong and specific delayed type hypersensitivity reactions in humans infected with M. tuberculosis. Therefore e DPPD is a molecule that can improve the specificity of the tuberculin skin test, which is widely used as an aid for the diagnosis of tuberculosis. However, a pitfall of our initial studies was that the DPPD molecule used to perform the skin tests was engineered as fusion molecule with another Mycobacterium protein. This approach was used because no expression of DPPD could be achieved either as a single molecule or as a fusion protein using a variety of commercially available expression systems. Here, we report the production and purification of rDPPD using a synthetic gene engineered to contain E. coli codon bias. The gene was cloned into pET14b expression vector, which was subsequently used to transform Rosetta 2(DE3) pLysS or BL-21(DE3)pLysS host cells. The recombinant protein was over-expressed after induction with IPTG and its purification was easily achieved at levels of 5 – 10 mg/l of bacterial broth cultures. The purified protein was confirmed to be DPPD by Mass Spectroscopy sequencing analysis. Moreover, purified rDPPD stimulated peripheral blood mononuclear cells of PPD positive blood donors to produce high levels of IFN-?, thus confirming that this molecule is biologically active. Because of the DPPD gene is restricted to the tuberculosis-complex organisms of Mycobacterium genus, this highly purified molecule should be useful for the identification of individuals sensitized with tubercle bacilli. PMID:23264930

  15. Selective pressures at a codon-level predict deleterious mutations in human disease genes.

    PubMed

    Arbiza, Leonardo; Duchi, Serena; Montaner, David; Burguet, Jordi; Pantoja-Uceda, David; Pineda-Lucena, Antonio; Dopazo, Joaquín; Dopazo, Hernán

    2006-05-19

    Deleterious mutations affecting biological function of proteins are constantly being rejected by purifying selection from the gene pool. The non-synonymous/synonymous substitution rate ratio (omega) is a measure of selective pressure on amino acid replacement mutations for protein-coding genes. Different methods have been developed in order to predict non-synonymous changes affecting gene function. However, none has considered the estimation of selective constraints acting on protein residues. Here, we have used codon-based maximum likelihood models in order to estimate the selective pressures on the individual amino acid residues of a well-known model protein: p53. We demonstrate that the number of residues under strong purifying selection in p53 is much higher than those that are strictly conserved during the evolution of the species. In agreement with theoretical expectations, residues that have been noted to be of structural relevance, or in direct association with DNA, were among those showing the highest signals of purifying selection. Conversely, those changing according to a neutral, or nearly neutral mode of evolution, were observed to be irrelevant for protein function. Finally, using more than 40 human disease genes, we demonstrate that residues evolving under strong selective pressures (omega<0.1) are significantly associated (p<0.01) with human disease. We hypothesize that non-synonymous change on amino acids showing omega<0.1 will most likely affect protein function. The application of this evolutionary prediction at a genomic scale will provide an a priori hypothesis of the phenotypic effect of non-synonymous coding single nucleotide polymorphisms (SNPs) in the human genome. PMID:16584746

  16. Codon optimization of cry1Ab gene for hyper expression in plant organelles.

    PubMed

    Jabeen, Rasheda; Khan, Muhammad Sarwar; Zafar, Yusuf; Anjum, Tehmina

    2010-02-01

    With the advent of genetic manipulation techniques, it has become possible to clone and insert gene into the genome of crop plants to confer resistance to insects and pests. Resistance to insects has been demonstrating in transgenic plants either by triggering defense system of plants or by expressing heterologous cry genes for delta-endotoxins from Bacillus thuringiensis. In the present study, synthetic cry1Ab gene was developed with optimized chloroplast preferred codons and is expressed in tobacco plastid genome called plastome, following chloroplast transformation strategy, which is environment friendly technique to minimize out-crossing of transgenes to related weeds and crops. In addition, due to high polyploidy of plastid genome transformation of chloroplast permits the introduction of thousands of copies of foreign genes per plant cell, leading to extraordinarily high levels of foreign protein expression. The chloroplast transformation technology aims to insert stably into the plastome through homologous recombination into pre-decided position. To characterize the synthetic cry1Ab gene, chloroplast transformation vectors were developed and bombarded to the leaf cells of tobacco plants maintained under aseptic conditions. After bombardment, the drug resistant shoots were selected and regenerated on drug containing regeneration medium. Homoplasmic shoots were recovered after successive rounds of selection and regeneration. Proliferated plants were subjected to genomic DNA analysis by using polymerase chain reaction (PCR) technique where cry1Ab gene-specific primers were used. PCR positive plants were subjected to protein analysis, and functionally expressed proteins were detected using Immuno-Strips specific for cry1Ab/Ac gene products. Transgenic plants carrying cry1Ab gene were found expressing Bt toxins confirming that engineered gene could be expressed in other plants as well. PMID:19757171

  17. The WW domain protein Kibra acts upstream of Hippo in Drosophila.

    PubMed

    Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie; Hafen, Ernst; Stocker, Hugo

    2010-02-16

    The conserved Hippo kinase pathway plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. Whereas the function of the core kinase cascade, consisting of the serine/threonine kinases Hippo and Warts, in phosphorylating and thereby inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra predominantly acts in the Merlin branch upstream of the core kinase cascade to regulate Hippo signaling. PMID:20159600

  18. Symbolic regression of upstream, stormwater, and tributary E. coli concentrations using river flows.

    PubMed

    Jagupilla, Sarath Chandra K; Vaccari, David A; Miskewitz, Robert; Su, Tsan-Liang; Hires, Richard I

    2015-01-01

    Symbolic regression was used to model E. coli concentrations of upstream boundary, tributaries, and stormwater in the lower Passaic River at Paterson, New Jersey. These models were used to simulate boundary concentrations for a water quality analysis simulation program to model the river. River flows from upstream and downstream boundaries of the study area were used as predictors. The symbolic regression technique developed a variety of candidate models to choose from due to multiple transformations and model structures considered. The resulting models had advantages such as better goodness-of-fit statistics, reasonable bounds to outputs, and smooth behavior. The major disadvantages of the technique are model complexity, difficulty to interpret, and overfitting. The Nash-Sutcliffe efficiencies of the models ranged from 0.61 to 0.88, and they adequately captured the upstream boundary, tributary, and stormwater concentrations. The results suggest symbolic regression can have significant applications in the areas of hydrologic, hydrodynamic, and water quality modeling. PMID:25630124

  19. Measurement of turbulent flow upstream and downstream of a circular pipe bend

    SciTech Connect

    Sakakibara, Jun; Machida, Nobuteru [Department of Engineering Mechanics and Energy, University of Tsukuba, Tsukuba 305-8573 (Japan)

    2012-04-15

    We measured velocity distribution in cross sections of a fully developed turbulent pipe flow upstream and downstream of a 90 degree sign bend by synchronizing two sets of a particle image velocimetry (PIV) system. Unsteady undulation of Dean vortices formed downstream from the bend was characterized by the azimuthal position of the stagnation point found on the inner and outer sides of the bend. Linear stochastic estimation was applied to capture the upstream flow field conditioned by the azimuthal location of the stagnation point downstream from the bend. When the inner-side stagnation point stayed below (above) the symmetry plane, the conditional streamwise velocity upstream from the bend exhibited high-speed streaks extended in a quasi-streamwise direction on the outer side of the curvature above (below) the symmetry plane.

  20. Ions upstream of the earth's bow shock - A theoretical comparison of alternative source populations

    NASA Technical Reports Server (NTRS)

    Schwartz, S. J.; Thomsen, M. F.; Gosling, J. T.

    1983-01-01

    The trajectories of ions reflected or leaked upstream from the earth's bow shock and subject solely to the Lorentz force in a steady interplanetary magnetic field B and the V x B electric field are studied theoretically. Expressions are obtained for the guiding center motion and gyromotion in a frame (the Hoffman-Teller frame) moving parallel to the shock surface with sufficient speed to transform the incident solar wind velocity into motion entirely along the interplanetary magnetic field. Equations are derived which transform these motions back to the observer's frame. The predicted upstream motions for four different source models for upstream ions are compared using these expressions: magnetic moment-conserving reflection of solar wind ions, specular reflection of solar wind ions, magnetic moment-conserving leakage of magnetosheath ions, and leakage of magnetosheath ions parallel to the shock normal.

  1. Effect of a curved duct upstream on performance of small centrifugal compressors for automobile turbochargers

    NASA Astrophysics Data System (ADS)

    Kikuchi, Shigeta; Yamasaki, Nobuhiko; Yamagata, Akihiro

    2013-02-01

    Since the automobile turbochargers are installed in an engine compartment with limited space, the ducts upstream of the turbocharger compressor may be curved in a complex manner. In the present paper, the effect of a curved duct upstream on performance of small centrifugal compressors for automobile turbochargers is discussed. The computational fluid dynamics (CFD) analysis of a turbocharger compressor validated for the compressor model with the straight pipe applied to the compressor with the curved pipe are executed, and the deterioration of the performance for the curved pipe is confirmed. It is also found that the deterioration of compressor performance is caused by the interaction of the secondary flow and the impeller.

  2. Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

    NASA Technical Reports Server (NTRS)

    Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

    2012-01-01

    The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

  3. Sound generation and upstream influence due to instability waves interacting with non-uniform mean flows

    NASA Technical Reports Server (NTRS)

    Goldstein, M. E.

    1984-01-01

    Attention is given to the sound produced by artificially excited, spatially growing instability waves on subsonic shear layers. Real flows that always diverge in the downstream direction allow sound to be produced by the interaction of the instability waves with the resulting streamwise variations of the flow. The upstream influence, or feedback, can interact with the splitter plate lip to produce a downstream-propagating instability wave that may under certain conditions be the same instability wave that originally generated the upstream influence. The present treatment is restricted to very low Mach number flows, so that compressibility effects can only become important over large distances.

  4. The role of upstream lakes in determining downstream severe lake-effect snowstorms

    NASA Astrophysics Data System (ADS)

    Rose, Bruce L., Jr.

    2001-06-01

    A severe lake-effect snowstorm on 25-26 December 1993 was successfully modeled using the Penn State/NCAR MM5 model at 7 km grid resolution. Another simulation performed with Lake Michigan removed from the domain resulted in a two-thirds reduction in snowfall maxima, reduced vertical ascent (50% smaller maxima), and cloud depth (50-100 mb in vertical depth) upwind and over Lake Erie. The downstream snowband shifted northward and eastward as a consequence of stronger background flow and weaker shoreline convergence in the removed case. An idealized model of two-lake interaction was devised using an alternative set of MM5 preprocesses, allowing the definition of simple boundary conditions subject to a single thermal profile applied across the domain. Fixed background winds, temperature, and humidity were then allowed to interact with a surface boundary composed of flat land and elliptical lakes. In the absence of orography and synoptic-scale transients, model responses could be attributed directly to mesoscale forcing via the thermal and frictional disparity between land and water. Results showed that multi-lake interaction did occur once heat and moisture advected from the upstream to downstream lakes (12-18 hours under 10 m s-1 background flow). When background conditions known to produce strong lake-effect snowband development are imposed, the heat and moisture plume from the upstream lake warmed the CIBL between the two lakes by 4- 6°C, and elevated cloud liquid water by amounts exceeding 0.20 g kg-1. The dynamical adjustment resulting from the upstream surface-forcing lowered pressure by 1.5-2.0 mb downwind of the upstream lake; produced a mesoscale low pressure with flow reversal along the northern one-third of the upstream lake; and accelerated flow downwind of the lower one- third of this lake. Removal of turbulent heat fluxes from the upstream lake demonstrated that sensible heating is directly responsible for the establishment and maintenance of the upstream local pressure perturbation through dynamic adjustment or thermal troughing. Suppression of moisture availability or latent heat flux from the upstream lake greatly reduces precipitation amounts and areal extents over the downstream lake, much more so than removal of both latent and sensible heat fluxes, or removal of the lake itself.

  5. Comment on - 'Upstream energetic ions under radial IMF - A critical test of the Fermi model'

    NASA Technical Reports Server (NTRS)

    Fuselier, Stephen A.

    1989-01-01

    A criticism is offered by Fusilier of the conclusion by Sarris and Krimigis (SK, 1988) that the failure to observe energetic ions continuously under near radial interplanetary magnetic field conditions contradicts a fundamental prediction of the Fermi mechanism for the origin of the upstream ions. It is argued that both events reported by SK fall short of critical tests of the Fermi mechanism because the magnetic turbulence required by the Fermi process is not guaranteed to be present. Sarris replies that the ad hoc limit on the local angle between the magnetic field and the shock normal imposed by Fusilier is not a relevant consideration to upstream ion activity.

  6. Bacterial toxin RelE mediates frequent codon-independent mRNA cleavage from the 5' end of coding regions in vivo.

    PubMed

    Hurley, Jennifer M; Cruz, Jonathan W; Ouyang, Ming; Woychik, Nancy A

    2011-04-29

    The enzymatic activity of the RelE bacterial toxin component of the Escherichia coli RelBE toxin-antitoxin system has been extensively studied in vitro and to a lesser extent in vivo. These earlier reports revealed that 1) RelE alone does not exhibit mRNA cleavage activity, 2) RelE mediates mRNA cleavage through its association with the ribosome, 3) RelE-mediated mRNA cleavage occurs at the ribosomal A site and, 4) Cleavage of mRNA by RelE exhibits high codon specificity. More specifically, RelE exhibits a preference for the stop codons UAG and UGA and sense codons CAG and UCG in vitro. In this study, we used a comprehensive primer extension approach to map the frequency and codon specificity of RelE cleavage activity in vivo. We found extensive cleavage at the beginning of the coding region of five transcripts, ompA, lpp, ompF, rpsA, and tufA. We then mapped RelE cleavage sites across one short transcript (lpp) and two long transcripts (ompF and ompA). RelE cut all of these transcripts frequently and efficiently within the first ?100 codons, only occasionally cut beyond this point, and rarely cut at sites in proximity to the 3' end. Among 196 RelE sites in these five transcripts, there was no preference for CAG or UCG sense codons. In fact, bioinformatic analysis of the RelE cleavage sites failed to identify any sequence preferences. These results suggest a model of RelE function distinct from those proposed previously, because RelE directed frequent codon-independent mRNA cleavage coincident with the commencement of translation elongation. PMID:21324908

  7. Research Start-up Request Form Please use this form for all start-up requests.

    E-print Network

    Thomas, Andrew

    Research Start-up Request Form Please use this form for all start-up requests. All requests must: Department: College: Date of Offer: Start Date: Year 1 Year 2 Year 3 Fiscal Year: Equipment: Amount of Start-up of Start-up Provided by Dept. or College Year 1 Year 2 Year 3 Amount: Planned Use: EVP/Provost Signature

  8. 30 CFR 57.10010 - Starting precautions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 2011-07-01 false Starting precautions. 57.10010 Section 57.10010...SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES...Aerial Tramways § 57.10010 Starting precautions. Where possible, aerial...

  9. 30 CFR 57.10010 - Starting precautions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 2012-07-01 false Starting precautions. 57.10010 Section 57.10010...SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES...Aerial Tramways § 57.10010 Starting precautions. Where possible, aerial...

  10. 30 CFR 57.10010 - Starting precautions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 2014-07-01 false Starting precautions. 57.10010 Section 57.10010...SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES...Aerial Tramways § 57.10010 Starting precautions. Where possible, aerial...

  11. 30 CFR 57.10010 - Starting precautions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 2010-07-01 false Starting precautions. 57.10010 Section 57.10010...SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES...Aerial Tramways § 57.10010 Starting precautions. Where possible, aerial...

  12. 30 CFR 57.10010 - Starting precautions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 2013-07-01 false Starting precautions. 57.10010 Section 57.10010...SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES...Aerial Tramways § 57.10010 Starting precautions. Where possible, aerial...

  13. Northwestern Investigator's Guide to Starting a Company

    E-print Network

    ? ......................................................................... 6 For-profit or non-profit1 Northwestern Investigator's Guide to Starting a Company acknowledgment to the University of Georgia for permission to use material from "Start

  14. Transfer RNA structural change is a key element in the reassignment of the CUG codon in Candida albicans.

    PubMed Central

    Santos, M A; Perreau, V M; Tuite, M F

    1996-01-01

    The human pathogenic yeast Candida albicans and a number of other Candida species translate the standard leucine CUG codon as serine. This is the latest addition to an increasing number of alterations to the standard genetic code which invalidate the theory that the code is frozen and universal. The unexpected finding that some organisms evolved alternative genetic codes raises two important questions: how have these alternative codes evolved and what evolutionary advantages could they create to allow for their selection? To address these questions in the context of serine CUG translation in C.albicans, we have searched for unique structural features in seryl-tRNA(CAG), which translates the leucine CUG codon as serine, and attempted to reconstruct the early stages of this genetic code switch in the closely related yeast species Saccharomyces cerevisiae. We show that a purine at position 33 (G33) in the C.albicans Ser-tRNA(CAG) anticodon loop, which replaces a conserved pyrimidine found in all other tRNAs, is a key structural element in the reassignment of the CUG codon from leucine to serine in that it decreases the decoding efficiency of the tRNA, thereby allowing cells to survive low level serine CUG translation. Expression of this tRNA in S.cerevisiae induces the stress response which allows cells to acquire thermotolerance. We argue that acquisition of thermotolerance may represent a positive selection for this genetic code change by allowing yeasts to adapt to sudden changes in environmental conditions and therefore colonize new ecological niches. Images PMID:8890179

  15. Role of p53 codon 72 polymorphism in chromosomal aberrations and mitotic index in patients with chronic hepatitis B

    PubMed Central

    Akba?, H.; Yalcin, K.; Isi, H.; Tekes, S.; Atay, A.E.; Akkus, Z.; Budak, T.

    2012-01-01

    Polymorphisms of the p53 gene, which participates in DNA repair, can affect the functioning of the p53 protein. The Arg and Pro variants in p53 codon 72 were shown to have different regulation properties of p53-dependent DNA repair target genes that can affect various levels of cytogenetic aberrations in chronic hepatitis B patients. The present study aimed to examine the frequency of chromosomal aberrations and the mitotic index in patients with chronic hepatitis B and their possible association with p53 gene exon 4 codon 72 Arg72Pro (Ex4+119 G>C; rs1042522) polymorphism. Fifty-eight patients with chronic hepatitis B and 30 healthy individuals were genotyped in terms of the p53 gene codon 72 Arg72Pro polymorphism by PCR-RFLP. A 72-h cell culture was performed on the same individuals and evaluated in terms of chromosomal aberrations and mitotic index. A high frequency of chromosomal aberrations and low mitotic index were detected in the patient group compared to the control group. A higher frequency of chromosomal aberrations was detected in both the patient and the control groups with a homozygous proline genotype (13 patients, 3 control subjects) compared to patients and controls with other genotypes [Arg/Pro (38 patients, 20 control subjects) and Arg/Arg (7 patients, 7 control subjects)]. We observed an increased frequency of cytogenetic aberrations in patients with chronic hepatitis B. In addition, a higher frequency of cytogenetic aberrations was observed in p53 variants having the homozygous proline genotype compared to variants having other genotypes both in patients and healthy individuals. PMID:22892830

  16. ModelOMatic: fast and automated model selection between RY, nucleotide, amino acid, and codon substitution models.

    PubMed

    Whelan, Simon; Allen, James E; Blackburne, Benjamin P; Talavera, David

    2015-01-01

    Molecular phylogenetics is a powerful tool for inferring both the process and pattern of evolution from genomic sequence data. Statistical approaches, such as maximum likelihood and Bayesian inference, are now established as the preferred methods of inference. The choice of models that a researcher uses for inference is of critical importance, and there are established methods for model selection conditioned on a particular type of data, such as nucleotides, amino acids, or codons. A major limitation of existing model selection approaches is that they can only compare models acting upon a single type of data. Here, we extend model selection to allow comparisons between models describing different types of data by introducing the idea of adapter functions, which project aggregated models onto the originally observed sequence data. These projections are implemented in the program ModelOMatic and used to perform model selection on 3722 families from the PANDIT database, 68 genes from an arthropod phylogenomic data set, and 248 genes from a vertebrate phylogenomic data set. For the PANDIT and arthropod data, we find that amino acid models are selected for the overwhelming majority of alignments; with progressively smaller numbers of alignments selecting codon and nucleotide models, and no families selecting RY-based models. In contrast, nearly all alignments from the vertebrate data set select codon-based models. The sequence divergence, the number of sequences, and the degree of selection acting upon the protein sequences may contribute to explaining this variation in model selection. Our ModelOMatic program is fast, with most families from PANDIT taking fewer than 150 s to complete, and should therefore be easily incorporated into existing phylogenetic pipelines. ModelOMatic is available at https://code.google.com/p/modelomatic/. PMID:25209223

  17. Engine management during NTRE start up

    NASA Astrophysics Data System (ADS)

    Bulman, Mel; Saltzman, Dave

    The topics are presented in viewgraph form and include the following: total engine system management critical to successful nuclear thermal rocket engine (NTRE) start up; NERVA type engine start windows; reactor power control; heterogeneous reactor cooling; propellant feed system dynamics; integrated NTRE start sequence; moderator cooling loop and efficient NTRE starting; analytical simulation and low risk engine development; accurate simulation through dynamic coupling of physical processes; and integrated NTRE and mission performance.

  18. Introduction of translation stop codons into the viral glycoprotein gene in a fish DNA vaccine eliminates induction of protective immunity

    USGS Publications Warehouse

    Garver, K.A.; Conway, C.M.; Kurath, G.

    2006-01-01

    A highly efficacious DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was mutated to introduce two stop codons to prevent glycoprotein translation while maintaining the plasmid DNA integrity and RNA transcription ability. The mutated plasmid vaccine, denoted pIHNw-G2stop, when injected intramuscularly into fish at high doses, lacked detectable glycoprotein expression in the injection site muscle, and did not provide protection against lethal virus challenge 7 days post-vaccination. These results suggest that the G-protein itself is required to stimulate the early protective antiviral response observed after vaccination with the nonmutated parental DNA vaccine. ?? Springer Science+Business Media, Inc. 2006.

  19. Head Start--Hopes and Disappointments.

    ERIC Educational Resources Information Center

    Hymes, James L., Jr.

    1985-01-01

    James L. Hymes, Jr., former President of NAEYC and member of the original Head Start Planning Committee, is interviewed about his hopes for and disappointments with Head Start during the past 20 years. Highlights Head Start's initial benefits to families, children, and the early childhood profession; program quality; and continued lack of federal…

  20. JumpStart III Final Report.

    ERIC Educational Resources Information Center

    Cohen, Arthur M.; Brawer, Florence B.; Kozeracki, Carol A.

    This final report for the JumpStart III program presents a summary of the entrepreneurship training programs developed by each of the four JumpStart III partners selected in March 1997. Grants for the colleges totaled $354,546 over 2 years. The Jumpstart funding has been only a starting point for these and the other 12 Jumpstart partners in…

  1. 76 FR 14841 - Head Start Program

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-18

    ...investigation, GAO followed up on received allegations...involving two Head Start grantees, including...2) of the Head Start Act. Up to 10 percent of the...the lack of clear up-to-date rules...regulations exposes the Head Start and Early Head...

  2. Head Start of North Dakota. [Videotape].

    ERIC Educational Resources Information Center

    Kingsley, Kranzler

    The Head Start program is a comprehensive child development program designed to increase the social competence of children in low-income families and children with disabilities and to improve their chances of school success. This 9-minute videotape describes the Head Start and Early Head Start programs in North Dakota. The tape features parents…

  3. Simultaneous identification of 36 mutations in KRAS codons 61and 146, BRAF, NRAS, and PIK3CA in a single reaction by multiplex assay kit

    PubMed Central

    2013-01-01

    Background Retrospective analyses in the West suggest that mutations in KRAS codons 61 and 146, BRAF, NRAS, and PIK3CA are negative predictive factors for cetuximab treatment in colorectal cancer patients. We developed a novel multiplex kit detecting 36 mutations in KRAS codons 61 and 146, BRAF, NRAS, and PIK3CA using Luminex (xMAP) assay in a single reaction. Methods Tumor samples and clinical data from Asian colorectal cancer patients treated with cetuximab were collected. We investigated KRAS, BRAF, NRAS, and PIK3CA mutations using both the multiplex kit and direct sequencing methods, and evaluated the concordance between the 2 methods. Objective response, progression-free survival (PFS), and overall survival (OS) were also evaluated according to mutational status. Results In total, 82 of 83 samples (78 surgically resected specimens and 5 biopsy specimens) were analyzed using both methods. All multiplex assays were performed using 50 ng of template DNA. The concordance rate between the methods was 100%. Overall, 49 (59.8%) patients had all wild-type tumors, 21 (25.6%) had tumors harboring KRAS codon 12 or 13 mutations, and 12 (14.6%) had tumors harboring KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA mutations. The response rates in these patient groups were 38.8%, 4.8%, and 0%, respectively. Median PFS in these groups was 6.1 months (95% confidence interval (CI): 3.1–9.2), 2.7 months (1.2–4.2), and 1.6 months (1.5–1.7); median OS was 13.8 months (9.2–18.4), 8.2 months (5.7–10.7), and 6.3 months (1.3–11.3), respectively. Statistically significant differences in both PFS and OS were found between patients with all wild-type tumors and those with KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA mutations (PFS: 95% CI, 0.11–0.44; P?codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA detected in Asian patients were not predictive of clinical benefits from cetuximab treatment, similar to the result obtained in European studies. PMID:24006859

  4. Upstream movement of residual hatchery steelhead into areas containing bull trout and cutthroat trout.

    SciTech Connect

    McMichael, Geoffrey A. (BATTELLE (PACIFIC NW LAB)); Pearsons, Todd N. (WASH FISH& WILDLIFE DEPT)

    2000-11-01

    Hatchery-reared steelhead Oncorhynchus mykiss that do not emigrate as smolts shortly after release may negatively impact wild fish communities through ecological interactions. We used systematic, stratified snorkeling surveys to document the relative abundance of wild rainbow trout O. mykiss, bull trout Salvelinus confluentus, and westslope cutthroat trout O. clarki lewisi as well as the upstream limit of residual hatchery steelhead (hatchery-reared steelhead that had failed to emigrate before June 1). Our objective was to determine whether residual hatchery steelhead had migrated upstream from their release point into an area containing a threatened population of bull trout and cutthroat trout. Hatchery steelhead made up a larger portion of the salmonid community in the sites near their release location (mean= 52.5%, range= 29-79%), and constituted a lower proportion (mean= 4.8%, range= 0-14%) of the salmonid community as distance upstream of the release location increased. However, residual hatchery steelhead had migrated over 12 km upstream into an area containing a threatened stock of bull trout and westslope cutthroat trout O. clarki lewisi.

  5. Floods, Habitat Hydraulics and Upstream Migration of Neritina virginea (Gastropoda: Neritidae) in Northeastern Puerto Rico

    E-print Network

    Floods, Habitat Hydraulics and Upstream Migration of Neritina virginea (Gastropoda: Neritidae a detailed study of snail density, size, and hydraulic descriptors in lower Río Mameyes, northeastern Puerto and size dynamics differed between reaches as a function of habitat hydraulics. While juveniles used

  6. Forage Fish Assemblages in the Brazos River Upstream and Downstream from Possum Kingdom Reservoir, Texas

    Microsoft Academic Search

    K. A. Anderson; T. L. Beitinger; E. G. Zimmerman

    1983-01-01

    The forage fish assemblage of the Brazos River was sampled at one location above and four locations below Possum Kingdom Reservoir each month for one year. A total of 13,936 individuals representing 18 species, 14 genera and five families were collected. Five of these species, Notropis stramineus, Notropis atherinoides, Hybognathus placitus, Hybopsis aestivalis and Cyprinodon rubrofluviatilis were found only upstream

  7. Simulating Upstream Solar Wind Conditions at Mercury: Results From two Independent Solar Wind Models

    Microsoft Academic Search

    B. Zieger; K. C. Hansen; O. Cohen; T. I. Gombosi; T. H. Zurbuchen; B. J. Anderson; H. Korth

    2009-01-01

    The knowledge of upstream solar wind conditions at Mercury is essential not only for modeling the Hermian magnetosphere-exosphere-surface system but also for interpreting the pioneering in situ observations made by MESSENGER during the January and October 2008 flybys. For this reason, and due to the fact that the MESSENGER plasma instruments cannot see the solar wind, we intend to provide

  8. Upstream Solar Wind Conditions at Mercury During the First two MESSENGER Flybys

    Microsoft Academic Search

    B. Zieger; K. C. Hansen; O. Cohen; T. I. Gombosi; T. H. Zurbuchen

    2008-01-01

    The knowledge of upstream solar wind conditions at Mercury is essential not only for modeling the Hermian magnetosphere-exosphere-surface system but also for interpreting the pioneering in situ observations made by MESSENGER during the January and October 2008 flybys. For this reason, and due to the fact that the MESSENGER plasma instruments cannot see the solar wind, we intend to provide

  9. Observations of low-frequency electromagnetic plasma waves upstream from the Martian shock

    E-print Network

    California at Berkeley, University of

    Observations of low-frequency electromagnetic plasma waves upstream from the Martian shock D. A. Brain,1 F. Bagenal,1 M. H. Acun~a,2 J. E. P. Connerney,2 D. H. Crider,2 C. Mazelle,3 D. L. Mitchell,4 2002. [1] We have analyzed magnetic field data returned from Mars Global Surveyor (MGS) for signatures

  10. Disturbances from shock/boundary-layer interactions affecting upstream hypersonic flow

    NASA Astrophysics Data System (ADS)

    Skoch, Craig Ryan

    Large disturbances and decreased Mach number in the core flow were sometimes found in the downstream end of the nozzle of the Boeing/AFOSR Mach-6 Ludwieg Tube at Purdue University. The cause of the disturbances has been identified using Kulite pressure transducer, hot wire, and hot film measurements of the flow in the tunnel. These disturbances were found to be separations caused by shock/boundary-layer interactions in the diffuser, often originating from shocks generated at the sting support. Some disturbances were found to propagate upstream about 100 boundary layer thicknesses. The large upstream effect is due to the laminar boundary layers being very susceptible to separation. Attempts to prevent the separations from propagating upstream included an improved sting mount, compression rings in the diffuser to thin the boundary layer, and trip rings, in the nozzle and diffuser, to trip the boundary layer. These attempts were not successful in eliminating the separation in the nozzle. A diffuser section with an increased area is proposed to prevent the separations from propagating upstream.

  11. Effects of Upstream Turbulence on Measurement Uncertainty of Flow Rate by Venturi

    NASA Astrophysics Data System (ADS)

    Lee, Jungho; Yoon, Seok Ho; Yu, Cheong-Hwan; Park, Sang-Jin; Chung, Chang-Hwan

    2010-06-01

    Venturi has been widely used for measuring flow rate in a variety of engineering applications since pressure loss is relatively small compared with other measuring method. The current study focuses on making detailed estimation of measured uncertainties as the upstream turbulence affects uncertainty levels of the water flows in the closed-loop testing. Upstream turbulences can be controlled by selecting 9 different swirl generators. Measurement uncertainty of flow rate has been estimated by a quantitative uncertainty analysis which is based on the ANSI/ASME PTC 19.1-2005 standard. The best way to reduce error in measuring flow rate was investigated for evaluating its measurement uncertainty. The results of flow rate uncertainty analysis show that the case with systematic error has higher than that without systematic error. Especially the result with systematic error exhibits that the uncertainty of flow rate was gradually increased by upstream turbulence. Uncertainty of flow rate measurement can be mainly affected by differential pressure and discharge coefficient. Flow disturbance can be also reduced by increasing of the upstream straight length of Venturi.

  12. Upstream urbanization exacerbates urban heat island effects Da-Lin Zhang,1

    E-print Network

    Zhang, Da-Lin

    Upstream urbanization exacerbates urban heat island effects Da-Lin Zhang,1 Yi-Xuan Shou,1; published 19 December 2009. [1] Urban Heat Island (UHI) effects adversely impact weather, air quality urbanization exacerbates urban heat island effects, Geophys. Res. Lett., 36, L24401, doi:10.1029/2009GL041082

  13. Observations of two distinct populations of bow shock ions in the upstream solar wind

    Microsoft Academic Search

    J. T. Gosling; J. R. Asbridge; S. J. Bame; G. Paschmann; N. Sckopke

    1978-01-01

    Observations upstream of the earth's bow shock with the LASL\\/MPI fast plasma experiments on ISEE 1 and 2 reveal the presence of two distinct and mutually exclusive populations of low energy (< or approx. =40keV) ions apparently accelerated at the bow shock. The first of these, the ''reflected'' population, is characterized by 1) sharply peaked spectra seldom extending much above

  14. Behavior of solar wind energy flux near density holes upstream of the bow shock

    Microsoft Academic Search

    G. K. Parks; E. Lee; R. de Guiran; N. Lin; F. Mozer; M. Wilber; B. Kearney; I. Dandouras; H. Reme; M. Goldstein

    2007-01-01

    We present new observations of density holes upstream of Earth's bow shock. Density holes are regions of density depletions below the solar wind level with scale length of an ion gyroradius. They represent the smallest nonlinear ion structures produced by the solar wind. The edges of density holes have strong currents and as the holes propagate earthward the magnetic field

  15. Hydrochemical and isotopic characteristics of groundwater in the Souss Upstream Basin, southwestern Morocco

    Microsoft Academic Search

    K. Dindane; L. Bouchaou; Y. Hsissou; M. Krimissa

    2003-01-01

    Heterogeneous shallow Plio-Quaternary formations of the Souss Plain represent the most important aquifer in southern High Atlas Mountains in Morocco. The present work was conducted in the Souss Upstream Basin to identify the chemical characteristics and the origin of groundwater in an aquifer under semi-arid climate. Isotopic and hydrochemical compositions combined with geological and hydrogeological data were used for this

  16. ORIGINAL PAPER Water temperature and upstream migration of glass eels in

    E-print Network

    Waikato, University of

    ORIGINAL PAPER Water temperature and upstream migration of glass eels in New Zealand: implications / Published online: 26 January 2007 Ó Springer Science+Business Media B.V. 2007 Abstract Glass eels migrating that warmer temperatures associ- ated with global climate change might have a detrimental impact on glass eel

  17. Numerical Evaluation of the Energy for Upstream Opportunistic Large Array-based Transmissions

    E-print Network

    Ingram, Mary Ann

    . Recently, the OLA concentric routing algorithm with limited flooding and transmission threshold (OLACRA-FT) was proposed for energy efficient upstream routing in wireless sensor networks that use an OLA-based physical angular width. I. INTRODUCTION Ad Hoc Wireless Sensor Networks (WSNs) are those in which simple

  18. NonE x B ordered ion beams upstream of the earth's bow shock

    Microsoft Academic Search

    C. Gurgiolo; G. K. Parks; B. H. Mauk; C. S. Lin; K. A. Anderson; R. P. Lin; H. Reme

    1981-01-01

    The unexpected appearance of spin modulations in our fixed voltage electrostatic analyzer detectors on ISEE 1 and 2 has given us the oppurtunity to investigate the plasma properties of the upstream ions in high time resolution. The detectors are narrowly collimated and point southward, antiparallel to the satellite spin axis covering a region in phase space not viewed by the

  19. CALIBRATION OF A 90 DEGREE V-NOTCH WEIR USING PARAMETERS OTHER THAN UPSTREAM HEAD

    EPA Science Inventory

    Traditional calibration of 90 degrees V-Notch Weirs has involved the establishment of a head-discharge relationship where the head is measured upstream of weir drawdown effects. This parameter is often difficult to mesure in field weir installations. Two other parameters are prop...

  20. Nonuniform upstream airfoil spacing effects on rotor blade noise generation and forced response

    Microsoft Academic Search

    John R. Fagan; Sanford Fleeter

    1988-01-01

    A mathematical model is developed to investigate the influence of altering the harmonic content of the inlet flow field to a rotor blade row on noise generation and forced response. This is effected by periodic nonuniform circumnferential spacing of the airfoils in the upstream row. The beneficial effects of such spacing are demonstrated by applying this model to a modern