These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Stochastic Models for Epidemics Valerie Isham  

E-print Network

Stochastic Models for Epidemics Valerie Isham Department of Statistical Science University College London valerie@stats.ucl.ac.uk December 2004 1 Introduction Early in 1987, the AIDS epidemic was still, based in part on the workshop, and thus began my involvement with epidemic modelling. It has proved

Guillas, Serge

2

Iraq's Oil Tomorrow Valerie Marcel, Senior Research Fellow  

E-print Network

Iraq's Oil Tomorrow April 2003 By Valerie Marcel, Senior Research Fellow John V. Mitchell the prior permission of the copyright holder. #12;Iraq's Oil Tomorrow 2 Introduction Public perceptions that the American-led military campaign against Iraq is fuelled by oil are widespread in Europe and in the Middle

O'Donnell, Tom

3

Mixed-mode oscillations in chemical systems Valery Petrov  

E-print Network

Mixed-mode oscillations in chemical systems Valery Petrov Department of Chemistry, West Virginia three-variable model for complex oscillations in an isothermal chemical system, P-A, (0) P+C-+A+C, cc> A to reveal the origin of mixed-mode oscillations. The initial oscillatory solution is born at a supercritical

Showalter, Kenneth

4

Transmission Costs, Selfish Nodes, and Protocol Design Peter Marbach and Ran Pang  

E-print Network

Transmission Costs, Selfish Nodes, and Protocol Design Peter Marbach and Ran Pang Department of Computer Science University of Toronto Abstract-- We study the influence of transmission costs on the behavior of selfish nodes in wireless local area networks. Intu- itively, it seems that transmission costs

Marbach, Peter

5

PANG AND SCHULTHEISSASSESSING IMPLICIT MOTIVES Assessing Implicit Motives in U.S. College Students  

E-print Network

with questionnaire measures of impulsivity and anxiety (Behavioral Inhibition System­Behavioral Activation System, the nonconscious motivational needs that orient, select, and energize behavior (McClelland, 1987). Researchers havePANG AND SCHULTHEISSASSESSING IMPLICIT MOTIVES ARTICLES Assessing Implicit Motives in U.S. College

Schultheiss, Oliver C.

6

Oxidation of Carbon Nanotubes by Singlet O2 Siu-Pang Chan,1  

E-print Network

recent theoretical studies on the chemisorption of singlet O2 on the walls of carbon nano- tubes, with an activation barrier as low as 0.61 eV for the (8, 0) tube. Our results raise the possibility that carbonOxidation of Carbon Nanotubes by Singlet O2 Siu-Pang Chan,1 Gang Chen,1,2 X. G. Gong,3,1,2 and Zhi

Gong, Xingao

7

STS-84 Post Landing - Valery Ryumin greets wife Elena Kondakova  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FL - Veteran cosmonaut Valery Ryumin greets his wife, STS-84 Mission Specialist Elena V. Kondakova, with some flowers after the Space Shuttle orbiter Atlantis lands on KSC's Runway 33. STS-84 was the sixth docking of the Space Shuttle with the Russian Space Station Mir. The nine-day STS-84 mission was Kondakova's second space flight, but her first on the Space Shuttle. She spent 169 days in space as flight engineer of the 17th main mission on Mir from October 1994 to March 1995. Her husband is now director of the Mir-Shuttle program for Russia.

1997-01-01

8

Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132  

E-print Network

Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132 adjustments. The amount of computation involved is usually considerable, and recycling provides a less computer intensive alternative. Recycling consists of using repeatedly the same samples drawn from

9

Academic Affairs Subject Files, 19331967 (bulk 19591967) Inventory by Valerie Gillispie, 10 February 2009  

E-print Network

, 19581961 Faculty Club Faculty Compensation Faculty Benefits FacultyStaff Housing Tuition GrantsAcademic Affairs Subject Files, 19331967 (bulk 19591967) #1000170 Inventory by Valerie Gillispie, 10 February 2009 BOX 1 Administrative Offices (nothing) Academic Affairs o Science Development

Devoto, Stephen H.

10

A Robust Panel Extraction Method for Manga Xufang Pang, Ying Cao, Rynson W.H. Lau, and Antoni B. Chan  

E-print Network

A Robust Panel Extraction Method for Manga Xufang Pang, Ying Cao, Rynson W.H. Lau, and Antoni B.com, {rynson.lau,abchan}@cityu.edu.hk ABSTRACT Automatically extracting frames/panels from digital comic pages, au- tomatic panel extraction for manga, i.e., Japanese comics, can be especially challenging, largely

Lau, W. H. Nynson

11

Tiled convolutional neural networks Quoc V. Le, Jiquan Ngiam, Zhenghao Chen, Daniel Chia, Pang Wei Koh, Andrew Y. Ng  

E-print Network

Tiled convolutional neural networks Quoc V. Le, Jiquan Ngiam, Zhenghao Chen, Daniel Chia, Pang Wei,jngiam,zhenghao,danchia,pangwei,ang}@cs.stanford.edu Abstract Convolutional neural networks (CNNs) have been successfully applied to many tasks such as digit propose tiled convolution neural networks (Tiled CNNs), which use a regular "tiled" pattern of tied

Ng, Andrew Y.

12

Is "rich-get-richer" valid for Indian Ocean and Atlantic ITCZ? Pang-chi Hsu1  

E-print Network

Is "rich-get-richer" valid for Indian Ocean and Atlantic ITCZ? Pang-chi Hsu1 and Tim Li1 Received-mean perspective. However, this "rich-get-richer" mechanism is not valid on a basin scale. In this study, on a basin scale, the wet does not always get wetter. Citation: Hsu, P., and T. Li (2012), Is "rich-get-richer

Li, Tim

13

Learning to Think Like Scientists with the PET Curriculum Valerie K. Otero and Kara E. Gray  

E-print Network

Learning to Think Like Scientists with the PET Curriculum Valerie K. Otero and Kara E. Gray and Everyday Thinking (PET) curriculum has specific goals for helping non-science majors explicitly reflect on the nature of science and the nature of science learning. We show that in PET courses with small and large

Colorado at Boulder, University of

14

Control Challenges of Fuel Cell-Driven Distributed Valery Knyazkin, Lennart Soder Claudio Canizares  

E-print Network

1 Control Challenges of Fuel Cell-Driven Distributed Generation Valery Knyazkin, Lennart S of a Solid Oxide Fuel Cell power plant is obtained and utilized for the design of robust controllers which robust controllers are synthesized applying the H mixed-sensitivity optimization and their performance

Cañizares, Claudio A.

15

Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132  

E-print Network

Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132. The amount of computation involved is usually considerable, and recycling provides a less computer intensive alternative. Recycling consists of using repeatedly the same samples drawn from a recycling distribution G

16

Slow waves in fractures filled with viscous fluid Valeri Korneev1  

E-print Network

Slow waves in fractures filled with viscous fluid Valeri Korneev1 ABSTRACT Stoneley guided waves in a fluid-filled fracture generally have larger amplitudes than other waves; therefore, their properties need to be incorporated into more realistic models. A fracture is modeled as an infinite layer

Korneev, Valeri A.

17

Vibroseis Monitoring of San Andreas Fault in California Valeri Korneev and Robert Nadeau  

E-print Network

Vibroseis Monitoring of San Andreas Fault in California Valeri Korneev and Robert Nadeau Lawrence collected as part of a controlled source Vibroseis experiment San Andreas Fault (SAF) at Parkfield to a complex stress or strain field at the boundary between creeping and locked zones of the San Andreas Fault

Korneev, Valeri A.

18

UNIVERSITE PAUL VALERY -MONTPELLIER III Arts et Lettres, Langues et Sciences Humaines et Sociales  

E-print Network

identity Occitan culture immaterial cultural heritage regional natural park local development rural ECOLE DOCTORALE LLCC ­ LANGUES, LITTERATURES, CULTURES, CIVILISATIONS DOCTORAT DE L'UNIVERSITE PAUL VALERY ­ MONTPELLIER III Discipline : Etudes Occitanes THIBAL Suzanne Développement local et Culture

Paris-Sud XI, Université de

19

Learning Physics by Listening To Children Danielle B. Harlow and Valerie K. Otero  

E-print Network

Learning Physics by Listening To Children Danielle B. Harlow and Valerie K. Otero University [1]. However, many researchers in teacher education agree that learning to listen to and analyze of these terms may make learning to listen to and interpret children's ideas about science difficult. Children

Colorado at Boulder, University of

20

Calibration For Augmented Reality Experimental Testbeds Valerie A. Summers*& Kellogg S. Booth Tom Calvert  

E-print Network

Calibration For Augmented Reality Experimental Testbeds Valerie A. Summers*& Kellogg S. Booth Tom.3.7[ComputerGraphics]: Three-Dimensional GraphicsandRealism-virtual reality Keywords: augmentedreality "augment" theuser's view of thereal 3D world with computer-generatedvirtual objects. Thesevirtual

21

Talking to Learn Physics and Learning to Talk Physics Danielle B. Harlow & Valerie K. Otero  

E-print Network

Research, Curricula, Teaching Methods, General Physics, Discourse PACS: 01.40.-d, 01.40.fk, 01.40, 01.55.+bTalking to Learn Physics and Learning to Talk Physics Danielle B. Harlow & Valerie K. Otero in physics differently than they are used in everyday speech. Thus, physics learners must develop conceptual

Colorado at Boulder, University of

22

Mining Interesting Contrast Rules for a Web-based Educational System Behrouz Minaei-Bidgoli, Pang-Ning Tan, and William F. Punch  

E-print Network

Mining Interesting Contrast Rules for a Web-based Educational System Behrouz Minaei-Bidgoli, Pang data, data mining and knowledge discovery techniques can be applied to find interesting relationships at Michigan State University called LON-CAPA. Keywords Data mining, association analysis, rule interestingness

23

Slow Wave in Fluid-Filled Fractures: What is Missing in Biot's Theory? Valeri Korneev, (vakorneev@lbl.gov), Lawrence Berkeley National Laboratory Berkeley, CA 94720  

E-print Network

Slow Wave in Fluid-Filled Fractures: What is Missing in Biot's Theory? Valeri Korneev, (vakorneev in a self-similar distribution of fractures in rocks, an explanation supported by the wide changes in permeability suggest the predominant role of fractures in fluid-flow processes at field scales

Santos, Juan

24

Tube-wave Effects in Cross-Well Seismic Data at Stratton Field Valeri Korneev, Lawrence Berkeley National Laboratory, Jorge Parra, South-West Research Institute,  

E-print Network

Tube-wave Effects in Cross-Well Seismic Data at Stratton Field Valeri Korneev, Lawrence Berkeley The analysis of crosswell seismic data for a gas reservoir in Texas revealed two newly detected seismic wave identified, from top to bottom, as the V2, V5, and V12 shale zones, and were recognizable in all the wells

Korneev, Valeri A.

25

Electro-Mechanical Control of Hexapod Robot Ezequiel del Rio, Valeri A. Makarov, Manuel G. Velarde, Manuel G. Bedia, and Werner Ebeling,  

E-print Network

1 Electro-Mechanical Control of Hexapod Robot Locomotion Ezequiel del Rio, Valeri A. Makarov is proposed as a central pattern generator (CPG) for controlling hexapodal robots. We show that the ring hexapod gaits. We provide an electronic circuit implementation of the CPG providing the corresponding

Ebeling, Werner

26

Fully Polarimetric Ground Penetrating Radar WISDOM Dirk Plettemeier (1), Valerie Ciarletti (2), Philippe Cais (3), Wolf-Stefan Benedix (1), ChristophStatz (1), Stephen Clifford  

E-print Network

Fully Polarimetric Ground Penetrating Radar WISDOM Dirk Plettemeier (1), Valerie Ciarletti (2) Forsvaretforskningsinstitutt, Kjeller, Norway (dirk.plettemeier@tu-dresden.de) Abstract The Ground Penetrating Radar (GPR for evidence of past and present life on Mars. The WISDOM radar will provide a penetration depth of about 3

Paris-Sud XI, Université de

27

Quantitative study of amplitude noise effects on dynamical localization Daniel A. Steck, Valery Milner, Windell H. Oskay, and Mark G. Raizen  

E-print Network

Quantitative study of amplitude noise effects on dynamical localization Daniel A. Steck, Valery. As we introduce amplitude noise, the coherences that lead to local­ ization are destroyed, resulting. This system exhibits dynamical localization, where quantum effects suppress classical momentum diffusion

Texas at Austin. University of

28

Mei-Fong, PANG 1 MEI-FONG PANG  

E-print Network

, 2012 Swedish Society for Medical Research (SSMF) travel grant, 2012 The Erik and Edith Fernström) and (2003/04 session) PUBLICATIONS (PEER REVIEWED) *Co-first authorship ORIGINAL ARTICLES 1. Joel Johansson

Nelson, Celeste M.

29

Introduction to Computer Graphics Instructor: Alex Pang (pang@cats)  

E-print Network

(30%), homeworks (5%), attendance/participation (5%), 2 exams (20% each) and final project (20%). You. Additional points may also be earned for extra features. #12; There will be no make­up exams, homeworks including homeworks, programs and exams are intended as individual effort and are graded as such. It's okay

Pang, Alex

30

Purdue extension Valerie A. Mock  

E-print Network

Cyst Nematode Management With a Guide for Identifying Known Weed Hosts Winter Annual Weeds and Soybean Council. #12;Winter Annual Weeds and Soybean Cyst Nematode Management With a Guide for Identifying Known Weed Hosts A Destructive Duo On their own, winter annual weeds and soybean cyst nematode (SCN) can

31

Scalable Leader Election Valerie King  

E-print Network

are bad (or corrupt), and (1-b)n of which are good, for some fixed b. Our goal is to design an algorithm, University of New Mexico, Albuquerque, NM 87131-1386; email: {saia,vishal}@cs.unm.edu. This research

Saia, Jared

32

VALERIE L. WONG University of California, Berkeley  

E-print Network

, MA Bachelor of Arts Degree. Biological Chemistry major. Undergraduate of Oceanography. Examined the effects of salinity and nutrient concentration on carotenoid Department. Investigated plant responses to stress and their correlation with changes

Bruns, Tom

33

Valerie A. Olson University of California, Irvine  

E-print Network

." Journal of Nursing Administration 34.7-8 (2004): 326-337. Hodge et al.. "Licensed Caregiver Characteristics and Staffing in California Acute Care Hospital Units." Journal of Nursing Administration 34 Quality to Evaluate Nurse Staffing Ratios." Journal of Nursing Administration 32.6 (2002): 338-45. #12

Loudon, Catherine

34

Jamie Snyder Valerie DeMean  

E-print Network

decades ago. Initially, a council was formed to study quality problems of U.S. businesses. In 1983 of the most striking dissimilarities between U.S. products and those of Japanese competition, the group of 175 corporate executives, business leaders, and academicians released a final report suggesting

Vardeman, Stephen B.

35

Short communication Valerie A. Pferdeort1  

E-print Network

intermediate (TCE epoxide) is gener- ated [3, 4]. Metabolic engineering involves genetic manip- ulations, and cloning an additional enzyme to react with and protect the cell from toxic intermediates. However than those introduced in the genetic manipulation [7]. Thus, proteomic analyses of metabolically

Wood, Thomas K.

36

Tryst: The Case for Confidential Service Discovery Jeffrey Pang  

E-print Network

that suggests the release of this infor- mation in wireless environments poses a real danger to our privacy. We them to everyone nearby since they are sent before security associations are established. To date ) because network names can be correlated with online databases to show where users have been and what

Wetherall, David

37

Accelerometer for Mobile Robot Positioning Hugh Liu, Grantham Pang  

E-print Network

distance-measuring device for mobile robot or platform. An interesting description of inertial sensors accelerometer is described in this paper. The sensor is intended for positioning of a mobile robot or platform. Acceleration signal outputted by the sensor is doubly integrated with time which yields the traveled distance

Pang, Grantham

38

An EVT primer for credit risk Valerie Chavez-Demoulin  

E-print Network

is going through the worst economic crisis since the Great Depression of the 1930s. It is definitely, regulatory guidelines or political decisions currently put forward will be the panacea ready to cure all

Embrechts, Paul

39

Scalable Service Discovery for MANET Francoise Sailhan, Valerie Issarny  

E-print Network

Scalable Service Discovery for MANET Franc¸oise Sailhan, Val´erie Issarny INRIA.Issarny@inria.fr Abstract Mobile Ad hoc NETworks (MANETs) conveniently com- plement infrastructure-based networks, allowing networks, either infrastructure-based or ad hoc. However, distributed ser- vice provisioning over MANETs

Paris-Sud XI, Université de

40

Welcome to Wayne Valerie M. Parisi, MD, MPH, MBA  

E-print Network

interim Vice Dean Research TBD Executive Vice Dean Academic and Student Programs Robert R. Frank Vice Dean Research Daniel Walz Assistant Dean Clinical & Translational Research Michael Diamond Assistant Dean Graduate Medical Education Wilhelmine Wiese #12;Fiscal Year Budget 2009 Total All Funds Budget $496 MILLION

Finley Jr., Russell L.

41

Dlivr par UNIVERSITE PAUL-VALERY MONTPELLIER 3  

E-print Network

and women throughout the last century. Key words : China ; gender ; Chinese literature ; female literature féminine ; condition des femmes Gender and Women's Condition to the Test of Twentieth Century : A look at Chinese Female Literature (1919-2000) In Dynastic China, women were often confined in domestic space

Paris-Sud XI, Université de

42

Measurements and Analysis of Process Variability in 90nm CMOS Borivoje Nikoli , Liang-Teck Pang  

E-print Network

, and are more immune to defocusing of the optical system [12]. Optical proximity correction techniques and systematic components, with a varying degree of spatial correlation. A test chip has been built to study-Induced Variations Present lithography systems employ step-and-scan method, where the stepping is used to move

Nikolic, Borivoje

43

HIGH FREQUENCY MICROMECHANICAL PIEZO ACTUATED DISK RESONATOR , Wei Pang*, Jian Wu  

E-print Network

-gap remains inevitable for electrostatic transduction. A piezoelectric thin film micromechanical beam, eliminated the need for high-temperature deposition of structural and sacrificial thin films. The highest processing temperature was the ZnO sputtering at 250ºC, which offers the opportunity for post

Tang, William C

44

Finding Spatio-Temporal Patterns in Earth Science Data * Pang-Ning Tan+  

E-print Network

normal seasonal variation such as anomalous climate events (e.g., El Nino) or trends (e.g., global patterns involving events derived from the multi-year output of CASA, and other climate variables. Mining

Kumar, Vipin

45

MCMC-Based Tracking and Identification of Leaders in Groups Avishy Y. Carmi, Lyudmila Mihaylova, Francois Septier, Sze Kim Pang,  

E-print Network

for identifying and track- ing dominant agents in groups. Our proposed approach relies on a causality detection patterns (see [20]). 1.1. Reasoning About Behavioural Traits Being the underlying driving mechanism

Mihaylova, Lyudmila

46

Energy book: a look at the death throes of one energy era and the birth pangs of another  

Microsoft Academic Search

Many commentators believe that by the year 2000 fossil fuels will be gone and Americans will freeze to death - in the dark. But this essentially optimistic book puts the problems and the possibilities into clearer perspective. Written by Massachusetts Audubon Society scientists and editors and other concerned environmentalists, this book first presents the history of energy from wood through

W. Hanley; J. Mitchell

1980-01-01

47

Optofluidic devices and applications in photonics, sensing and imaging{ Lin Pang,* H. Matthew Chen, Lindsay M. Freeman and Yeshaiahu Fainman*  

E-print Network

, Lindsay M. Freeman and Yeshaiahu Fainman* Received 30th April 2012, Accepted 31st May 2012 DOI: 10.1039/c2 adopted only after successes in the area of microfluidics with extensive efforts by optical

Fainman, Yeshaiahu

48

VALERIE BURKE DELEON, PH.D. Johns Hopkins University School of Medicine  

E-print Network

University of Florida, Gainesville, FL M.A. (1998), Anthropology Thesis: "Stable Isotope Analysis-1996). Organized new laboratory and prepared archaeological specimens for stable isotope analysis. Field Crew

49

Valerie M. Parisi, MD, MPH, MBA Began in 1868 as the Detroit College of Medicine  

E-print Network

Biology · Immunology and Microbiology · Medical Physics · Molecular and Cellular Toxicology · Molecular of Public Health · Genetic Counseling · Radiologic Physics · Psychiatry · Biomedical Sciences · Medical medical schools in the US · 3rd highest medical student enrollment · 1st largest single-campus medical

Finley Jr., Russell L.

50

Dynamic Adaptation of Broad Phase Collision Detection Algorithms Quentin Avril Valerie Gouranton Bruno Arnaldi  

E-print Network

animation, robotics, physical or mechanical sim- ulations (medical, cars industry, civil engineering--Parallel processing; I.3.5 [Computer Graphics]: Computational Geometry and Object Modeling--Physically based modeling

Paris-Sud XI, Université de

51

Synchronization-Free Parallel Collision Detection Pipeline Quentin Avril Valerie Gouranton Bruno Arnaldi  

E-print Network

in several fields including computer animation, robotics, physical simulations (medical, cars industry, civil Modeling--Physically based modeling 1 INTRODUCTION Collision detection is a large research field in charge

Paris-Sud XI, Université de

52

A review of "The Renaissance of Lesbianism in Early Modern England." by Valerie Traub  

E-print Network

in general with the stigma of immorality and irrationality formerly reserved for the tribade. This stigmatization ?provide[d] the condition of possibility for modern erotic identities? to emerge during the eighteenth century (20). Traub describes her project...), Chapter 2 argues that female erotic plea- sure was considered ?a central component of reproductive, marital chastity? in the period (78). Yet male anatomists and writers of obscene poems such as Thomas Nashe also recognized that the REVIEWS 319 clitoris...

Mario Digangi

2003-01-01

53

An Examination of Children's Scientific Argumentation Danielle B. Harlow and Valerie K. Otero  

E-print Network

here, third grade (eight-years-old) children discuss what they believe is happening inside of argumentation among these eight-year-old children is proposed and described in this discussion. Introduction

Colorado at Boulder, University of

54

Debt Contracts and the Need for Mandatory Accounting Changes Hans B. Christensen and Valeri V. Nikolaev  

E-print Network

in place are contingent on accounting data (Watts and Zimmerman 1978, 1986, Leftwich 1981, Holthausen changes in GAAP on contract efficiency is heavily debated in the accounting literature (Watts 2006

55

Visualization of Environmental Data Generated by Wireless Sensor Networks Valerie Szudziejka  

E-print Network

, preservation of avian species, and determination of structural integrity of build- ings. The Smart Dust project coin and may cost up to $100 each; however, a prototype the size of an aspirin and one-tenth the cost

Hamann, Bernd

56

Scar selection in an optical fibre Valerie Doya, Olivier Legrand, Claire Michel and Fabrice Mortessagne  

E-print Network

for this work has been designed and fabricated in our lab. The transverse cross section of the fiber is a truncated disk fabricated from a 1-cm- diameter preform of silica that has been cut at half its radiusScar selection in an optical fibre Val´erie Doya, Olivier Legrand, Claire Michel and Fabrice

Paris-Sud XI, Université de

57

UNIVERSIT MONTPELLIER III PAUL VALERY cole doctorale n 60 : Territoires, Temps, Socits et Dveloppement  

E-print Network

practice ; therefore making us utter the hypothesis of a psychosomatic logic underlying the symptom clinical aspects, leads us to establish a link between the spelling disorder symptom and the psychosomatic

Paris-Sud XI, Université de

58

Introduction: Hydrogen isotopes as environmental recorders Valery J. Terwilligera,b,c,d  

E-print Network

of soil water into plants-- during transpiration in the leaves where much of photosynthesis will take is the hydrogen fractionations that occur between precipitation and the water that is used in photosynthesis between the hydrogen of water used in photosynthesis and that of a biochemical of interest (Kennedy

Paris-Sud XI, Université de

59

A Type System for Certified Binaries ZHONG SHAO and VALERY TRIFONOV  

E-print Network

that generate certified code have focused on simple memory and control-flow safety rather than more advanced.saha@intel.com; N. Papaspyrou, National Technical University of Athens, Department of Electrical and Com- puter@softlab.ntua.gr. Permission to make digital or hard copies of part or all of this work for personal or classroom use

Trifonov, Valery

60

A Type System for Certified Binaries ZHONG SHAO and VALERY TRIFONOV  

E-print Network

that generate certified code have focused on simple memory and control-flow safety rather than more advanced.saha@intel.com; Nikolaos Papaspyrou, National Technical University of Athens, Depart- ment of Electrical and Computer@softlab.ntua.gr. Permission to make digital/hard copy of all or part of this material without fee for personal or classroom

61

NCI-CCR Pediatric Oncology Branch - Pediatric Psycho-Oncology Professionals Profile Listings - Valerie Crabtree  

Cancer.gov

Skip to Main Content CCR Home | About CCR | CCR Intranet Main Navigation Home Profiles Research Newsworthy References Special Interest Groups Training Main Links Psycho-Oncology Home Profiles Research Publications Newsworthy/Resources References Special

62

Faster Agreement via a Spectral Method for Detecting Malicious Valerie King  

E-print Network

of a constant fraction of processors which it may choose to corrupt adaptively. In 1983, Ben-Or proposed to repeatedly try to generate a fair global coin. The corrupted pro- cessors can bias this global coin@uvic.ca. Department of Computer Science, University of New Mexico. This research was partially supported by NSF CAREER

Saia, Jared

63

Towards Secure and Scalable Computation in Peer-to-Peer Networks Valerie King  

E-print Network

that all uncorrupted processors come to an agreement on a bit initially held by one of the un- corrupted polylogarithmic in n. (We assume no limit on the number of messages sent by corrupted proces- sors.) With high@cs.uvic.ca. This research was supported by NSERC. Department of Computer Science, University of New Mexico, Albu- querque

Saia, Jared

64

UNIVERSITE MONTPELLIER III PAUL VALERY Arts et Lettres, Langues et Sciences Humaines et Sociales  

E-print Network

. le Professeur Henry BAKIS Membres du Jury : M. le Professeur Henry BAKIS ­ Université de Montpellier la direction de M. le Professeur Henry BAKIS Membres du Jury : M. le Professeur Henry BAKIS Houari et Patrick pour leurs compétences techniques, à Christian, Isabelle et Carine pour leur relecture

Paris-Sud XI, Université de

65

VISIONING WESTON NURSERIES Team 1: Valerie Gingrich, Helen Lee, Taylor Mammen, Adam Marcus  

E-print Network

agricultural activity by creating open spaces. There are no significant wildlife habitats and few recognized vernal pools on-site. However, there are opportunities to create some green/wildlife, and there is little tree cover in the interior. There is potential to create connections between Hopkinton and Ashland

Ishii, Hiroshi

66

Issue N 20 / February 2010 Editor : Valrie Devanthry, valerie.devanthery@idiap.ch  

E-print Network

meeting environment. The Human Media Interaction group of the University of Twente has developed a User they are connected with. From extensive analyses of face to face and remote meetings it is clear how important non-verbal social behavior is in communicating who is being addressed and who is expected to take turn. One

Nijholt, Anton

67

AdHocFS: Sharing Files in WLANs Malika Boulkenafed, Valerie Issarny  

E-print Network

the provision of protocols for the management of conflict detection and resolution. Optimistic replication has collaborative sharing of files among the group's members. In addition, ad hoc group management is realized so to the underlying scheme of update propagation. This is even more true in the case of collaborative work where

Paris-Sud XI, Université de

68

FRACTAL TILES ASSOCIATED WITH SHIFT RADIX SYSTEMS VALERIE BERTHE, ANNE SIEGEL, WOLFGANG STEINER, PAUL SURER,  

E-print Network

FRACTAL TILES ASSOCIATED WITH SHIFT RADIX SYSTEMS VAL´ERIE BERTH´E, ANNE SIEGEL, WOLFGANG STEINER to fractal shapes, such as the classical Rauzy fractal and the twin dragon. These fractals turned out a collection of fractal tiles with shift radix systems. We show that for certain classes of parameters r

Paris-Sud XI, Université de

69

Coverage statistics for sequence census methods Steven N. Evans, Valerie Hower and Lior Pachter  

E-print Network

when mapping by fingerprinting random clones, the Lander-Waterman model has served as an essential tool designed to assess the content of a mixture of molecules via the creation of DNA fragments whose abundances can be used to infer those of the original molecules. The DNA fragments are identified by sequencing

Evans, Steven N.

70

The Dark Side of the Web: An Open Proxy's View Vivek S. Pai, Limin Wang, KyoungSoo Park, Ruoming Pang, and Larry Peterson  

E-print Network

The Dark Side of the Web: An Open Proxy's View Vivek S. Pai, Limin Wang, KyoungSoo Park, Ruoming with other resources on the Web. While such interaction can easily attract clients and traffic, our expe, deployed on PlanetLab, uses a network of caching Web proxy servers to intelligently dis- tribute and cache

Pai, Vivek

71

Adhesion of Sputtered Nickel Films on Polycarbonate Xueqiang Qian, Xiaolu Pang, Kewei Gao, Huisheng Yang, Jie Jin, and Alex A. Volinsky  

E-print Network

is also discussed in this paper. Keywords adhesion, nickel films, plasma treatment, sputtering, surface on critical load, thus the surface energy of polycarbonate substrate after plasma treatment was measured using

Volinsky, Alex A.

72

Brillouin light scattering analysis of three-magnon splitting processes in yttrium iron garnet films Christoph Mathieu,* Valeri T. Synogatch,  

E-print Network

surface wave MSSW pulse signals in a long and narrow yttrium iron garnet film strip through three magnon that the launch and propagation of a relatively wide high-power magnetostatic surface wave MSSW pulse in a thin. The frequencies and k values match those predicted from the dispersion relations and energy and momentum

Patton, Carl

73

Sustainability criteria for bioenergy systems: results from an expert survey Thomas Buchholz*, Valerie A. Luzadis, Timothy A. Volk  

E-print Network

Sustainability criteria for bioenergy systems: results from an expert survey Thomas Buchholz in revised form 10 April 2009 Accepted 24 April 2009 Available online 9 May 2009 Keywords: Bioenergy and concerns about regional and national security are driving the development and use of biomass for bioenergy

Vermont, University of

74

Can we predict who will benefit from computer-based phonetic training? Valerie Hazan, Yoon Hyun Kim  

E-print Network

phonetic contrast (Korean lenis-aspirated contrast) or to the degree of learning following computer participants on a novel phonetic contrast (the Korean lenis-aspirated voicing contrast) to which they had other languages, none had studied Korean or another language with lenis/aspirated stop contrasts. 2

Fujimoto, Hiroshi

75

Prediction of Vertical Motions for Landing Operations of UAVs Xilin Yang, Hemanshu Pota, Matt Garratt and Valery Ugrinovskii  

E-print Network

excellent prediction perfor- mance, making it suitable for integration into ship-helicopter approaches and emergent crew rescue in danger. In our project, which aims at safe landing of an autonomous helicopter are with the School of Information Technology and Electrical Engineering, Univer- sity of New South Wales, Canberra

Pota, Himanshu Roy

76

JIMAR PFRP ANNUAL REPORT FOR FY 2006 P.I. Names: Valerie Allain, Robert Olson, Felipe Galvn-Magaa, and Brian Popp.  

E-print Network

. This project proposes to test this hypothesis by combining diet analysis, stable isotopic analyses, and food in stable isotope analysis of the zooplankton sampl trips by students in Manta, Ecuador (all supervised by F. Galván). 2.2 Stable isotope and mercury

Hawai'i at Manoa, University of

77

Results of the Nematode Variety Test at AG-CARES, Lamesa, TX 2003. Terry A. Wheeler, John R. Gannaway, Lyndon Schoenhals, Anna Hall, and Valerie Morgan,  

E-print Network

TITLE: Results of the Nematode Variety Test at AG-CARES, Lamesa, TX 2003. AUTHORS: Terry A. Wheeler, Senior Research Associate, Research Associate, Technician MATERIALS AND METHODS: Test: Nematode of lint/acre, but it was ranked only 13th of 28 entries in terms of lowest root-knot nematode reproduction

Mukhtar, Saqib

78

Michel MOREL (DCNS SIS), Pierre GLIZE (IRIT), Anne LITTAYE (ECOMER), Valerie BAZIN (ONERA), Aldo NAPOLI (ECOLE NATIONALE DES MINES DE PARIS) & Bernard ALHADEF  

E-print Network

functions that improve the effectiveness of a global surveillance of the contraveners. They will contribute, terrorism, and trafficking of drugs, weapons and illicit substances. Indeed, maritime traffic is peculiarly well suited to the development of illicit activities. For example, illegal migrant prefer maritime

Paris-Sud XI, Université de

79

Michel MOREL (DCNS), Pierre GLIZE (IRIT), Anne LITTAYE (ECOMER), Valerie BAZIN (ONERA), Aldo NAPOLI (ECOLE NATIONALE DES MINES DE PARIS) & Bernard ALHADEF  

E-print Network

functions that improve the effectiveness of a global surveillance of the contraveners. They will contribute, terrorism, and trafficking of drugs, weapons and illicit substances. Indeed, maritime traffic is peculiarly well suited to the development of illicit activities. For example, illegal migrant prefer maritime

Paris-Sud XI, Université de

80

Utility and limitations of GPS-Interferometric Reflectometry in vegetation sensing Clara C. Chewa, Eric E. Smallb, Kristine M. Larsonc, Valery U. Zavorotnyd  

E-print Network

(phase and amplitude of SNR oscillations, and effective reflector height limiting its ability to also measure vegetation. Effective reflector height on ecology, ensuring future food security, and in the implementation of variable

Larson, Kristine

81

An interaction abstraction model for seamless avatar exchange in CVET Rozenn BOUVILLE, Thomas LOPEZ, Florian NOUVIALE, Valerie GOURANTON and Bruno ARNALDI  

E-print Network

An interaction abstraction model for seamless avatar exchange in CVET Rozenn BOUVILLE, Thomas LOPEZ level to pool the management of the main processes useful to control an avatar, interact with the environment and gather knowledge from a CVET. Besides, the Shell allows seamless exchange of avatars dur- ing

Paris-Sud XI, Université de

82

QUA ART QUA SCIENCE Uitgave in het kader van  

E-print Network

kunstenares Valerie Zwart en de Nederlandse wetenschapper Onno Bokhove. Zij delen niet alleen elkaars leven periode waarin ook Valerie Zwart be- trokken werd in de inmiddels diepe vriendschap met Howell. Tijdens onderzoek en Valerie, die na Peregrine's dood de beschikking kreeg over duizenden dia's en foto's, in haar

Al Hanbali, Ahmad

83

Target Audience: Health care professionals  

E-print Network

(palliative care, chronic ill- ness), child welfare, and do- mestic violence. Valerie is an AssistantTarget Audience: Health care professionals Workshop Facilitator: Valerie Spironello, MSW, RSW Valerie has been a social worker for over 20 years working in a variety of settings including health care

Haykin, Simon

84

Computing Wrench Cones for Planar Contact Tasks Devin J. Balkcom  

E-print Network

Institute Pittsburgh, PA 15213. devin@ri.cmu.edu J.C. Trinkle and E.J. Gottlieb Sandia National theoretical results in rigid body mechanics [9, 11] and complementarity the- ory [2]. In Pang and Trinkle [9 wrench. Apart from Pang and Trinkle [9], the work most simi- lar to that presented here is probably Mason

Trinkle, Jeff

85

ConstraintDirected Backtracking Algorithm for ConstraintSatisfaction Problems  

E-print Network

. Goodwin Technical Report CS­96­05 May 1996 c flWanlin Pang and Scott D. Goodwin Department of Computer; Constraint­Directed Backtracking Algorithm for Constraint­Satisfaction Problems Wanlin Pang Scott D. Goodwin@cs.uregina.ca goodwin@cs.uregina.ca Abstract We propose a new backtracking method called constraint

Regina, University of

86

Adapting the UPPAAL Model of a Distributed Lift System  

E-print Network

Adapting the UPPAAL Model of a Distributed Lift System Wan Fokkink1,2 , Allard Kakebeen, and Jun.pang@informatik.uni-oldenburg.de Abstract. Groote, Pang and Wouters (2001) analyzed an existing dis- tributed lift system using the process the synchronization mechanism between lifts, to explain a new problem that was reported by the developers of the lift

Fokkink, Wan

87

NEW SOLAR HOMES PARTNERSHIP COMMITTEEFINALGUIDEBOOK  

E-print Network

Johnson Manager Renewable Energy Office Valerie Hall Deputy Director Efficiency, Renewables and Demand. New Housing Development and Multi-Family Development............................... 18 1. Initial

88

Der Rolle der Grndervter in der Zitationskultur der Individualpsychologie am Beispiel Alfred Adlers und Sigmund Freuds.  

E-print Network

??Die vorliegende Diplomarbeit befasst sich mit Qualittsmerkmalen wissenschaftlicher Artikel und baut auf einer kritischen Auseinandersetzung mit dem Impact-Factor wobei Diplomarbeit Valerie Bammer: Die Rolle der (more)

Bammer, Valerie

2012-01-01

89

3/7/14 Chemistryof Materials: Most Read Articles (ACS Publications) pubs.acs.org/action/showMostReadArticles?journalCode=cmatex&topArticlesType=month 1/8  

E-print Network

: An Alternative Organolead Iodide Perovskite Sensitizer for Mesoscopic Solar Cells Shuping Pang, Hao Hu, Jiliang, and Mass Spectroscopy and Other Related Properties Efficient and Facile Synthesis of Gold Nanorods

Rubloff, Gary W.

90

a Newtonian liquid surface Matthew Thrasher, Sunghwan Jung,  

E-print Network

into a mineral oil. 1 1 Thrasher, S. Y. Pang, C.­P. Chuu, Swinney, bouncing Newtonian liquid rebounding surface viscosity, velocity, radius, bath velocity. This ex­ periment easily done home pouring mineral

Texas at Austin. University of

91

ENGINEERING AND ECONOMIC APPLICATIONS OF COMPLEMENTARITY PROBLEMS  

E-print Network

ENGINEERING AND ECONOMIC APPLICATIONS OF COMPLEMENTARITY PROBLEMS M. C. FERRIS AND J. S. PANG SIAM problems, variational inequalities, frictional contact, structural engineering, economic equilibria, the subject of complementarity problems, with its diverse applications in engineering, economics, and sciences

Ferris, Michael C.

92

148 SDSU General Catalog 2014-2015 OFFICE: Arts and Letters 473  

E-print Network

Literature, Geography, History, Japanese, Journalism and Media Studies, Linguistics and Asian/ Middle Eastern. Hansen (Japanese), W. Hansen (Religious Studies), Higurashi (Japanese), Hua (Women's Studies), Kitajima (Japanese), Li (Social Work), Pang (Teacher Education), Riley (Anthropology), Samraj (Linguistics

Gallo, Linda C.

93

SDSU General Catalog 2013-2014 149 Asian Studies  

E-print Network

, Economics, English and Comparative Literature, Geography, History, Japanese, Journalism and Media Studies (Women's Studies), Guang (Political Science), K. Hansen (Japanese), W. Hansen (Religious Studies), Higurashi (Japanese), Hua (Women's Studies), Kitajima (Japanese), Li (Social Work), Pang (Teacher Education

Gallo, Linda C.

94

SDSU General Catalog 2011-2012 149 Asian Studies  

E-print Network

History, Chinese, Economics, English and Comparative Literature, Geography, History, Japanese, Journalism (Women's Studies), Guang (Political Science), Hansen (Religious Studies), Higurashi (Japanese), Hua (Women's Studies), Kitajima (Japanese), Li (Social Work), Pang (Teacher Education), Riley (Anthropology

Gallo, Linda C.

95

SDSU General Catalog 2012-2013 149 Asian Studies  

E-print Network

History, Chinese, Economics, English and Comparative Literature, Geography, History, Japanese, Journalism (Women's Studies), Guang (Political Science), Hansen (Religious Studies), Higurashi (Japanese), Hua (Women's Studies), Kitajima (Japanese), Li (Social Work), Pang (Teacher Education), Riley (Anthropology

Gallo, Linda C.

96

Proceedings of 2008 NSF CMMI Engineering Research and Innovation Conference, Knoxville, Tennessee Grant # 0601167 Domain-Specific Ontology Mapping by Corpus-Based Semantic Similarity  

E-print Network

comparison. Preliminary results are obtained using ontologies from the architectural, engineeringProceedings of 2008 NSF CMMI Engineering Research and Innovation Conference, Knoxville, Tennessee Grant # 0601167 Domain-Specific Ontology Mapping by Corpus-Based Semantic Similarity Chin Pang Cheng

Stanford University

97

Hydrodenitrogenation of quinoline in a trickle bed reactor over improved zeolite based catalyst  

E-print Network

HYDRODENITROGENATION OF QUINOLINE IN A TRICKLE BED REACTOR OVER INPROVED ZEOLITE BASED CATALYST A Thesis MAN PANG KWAN Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE December 1983 Major Subject: Chemical Engineering HYDRODENITROGENATION OF QUINOLINE IN A TRICKLE BED REACTOR OVER IMPROVED ZEOLITE BASED CATALYST A Thesis by WAN PANG KWAN Approved as to style and content by: Aydin Akgerman...

Kwan, Wan Pang

2012-06-07

98

Author s note: Marie F. Smith, CRA;Valerie T. Eviner, PhD; Kathie Weathers, PhD; Maria Uriarte, PhD; Holly Ewing, PhD; Jonathan M. Jeschke, PhD; Peter Groffman, PhD; Clive G. Jones, PhD; Institute of Ecosystem Studies, 65 Sharon Turnpike (PO  

E-print Network

Uriarte, PhD; Holly Ewing, PhD; Jonathan M. Jeschke, PhD; Peter Groffman, PhD; Clive G. Jones, Ph. Eviner, PhD Kathie C. Weathers, PhD Maria Uriarte, PhD Holly A. Ewing, PhD Jonathan M. Jeschke, PhD Peter

Berkowitz, Alan R.

99

Graph Theory, Matrix Theory and Interactions A conference to celebrate the scholarship of David Gregory  

E-print Network

[ILAS Lecturer] Chris Godsil Willem Haemers Steven Kirkland Ram Murty Stewart Neufeld Bryan Shader Naomi Shaked-Monderer Claude Tardif Kevin Vander Meulen Valerie Watts David Wehlau Organizing Committee Sebastian Cioaba Bryan Shader Ram Murty

Abolmaesumi, Purang

100

ISBNISBNISBNISBN 1 9780313032141 Culture and customs of Taiwan {Culture and customs of Asia ; 1097-0738 Davison, Gary Marvin.  

E-print Network

9780313082252 Bullying: A Handbook for Educators and Parents By Ian Rivers, Neil Duncan, and Valerie E. Besag to School in East Asia Edited by Gerard A. Postiglione and Jason Tan Greenwood 2007 18 9780313012884 Beyond

Wu, Yih-Min

101

Vol. 10, No. 1 These proud graduaTes of The school of informaTics  

E-print Network

Susan (Fleet) Beckett, BS'67 Stefan Berg, BS'94 Londa R. (Bechert) Bick, BS'76 Valerie (Scott) Bierlein'04 James A. Holder, MS'78 Paul A. Horan, BS'84 Matthew P. Hottell, MS'03 Ann E. (Furness) Howard, BS

Zhou, Yaoqi

102

Google Earth Blog: Great collection of resources for the Fukushima power plant  

NSDL National Science Digital Library

This Google Earth blog entry features a single network link from Valery Hronusov devoted to the Fukushima power plant. The file is packed with information about the plant -- photo overlays, 3D buildings, photos, videos and more.

Hronusov, Valery; Blog, Google E.

103

International Toys in Space: Jump Rope  

NASA Video Gallery

Cosmonaut Valery Korzun attempts jumping rope in microgravity. He decides to adapt the activity by taking out the "jumping part," but the act of spinning the rope around him still proves difficult....

104

2009 Year in Review The Science of Communication Disorders  

E-print Network

D: valerie.looi@canterbury.ac.nz Cochlear implants, music perception, clinical and research methods Margaret, PGDip in Rehabilitation: christine.wyles@canterbury.ac.nz Aphasia and dementia related communication

Hickman, Mark

105

2010 Year in Review The Science of Communication Disorders  

E-print Network

D: valerie.looi@canterbury.ac.nz Cochlear implants, music perception, clinical and research methods Margaret intervention Christine Wyles MBSLT, PGDip in Rehabilitation: christine.wyles@canterbury.ac.nz Aphasia

Hickman, Mark

106

Direction of biological motion 1 In press, Infancy  

E-print Network

motion in point-light displays Valerie A. Kuhlmeier, Nikolaus F. Troje, and Vivian Lee Department morphological features (e.g., faces, skin, hair) (e.g., Barclay, Cutting, & Kozlowski, 1978; Bertenthal & Pinto

Troje, Nikolaus

107

NEW SOLAR HOMES PARTNERSHIP COMMITTEEDRAFTGUIDEBOOK  

E-print Network

Drake Johnson Manager Renewable Energy Office Valerie Hall Deputy Director Efficiency, Renewables. New Housing Development and Multi-Family Development............................... 15 1. Initial....................................................................................... 19 B. Custom Homes and Small Developments..................

108

NEW SOLAR HOMES PARTNERSHIP DRAFTGUIDEBOOK  

E-print Network

Drake Johnson Manager Renewable Energy Office Valerie Hall Deputy Director Efficiency, Renewables. New Housing Development and Multi-Family Development............................... 12 1. Reservation. Custom Homes and Small Developments .......................................................... 17 1

109

DISTRIBUTED GENERATION AND COGENERATION POLICY  

E-print Network

Rawson and John Sugar Co-Authors John Sugar Manager PUBLIC PROGRAMS OFFICE Valerie T. Hall Deputy to the development of this report by the Energy Commission's Distributed Generation Policy Advisory Team; Melissa...................................................................................................................5 DEVELOPMENT OF THE POLICY ROADMAP

110

J U N E 2 0 1 4 Looking ahead! Stay tuned for these  

E-print Network

-mail Valerie for details! 613-533-2846 ext 74909 admuclub@queensu.ca Patio Thursdays! Enjoy Burgers & Sausages to Sausage - apple & sage sausages, Assorted salads & Strawberry shortcake $11 ­ Members $16 ­ Guests plus

Ellis, Randy

111

ew Orleans is the newest Nof ten Albert Schweitzer  

E-print Network

of children with special health needs through Creative Outlets Promoting Empowerment-- ProjectCOPE. Chancellor to addressing unmet health needs in their local areas. ­ Valerie Fontenot and Tyra Toston, Public Health

112

Quantum Mechanics 1 for graduate students  

E-print Network

Course 606 Quantum Mechanics 1 for graduate students Fall 2010 Instructor Valery Pokrovsky 1 electromagnetic field. Gauge invariance. Landau levels. 7. Semiclassical approximation. 8. Quantum mechanics. Scattering. The main textbook is E. Merzbacher, Quantum Mechanics, third edition, Wiley. Additional

113

76 FR 58277 - Performance Review Board Members  

Federal Register 2010, 2011, 2012, 2013

...Miller, Valerie E. Morgan Alston, Michael J. Nelson, Dawn M. O'Connell, Robert F. Owens Jr., Jennifer L. Parker, Aida M. Perez, Cheri M. Rice, Geoffrey Roth, Roberto Ruiz, Dorinda A. Salcido, Daniel J. Schreiner, William B....

2011-09-20

114

Forests in Flux  

NSDL National Science Digital Library

In this video presentation, Jerry Franklin, Review author Gordon Bonan, and Perspective author Valerie Kapos discuss the importance of understanding the influence of forests on climate and some of the challenges of global forest governance.

Robert Frederick (AAAS;)

2008-06-13

115

The NIH Grant Process: Application, Review & Funding  

E-print Network

& Violence (Valerie Maholmes) · Human-Animal Interaction (Layla Esposito) #12;10 Demographic and Behavioral://ies.ed.gov/ · DHHS Administration For Children and Families http://www.acf.hhs.gov/ · Substance Abuse & Mental Health

Niebur, Ernst

116

Bacterial Acquisition in Juveniles of Several Broadcast Spawning Coral Species  

E-print Network

*� , Kim B. Ritchie2 , Peter J. Schupp3 , Raphael Ritson-Williams1 , Valerie J. Paul1 1 Smithsonian Marine the structure of bacterial assemblages in corals. Citation: Sharp KH, Ritchie KB, Schupp PJ, Ritson-Williams R

Mcilwain, Jenny

117

PowerPoint Presentation  

Cancer.gov

Center for Applied Proteomi cs and Molecular Medicine Co-Directors: Lance Liotta and Chip Petricoin Amy VanMeter, Julia Wulfkuhle, Mark Ross, Valerie Calvert Robyn Araujo, Weidong Zhou, Isela Galla gher, James Cooper, Vikas Chandhoke, Sally Rucker, Sheila

118

International Toys in Space: Kendama  

NASA Video Gallery

Cosmonaut Valery Korzun attempts to capture the ball in a cup using the Japanese Kendama toy. The game must be adapted for the ball to stay in the cup in microgravity. Astronaut Peggy Whitson narra...

119

International Toys in Space: Soccer  

NASA Video Gallery

Cosmonauts Sergi Treschev and cosmonaut Valery Korzun discover they must change the way they play soccer because of the effects of microgravity. They quickly adapt to accommodate for the increased ...

120

Fashion and feminism  

Microsoft Academic Search

Valerie Steele, Fashion and Eroticism: Ideals of Beauty from the Victorian Era to the Jazz Age (Oxford University Press), New York, 1985; Elizabeth, Wilson, Adorned in Dreams: Fashion and Modernity (Virago), London, 1985.

Robyn Cooper

1987-01-01

121

A Recommendation System for Preconditioned Iterative Solvers  

E-print Network

December 2009 Major Subject: Computer Science A RECOMMENDATION SYSTEM FOR PRECONDITIONED ITERATIVE SOLVERS A Dissertation by THOMAS GEORGE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Vivek Sarin Committee Members, Patrick Lynett Valerie Taylor Yoonsuck Choe Head of Department, Valerie Taylor December 2009 Major Subject: Computer Science iii ABSTRACT A Recommendation...

George, Thomas

2011-02-22

122

Translating Evidence-Based Policy to Practice: A Multilevel Partnership Using the Interactive Systems Framework  

E-print Network

, Childrens Bureau. Jacqueline M. counts, PhD, msW, director, Center for Public Partnerships and research, and Rebecca J. Gillam, lmsW, msW, project coordinator, University of Kansas. Linda Baker, msW, director, and valerie Spiva collins, PhD, training...: A Multilevel Partnership using the Interactive Systems Framework melissa lim Brodowski, Jacqueline m. counts, Rebecca J. Gillam, linda Baker, Valerie spiva collins, edi Winkle, Jennifer skala, Kathy stokes, Rosie Gomez, & James Redmon Despite...

Brodowski, Melissa L.; Counts, Jacqueline Marie; Gillam, Rebecca J.; Baker, Linda; Collins, Valerie S.; Winkle, Edi; Skala, Jennifer; Stokes, Kathy; Gomez, Rosie; Redmon, James

2013-01-01

123

VAV System Optimization through Continuous Commissioning in an Office Building  

E-print Network

building. ICEBO, Pittsburgh, PA. Figure 21. Post-CC hot water supply temperature and outside air temperature (January 7~10, 2007) 3. Zheng B, Liu M, and Xiufeng Pang, 2005. Continuous Commissioning of an Office Building. ICEBO, Pittsburgh, PA.... Figure 22 compares electricity consumption over a one-year period before CC and after CC . The electricity consumption savings was 1,328,832 kWh, a reduction of 26.8% in one year. 5. Pang X, Liu M, and Bin Zheng, 2005. Building Pressure Control...

Cho, Y.; Pang, X.; Liu, M.

2007-01-01

124

The genus Aspidimerus Mulsant, 1850 (Coleoptera, Coccinellidae) from China, with descriptions oftwonew species.  

PubMed

Chinese members of the genus Aspidimerus Mulsant, 1850 are reviewed. Ten species are recognized, including two new species: A. zhenkangicus Huo & Ren, sp. n. and A. menglensis Huo & Ren, sp. n. A. kabakovi Hong is recorded from China for the first time. A. blandus (Mader, 1954) is recognized as synonymous with A. ruficrus Gorham, 1895 (syn. n.). Aspidimerus rectangulatus Kuznetsov & Pang, 1991 and A. serratus Kuznetsov & Pang, 1991 are transferred to the genus Pseudaspidimerus Kapur, 1948 (comb. n.). All species from China are described and illustrated. Distribution maps of the Chinese species, a key and a catalogue of all known Aspidimerus are provided. PMID:24294073

Huo, Lizhi; Wang, Xingmin; Chen, Xiaosheng; Ren, Shunxiang

2013-01-01

125

Redescription of Platynaspisflavoguttata (Gorham) (Coleoptera, Coccinellidae) and notes on nomenclature of Platynaspiskapuri Chakraborty & Biswas.  

PubMed

Platynaspisflavoguttata (Gorham) (Coleoptera: Coccinellidae) is redescribed and the male genitalia are illustrated for the first time. It is also recorded from Sri Lanka for the first time. Platynaspisbimaculata (Hoang, 1983) is a new junior synonym of Platynaspisbimaculata Pang & Mao, 1979 (new synonym). Platynaspiskapuri Chakraborty & Biswas, 2000, the replacement name for Platynaspisbimaculata Pang & Mao, 1979 established by Ukrainsky (2007), is also the new replacement name for Platynaspisbimaculata (Hoang, 1983), as both are junior homonyms of Platynaspisbimaculata Weise, 1888 besides being synonyms.Platynaspishoangi Ukrainsky (2007) is an unnecessary replacement name for Platynaspisbimaculata (Hoang). PMID:25057247

Poorani, J

2014-01-01

126

The genus Aspidimerus Mulsant, 1850 (Coleoptera, Coccinellidae) from China, with descriptions oftwonew species  

PubMed Central

Abstract Chinese members of the genus Aspidimerus Mulsant, 1850 are reviewed. Ten species are recognized, including two new species: A. zhenkangicus Huo & Ren, sp. n. and A. menglensis Huo & Ren, sp. n. A. kabakovi Hong is recorded from China for the first time. A. blandus (Mader, 1954) is recognized as synonymous with A. ruficrus Gorham, 1895 (syn. n.). Aspidimerus rectangulatus Kuznetsov & Pang, 1991 and A. serratus Kuznetsov & Pang, 1991 are transferred to the genus Pseudaspidimerus Kapur, 1948 (comb. n.). All species from China are described and illustrated. Distribution maps of the Chinese species, a key and a catalogue of all known Aspidimerus are provided. PMID:24294073

Huo, Lizhi; Wang, Xingmin; Chen, Xiaosheng; Ren, Shunxiang

2013-01-01

127

Redescription of Platynaspis flavoguttata (Gorham) (Coleoptera, Coccinellidae) and notes on nomenclature of Platynaspis kapuri Chakraborty & Biswas  

PubMed Central

Abstract Platynaspis flavoguttata (Gorham) (Coleoptera: Coccinellidae) is redescribed and the male genitalia are illustrated for the first time. It is also recorded from Sri Lanka for the first time. Platynaspis bimaculata (Hoang, 1983) is a new junior synonym of Platynaspis bimaculata Pang & Mao, 1979 (new synonym). Platynaspis kapuri Chakraborty & Biswas, 2000, the replacement name for Platynaspis bimaculata Pang & Mao, 1979 established by Ukrainsky (2007), is also the new replacement name for Platynaspis bimaculata (Hoang, 1983), as both are junior homonyms of Platynaspis bimaculata Weise, 1888 besides being synonyms.Platynaspis hoangi Ukrainsky (2007) is an unnecessary replacement name for Platynaspis bimaculata (Hoang). PMID:25057247

2014-01-01

128

Development of Microplitis bicoloratus on Spodoptera litura and implications for biological control  

E-print Network

from China, is a solitary endoparasitoid of the larvae of the cotton leafworm, Spodoptera litura Introduction The cotton leafworm, Spodoptera litura (Fabricius), is a polyphagous insect pest widely on a large scale as a commercial biological insecticide (Chen et al. 1998; Pang 1998). However, one

Trumble, John T.

129

John E. Mitchell Department of Mathematical Sciences http://www.rpi.edu/~mitchj  

E-print Network

John E. Mitchell Department of Mathematical Sciences http://www.rpi.edu/~mitchj Rensselaer-advised with Jong-Shi Pang. "Recent applications of Nash equilibria". First and current employer: ISO ­ New England. "Power control for multiuser communication systerms and computation of generalized Nash equilibria

Mitchell, John E.

130

Understanding fish behavior during typhoon events in real-life underwater environments  

E-print Network

Understanding fish behavior during typhoon events in real-life underwater environments Concetto · Fang-Pang Lin · Daniela Giordano · Lynda Hardman · Robert B. Fisher Abstract The study of fish inevitably influenced the behavior of the fish under observation. Recent projects involving the installation

Fisher, Bob

131

A Jini-based Computing Portal System Toyotaro Suzumura  

E-print Network

. The web portal could also encounter such problems; the reason for their success is that software object technology. JiPANG performs uniform higher-level management of the computing services and re- sources being managed by individual Grid systems such as Ninf, NetSolve, Globus, etc. In order to give

132

Single-shot depth-section imaging through chromatic slit-scan confocal microscopy  

E-print Network

into two categories: transverse x, y and depth z scanning. The scan- ning technique dictates the speedSingle-shot depth-section imaging through chromatic slit-scan confocal microscopy Paul C. Lin, Pang by incorporating a slit-scan confocal technique into the system. A system using a 100 objective obtained a depth

Fainman, Yeshaiahu

133

The Effect of Globalization on Network's Nodes of Different Structural Characteristic: an Heterogeneous Agent Simulation  

Microsoft Academic Search

Abstract Globalization is much more than an economic phenomenon and has non-economic consequences (Fischer, 2003). Studies on globalization follow two main lines [Li, Pang and Ng (2007)]. While most proglobalization advocates (for example, Feldstein 2000) examine the impact of external or openness factors, anti-globalization advocates ,focus on economic ,sectors that have ,lost out in the ,process of globalization (Wallach and

Massimo Salzano

134

PMMA quantum dots composites fabricated via use of pre-polymerization  

E-print Network

PMMA quantum dots composites fabricated via use of pre-polymerization Lin Pang, Yaoming Shen, Kevin a novel method to produce a PMMA-quantum-dot (QD) composite fabricated by pre-polymerization of PMMA and dispersing commercially available colloidal semiconductor QDs. The QDs are stabilized in rapidly formed

Fainman, Yeshaiahu

135

Crystal Packing Mediates Enantioselective Ligand Recognition at the Peripheral Site of Acetylcholinesterase  

E-print Network

of Acetylcholinesterase Haim Haviv,, Dawn M. Wong,,,§ Harry M. Greenblatt, Paul R. Carlier,| Yuan-Ping Pang, Israel Silman, hupyridone) were shown to exhibit higher acetylcholinesterase (AChE) inhibition than either monomeric 1 or 2-site gorge. Introduction The principal role of the serine-hydrolase acetylcholinesterase (AChE; EC 3

Sussman, Joel L.

136

Origins of Bilateral Symmetry: Hox and Dpp Expression  

E-print Network

that encompasses more than 1.5 million mod- ern-day animal species, including such di- verse forms as humans, fruit Pang,2 Pat Burton,1 Dave Paulson,2 Mark Q. Martindale2 Over 99% of modern animals are members" of the Bilateria, associated with an evolution- ary transition from stationary or drifting planktonic animals

Finnerty, John R.

137

Fast Direct GPS Signal Acquisition Using FPGA Janusz Starzyk*  

E-print Network

the acquisition time. The method was implemented on Xilinx VirtexE FPGA chip and tested on GPS data. 1Fast Direct GPS Signal Acquisition Using FPGA Jing Pang Janusz Starzyk* School of Electrical a novel P-code generator design strategy and direct GPS P-code acquisition technique. This method not only

Starzyk, Janusz A.

138

P-code Generator FPGA Design for Direct GPS P (Y)-Code Acquisition  

E-print Network

prototyping and design. Especially Xilinx Virtex chip DLL feature is appropriate for GPS application since GPSP-code Generator FPGA Design for Direct GPS P (Y)-Code Acquisition Jing Pang 1, Janusz Starzyk 2 1, Athens OH 45701, U. S. A. starzyk@bobcat.ent.ohiou.edu Abstract. Direct GPS P (Y)-code acquisition

Starzyk, Janusz A.

139

A Novel Twist in Membrane dePHormation.  

PubMed

Bin-Amphiphysin-Rvs (BAR) domain-containing proteins form oligomeric assemblies that aid membrane remodeling. In this issue of Developmental Cell, Pang etal. (2014) show that the BAR domain of ACAP1, although architecturally similar to other BAR domains, cooperates with its neighboring pleckstrin homology domain to deform membranes and facilitate endosomal recycling. PMID:25313957

Krauss, Michael; Haucke, Volker

2014-10-13

140

A Language with Class The Theory of Classification Exemplified in  

E-print Network

into a computer scientist and gave me my first taste of object-orientation; Tony Cowling, Matt Fairtlough and Mike; Low Eng-Kwang, Tse Hau-Pui, Ong Pang-Siong, Ng Yee-Mei, David Black, Rex Tam and Mark Williams

Simons, Anthony J. H.

141

Discovery of Climate Indices using Clustering Michael Steinbach  

E-print Network

Discovery of Climate Indices using Clustering Michael Steinbach Pang-Ning Tan Vipin Kumar Dept. of Comp. Sci. & Eng. University of Minnesota steinbac,ptan,kumar@cs.umn.edu Steven Klooster California State University, Monterey Bay klooster@gaia.arc.nasa.gov Christopher Potter NASA Ames Research Center

Kumar, Vipin

142

Temporal Data Mining for the Discovery and Analysis of Ocean Climate Indices*  

E-print Network

and Engineering, Army HPC Research Center University of Minnesota {steinbac, ptan, kumar@cs.umn.edu} ++ NASA Ames+ Pang-Ning Tan+ Vipin Kumar+ Steven Klooster+++ Christopher Potter++ + Department of Computer Science Research Center +++ California State University, Monterey Bay {cpotter@mail.arc.nasa.gov} {klooster

Kumar, Vipin

143

Gain-scheduled `1 -optimal control for boiler-turbine dynamics  

E-print Network

Gain-scheduled `1 -optimal control for boiler-turbine dynamics with actuator saturation Pang; accepted 2 June 2003 Abstract This paper presents a gain-scheduled approach for boiler-turbine controller the magnitude and rate saturation constraints on actuators. The nonlinear boiler-turbine dynamics is brought

Shamma, Jeff S.

144

Model Checking a Cache Coherence Protocol of a Java DSM Implementation  

E-print Network

Model Checking a Cache Coherence Protocol of a Java DSM Implementation Jun Pang1 , Wan Fokkink2 Shared Memory (DSM), has been imple- mented both in software (e.g., to provide the shared memory. Jackal [30] is a fine- grained DSM implementation of the Java programming language. It aims to implement

Fokkink, Wan

145

Biometrics 67, 13301339 December 2011  

E-print Network

Frailty Model for Recurrent Event Data Pang Du,1, Yihua Jiang,2 and Yuedong Wang3 1 Department to model the log gap time hazard as a joint function of gap time and covariates, and general frailty is introduced to account for between-subject heterogeneity and within-subject correlation. We estimate

Wang, Yuedong

146

Bouncing of a jet off a Newtonian liquid surface Matthew Thrasher, Sunghwan Jung,  

E-print Network

by pouring mineral oil into a pan of mineral oil.1 1 M. Thrasher, S. Jung, Y. K. Pang, C.-P. Chuu, and H. L of silicone oil of flow rate Q and viscosity is falling from height H to a bath of the same liquid, which

Texas at Austin. University of

147

A Collaborative Web Service Platform for AEC Supply Chain  

E-print Network

A Collaborative Web Service Platform for AEC Supply Chain Chin-Pang Jack Cheng*§ , Kincho H. Law is crucial for an effective supply chain. For the AEC industry, however, information sharing is difficult due to the highly fragmented and temporary, project- based nature of its supply chain. As Internet access becomes

Stanford University

148

Identifying Intention Posts in Discussion Forums Zhiyuan Chen, Bing Liu Meichun Hsu, Malu Castellanos,  

E-print Network

learning meth- od. 1 Introduction Social media content is increasingly regarded as an information gold mine. Researchers have stud- ied many problems in social media, e.g., senti- ment analysis (Pang & Lee, 2008; Liu such intention automatically can help social media sites to decide what ads to display so that the ads are more

Liu, Bing

149

ioscience.D distribute.  

E-print Network

Martine Biard-Piechaczyk,15 Janice S. Blum,16 Dale E. Bredesen,17 Jeffrey L. Brodsky,18 John H. Brumell,19 Heidenreich,74 Joseph A. Hill,75 Maria Høyer-Hansen,76 Xun Hu,77 Wei-Pang Huang,78 Akiko Iwasaki,79 Marja

Li, Lian

150

Two-Parameter Heavy-Traffic Limits for Infinite-Server Queues With Dependent Service Times  

E-print Network

in the CLT is affected by the cumulative correlations; see §4.4 of Whitt (2002). In the present context, weak (1997) and Pang and Whitt (2010), in the iid case the service times affect the heavy-traffic limit or epidemic diseases and with multi-person transportation accidents, as with cars or trains. Second

Whitt, Ward

151

Impact of footprint diameter and off-nadir pointing on the precision of canopy height estimates from spaceborne lidar  

E-print Network

from spaceborne lidar Yong Pang a,b , Michael Lefsky a, , Guoqing Sun c , Jon Ranson d a Center for Ecological Applications of Lidar, Warner College of Natural Resources, Colorado State University, Fort August 2010 Accepted 31 August 2010 Available online 12 May 2011 Keywords: Spaceborne lidar Lidar

Lefsky, Michael

152

Transfer of micro and nano-photonic silicon nanomembrane waveguide devices on flexible  

E-print Network

devices," Proc. SPIE 7606, 76060V (2010). 8. W. Zhou, Z. Ma, H. Yang, Z. Qiang, G. Qin, H. Pang, L. Chen: inorganic nanomembranes," Soft Matter 6(3), 439­ 455 (2010). 2. G. Qin, H. C. Yuan, G. K. Celler, W. Zhou, W. Yang, S. Chuwongin, and D. Zhao, "Flexible photonic-crystal Fano filters based on transferred

Texas at Austin, University of

153

BioMed Central Page 1 of 12  

E-print Network

experiments The human genome is the blueprint that encodes most of the functional components in the human body: proteins and RNAs. With the completion of sequencing of the human genome, the focus of the genomic research-specific functional RNAs in human Zhaolei Zhang*1,2, Andy Wing Chun Pang1,2 and Mark Gerstein3 Address: 1Banting

Gerstein, Mark

154

Eleventh Industrial Mathematical and Statistical Modeling Workshop for Graduate Students  

E-print Network

, Mette S. Olufsen, Ralph C. Smith and Hien Tran #12;ii #12;iii Participants Students 1. Affane Aji, Auburn University 41. Tweedy, Eamonn, NCSU 42. Vijayat, Amith, Clarkson University #12;iv 43. Vogl, Chris. Pang, Tao 9. Pelletier, Denis 10. Smith, Charlie 11. Smith, Ralph 12. Tran, Hien 13. Zenkov, Dmitry 14

155

View - Optimization Online  

E-print Network

LEI-HONG ZHANG? AND WEI HONG YANG ...... [2] J. Burke and S. Xu, The global linear convergence of a noninterior path-following algorithm for ... [7] R. W. Cottle, J.-S. Pang and R. E. Stone, The linear complementarity problem, Computer.

2014-03-31

156

Analyzing the Redesign of a Distributed Lift System in UPPAAL  

E-print Network

Analyzing the Redesign of a Distributed Lift System in UPPAAL Jun Pang1 , Bart Karstens1 and Wana, 1081 HV Amsterdam, The Netherlands, wanf@cs.vu.nl Abstract. An existing distributed lift system by analyzing the redesign of a distributed lift system. This lift system is used in real life for lifting

Fokkink, Wan

157

Justification of Constrained Game Equilibrium Models1 1 Introduction  

E-print Network

The most popular solution concept for this problem was suggested by Nash [2]. The ...... [17] Pang J-S, Scutari G, Facchinei F, Wang C (2008) Distributed power allocation with rate constraints in Gaussian ... Autom Remote Control 29: 427-443

2014-07-14

158

Incremental linear discriminant analysis for evolving feature spaces in multitask pattern recognition problems  

Microsoft Academic Search

In this paper, we propose a new incremental linear discriminant analysis (ILDA) for multitask pattern recognition (MTPR) problems in which a chunk of training data for a particular task are given sequentially and the task is switched to another related task one after another. The Pang et al.'s ILDA is extended such that a discriminant space of the current task

Masayuki Hisada; Seiichi Ozawa; Kau Zhang; Nikola Kasabov

2010-01-01

159

Increase of global monsoon area and precipitation under global warming: A robust signal?  

E-print Network

Increase of global monsoon area and precipitation under global warming: A robust signal? Pang 2012; revised 18 February 2012; accepted 20 February 2012; published 16 March 2012. [1] Monsoons of people around the world. The global monsoon precipitation had an increasing trend over the past three

Li, Tim

160

DOI: 10.1002/adem.200700057 Interfacial Microstructure of Chromium Oxide Coatings**  

E-print Network

DOI: 10.1002/adem.200700057 Interfacial Microstructure of Chromium Oxide Coatings** By Xiaolu Pang, Kewei Gao,* Huisheng Yang, Lijie Qiao, Yanbin Wang and A. A. Volinsky Chromium oxide coatings was about 14.7 GPa, while a 200 nm thick RF-sputtered chromium oxide coating, stoichiometri- cally close

Volinsky, Alex A.

161

Microstructure and mechanical properties of chromium oxide coatings  

E-print Network

Microstructure and mechanical properties of chromium oxide coatings Xiaolu Pang Department 33620 (Received 2 August 2007; accepted 12 September 2007) Chromium oxide coatings were deposited on low to investigate the microstructure of chromium oxide coatings. Varying oxygen flux changed the coating

Volinsky, Alex A.

162

Long-term underwater camera surveillance for monitoring and analysis of fish populations  

E-print Network

, Jacco van Ossenbruggen2 Daniela Giordano3 , Lynda Hardman2 , Fang-Pang Lin4 , Robert B. Fisher1 1 School that the system is expected to process. At the moment, around 10 cam- eras record 12 hours a day (daylight) where

Fisher, Bob

163

RUTGERS -THE STATE UNIVERSITY OF NEW JERSEY Data Mining (26:198:685)  

E-print Network

RUTGERS - THE STATE UNIVERSITY OF NEW JERSEY Data Mining (26:198:685) Spring 2009 Instructor: Dr · Office Phone: 973-353-5261 · Text Book: "Introduction to Data Mining", by Pang-Ning Tan, Michael, it is difficult for analysts to sift through the data even though it may contain useful information. Data mining

Lin, Xiaodong

164

RUTGERS -THE STATE UNIVERSITY OF NEW JERSEY Data Mining  

E-print Network

RUTGERS - THE STATE UNIVERSITY OF NEW JERSEY Data Mining Instructor: Dr. Hui Xiong E-mail: hxiong@rutgers.edu WEB : http://datamining.rutgers.edu Text Book: "Introduction to Data Mining", by Pang-Ning Tan useful information. Data mining holds great promise to address this problem by providing efficient

Lin, Xiaodong

165

RUTGERS -THE STATE UNIVERSITY OF NEW JERSEY Data Mining  

E-print Network

RUTGERS - THE STATE UNIVERSITY OF NEW JERSEY Data Mining Fall 2012 Instructor: Dr. Hui Xiong E or by appointment Text Book: "Introduction to Data Mining", by Pang-Ning Tan, Michael Steinbach, Vipin Kumar for analysts to sift through the data even though it may contain useful information. Data mining holds great

Lin, Xiaodong

166

RUTGERS -THE STATE UNIVERSITY OF NEW JERSEY Data Mining  

E-print Network

RUTGERS - THE STATE UNIVERSITY OF NEW JERSEY Data Mining Spring 2011 Instructor: Dr. Hui Xiong E-353-5261 Text Book: "Introduction to Data Mining", by Pang-Ning Tan, Michael Steinbach, Vipin Kumar, Addison for analysts to sift through the data even though it may contain useful information. Data mining holds great

Lin, Xiaodong

167

RUTGERS -THE STATE UNIVERSITY OF NEW JERSEY Data Mining  

E-print Network

RUTGERS - THE STATE UNIVERSITY OF NEW JERSEY Data Mining Fall 2013 Instructor: Dr. Hui Xiong E: "Introduction to Data Mining", by Pang-Ning Tan, Michael Steinbach, Vipin Kumar, Addison Wesley, ISBN: 0 even though it may contain useful information. Data mining holds great promise to address this problem

Lin, Xiaodong

168

Java Therapy: Web-Based Robotic Rehabilitation  

E-print Network

Java Therapy: Web-Based Robotic Rehabilitation David J. Reinkensmeyer, Clifton T. Pang, Jeff A available for individuals with brain injury to practice and monitor therapy on their own at home. This paper describes an inexpensive robotic telerehabilitation system for arm and hand therapy following brain injury

Reinkensmeyer, David J.

169

An Account of Opinion Implicatures Janyce Wiebe Lingjia Deng  

E-print Network

-oriented text is positive or negative (e.g., Das and Chen. (2001), Pang et al (2002), Dave et al (2003 implicatures that arise in the presence of explicit sentiments, and events that positively or negatively affect- ence) in text. This paper describes a rule-based framework for representing and analyzing opinion

Wiebe, Janyce M.

170

Developing a Flexible Sentiment Classification  

E-print Network

the results · Create a classification method with which to determine if text contains a positive or negative affective words indicating their POS is misinterpreted, or they appear more frequently, even in negative) Created by Bo Pang and Lillian Lee at Cornell Contains 2,000 positive & negative movie reviews · Product

Hearst, Marti

171

Journal of Geodynamics 53 (2012) 3442 Contents lists available at SciVerse ScienceDirect  

E-print Network

determination. Compared to the satellite laser ranging (SLR) technique that can only obtain one- dimensional of COSMIC and GRACE satellite missions Tingjung Lina , Cheinway Hwanga, , Tzu-Pang Tsenga,c , B.F. Chaob coefficients from GPS data of COS- MIC and GRACE satellite missions. The kinematic orbits of COSMIC and GRACE

Hwang, Cheinway

172

Thorsten Joachims University Activities  

E-print Network

· Senator, Computer Science · Cognitive Science Steering Committee · Graduated Ph.D. Student: Filip Computer, 40(8):34 ­ 40, August. · T. Joachims, L. Granka, B. Pang, H. Hembrooke, F. Radlinski, and G. Gay Alignment Models. In Proceeding of the International Conference on Research in Computational Molecular

Keinan, Alon

173

INTEGRATED PARYLENE-CABLED SILICON PROBES FOR NEURAL PROSTHETICS  

E-print Network

INTEGRATED PARYLENE-CABLED SILICON PROBES FOR NEURAL PROSTHETICS R. Huang1 , C. Pang1 , Y.C. Tai1 Recent advances in the field of neural prosthetics have demonstrated the thought control of a computer will facilitate future research in developing a neural prosthetic system. 2. DESIGN A flexible parylene lift

Andersen, Richard

174

Cellular/Molecular Dendritic Calcium Signaling in ON and OFF Mouse Retinal  

E-print Network

simultaneous patch-clamp recording and 2-photon Ca2 imaging are used to study voltage- and light-evokedCa2 and two types of OFF cells; OFF transient (OFF-T) and OFF sustained (OFF-S), based on whether they respond to light offset with a transient or sustained burst of spikes (Pang et al., 2003; Margolis and De- twiler

Alford, Simon

175

Can Boltzmann Soliton Star Exist?  

NASA Astrophysics Data System (ADS)

The fermion soliton stars suggested by Lee and Pang are extended to finite temperature. The degeneracy temperature TD above which the fermion soliton star will become a Boltzmann soliton star is given. We prove that the Boltzmann soliton star cannot exist, because it is unstable.

Su, Rukeng; Chen, Xuelei; Pan, Rongshi

1992-12-01

176

Physical properties of a soliton black hole at finite temperature  

NASA Astrophysics Data System (ADS)

It is shown that the nontopological scalar black hole suggested by Friedberg, Lee, and Pang is dynamically stable at finite temperature. The heat capacity of a scalar soliton black hole is positive. The physical properties of a scalar black hole at finite temperature are discussed.

Pan, Rong-Shi; Su, Ru-Keng

1992-03-01

177

Menace of Undesirables: The Eugenics Movement During the Progressive Era  

Microsoft Academic Search

th century had produced industrial misery, class polarization, and urban distress. Americans, experiencing the social inequities of the post-Civil War period and the pangs of depression during the 1890's, enthusiastically embraced movements for reform to help alleviate the injustices and suffering. Originally, progressive reformers sought to regulate irresponsible corporate monopoly, safeguarding consumers and labor from the excesses of the profit

Ted L. DeCorte

178

Light-Driven Cone Arrestin Translocation in Cones of Postnatal Guanylate Cyclase-1 Knockout Mouse Retina  

E-print Network

Retina Treated with AAV-GC1 Shannon E. Haire,1 Jijing Pang,2 Sanford L. Boye,2 Izabel Sokal,3 Cheryl M of the light-driven translocation of cone arrestin is one of the pheno- types of cone cells in this retina- stores cone arrestin translocation in the cone cells of postnatal GC1 knockout mouse retina. METHODS

Palczewski, Krzysztof

179

Opportunities for Smart & Tailored Activity Coaching Harm op den Akker  

E-print Network

and Development Telemedicine group h.opdenakker@rrd.nl Randy Klaassen University of Twente Human Media Interaction.j.a.opdenakker@utwente.nl Valerie M. Jones University of Twente Telemedicine group v.m.jones@utwente.nl Hermie J. Hermens Roessingh Research and Development Telemedicine group h.hermens@rrd.nl Abstract This short paper describes how

Twente, Universiteit

180

Educational Restructuring and the Community Education Process.  

ERIC Educational Resources Information Center

This document explores the application of the community education process to restructuring activities at both the state and local level. The monograph contains the following papers: "In the Forefront of Restructuring" (Larry Decker, Valerie Romney); "Building Learning Communities: Realities of Educational Restructuring" (Larry Decker); "The

Decker, Larry E., Ed.; Romney, Valerie A., Ed.

181

Proposals Submitted FY13 Awards Received, FY13 Expenditures FY13 College/Center No.  

E-print Network

Sponsor Maximum Amount* James Miller ISED ALSDoEd $2,700,000 Phillip Farrington ISE NASA/MSFC $654,750 Rahul Ramachandran ITSC NASA/SSC $531,158 John Gregory SGC NASA/GSFC $375,000 Valerie Connaughton CSPAR Consortium: Development of a Novel Telescope for Very High-Energy Gamma-Ray Astrophysics Development

Alabama in Huntsville, University of

182

Cigarette smoking and cognitive function in human immunodeficiency virus seropositive women Short running title: Smoking and cognition in women with HIV  

E-print Network

Cigarette smoking and cognitive function in human immunodeficiency virus seropositive women Short running title: Smoking and cognition in women with HIV Valerie Wojna1,2 , Lizbeth Robles1 , Richard L the official views of NCRR or NIH. #12;Abstract Cigarette smoking alters the immune system and may improve

Lasalde Dominicc, Jose A. - Department of Biology, Universidad de Puerto Rico

183

Team Kentucky Awards: 2013 INTEL Grand Awards  

E-print Network

Category The Effects of the Media on Gender Stereotypes and the Furthering of Sexual Harassment Petra Novel Materials for Organic Solar Cells Valerie Youngmi Sarge, 15, Paul Laurence Dunbar High School High School, Louisville, Kentucky Third Award of $1,000: Engineering: Materials and Bioengineering

Cooper, Robin L.

184

REAL-TIME WATER WAVES WITH WAVE PARTICLES  

E-print Network

REAL-TIME WATER WAVES WITH WAVE PARTICLES A Dissertation by Cem Yuksel Submitted to the Office of DOCTOR OF PHILOSOPHY August 2010 Major Subject: Computer Science #12;REAL-TIME WATER WAVES WITH WAVE, Valerie E. Taylor August 2010 Major Subject: Computer Science #12;iii ABSTRACT Real-time Water Waves

Keyser, John

185

LuxU connects quorum sensing to biofilm formation in Vibrio fischeri  

E-print Network

LuxU connects quorum sensing to biofilm formation in Vibrio fischeri Valerie A. Ray and Karen L, USA. Summary Biofilm formation by Vibrio fischeri is a complex process involving multiple regulators polysaccha- ride (syp) locus. To identify other regulators of biofilm formation in V. fischeri, we screened

McFall-Ngai, Margaret

186

The Learning System. Volume 4, Number 8  

ERIC Educational Resources Information Center

"The Learning System" is a newsletter designed for superintendents and central office staff with professional learning responsibilities. This issue includes: (1) Principal-Coaches Transform Teachers and Schools (Valerie von Frank); (2) District Leadership: Delve into NSDC's [National Staff Development Council's] New Definition of Professional

von Frank, Valerie, Ed.

2009-01-01

187

June 25, 2007 CURRICULUM VITAE  

E-print Network

-Li Su, Sc.M., Biostatistics, 1998 Master's Thesis: "Adjusting for Drop-out and Non Michelle Shardell, Ph.D., Biostatistics, 2004 Doctoral Thesis: "The Analysis of Informatively Coarsened in Elderly People with and without White Matter Lesions" Valerie Harder, MHS, Biostatistics, 2005 Current

Scharfstein, Daniel

188

A Magazine the School of Molecular and Cellular Biology at the University of Illinois at Urbana-Champaign mcb VOL. 1 ISSUE 2  

E-print Network

Tor Stephen G. Sligar ediTor Carla Barnwell projecT Manager Julia Stackler graphic designer Valerie Lohmann, health, and disease. Our world-renowned researchers and educators advance the understanding of biological employment opportunities in biotechnology, pharmaceutical research, and other disciplines where a strong

Ha, Taekjip

189

Groundbreakers: Successful Careers of Indian Women Today.  

ERIC Educational Resources Information Center

Three successful American Indian women--film maker and businesswoman Valerie Red-Horse, Cherokee law professor and appeals court justice Stacey Leeds, and prolific artist Virginia Stroud--discuss their careers, emphasizing the importance of retaining cultural values, the struggles of being a racial and gender pioneer in their field, and the

Adams, Nicole

2002-01-01

190

Localised modes due to defects in high contrast periodic media via homogenization  

E-print Network

Localised modes due to defects in high contrast periodic media via homogenization Ilia V. Kamotski and Valery P. Smyshlyaev Bath Institute For Complex Systems Preprint 3/06 (2006) http://www.bath.ac.uk/math-sci/BICS #12;Localised modes due to defects in high contrast periodic media via homogenization I.V. Kamotski1

Smyshlyaev, Valery P.

191

Obituary: Ronald N. Bracewell, 1921-2007  

Microsoft Academic Search

Ronald N. Bracewell, Professor Emeritus (since 1991) of Electrical Engineering at Stanford University, and a true renaissance man of science, died of a heart attack on 12 August 2007 at his home. Ron Bracewell was born in Sydney, Australia, on 22 July 1921, one of the two sons of Cecil and Valerie Bracewell. He graduated from the University of Sydney

Vah Petrosian

2009-01-01

192

Molina S. et al., CD81 and primary hepatocyte infection by HCV Serum derived HCV infection of primary human hepatocytes1  

E-print Network

Molina S. et al., CD81 and primary hepatocyte infection by HCV 1 Serum derived HCV infection of primary human hepatocytes1 is tetraspanin CD81 dependent2 3 Sonia Molina1,8$ , Valerie Castet1$ , Lydiane-07 #12;Molina S. et al., CD81 and primary hepatocyte infection by HCV 2 * Corresponding author: Patrick

Boyer, Edmond

193

Game-Based Assessments: A Promising Way to Create Idiographic Perspectives  

ERIC Educational Resources Information Center

"Game-Based Assessments: A Promising Way to Create Idiographic Perspectives" (Adrienne Walker and George Englehard) comments on: "How Task Features Impact Evidence from Assessments Embedded in Simulations and Games" by Russell G. Almond, Yoon Jeon Kim, Gertrudes Velasquez, and Valerie J. Shute. Here, Walker and Englehard write

Walker, A. Adrienne; Engelhard, George, Jr.

2014-01-01

194

TMS Agents: Enabling Dynamic Distributed Supply Chain Management  

E-print Network

T?MS Agents: Enabling Dynamic Distributed Supply Chain Management Tom Wagner Valerie Guralnik John of a discrete distributed dynamic supply chain management problem and specify how TAEMS agents, equipped with new coordination mechanisms, are being used to automate and manage the supply chain. Key words: agent

Wagner, Thomas

195

We are all adult educators now: the implications of adult learning theory for the continuing professional development of educational leaders and managers  

Microsoft Academic Search

This article was written, but never published, by Dr Valerie Hall, who died in 2002. Its existence was brought to my attention by Professor Ron Glatter at the memorial event for her held at the University of Bristol. It was presented at a seminar in Milton Keynes in 1998 as part of an ESRC series on Redefining Educational Management

Valerie Hall

2004-01-01

196

Emily Brooks 3151 Social Science Plaza A  

E-print Network

`New Way of Life': Analogizing Danger in a Dying Town". American Anthropological Association Annual Meeting. Chicago, IL. November 2013. #12;"Extreme Ecologies and Animal Futures". Guest Lecture for Valerie Olson's "Humans and Other Animals" Undergraduate Course. UC Irvine. November 2013. "Navigating Extremes

Loudon, Catherine

197

English Teaching at Lilydale High.  

ERIC Educational Resources Information Center

Presents six narratives from teachers including: "VCE English at Lilydale High School" (Valerie Mayer); "Should 'I' Be Their Teacher" (Mark Matcott); "Teaching Poetry to Year 7 English Students" (Janet Lyons); "Creative Art Therapy and Mandalas" (Demi Flessa); "Would the 'Real' Teacher Please Stand Up?" (Anna Hayman); and "When Volumes Speak

Mayer, Valerie; Matcott, Mark; Lyons, Janet; Flessa, Demi; Hayman, Anna; Hough, Peter

2002-01-01

198

Teachers Teaching Teachers (T3)[TM]. Volume 4, Number 4  

ERIC Educational Resources Information Center

"Teachers Teaching Teachers" ("T3") focuses on coaches' role in the professional development of teachers, exploring challenges and rewards that teacher leaders encounter. This issue includes: (1) Making a Serious Study of Classroom Scenes: High School Faculty Develops Away to Observe and Learn from Each Other (Valerie von Frank); (2) Tools for

von Frank, Valerie, Ed.

2008-01-01

199

Gender Fictions.  

ERIC Educational Resources Information Center

Reviews and compares "Gender and Mathematics" edited by Leone Burton and Valerie Walkerdine's book "Schoolgirl Fictions" on proposed truths related to gender issues in mathematics. Issues include (1) attention given to boys and girls in mathematics class; (2) the effects of noncompetitive classroom environments; and (3) sex differences in

Lee, Lesley

1992-01-01

200

Designing Robots for Long-Term Social Interaction Rachel Gockley, Allison Bruce, Jodi Forlizzi, Marek Michalowski, Anne Mundell,  

E-print Network

Designing Robots for Long-Term Social Interaction Rachel Gockley, Allison Bruce, Jodi Forlizzi Robots Project. A perma- nent installation in the entranceway to Newell-Simon Hall, the robot combines and compelling character. We are using Valerie to investigate human-robot social interaction, especially long

McLaren, Bruce Martin

201

The Joumalof ExperimentalBiology 200, 185-192(1997) Printedin GreatBritain @The Companyof BiologistsLimited 1997  

E-print Network

cells, gall fly, logisticregression. Introduction The goldenrod gatl fly Eurosta solidaginis (Fitch) has synthesisis inducedby larval dehydration as the goldenrod plant senescesand the gall dries (Rojas el al. L986 OF THE GALL FLY EUROSTASOLIDAGINIS (DIPTERA, TEPHRITIDAE) VALERIE A. BENNETT E.NNRICHARD E. LEE, JN

Lee Jr., Richard E.

202

UNIVERSITY OF SUSSEX FORMER STAFF ASSOCIATION Steering Group Meeting no 2  

E-print Network

Pavey Valerie Cromwell Adrian Peasgood Christine Glasson Jennifer Platt (JP) Willie Lamont Ken Wheeler-retirement mailing ­ DARO 2. Initial events and activities: Next Newsletter to go out within next few weeks to races/greyhounds ML 3. Next newsletter and its content: · To go out in next few weeks, emailed where

Sussex, University of

203

Surveys for California Red-Legged Frog and Arroyo Toad on the Los Padres  

E-print Network

Surveys for California Red-Legged Frog and Arroyo Toad on the Los Padres National Forest1 Valerie K-listed California red-legged frog (Rana aurora draytonii) and arroyo toad (Bufo californicus). Sites known to have frogs or toads present were monitored for breeding and possible impacts of Forest Service activities

Standiford, Richard B.

204

OFFICE OF INFORMATION TECHNOLOGY UNIVERSITY OF CALIFORNIA, IRVINE July 21, 2014  

E-print Network

Hildebrand Mike Iglesias Lee Knutson John Lenning Sheena Yarberry UCI Information Security Officer Isaac Straley Data Warehouse Valerie Jones Ken Go Anh Le Grace Ong Eufemia Palomino Tammy Phan Sushman Pulluri Carol Jackson Gayle Bonham Mike Caban #Eugene Day Bob Hudack Michele Joyce Chris Nelson Brian Rowatt

Brody, James P.

205

Electronic Communication: Themes from a Case Study of the Deaf Community  

E-print Network

Electronic Communication: Themes from a Case Study of the Deaf Community Valerie Henderson-Summet1 the space of electronic communication (e.g. instant messaging, short message service, email) by Deaf teenagers in the greater Atlanta metro area. We discuss differences and similarities between deaf

Grinter, Rebecca Elizabeth

206

IEEE TRANSACTIONS ON MAGNETICS, VOL. 35, NO. 6, NOVEMBER 1999 4511 Nonlinear Ferromagnetic Resonance and  

E-print Network

, Senior Member, IEEE, Carl E. Patton, Fellow, IEEE, and Valeri T. Synogach Abstract-- A thin Engineering, Electron- ics, and Automation (MIREA), Moscow, 117454 Russia. C. E. Patton is with the Department of Physics, Colorado State University, Fort Collins, CO 80523 USA (e-mail: patton@lamar.colostate.edu). V. T

Patton, Carl

207

Cost Center Department Mail Alt Dept Records Analyst UC Assoc Dir UC Dept Mgr H 1009301 Office of Diversity 929301 Almeida,Evelyn S Acosta,David A Latimore,Darin A (interim)  

E-print Network

,Michael P Preczewski,Luke B H 1009392 Enzyme Replacement Therapy 939392 Almeida,Evelyn S Condrin,Michael P 1009648 Child Life & Creative Arts Thp 929648 Almeida,Evelyn S Robinson,Carol A Sundberg,Diana C H 1009666 PM&R - Hand Therapy 929666 Almeida,Evelyn S Condrin,Michael P Adame,Valerie Renee H 1009690

Schladow, S. Geoffrey

208

Provost & Senior Vice President for Academic Affairs  

E-print Network

of Biomedical Education The School of Education Division of Humanities & Arts Division Education � Office of Academic Standards � Gateway Advising � Student Support Services � ROTC � Non levy resources � Startup fund accounts Director of Academic Personnel Ms. Valerie Rutstein � College

Brinkmann, Peter

209

Z .Global and Planetary Change 31 2001 283295 www.elsevier.comrlocatergloplacha  

E-print Network

of Quaternary studies performed in the Russian Arctic by West European scientists, mostly under the aegis framework for the Upper Pleistocene of the glaciated Russian Arctic: changing paradigms Valery Astakhov and others are described. Stratigraphic schemes traditionally used in Siberia and in the Russian European

Ingólfsson, ?lafur

210

Anatoly Kitov -pioneer of Russian informatics Vladimir A. Kitov1  

E-print Network

generation of scientists who had created Russian cybernetics, computer engineering and informatics. DueAnatoly Kitov - pioneer of Russian informatics Vladimir A. Kitov1 , Valery V. Shilov2 1 Fujitsu "MATI" � Russian State Technological University, Orshanskaja 3, 121522 Moscow, Russia shilov

Boyer, Edmond

211

28th International Cosmic Ray Conference 3473 REal-time COsmic Ray Database (RECORD)  

E-print Network

28th International Cosmic Ray Conference 3473 REal-time COsmic Ray Database (RECORD) Valery Kozlov, Moscow region, Russia. Abstract In this paper we present a first distributed REal-time COsmic Ray methods. The database contains not only original cosmic ray data but also auxiliary data necessary

Usoskin, Ilya G.

212

HALL OF FAME ($10,000+) Thomas A. Andruskevich '73  

E-print Network

. Painter '60 ++ Sandie Paul '90P '92P William G. Paul, Jr. '67 '90P '92P ++ Amy M. Perella Joseph R A. Anderson '03P ++ James G. Baxter '70 ++ Michael G. Bolton '65 '67G '94P ++ Glenn I. BreidenbachAnn Haines Paul F. Hartzell, Jr. '75 ++ Thomas J. Hensler '80 '82G Thomas E. Hirsch III '75 '10P ++ Valerie S

Napier, Terrence

213

Audio Engineering Society Convention Paper  

E-print Network

josh.reiss@elec.qmul.ac.uk ABSTRACT Sigma delta modulation is a popular form of audio analogue-to-digital popular methods for analog to digital (and digital to analog) conversion for audio applications. Yet of Sigma Delta Modulators Georgi Tsenov1 , Valeri Mladenov1 , and Joshua D. Reiss2 1 Dept of Theoretical

Reiss, Josh

214

Key Themes in Intercultural Communication Pedagogy  

ERIC Educational Resources Information Center

The seminar, organised by Jane Woodin, Gibson Ferguson, Valerie Hobbs and Lesley Walker (School of Modern Languages & Linguistics and School of English, University of Sheffield), aimed to bring together those working in intercultural communication (IC) pedagogy largely--though not exclusively--in the higher education sector. It drew inspiration

Woodin, Jane

2010-01-01

215

LETTER OPEN doi:10.1038/nature13668  

E-print Network

Niu3 , E. Jay Rehm9 , Joel Rozowsky2 , Matthew Slattery9 , Rebecca Spokony9 , Robert Terrell4 , Dionne , Peter J. Good10 , Michael J. Pazin10 , Haiyan Huang7 , Peter J. Bickel7 , Steven E. Brenner11,12 , Valerie Reinke3 , Robert H. Waterston4 , Mark Gerstein2 , Kevin P. White9 1, Manolis Kellis6 1 & Michael

216

IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 34, NO. 3, JUNE 2006 755 Nonequilibrium EEDF in Gas Discharge Plasmas  

E-print Network

by an electron beam, where electron ac- celeration takes place in an electron gun outside the plasma. A wellIEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 34, NO. 3, JUNE 2006 755 Nonequilibrium EEDF in Gas Discharge Plasmas Valery A. Godyak, Fellow, IEEE Abstract--Nonequilibrium effects associated with spatial

Kaganovich, Igor

217

The Ethics of Interpretation: The Signifying Chain from Field to Analysis  

ERIC Educational Resources Information Center

This paper attempts to describe the relationship between the embodied practice of fieldwork and the written articulation of this experience. Starting from Valerie Hey's conceptualization of "rapport" as form of "intersubjective synergy", a moment of recognition of similarity within difference--similar in structure to Laclau and Moufffe's

Lapping, Claudia

2008-01-01

218

KSC-03PD-1450  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto is one of the scientists recovering experiments found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

219

KSC-03PD-1455  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., works on an experiment found during the search for Columbia debris. Mike Casasanto, also with ITA, looks on. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

220

KSC-03PD-1453  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., works on an experiment found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

221

KSC-03PD-1461  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto (foreground), Instrumentation Technology Associates, Inc., examines one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

222

Dying to Die Right: A Look at Death in Ancient Rome  

Microsoft Academic Search

Valerie M. Hope explains in her book Death in Ancient Rome that many of us in the modern world have a ?hospitalized? relationship to death. With a nearly religious belief in the usage of Western medicine and advanced methods of prolonging life, it is not outrageous to claim that today many judge their lives based on the quantity, rather than

Jeff Eamon

2010-01-01

223

Expedition Five crew members wave to onlookers as they leave KSC for Houston  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- Expedition Five crew members wave to onlookers as they leave KSC for Houston. From left are Science Officer Peggy Whitson and Commander Valery Korzun. Not seen is Flight Engineer Sergei Treschev. The three returned to Earth Dec. 7 on Endeavour, with the STS-113 crew, after six months on the International Space Station.

2002-01-01

224

What Was Life? Answers from Three Limit Biologies Author(s): Stefan Helmreich  

E-print Network

- ductive technologies, along with genomic reshufflings of biomatter in such practices as cloning, have: Anthropology, Kinship, and the New Reproductive Technologies (Manchester, 1992); Conceiving the New World Order: The Global Politics of Reproduction, ed. Faye D. Ginsburg and Rayna Rapp (Berkeley, 1995); Valerie Hartouni

Polz, Martin

225

Conceptualising Hy-Bivalent Subjectivities to Facilitate an Examination of Australian Government Mutual Obligations Policies  

ERIC Educational Resources Information Center

This paper illustrates how the work of feminist theorists Valerie Walkerdine, Helen Lucey and June Melody, Beverly Skeggs, and Nancy Fraser were used together to examine the lived effects of Australian government Mutual Obligations policies. As "active" welfare policies, Mutual Obligations construct particular relations between themselves and

Edwards, Jan

2006-01-01

226

www.biosciencemag.org January 2007 / Vol. 57 No. 1 BioScience 71 Professional Biologist  

E-print Network

and institutionalize a value system that María Uriarte (e-mail: mu2126@columbia.edu) works in the Department of Ecology. Constructing a Broader and More Inclusive Value System in Science MARÍA URIARTE, HOLLY A. EWING, VALERIE T

Weathers, Kathleen C.

227

RENEWABLE ENERGY PROGRAM OVERALL PROGRAM GUIDEBOOK  

E-print Network

RENEWABLE ENERGY PROGRAM OVERALL PROGRAM GUIDEBOOK Staff Draft Guidebook Third Edition COMMISSION Kate Zocchetti Project Manager Tony Gonçalves Office Manager Renewable Energy Office Valerie Hall Deputy Director Efficiency and Renewable Energy Division Melissa Jones Executive Director The California

228

Central pattern generator incorporating the actuator dynamics for a hexapod robot  

E-print Network

Central pattern generator incorporating the actuator dynamics for a hexapod robot Valeri A. Makarov pattern generator (CPG) for controlling hexapodal robots. We show that the ring composed of six Toda-Rayleigh units coupled to the limb actuators reproduces the most common hexapodal gaits. We provide an electrical

Ebeling, Werner

229

Forum on the Future of Academic Medicine: Final Session--Implications of the Information Revolution for Academic Medicine.  

ERIC Educational Resources Information Center

Summarizes two speeches. William W. Stead offers three scenarios illustrating typical future interactions of consumers with a medical system based on informatics and information technology and then considers implications for academic medicine. Valerie Florance discusses a program that is exploring ways medical schools and teaching hospitals can

Iglehart, John

2000-01-01

230

Child and Adolescent Development Research and Teacher Education: Evidence-based  

E-print Network

Berch Associate Chief Child Development and Behavior Branch Dr. Lisa Freund Program Director Child Development and Behavior Branch Dr. Valerie Maholmes Program Director Child Development and Behavior Branch Dr. Peggy McCardle Chief Child Development and Behavior Branch NCATE Representatives Dr. Arthur E. Wise

Rau, Don C.

231

THERMAL EXPANSION COEFFICIENTS OF SOME MATERIALS USED FOR HOM LOAD ABSORBERS  

E-print Network

ERL 07-1 THERMAL EXPANSION COEFFICIENTS OF SOME MATERIALS USED FOR HOM LOAD ABSORBERS Valery, and for brazing ­ TiCuSil foil (4.5 % Ti, 26.7 % Cu, 8.8 % Ag). COEFFICIENTS OF THERMAL EXPANSION Ideally of the mutual shift of bonded materials, measurements of the thermal expansion coefficient were performed at our

232

Reforming Chicago's High Schools: Research Perspectives on School and System Level Change.  

ERIC Educational Resources Information Center

This collection of papers describes research on school and system level change in Chicago's high schools. Papers include "Introduction: Setting Chicago High School Reform within the National Context" (Valerie E. Lee); (1) "The Effort to Redesign Chicago High Schools: Effects on Schools and Achievement" (G. Alfred Hess, Jr. and Solomon Cytrynbaum);

Lee, Valerie E., Ed.

233

Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake  

E-print Network

Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake Valerie B, sweetness) sensations from alcohol. We determined whether the TAS2R38 gene at 7q36 predicted PROP bitterness, alcohol sensation and use. Methods: Healthy adults (53 women, 31 men; mean age 36 years)--primarily light

Kidd, Kenneth

234

Technology and Higher Education: Report from the Front.  

ERIC Educational Resources Information Center

Includes two reports on the current integration of technology in postsecondary education. Mara Mayor and Peter Dirr discuss the relationship between technology and access and quality. Valerie Crane presents study results on how students use and evaluate telecourses compared to on-campus courses. (DMM)

Mayor, Mara; And Others

1987-01-01

235

Recent Developments in Algebraic Combinatorics  

E-print Network

fans by Paul Bressler and Valery Lunts and their application by Kalle Karu to the toric h-Witten invariants, and the toric h-vector of a convex polytope. Note. The notation C, R, and Z, denotes the sets or conjectured to be inte- gral. For example, Robinson conjectured that if 1 p q r and k = p + q + r

236

PublicationsmailagreementNo.40014024 the VeSSeL WILL  

E-print Network

The University of Victoria's community newspaper ring.uvic.ca theeagleshave landed(again) P.4 SPEED READING of their beans and have a 50-per-cent share in their company. "UVic is the first Canadian university to move. by Valerie Shore The University of Victoria is aiming for a world-first in green shipping technology, thanks

Pedersen, Tom

237

Michigan Institute for Plasma Sci-  

E-print Network

kinetics and plasma elec- trodynamics, plasma diagnostics, light source science and technology, plasmaMichigan Institute for Plasma Sci- ence and Engi- neering Seminar Physics of Low Pressure Inductive Discharges Dr. Valery Godyak RF Plasma Consulting & University of Michigan Wednesday, 1 December 2010 - 4

Shyy, Wei

238

Understanding the long-term effects of species invasions  

E-print Network

Understanding the long-term effects of species invasions David L. Strayer1 , Valerie T. Eviner1 and evolutionary processes that modulate the effects of invasive species over time, and argue that such processes of invasive species. These processes (including evolution, shifts in species composition, accumulation

239

S S R L G E N E R A L P H O N E L I S T V 8 6/25/12 SECURITY X 2551 http://www2.slac.stanford.edu/comp/telecom/phone/  

E-print Network

............ 4302 Bibee, Matt.................... 4281 Borzenets, Valery.......... 5584 408 836-5975 Boussina, P.J 925 997-9444 Escobar, Ricardo........... 3966 570-8947 Pgr Estebanez, Edgar ......... 5420 940..............3153 723-1328 Hollenbeck, Michael ......8684 Hollenbeck, William.......4720 849-9498 Pgr Hoover, Chris

Kay, Mark A.

240

CALIFORNIA ENERGY CALIFORNIA'S STATE ENERGY  

E-print Network

CALIFORNIA ENERGY COMMISSION CALIFORNIA'S STATE ENERGY EFFICIENT APPLIANCE REBATE PROGRAM INITIAL November 2009 CEC-400-2009-026-CMD Arnold Schwarzenegger, Governor #12;#12;CALIFORNIA ENERGY COMMISSION Program Manager Paula David Supervisor Appliance and Process Energy Office Valerie T. Hall Deputy Director

241

The Learning System. Volume 4, Number 6  

ERIC Educational Resources Information Center

Ensuring quality teaching in every classroom across an entire system of schools--that's what a district leader's job is all about. A district leader's challenges are unique so "The Learning System" was created with that in mind. This issue contains: (1) Competing Values Form Obstacles to Change: Deep Conversations Uncover Invisible Goals (Valerie

von Frank, Valerie, Ed.

2009-01-01

242

Reconciliation of Retailer Claims, 2005 CommissionReport  

E-print Network

OFFICE Valerie Hall Deputy Director EFFICIENCY, RENEWABLES, AND DEMAND ANALYSIS DIVISION #12;Acknowledgements The following individuals contributed to the development of this report, by assisting individuals contributed to the development of this report by collecting data and assisting with the analysis

243

RECONCILIATION OF RETAILER CLAIMS, COMMISSIONREPORT  

E-print Network

Renewable Energy Office Valerie Hall Deputy Director Efficiency, Renewables & Demand Analysis Division #12;Acknowledgements The following individuals contributed to the development of this report, by assisting to the development of this report by collecting data and assisting with the analysis of data: Terry Ewing Tony

244

University of Sussex Centre for Higher Education and Equity  

E-print Network

(social class, educational disadvantage, disciplinary exclusion, teacher education) · Professor Valerie of Education and Social Work which is based in Essex House on the University of Sussex campus. The University and Equity Research (CHEER) Department of Education School of Education and Social Work Essex House

Sussex, University of

245

Literacy, Community, and Youth Acts of Place-Making  

ERIC Educational Resources Information Center

Valerie Kinloch describes how the literacy narratives around place-making by Phillip, an African American teenager who resides in this historic community, demonstrate complexities of confronting power, struggle, and identity within an out-of-school community that is rapidly becoming gentrified. (Contains 3 notes.)

Kinloch, Valerie

2009-01-01

246

Defending Where the Attacker Isn't Peter Gutmann  

E-print Network

Cybercrime is a multibillion dollar industry Last year [2004] was the first year that proceeds from cybercrime were greater than proceeds from the sale of illegal drugs -- Valerie McNiven, US Treasury cybercrime advisor · (These figures are unreliable, but nevertheless it's a serious problem) But we've got

Gutmann, Peter

247

Associate ProfessorThe Department of African American and African Diaspora Studies (AAADS) and the Department of History at Indiana University seek to hire a scholar of  

E-print Network

) and the Department of History at Indiana University seek to hire a scholar of twentieth-century African American Grim at vgrim@indiana.edu or by mail to Dr. Valerie Grim, Chair, Department of African American and African Diaspora Studies, Indiana Univer- sity, Memorial Hall East-Room M29, Bloomington, IN 47405

Indiana University

248

Crossing Boundaries: Collaborative Solutions to Urban Problems. Selected Proceedings of the National Conference on Urban Issues (1st, Buffalo, New York, November 11-13, 1994).  

ERIC Educational Resources Information Center

Selected papers are presented from a national conference on urban issues. They are: (1) "Collaboration as a Social Process: Inter-Institutional Cooperation and Educational Change" (Charles F. Underwood and Hardy T. Frye); (2) "Mobilizing the Village To Educate the Child" (Valerie Maholmes); (3) "Pathways to Teaching: An Urban Teacher Licensure

Koritz, Douglas, Ed.; And Others

249

Edition No 36 November 2007 Congratulations to  

E-print Network

to the Materials Congress 2006. #12;Professor Roderick Smith being presented with the Thornton Medal (Clark Maxwell Blackney, Term-Time Technician in the Student Training Workshop, who started on 5th November Mr Valerie behaviour Castrol Limited 144,838 2 years Professor A Taylor and Dr Y Hardalupas Evaluation of Diesel sprays

250

"Bad Talk" Made Good: Language Variety in Four Caribbean British Children's Poets  

ERIC Educational Resources Information Center

This article looks at how four British-based poets born in the Caribbean exploit the rich language repertoire available to them in their work for children and young people. Following initial consideration of questions of definition and terminology, poetry collections by James Berry, John Agard, Grace Nichols and Valerie Bloom are discussed, with a

Lockwood, Michael

2014-01-01

251

Crossing Boundaries: Teaching and Learning with Urban Youth. Teaching for Social Justice Series  

ERIC Educational Resources Information Center

In her new book, Valerie Kinloch, award-winning author of "Harlem on Our Minds", sheds light on the ways urban youth engage in "meaning-making" experiences as a way to assert critical, creative, and highly sophisticated perspectives on teaching, learning, and survival. Kinloch rejects deficit models that have traditionally defined the literacy

Kinloch, Valerie

2012-01-01

252

The Public Assault on America's Children: Poverty, Violence, and Juvenile Injustice. The Teaching for Social Justice Series.  

ERIC Educational Resources Information Center

This collection of papers reveals the systemic violence, poverty, educational neglect, and social disregard that shape the lives of poor children in the United States. After an introduction, "Savage Policies: Systemic Violence and the Lives of Children" (Valerie Polakow), there are eight chapters: (1) "A Crucible of Contradictions: Historical

Polakow, Valerie, Ed.

253

ORGANIZATIONAL CHART--AS OF FEB. 2014 David Engelke, PhD  

E-print Network

Michael Mulholland, MD, PhD Surgery Edward Bove, MD Cardiac Surgery David Fink, MD Neurology Carol Carpenter, MD Orthopaedic Surgery Gregory Dalack, MD Psychiatry Robert Neumar, MD, PhD Emergency Medicine Timothy Johnson, MD Obstetrics and Gynecology Valerie Castle, MD Pediatrics & Communicable Diseases

Kirschner, Denise

254

Labor Relations Unit Assignments Dept ID Department  

E-print Network

Capital Finance Gina Harwood H 1009716 Cardiac Catheterization Lab Valerie Manuel H 1009391 Cardiac Unit Noel VanDeviver H 1009618 D-12 Vascular / GI Surgery Noel VanDeviver H 1009620 D-14 Orthopedics Noel VanDeviver H 1009613 D-6 Cardiology Noel VanDeviver H 1009625 D-7 Pediatrics Noel VanDeviver

Leistikow, Bruce N.

255

Taking a Closer Look at the "Grit" Narratives  

ERIC Educational Resources Information Center

In this article Ira Socol explores the pros and cons of Paul Tough's "How Children Succeed: Grit, Curiosity, and the Hidden Power of Character." As Tough told Valerie Strauss, "The book is about two things: first, an emerging body of research that shows the importance of so-called non-cognitive skills in children's

Socol, Ira

2014-01-01

256

ON THE MODE SYNTHESIS IN THE SYNCHROSQUEEZING METHOD Thomas Oberlina,b  

E-print Network

ON THE MODE SYNTHESIS IN THE SYNCHROSQUEEZING METHOD Thomas Oberlina,b , Sylvain Meignena.oberlin,sylvain.meignen,valerie.perrier}@imag.fr ABSTRACT The synchrosqueezing is a powerful tool to analyse and repre- sent multicomponent signals of applications. Index Terms-- Analytic Wavelet Transform, Empirical Mode Decomposition, Synchrosqueezing

Meignen, Sylvain

257

P. George Benson (5500) George W. Hynd (5527)  

E-print Network

, Planning, & Information Management James T. Posey (5708) Dean, School of the Arts Valerie B. Morris (8222 Frances C. Welch (5613) Dean, School of Humanities & Social Sciences Jerold L. Hale (0760) Dean, School Services, Library James Williams III (5530) Technical Services, Library Katina Strauch (5530) Revision Date

Kasman, Alex

258

THE DENDROCLIMATIC SIGNAL IN WHITE SPRUCE (PICEA GLAUCA) RING-WIDTHS,  

E-print Network

undoubtedly helped me through the long days of thesis writing. Mom and dad, thank you for your support over, and Thomas MacTavish, to name a few. To Alexandra Guiry, your love, encouragement, and support has been a blessing and I can't thank you enough. Valerie and Fred, I am so happy to be your brother, and becoming

Patterson, Timothy

259

Biology 2250 Principles of Genetics  

E-print Network

1 Biology 2250 Principles of Genetics Instructors: Dr. Steven M. Carr B Molecular Genetics Dr. David J. Innes B MendelianGenetics Biology 2250 Principles of Genetics Lab Instructor: Valerie Power Genetics Laboratory: SN-4110 (Lab. organization meeting week of Sept. 13: Groups A &B) Lab. Demonstrators

Innes, David J.

260

Technical Report TRCS Series A Formalization of Mediating Connectors: Towards on  

E-print Network

Interoperability Romina Spalazzese, Paola Inverardi, Valerie Issarny Technical Report TRCS 004/2009 The Technical of Mediating Connectors: Towards on the fly Interoperability Romina Spalazzese Universit`a degli Studi dell'Aquila via Vetoio I-67100 L'Aquila, Italy romina.spalazzese@di.univaq.it Paola Inverardi Universit`a degli

Boyer, Edmond

261

Royal Botanical Gardens 680 Plains Road West, Burlington, ON -"Free Parking"  

E-print Network

FamilyMedicine McMasterUniversity,Hamilton,ON Valerie Spironello, MSW, RSW SocialWorker Assistant,www.ChooseWellness.ca Maryann Kovljenic, BA/BSW, RSW, MBA SocialWorker-3West,PalliativeCareProgram HamiltonHealthSciences St.Peter'sHospital,Hamilton,ON Carol Sweeney, BSW, RSW SocialWorker,GIM Teacher,DivisionofPalliativeCare Professional

Haykin, Simon

262

THE CENTER FOR NANOPHASE MATERIALS SCIENCES USER GROUP MEMBERS August 9, 2010  

E-print Network

Dartmouth College Baker, Lane Indiana U. Baker, Sheila Harbach Engineering & Solutions, Inc. Balke, Nina Pennsylvania State U. Blackstock, Silas U. Alabama, Tuscaloosa Bliznyuk, Valery Western Michigan U. Bloemer. Florida Chandler, Clive FEI Company Chang,Chia-Chen College of William & Mary Chang, Jen-Yung Michigan

263

History Honors Symposium 2007 William L. Clements Library  

E-print Network

. Tonsor History of Ideas Award Karen Carmichael Americanization and Mexican Immigrants: Racism on "Americanization and Mexican Immigrants: Racism and Citizenship in Conflict in 1920s Detroit". #12;The three Award (2) Valerie Samet Equality of Devotion: Women of the Paris Commune, 1871 Advisor: Joshua Cole Amy

Edwards, Paul N.

264

Acoustic detection and classification of river boats Amir Averbuch a,  

E-print Network

Acoustic detection and classification of river boats Amir Averbuch a, , Valery Zheludev a , Pekka September 2010 Available online 13 October 2010 Keywords: Hydro-acoustic signature Wavelet packet Best acoustic signature against an existing database of recorded and processed acoustic signals. We characterize

Averbuch, Amir

265

Higher Prices from Entry: Pricing of Brand-Name Drugs  

E-print Network

Higher Prices from Entry: Pricing of Brand-Name Drugs Jeffrey M. Perloff* Valerie Y. Suslow** Paul anti-ulcer drugs rose as new products entered the market. #12;Higher Prices from Entry: Pricing of Brand-Name Drugs When a new firm starts marketing a product that is spatially differentiated from

Perloff, Jeffrey M.

266

Higher Prices from Entry: Pricing of Brand-Name Drugs  

E-print Network

Higher Prices from Entry: Pricing of Brand-Name Drugs Jeffrey M. Perloffa Valerie Y. Suslowb,* Paul or collusive game. We find support for our theory using data on brand-name entry in the anti-ulcer drug market; Pharmaceutical drugs #12;1. Introduction When a new firm starts marketing a product that is spatially

Perloff, Jeffrey M.

267

Ontology Development at the Conceptual Level for Theory-Aware ITS Authoring  

E-print Network

.valery@courrier.uqam.ca Abstract. This paper presents ontology engineering at the conceptual level, based on case analysis where@ei.sanken.osaka-u.ac.jp Abstract. This paper presents ontology engineering at the conceptual level, based on case analysis where ontology engineering (OE) at the conceptual level, based on case analysis where an author (a human

Paris-Sud XI, Université de

268

Teachers Teaching Teachers (T3)[TM]. Volume 4, Number 6  

ERIC Educational Resources Information Center

"Teachers Teaching Teachers" ("T3") focuses on coaches' roles in the professional development of teachers. Each issue also explores the challenges and rewards that teacher leaders encounter. This issue includes: (1) Values and Clarity Build Classroom Language (Valerie von Frank); (2) Tools: Identifying and Clarifying Beliefs about Learning; (3)

von Frank, Valerie, Ed.

2009-01-01

269

Changes in the plasma concentration of arginine vasotocin during oviposition in sea turtles  

E-print Network

invertebrate taxa. Immunocytological investigations have isolated immunoreactive neurohypophyseal peptide-like molecules in the nervous systems of three species of gastropod mollusc (Sawyer et al. , 1984, 1985; Schot et al. , 1981), one cephalopod species...), vascular responses (Chan, 1977), sodium metabolism (Sawyer and Pang, 1979), reproduction (LaPointe, 1977), behavior modification (Diakow and Riamondi, 1981), the release of anterior pituitary hormones (Yamashita, 1980; Fryer and Leung, 1982), and may...

Figler, Robert Alan

2012-06-07

270

Neonatal screening for congenital adrenal hyperplasia  

Microsoft Academic Search

Capillary blood samples from 42930 infants born in the Italian region of Emilia-Romagna were collected for 17-hydroxyprogesterone radioimmunoassays on days 2, 3, 4, 5, 6, and 7, or between days 7 and 15 of life. A microfilter paper method modified from that of Pang et al.1 was used for this assay. Pathologic values of 17-hydroxyprogesterone were found in 5 infants

E Cacciari; A Balsamo; A Cassio; S Piazzi; F Bernardi; S Salardi; A Cicognani; P Pirazzoli; F Zappulla; M Capelli

1983-01-01

271

Neonatal Screening for Congenital Adrenal Hyperplasia Using a Microfilter Paper Method for 17-?-Hydroxyprogesterone Radioimmunoassay  

Microsoft Academic Search

We examined 22,233 infants born in Emilia-Romagna (Italy). Capillary blood samples for 17-OH-progesterone assay were collected on the 3rd, 4th, 5th, 6th or 7th day of life on filter paper of the same type used for the screening of aminoacidopathy and hypothyroidism. 17-OH-progesterone values were determined using a micromethod modified from that of Pang and co-workers. 20 pg\\/disk was considered

Emanuele Cacciari; Antonio Balsamo; Alessandra Cassio; Sandro Piazzi; Filippo Bernardi; Silvana Salardi; Alessandro Cicognani; Piero Pirazzoli; Franco Zappulla; Maurizio Capelli; Magda Paolin

1982-01-01

272

A new fossil petalurid dragonfly (Odonata: Petaluroidea: Aktassiidae) from the Cretaceous of China  

Microsoft Academic Search

LI, Y.J., HAN, G., NEL, A. REN, D., PANG, H. & LIU. X.L., iFirst article. A new fossil petalurid dragonfly (Odonata: Petaluroidea: Aktassiidae) from the Cretaceous of China. Alcheringa, 14. ISSN 0311-5518.The new petalurid species Pseudocymatophlebia boda is described from Lower Cretaceous strata of Inner Mongolia, China. It provides additional morphological characters for this genus, which has been previously recorded

Yongjun Li; Gang Han; Andr Nel; Dong Ren; Hong Pang; Xueling Liu

2012-01-01

273

Set # Name Size (Towne) Forward Reverse Probe Author Date Citation 1 TRL11, IRL11 ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 44264432  

E-print Network

ATAGGAGGCGCCACGTATTC Bai 1997 Clinical Chemistry 43:10 p1843-1849 15 gB-A T A P O R I M B Bai 1997 Bai 1997) 335-342 UL55&56 / gB 14 gB-B A P 320 TACCCCTATCGCGTGTGTTC CCTCCTATAACGCGGCTGTA Bai 1997 Clinical Chemistry 43:10 p1843-1849 14 TACCCCTATCGCGTGTGTTC CCTCCTATAACGCGGCTGTA Pang 2003 JOURNAL OF CLINICAL

274

The age-dependent binding of CBP\\/tk, a ccaat binding protein, is deregulated in transformed and immortalized mammalian cells but absent in premature aging cells  

Microsoft Academic Search

CBP\\/tk, CCAAT Binding Protein for thymidine kinase, has been shown to bind to the distal and proximal CCAAT elements in human TK gene at G1\\/S boundary in normal human IMR-90 cells after serum stimulation (Pang and Chen, 1993). We now show that the serum-induced binding activity of CBP\\/tk was inversely related to the population doubling level (PDL) of the normal

Jong Hwei Pang; Lifeng Good; Kuang Yu Chen

1996-01-01

275

Soliton stars at finite temperature  

NASA Astrophysics Data System (ADS)

We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature Tc ~ 100-200 MeV, a first order phase transition occurs leading to the formation of soliton stars with some characteristics similar to those considered by Lee and Pang but with much smaller mass and size. When they cool to their cold configuration their mass ~ 10-6 Msolar.

Cottingham, W. N.; Vinh Mau, R.

1991-05-01

276

Parameter estimation in ordinary differential equations  

E-print Network

: Bart Childs (Chair of Committee) Daren B.H. Cline (Member) Vivek Sarin (Member) Valerie E. Taylor (Head of Department) May 2003 Major Subject: Computer Science iii ABSTRACT Parameter Estimation in Ordinary Differential Equations. (May 2003) Chee Loong... in Temasek Polytechnic v ACKNOWLEDGMENTS My greatest gratification and appreciation goes to Professor Childs, Professor Cline and Professor Sarin for their guidance and assistance. They have made my learning experiences at Texas A&M a fruitful and memorable...

Ng, Chee Loong

2004-09-30

277

Statistical static timing analysis considering process variations and crosstalk  

E-print Network

Vivek Sarin Weiping Shi Head of Department, Valerie Taylor August 2005 Major Subject: Computer Science iii ABSTRACT Statistical Static Timing Analysis Considering Process Variations and Crosstalk. (August 2005) Senthilkumar... of the industry. I have learned many things from him and consider myself fortunate to have been one of his students. I would also like to thank Drs. Mahapatra, Sarin and Shi for being on my committee. I am grateful to Dr. Shi for allowing me to use his research...

Veluswami, Senthilkumar

2005-11-01

278

An aid to convert spreadsheets to higher quality presentations  

E-print Network

Approved as to style and content by: Bart Childs (Chair of Committee) Mac Lively (Member) Rodger J. Koppa (Member) Valerie E. Taylor (Head of Department) May 2004 Major Subject: Computer Science iii ABSTRACT An Aid to Convert Spreadsheets to Higher Quality... Presentations. (May 2004) Wasiu Olaniyi Olajide, B.S., University of Ibadan Chair of Advisory Committee: Dr. Bart Childs A table is often the preferred medium for presenting quantative information. In some cases the presentation of quantative information can...

Olajide, Wasiu Olaniyi

2005-08-29

279

KSC-03PD-1470  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Bob McLean, Southwest Texas State University, and Valerie Cassanto, Instrumentation Technology Associates, Inc., study one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

280

KSC-03PD-1467  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, Instrumentation Technology Associates, Inc., studies one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

2003-01-01

281

KSC-03PD-1459  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Bob McLean, Southwest Texas State University; Valerie Cassanto, Instrumentation Technology Associates, Inc.; and Dennis Morrison, NASA Johnson Space Center, process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

282

KSC-03PD-1457  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., and Bob McLean, from the Southwest Texas State University, transfer to a new container material from one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

283

KSC-03PD-1462  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Valerie Cassanto, Instrumentation Technology Associates, Inc., and Dr. Dennis Morrison, NASA Johnson Space Center, analyze one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

284

KSC-03PD-1454  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., and Bob McLean, from the Southwest Texas State University, work on an experiment found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

285

KSC-03PD-1456  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., examines closely the container containing one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

286

KSC-03PD-1452  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto and Bob McLean talk to a reporter about experiments found during the search for Columbia debris. Cassanto is with Instrumentation Technology Associates Inc. and McLean is with the Southwest Texas State University. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

2003-01-01

287

Soap Opera Video on Handheld Computers to Reduce Young Urban Womens HIV Sex Risk  

Microsoft Academic Search

The purpose of this study was to develop a soap opera video, A Story about Toni, Mike, and Valerie, designed to communicate HIV risk reduction themes. The study evaluated viewing the video and responding to audio computer\\u000a assisted self-interview (ACASI) on a handheld computer. The sample was 76 predominately African American women, aged 1829,\\u000a in sexual relationships with men. Data

Rachel Jones

2008-01-01

288

A Distributed Pool Architecture for Genetic Algorithms  

E-print Network

for the degree of MASTER OF SCIENCE Approved by: Co-Chairs of Committee, Jennifer Welch Nancy Amato Committee Members, Takis Zourntos Head of Department, Valerie Taylor December 2009 Major Subject: Computer Engineering iii ABSTRACT A Distributed Pool Architecture... for Genetic Algorithms. (December 2009) Gautam Samarendra N Roy, B. Tech., Indian Institute of Technology Guwahati Co?Chairs of Advisory Committee: Dr. Jennifer Welch Dr. Nancy Amato The genetic algorithm paradigm is a well-known heuristic for solving many...

Roy, Gautam

2011-02-22

289

Supporting fault-tolerant communication in networks  

E-print Network

OF SCIENCE Approved by: Co-Chairs of Committee, Jennifer Welch Alexander Sprintson Committee Member, Anxiao Jiang Head of Department, Valerie E. Taylor December 2008 Major Subject: Computer Engineering iii ABSTRACT Supporting Fault-Tolerant Communication... in Networks. (December 2008) Khushboo Kanjani, B.Tech., Indian Institute of Technology Roorkee, India Co?Chairs of Advisory Committee: Dr. Jennifer Welch Dr. Alex Sprintson We address two problems dealing with fault-tolerant communication in networks...

Kanjani, Khushboo

2009-05-15

290

COLOR PREFERENCES RELATIVE TO DEMOGRAPHIC FACTORS, PERSONALITY, AND SELF-CONCEPT WITH IMPLICATIONS FOR HOMEMAKING EDUCATION  

Microsoft Academic Search

ACKNOWLEDGMENTS The investigator,wishes to express sincere appre ciation to Dr. Valerie Chamberlain, chairman of the com mittee, for her guidance and patient understanding through out,this,study,and,to the,other,committee,member.,Dr. Joan Kelly, whose suggestions and criticisms kept the study progressing. In addition, the author wishes to thank Dr. Norma,Walker,and,Dr. Merrilyn,Cummings,for,their,com ments during the preparation of the manuscript, Mr. Gary Klein for his assistance with

JANIS M. CHOATE

1977-01-01

291

Symposium Organizers Juanamara Cordones-Cook, Professor of Spanish,  

E-print Network

.m., Legends Room, MizzouRec Center Afternoon sessions: 2:00 p.m.­6:30 p.m., Black Culture Center, Main (on your own) Afternoon sessions in the Main Multipurpose Room, Black Culture Center 2:00­3:00 Session Luis, Vanderbilt University 4:00­4:30 Coffee break 4:30­5:30 Session V: Valerie Kaussen, Chair

Noble, James S.

292

A Rice Glutamate ReceptorLike Gene Is Critical for the Division and Survival of Individual Cells in the Root  

E-print Network

A Rice Glutamate Receptor­Like Gene Is Critical for the Division and Survival of Individual Cells,a Keke Yi,a Yanfen Liu,b Valerie J. Karplus,b Ping Wu,a,3 and Xing Wang Dengc,3 a State Key Laboratory their function is largely unknown. We have identified a rice (Oryza sativa) Glu receptor­like gene, designated

Deng, Xing-Wang

293

Ladies on the Label: A Meta-Analysis of Stereotypes in Advertising  

Microsoft Academic Search

ABSTRACT Ladies on the Label: A Meta-Analysis of Stereotypes in Advertising Valerie Spears This thesis explores the origins of modern-day racism and sexism by combining a meta-analysis with an in-depth historical examination,of the Aunt Jemima and Betty Crocker campaigns. The ten studies used in the meta-analysis were selected and analyzed based on criteria developed from the research question and literature

Valerie L. Spears; Corley Dennison; Janet Dooley; Cicero M. Fain

2007-01-01

294

Department of Computer Science and Engineering Phone List TEXAS A&M UNIVERSITY  

E-print Network

-5469 509C Caverlee, James caverlee 5-0537 403 Chai, Jin-Xiang jchai 5-3510 527D Chen, Jianer chen 5-Hoi shsze 5-5009 328B Taylor, Valerie taylor 5-2497 517 Walker, Hank walker 2-4387 515B Welch, Jennifer welch 5-5076 425G Williams, Tiffani tlw 5-7977 328C LECTURERS Daugherity, Walter daugher 5-1308 318A

295

Dissolution-induced surface modifications and permeability changes associated with fluid flow through an abraded saw-cut in single crystal quartz  

E-print Network

DISSOLUTION-INDUCED SURFACE MODIFICATIONS AND PERMEABILITY CHANGES ASSOCIATED WITH FLUID FLOW THROUGH AN ABRADED SAW-CUT IN SINGLE CRYSTAL QUARTZ A Thesis by JAlvlES ALBERT BOWMAN, JR, Submined to the Oflice of Graduate Studies of Texas A8r...-CUT IN SINGLE CRYSTAL QUARTZ A Thesis by JAMES ALBERT BOWMAN, JR. Approved as to style and content by: Brann Jo on (Co-Chairman ommittee) Thomas T. Tieh (Co-Chairman of Committee) Andrew )ash (Member) Frank Dale Morgan (Member) John H. pang (Head...

Bowman, James Albert

2012-06-07

296

Soliton stars at finite temperature  

NASA Astrophysics Data System (ADS)

We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature Tc~100-200 MeV, a first-order phase transition occurs leading to the formation of soliton stars with characteristics similar to those considered by Lee and Pang but with a much smaller mass and size. We study the evolution of these soliton stars with the temperature from the early Universe to the present time.

Cottingham, W. N.; Vinh Mau, R.

1991-09-01

297

Cosmic X-ray background and solitars.  

NASA Astrophysics Data System (ADS)

In this paper the authors has examined the observational consequences of a class of new astronomical objects proposed by Friedberg, Lee and Pang, called solitars which are degenerate vacuum states embedded with particles. A study is made to include finite temperature effect and pair creation. Quark is believed to be the only species that can exist in the interior of solitars. Massive quark solitars are primarily X-ray emitters and may account for the large unexplained thermal component of the cosmic X-ray background.

Chiu, H.-Y.

298

Observable relic features of soliton stars from early Universe.  

NASA Astrophysics Data System (ADS)

Nontopological soliton stars belong to a wide class of stable extended objects characterized by a conserved charge (such as the net number of particles). The author discusses the time evolution of one particular model due to Lee and Pang. Radiation from soliton stars mix with the black body background radiation of the Universe, and if not thermalized, it may cause a small distortion in the short wavelength end of the observed cosmic background radiation. These distortions may be observed as spatial inhomogeneities in the short wavelength end.

Chiu, Hong-Yee

299

The geomagnetic storm of 1910 May 18 and the tail of Halley's Comet  

NASA Astrophysics Data System (ADS)

On May 18, 1910, the Lu-Kia-Pang Observatory near Shanghai recorded a geomagnetic storm, but it was thought that this storm was not connected with the tail of Halley's comet. In the present paper, it is argued that this storm, rather than originating in some solar activity (coronal hole or solar flare), could have been the result of the interaction of the plasma tail of Halley's comet and the earth's magnetosphere. The time lag between the storm and the transit as calculated by Leuchner (1910) is given, and the characteristic features of cometary tails and the mechanisms by which they produce geomagnetic storms are analyzed.

Yan, L.-S.; Li, Z.-Y.; Gu, S.-Y.

1984-09-01

300

Stability of excited bosonic stellar configurations  

NASA Astrophysics Data System (ADS)

In this paper I study the problem of the dynamical stability of Bose star configurations which correspond to excited states. In particular I show that the eigenvalues of the pulsation equation, which governs the time evolution of the infinitesimal radial oscillations, are real. This, together with the theorem, proved by Lee and Pang, that for a configuration with critical central density ?crit the pulsation equation has a zero mode and the fact that for central densities much smaller than ?crit the lowest eigenvalue is positive, leads to the conclusion that the excited Bose star configurations are classically stable for central densities up to ?crit.

Jetzer, Ph.

1989-05-01

301

Exploring the variability in how educators attend to science classroom interactions  

NASA Astrophysics Data System (ADS)

Many researchers assert educators must develop a shared instructional vision in order for schools to be effective. While this research tends to focus on educators' alignment around goals of science classrooms, I argue that we can't assume that educators agree on what they see when they look at science classrooms. In this dissertation, I explore the variability in what teachers and leaders notice in science classroom episodes and how they reason about what they notice. I ground my studies in real classroom practice: a videotaped lesson in the first study and a live classroom observation in the second. In Chapter 2, I discuss the importance of grounding discussions about teaching and learning in classroom artifacts, a commitment that motivates my dissertation: educators may have a shared vision when discussing teaching and learning in the abstract but disagree about whether that vision is being realized in a classroom. I then describe and analyze the video clip I used in my interviews, highlighting moments that I consider to be good teaching and learning. In Chapter 3, I present my first study, in which I showed this episode to 15 different science teachers, science instructional leaders, and principals. I found that participants attended to many different features in the episode, which led to significant disagreement about what is happening in the episode. Additionally, I found that these differences in attention corresponded to differences in how participants were framing the activity of watching the clip. In Chapter 4, I explore the attentional variability of one science instructional leader, Valerie, in multiple contexts. In addition to interviewing Valerie about the videotaped lesson, I also observed Valerie engage in an "observation cycle" with a teacher. Even though Valerie is quite skilled at attending to student thinking in some contexts, I found that Valerie's attention is strongly context-dependent and gets pulled away from students' scientific thinking when she uses a district mandated form. Finally, in Chapter 5 I summarize my findings and describe the implications my work has for both research and practice.

Gillespie, Colleen Elizabeth

302

Multi-writer consistency conditions for shared memory objects  

E-print Network

Approved by: Chair of Committee, Jennifer L. Welch Committee Members, Jianer Chen Alexander Parlos Vivek Sarin Head of Department, Valerie E. Taylor December 2007 Major Subject: Computer Science iii ABSTRACT Multi-Writer Consistency Conditions for Shared... to express my gratitude to the members of my advisory com- mittee, Dr. Jianer Chen, Dr. Alexander Parlos, and Dr. Vivek Sarin, for all the help you extended to me during my study and research. Finally, I would like to thank my parents and my family. I love...

Shao, Cheng

2008-10-10

303

Multi-writer consistency conditions for shared memory objects  

E-print Network

Approved by: Chair of Committee, Jennifer L. Welch Committee Members, Jianer Chen Alexander Parlos Vivek Sarin Head of Department, Valerie E. Taylor December 2007 Major Subject: Computer Science iii ABSTRACT Multi-Writer Consistency Conditions for Shared... to express my gratitude to the members of my advisory com- mittee, Dr. Jianer Chen, Dr. Alexander Parlos, and Dr. Vivek Sarin, for all the help you extended to me during my study and research. Finally, I would like to thank my parents and my family. I love...

Shao, Cheng

2009-05-15

304

KSC-03PD-1464  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida, and Valerie Cassanto, Instrumentation Technology Associates, Inc., process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

2003-01-01

305

KSC-03PD-1466  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida, and Valerie Cassanto, Instrumentation Technology Associates, Inc., analyze one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

2003-01-01

306

KSC-03PD-1469  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida; Valerie Cassanto, Instrumentation Technology Associates, Inc.; and Dr. Dennis Morrison, NASA Johnson Space Center, process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

2003-01-01

307

KSC-03PD-1465  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida, and Valerie Cassanto, Instrumentation Technology Associates, Inc., process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

2003-01-01

308

STS-112 Flight Day 7 Highlights  

NASA Technical Reports Server (NTRS)

On this seventh day of STS-112 mission members of the crew (Commander Jeff Ashby; Pilot Pam Melroy; Mission Specialist Sandy Magnus, Piers Sellers, Dave Wolf, and Fyodor Yurchikhin) along with the Expedition Five crew (Commander Valery Korzun; Flight Engineer Peggy Whitson, and Sergei Treschev) are seen answering questions during the mission's press interview and photo opportunity. They answered various questions regarding the mission's objectives, the onboard science experiments, the extravehicular activities (EVAs) and the effects of living in space. Shots of the test deployment of the S1 truss radiator and Canadarm rotor joint are also shown.

2002-01-01

309

STS-96 FD Highlights and Crew Activities Report: Flight Day 10  

NASA Technical Reports Server (NTRS)

On this tenth day of the STS-96 Discovery mission, the flight crew, Commander Kent V. Rominger, Pilot Rick D. Husband, and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette, and Valery Ivanovich Tokarev are seen making final preparation for their return to Earth. Rominger Husband, and Ochoa checkout the flight control systems, perform hot-fired tests and verify the performance of Discovery's small steering jets. Jernigan and Tokarev stow all the equipment used in the mission. Payette deploys a small student-built payload called STARSHINE. The crew also tests all the communications channels.

1999-01-01

310

Mapping multimode system communication to a network-on-a-chip (NoC)  

E-print Network

of MASTER OF SCIENCE Approved as to style and content by: Rabi N. Mahapatra (Chair of Committee) Duncan M. H. Walker (Member) A. L. Narasimha Reddy (Member) Valerie E. Taylor (Head of Department) December 2003 Major Subject: Computer Engineering iii ABSTRACT... synthesis. iv To my parents Neela and Sunder. v ACKNOWLEDGMENTS Thanks are first due to Dr. Rabi Mahapatra. His insight and guidance have been instrumental in the completion of this research. I would like to thank the members of the Network-On-Chip group...

Bhojwani, Praveen Sunder

2004-09-30

311

The physician-cosmonaut tasks in stabilizing the crew members health and increasing an effectiveness of their preparation for returning to Earth  

NASA Astrophysics Data System (ADS)

During a final 4-month stage of I-year space flight of cosmonauts Titov and Manarov, a physician, Valery Polyakov was included on a crew for the purpose of evaluating their health, correcting physical status to prepare for the spacecraft reentry and landing operations. The complex program of scientific investigations and experiments performed by a physician included an evaluation of adaptation reactions of the human body at different stages of space mission using clinicophysiological and biochemical methods; testing of alternative regimes of exercises and new countermeasures to prevent an unfavorable effect of long-term weightlessness.

Polyakov, V. V.

312

Long-term space flights - personal impressions  

NASA Astrophysics Data System (ADS)

During a final 4-month stage of a 1-year space flight of cosmonauts Titov and Manarov, a physician, Valery Polyakov was included on a crew for the purpose of evaluating their health, correcting physical status to prepare for the spacecraft reentry and landing operations. The complex program of scientific investigations and experiments performed by the physician included an evaluation of adaptation reactions of the human body at different stages of space mission using clinicophysiological and biochemical methods; testing of alternative regimes of exercise and new countermeasures to prevent an unfavourable effect of long-term weightlessness.

Polyakov, V. V.

313

Low LBNP tolerance in men is associated with attenuated activation of the renin-angiotensin system  

NASA Technical Reports Server (NTRS)

Plasma vasoactive hormone concentrations [epinephrine (p(Epi)), norepinephrine (p(NE)), ANG II (p(ANG II)), vasopressin (p(VP)), endothelin-1 (p(ET-1))] and plasma renin activity (p(RA)) were measured periodically and compared during lower body negative pressure (LBNP) to test the hypothesis that responsiveness of the renin-angiotensin system, the latter being one of the most powerful vasoconstrictors in the body, is of major importance for LBNP tolerance. Healthy men on a controlled diet (2,822 cal/day, 2 mmol. kg(-1). day(-1) Na(+)) were exposed to 30 min of LBNP from -15 to -50 mmHg. LBNP was uneventful for seven men [25 +/- 2 yr, high-tolerance (HiTol) group], but eight men (26 +/- 3 yr) reached presyncope after 11 +/- 1 min [P < 0.001, low-tolerance (LoTol) group]. Mean arterial pressure (MAP) did not change measurably, but central venous pressure and left atrial diameter decreased similarly in both groups (5-6 mmHg, by approximately 30%, P < 0.05). Control (0 mmHg LBNP) hormone concentrations were similar between groups, however, p(RA) differed between them (LoTol 0.6 +/- 0.1, HiTol 1.2 +/- 0.1 ng ANG I. ml(-1). h(-1), P < 0.05). LBNP increased (P < 0. 05) p(RA) and p(ANG II), respectively, more in the HiTol group (9.9 +/- 2.2 ng ANG I. ml(-1). h(-1) and 58 +/- 12 pg/ml) than in LoTol subjects (4.3 +/- 0.9 ng ANG I. ml(-1). h(-1) and 28 +/- 6 pg/ml). In contrast, the increase in p(VP) was higher (P < 0.05) in the LoTol than in the HiTol group. The increases (P < 0.05) for p(NE) were nonsignificant between groups, and p(ET-1) remained unchanged. Thus there may be a causal relationship between attenuated activation of p(RA) and p(ANG II) and presyncope, with p(VP) being a possible cofactor. Measurement of resting p(RA) may be of predictive value for those with lower hypotensive tolerance.

Greenleaf, J. E.; Petersen, T. W.; Gabrielsen, A.; Pump, B.; Bie, P.; Christensen, N. J.; Warberg, J.; Videbaek, R.; Simonson, S. R.; Norsk, P.

2000-01-01

314

Anxiety sensitivity in bereaved adults with and without complicated grief.  

PubMed

Complicated grief (CG) is a bereavement-specific syndrome chiefly characterized by symptoms of persistent separation distress. Physiological reactivity to reminders of the loss and repeated acute pangs or waves of severe anxiety and psychological pain are prominent features of CG. Fear of this grief-related physiological arousal may contribute to CG by increasing the distress associated with grief reactions and increasing the likelihood of maladaptive coping strategies and grief-related avoidance. Here, we examined anxiety sensitivity (AS; i.e., the fear of anxiety-related sensations) in two studies of bereaved adults with and without CG. In both studies, bereaved adults with CG exhibited elevated AS relative to those without CG. In study 2, AS was positively associated with CG symptom severity among those with CG. These findings are consistent with the possibility that AS contributes to the development or maintenance of CG symptoms. PMID:25075646

Robinaugh, Donald J; McNally, Richard J; LeBlanc, Nicole J; Pentel, Kimberly Z; Schwarz, Noah R; Shah, Riva M; Nadal-Vicens, Mireya F; Moore, Cynthia W; Marques, Luana; Bui, Eric; Simon, Naomi M

2014-08-01

315

Neonatal screening for congenital adrenal hyperplasia.  

PubMed Central

Capillary blood samples from 42930 infants born in the Italian region of Emilia-Romagna were collected for 17-hydroxyprogesterone radioimmunoassays on days 2, 3, 4, 5, 6, and 7, or between days 7 and 15 of life. A microfilter paper method modified from that of Pang et al.1 was used for this assay. Pathologic values of 17-hydroxyprogesterone were found in 5 infants giving an incidence in this homogeneous Caucasian population of 1:8586. We also investigated 17-hydroxyprogesterone values in relation to the day of sampling and the possible correlation between 17-hydroxyprogesterone values and birthweight and gestational age. We concluded that neonatal screening for congenital adrenal hyperplasia caused by 21-hydroxylase deficiency was possible by this method and that the infants' maturity and the particular day of collection of the samples affect the values but not the validity of the screening. PMID:6639129

Cacciari, E; Balsamo, A; Cassio, A; Piazzi, S; Bernardi, F; Salardi, S; Cicognani, A; Pirazzoli, P; Zappulla, F; Capelli, M

1983-01-01

316

Uncertainty estimates for the Bayes Inference Engine, (BIE)  

SciTech Connect

In the fall 2007 meeting of the BIB users group, two approaches to making uncertainty estimates were presented. Ken Hanson asserted that if the BFGS optimizer was used, the inverse Hessian matrix was the same as the covariance matrix representing parameter uncertainties. John Pang presented preliminary results of a Monte Carlo method called Randomized Maximum Likelihood (RML). The BFGS/Hessian matrix approach may be applied to the region of the 'ideal model' Approximately 250 parameters describing the object density patches that are varied to match an image of 1,000,000 pixels. I cast this in terms of least squares analysis, as it is much better understood. This not as large a conceptual jump as some suppose because many of the functional blocks in the BIB are taken directly from existing least squares programs. If a Gaussian (normal) probability density function is assumed for both the observation and parameter errors, the Bayesian and least squares result should be identical.

Beery, Thomas A [Los Alamos National Laboratory

2009-01-01

317

Human trafficking: crime in our own backyard.  

PubMed

Imagine for a moment being in a small, cold, dark, and dirty room. You haven't seen your family in months and you're not sure if you ever will again. When the drugs that you've given begin to wear off, you feel hunger pangs because you haven't eaten anything in more hours than you can count. You hear a door opening and are filled with paralyzing fear and dread. You are never quite sure who or what will greet you on the other side of that door. You may have to endure a brutal beating, you may be forced to take drugs, or you may be raped. PMID:24685757

McNulty, Melissa S

2014-04-01

318

Anxiety Sensitivity in Bereaved Adults with and without Complicated Grief  

PubMed Central

Complicated grief (CG) is a bereavement specific syndrome chiefly characterized by symptoms of persistent separation distress. Physiological reactivity to reminders of the loss and repeated acute pangs or waves of severe anxiety and psychological pain are prominent features of CG. Fear of this grief-related physiological arousal may contribute to CG by increasing the distress associated with grief reactions and increasing the likelihood of maladaptive coping strategies and grief-related avoidance. Here, we examined anxiety sensitivity (i.e., the fear of anxiety-related sensations; AS) in two studies of bereaved adults with and without CG. In both studies, bereaved adults with CG exhibited elevated AS relative to those without CG. In Study 2, AS was positively associated with CG symptom severity among those with CG. These findings are consistent with the possibility that AS contributes to the development or maintenance of CG symptoms. PMID:25075646

Robinaugh, Donald J.; McNally, Richard J.; LeBlanc, Nicole J.; Pentel, Kimberly Z.; Schwarz, Noah R.; Shah, Riva M.; Nadal-Vicens, Mireya F.; Moore, Cynthia W.; Marques, Luana; Bui, Eric; Simon, Naomi M.

2014-01-01

319

Ponderable soliton stars  

NASA Astrophysics Data System (ADS)

The theory of Lee and Pang (1987), who obtained solutions for soliton stars composed of zero-temperature fermions and bosons, is applied here to quark soliton stars. Model soliton stars based on a simple physical model of the proton are computed, and the properties of the solitons are discussed, including the important problem of the existence of a limiting mass and thus the possible formation of black holes of primordial origin. It is shown that there is a definite mass limit for ponderable soliton stars, so that during cooling a soliton star might reach a stage beyond which no equilibrium configuration exists and the soliton star probably will collapse to become a black hole. The radiation of ponderable soliton stars may alter the short-wavelength character of the cosmic background radiation, and may be observed as highly redshifted objects at z of about 100,000.

Chiu, Hong-Yee

1990-12-01

320

Nucleon Compton Scaterring in the perturbative Limit  

NASA Astrophysics Data System (ADS)

Results of perturbative calculation for nucleon Compton scattering are presented. The calculations consider both the case of the incoming photon being real and the case of the incoming photon being virtual. Hard scattering amplitudes are calculated using a software package developed at NC State Universityfootnote[1]A. Pang and C.-R. Ji, Computers in Physics Vol 9 (No. 6), Nov/Dec 1995 p589-593footnote[2]A. Pang and C.-R. Ji, J. Comp. Phys. 115, 267 (1994). The integrations required to calculate total cross section are made following the approach of Kronfeld and Nizicfootnote[3]A. Kronfeld and B. Nizic, Phys. Rev. D 44, 3445 (1991). Poles are split into a real principal part plus an imaginary delta function. The delta functions are evaluated explicitly by hand; principal part integrations are evaluated numerically, after making a variable transformation to render the integrand finite over the range of integration. For the real photon case, there are five previous calculations to consider, each of which produced a different result.^3footnote[4]E. Maina and G. Farrar, Phys. Lett. B 206, 120 (1988).footnote[5]G. Farrar and H. Zhang, Phys. Rev. D 41, 3348 (1990).footnote[6]M. Vanderhaeghen, P. Guichon, and J. Van de Wiele, presented at workshop on virtual Compton scattering, Clermont-Ferrand, France, 1996.footnote[7]T. Brooks and L. Dixon, Phys. Rev. D 62, 114021 (2000). There is an agreement with the results of Brooks and Dixon.^7 For the virtual photon case, the new result is compared with that of Farrar and Zhang.^5 Since there are differences, we discuss which result is more believable and why. For the deeply virtual case (DVCS), comparison is made with other non-pertubative methods using GPDs.

Thomson, Richard

2004-11-01

321

Virtual Nucleon Compton Scattering in Perturbative QCD  

NASA Astrophysics Data System (ADS)

Results of perturbative calculation for nucleon Compton scattering are presented. The calculations consider both the case of the incoming photon being real and the case of the incoming photon being virtual. Hard scattering amplitudes are calculated using a software package developed at NC State University footnote[1]A. Pang and C.-R. Ji, Computers in Physics Vol 9 (No. 6), Nov/Dec 1995 p589-593footnote[2]A. Pang and C.-R. Ji, J. Comp. Phys. 115, 267 (1994). The integrations required to calculate total cross section are made following the approach of Kronfeld and Nizicfootnote[3]A. Kronfeld and B. Nizic, Phys. Rev. D 44, 3445 (1991). Poles are split into a real principal part plus an imaginary delta function. The delta functions are evaluated explicitly by hand; principal part integrations are evaluated numerically, after making a variable transformation to render the integrand finite over the range of integration. For the real photon case, there are five previous calculations to consider, each of which produced a different resultfootnote[3]A. Kronfeld and B. Nizic, Phys. Rev. D 44, 3445 (1991)footnote[4]E. Maina and G. Farrar, Phys. Lett. B 206, 120 (1988)footnote[5]G. Farrar and H. Zhang, Phys. Rev. D 41, 3348 (1990)footnote[6]M. Vanderhaeghen, P. Guichon, and J. Van de Wiele, presented at workshop on virtual Compton scattering, Clermont-Ferrand, France, 1996footnote[7]T. Brooks and L. Dixon, Phys. Rev. D 62, 114021 (2000). There is an agreement with the results of Brooks and Dixonfootnote[7]T. Brooks and L. Dixon, Phys. Rev. D 62, 114021 (2000). For the virtual photon case, the new result is compared with that of Farrar and Zhang footnote[5]G. Farrar and H. Zhang, Phys. Rev. D 41, 3348 (1990). Since there are differences, we discuss which result is more believable and why. For the deeply virtual case (DVCS), comparison is made with other non-pertubative methods using GPDs.

Thomson, Richard; Ji, Chueng-Ryong

2004-10-01

322

Get A Bite On The "Delicious" Young Star Cluster NGC 3603  

NASA Astrophysics Data System (ADS)

Young star cluster NGC3603 is one of the most massive star clusters in the Milky Way. It hosts 10 times more OB stars than the Orion Nebular Cluster, among which two are the most massive binaries in the Galaxy (Schnurr et al. 2008). To investigate this star formation arena, we utilize the HST/WFPC2 data. Those data are 10 years apart, which permits us to determine star membership. The cluster displays a significant degree of mass segregation (Pang et al. 2010). To quantify the lower limit in stellar mass at which we see segregation, we apply the minimum spanning tree analysis to cluster stars. The result shows that the stars above 5 solar mass exhibit pronounced mass segregation. What's the origin of this mass segregation? Simulations by Moeckel & Bate (2010) show that primordial segregation is transient and exists within the first 1 Myr. The cluster pre-main sequence (PMS) stars display an age spread up to 3 Myr, while the main sequence stars are consistent with an age of 1 Myr (Pang et al. 2010). And Beccari et al. (2010) derive an age spread as large as 10 Myr among PMS stars. Therefore, at present, the age of NGC3603 is still highly uncertain. A way to improve the age determination of the cluster is to quantify the differential reddening across the cluster. The differential reddening is about 0.8 mag from the core of NGC3603 to the outer region (Sung & Bessel 2004). This affects the PMS stars, which are spatially distributed more widely than the MS stars. We are currently deriving an extinction map of the cluster through Halpha and Paschenbeta images from WFC3 (work in progress), in order to correct the color magnitude diagram, and thus to better constrain the age of the cluster and the masses of its members.

Pang, Xiaoying; Grebel, E.; Altmann, M.; Pasquali, A.

2011-01-01

323

STS-91 Post Flight Presentation  

NASA Technical Reports Server (NTRS)

Footage of the Crew of STS-91 Discovery Shuttle, Commander Charles J. Precourt, Pilot Dominic L. Pudwill Gorie, Mission Specialists Wendy B. Lawrence, Franklin R. Chang-Diaz, Janet L. Kavandi, and Valery Victorovitch Ryumin, is shown. Scenes include the crew suit up, walk out to the transfer vehicle, and strap-in into the shuttle. Also presented are scenes of the start of the main engine, ignition of the solid rocket boosters, panoramic views of the Earth as the shuttle takes off, and the separation of the solid rocket boosters. The crew of Discovery opens the payload bay doors to the Mir International Space Station, completes SPACEHAB tunnel leak checks, greets crew in Mir Space Station, and transfers materials to Mir. Beautiful panoramic views of the Moon, and Mir above Cape Canaveral are seen. Scenes also include the crew of Discovery sharing meals, and exercising. The film ends with the reentry of the Discovery Space Shuttle into the Earth's atmosphere.

1998-01-01

324

KSC-03PD-1400  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto holds a piece of the Commercial ITA Biomedical Experiments payload that was carried on mission STS-107 and recently recovered. She is the daughter of John Cassanto of ITA, who is part of a recovery team transferring experiments to alternate containers. One of the experiments was the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), a Planetary Society-sponsored astrobiology experiment developed by the Israeli Aerospace Medical Institute and the Johnson Space Center Astrobiology Center, with joint participation of an Israeli and a Palestinian student. The recovery team also includes Eran Schenker of the Israeli Aerospace Medical Institute; David Warmflash of JSC, and Louis Friedman, executive director of the Planetary Society. The GOBBSS material will be sent to JSC where the science team will analyze the samples, studying the effects of spaceflight on bacterial growth.

2003-01-01

325

KSC-03PD-1398  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - John Cassanto of ITA and his daughter Valerie stand next to the table holding the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS) experiment that was carried on mission STS-107 as part of the Commercial ITA Biomedical Experiments payload. He is part of a recovery team transferring experiments to alternate containers. GOBBSS was a Planetary Society-sponsored astrobiology experiment developed by the Israeli Aerospace Medical Institute and the Johnson Space Center Astrobiology Center, with joint participation of an Israeli and a Palestinian student. The recovery team also includes Eran Schenker of the Israeli Aerospace Medical Institute; David Warmflash of JSC, and Louis Friedman, executive director of the Planetary Society. The GOBBSS material will be sent to JSC where the science team will analyze the samples, studying the effects of spaceflight on bacterial growth.

2003-01-01

326

KSC-03PD-1399  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Valerie Cassanto holds a piece of the Commercial ITA Biomedical Experiments payload that was carried on mission STS-107 and recently recovered. She is the daughter of John Cassanto of ITA, who is part of a recovery team transferring experiments to alternate containers. One of the experiments was the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), a Planetary Society-sponsored astrobiology experiment developed by the Israeli Aerospace Medical Institute and the Johnson Space Center Astrobiology Center, with joint participation of an Israeli and a Palestinian student. The recovery team also includes Eran Schenker of the Israeli Aerospace Medical Institute; David Warmflash of JSC, and Louis Friedman, executive director of the Planetary Society. The GOBBSS material will be sent to JSC where the science team will analyze the samples, studying the effects of spaceflight on bacterial growth.

2003-01-01

327

Human Embryology Animations  

NSDL National Science Digital Library

For students of human development, the Human Embryology Animations site is a worthy resource. Created by Dr. Valerie O'Loughlin at Indiana University, the goal of this site is to help students "better understand the complex processes that must occur in embryologic development." The animations are divided into five thematic sections, including General Embryology, Development of the Limbs, and Urinary and Reproductive Embryology. Each animation lasts anywhere from 20 seconds to 8 minutes, and they cover heart tube folding, septum development, postnatal circulation, and 30 or so other processes. The site is designed for students and members of the general public with a basic understanding of human biology, and the animations are well-planned and worth a look. Additionally, they could be used for students reviewing materials for a course like AP Biology.

O'Loughlin, Valerie

2012-03-02

328

STS-91 Mission Specialist Kavandi visits Pad 39A before launch  

NASA Technical Reports Server (NTRS)

STS-91 Mission Specialist Janet Kavandi, Ph.D., visits Launch Pad 39A from which she is scheduled to be launched aboard Space Shuttle Discovery on June 2 around 6:10 p.m. EDT. In her pocket are flowers intended as gifts for her two children whom she will be seeing shortly. STS-91 will feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, the conclusion of Phase I of the joint U.S.-Russian International Space Station Program, and the first flight of the new Space Shuttle super lightweight external tank. The STS-91 flight crew also includes Commander Charles Precourt; Pilot Dominic Gorie; and Mission Specialists Franklin Chang-Diaz, Ph.D.; Wendy B. Lawrence; and Valery Ryumin, with the Russian Space Agency. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

1998-01-01

329

Science Signaling Podcast: 24 May 2011  

NSDL National Science Digital Library

This Podcast features conversations with authors of articles related to Hippo signaling that appear in Science and Science Signaling. James Martin discusses his group’s finding that Hippo signaling regulates the size of the mouse heart by antagonizing Wnt signaling through a mechanism that involves cooperation between the transcription factors Yap and β-catenin, as described in a Research Report published in the 22 April 2011 issue of Science. Valeri Vasioukhin and Mark Silvis discuss their findings related to Hippo signaling in tumorigenesis, as reported in the 24 May 2011 issue of Science Signaling. They report that the adhesion protein αE-catenin acts as a tumor suppressor by regulating the localization and activity of the transcriptional coactivator Yap, which is also regulated by Hippo signaling.

James F. Martin (Texas A&M System Health Science Center;Institute of Biosciences and Technology REV); Valeri Vasioukhin (Fred Hutchinson Cancer Research Center;Division of Human Biology REV); Mark R. Silvis (Fred Hutchinson Cancer Research Center;Division of Human Biology REV); Annalisa M. VanHook (American Association for the Advancement of Science;Science Signaling REV)

2011-05-24

330

International Program and Local Organizing Committees  

NASA Astrophysics Data System (ADS)

International Program Committee Dionisio Bermejo (Spain) Roman Ciurylo (Poland) Elisabeth Dalimier (France) Alexander Devdariani (Russia) Milan S Dimitrijevic (Serbia) Robert Gamache (USA) Marco A Gigosos (Spain) Motoshi Goto (Japan) Magnus Gustafsson (Sweden) Jean-Michel Hartmann (France) Carlos Iglesias (USA) John Kielkopf (USA) John C Lewis (Canada) Valery Lisitsa (Russia) Eugene Oks (USA) Christian G Parigger (USA) Gillian Peach (UK) Adriana Predoi-Cross (Canada) Roland Stamm (Germany) Local Organizing Committee Nikolay G Skvortsov (Chair, St Petersburg State University) Evgenii B Aleksandrov (Ioffe Physico-Technical Institute, St Petersburg) Vadim A Alekseev (Scientific Secretary, St Petersburg State University) Sergey F Boureiko (St.Petersburg State University) Yury N Gnedin (Pulkovo Observatory, St Petersburg) Alexander Z Devdariani (Deputy Chair, St Petersburg State University) Alexander P Kouzov (Deputy Chair, St Petersburg State University) Nikolay A Timofeev (St Petersburg State University)

2012-12-01

331

Expedition 5 crew member Korzun arrives at KSC for launch  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- Expedition 5 cosmonaut Valeri Korzun, who is commander on the crew, arrives at KSC aboard a T-38 jet aircraft to prepare for launch on mission STS-111. Korzun is with the Russian Space Agency. Expedition 5 will travel to the Station on Space Shuttle Endeavour as the replacement crew for Expedition 4, who will return to Earth aboard the orbiter. Mission STS-111, known as Utilization Flight 2, is carrying supplies and equipment to the International Space Station. The payload includes the Multi-Purpose Logistics Module Leonardo, the Mobile Base System, which will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, and a replacement wrist/roll joint for Canadarm 2. The mechanical arm will then have the capability to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. Launch is scheduled for May 30, 2002.

2002-01-01

332

STS-113 Flight Day 9 Highlights  

NASA Technical Reports Server (NTRS)

This video shows the activities of the STS-113 (Jim Wetherbee, Commander; Paul Lockhart, Pilot; Michael Lopez-Alegria, John Herrington, Mission Specialists) crew during flight day 9. Also seen are the outgoing Expedition 5 (Valeri Korzun, Commander; Peggy Whitsun, ISS Science Officer/Flight Engineer; Sergei Treschev, Flight Engineer) and incoming Expedition 6 (Kenneth Bowersox, Commander; Donald Pettit, Nikolai Budarin, Flight Engineers) crews of the ISS (International Space Station). Flight day 9 is a relatively inactive day, with some off-time scheduled for crew bonding and enjoying views. Seven of the joint crew members, including Lopez-Alegria, Wetherbee, Herrington, and Whitsun, pose together and answer questions. Footage shows ISS Science Officers Whitsun and Pettit troubleshooting equipment. The video also contains a clear view of southern South America, a cloudy view of the South Pacific, and external footage of the ISS including the Canadarm robotic arm. The payload bay of the shuttle Endeavour is also shown.

2002-01-01

333

Expedition 5 crew during TCDT suitup  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - The Expedition 5 crew pauses during suitup before going to the pad for a simulated launch countdown, part of Terminal Countdown Demonstration Test activities. From left are cosmonaut Sergei Treschev, astronaut Peggy Whitson and Commander Valeri Korzun. . Expedition 5 will travel to the International Space Station on mission STS-111 as the replacement crew for Expedition 4, who will return to Earth aboard Endeavour. Mission STS-111 is known as Utilization Flight 2, carrying supplies and equipment in the Multi-Purpose Logistics Module Leonardo to the Station. The payload also includes the Mobile Base System, which will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, and a replacement wrist/roll joint for Canadarm 2. The mechanical arm will then have the capability to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. Launch is scheduled for May 30, 2002.

2002-01-01

334

Final Report: High Energy Physics Program (HEP), Physics Department, Princeton University  

SciTech Connect

The activities of the Princeton Elementary particles group funded through Department of Energy Grant# DEFG02-91 ER40671 during the period October 1, 1991 through January 31, 2013 are summarized. These activities include experiments performed at Brookhaven National Lab; the CERN Lab in Geneva, Switzerland; Fermilab; KEK in Tsukuba City, Japan; the Stanford Linear Accelerator Center; as well as extensive experimental and the- oretical studies conducted on the campus of Princeton University. Funded senior personnel include: Curtis Callan, Stephen Gubser, Valerie Halyo, Daniel Marlow, Kirk McDonald, Pe- ter Meyers, James Olsen, Pierre Pirou#19;e, Eric Prebys, A.J. Stewart Smith, Frank Shoemaker (deceased), Paul Steinhardt, David Stickland, Christopher Tully, and Liantao Wang.

Callan, Curtis G. [Princeton University] (ORCID:0000000199376160); Gubser, Steven S. [Princeton University] (ORCID:0000000152141786); Marlow, Daniel R. [Princeton University] (ORCID:0000000263951079); McDonald, Kirk T. [Princeton University] (ORCID:0000000235027380); Meyers, Peter D. [Princeton University] (ORCID:0000000263792995); Olsen, James D. [Princeton University] (ORCID:0000000293615762); Smith, Arthur J.S. [Princeton University] (ORCID:0000000329789562); Steinhardt, Paul J. [Princeton University] (ORCID:0000000334881603); Tully, Christopher G. [Princeton University] (ORCID:0000000167712174); Stickland, David P. [Princeton University] (ORCID:0000000347028820)

2013-04-30

335

STS-96 Crew Training, Mission Animation, Crew Interviews, STARSHINE, Discovery Rollout and Repair of Hail Damage  

NASA Technical Reports Server (NTRS)

Live footage shows the crewmembers of STS-96, Commander Kent V. Rominger, Pilot Rick D. Husband, Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette and Valery Ivanovich Tokarev during various training activities. Scenes include astronaut suit-up, EVA training in the Virtual Reality Lab, Orbiter space vision training, bailout training, and crew photo session. Footage also shows individual crew interviews, repair activities to the external fuel tank, and Discovery's return to the launch pad. The engineers are seen sanding, bending, and painting the foam used in repairing the tank. An animation of the deployment of the STARSHINE satellite, International Space Station, and the STS-96 Mission is presented. Footage shows the students from Edgar Allen Poe Middle School sanding, polishing, and inspecting the mirrors for the STARSHINE satellite. Live footage also includes students from St. Michael the Archangel School wearing bunny suits and entering the clean room at Goddard Space Flight Center.

1999-01-01

336

STS-96 FD Highlights and Crew Activities Report: Flight Day 03  

NASA Technical Reports Server (NTRS)

On this third day of the STS-96 Discovery mission, the flight crew, Commander Kent V. Rominger, Pilot Rick D. Husband, and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette, and Valery Ivanovich Tokarev are seen executing the very first docking with the International Space Station. Also shown are views of the docking taken from both the Unity and Discovery. Final preparation for the mission's space walk is also presented. Jernigan and Barry check the tools and the emergency rescue backpacks they will need for their space walk. Ochoa and Jernigan perform leak and pressurization checks and open the hatch to the Unity module. Ochoa and Takarev store docking targets and lights and check the hatch seals in the narrow passageway. Rominger and Husband remove and store four electronic boxes around the Unity module.

1999-01-01

337

Participation in alcoholics anonymous: intended and unintended change mechanisms.  

PubMed

This article is a compilation of the information presented at a symposium at the 2001 RSA Meeting in Montreal, Canada. The presentations were: (1) Maintaining change after conjoint behavioral alcohol treatment for men: the role of involvement with Alcoholics Anonymous, by Barbara S. McCrady and Elizabeth E. Epstein; (2) Changing AA practices and outcomes: Project MATCH 3-year follow-up, by J. Scott Tonigan; (3) Life events and patterns of recovery of AA-exposed adults and adolescents, by Patricia L. Owen and Valerie Slaymaker; (4) Social networks and AA involvement as mediators of change, by Lee Ann Kaskutas and Keith Humphreys; and (5) What do we know about Alcoholics Anonymous? by William R. Miller, discussant. PMID:12658120

Owen, Patricia L; Slaymaker, Valerie; Tonigan, J Scott; McCrady, Barbara S; Epstein, Elizabeth E; Kaskutas, Lee Ann; Humphreys, Keith; Miller, William R

2003-03-01

338

An Analysis of Historical Records of Solar Variability, Volcanic Eruptions, and Climate Change in the Last Millennium  

NASA Astrophysics Data System (ADS)

Studying past climate changes can help us better understand present natural variations and predict future trends. However, various reconstructions of the climate of the last 1000 years have given only broad similarities [Briffa, JGR 106, 2929, 2001]. The variances are partly due to uncertainties in the past radiative and aerosol forcing, and gaps in regional coverage. Another outstanding question is whether we are in a time similar to the Medieval Warm Period. From the frequencies of sunspot and aurora sightings, abundance of carbon-14 in the rings of long-lived trees, and beryllium-10 in the annual layers of polar ice cores, we have reconstructed the recent history of a variable Sun. In the past 1800 years the Sun has gone through nine cycles of changes in brightness. While these long-term changes account for less than 1% of the total irradiance, there is clear evidence that they affect the climate [Pang and Yau, Eos, 83, No. 43, 481, 2002]. We have analyzed Chinese historical weather records to fill the data void in this region. Reports of unseasonable cold are classified by the degree of severity: (1) Late (April-June) or early (July-Sept) killing frosts; (2) Bitter cold/heavy snowfall; and (3) heavy sustained snowfall, bitter cold with frozen wells, lakes, rivers, and icebound seas. The latter cases were often widespread and multi-year. All categories occurred most frequently during the coldest part of the Little Ice Age, with the coldest episodes in 1652-54, 1656, 1664, 1670-72, 1676-77, 1683, 1688-91, 1716 and 1718-19. They thus coincide with Maunder Minimum (1645-1715), when very few sunspots were seen-about one in ten years from China or Europe-indicative of a weakened Sun. There was only one Category 3 episode between the Maunder and Dalton Minima-in 1761, and two in the Dalton Minimum (1795-1825)-in 1796 and 1814-7. Analysis of proxy data has shown that the 1810's were among the coldest years in Europe [Briffa and Jones, in ``The Year Without a Summer,'' C.R. Harrignton, ed., 1992]. Large eruptions, of an unknown volcano in 1809 [Dai, JGR 96, 17361, 1991], at Mayon in 1814, and at Tambora in 1815, with the reduced solar luminosity seem to have been responsible. The Sun has slowly brightened since the Dalton Minimum. However, the climate of China remained cold through the 19th century, consistent with world climate trend [Bradley and Jones, Holocene 3, 367, 1993], possibly due to increased volcanic aerosol loading of the atmosphere [Sato, JGR 98, 22987, 1993]. In the 200 years prior to the Maunder Minimum, there was at least one other major planetwide volcanically forced cold episode-in 1453-54. The climate of China appears to have been warm during the Late 14th-Century Solar Maximum (1350-1410). We have found only one report of early killing frost-in May, 1993. It then turned cold during the Sporer Minimum (140-1590) [Pang and Yau, op. cit.]. Category 3 cold episodes occurred in 1453-54, 1513, 1569, and 1577-78. Lesser ones were also more common. The coldest was in 1453-54, due to a Tamboran class eruption that broke a big island in New Hebrides Arc in two, separated by a 12X6X1 km submarine caldera Kuwae. The volcanic chill was felt worldwide, with extensive reporting in China [Pang, Eos 74, No. 43, 196, 1993]. Reduced solar luminosity may have also contributed to the cold climate of that decade, as was the case in the 1810's. We conclude that the climate of China in the past 650 years generally follows world trend. The major forcing seems to have been changing solar luminosity, perturbed by frequent volcanic eruptions.

Pang, K. D.

2003-12-01

339

Do Changes in Muscle Architecture Affect Post-Activation Potentiation?  

PubMed Central

The purpose of this randomized, cross-over design study was to examine the effect of three different muscle potentiation protocols on acute changes in muscle architecture and vertical jump performance. Eleven experienced, resistance trained men (25.23.6y) completed three potentiation squat protocols using moderate intensity (MI; 75%, 3 sets x 10 repetitions), high intensity (HI; 90%, 3 sets x 3 repetitions) and 100% (1RM; 1 set x 1repetition) of their 1RM. In addition, all participants completed a control session (CTL) in which no protocol was performed. During each testing session, muscle architecture and vertical jump testing were assessed at baseline (BL), 8min post (8P) and 20min post (20P) workout. Ultrasound measures included cross sectional area (CSA) and pennation angle (PANG) of both the rectus femoris (RF) and vastus lateralis (VL). Following each ultrasound measure, peak vertical jump power (PVJP) and mean (MVJP) power was assessed using an accelerometer. Magnitude based inferences were used to make comparisons between trials. The MI trial resulted in a likely greater increase from BL to 8P and 20P in RF-CSA and VL-CSA, while the HI trial resulted in a likely greater change from BL to 20P in both RF-CSA and VL-CSA. Meanwhile, changes in PVJP and MVJP for the MI trial was likely decreased at BL-8P and BL20P, while the HI trial was shown to result in a likely or possible decrease compared to CTL at BL-8P and BL20P, respectively. A likely negative relationship was observed between changes in VL-PANG and MVJP (r = -0.35; p , 0.018) at BL-8P, and between changes in PVJP and RF-CSA (r = -0.37; p , 0.014) at BL20P. Results of this study were unable to demonstrate any potentiation response from the trials employed, however these protocols did result in acute muscle architectural changes. Key points Three squat protocols using moderate intensity (75% 1-RM; 3 sets x 10 repetitions), high intensity (90% 1-RM, 3 sets x 3 repetitions) and maximal intensity (100% 1RM; 1 set x 1repetition) were unable to potentiate jump height or jump power in experienced, resistance trained men. Experienced, resistance trained athletes who are not competitive may be limited in regards to potentiation due to a poor level of conditioning. Both the moderate and high intensity potentiation protocols stimulated acute changes in muscle architecture. Greater increases in the CSA of both the RF and VL muscles were noted. A different potentiation protocol may have elicited greater changes in muscle architecture. PMID:25178394

Reardon, Danielle; Hoffman, Jay R.; Mangine, Gerald T.; Wells, Adam J.; Gonzalez, Adam M.; Jajtner, Adam R.; Townsend, Jeremy R.; McCormack, William P.; Stout, Jeffrey R.; Fragala, Maren S.; Fukuda, David H.

2014-01-01

340

Ancient Observations Reveal How a Variable Sun Has Changed the Earth's Climate  

NASA Astrophysics Data System (ADS)

The Sun, once thought to be constant, has actually undergone nine long brightness cycles in the past 1800 years. Although these luminosity changes were < 1%, they have clearly influenced in the Earth's climate. For example, during the Maunder (Solar) Minimum between 1645 and 1715, sunspots were rarely seen, indicative of a weak Sun. Astronomers at Mt. Wilson, e.g., Hale, Nicholson and Wilson, have linked the luminosity changes to solar magnetic cycles, and similar behaviors in Sun-like stars. Others have elucidated the Sun-climate connection. For example, Eddy suggested that the enfeebled Sun was responsible for the cold climate of the Little Ice Age. The estimated average global temperature then was half a degree Centigrade lower than that prevailed in the 1970's (Lean, Geophys. Res. Lett. 22, 3195, 1995). Yau researched East Asian historical sunspot records, and found that there were seven Maunder-like solar minima before 1600 (Quart. J. Roy. Astron. Soc. 29, 175, 1988). The earliest was in the third century, and the Sporer Minimum occurred in 1400-1600. These findings agree with analyses of historical records of aurora sightings. Energetic electrons and protons emitted by an active Sun create auroras on Earth. When sunspots were rare auroras were, likewise, seldom seen. Minima in sunspot/aurora sightings are, in turn, coincident with peaks in long-term carbon-14 and beryllium-10 records. The radioisotopes are made high in atmosphere by cosmic rays. Their production is low when strong solar magnetic storms deflect such rays from the Solar System, and vice versa (Pang and Yau, Eos 83, No. 43, 481, 2002). Pang analyzed Chinese historical weather records, and discovered that periods of severely cold climate coincide with the Maunder and Sporer Minima. Lakes and rivers froze up, seas icebound, unseasonable frosts killed crops, and famines were widespread during these cold spells, consistent with general circulation model hindcast of contemporary winter conditions for China (Shindell, Science 294, 2149, 2001). Although variable solar luminosity is important, other strong forces also drive the Earth's climate system. These include greenhouse warming, volcanic eruptions, and changing ocean current systems, e.g., the El Nino. The solar variations, however, act over periods ranging from decades to centuries.

Pang, K. D.; Yau, K. K.

2004-12-01

341

Eclipses and the Olympics  

NASA Astrophysics Data System (ADS)

Like returns of Halley's comet the Olympic games occur periodically, though not as regularly in antiquity. Dates were also imprecise due to the chaotic calendars in use. Reported sightings of comets and eclipses can be used with game dates to help fix ancient events. However some reported darkening of the sun, e.g., after Julius Caesar's murder in 44 BC, was due to volcanic eruptions. A red comet, visible in daylight, first appeared during the games that year. It was also seen from China and Korea (Pang, Sciences 31, 30). Phlegon's ``Olympiads" (2nd century) says that Christ's crucifixion was in the 4th year of the 202nd Olympiad (AD 29-33), when a total solar eclipse occurred in the 6th hour. Only the Nov. 24, AD 29 eclipse over Asia Minor can match that, and Joel's prophecy (Acts 2, 14-21) that ``the sun will be turned to darkness and moon to blood." However it conflicts with ``the first day of Passover," as recorded by Mathew, Mark and Luke, i.e., full moon in early spring. Humphreys and Waddington (Nature 306, 743) have suggested meteorological darkening and the April 3, AD 33 lunar eclipse instead. Schaefer has questioned the eclipse's visibility from Jerusalem (31.46N, 35.14E). The six computations he cited gave dissimilar answers due to the imprecise rates of the secular lunar acceleration, and lengthening of the day used (Q.Jl.R.astr.Soc. 31, 53). Lunar laser ranging has since fixed the former at -26"/cen2. Analysis of ancient Chinese solar eclipse records, e.g., the April 21, 899 BC and April 4, AD 368 ``double dawns" over Zheng, has given us a delta T (in sec) = 30t2, where t is centuries before 1800 (Pang, Yau and Chou, in ``Dynamics of Ice Age Earth: A Modern Perspective," 1998). Our computations show that the moon rose over Jerusalem, with 1/3 still in the umbra and the rest in penumbra. Holdover meteorological darkening with long absorption air mass could have help reddened the moon also. Finally the first ``eclipse season" (the Aug. 21 lunar, and Sept. 6 solar, eclipses) were recorded in China in 776 BC, the year of the first Olympiad. A total solar eclipse (August 1, 2008) will occur during the 29th modern Olympiad (July 25-Aug. 10), with its path of totality ending in a spectacular ``double sunset" over Zheng, China (34.5N, 110E).

Pang, K. D.; Yau, K. K.

2000-12-01

342

Integrating chemical and biological control of European corn borer in bell pepper.  

PubMed

Using multiple locations and a series of field trials over 2 yr, we evaluated an integrated pest management program for Ostrinia nubilalis (Hbner) (Lepidoptera: Crambidae) management in peppers involving biorational chemistries, inundative releases of Trichogramma ostriniae (Pang & Chen), and conservation of generalist predators. In small plot trials, three biorational insecticides (spinosad, indoxacarb, and methoxyfenozide) provided comparable control of O. nubilalis as two broad-spectrum conventional insecticides (acephate and lambda-cyhalothrin). However, lambdacyhalothrin at most locations, and indoxacarb at one location, resulted in outbreaks of green peach aphids. We also observed significant effects on the generalist predator community: beneficial communities in methoxyfenozide-treated plots were most similar to untreated controls, and acephate-treated plots were the least similar. Management systems comparing untreated controls, inundative release of T. ostriniae with methoxyfenozide applied when lepidopterans exceeded thresholds, or weekly applications of acephate or lambda-cyhalothrin, showed no effects on marketable fruit or percentage of fruit damaged, but the conventional insecticide approach caused aphid flares. Inundative releases of T. ostriniae and biorational chemistries provide a more environmentally sound approach to managing O. nubilalis in peppers, due, in part, to conservation of generalist predators. PMID:19253647

Chapman, Anna V; Kuhar, Thomas P; Schultz, Peter B; Leslie, Timothy W; Fleischer, Shelby J; Dively, Galen P; Whalen, Joanne

2009-02-01

343

Open standards for cascade models for RHIC: Volume 1. Proceedings of RIKEN BNL Research Center workshop  

SciTech Connect

It is widely recognized that cascade models are potentially effective and powerful tools for interpreting and predicting multi-particle observables in heavy ion physics. However, the lack of common standards, documentation, version control, and accessibility have made it difficult to apply objective scientific criteria for evaluating the many physical and algorithmic assumptions or even to reproduce some published results. The first RIKEN Research Center workshop was proposed by Yang Pang to address this problem by establishing open standards for original codes for applications to nuclear collisions at RHIC energies. The aim of this first workshop is: (1) to prepare a WWW depository site for original source codes and detailed documentation with examples; (2) to develop and perform standardized test for the models such as Lorentz invariance, kinetic theory comparisons, and thermodynamic simulations; (3) to publish a compilation of results of the above work in a journal e.g., ``Heavy Ion Physics``; and (4) to establish a policy statement on a set of minimal requirements for inclusion in the OSCAR-WWW depository.

NONE

1997-10-01

344

Freud's treatment of a narcissistic patient.  

PubMed

The newly-published correspondence between Freud and Ernest Jones reveals Freud's views on the treatment of a severely narcissistic patient in 1922, just prior to his writing 'The Ego and the Id'. His formulation centres on 'a deep sense of guilt ... a conflict between Ego and Ideal ... whenever it is revived she projects her self-criticism to other people, turns her pangs of conscience into sadistic behaviour'. He aims toward 'reconciliation of her Ideal to her Ego', and emphasises her need for his friendly support in order to tolerate the analytic process. Freud's views, expressed in his formulation, coincide with ideas that the author has put forward over the past two decades in regard to the vicious cycle of punitive unconscious self-criticism, self-deprivation, and excessive demand (narcissistic entitlement) and the need to maintain functional neutrality by providing support. The discussion addresses the contrast between Freud's therapeutic activity and his published recommendations, emphasising Freud's mistaken belief in the analyst's 'objectivity' in the analytic situation and his passionate commitment to maintaining the scientific respectability of psychoanalysis, with its consequences in the minimalist austerity of 'classical technique'. PMID:7989139

Kris, A O

1994-08-01

345

Multi-generation effects of Bt rice on Anagrus nilaparvatae, a parasitoid of the nontarget pest Nilapavarta lugens.  

PubMed

Little is known about the potential cumulative long-term effects of transgenic crops on nontarget organisms. In the present laboratory study, the potential cumulative effects of transgenic Bacillus thuringiensis (Bt) rice on parasitoids in successive generations were observed for an egg parasitoid, Anagrus nilaparvatae parasitizing eggs of Nilaparvata lugens (Stl) (Hemiptera: Delphacidae) feeding on Bt rice. Enzyme-linked immunosorbent assay test confirmed that Cry1Ab insecticidal protein could be detected in newly eclosed parasitoid adults. However, no significant effect on the fecundity of Anagrus nilaparvatae Pang et Wang (Hymenoptera: Mymaridae) was observed between Bt and non-Bt rice. Developmental times of both genders of A. nilaparvatae parasitizing host eggs laid in Bt (KMD1 and KMD2) rice lines were significantly prolonged from first generation to second generation, but not always prolonged from third generation to 11th generation as compared with the control rice line. Furthermore, the sex ratio of A. nilaparvatae progeny from the first generation to 11th generation in three rice lines was not significantly different. In general, our results suggested that the effect of Bt rice on this parasitoid could be negligible. PMID:22182572

Gao, Ming-Qing; Hou, Shou-Peng; Pu, De-Qiang; Shi, Min; Ye, Gong-Yin; Chen, Xue-Xin

2010-12-01

346

Osteology of Huabeisaurus allocotus (Sauropoda: Titanosauriformes) from the Upper Cretaceous of China  

PubMed Central

Background The Late Cretaceous titanosauriform sauropod Huabeisaurus allocotus Pang and Cheng is known from teeth and much of the postcranial skeleton. Its completeness makes it an important taxon for integrating and interpreting anatomical observations from more fragmentary Cretaceous East Asian sauropods and for understanding titanosauriform evolution in general. Methodology/Principal Findings We present a detailed redescription of Huabeisaurus allocotus and a suite of anatomical comparisons with other titanosauriforms that demonstrate its validity via autapomorphies (e.g., division of some presacral vertebral laminae, reduced development of caudal ribs, the development of fossae relative to one another in caudal vertebral neural arches, high tibia-to-femur ratio). Huabeisaurus shares many features with other Cretaceous East Asian sauropods (e.g., pendant cervical ribs, anterior-middle caudal vertebrae with a nearly flat anterior centrum face and a concave posterior centrum face) that are absent in sauropods from other landmasses and strata, suggesting a close relationship among many of these forms within the clade Somphospondyli. Conclusions/Significance Restudy of Huabeisaurus provides further evidence for the existence of a clade of somphospondylans Euhelopodidae mainly found in the Cretaceous of East Asia. Euhelopodidae represents a fourth example of the evolution of narrow crowns within Sauropoda, along with diplodocoids, brachiosaurids, and advanced titanosaurs (lithostrotians). Despite being known from fewer species than Diplodocoidea, Brachiosauridae, or Lithostrotia, euhelopodids possessed a broader range of tooth shapes than any of these clades, suggesting that euhelopodids exemplified a comparably broad range of feeding strategies and perhaps diets. PMID:23936326

D'Emic, Michael D.; Mannion, Philip D.; Upchurch, Paul; Benson, Roger B. J.; Pang, Qiqing; Zhengwu, Cheng

2013-01-01

347

Structural and stratigraphic evolution of the East Georges Bank Basin, offshore Nova Scotia, Canada  

SciTech Connect

The East Georges Bank Basin is located offshore Nova Scotia on the southeastern Canadian continental shelf. The basin covers 2.5 million ac and is one of the last undrilled basins in North America. The geological interpretation is almost entirely based on 16,000 km of seismic data over the basin. Pertinent well control is limited to 10 wells on the US portion of the Georges Bank (West Georges Bank Basin) and two wells on the Scotian shelf. Seismic-stratigraphic analysis of this data has led to a structural and stratigraphic model for the basin. The basin formed during the Triassic when the landmass of Pange began separating along rift zones. A prominent Paleozoic basement high, the Yarmouth Arch separated the East Georges Bank Basin from the West Georges Bank Basin and had a dominant influence on sedimentation until the Middle Jurassic. Early synrift sequences consist of lacustrine clastics and shales. Marine incursions began in the late Triassic resulting in massive salt deposits that reflect the restricted extent of the basin and the arid Triassic and Early Jurassic climate. Further continental separation during the Early Jurassic resulted in deposition of carbonates and evaporites followed by Middle Jurassic continental shelf carbonates and deltaic sands. During the Middle Jurassic, major growth faulting and halokinesis was initiated by progradation of the deltaic sands. Post Middle Jurassic continental spreading in combination with changing climatic conditions resulted in a steady decline of carbonate sedimentation and dominance of clastic deposition throughout the remaining history of the basin.

Carswell, A.B. (Esso Canada Resources Ltd., Calgary, Alberta (Canada)); Koning, T. (Texaco Canada Petroleum, Inc., Calgary, Alberta (Canada)); Hibbs, D.C. (Conoco Canada Ltd., Calgary, Alberta (Canada))

1990-05-01

348

Massive soliton stars  

NASA Astrophysics Data System (ADS)

The structure of nontopological solutions of Einstein field equations as proposed by Friedberg, Lee, and Pang (1987) is examined. This analysis incorporates finite temperature effects and pair creation. Quarks are assumed to be the only species that exist in interior of soliton stars. The possibility of primordial creation of soliton stars in the incomplete decay of the degenerate vacuum in early universe is explored. Because of dominance of pair creation inside soliton stars, the luminosity of soliton stars is not determined by its radiative transfer characteristics, and the surface temperature of soliton stars can be the same as its interior temperature. It is possible that soliton stars are intense X-ray radiators at large distances. Soliton stars are nearly 100 percent efficient energy converters, converting the rest energy of baryons entering the interior into radiation. It is possible that a sizable number of baryons may also be trapped inside soliton stars during early epochs of the universe. In addition, if soliton stars exist they could assume the role played by massive black holes in galactic centers.

Chiu, Hong-Yee

1990-05-01

349

Solar wind-magnetosphere interaction during the possible encounter of Comet Halley's tail in 1910 inferred from mid-latitude geomagnetic field disturbances  

NASA Astrophysics Data System (ADS)

Geomagnetic disturbances from the period April to June 1910 are analyzed to detect the possible effects of the Comet Halley on the solar wind-magnetosphere interaction. Data from six midlatitude geomagnetic observatories are used to calculate the longitudinally symmetric (i.e., Dst) and asymmetric fields. An application of a linear prediction filter to separate the solar wind dynamic pressure effect on the disturbances from that of the ring current, suggests that there exists a compressional variation in the Dst on May 18 which is around or slightly earlier than the time of estimated cometary tail encounter. The normal-run magnetogram from Agincourt on the dayside and that from Lu-Kia-Pang on the nightside, also indicate rather strong (i.e., 30-40 nT) compressional variation. The disturbances characteristic to the solar wind-magnetosphere interaction under the southward IMF condition and that of the ring current development are seen during the period. These results suggest that the earth's magnetosphere had been affected by a dense cometary plasma tail with high dynamic pressure, though the solar wind-magnetosphere interaction typically observed under the southward IMF condition had been taking place during the encounter.

Iyemori, T.; Araki, T.

350

Chronology of eclipse "San Miao"  

NASA Astrophysics Data System (ADS)

The ancient book "Mozi" (5th century BC) records: "In ancient times, the San Miao tribes were in disarray. The sun rose in the evening...King Yu vanquished them. "King Yu is a prehistoric person living in 23-19th century BC. The strange phenomena "sun rose in evening" was explained as a large solar eclipse at sunset by Pang. Therefore investigations on it may lead to an important progress of Chinese chronology. After an analysis on all similar records in Chinese history, we pay main attention to the relationship of eclipse computations with parameter "c", the long term of earth's rotation rate. We have computed all the solar eclipses in that period by the way similar to that used for investigating the "double dawn" eclipse. By change parameter "c" in reasonable range (28-36 sec/cy2), we have found 11 possible results listed in a table. One figure shows the eclipse maps and relative "double dawn/dusk" areas while another one illustrates how the parameter "c" affects the result. For an exact conclusion of King Yu's chronology, we need further progress from both side: history which may limit the King Yu's period and astronomy which may limit the possible range of parameter "c".

Liu, Ci-Yuan

2001-06-01

351

A self-consistent evaluation of the rate constants for the production of the OI 6300 A airglow  

NASA Astrophysics Data System (ADS)

The considered evaluation shows that the revised quenching rate of O(1D) by N2 in the thermosphere derived from the data of Hays et al. (1978) is k(N2) = 2.3 x 10 to the -11th cc/s, in excellent agreement with the laboratory results of Streit et al. (1976). The laboratory measurements of the O(1D) and O(1S) transition coefficients by Kernahan and Pang (1975) are consistent with the aeronomic results of Frederick et al. (1976), Kopp et al. (1977), Hays et al. (1978), and Rusch et al. (1978) and are in agreement with the theoretical calculations. The revised value of J(O2) = 1.5 x 10 to the -6th per s is in agreement with the observations of Heroux and Swirbalus (1976). The specific recombination rate of O2(+) leading to the production of O(1D) is alpha(1D) = 2.1 x 10 to the -7th cc/s at ionospheric electron temperatures, in good agreement with the laboratory measurement by Zipf (1970).

Link, R.; McConnell, J. C.; Shepherd, G. G.

1981-06-01

352

Composite KRFM-ISM spectrum of Phobos (0.315-3.1 microns)  

NASA Astrophysics Data System (ADS)

The spectrum of a portion of the Phobos surface was measured at the same points by two instruments (KRFM and ISM) on board the Phobos-2 mission in two ranges: 0.315-0.6 and 0.8-3.1 microns. An example of a spectrum based on data from both experiments obtained in the same locations is presented and discussed. It is substantially different from a previously published 'average' spectrum of Phobos Pang et al. (1978). There is no direct analogue to the presented spectrum among the known reflectivity spectra of meteorites and asteroids. The spectral reflectivity of the observed part of Phobos is like carbonaceous C1-C2 chondrites for the range below 0.6 micron, but not above 0.8 micron, where it shows a rise of reflectivity with wavelength even stronger than in the case of CM chondrites. No traces of the hydration band near 3 microns are visible. The nature of the surface layer is probably complicated, and it consists of inhomogeneous material.

Bibring, J. P.; Ksanfomaliti, L. V.; Langevin, I.; Moroz, V. I.; Combes, M.; Grigor'ev, A. V.; Khatuntsev, I. V.; Nikol'Skii, Iu. V.; Zharkov, A. V.

1992-09-01

353

Massive soliton stars  

NASA Technical Reports Server (NTRS)

The structure of nontopological solutions of Einstein field equations as proposed by Friedberg, Lee, and Pang (1987) is examined. This analysis incorporates finite temperature effects and pair creation. Quarks are assumed to be the only species that exist in interior of soliton stars. The possibility of primordial creation of soliton stars in the incomplete decay of the degenerate vacuum in early universe is explored. Because of dominance of pair creation inside soliton stars, the luminosity of soliton stars is not determined by its radiative transfer characteristics, and the surface temperature of soliton stars can be the same as its interior temperature. It is possible that soliton stars are intense X-ray radiators at large distances. Soliton stars are nearly 100 percent efficient energy converters, converting the rest energy of baryons entering the interior into radiation. It is possible that a sizable number of baryons may also be trapped inside soliton stars during early epochs of the universe. In addition, if soliton stars exist they could assume the role played by massive black holes in galactic centers.

Chiu, Hong-Yee

1990-01-01

354

Infection of Rice Plants by Rice Black Streaked Dwarf Virus Improves an Egg Parasitoid, Anagrus nilaparvatae (Hymenoptera: Mymaridae), of Rice Planthoppers.  

PubMed

The effects of rice plants infected by rice black streaked dwarf virus (RBSDV) on the host preference, duration of immature stages, sex ratio, and adult longevity and parasitic capacity of an egg parasitoid, Anagrus nilaparvatae Pang et Wang, of rice brown planthopper, Nilaparvata lugens Stl, were evaluated. Tests of response to plant volatiles using an olfactometer showed that A. nilaparvatae preferred rice plants harboring rice brown planthopper eggs over plants free of rice brown planthopper eggs. However, both the response to plant volatiles and the host selectivity test showed no significant differences in host preference between RBSDV-infected plants and healthy plants when both contained rice brown planthopper eggs. The developmental duration at immature stage of the male A. nilaparvatae in rice brown planthopper eggs on RBSDV-infected rice plants was significantly prolonged, and the parasitic capacity of rice brown planthopper eggs was significantly increased in comparison with the A. nilaparvatae parasite in rice brown planthopper eggs on healthy rice plants. There were no significant differences between RBSDV-infected rice plants and healthy rice plants in other ecological fitness parameters, including the developmental duration of female adults, female percentage, and adult longevity of A. nilaparvatae. PMID:25199055

Xu, Hongxing; He, Xiaochan; Zheng, Xusong; Yang, Yajun; Tian, Junce; Lu, Zhongxian

2014-10-01

355

STS-96 Mission Highlights. Part 3  

NASA Technical Reports Server (NTRS)

In this third part of a three-part video mission-highlights set, spacecrew operations between the STS-96 Space Shuttle Orbiter Discovery and the International Space Station, as well as STS reentry and landing is reviewed. The flight crew consists of Kent V. Rominger, Commander; Rick D. Husband, Pilot; and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette (Canadian), and Valery Ivanovich Tokarev (Russian). The primary goals of this mission were to work on logistics and resupply the International Space Station. This third part of the three part series includes footage from Flight Days 8-11 (FD 8-11) of the mission. FD 8 includes the crew members moving the last items from Discovery into the International Space Station (ISS), closing the final hatch on the orbiting outpost and commanding a series of 17 pulses of Discovery's reaction control system jets to boost the station's orbit. Discovery undocks from the station, performs a 2 1/2 lap flyaround of the station, before Husband fires Discovery's jets in a final burst to move Discovery away from the station, concluding six days of docked operations. After the flyaround, Husband fires Discovery's jets to depart the station's vicinity. Beginning FD 9, as Discovery departs from the station, Mission Specialists Tammy Jernigan and Dan Barry pack away the space suit gear they used during their spacewalk early in the mission, while Commander Kent Rominger and Pilot Rick Husband practice landings on a laptop computer program. Mission Specialists Julie Payette and Valery Tokarev help to stow gear and repressurize the shuttle's cabin to its standard 14.7 pounds per square inch. The crew also readies to deploy a small, student-built payload called STARSHINE (Student Tracked Atmospheric Research Satellite for Heuristic International Networking Equipment). In and around landing preparations and the STARSHINE deploy, the crew stowe all equipment used throughout the mission. The STARSHINE satellite ejects from a canister in Discovery's payload bay on FD 10. FD 11 is completed as Discovery swoops out of the darkness as Commander Kent Rominger sets the shuttle and his crewmates down on Runway 15 at the Shuttle Landing Facility in Florida to successfully complete the first shuttle mission of the year. Several different views of the landing are highlighted in the video.

1999-01-01

356

Differences in intestinal microbial metabolites in laying hens with high and low levels of repetitive feather-pecking behavior.  

PubMed

Feather pecking in laying hens is a serious behavioral problem and is often associated with feather eating. There is some evidence that ingested feathers affect gut function. The aim of the present study was to explore whether differences in intestinal microbial metabolites in laying hens with high and low levels of repetitive feather-pecking behavior exist. Sixty high feather-pecking birds (H) and sixty low feather-pecking birds (L) of the White Leghorn breed were used for behavioral recordings of feather pecking. Feather pecking activity was observed for 5 weeks, after which 22 H birds with the highest and 22 L birds with the lowest feather pecking activity were chosen. The number of whole feathers and feather parts in the gizzard and intestinal microbial metabolites in the ileum and ceca of these laying hens was examined. Biogenic amines, short-chain fatty acids, ammonia and lactate were measured as microbial metabolites. A higher number of feather parts and particles were found in H than in L birds. Putrescine and cadaverine concentrations were higher in the ileum of the hens with low pecking activity (P<0.001 and P=0.012). In the cecum the amounts of l-lactate, d-lactate and total lactate and SCFA were higher in H birds (P=0.007, P=0.005, P=0.006, and P<0.001). Acetate, i-butyrate, i-valeriate and n-valeriate all displayed significantly higher molar ratios in the cecal contents of L birds (P=0.001, P=0.003, P=0.001, and P<0.001). Propionate and n-butyrate showed higher molar ratios in H birds (P<0.001 and P=0.034). Ammonia was higher in the ileum and cecum of the L birds (P<0.001 and P=0.004). For the first time, this study shows that birds with high and low numbers of repetitive pecking movements to the plumage of other birds differ in their intestinal microbial metabolism. Further experiments should be conducted to investigate whether these differences alter behavior in H and L feather pecking birds. The present results, however, open new avenues of research into implications of gut bacteria, their metabolites and the polyamine system on brain and behavior in laying hens. PMID:23313560

Meyer, Beatrice; Zentek, Jrgen; Harlander-Matauschek, Alexandra

2013-02-17

357

Remotely Sensed and In Situ Data Availability for Validation of EOS Land Data Products  

NASA Astrophysics Data System (ADS)

In support of the NASA Earth Observing System (EOS) Land Product Validation investigations, numerous remotely sensed data and field measurements are being collected at core validation sites around the world. These `core sites' represent different biomes and include locations at which in situ measurements are routinely collected. The types of remotely sensed data that are being acquired and analyzed over these sites include Landsat 7 ETM+, ASTER, MODIS, and SPOT VEGETATION. The data being collected over these sites are being used to monitor ecosystem status, compile time-series records of biophysical and geophysical parameters, and to validate the suite of land products being derived from MODIS data. In order to facilitate easy access to the remotely sensed data being collected over these core sites, the data are stored online under FTP directories established by the Land Processes Distributed Active Archive Center (LP DAAC) at the USGS EROS Data Center. In situ measurements and data collected through field campaigns are being coordinated by the Oak Ridge National Laboratory Distributed Active Archive Center (ORNL DAAC) and being made accessible through the Mercury system, which is a web-based search engine (http://mercury.ornl.gov/ornldaac/). Access to many of the remotely sensed and in situ data sets collected over the EOS Land Validation `core sites' can be accessed through Mercury or the MODIS Land Validation web page (http://modarch.gsfc.nasa.gov/MODIS/LAND/VAL/). We are hoping to stimulate interest and participation by the Validation of Land European Remote Sensing Instruments (VALERI, http://147.100.0.5/valeri//) to extend the network and diversity of sites as well as increase collaborative research. We have developed a web portal that enables investigators to select a particular site of interest, determine what data are available for that site, and select datasets for ftp download. Certain services may be requested to be applied to the data prior to download, including: spatial and parameter subsetting, projection transformation, and file format conversion. The scientific rationale for this project is predicated on improving international and interdisciplinary collaboration in the assessment, application, and improvement of remotely sensed data products and services available to the research community. Efforts to validate remotely sensed data products at a global scale are unprecedented, yet such efforts are necessary in order to quantify the errors or uncertainties associated with these derived geophysical and biophysical parameters. These products must be evaluated over a wide range of land surface conditions and on a regular basis.

Dwyer, J.; Morisette, J.

2003-12-01

358

Bribery or benevolence?  

PubMed

This paper presents an interview from several pro-choice leaders on the topic of abortion. The interview aims to assess the appropriateness of actions taken by Cardinal Thomas Winning of the Scottish Catholic Church, founder of Prolife Initiative. The action centers on an issue concerning the father of a pregnant girl aged 12 years who approached the program asking help for her daughter to carry her pregnancy to term. The father claimed the family could not provide the basic needs for the baby and that his daughter would be devastated to have an abortion. Established in 1997, the Initiative offers girls and women an alternative to abortion. According to news accounts, teachers and social workers encouraged her to have an abortion. The Initiative agreed to give her financial support, which however, remained unclear as to what form the support had taken. Opinions concerning these issues were obtained from Alison Hadley, Brook Centers national policy coordinator in United Kingdom (UK); Jane Roe, Abortion Law Reform Association coordinator in UK; Tony O'Brien, executive director of the Family Planning Association in Ireland; Valerie Stroud, representative of We are Church in UK; and Frances Kissling, president of Catholics for a Free Choice in USA. Surprising differences in views surfaced and are discussed in this article. PMID:12178912

Hisel, L M; Miller, P

2000-01-01

359

STS-113 Post Flight Presentation  

NASA Technical Reports Server (NTRS)

The STS-113 post-flight presentation begins with a view of Mission Specialists Michael E. Lopez-Alegria and John B. Herrington getting suited for the space mission. The STS-113 crew consists of: Commander James D. Wetherbee, Pilot Paul Lockhart, Mission Specialists Michael Lopez-Alegria and John Herrington. Cosmonauts Valery Korzun, and Sergei Treschev, and astronaut Peggy Whitson who are all members of the expedition five crew, and Commander Kenneth Bowersox, Flight Engineers Nikolai Budarin and Donald Pettit, members of Expedition Six. The main goal of this mission is to take Expedition Six up to the International Space Station and Return Expedition Five to the Earth. The second objective is to install the P(1) Truss segment. Three hours prior to launch, the crew of Expedition Six along with James Wetherbee, Paul Lockhart, Michael Lopez-Alegria and John Herrington are shown walking to an astrovan, which takes them to the launch pad. The actual liftoff is presented. Three Extravehicular Activities (EVA)'s are performed on this mission. Michael Lopez-Alegria and John Herrington are shown performing EVA 1 and EVA 2 which include making connections between the P1 and S(0) Truss segments, and installing fluid jumpers. A panoramic view of the ISS with the Earth in the background is shown. The grand ceremony of the crew exchange is presented. The astronauts performing everyday duties such as brushing teeth, washing hair, sleeping, and eating pistachio nuts are shown. The actual landing of the Space Shuttle is presented.

2002-01-01

360

STS-111 Flight Day 8 Highlights  

NASA Technical Reports Server (NTRS)

On Flight Day 8 of STS-111 (Space Shuttle Endeavour crew includes: Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist; International Space Station (ISS) Expedition 5 crew includes Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer; ISS Expedition 4 crew includes: Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer), the Leonardo Multi Purpose Logistics Module (MPLM) is shown from the outside of the ISS. The MPLM, used to transport goods to the station for the Expedition 5 crew, and to return goods used by the Expedition 4 crew, is being loaded and unloaded by crewmembers. Live video from within the Destiny Laboratory Module shows Whitson and Chang-Diaz. They have just completed the second of three reboosts planned for this mission, in each of which the station will gain an additional statutory mile in altitude. Following this there is an interview conducted by ground-based reporters with some members from each of the three crews, answering various questions on their respective missions including sleeping in space and conducting experiments. Video of Earth and space tools precedes a second interview much like the first, but with the crews in their entirety. Topics discussed include the feelings of Bursch and Walz on their breaking the US record for continual days spent in space. The video ends with footage of the Southern California coastline.

2002-01-01

361

In vitro digestibility, physicochemical, thermal and rheological properties of banana starches.  

PubMed

Banana starches (BS) were isolated from Enano, Morado, Valery and Macho cultivars. The BS possessed B-type crystallinity and an amylose content varying from 19.32 to 26.35%. Granules had an oval morphology with different major-to-minor axis ratios, exhibiting both mono- and bi-modal distributions and mean particle sizes varying from 32.5 to 45 ?m. BS displayed zeta-potential values ranging between -32.25 and -17.32 mV, and formed gels of incipient to moderate stability. The enthalpy of gelatinization of BS affected the crystalline order stability within the granules. In-vitro digestibility tests showed fractions as high as 68% of resistant starch. Rheological oscillatory tests at 1 Hz showed that BS dispersions (7.0%, w/w) exhibited Type III behaviour, attributed to the formation of a continuous phase complex three-dimensional amylose gel reinforced by swollen starch granules acting as fillers. Amylose content and granules morphology were the main factors influencing the BS properties. PMID:24299760

Utrilla-Coello, R G; Rodrguez-Huezo, M E; Carrillo-Navas, H; Hernndez-Jaimes, C; Vernon-Carter, E J; Alvarez-Ramirez, J

2014-01-30

362

STS-91 Mission Specialist Ryumin suits up for launch  

NASA Technical Reports Server (NTRS)

STS-91 Mission Specialist and Russian cosmonaut Valery Victorovitch Ryumin is outfitted with his ascent/reentry flight suit and helmet by two suit technicians in the Operations and Checkout (O&C) Building. The final suit fitting and checkout takes place prior to the crew walkout and transport to Launch Pad 39A. He has been director of the Russian Shuttle-Mir program and flight director for the Salyut-7 and Mir space stations and is a veteran of three space flights with a total of 362 days in space. This will be Ryumin's first visit to Mir. However, his experience with Russian spacecraft in orbit will prove extremely valuable as he helps the crew with Mir equipment transfer operations. He will also be assessing the condition of the station for the Russian space program. STS-91 is scheduled to be launched on June 2 with a launch window opening around 6:10 p.m. EDT. The mission will feature the ninth and final Shuttle docking with the Russian space station Mir, the first Mir docking for Discovery, the first on-orbit test of the Alpha Magnetic Spectrometer (AMS), and the first flight of the new Space Shuttle super lightweight external tank. Astronaut Andrew S. W. Thomas will return to Earth as a STS- 91 crew member after living more than four months aboard Mir.

1998-01-01

363

STS-91 Mission Specialist Ryumin visits KSC to participate in the TCDT  

NASA Technical Reports Server (NTRS)

STS-91 Mission Specialist and Russian cosmonaut Valery Victorovitch Ryumin, arrives at Kennedy Space Center's Shuttle Landing Facility aboard a T-38 jet. He is here to participate in the Terminal Countdown Demonstration Test (TCDT), a dress rehearsal for launch. The STS-91 launch is targeted for June 2 with a launch window opening around 6:10 p.m. EDT. The mission will conclude Phase I of the joint U.S.-Russian International Space Station Program. Although it will be the ninth Shuttle docking with the Russian Space Station Mir, it will be the first Mir docking for the Space Shuttle orbiter Discovery. Ryumin is a veteran of three space flights and has logged 362 days in space. The STS-91 mission will also be the first flight for the new Space Shuttle super lightweight external tank. The STS-91 flight crew also includes Mission Commander Charles Precourt; Pilot Dominic Gorie; and Mission Specialists Wendy B. Lawrence; Franklin Chang-Diaz, Ph.D.; and Janet Kavandi, Ph.D. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living aboard Mir since January 25, 1998.

1998-01-01

364

University of Kentucky Agricultural Information Center  

NSDL National Science Digital Library

If you're just starting to learn about agriculture, biology, animal welfare or human environmental sciences, it can be a bit daunting. There are hundreds of online resources dealing with such matters, and separating the wheat from the chaff can be taxing and time-consuming. Valerie Perry and Jo Staggs-Neel at the University of Kentucky Library's Agricultural Information Center have created these three excellent research guides to the aforementioned subjects. The guides contain seven or eight separate subsections, including "Electronic Resources", "Best Databases", and "Frequently Cited Journals". Each guide also contains a "New Resource" area which profiles a newly added resource that complements the existing set of resources. A number of the links lead to resources that require a password or subscription, but there are enough here with open access to pique the interest of persons new to the field. Overall, it's a good way to get a basic grounding in the important online and offline resources in these three scholarly subjects.

2010-03-26

365

STS-112 Mission Highlights Resource Tape Part 2 of 3  

NASA Technical Reports Server (NTRS)

An overview of the STS-112 Mission is presented. The fourth flight day begins with a view inside of the Destiny Laboratory of the International Space Station where Expedition Five Commander Valery Korzun is shown. The robotics workstation where Mission Specialist Sandra Mangus and Flight Engineer Peggy Whitson operate Canadarm 2 to lift the S(1) Truss segment out of the payload bay of the Space Shuttle Atlantis and maneuver it for installation onto the S(1) Truss is presented. Mission Specialist Piers Sellers is shown preparing for his six and one half hour spacewalk by performing breathing exercises. Animation of the installation of the S(1) Truss, and also the unbirthing of the S(1) truss is also presented. Mission Specialists David Wolf and Piers Sellers are shown getting suited for their spacewalks. During the spacewalk, David Wolf is removing the antenna assembly from its launched position and Piers Sellers is releasing launch restraints from the Radiator Beam Assembly. A beautiful view of the coast of Texas is captured during this spacewalk. Flight day five shows pilot Pam Melroy and Mission Specialist Dave Wolf working inside of the International Space Station's Quest Airlock. Flight day six is shown with Dave Wolf and Piers Sellers exiting their spacesuits inside of the Quest Airlock Module after a successful spacewalk. This presentation ends with views of the International Space Station's installed S(1) Truss, rotation of the radiator assembly and the radiator's coolant tubing.

2003-01-01

366

STS-96 Mission Highlights. Part 1  

NASA Technical Reports Server (NTRS)

In this first part of a three-part video mission-highlights set, the flight of the STS-96 Space Shuttle Orbiter Discovery is reviewed. The flight crew consists of Kent V. Rominger, Commander; Rick D. Husband, Pilot; and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette (Canadian), and Valery Ivanovich Tokarev (Russian). The primary goals of this mission were to work on logistics and resupply the International Space Station (ISS). This is the first flight to dock to the International Space Station. The primary payloads are the Russian cargo crane, known as STRELA, which the astronauts mount to the exterior of the Russian station segment, the SPACEHAB Oceaneering Space System Box (SHOSS), and a U.S. built crane called the ORU Transfer Device (OTD). Other payloads include the Student Tracked Atmospheric Research Satellite for Heuristic International Networking Equipment (STARSHINE), the Shuttle Vibration Forces Experiment (SVF), and the Orbiter Integrated Vehicle Health Monitoring - HEDS Technology Demonstration (IVHM HTD). The traditional pre-launch breakfast, being suited up, entry into the Shuttle, and views of the liftoff from several different vantage points are shown. In-flight footage includes views from the robot arm conducting a television survey of Discovery's payload bay and the flawless docking of the Unity module with the International Space Station. During the docking, camera views from both the ISS and Discovery are presented. These activities make up the first three Flight Days of STS-96.

1999-01-01

367

Resistance and host-response of selected plants to Meloidogyne megadora.  

PubMed

Fourteen plant species, including 30 genotypes, were assessed for host suitability to Meloidogyne megadora in a growth room at 20 to 28 degrees C. Host suitability was based on the gall index (GI) and the reproduction factor (Rf):final population density (Pf)/initial population density (Pi). The presence of distinct galling was observed on roots of six plant species, and reproduction occurred on five of the 14 species tested. Three cultivars of cantaloupe (cvs. Branco do Ribatejo, Concerto, and Galia), three of cucumber (cvs. LM 809, Half Long Palmetto, and Market More), six of banana (cvs. Ma, Ouro Branco, Ouro Roxo, Prata, Po, and Valery), and one of broad bean (cv. Algarve) were considered susceptible (Pf/Pi > 1). Resistant cultivars (Pf/Pi = 0) included beet (cv, Crosby), pepper (cv. LM 204), watermelon (cvs. Black Magic and Crimson Sweet), tomato (cvs. Moneymaker and Rossol), radish (cv. Cherry Belle), and corn (cv. Dunia); sunn hemp and black velvetbean genotypes were also resistant. All Brassica cultivars were galled, although no egg masses were observed (Pf/Pi = 0), and classified as resistant/hypersensitive. PMID:19265922

de Almeida, A M S F; de A Santos, M S N

2002-06-01

368

AMS undergoes a final weight and balance check in the SSPF  

NASA Technical Reports Server (NTRS)

Under the supervision of Boeing technicians, the Alpha Magnetic Spectrometer (AMS), a payload slated to fly on STS-91, is undergoing a final weight and balance check on the Launch Package Integration Stand in the Space Station Processing Facility (SSPF). Next, it will be placed in the Payload Canister and transported to Launch Complex 39A where it will be installed into Space Shuttle Discovery's payload bay. Weighing in at approximately three tons, the AMS is a major particle physics experiment that will look for cosmic antimatter originating from outside our galaxy. The data it gathers could also give clues about the mysterious 'dark matter' that may make up 90 percent or more of the universe. STS-91 is scheduled to be launched on June 2 with a launch window opening around 6:10 p.m. EDT. The mission will also feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, and the conclusion of Phase I of the joint U.S.-Russian International Space Station Program. The STS-91 flight crew includes Commander Charles Precourt; Pilot Dominic Gorie; and Mission Specialists Wendy B. Lawrence; Franklin Chang-Diaz, Ph.D.; Janet Kavandi, Ph.D.; and Valery Ryumin, with the Russian Space Agency. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

1998-01-01

369

Artist's Concept of the Apollo-Soyuz Test Project  

NASA Technical Reports Server (NTRS)

This artist's concept depicts the Apollo-Soyuz Test Project (ASTP), the first international docking of the U.S.'s Apollo spacecraft and the U.S.S.R.'s Soyuz spacecraft in space. The objective of the ASTP mission was to provide the basis for a standardized international system for docking of marned spacecraft. The Soyuz spacecraft, with Cosmonauts Alexei Leonov and Valeri Kubasov aboard, was launched from the Baikonur Cosmodrome near Tyuratam in the Kazakh, Soviet Socialist Republic, at 8:20 a.m. (EDT) on July 15, 1975. The Apollo spacecraft, with Astronauts Thomas Stafford, Vance Brand, and Donald Slayton aboard, was launched from Launch Complex 39B, Kennedy Space Center, Florida, at 3:50 p.m. (EDT) on July 15, 1975. The Primary objectives of the ASTP were achieved. They performed spacecraft rendezvous, docking and undocking, conducted intervehicular crew transfer, and demonstrated the interaction of U.S. and U.S.S.R. control centers and spacecraft crews. The mission marked the last use of a Saturn launch vehicle. The Marshall Space Flight Center was responsible for development and sustaining engineering of the Saturn IB launch vehicle during the mission.

1974-01-01

370

STS-111 Crew before launch at KSC's SLF  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- After their arrival at the Shuttle Landing Facility, the STS-111 and Expedition 5 crews wave to spectators. From left are Missin Commander Kenneth Cockrell, Pilot Paul Lockhart and Mission Specialists Philippe Perrin and Franklin Chang-Diaz; Expedition 5 Commander Valeri Korzun, astronaut Peggy Whitson and cosmonaut Sergei Treschev. Perrin is with the French Space Agency; Korzun and Treschev are with the Russian Space Agency. The crews have arrived to prepare for launch. Expedition 5 is traveling to the International Space Station on Space Shuttle Endeavour as the replacement crew for Expedition 4, who will return to Earth aboard the orbiter. Known as Utilization Flight 2, STS-111 is carrying supplies and equipment to the Station. The payload includes the Multi-Purpose Logistics Module Leonardo, the Mobile Base System, which will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, and a replacement wrist/roll joint for Canadarm 2. The mechanical arm will then have the capability to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. Also on board will be Launch is scheduled for May 30, 2002.

2002-01-01

371

STS-111 crew on top of Launch Pad 39-A during TCDT  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- During Terminal Countdown Demonstration Test activities at Launch Pad 39A, the Expedition 5 and STS-111 crews pose on the 295-foot level. Standing, left to right, are Pilot Paul Lockhart, and the Expedition 5 crew Peggy Whitson, Commander Valeri Korzun and Sergei Treschev. Kneeling in front are Mission Specialist Philippe Perrin, Commander Kenneth Cockrell and Mission Specialist Franklin Chang-Diaz. Korzun and Treschev are with the Russian Space Agency, and Perrin is with the French Space Agency. Seen behind the crews are the top of the orange external tank and one of the white solid rocket boosters. The TCDT includes emergency egress training at the pad and a simulated launch countdown. Mission STS-111 is known as Utilization Flight 2, carrying supplies and equipment in the Multi-Purpose Logistics Module Leonardo to the International Space Station. The payload also includes the Mobile Base System, which will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, and a replacement wrist/roll joint for Canadarm 2. The mechanical arm will then have the capability to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. Expedition 5 will travel to the Station on Endeavour as the replacement crew for Expedition 4, who will return to Earth aboard the orbiter. Launch is scheduled for May 30, 2002.

2002-01-01

372

STS-111 crew walks out of O&C building for TCDT  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- The STS-111 crew and Expedition 5 walk eagerly to the Astrovan that will take them to Launch Pad 39A for a simulated countdown. From left are Mission Specialists Philippe Perrin and Franklin Chang-Diaz; the Expedition 5 crew, Sergei Treschev, Peggy Whitson and Valeri Korzun; Pilot Paul Lockhart; and Commander Kenneth Cockrell. The simulation is part of STS-111 Terminal Countdown Demonstration Test activities for the crew and Expedition 5. The payload on the mission to the International Space Station includes the Mobile Base System (MBS), an Orbital Replacement Unit and Multi-Purpose Logistics Module Leonardo. The MBS will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, enabling Canadarm 2 to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. The Expedition 5 crew is traveling on Endeavour to replace the Expedition 4 crew on the Station. Launch of Endeavour is scheduled for May 30, 2002.

2002-01-01

373

STS-111 Post Flight Presentation  

NASA Technical Reports Server (NTRS)

The crews of STS-111 (Endeavour's crew: Ken Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist (MS); Philippe Perrin, MS; International Space Station's (ISS) Expedition 4 crew: Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer; ISS Expedition 5 crew: Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer) narrate this video of highlights from the mission. It includes footage from each major portion of the mission: launch preparation, launch, entering orbit, opening payload bay doors, rendezvous of Endeavour with ISS, docking of the crafts and the meeting between Endeavour and Expedition 5 crews and the Expedition 4 crew, which Expedition 5 relieved. Docked operations include: crew transfer procedures, transfer of goods, EVA (extravehicular activity) prep, EVA performed by Chang-Diaz and Perrin which included installing a grapple fixture, mounting the Mobile Base System (MBS) to the Mobile Transporter (MT), and changing a joint on the station's Canadarm 2 robotic arm. The video ends with re-entry and landing of the shuttle.

2002-01-01

374

STS-111 Mission Highlights Resource Tape. Part 2 of 4; Flight Days 5 - 7  

NASA Technical Reports Server (NTRS)

This video, Part 2 of 4, shows the activities of the STS-111 crew (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Phillipe Perrin, Mission Specialists) during flight days 5 through 7. Also shown are the incoming Expedition 5 (Valeri Korzun, Commander; Peggy Whitson, NASA ISS Science Officer; Sergei Treschev, Flight Engineer) and outgoing Expedition 4 (Yuri Onufriyenko, Commander; Carl Walz, Daniel Bursch, Flight Engineers) crews of the ISS (International Space Station). The activities from other flight days can be seen on 'STS-111 Mission Highlights Resource Tape' Part 1 of 4 (internal ID 2002139357), 'STS-111 Mission Highlights Resource Tape' Part 3 of 4 (internal ID 2002139468), and 'STS-111 Mission Highlights Resource Tape' Part 4 of 4 (internal ID 2002139474). On flight day 5, the transfer and installation of a Power and Data Grapple Fixture onto the P6 Truss during an EVA (extravehicular activity) is shown. The relocation of micrometeorite debris shields is also shown. Canadarm 2 is used to move the Mobile Base System near the Mobile Transporter on the ISS Destiny Module. The capture of the Mobile Base System takes place on flight day 6, along with a crew transfer ceremony on board the ISS. The video includes a view of the South Pacific just before dawn, and the Endeavour crew answers questions from the public.

2002-01-01

375

STS-113 Flight Day 3 Highlights  

NASA Technical Reports Server (NTRS)

This video shows the activities of the STS-113 crew (Jim Wetherbee, Commander; Paul Lockhart, Pilot; Michael Lopez-Alegria, John Herrington, Mission Specialists) during flight day 3. The major tasks of flight day 3 were rendezvous and docking with the ISS (International Space Station), the transfer of the Expedition 6 crew (Kenneth Bowersox, Commander; Donald Pettit, Nikolai Budarin, Flight Engineers) to the ISS, and preparations for an EVA (extravehicular activity) scheduled for the following day. The approach of Space Shuttle Endeavour to the ISS is shown in detail, including the firing of the Left Orbital Maneuvering System, and the aiming maneuvers the orbiter makes to dock with the ISS. There are centerline views of the ISS before and during the final docking maneuver. The new ISS crew is received by the Expedition 5 crew (Valeri Korzun, Commander; Peggy Whitsun, Sergei Treschev; Flight Engineers), and the transfer of EVA suits is shown. Earth views include a pan along a reddish Earth limb, and the Pacific Ocean with Endeavour's Canadarm robotic arm in the foreground.

2002-01-01

376

STS-111 Crew in white room during TCDT  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- In the White Room, Launch Pad 39A, the STS-111 and Expedition 5 crews pose in front of the entry into Space Shuttle Endeavour. From left are Expedition 5 crew member Sergei Treschev and Commander Valeri Korzun, with the Russian Space Agency; STS-111 Mission Specialist Philippe Perrin, with the French Space Agency; Commander Kenneth Cockrell and Pilot Paul Lockhart; Expedition 5 crew member Peggy Whitson; and Mission Specialist Franklin Chang-Diaz. The crews are taking part in Terminal Countdown Demonstration Test activities at the pad, which include emergency egress training and a simulated launch countdown. The mission is Utilization Flight 2, carrying supplies and equipment to the International Space Station, the Mobile Base System, which will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, and a replacement wrist/roll joint for Canadarm 2. The mechanical arm will then have the capability to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. Expedition 5 will travel to the Station on Endeavour as the replacement crew for Expedition 4, who will return to Earth aboard the orbiter. Launch is scheduled for May 30, 2002.

2002-01-01

377

Expedition 5 crew members arrive at KSC for launch  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. -- Expedition 5 crew members Commander Valeri Korzun, cosmonaut Sergei Treschev and astronaut Peggy Whitson get together after landing at the Shuttle Landing Facility to prepare for launch on mission STS-111. Korzun and Treschev are with the Russian Space Agency. Expedition 5 will travel to the Station on Space Shuttle Endeavour as the replacement crew for Expedition 4, who will return to Earth aboard the orbiter. Mission STS-111, known as Utilization Flight 2, is carrying supplies and equipment to the International Space Station. The payload includes the Multi-Purpose Logistics Module Leonardo, the Mobile Base System, which will be installed on the Mobile Transporter to complete the Canadian Mobile Servicing System, or MSS, and a replacement wrist/roll joint for Canadarm 2. The mechanical arm will then have the capability to 'inchworm' from the U.S. Lab Destiny to the MSS and travel along the truss to work sites. Launch is scheduled for May 30, 2002.

2002-01-01

378

STS-111 Flight Day 3 Highlights  

NASA Technical Reports Server (NTRS)

On Flight Day 3 of STS-111, the crew of Endeavour (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist) and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer), begin their final approach towards the International Space Station (ISS). From cameras aboard the ISS, live video of Endeavour is shown as it approaches the station. The Orbiter is maneuvered slowly to a position for docking, and cameras from multiple angles show this process. As it is maneuvered, there are clear views of its payload bay, which includes the Leonardo MultiPurpose Logistics Module (MPLM) and the Mobile Base System (MBS), both of which will be installed on the ISS during this mission. In the final stages of the docking procedure there is close-up footage of Endeavour meeting the ISS's Pressurized Mating Adapter 2 on the Destiny Laboratory Module. Inside the ISS, the Expedition 4 crew (Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer), which will be replaced by the Expedition 5 crew, prepares for final docking. Crew members are shown transferring equipment from the Endeavour to the ISS, prior to a replay of the mating of the two crafts. In the replay, the hatch is shown being opened and the two newly arrived crews are greeted with excitement by Expedition 4 crewmembers. The video closes with footage of the Quest airlock used for EVA (extravehicular activity) egress, and the Canadarm 2 robotic arm.

2002-01-01

379

STS-113 Flight Day 3 Highlights  

NASA Astrophysics Data System (ADS)

This video shows the activities of the STS-113 crew (Jim Wetherbee, Commander; Paul Lockhart, Pilot; Michael Lopez-Alegria, John Herrington, Mission Specialists) during flight day 3. The major tasks of flight day 3 were rendezvous and docking with the ISS (International Space Station), the transfer of the Expedition 6 crew (Kenneth Bowersox, Commander; Donald Pettit, Nikolai Budarin, Flight Engineers) to the ISS, and preparations for an EVA (extravehicular activity) scheduled for the following day. The approach of Space Shuttle Endeavour to the ISS is shown in detail, including the firing of the Left Orbital Maneuvering System, and the aiming maneuvers the orbiter makes to dock with the ISS. There are centerline views of the ISS before and during the final docking maneuver. The new ISS crew is received by the Expedition 5 crew (Valeri Korzun, Commander; Peggy Whitsun, Sergei Treschev; Flight Engineers), and the transfer of EVA suits is shown. Earth views include a pan along a reddish Earth limb, and the Pacific Ocean with Endeavour's Canadarm robotic arm in the foreground.

2002-11-01

380

STS-113 Space Shuttle Endeavour landing at KSC  

NASA Technical Reports Server (NTRS)

KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour touches down on runway 33 at the Shuttle Landing Facility (SLF) after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. In the background is a well known KSC landmark: the 525-foot-tall Vehicle Assembly Building. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

2002-01-01

381

Two Shuttle crews check equipment at SPACEHAB to be used on ISS Flights  

NASA Technical Reports Server (NTRS)

At Astrotech in Titusville, Fla., STS-96 Mission Speciaists Daniel T. Barry (left), Julie Payette (center, with camera), and Tamara E. Jernigan (right, pointing) get a close look at one of the payloads on their upcoming mission. Other crew members are Commander Kent V. Rominger, and Mission Specialists Ellen Ochoa and Valery Ivanovich Tokarev, with the Russian Space Agency. Payette is with the Canadian Space Agency. For the first time, STS-96 will include an Integrated Cargo Carrier (ICC) that will carry a Russian cargo crane, the Strela, to be mounted to the exterior of the Russian station segment on the International Space Station (ISS); the SPACEHAB Oceaneering Space System Box (SHOSS), which is a logistics items carrier; and a U.S.-built crane (ORU Transfer Device, or OTD) that will be stowed on the station for use during future ISS assembly missions. The ICC can carry up to 6,000 lb of unpressurized payload. It was built for SPACEHAB by DaimlerChrysler and RSC Energia of Korolev, Russia. STS-96 is targeted for launch on May 24 from Launch Pad 39B. STS-101 is scheduled to launch in early December 1999.

1999-01-01

382

STS-84 M.S. Kondakova with husband Ryumin at SLF  

NASA Technical Reports Server (NTRS)

STS-84 Mission Specialist Elena V. Kondakova, a cosmonaut with the Russian Space Agency, and her husband, Valery Ryumin, greet press represenatives and other well wishers after her arrival at KSCs Shuttle Landing Facility. Ryumin is director of the Mir- Shuttle program for RSC Energia in Russia. This will be Kondakovas first flight on a U.S. Space Shuttle, but her second trip into space. She spent 169 days in space as flight engineer of the 17th main mission on Mir from October 1994 to March 1995. STS-84 will be the sixth docking of the Space Shuttle with the Russian Space Station Mir. During the docking, STS-84 Mission Specialist C. Michael Foale will transfer to the Russian space station to become a member of the Mir 23 crew, replacing U.S. astronaut Jerry M. Linenger, who will return to Earth on Atlantis. Foale is scheduled to remain on Mir about four months until his replacement arrives on STS-86 in September.

1997-01-01

383

Two Shuttle crews check equipment at SPACEHAB to be used on ISS Flights  

NASA Technical Reports Server (NTRS)

At Astrotech in Titusville, Fla., STS-96 Mission Specialists Tamara E. Jernigan and Daniel T. Barry take turns working with a Russian cargo crane, the Strela, which is to be mounted to the exterior of the Russian station segment on the International Space Station (ISS). Technicians around the table observe. The STS-96 crew is taking part in a Crew Equipment Interface Test. Other members participating are Commander Kent V. Rominger, Pilot Rick Douglas Husband, and Mission Specialists Julie Payette, with the Canadian Space Agency, and Valery Ivanovich Tokarev, with the Russian Space Agency. For the first time, STS-96 will include an Integrated Cargo Carrier (ICC) that will carry the Russian cargo crane; the SPACEHAB Oceaneering Space System Box (SHOSS), which is a logistics items carrier; and a U.S.-built crane (ORU Transfer Device, or OTD) that will be stowed on the station for use during future ISS assembly missions. The ICC can carry up to 6,000 lb of unpressurized payload. It was built for SPACEHAB by DaimlerChrysler Aerospace and RSC Energia of Korolev, Russia. STS-96 is targeted for launch on May 24 from Launch Pad 39B. STS-101 is scheduled to launch in early December 1999.

1999-01-01

384

Relativistic Astrophysics  

NASA Astrophysics Data System (ADS)

Preface; Prologue: Conference overview Bernard Carr; Part I. The Universe At Large and Very Large Redshifts: 2. The size and age of the Universe Gustav A. Tammann; 3. Active galaxies at large redshifts Malcolm S. Longair; 4. Observational cosmology with the cosmic microwave background George F. Smoot; 5. Future prospects in measuring the CMB power spectrum Philip M. Lubin; 6. Inflationary cosmology Michael S. Turner; 7. The signature of the Universe Bernard J. T. Jones; 8. Theory of large-scale structure Sergei F. Shandarin; 9. The origin of matter in the universe Lev A. Kofman; 10. New guises for cold-dark matter suspects Edward W. Kolb; Part II. Physics and Astrophysics Of Relativistic Compact Objects: 11. On the unification of gravitational and inertial forces Donald Lynden-Bell; 12. Internal structure of astrophysical black holes Werner Israel; 13. Black hole entropy: external facade and internal reality Valery Frolov; 14. Accretion disks around black holes Marek A. Abramowicz; 15. Black hole X-ray transients J. Craig Wheeler; 16. X-rays and gamma rays from active galactic nuclei Roland Svensson; 17. Gamma-ray bursts: a challenge to relativistic astrophysics Martin Rees; 18. Probing black holes and other exotic objects with gravitational waves Kip Thorne; Epilogue: the past and future of relativistic astrophysics Igor D. Novikov; I. D. Novikov's scientific papers and books.

Jones, Bernard J. T.; Markovic, Dragoljub

1997-06-01

385

Apollo-Soyuz Test Project (ASTP)  

NASA Technical Reports Server (NTRS)

This artist's concept depicts the Apollo-Soyuz Test Project (ASTP) with insets of photographs of three U.S. astronauts (Thomas Stafford, Vance Brand, and Donald Slayton) and two U.S.S.R. cosmonauts (Alexei Leonov and Valeri Kubasov). The objective of the ASTP mission was to accomplish the first docking of a standardized international system, the U.S.'s Apollo spacecraft and the U.S.S.R.'s Soyuz spacecraft, in space. The Soyuz spacecraft was launched from the Baikonur Cosmodrome near Tyuratam in the Kazakh, Soviet Socialist Republic, at 8:20 a.m. (EDT) on July 15, 1975. The Apollo spacecraft was launched from Launch Complex 39B, Kennedy Space Center, Florida, at 3:50 p.m. (EDT) on July 15, 1975. The Primary objectives of the ASTP were achieved. They performed spacecraft rendezvous, docking and undocking, conducted intervehicular crew transfer, and demonstrated the interaction of U.S. and U.S.S.R. control centers and spacecraft crews. The mission marked the last use of a Saturn launch vehicle. The Marshall Space Flight Center was responsible for development and sustaining engineering of the Saturn IB launch vehicle during the mission.

1974-01-01

386

Preserved painting abilities after a stroke. The case of Paul-Elie Gernez.  

PubMed

In a famous paper published in 1948, the French neurologist Thophile Alajouanine discussed the influence of aphasia on artistic output. He used as examples three artists he had personally examined. They were the musician Maurice Ravel, the writer Valery Larbaud, and a painter whose name was not mentioned. We have now discovered the identity of this painter and therefore present, for the first time, with the permission of his family, an analysis of the works of Paul-Elie Gernez (1888-1948) before and after his cerebral stroke. This painter's ability to produce works of art was not really diminished by his aphasia. However, we do believe that there was a change in his style, which seemed to become less poetic, as though his ability to "invent" had decreased and he had lost some of his spontaneity. This and other published cases strongly suggest that in some artists the effect of cerebral lesions is different from that found in individuals with no artistic training. This difference may be attributable to the presence, in the former, of an expanded cortical representation, secondary to their lifelong formal training. PMID:16483452

Boller, Franois; Sinforiani, Elena; Mazzucchi, Anna

2005-01-01

387

Intrinsic Charge Transport in Organic Field-Effect Transistors  

NASA Astrophysics Data System (ADS)

Organic field-effect transistors (OFETs) are essential components of modern electronics. Despite the rapid progress of organic electronics, understanding of fundamental aspects of the charge transport in organic devices is still lacking. Recently, the OFETs based on highly ordered organic crystals have been fabricated with innovative techniques that preserve the high quality of single-crystal organic surfaces. This technological progress facilitated the study of transport mechanisms in organic semiconductors [1-4]. It has been demonstrated that the intrinsic polaronic transport, not dominated by disorder, with a remarkably high mobility of ``holes'' ? = 20 cm^2/Vs can be achieved in these devices at room temperature [4]. The signatures of the intrinsic polaronic transport are the anisotropy of the carrier mobility and an increase of ? with cooling. These and other aspects of the charge transport in organic single-crystal FETs will be discussed. Co-authors are Etienne Menard, University of Illinois at Urbana Champaign; Valery Kiryukhin, Rutgers University; John Rogers, University of Illinois at Urbana Champaign; Michael Gershenson, Rutgers University. [1] V. Podzorov et al., Appl. Phys. Lett. 82, 1739 (2003); ibid. 83, 3504 (2003). [2] V. C. Sundar et al., Science 303, 1644 (2004). [3] R. W. I. de Boer et al., Phys. Stat. Sol. (a) 201, 1302 (2004). [4] V. Podzorov et al., Phys. Rev. Lett. 93, 086602 (2004).

Podzorov, Vitaly

2005-03-01

388

Human Embryology Animations  

NSDL National Science Digital Library

One of the most impressive ways to learn about biology, particularly that which we seldom see, is through modeling. Dr. Valerie O'Loughlin and her colleagues at Indiana University have created this thoroughly impressive set of animations so that "students could better understand the complex processes that must occur in embryologic development." The site is arranged into five main areas, including: Cardiovascular Embryology, Development of the Head and Neck, Gastrointestinal Embryology, Development of the Limbs, and Urinary and Reproductive Embryology. However, the only two sections currently loaded with animations are the first two. Presumably, the rest are coming soon. Also, because these animations are part of a study of teaching efficacy, Dr. O'Loughlin asks that users participate in an optional survey. However, all animations can be accessed without taking part. As a great addition to the site, users are presented with a few questions regarding the anatomy which they are about to see, prior to viewing the animation. Undboutedly, this is related to the Indiana University course that these animations are a part of, but they serve as a great addition for visitors other than students, too.

O'Loughlin, Valerie

389

Banana Ripening: Implications of Changes in Internal Ethylene and CO2 Concentrations, Pulp Fructose 2,6-Bisphosphate Concentration, and Activity of Some Glycolytic Enzymes 1  

PubMed Central

In ripening banana (Musa acuminata L. [AAA group, Cavandish subgroup] cv. Valery) fruit, the steady state concentration of the glycolytic regulator fructose 2,6-bisphosphate (Fru 2,6-P2) underwent a transient increase 2 to 3 hours before the respiratory rise, but coincident with the increase in ethylene synthesis. Fru 2,6-P2 concentration subsequently decreased, but increased again approximately one day after initiation of the respiratory climacteric. This second rise in Fru 2,6-P2 continued as ripening proceeded, reaching approximately five times preclimacteric concentration. Pyrophosphate-dependent phosphofructokinase glycolytic activity exhibited a transitory rise during the early stages of the respiratory climacteric, then declined slightly with further ripening. Cytosolic fructose 1,6-bisphosphatase activity did not change appreciably during ripening. The activity of ATP-dependent phosphofructokinase increased approximately 1.6-fold concurrent with the respiratory rise. A balance in the simultaneous glycolytic and gluconeogenic carbon flow in ripening banana fruit appears to be maintained through changes in substrate levels, relative activities of glycolytic enzymes and steady state levels of Fru 2,6-P2. PMID:16665670

Beaudry, Randolph M.; Paz, Nachman; Black, Clanton C.; Kays, Stanley J.

1987-01-01

390

Expedition Crews Four and Five and STS-111 Crew Aboard the ISS  

NASA Technical Reports Server (NTRS)

Huddled together in the Destiny laboratory of the International Space Station (ISS) are the Expedition Four crew (dark blue shirts), Expedition Five crew (medium blue shirts) and the STS-111 crew (green shirts). The Expedition Four crewmembers are, from front to back, Cosmonaut Ury I. Onufrienko, mission commander; and Astronauts Daniel W. Bursch and Carl E. Waltz, flight engineers. The ISS crewmembers are, from front to back, Astronauts Kerneth D. Cockrell, mission commander; Franklin R. Chang-Diaz, mission specialist; Paul S. Lockhart, pilot; and Philippe Perrin, mission specialist. Expedition Five crewmembers are, from front to back, Cosmonaut Valery G. Korzun, mission commander; Astronaut Peggy A. Whitson and Cosmonaut Sergei Y. Treschev, flight engineers. The ISS recieved a new crew, Expedition Five, replacing Expedition Four after a record-setting 196 days in space, when the Space Shuttle Orbiter Endeavour STS-111 mission visited in June 2002. Three spacewalks enabled the STS-111 crew to accomplish additional mission objectives: the delivery and installation of the Mobile Base System (MBS), which is an important part of the station's Mobile Servicing System allowing the robotic arm to travel the length of the station; the replacement of a wrist roll joint on the Station's robotic arm; and unloading supplies and science experiments from the Leonardo Multi-Purpose Logistics Module, which made its third trip to the orbital outpost. The STS-111 mission, the 14th Shuttle mission to visit the ISS, was launched on June 5, 2002 and landed June 19, 2002.

2002-01-01

391

Do changes in muscle architecture affect post-activation potentiation?  

PubMed

The purpose of this randomized, cross-over design study was to examine the effect of three different muscle potentiation protocols on acute changes in muscle architecture and vertical jump performance. Eleven experienced, resistance trained men (25.23.6y) completed three potentiation squat protocols using moderate intensity (MI; 75%, 3 sets x 10 repetitions), high intensity (HI; 90%, 3 sets x 3 repetitions) and 100% (1RM; 1 set x 1repetition) of their 1RM. In addition, all participants completed a control session (CTL) in which no protocol was performed. During each testing session, muscle architecture and vertical jump testing were assessed at baseline (BL), 8min post (8P) and 20min post (20P) workout. Ultrasound measures included cross sectional area (CSA) and pennation angle (PANG) of both the rectus femoris (RF) and vastus lateralis (VL). Following each ultrasound measure, peak vertical jump power (PVJP) and mean (MVJP) power was assessed using an accelerometer. Magnitude based inferences were used to make comparisons between trials. The MI trial resulted in a likely greater increase from BL to 8P and 20P in RF-CSA and VL-CSA, while the HI trial resulted in a likely greater change from BL to 20P in both RF-CSA and VL-CSA. Meanwhile, changes in PVJP and MVJP for the MI trial was likely decreased at BL-8P and BL-20P, while the HI trial was shown to result in a likely or possible decrease compared to CTL at BL-8P and BL-20P, respectively. A likely negative relationship was observed between changes in VL-PANG and MVJP (r = -0.35; p , 0.018) at BL-8P, and between changes in PVJP and RF-CSA (r = -0.37; p , 0.014) at BL-20P. Results of this study were unable to demonstrate any potentiation response from the trials employed, however these protocols did result in acute muscle architectural changes. Key pointsThree squat protocols using moderate intensity (75% 1-RM; 3 sets x 10 repetitions), high intensity (90% 1-RM, 3 sets x 3 repetitions) and maximal intensity (100% 1RM; 1 set x 1repetition) were unable to potentiate jump height or jump power in experienced, resistance trained men.Experienced, resistance trained athletes who are not competitive may be limited in regards to potentiation due to a poor level of conditioning.Both the moderate and high intensity potentiation protocols stimulated acute changes in muscle architecture. Greater increases in the CSA of both the RF and VL muscles were noted.A different potentiation protocol may have elicited greater changes in muscle architecture. PMID:25178394

Reardon, Danielle; Hoffman, Jay R; Mangine, Gerald T; Wells, Adam J; Gonzalez, Adam M; Jajtner, Adam R; Townsend, Jeremy R; McCormack, William P; Stout, Jeffrey R; Fragala, Maren S; Fukuda, David H

2014-09-01

392

The Earth's Interaction With the Sun Over the Millennia From Analyses of Historical Sunspot, Auroral and Climate Records  

NASA Astrophysics Data System (ADS)

A prolonged decrease in the Sun's irradiance during the Maunder Minimum has been proposed as a cause of the Little Ice Age ({ca} 1600-1800). Eddy [{Science} {192}, 1976, 1189] made this suggestion after noting that very few sunspots were observed from 1645 to 1715, indicative of a weakened Sun. Pre-telescopic Oriental sunspot records go back over 2200 years. Periods when no sunspots were seen have been documented by, {eg}, Clark [{Astron} {7}, 2/1979, 50]. Abundances of C 14 in tree rings and Be10 in ice cores are also good indicators of past solar activity. These isotopes are produced by cosmic rays high in the atmosphere. When the Sun is less active more of them are made and deposited at ground level. There is thus a strong {negative} correlation between their abundances and sunspot counts. Minima of solar activity in tree rings and a south polar ice core have been collated by, {eg}, Bard [{Earth Planet Sci Lett} {150} 1997, 453]; and show striking correspondence with periods when no sunspots were seen, centered at {ca} 900, 1050, 1500, 1700. Pang and Yau [{Eos} {79}, #45, 1998, F149] investigated the Medieval Minimum at 700, using in addition the frequency of auroral sighting7s, a good indicator of solar activity too [Yau, PhD thesis, 1988]; and found that the progression of minima in solar activity goes back to 700. Auroral frequency, C 14 and Be 10 concentrations are also affected by variations in the geomagnetic field. Deposition changes can also influence C 14 and Be 10 abundances. Sunspot counts are thus the only true indicator of solar activity. The Sun's bolometric variations (-0.3% for the Maunder Minimum) can contribute to climatic changes (\\0.5 C for the Little Ice Age)[{eg}, Lean, {GRL} {22}, 1995, 3195]. For times with no thermometer data, temperature can be estimated from, {eg}, Oxygen 18 isotopic abundance in ice cores, which in turn depends on the temperature of the ocean water it evaporated from. We have linked the Medieval Minimum to the cold spell, dated to {ca} 700 by Dansgaard [{Nature} {255}, 1974, 24]. Using records of advances and retreats of glaciers, previous researchers have linked it to a cold spell in the previous two centuries instead, thus requiring an offset in timescales. Our literature search has yielded more records of sunspot sightings, and established the fifth century as a minimum of solar activity, ending in a maximum at {ca} 500. These features and the minimum at 700 match contemporary deviations of atmospheric C 14 from a secular trend, due primarily to long-term changes in the strength of the Earth's magnetic moment [Stuiver, {Radiocarbon} {35}, 215]. Pang has shown that the climate of Eurasia was cold in the 5th century, due partly to volcanic cooling [{Eos} {80}, #46, 1999, F220]. Reduced solar luminosity may have contributed to that too. The cold apparently forced massive southward migrations of Teutonic and Asian barbarians into the Roman Empire, ending it in 476. Europe was plunged into the Dark Age, from which it did not recover until the climate warmed up again toward the end of the millennium. Finally, climate changes can also be produced by greenhouse warming, reorganization of ocean current systems "Dansgaard-Oeschger events," the Earth's orbital variations "Milankovitch effects," {etc}. Continued analysis of historical records, in conjunction with other proxy data, can help shed light on the nature of the Earth's interactions with the Sun, and the causes of past climate changes.

Yau, K.

2001-12-01

393

Understanding Sun-Climate Connection by Analysis of Historical Sunspot, Auroral and Weather Records  

NASA Astrophysics Data System (ADS)

Fifty years of galactic cosmic ray data show changes with the solar cycle. Deflection of the highly energetic particles from exploding supernovae by the solar wind and associated magnetic field also modulates cosmogenic radioisotope production high in the atmosphere. The same trends are seen in carbon-14 and beryllium-10 abundances from long-lived trees and polar ice cores, respectively. Total solar irradiances measured by satellite radiometers show a 0.1% variance over the last two solar cycles, with only a small effect on global temperatures. A longer view is obviously needed. During the Maunder Minimum (1645-1715) sunspots were rarely seen. Total solar irradiances, reconstructed from historical sunspot data, were 0.24% lower, correlating nicely with an estimated 0.5-degree drop in Northern Hemisphere surface temperatures during the Little Ice Age [Lean and Rind, J. Clim. 11, 3069, 1998]. A longer time series has been reconstructed from even earlier records. From the frequencies of sunspot and auroral sightings in East Asian and European chronicles, C-14 and Be-10 abundances we have reconstructed the recent history of a variable Sun. In the past 1800 years the Sun has gone through nine cycles of brightness change. Although these long-term changes were <1% they have clearly affected the climate [Pang and Yau, Eos 83, No. 43, 481, 2002]. We have also analyzed Chinese historical weather records for comparison. Reports of unseasonable cold are classified by their degree of severity: (1) Late (April-June) or early (July-Sept.) killing frosts; (2) Bitter cold/heavy snowfall; and (3) Heavy sustained snowfall, bitter cold with frozen wells, lakes, rivers and icebound seas. The latter cases were often widespread and multi-year. All categories occurred most often during Maunder Minimum. The Category 3 episodes were in 1652-54, 1656, 1664, 1670-72, 1676-77, 1683, 1688-91, 1716 and 1718-19. The coldest time 1670-1697 coincides with lows in aurora sightings and numerical model simulated temperatures, and highs in radioisotope production. There was only one Category 3 episode between the Maunder and Dalton Minima-in 1761 (due to a big eruption); and two in the Dalton Minimum (1795-1825)-in 1796 and 1814-17. The 1815 Tambora eruption, with the reduced solar luminosity, seem to have been responsible for the "year without summer" and long-cold spell. The Sun has brightened since the Dalton Minimum, but the climate of China stayed cold through the 19th century. However there were only two Category 3 episodes: in 1841 and 1877. The onset of global warming reduced that to just once in the 20th century: 1955. The climate of China seems to have been warm during the Late 14th-Century Maximum (1350-1410). We have found only one Category 1 episode: in 1393. It then turned cold during the Sporer Minimum (1410-1590). Category 3 episodes occurred in 1453-54, 1493, 1513, 1569, and 1577-78. The early 1453 great Kuwae eruption apparently deepened and prolonged the first [Pang, Eos 74, No. 43, 106, 1993; Simarski, Aramco World 47, No.6, 8, 1996]. We conclude that the climate of China in the past 650 years generally follows world trend. The major forcing seems to have been changing solar luminosity, as all but four severe weather episodes coincide with solar minimum. The exact mechanism remains unknown, but could have been increased cloudiness.

Pang, K. D.; Yau, K. K.

2005-12-01

394

The amino terminus of GLUT4 functions as an internalization motif but not an intracellular retention signal when substituted for the transferrin receptor cytoplasmic domain  

PubMed Central

Previous studies have demonstrated that the amino-terminal cytoplasmic domain of GLUT4 contains a phenylalanine-based targeting motif that determines its steady state distribution between the surface and the interior of cells (Piper, R. C., C. Tai, P. Kuleza, S. Pang, D. Warnock, J. Baenziger, J. W. Slot, H. J. Geuze, C. Puri, and D. E. James. 1993. J. Cell Biol. 121:1221). To directly measure the effect that the GLUT4 amino terminus has on internalization and subsequent recycling back to the cell surface, we constructed chimeras in which this sequence was substituted for the amino-terminal cytoplasmic domain of the human transferrin receptor. The chimeras were stably transfected into Chinese hamster ovary cells and their endocytic behavior characterized. The GLUT4-transferrin receptor chimera was recycled back to the cell surface with a rate similar to the transferrin receptor, indicating that the GLUT4 sequence was not promoting intracellular retention of the chimera. The GLUT4-transferrin receptor chimera was internalized at half the rate of the transferrin receptor. Substitution of an alanine for phenylalanine at position 5 slowed internalization of the chimera by twofold, to a level characteristic of bulk membrane internalization. However, substitution of a tyrosine increased the rate of internalization to the level of the transferrin receptor. Neither of these substitutions significantly altered the rate at which the chimeras were recycled back to the cell surface. These results demonstrate that the major function of the GLUT4 amino-terminal domain is to promote the effective internalization of the protein from the cell surface, via a functional phenylalanine-based internalization motif, rather than retention of the transporter within intracellular structures. PMID:8120093

1994-01-01

395

Robust evidence for random fractal scaling of groundwater levels in unconfined aquifers  

NASA Astrophysics Data System (ADS)

SummaryThis study introduces new approaches to improve the statistical robustness of techniques for quantifying the fractal scaling of groundwater levels, and uses these techniques to investigate scaling of groundwater levels from a consolidated permeable carbonate aquifer. Six groundwater level time series and an associated river stage time series from the unconfined Chalk aquifer (a dual-porosity, fractured limestone aquifer) in the Pang-Lambourn catchment, UK, have been analysed. Surrogate data of time series with known scaling properties have been used to estimate the probability distribution of the spectral and geometric scaling exponents determined by detrended fluctuation analysis (DFA) and power spectral density (PSD) respectively; robust regression techniques have been used to improve estimates of the scaling exponents; and robust non-parametric techniques have been used to correlate scaling exponents with features of the boreholes and catchments. Strong statistical support has been found for temporal scaling of groundwater levels over a wide range of time scales, however, bootstrap estimates of the scaling exponents indicate a much larger range of exponents than found by previous studies, suggesting that the uncertainty in existing estimates of scaling exponents may be too small. There is robust evidence that geometrical scaling properties at each borehole can be related to the depth of the observation boreholes and distance of those boreholes from the river in the catchment, but no such correlations were found for the spectral scaling exponents. The results build on the body of evidence that groundwater levels, as with many hydrogeological phenomena, may be well modelled with mathematical concepts from statistical mechanics that do not attempt to capture every detail of these highly heterogeneous and complex systems.

Little, Max A.; Bloomfield, John P.

2010-11-01

396

Dispersal of Trichogramma ostriniae (Hymenoptera: Trichogrammatidae) in potato fields.  

PubMed

The dispersal ability of Trichogramma ostriniae Pang and Chen, a biological control agent of Ostrinia nubilalis Hbner, was studied in commercial potato fields on the Eastern Shore of Virginia. The purpose was to quantify dispersal of T. ostriniae after an inundative release to aid in determining the number of release points needed per unit area for effective biological control of O. nubilalis in solanaceous crops. A single release of approximately 0.5 million wasps was made in two spatially separate potato fields in summer 2005 and 2006. Each release area contained 25 monitoring points at distances from 5 to 45 m from the release point bearing a yellow sticky card and O. nubilalis egg sentinels to observe for adult parasitoids and parasitism, respectively. Results showed that movement of T. ostriniae adults from the release point was rapid with individuals captured at 45 m within 1 d of emergence. High rates of parasitization (20-50%) also were observed at this distance, but the levels decreased with increasing distance from the release point. The distances that encompassed 98% recaptured T. ostriniae adults (x(98)) were 27.5 and 12.9 m from the release point in 2005 and 2006, respectively. The (x(98)) distances for parasitization of O. nubilalis were 21-26 m in 2005 and 8-10 m in 2006. However, the highest levels of parasitization in both years occurred nearest the release point. T. ostriniae showed uniform dispersal within an area of approximately 0.1 ha, indicating that multiple release points should be used for effective dispersal of T. ostriniae and control of O. nubilalis in solanaceous crops. Based on the assumption that a distance of 16 m represents the radius around a release point in which T. ostriniae activity was at its maximum, we estimate that approximately 12 release points/ha would be required in potato fields. PMID:19508776

Chapman, Anna V; Kuhar, Thomas P; Schultz, Peter B; Brewster, Carlyle C

2009-06-01

397

COLOR SUPERCONDUCTIVITY, INSTANTONS AND PARITY (NON?)-CONSERVATION AT HIGH BARYON DENSITY-VOLUME 5.  

SciTech Connect

This one day Riken BNL Research Center workshop was organized to follow-up on the rapidly developing theoretical work on color super-conductivity, instanton dynamics, and possible signatures of parity violation in strong interactions that was stimulated by the talk of Frank Wilczek during the Riken BNL September Symposium. The workshop was held on November 11, 1997 at the center with over 30 participants. The program consisted of four talks on theory in the morning followed by two talks in the afternoon by experimentalists and open discussion. Krishna Rajagopal (MIT) first reviewed the status of the chiral condensate calculations at high baryon density within the instanton model and the percolation transition at moderate densities restoring chiral symmetry. Mark Alford (Princeton) then discussed the nature of the novel color super-conducting diquark condensates. The main result was that the largest gap on the order of 100 MeV was found for the 0{sup +} condensate, with only a tiny gap << MeV for the other possible 1{sup +}. Thomas Schaefer (INT) gave a complete overview of the instanton effects on correlators and showed independent calculations in collaboration with Shuryak (SUNY) and Velkovsky (BNL) confirming the updated results of the Wilczek group (Princeton, MIT). Yang Pang (Columbia) addressed the general question of how breaking of discrete symmetries by any condensate with suitable quantum numbers could be searched for experimentally especially at the AGS through longitudinal A polarization measurements. Nicholas Samios (BNL) reviewed the history of measurements on {Lambda} polarization and suggested specific kinematical variables for such analysis. Brian Cole (Columbia) showed recent E910 measurements of {Lambda} production at the AGS in nuclear collisions and focused on the systematic biases that must be considered when looking for small symmetry breaking effects. Lively discussions led by Robert Jaffe (MIT) focused especially on speculations on the still unknown signatures of 0{sup +} color super-conductivity which of course would not be observable via discrete symmetry breaking.

GYULASSY,M.

1997-11-11

398

Suspended sediment and particulate phosphorus in surface waters of the upper Thames Basin, UK  

NASA Astrophysics Data System (ADS)

SummarySuspended sediment (SS) and particulate phosphorus (PP) concentrations in surface waters of the upper Thames Basin are reported for the main stem of the River Thames, several of its tributaries, the Cherwell, Dun, Lambourn, Pang and Thame, the Kennet and Avon Canal (that drains to the Dun and Kennet) and an artificial supply reservoir (Wilton Water). For the rivers which are mainly supplied from Chalk aquifer sources, SS and PP concentrations are poorly correlated with flow and there are issues of both biological and inorganic production of SS and PP during the spring and summer months. SS and PP are better correlated with flow when the antecedent conditions are taken into account. Thus, if flows had increased the previous day, then SS and PP concentrations are augmented. Wilton Water and the Kennet and Avon Canal have, on average, higher SS and PP concentrations than the nearby Chalk fed rivers and this probably reflects increased effects of biological activity and calcite (CaCO 3) precipitation under more stagnant conditions. For the rivers draining less permeable (clay dominated) catchments, then there is clearer linkage between flow and SS and PP concentrations. This feature reflects the more responsive influence of runoff from the land surface without the confounding issues of seasonally-varying groundwater discharges, intersection of groundwater levels with the ground surface and overland flow that may well characterise the permeable Chalk catchments. SS and PP are linearly correlated across the catchments. For the Chalk catchments and the associated Wilton Water and Kennet and Avon Canal, the PP:SS ratios are similar, ranging typically between 2 and 4 ?g/mg. For the clay dominated catchments, the ratios are typically higher at 3-7 ?g/mg. The results are considered in the light of process understanding, farming, climate change/climate-variability and the Water Framework Directive.

Neal, Colin; Neal, Margaret; Leeks, Graham J. L.; Old, Gareth; Hill, Linda; Wickham, Heather

2006-10-01

399

Drawing, Engraving, Photographing, Plotting, and Printing: Recent results in the historical study of visual representations  

NASA Astrophysics Data System (ADS)

As an introduction, I survey the recent literature on nonverbal - in particular visual - representations in the history of astronomy and astrophysics, for which pictorial records form an integral part, and identify areas in need of more in-depth historical study. One example is Daston & Galison's distinction of three types of atlases: first (predominantly since the 18th century), the highly idealized `metaphysical' image; second (prevalent in the second half of the 19th century), the `mechanical' image ideally produced without human intervention; third (mostly in the 20th century), `typified' patterns, with corresponding upgrading of human skills for Gestalt recognition. Related to the second type of representation is the high cultural value of photography, welcomed then in the hope that henceforth `Nature herself' would be her own recorder, thus promising to do away with the problems of human bias and artistic limitations. Recent studies on research practice, e.g., in the mapping of spectra or astronomical image-processing, have shown, however, that human intervention still is present at many levels of the recording and printing process. Alex Pang's papers on Victorian representations of the solar corona and on astrophotography are discussed as trailblazing examinations of the interplay between observers and their photomechanical printing agents. My recent paper on the culture of visual representations in spectroscopic education and laboratory instruction is presented as an extension into the area of teaching and dissemination: how were spectroscopy students trained in stellar classification, or element identification? More generally: how are visual cultures, or image traditions, as Peter Galison puts it in Image and Logic (1997), formed and stabilized?

Hentschel, K.

400

Color Variations Of Saturn's Small Satellites: The Ring Connection  

NASA Astrophysics Data System (ADS)

We investigate color hetereogeneities among Pandora, Janus, Epimetheus, and Telesto in calibrated high resolution (<1.5 km/pixel) Cassini Imaging Subsystem (ISS) images over the UV3 (338 nm) , GRN (568 nm), IR3 (930 nm) broadband filters. The whole-disk color ratios show a progression with increasing distance from Saturn from Pandora to Telesto (and from the F-ring to the E-ring) . The mode UV3/IR3 ratio for Pandora is 0.5; for Janus and Epimetheus it is 0.6 and is 1.0 for Telesto. The systematic increase of blueness toward the E-ring may be a result of contamination by E-ring particles injected by the cryovolcanic plume eruptions from Enceladus (Pang et al. 1984, JGR 89, 9459-9470). All of these satellites exhibit subtle regional color variations that deviate no more than +/-0.2 from the modal ratio value. These variations may reflect different geologic compositional units or grain sizes. Telesto is the most uniform with ratio differences that are mostly less than +/- 0.04. Pandora has a UV3/IR3 ratio variation generally less than +/-0.12 that shows different material in parts of larger crater interiors. Janus has a latitudinal UV3/IR3 variation in which the south is redder than the north, which is consistent with VIMS observations of Janus (Filacchione et al. 2009, LPSC 40, 1780). Many crater rims on Epimetheus have UV3/IR3 ratios distinct from smoother surroundings.

Morrison, Sarah J.; Helfenstein, P.; Thomas, P.; Veverka, J.; Denk, T.

2009-09-01

401

Pre-Venus-Transit Dark Lunar Eclipse Reveals a Very Large Volcanic Eruption in 1761  

NASA Astrophysics Data System (ADS)

Kepler's third law states Sun-planet distances in AU. International observations of the solar parallax during the 1761/1769 Venus transits gave us the first AU in miles. Benjamin Franklin promoted American participation in the project. While serving as Ambassador to France he observed that a "dry fog from the 1783 Laki eruption in Iceland had obscured the Sun, and led to a cold summer and winter. Using Benjamin Franklin's method I analyzed photometric observations of the dark lunar eclipse made just before the 1761 Venus transit, ice core, tree ring, and Chinese weather data, and conclude that a very large previously unknown volcanic eruption in early 1761 had cooled the world climate. Observers worldwide found the 18 May 1761 totally eclipsed Moon very dark or invisible, e.g., Wargentin could not see the Moon for 38 minutes even with a 2-ft telescope (Phil. Trans. 52, 208, 1761-1762). Since the totally eclipsed Moon is illuminated only by sunlight refracted by the Earth's atmosphere, the obscuration must have been very severe. Ice cores from Greenland and Antarctica have large sulfuric acid contents in 1761-1762, precipitated from the global volcanic acid cloud (Zeilinski, J. Geophys. Res. 102, 26625, 1997). Frost-damaged rings in American bristlecone pines confirm that 1761 was very cold (LaMarche, Nature 307, 121, 1984). Contemporary Chinese chronicles report that heavy sustained snow fell from the Tropic of Cancer to the Yellow River. Wells and rivers froze, e.g., Taihu "Great Lake and nearby Yangtze tributaries were not navigable. Innumerable trees, birds and livestock perished, etc. All observations are consistent with the above conclusion. Finally Benjamin Franklin's criteria for a climate-altering volcanic eruption are still universally used. Moreover his legacy continues to inspire climate researchers. See Pang, Eos 74, no. 43, 106, 1993; and as cited in "Earth in Balance, Al Gore, p. 379, 1993.

Pang, Kevin

2009-01-01

402

STS-112 Flight Day 4 Highlights  

NASA Technical Reports Server (NTRS)

On the fourth day of STS-112, its crew (Jeffrey Ashby, Commander; Pamela Melroy, Pilot; David Wolf, Mission Specialist; Piers Sellers, Mission Specialist; Sandra Magnus, Mission Specialist; Fyodor Yurchikhin, Mission Specialist) onboard Atlantis and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer) onboard the International Space Station (ISS) are seen preparing for the installation of the S1 truss structure. Inside the Destiny Laboratory Module, Korzun and other crewmembers are seen as they busily prepare for the work of the day. Sellers dons an oxygen mask and uses an exercise machine in order to purge the nitrogen from his bloodstream, in preparation for an extravehicular activity (EVA). Whitson uses the ISS's Canadarm 2 robotic arm to grapple the S1 truss and remove it from Atlantis' payload bay, with the assistance of Magnus. Using the robotic arm, Whitson slowly maneuvers the 15 ton truss structure into alignment with its attachment point on the starboard side of the S0 truss structure, where the carefully orchestrated mating procedures take place. There is video footage of the entire truss being rotated and positioned by the arm, and ammonia tank assembly on the structure is visible, with Earth in the background. Following the completion of the second stage capture, the robotic arm is ungrappled from truss. Sellers and Wolf are shown exiting the the Quest airlock hatch to begin their EVA. They are shown performing a variety of tasks on the now attached S1 truss structure, including work on the Crew Equipment Translation Cart (CETA), the S-band Antenna Assembly, and umbilical cables that provide power and remote operation capability to cameras. During their EVA, they are shown using a foot platform on the robotic arm. Significant portions of their activities are shown from the vantage of helmet mounted video cameras. The video closes with a final shot of the ISS and its new S1 truss.

2002-01-01

403

STS-111 Flight Day 5 Highlights  

NASA Technical Reports Server (NTRS)

On Flight Day 5 of STS-111, the crew of Endeavour (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist) and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer) and Expedition 4 crew (Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer) are aboard the docked Endeavour and International Space Station (ISS). The ISS cameras show the station in orbit above the North African coast and the Mediterranean Sea, as Chang-Diaz and Perrin prepare for an EVA (extravehicular activity). The Canadarm 2 robotic arm is shown in motion in a wide-angle shot. The Quest Airlock is shown as it opens to allow the astronauts to exit the station. As orbital sunrise approaches, the astronauts are shown already engaged in their EVA activities. Chang-Diaz is shown removing the PDGF (Power and Data Grapple Fixture) from Endeavour's payload bay as Perrin prepares its installation position in the ISS's P6 truss structure; The MPLM is also visible. Following the successful detachment of the PDGF, Chang-Diaz carries it to the installation site as he is transported there by the robotic arm. The astronauts are then shown installing the PDGF, with video provided by helmet-mounted cameras. Following this task, the astronauts are shown preparing the MBS (Mobile Base System) for grappling by the robotic arm. It will be mounted to the Mobile Transporter (MT), which will traverse a railroad-like system along the truss structures of the ISS, and support astronaut activities as well as provide an eventual mobile base for the robotic arm.

2002-01-01

404

List of participants at SIDE IV meeting, Tokyo, 27 November--1 December 2000  

NASA Astrophysics Data System (ADS)

Mark J Ablowitz, Vsevolod Adler, Mark Alber, Said Belmehdi, Marco Boiti, Claude Brezinski, R Bullough, Y M Chiang, Theodore Chihara, Peter A Clarkson, Robert Conte, Adam Doliwa, Vladimir Dorodnitsyn, Mitsuaki Eguchi, Claire Gilson, Basil Grammaticos, Valeri Gromak, Rod Halburd, Koji Hasegawa, Jarmo Hietarinta, Ryogo Hirota, Xing Biao Hu, M Idzumi, J Inoguchi, Hiroya Ishikara, Mourad Ismail, Shin Isojima, Kenichi Ito, Yoshiaki Itoh, Masashi Iwasaki, Klara Janglajew, Michio Jimbo, Nalini Joshi, Kenji Kajiwara, Saburo Kakei, Masaru Kamata, Satoshi Kamei, Rinat Kashaev, Shingo Kawai, Taeko Kimijima, K Kimura, Anatol Kirillov, Koichi Kondo, Boris Konopelchenko, Martin Kruskal, Atsuo Kuniba, Wataru Kunishima, Franklin Lambert, Serguei Leble, Decio Levi, Shigeru Maeda, Manuel Manas, Ken-Ichi Maruno, Tetsu Masuda, J Matsukidaira, Atsushi Matsumiya, Shigeki Matsutani, Yukitaka Minesaki, Mikio Murata, Micheline Musette, Atsushi Nagai, Katsuya Nakagawa, Atsushi Nakamula, Akira Nakamura, Yoshimasa Nakamura, Frank Nijhoff, J J C Nimmo, Katsuhiro Nishinari, Michitomo Nishizawa, A Nobe, Masatoshi Noumi, Yaeko Ohsaki, Yasuhiro Ohta, Kazuo Okamoto, Alexandre Orlov, Naoki Osada, Flora Pempinelli, Spiro Pyrlis, Reinout Quispel, Orlando Ragnisco, Alfred Ramani, Jean-Pierre Ramis, Andreas Ruffing, Simon Ruijsenaars, Satoru Saito, Noriko Saitoh, Hidetaka Sakai, Paulo Santini, Narimasa Sasa, Ryu Sasaki, Yoshikatsu Sasaki, Junkichi Satsuma, Sergei Sergeev, Nobuhiko Shinzawa, Evgueni Sklyanin, Juris Suris, Norio Suzuki, Yukiko Tagami, Katsuaki Takahashi, Daisuke Takahashi, Tomoyuki Takenawa, Yoshiro Takeyama, K M Tamizhmani, T Tamizhmani, Kouichi Toda, Morikatsu Toda, Tetsuji Tokihiro, Takayuki Tsuchida, Yohei Tsuchiya, Teruhisa Tsuda, Satoru Tsujimoto, Walter Van Assche, Claude Viallet, Luc Vinet, Shinsuke Watanabe, Yoshihida Watanabe, Ralph Willox, Pavel Winternitz, Yasuhiko Yamada, Yuji Yamada, Jin Yoneda, Haruo Yoshida, Katsuhiko Yoshida, Daisuke Yoshihara, Fumitaka Yura, J Zagrodzinski, Alexei Zhedanov

2001-12-01

405

STS-111 Mission Highlights Resource Tape  

NASA Astrophysics Data System (ADS)

This video, Part 1 of 4, shows the activities of the STS-111 crew (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Phillipe Perrin, Mission Specialists) during flight days 1 through 4. Also shown are the incoming Expedition 5 (Valeri Korzun, Commander; Peggy Whitson, NASA ISS Science Officer; Sergei Treschev, Flight Engineer) and outgoing Expedition 4 (Yuri Onufriyenko, Commander; Carl Walz, Daniel Bursch, Flight Engineers) crews of the ISS (International Space Station). The activities from other flight days can be seen on 'STS-111 Mission Highlights Resource Tape' Part 2 of 4 (internal ID 2002139469), 'STS-111 Mission Highlights Resource Tape' Part 3 of 4 (internal ID 2002139468), and 'STS-111 Mission Highlights Resource Tape' Part 4 of 4 (internal ID 2002139474). The primary activity of flight day 1 is the launch of Space Shuttle Endeavour. The crew is seen before the launch at a meal and suit-up, and some pre-flight procedures are shown. Perrin holds a sign with a personalized message. The astronauts communicate with Mission Control extensively after launch, and an inside view of the shuttle cabin is shown. The replays of the launch include close-ups of the nozzles at liftoff, and the fall of the solid rocket boosters and the external fuel tank. Flight day 2 shows footage of mainland Asia at night, and daytime views of the eastern United States and Lake Michigan. Flight day three shows the Endeavour orbiter approaching and docking with the ISS. After the night docking, the crews exchange greetings, and a view of the Nile river and Egypt at night is shown. On flight day 4, the MPLM (Multi-Purpose Logistics Module) Leonardo was temporarily transferred from Endeavour's payload bay to the ISS.

2002-08-01

406

STS-111 Flight Day 7 Highlights  

NASA Technical Reports Server (NTRS)

On Flight Day 7 of STS-111 (Space Shuttle Endeavour crew includes: Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist; International Space Station (ISS) Expedition 5 crew includes Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer; ISS Expedition 4 crew includes: Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer), this video opens with answers to questions asked by the public via e-mail about the altitude of the space station, the length of its orbit, how astronauts differentiate between up and down in the microgravity environment, and whether they hear wind noise during the shuttle's reentry. In video footage shot from inside the Quest airlock, Perrin is shown exiting the station to perform an extravehicular activity (EVA) with Chang-Diaz. Chang-Diaz is shown, in helmet mounted camera footage, attaching cable protection booties to a fish-stringer device with multiple hooks, and Perrin is seen loosening bolts that hold the replacement unit accomodation in launch position atop the Mobile Base System (MBS). Perrin then mounts a camera atop the mast of the MBS. During this EVA, the astronauts installed the MBS on the Mobile Transporter (MT) to support the Canadarm 2 robotic arm. A camera in the Endeavour's payload bay provides footage of the Pacific Ocean, the Baja Peninsula, and Midwestern United States. Plumes from wildfires in Nevada, Idaho, Yellowstone National Park, Wyoming, and Montana are visible. The station continues over the Great Lakes and the Eastern Provinces of Canada.

2002-01-01

407

Atomically Precise Bottom-up Fabrication of Graphene Nanoribbons  

NASA Astrophysics Data System (ADS)

Graphene nanoribbons (GNRs) -- narrow stripes of graphene -- are predicted to exhibit remarkable properties making them suitable for future electronic applications. Contrary to their two-dimensional (2D) parent material graphene, which exhibits semimetallic behavior, GNRs with widths smaller than 10 nm are predicted to be semiconductors due to quantum confinement and edge effects. Despite significant advances in GNR fabrication using chemical, sonochemical and lithographic methods as well as recent reports on the successful unzipping of carbon nanotubes into GNRs, the production of sub-10 nm GNRs with chemical precision remains a major challenge. In this talk, we will present a simple GNR fabrication method that allows for the production of atomically precise GNRs of different topologies and widths [1]. Our bottom-up approach consists in the surface-assisted coupling of suitably designed molecular precursors into linear polyphenylenes and their subsequent cyclodehydrogenation, and results in GNRs whose topology, width and edge periphery are defined by the precursor monomers. By means of STM and Raman characterization, we demonstrate that this fabrication process allows for the atomically precise fabrication of complex GNR topologies. Furthermore, we have developed a reliable procedure to transfer GNRs fabricated on metal surfaces onto other substrates. It will for example be shown that millimeter sized sheets of crosslinked GNRs can be transferred onto silicon wafers, making them available for further processing, e.g. by lithography, prototype device fabrication and characterization. [4pt] Coauthors: Pascal Ruffieux, Rached Jaafar, Marco Bieri, Thomas Braun, and Stephan Blankenburg, Empa, Swiss Federal Laboratories for Materials Science and Technology, 3602 Thun and 8600 D"ubendorf, Switzerland; Matthias Muoth, ETH Zurich, Department of Mechanical and Process Engineering, 8092 Zurich, Switzerland; Ari P. Seitsonen, University of Zurich, Physical Chemistry Institute, 8057 Zurich, Switzerland; Moussa Saleh, Max Planck Institute for Polymer Research, 55124 Mainz, Germany; Ivan Shorubalko, Empa, Swiss Federal Laboratories for Materials Science and Technology, 3602 Thun and 8600 D"ubendorf, Switzerland; Shuping Pang, Xinliang Feng, and Klaus M"ullen, Max Planck Institute for Polymer Research, 55124 Mainz, Germany; and Roman Fasel, Empa, Swiss Federal Laboratories for Materials Science and Technology, 3602 Thun and 8600 D"ubendorf, Switzerland and University of Bern, Department of Chemistry and Biochemistry, 3012 Bern, Switzerland. [4pt] [1] J. Cai et.al, Nature 466, 470-473 (2010)

Cai, Jinming

2011-03-01

408

A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis.  

PubMed

Selective silencing of the cyclooxygenase-2 (COX-2) gene with the loss of the antifibrotic mediator prostaglandin E2 contributes to the fibrotic process in idiopathic pulmonary fibrosis (IPF). This study explored the role of G9a- and enhancer of zeste homolog 2 (EZH2)-mediated methylation of histone H3 lysine 9 (H3K9me3) and histone H3 lysine 27 (H3K27me3) in COX-2 silencing in IPF. Chromatin immunoprecipitation (ChIP) and re-ChIP assays demonstrated marked increases in H3K9me3, H3K27me3, and DNA methylation, together with their respective modifying enzymes G9a, EZH2, and DNA methyltransferases (Dnmts) and respective binding proteins heterochromatin protein 1 (HP1), polycomb protein complex 1 (PRC1) and methyl CpG binding protein 2 (MeCP2), at the COX-2 promoter in lung fibroblasts from patients with IPF (F-IPFs) compared with fibroblasts from nonfibrotic lungs. HP1, EZH2, and MeCP2 in turn were associated with additional repressive chromatin modifiers in F-IPFs. G9a and EZH2 inhibitors and small interfering RNAs and the Dnmt1 inhibitor markedly reduced H3K9me3 (49-79%), H3K27me3 (44-81%), and DNA methylation (61-97%) at the COX-2 promoter. These reductions were correlated with increased histone H3 and H4 acetylation, resulting in COX-2 mRNA and protein reexpression in F-IPFs. Our results support a central role for G9a- and EZH2-mediated histone hypermethylation and a model of bidirectional, mutually reinforcing, and interdependent crosstalk between histone hypermethylation and DNA methylation in COX-2 epigenetic silencing in IPF.-Coward, W. R., Feghali-Bostwick, C. A., Jenkins, G., Knox, A. J., Pang, L. A central role for G9a and EZH2 in the epigenetic silencing of cyclooxygenase-2 in idiopathic pulmonary fibrosis. PMID:24652950

Coward, William R; Feghali-Bostwick, Carol A; Jenkins, Gisli; Knox, Alan J; Pang, Linhua

2014-07-01

409

Sigma-2 receptor agonists activate a novel apoptotic pathway and potentiate antineoplastic drugs in breast tumor cell lines.  

PubMed

We have reported previously that sigma-2 receptors are expressed in high densities in a variety of tumor cell types (B. J. Vilner et al., Cancer Res., 55: 408-413, 1995) and that various sigma ligands have cytotoxic effects (B. J. Vilner et al., J. Neurosci., 15: 117-134, 1995). Other investigators have demonstrated increased expression of sigma-2 receptors in rapidly proliferating tumors (R. H. Mach et al., Cancer Res., 57: 156-161, 1997) and the ability of some sigma ligands to inhibit proliferation (P. J. Brent and G. T. Pang, Eur. J. Pharmacol., 278: 151-160, 1995). We demonstrate here the ability of sigma-2 receptor agonists to induce cell death by a mechanism consistent with apoptosis. In breast tumor cell lines that are sensitive (MCF-7) and resistant (MCF-7/Adr-, T47D, and SKBr3) to antineoplastic agents, incubation with the sigma-2 subtype-selective agonists CB-64D and CB-184 produced dose-dependent cytotoxicity (measured by lactate dehydrogenase release into medium). The EC(50) for this response was similar across cell lines, irrespective of p53 genotype and drug-resistance phenotype. CB-64D and the subtype nonselective sigma-2 agonists haloperidol and reduced haloperidol induced terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling staining in MCF-7 and T47D cells, indicating that cell death occurs via apoptosis. Apoptosis was also indicated by increases in Annexin V binding caused by CB-64D. In MCF-7 cells, cytotoxicity and Annexin V binding induced by the antineoplastics doxorubicin and actinomycin D was partially or completely abrogated by certain specific and general inhibitors of caspases. In contrast, caspase inhibitors had no effect on sigma-2 receptor-mediated (CB-64D and CB-184) cytotoxicity or Annexin V binding. Marked potentiation of cytotoxicity was observed when a subtoxic dose of CB-184 was combined with doxorubicin or actinomycin D, both in drug-sensitive (MCF-7) and drug-resistant (MCF-7/Adr-) cell lines. Haloperidol potentiated doxorubicin only in drug-resistant cells. These findings suggest the involvement of a novel p53- and caspase-independent apoptotic pathway used by sigma-2 receptors, which is distinct from mechanisms used by some DNA-damaging, antineoplastic agents and other apoptotic stimuli. These observations further suggest that sigma-2 receptors may be targets that can be therapeutically exploited in the treatment of both drug-sensitive and drug-resistant metastatic tumors. PMID:11782394

Crawford, Keith W; Bowen, Wayne D

2002-01-01

410

The Single Scattering Albedo of Martian Atmospheric Dust in the 290-500 nm Region  

NASA Astrophysics Data System (ADS)

Despite multiple previous investigations, the detailed wavelength-dependence of Martian atmospheric dust absorption at ultraviolet (UV) and near-UV wavelengths is not particularly well-known. Several efforts have made some progress (e.g., Pang and Ajello, Icarus, 30, 63, 1977; Clancy et al., JGR, 100, 5251, 1995; Wolff et al., JGR, 104, 9027, 1999), but observational or instrumental constraints have severely limited the amount of detail retrievable. Ideally, one would observe an isolated dust signature with moderate spectral resolution and adequate spectral coverage. In essence, one would like to obtain data of a large-scale, optically-thick dust storm with a well-calibrated spacecraft-based spectrometer. Such a set of data has very recently been obtained, albeit somewhat fortuitously. Using the Hubble Space Telescope and the Space Telescope Imaging Spectrograph (STIS) instrument to perform high resolution imaging spectroscopy of Mars during the 2001 opposition, the combination of an electronics failure and an unusually early onset of a global dust storm, we have observations of Martian atmospheric dust with a minimal-to-undetectable surface contribution. Our 2001 observations utilized the G430L grating to cover 289 to 590 nm at 0.27 nm/channel. The STIS 0.2 arcec slit was pushbroom-scanned across the 13-16 arcsec diameter planet in ~70 adjacent steps, yielding a 3-dimensional image cube in 1024 wavelengths and at ~20x80 km spatial resolution per spectrum. This was done during four visits on 2001 August 9, 10, 14, and September 4 (LS=211\\ to 227). We will present the derived dust absorption spectra (i.e., single scattering albedo) which has resulted from our multiple-scattering, radiative transfer analyses of the STIS data. Our results will be compared to analogous efforts of Goguen et al. (personal communication, 2002) using nearly-contemporaneous observations in the 230-300 nm range (STIS/G230L). In addition, in order to better constrain the dust properties (e.g., size, shape) and subsequently isolate the single scattering albedo, our work includes retrievals from Mars Global Surveyor Thermal Emission Spectrometer observations (both the thermal infrared and solar-band channel).

Wolff, M. J.; Bell, J. F.; Sohl-Dickstein, J.

2002-12-01

411

Spin transistor action via tunable Landau-Zener transitions in magnetic semiconductor quantum wells  

NASA Astrophysics Data System (ADS)

Spin-transistors, employing spin-orbit interaction like Datta-Das prototypes [1], principally suffer from low signal levels due to limitations in spin injection efficiency, fast spin relaxation and dephasing processes. Here we present an alternative concept to implement spin transistor action where efficiency is improved by keeping spin transport adiabatic [2]. To this end a helical stray field B, generated by ferromagnetic Dysprosium stripes, is superimposed upon a two-dimensional electron system in (Cd,Mn)Te, containing Mn ions with spin 5/2. Due to the giant spin splitting, occurring at low temperatures and small B in (Cd,Mn)Te quantum wells, the B-helix translates into a spin-helix and the electron spins follow adiabatically the imposed spin texture. Within this approach the transmission of spin-polarized electrons between two contacts is regulated by changing the degree of adiabaticity, i.e. an electron's ability to follow the spin helix. This is done by means of a small applied homogeneous magnetic field while the degree of adiabaticity is monitored by the channel resistance. Our scheme allows spin information to propagate efficiently over typical device distances and provides an alternative route to realize spintronics applications. We note that our concept is not restricted to a particular choice of materials, temperature, methods of spin injection, manipulation as well as detection. [4pt] Work done in cooperation with Christian Betthausen, Institute of Experimental and Applied Physics, University of Regensburg, D-93040 Regensburg, Germany; Tobias Dollinger, Henri Saarikosi, Institute of Theoretical Physics, University of Regensburg, D-93040 Regensburg, Germany; Valeri Kolkovsky, Grzegorz Karczewski, Tomasz Wojtowicz, Institute of Physics, Polish Academy of Sciences, PL-02668 Warsaw, Poland; and Klaus Richter, Institute of Theoretical Physics, University of Regensburg. [4pt] [1] H. C. Koo et al., Control of spin precession in a spin-injected field effect transistor. Science 325, 1515 (2009). [0pt] [2] C. Betthausen et al., Spin-Transistor Action via Tunable Landau-Zener Transitions. Science 337, 324 (2012).

Weiss, Dieter

2013-03-01

412

Potassic magma genesis and the Ailao Shan-Red River fault  

NASA Astrophysics Data System (ADS)

Two types of K-rich magma of Eocene to Early Oligocene (ca. 40-30) and Plio-Pleistocene (ca. 5-0.1 Ma) age were emplaced prior to and following left-lateral slip on the Ailao Shan-Red River (ASRR) fault, a regional shear zone extending between southwest China and the Tonkin Gulf (South China Sea) that accommodated 'escape' of the Indochina block. The first type is exposed in the Dali-Lijiang and adjacent regions of western Yunnan and Sichuan and comprises ultramafic potassic to ultrapotassic 'absarokites' and their shoshonite, banakite, and SiO2-rich derivatives which were emplaced immediately prior to activation of the ASRR fault. They are characterized by high Mg.-nos, and low contents of fusible oxides (FeO*, CaO, Al2O3), for equivalent MgO content, and pronounced primitive mantle-normalized high-field strength element (HFSE) depletions. In contrast, 'post-escape' K-rich magmas were erupted in the Puer, Maguan-Pingbian regions of south and southeast Yunnan. Apart from their relative enrichments in potassium they show typical HFSE-rich intra-plate compositional affinity. Geological and geomorphic evidence, and thermochronologic age dating of metamorphisc events, suggest that left-lateral shearing occurred between ca. 30 and 17 Ma; thereby accommodating the southeastward 'escape' of Indochina and (possibly) two episodes of spreading in the South China Sea. The southwestern part of Dali-Lijiang magmatic products was detached and offset by ca. 600 km and are now located in Phan Xi Pang in northern Viet Nam. The same is true for the Permo-Triassic Emeishan flood basalts, whose western exposures were likewise displaced by the same amount and are now represented by the Song Da complex, also in northern Viet Nam. Here, we report geochemical, isotopic, and 40Ar/39Ar age data for samples from both the 'pre-escape' Dali-Lijiang magmas and the 'post-escape' K-rich Puer, Maguan-Pingbian basalts and basanites, with a view to comparing and contrasting their interpolated source compositions, estimated conditions of upper mantle melt segregation and, by inference, their mantle dynamic and contamination histories insofar as these were conditioned by the India-Asia collision. Our interpretations yielded two complementary conclusions. The first contends that the pre-escape magmas result from adiabatic melting of crust-contaminated asthenosphere comprising a 'mlange' of continental lithospheric mantle (CLM) (hydrated by sab-derived hysdrous fluids released at 0.2-0.5 GPa) and lower crust, delaminated from the overriding plate during mantle wedge corner flow and further enriched by metasomatic melts of subducted continental crust. We postulate that incipient H2O-saturated melting of the 'mlange' occurs at depths of between ca. 100 and 200 km after being 'dragged' down by relict oceanic slab fragments, in response to the dehydration of supra-subduction amphibole- and phlogopite. The ensuing viscosity 'crisis' and buoyancy relative to ambient 'fertile' convecting mantle of such asthenospheric 'pockets', and the collision-related change from lithospheric compression to extension, almost certainly predisposes such a refractory yet crust-contaminated 'pockets' to rapid adiabatic melting. The second conclusion concerns the post-escape K-rich basalts and basanites and is based on the contention that decompression melting of thermally anomalous K-rich asthenospheric occurred in response to regional post-escape transtension, concomitant with the cessation Indochina escape and contiguous seafloor spreading. However, although these magmas share the HFSE-rich fertile source character of other, widely dispersed, post-escape Cenozoic basalts they more specifically resemble relatively rare examples of intra-plate, K-rich activity observed in northeast China, central Spain, and elsewhere in Asia and Europe, arguably (indirectly) reflecting mantle perturbations caused by major continental collisions.

Flower, Martin F. J.; Hong, Nguy?n; Lo, Chinh-hua; Ch, Cung Thu'?'ng; Cu''ng, Nguy?n Qu?c; Liu, Fu-tian; Deng, Jin-fu; Mo, Xuan-xue

2013-09-01

413

Electron Acceleration in the Earth's Magnetotail Using Multi-Scale Simulations  

NASA Astrophysics Data System (ADS)

Magnetic reconnection in magnetized plasma represents a change in the topology of magnetic fields and is associated with a concomitant energization of charged particles that results from a conversion of magnetic energy into particle energy. Using data from the THEMIS and Cluster missions together with global and test particle simulations, we demonstrate that during a substorm on February 15, 2008 electrons are energized in two distinct regions: A low-energy population (up to a few keV) appears to arise in the diffusion region where particles are demagnetized and the magnetic topology changes. In addition a high-energy component that is energized by betatron acceleration arises within dipolarization fronts as they sweep toward the inner magnetosphere far from the diffusion region. This study concluded that particle energization is not associated solely with the conversion of magnetic to kinetic energy but, at least in the magnetosphere, also arises in conjunction with macroscopic flows. In a second substorm study, on March 11, 2008 we found that the test particle results compared favorably with observations only when we added a high-energy tail to the distribution function near the reconnection site. This implies that acceleration near the X-line was substantial and needs to be included. THEMIS and Cluster observations indicate that plasma waves are associated with the dipolarization fronts [1]. The test particle calculations are not self-consistent and do not include plasma waves. Therefore, to fully understand the processes that lead to electron acceleration throughout the near-Earth tail, we need to utilize a self-consistent kinetic approach that includes waves and electron acceleration near the neutral line along with large-scale dynamics. We present results from a model which couples the large scale magnetospheric processes and kinetic processes by developing a simulation approach in which a global MHD simulation is coupled with a particle in cell simulation. In this approach we couple the UCLA global MHD code [2] with the iPIC3D implicit particle in cell code [3]. We use a two dimensional version of iPIC3D to investigate the multi-scale nature of the electron energization during the February 15, 2008 substorm. In this multi-scale simulation the electric and magnetic fields show the quadrupolar signature of Hall-MHD which is absent in the resistive MHD simulation. Moreover the electrons move much faster than the ions especially at the separatrices and the inflow boundary. We note that during this event, just like in the case of the MHD, dipolarization fronts are formed mainly earthward of the neutral line. Finally, we find that electrons are energized near both the x-line and dipolarization fronts, but the energization is greater at the latter location. [1] Zhou, M., M. Ashour-Abdalla, X. Deng, D. Schriver, M. El-Alaoui, and Y. Pang (2009), THEMIS observation of multiple dipolarization fronts and associated wave characteristics in the near-Earth magnetotail, Geophys. Res. Lett., 36(20), L20107. [2] El-Alaoui, M. (2001), Current disruption during November 24, 1996, substorm, J. Geophys. Res., 106(A4), 6229-6245. [3] Markidis, S., G. Lapenta, and Rizwan-uddin (2010), Multi-scale simulations of plasma with iPIC3D, Math. Comput. Simulation, 80(7), 1509-1519.

Ashour-Abdalla, Maha; Lapenta, Giovanni; El-Alaoui, Mostafa; Walker, Raymond

2014-05-01

414

Discovery of a Large Volcanic Eruption in 1761 From Pre-Venus-Transit and Other Proxy Data, Using Benjamin Franklin's Method of Linking the 1783-1784 Cold Weather to the Laki Eruption  

NASA Astrophysics Data System (ADS)

Observations of the 1761 and 1769 transits of Venus were crucial to the early development of American geoscience. Accurate longitude measurements were needed for that, the Mason-Dixon survey, the 1804-1806 Lewis and Clark expedition to Oregon, and the westward expansion of the new republic [Woolf, "The Transits of Venus: A Study of 18th Century Science," Princeton, 1959]. As founder of the American Philosophical Society Benjamin Franklin promoted the transit observations, and procured a large telescope for the Philadelphia group. While serving as ambassador to France he observed that a "dry fog" from the 1783 Laki eruption in Iceland had obscured the Sun, and suggested that as a cause of the unseasonably cold weather of that summer and winter. Although the longitude, solar parallax and Sun-Earth distance measurements have long since been improved on, observations of the dark lunar eclipse just before the June 6, 1761 transit are still valuable for identifying a very large volcanic eruption that spring, using Benjamin Franklin's method. Many observers worldwide, while making a final check on their clock/longitude, found the May 18, 1761 totally eclipsed Moon very dark or even invisible, e.g., Wargentin (Stockholm Observatory) could not see the Moon for 38 minutes even with a 2-ft telescope [Phil. Trans. 52, 208, 1761-1762]. Whereas the totally eclipsed Moon is illuminated only by sunlight refracted by the Earth's atmosphere, I conclude that it was severely obscured, thus meeting Benjamin Franklin's first condition. Ice cores from Greenland and Antarctica show a large sulfuric acid peak at 1762 [Crowley, Geophys. Res. Lett. 20, 209, 1993; and Karlof, J. Geophys. Res. 105, D10, 12471, 2000], also satisfying Benjamin Franklin's second condition that the obscuration be due to a "dry fog" (sulfuric acid mist). The weather of 1761-1762 was indeed very cold, as recorded in chronicles, and frost-damaged rings of North American bristlecone pines [LaMarche and Hirschboeck, Nature 307, 121, 1984]. Annual weather reviews in imperial, provincial and county histories in China have been examined. Unseasonable cold are classified by their degree of severity: (1) Late (April-June) or early (July-Sept.) killing frosts; (2) Bitter cold/heavy snowfall; and (3) Heavy sustained snowfall, bitter cold with frozen wells, lakes and rivers. The latter cases were often widespread and multi-year, with the coast icebound also. The weather of 1761-1762 was a "3." Heavy sustained snow fell over many sites from the Tropic of Cancer to the Yellow River. In the north wells and rivers froze. Taihu (Great Lake near Shanghai) and nearby rivers froze over and were not navigable. Innumerable trees, birds and livestock perished, etc. Whereas all three of Benjamin Franklin's conditions have been met I conclude that a very large volcanic eruption early in 1761 had a major impact on the Earth's climate. Its location is unknown, but was probably low- or mid-latitude, as sulfuric acid from the volcanic cloud settled onto both poles. Finally Benjamin Franklin's criteria for a climate-altering volcanic eruption are still universally used (the appearance of brilliant red twilight displays have since been added). Moreover his legacy continues to inspire climate researchers. See, for example, "Climatic Impact of the mid-15th-Century Kuwae Caldera Formation...," Pang, Eos 74, No. 43, 106, 1993; and as cited in "Earth in Balance," Al Gore, p. 379, Penguin, 1993. See also "Constantinople's Volcanic Twilight," Lynn Simarski, Aramco World 47, No. 6, 8-13, 1996.

Pang, K. D.

2006-12-01

415

Introduction and Committees  

NASA Astrophysics Data System (ADS)

This volume contains contributions to the XXVIIIth International Colloquium on Group-Theoretical Methods in Physics, the GROUP 28 conference, which took place in Newcastle upon Tyne from 26-30 July 2010. All plenary and contributed papers have undergone an independent review; as a result of this review and the decisions of the Editorial Board most but not all of the contributions were accepted. The volume is organised as follows: it starts with notes in memory of Marcos Moshinsky, followed by contributions related to the Wigner Medal and Hermann Weyl prize. Then the invited talks at the plenary sessions and the public lecture are published followed by contributions in the parallel and poster sessions in alphabetical order. The Editors:Maia Angelova, Wojciech Zakrzewski, Vronique Hussin and Bernard Piette International Advisory Committee Michael BaakeUniversity of Bielefeld, Germany Gerald DunneUniversity of Connecticut, USA J F (Frank) GomesUNESP, Sao Paolo, Brazil Peter HanggiUniversity of Augsburg, Germany Jeffrey C LagariasUniversity of Michigan, USA Michael MackeyMcGill University, Canada Nicholas MantonCambridge University, UK Alexei MorozovITEP, Moscow, Russia Valery RubakovINR, Moscow, Russia Barry SandersUniversity of Calgary, Canada Allan SolomonOpen University, Milton Keynes, UK Christoph SchweigertUniversity of Hamburg, Germany Standing Committee Twareque AliConcordia University, Canada Luis BoyaSalamanca University, Spain Enrico CeleghiniFirenze University, Italy Vladimir DobrevBulgarian Academy of Sciences, Bulgaria Heinz-Dietrich DoebnerHonorary Member, Clausthal University, Germany Jean-Pierre GazeauChairman, Paris Diderot University, France Mo-Lin GeNankai University. China Gerald GoldinRutgers University, USA Francesco IachelloYale University, USA Joris Van der JeugtGhent University, Belgium Richard KernerPierre et Marie Curie University, France Piotr KielanowskiCINVESTAV, Mexico Alan KosteleckyIndiana University, USA Mariano del OlmoValladolid University, Spain George PogosyanUNAM, Mexico, JINR, Dubna, Russia Christoph SchweigertUniversity of Hamburg, Germany Reidun TwarockYork University, UK Luc VinetMontral University, Canada Apostolos VourdasBradford University, UK Kurt WolfUNAM, Mexico Local Organising Committee Maia Angelova - ChairNorthumbria University, Newcastle Wojtek Zakrzewski - ChairDurham University, Durham Sarah Howells - SecretaryNorthumbria University, Newcastle Jeremy Ellman - WebNorthumbria University, Newcastle Vronique HussinNorthumbria, Durham and University of Montral Safwat MansiNorthumbria University, Newcastle James McLaughlinNorthumbria University, Newcastle Bernard PietteDurham University, Durham Ghanim PutrusNorthumbria University, Newcastle Sarah ReesNewcastle University, Newcastle Petia SiceNorthumbria University, Newcastle Anne TaorminaDurham University, Durham Rosemary ZakrzewskiAccompanying persons programme Lighthouse Photograph by Bernard Piette: Souter Lighthouse, Marsden, Tyne and Wear, England

Angelova, Maia; Zakrzewski, Wojciech; Hussin, Vronique; Piette, Bernard

2011-03-01

416

The Geochemistry and Hydrography of Lake Tanganyika  

NASA Astrophysics Data System (ADS)

John Edmond was a key member of the scientific group that participated in the two SIO expeditions on Lake Tanganyika, involved in both the water sampling on the lake and the operations in the potable chemical laboratory used ashore. Much of his data on the nutrient chemistry of the lake has been published in summary form (Limnol.Oceanog.1993). The present paper, which describes some of the other studies made on the lake, is dedicated to John, who was both a close personal friend and a brilliant colleague. Along the ~650 km length of the lake we occupied 18 stations and sampled the major inflowing streams. The CI concentration of the lake waters below ~150m (depth of the epilimnion) is constant (27.8ppm), so that temperature is the only hydrographic variable, and distinctive profiles occur in the two major deep basins (North & South, = NB and SB). In the NB from 100 to 1200m, T C decreases smoothly to 400m, below which are two ~ isothermal layers extending down to a sharp discontinuity at 700m, followed by a decrease to an nderline{in-situ} minimum (23.32 C at 870m, the coldest water in Lake Tanganyika). The lower-most 300m of the profile is essentially adiabatic, with a bottom T = 23.32 C. The 700m T discontinuity is associated witha sharp cusp in methane concentration, which increases smoothly with depth from zero at the base of the mixed layer to 2.5 cc/kg at 700m, and then increases rapidly to 5.0 cc/kg at 1200m. In the SB, T decreases smoothly to 600m depth, below which is an almost isothermal layer to 1100m, followed by an ~ adiabatic gradient for 300m, to 23.40 C at 1400m. In this basin the CH4 profile is a smoothly continuous curve from 100-1200m, showing that the effective sill-depth between the two basins is at ~700m. Helium isotope profiles also show distinctive profiles in the two deep basins. In the NB, the 4He profile increases downward from atmospheric saturation to a smooth maximum at 450m (2.26 x saturation) and a 3He/4He ratio anomaly ? (3He) = -40% of atmospheric value). In the SB there is a similar though less marked He maximum at 900m. These extrema show the depths of injection of He from crustal sources, which in both basins has a 3He/4He ratio of 0.28 x atmospheric, close to the ratio in radiogenic helium. The He concentration requires a saturation T of 15 C at the present level of 773m above sealevel. If the deep water has not changed and was saturated at the present 23 C, the required lake level is ~250m below the present level. Co2 and 13C data show production of light CO2 at 220m, the depth of a ? (13C) minimum, and on the lake bottom where heavy CO2 is produced by CH4 production. Other data to be discussed as time permits include stable isotopes (D and 18O, enriched in deep water), 14C, tritium, 226Ra, 210Pb, and dissolved N2, Ne, and Ar. Our logistical work was supported by UNDP-FAO. G.W. Coulter (UNDP, Burundi), Ray Weiss (SIO), and Valerie Craig (SIO) participated in the expedition work at sea and on land.

Craig, H.

2001-12-01

417

Obituary for Moshe Shapiro  

NASA Astrophysics Data System (ADS)

Moshe Shapiro, a pioneer in the area of quantum control of molecular dynamics, whose research opened new pathways for directing the course of chemical reactions and creating matter in unique, often quantum-specified states of aggregation, died on 3 December 2013 in Rehovot, Israel. He was 69 years old. Professor Shapiro is perhaps best known for his work with Paul Brumer of the University of Toronto. In 1986, the pair developed theoretical models predicting the control of unimolecular reactions following excitation by coherent fields of laser light. The reaction dynamics community immediately recognized the Brumer-Shapiro approach as distinct from ideas prevailing at the time to use sequences of short laser pulses timed to impulsively direct wavepacket motion in molecules. Many experimental groups devised strategies to apply this principle of phase control of molecular dynamics, and the results provided some of the earliest and most robust demonstrations of coherent control. The field has matured since to employ emerging electro-optic techniques to shape the phase and frequency characteristics of laser sources in time, and achieve degrees of control that rely simultaneously on interference and impulse. This is well demonstrated by the technique of step-wise adiabatic passage, introduced by Shapiro's group at the University of British Columbia, which enables the controlled transport of an ensemble of molecules to a selected level of excitation, and ultracold atoms to bound, ground-state molecules. Shapiro introduced a number of other new ideas to chemical dynamics. Working with Richard Bersohn, he performed early quantum scattering calculations that traced the multidimensional relaxation of potential energy in the photofragmentation of methyl iodide leading to vibrational excitation of the umbrella bend of the methyl radical product. He also described general conditions characterizing chaos in an isolated energy eigenstate, developed a theory for controlled photon induced symmetry breaking to form chiral products from achiral precursors, and showed how to use phase-coherent laser excitation to launch directional currents in semiconductors, in the absence of bias voltage. He has also contributed to important advances in laser catalysis, quantum computing and decoherence, transition state spectroscopy, potential inversion and wavefunction imaging, the theory of strong field phenomena in atoms and molecules, quantum theory of elementary exchange reactions and foundations of quantum mechanics. His most recent research focused on the control of molecular, atomic, and photonic processes with coherent light, quantum pattern recognition, coherent chiral separation and the coherent suppression of spontaneous emission, decoherence and other decay processes. At UBC, Moshe is remembered for his perceptiveness, broad vision and collegiality. 'One day he came to a group meeting with the idea of a solar-pumped living laser,' said physics colleague, Valery Milner. 'After thinking about this for two months, we designed an experiment using a random laser cavity that produced gain with milliwatts of pumping power applied to a fluorescent protein. We have now only to get lasing with the bacterium we engineered to express this protein.' Moshe studied for his PhD guided by Professor Raphael D Levine, in theoretical chemistry at the Hebrew University, focusing on photodissociation and molecular collisions. In 1970, he moved to Harvard University as a postdoctoral fellow, where he worked in reaction dynamics with Martin Karplus, a 2013 Nobel laureate in chemistry. In 1972, Moshe joined the faculty of the Department of Chemical Physics at the Weizmann Institute. There, he served as a department chair and was named the Jacques Mimran Professor of Chemical Physics. In 2002, he was appointed to a Canada Research Chair in Quantum Control in the Department of Chemistry at UBC. He won the Willis E Lamb Medal for achievements in the Physics of Quantum Electronics (2007), the John C Polanyi Award of The Canadian Society of Chemistry (2011), the Israel Ch

Grant, Edward R.

2014-04-01

418

News and Announcements  

NASA Astrophysics Data System (ADS)

New Source of Information from Advertisers The Journal has a new feature effective with the June 1999 issue. If you would like additional information about our advertisers or their products, the quickest and easiest way to get it is via JCE Online: go to http://jchemed.chem.wisc.edu click on Ad Index This will take you to the list of advertisers, each conveniently linked to their home page. When you do contact our advertisers, be sure to tell them that you saw their ad in the Journal of Chemical Education. This is important to them, and to us. JCE Software Receives Award The Journal recently received notice that JCE Software portion of JCE Online has been selected as a Links2Go Key Resource for the topic of chemistry software. According to Links2Go (www.links2go.com), JCE Software's home page is one of the top fifty most accessed online resources in the area of chemistry software (currently ranked 45). Thanks to all of you who have visited JCE Online and the JCE Software area to make this possible. If you haven't visited the site yet, you can go there directly (http://jchemed.chem.wisc.edu/JCESoft/index.html ) as well as via our JCE Online home page. You will be greeted with a short video of nitrogen triiodide exploding and be able to get a wealth of information about our latest releases, software, CD-ROMs/Video, student resources, materials for authors and software developers. You can see color graphics from our CD-ROMs, video, and software,... Actually, if you are familiar with our Catalog, this is much better. 1999 Welch Chemistry Prize Richard N. Zare, the Marguerite Blake Wilbur Professor of Natural Science at Stanford University, has been named the 1999 recipient of the Welch Award in Chemistry for his lifetime achievements in physical and analytical chemistry. Zare's interests focus on the development and application of lasers and other novel instruments to explore chemical frontiers, ranging from molecules to chemical processes, from the inside of cells to the inside of meteorites. Zare and colleague Andrew Alexander are contributors to the Journal's Viewpoints series, sponsored by the Camille and Henry Dreyfus Foundation: "Anatomy of Elementary Chemical Reactions", JCE, 1998, 75, 1105. The Welch Award in Chemistry has been given by the Welch Foundation since 1972 to honor lifetime achievements in the field. Zare will be honored and presented with a $300,000 prize and gold medallion during the Foundation's annual award banquet held in Houston in October. NEACT Conference: Chemistry of Materials and Material Science The 61st Summer Conference of NEACT, the New England Association of Chemistry Teachers, will be held from Monday, August 9, through Thursday, August 12, at Massachusetts Institute of Technology in Cambridge, MA. The four-day conference will feature an exploration of the chemistry of materials and material science and effective methods of presenting these in the classroom and laboratory. The keynote address is "Teaching Solid State Chemistry at MIT" by Ron Latanision of MIT's Department of Material Science. Other presentations include "Driving Force", James Livingston; "The Colorful Nanoworld", Moungi Bawendi; "Molecular Wire-Based Amplification in Chemical Sensors", Timothy Swager; "Putting Solids in the Foundation", Arthur Ellis, George Lisensky, and Karen Nordell; "Miracle Materials", Valerie Wilcox; "Teaching About Polymers to Chemistry Students", Richard Stein; and "Using Software in Teaching About Polymers to Chemistry Students", William Vining. There will be a selection of workshops on the conference theme as well. The conference is open to all. The program chairperson is Peter J. Nassiff, Science Department Chairperson at Burlington High School. For further information contact Nassiff at 80 Gregory Road, Framingham, MA 01701; email: pnassiff@massed.net. Call for Symposia, Papers, & Workshops: 16th BCCE The Web site for the 16th Biennial Conference on Chemical Education, July 30-August 3, 2000, at the Un

1999-07-01

419

PREFACE: Strongly Coupled Coulomb Systems  

NASA Astrophysics Data System (ADS)

This special issue contains papers presented at the International Conference on Strongly Coupled Coulomb Systems (SCCS) which was held during the week of 20 24 June 2005 in Moscow, Russia. The Moscow conference was the tenth in a series of conferences. The previous conferences were organized as follows. 1977: Orleans-la-Source, France, as a NATO Advanced Study Institute on Strongly Coupled Plasmas (organized by Marc Feix and Gabor J Kalman) 1982: Les Houches, France (organized by Marc Baus and Jean-Pierre Hansen) 1986: Santa Cruz, California, USA (hosted by Forrest J Rogers and Hugh E DeWitt) 1989: Tokyo, Japan (hosted by Setsuo Ichimaru) 1992: Rochester, NY, USA (hosted by Hugh M Van Horn and Setsuo Ichimaru) 1995: Binz, Germany (hosted by Wolf Dietrich Kraeft and Manfred Schlanges) 1997: Boston, Massachusetts, USA (hosted by Gabor J Kalman) 1999: St Malo, France (hosted by Claude Deutsch and Bernard Jancovici) 2002: Santa Fe, New Mexico, USA (hosted by John F Benage and Michael S Murillo) After 1995 the name of the series was changed from `Strongly Coupled Plasmas' to the present name in order to extend the topics of the conferences. The planned frequency for the future is once every three years. The purpose of these conferences is to provide an international forum for the presentation and discussion of research accomplishments and ideas relating to a variety of plasma liquid and condensed matter systems, dominated by strong Coulomb interactions between their constituents. Strongly coupled Coulomb systems encompass diverse many-body systems and physical conditions. Each meeting has seen an evolution of topics and emphasis as new discoveries and new methods appear. This year, sessions were organized for invited presentations and posters on dense plasmas and warm matter, astrophysics and dense hydrogen, non-neutral and ultracold plasmas, dusty plasmas, condensed matter 2D and layered charged-particle systems, Coulomb liquids, and statistical theory of SCCS. Within each area new results from theory, simulations and experiments were presented. In addition, a special symposium was held one evening to explore the questions on high-energy-density matter generated by intense heavy ion beams and to discuss the outlook for applications to industry. As this special issue illustrates, the field remains vibrant and challenging, being driven to a great extent by new experimental tools and access to new strongly coupled conditions. This is illustrated by the inclusion of developments in the areas of warm matter, dusty plasmas, condensed matter and ultra-cold plasmas. In total, 200 participants from 17 countries attended the conference, including 42 invited speakers. The individuals giving presentations at the conference, including invited plenary and topical talks and posters, were asked to contribute to this special issue and most have done so. We trust that this special issue will accurately record the contents of the conference, and provide a valuable resource for researchers in this rapidly evolving field. We would like to thank the members of the International Advisory Board and all members of the Programme Committee for their contributions to the conference. Of course, nothing would have been possible without the dedicated efforts of the Local Organizing Committee, in particular Igor Morozov and Valery Sultanov. We wish to thank the Russian Academy of Sciences, the Institute for High Energy Densities, the Institute of Problems of Chemical Physics, the Moscow Institute of Physics and Technology, the Ministry of Education and Science of the Russian Federation, the Russian Foundation for Basic Research, the Moscow Committee of Science and Technologies, the Russian Joint Stock Company `Unified Energy System of Russia', and The International Association for the Promotion of Co-operation with Scientists from the New Independent States (NIS) of the Former Soviet Union for sponsoring this conference.

Fortov, Vladimir E.; Golden, Kenneth I.; Norman, Genri E.

2006-04-01

420

PREFACE: Seventh International Conference on Dissociative Recombination: Theory, Experiments and Applications  

NASA Astrophysics Data System (ADS)

Dissociative Recombination is one of the outcomes of collisions between electrons and molecular ions. This reaction dominates many plasmas, dense as well as dilute. Therefore, knowledge about this reaction is highly relevant for astrophysics, atmospheric sciences, (non-)reactive plasmas, and fusion plasmas. A theoretical description of this process requires intensive ab initio quantum chemistry calculations as well as a detailed description of the electron collision process. The high density of states near the ionization energy of molecules renders calculations extremely difficult and complex. In experiments, both discharge and flowing afterglow experiments and fast beam and ion storage ring experiments, a steady development can be seen towards more detailed studies often at the quantum state resolved level including product internal state identification and very recently detailed vector properties such as fragment angular distributions. Thanks to an efficient interplay between experiment and theory dissociative recombination has progressed significantly over the last few years. The Seventh International Conference on Dissociative Recombination: Theory, Experiments, and Applications (DR2007) was organized by the Institute of Molecules and Materials at the Radboud University Nijmegen, The Netherlands and was held on the Wadden Island of Ameland. Earlier conferences in this series were held at Lake Louise, Alberta, Canada (1988), Saint Jacut, Bretagne, France (1992), Ein Gedi, Israel (1995), Nsslingen, Stockholm Archipelago, Sweden (1999), Chicago, USA, as part of the American Chemical Society meeting (2001), and in Mosbach, Germany (2004). Ameland and the Resort d'Amelander Kaap was chosen in the spirit of previous dissociative recombination conferences. It turned out to be a venue where discussions about dissociative recombination could take place around the clock both inside and outside while walking through dunes and on the beach. The conference was made possible by generous sponsors, whom we thank wholeheartedly: The Radboud University Nijmegen, The Institute for Molecules and Materials of the Radboud University Nijmegen, The Foundation for Fundamental Research on Matter (Stichting FOM), The Foundation PHYSICA (Stichting Physica), and The Netherlands Royal Academy of Sciences (KNAW). The organisational support by Erna Gouwens van Oss before and during the conference was essential for its success. The help of Thanja Lambrechts and Vitali Zhaunerchyk during the preparation of the proceedings is greatly appreciated. The delay in the publication of these proceedings is entirely caused by the editor. The authors of the contributions are thanked for the quality of their contributions, Wim J van der Zande, Editor Institute for Molecules and Materials, Radboud University Nijmegen, PO Box 9010, NL-6500 GL Nijmegen, The Netherlands Email: w.vanderzande@science.ru.nl Conference photograph Participants of the 7th International Conference on Dissociative Recombination: Theory, Experiments and Applications, taken in front of d'Amelander Kaap, the conference venue in Ameland, one of the Wadden Islands in the North of the Netherlands. 1. Dror Shafir21. Annemieke Petrignani41. Oumanou Motopan 2. Ioan Scheider22. Johanna Roos42. Max Berg 3. Nigel Adams23. Erna Gouwens van Oss43. Henrik Buhr 4. Hajime Tanuma24. Natalie de Ruette44. Ilya Fabrikant 5. Jonathan Tennyson25. Francois Wameu Tamo45. Claude Krantz 6. Vitali Zhaunerchyk26. Rainer Johnsen46. Michael Stenrup 7. Robert Continetti27. Viatcheslav Kokoouline47. Xavier Urbain 8. Stefan Rosn28. Hidekazu Takagi48. Evelyne Roueff 9. Erik Vigren29. Hans-Jakob Wrner49. Dirk Schwalm 10. Magdalena Kaminska30. Oskar Asvany50. Valery Ngassam 11. Chris Greene31. Lutz Lammich51. Julien Lecointre 12. Steffen Novotny32. Brandon Jordon-Thaden52. Ann Orel 13. Amy Schumak33. Wolf Diettrich Geppert53. Ihor Korolov 14. Gerard van Rooij34. Alexander Faure54. Romain Guerot 15. Wim van der Zande35. Mathias Hamberg55. Peet Hickman 16. Daan Schram36. Oldrich Novotny56. Christiaan Jungen 17. Dahbia Talb

van der Zande, Wim J.

2009-09-01

421

Physical Biology : challenges for our second decade.  

PubMed

It is quite an honor to be asked to become the third editor-in-chief of Physical Biology . I am following in the footsteps of Tim Newman, who served with energy and enthusiasm. Hopefully, the entire community fully appreciates his contributions to moving the field forward. Thank you, Tim! With the honor, however, goes a clear responsibility. Our journal has survived its birth pangs and emerged as a serious venue for publishing quality research papers using physical science to address the workings of living matter. With the support of scientists in this field and with the ongoing commitment of the IOP, we have successfully reached adolescence. Yet, there is clearly much room to grow and there are clear challenges in defining and maintaining our special niche in the publishing landscape. In this still-developing state, the journal very much mimics the state of the field of physical biology itself. Few scientists continue to question the relevance of physical science for the investigation of the living world. But, will our new perspective and the methods that come with it really lead to radically new principles of how life works? Or, will breakthroughs continue to come from experimental biology (perhaps aided by the traditional physicist-as-tool-builder paradigm), leaving us to put quantitative touches on established fundamentals? In thinking about these questions for the field and for the journal, I have tried to understand what is really unique about our joint endeavors. I have become convinced that living matter represents a new challenge to our physical-science based conceptual framework. Not only is it far from equilibrium, as has been generally recognized, but it violates our simple notions of the separability of constituents, their interactions and the resulting large-scale behavior. Unlike, say, atomic physicists who can do productive research while safely ignoring the latest developments in QCD (let alone particle physics at higher energies), we do not yet understand when the details of proteins and nucleic acids structure and function can be assumed constant when considering the cell. This problem is even more serious as we try to set higher sights and think of cells as constituents of tissue, organ and organism. Trying to understand higher-order biological systems is a bit like trying to play a board game where the pieces and rules are constantly changing, somehow in concert with what is happening at the scale of the game. Others will undoubtedly have their own view of what is really difficult and different about living systems. One of the roles of Physical Biology should therefore be to provide a needed forum to address some of these really difficult questions. Of course, most papers will operate with the safety-setting on, and will use established ideas in physics, either experimental or theoretical, to further our quantitative appreciation of living systems. These papers are without doubt an absolutely necessary part of the field, and we hope that our journal can serve as a home for the best of these. But, my real hope is that we can attract papers that really try to break new ground, that suggest ways in which the living world is not just an extremely messy example of the same phenomena that can be studied in non-biological contexts. Amazingly, this hope is actually shared by many leading biologists. In one of the most influential papers on cancer research in the past decades. Hanahan and Weinberg argue that 'one day, we imagine that cancer biology and treatment-at present, a patchwork quilt of cell biology, genetics, histopathology, biochemistry, immunology, and pharmacology-will become a science with a conceptual structure and logical coherence that rivals that of chemistry or physics.' We should take up the challenge, not just for cancer, and Physical Biology should help. Figuring out exactly how best to do this is now my responsibility, and I look forward to hearing from you and working with all of you, in order to make it happen. PMID:24732666

Levine, Herbert

2014-06-01

422

Obituary: Ronald N. Bracewell, 1921-2007  

NASA Astrophysics Data System (ADS)

Ronald N. Bracewell, Professor Emeritus (since 1991) of Electrical Engineering at Stanford University, and a true renaissance man of science, died of a heart attack on 12 August 2007 at his home. Ron Bracewell was born in Sydney, Australia, on 22 July 1921, one of the two sons of Cecil and Valerie Bracewell. He graduated from the University of Sydney in 1941 and received his doctorate degree in physics from Cambridge University in 1949. During World War II, Ron worked in the Australian National Radar Establishment, where he designed and developed microwave radar equipment. Like several other World War II radar scientists, after the war he used this experience to pioneer the new field of radio astronomy. With J. L. Pawsey, in 1955 he published the first comprehensive textbook in this field entitled, Radio Astronomy. Bracewell joined the Stanford Electrical Engineering faculty in 1955, and from 1974 on he held the first prestigious Lewis Terman professorship. He was awarded the Outstanding Service Award of the department in 1984. In 1988, he was named an officer of the Order of Australia--the Australian equivalent of Order of the British Empire. Soon after his arrival at Stanford, Bracewell designed and began building a solar spectroheliograph, consisting of thirty-two dish antennas in the form of a cross. This was completed in 1961 and provided daily maps of the Sun for more than a decade encompassing more than one solar activity cycle of eleven years. These maps were useful in predicting magnetic storms caused by solar activity and were used by NASA during the first landing on the Moon. In 1971 he started the building of a five-element radio interferometer, for observation of extragalactic radio sources, with the novel design of unequal spacing that gave the resolution of a ten-element array. Both telescopes are now dismantled. The common characteristics of these and other projects were that they were all built in-house with a limited budget, often a small fraction of what a national laboratory would spend on a comparable project. As a result they provided an excellent arena for training future radio astronomers. Many prominent radio astronomers were indeed trained by Bracewell as graduate students or postdoctoral researchers. An excellent example is the often-forgotten, simple-but-elegant experiment of the first detection of the dipole (or the so-called 24-hour) anisotropy of the then-recently discovered cosmic microwave background radiation. This was done by installing a small horn microwave antenna on top of the Durand building at Stanford, which scanned the sky once every 24 hours as the Earth rotated around its axis. The result of this experiment, incorporated in Dave Conklin's Ph.D. thesis, was instrumental in establishing the Big Bang origin of this radiation and provided the first measurement of the velocity of the Earth (and our Solar System and Galaxy) with respect to the fundamental rest frame of the universe defined by this radiation. The techniques and mathematical algorithms that Ron developed for radio interferometry have been applied to medical imaging such as X-ray tomography for detecting tumors. Bracewell, not directly involved with such experiments, often acted as a consultant to medical practitioners. Another outcome of Bracewell's research was a book published first in 1965 titled, The Fourier Transform and its Applications, which has become the gold standard of this subject and can be found in the personal libraries of many astronomers, engineers, physicists, and medical researchers. Many years ago, before an observing run at Kitt Peak, I needed to refer to this book. I looked for it in the shelves of the library at the National Optical Astronomical Observatory in Tucson, Arizona, but could not find it. The librarian informed me that the book had been signed out. I told her that this is a very useful book, and they should have more than one copy. She agreed and said that there were indeed eleven copies; all were in use by the resident astronomers. A further interest of Ron was the discovery of and

Petrosian, Vah

2009-01-01

423

EDITORIAL: Colloidal suspensions Colloidal suspensions  

NASA Astrophysics Data System (ADS)

Special issue in honour of Henk Lekkerkerker's 65th birthday Professor Henk N W Lekkerkerker is a world-leading authority in the field of experimental and theoretical soft condensed matter. On the occasion of his 65th birthday in the summer of 2011, this special issue celebrates his many contributions to science. Henk Lekkerkerker obtained his undergraduate degree in chemistry at the University of Utrecht (1968) and moved to Calgary where he received his PhD in 1971. He moved to Brussels as a NATO fellow at the Universit Libre de Bruxelles and was appointed to an assistant professorship (1974), an associate professorship (1977) and a full professorship (1980) in physical chemistry at the Vrije Universiteit Brussel. In 1985 he returned to The Netherlands to take up a professorship at the Van 't Hoff Laboratory, where he has been ever since. He has received a series of awards during his career, including the Onsager Medal (1999) of the University of Trondheim, the Bakhuys Roozeboom Gold Medal (2003) of the Royal Dutch Academy of Arts and Sciences (KNAW), the ECIS-Rhodia European Colloid and Interface Prize (2003), and the Liquid Matter Prize of the European Physical Society (2008). He was elected a member of KNAW in 1996, was awarded an Academy Chair position in 2005, and has held several visiting lectureships. Henk's work focuses on phase transitions in soft condensed matter, and he has made seminal contributions to both the theoretical and experimental aspects of this field. Here we highlight three major themes running through his work, and a few selected publications. So-called depletion interactions may lead to phase separation in colloid-polymer mixtures, and Henk realised that the partitioning of polymer needs to be taken into account to describe the phase behaviour correctly [1]. Colloidal suspensions can be used as model fluids, with the time- and length-scales involved leading to novel opportunities, notably the direct observation of capillary waves at a fluid-fluid interface [2]. Together with Remco Tuinier, Henk has recently completed a book in this area which is to appear later this year. A major theme in Henk's research is that of phase transitions in lyotropic liquid crystals. Henk, together with Daan Frenkel and Alain Stroobants, realized in the 1980s that a smectic phase in dispersions of rod-like particles can be stable without the presence of attractive interactions, similar to nematic ordering as predicted earlier by Onsager [3]. Together with Gert-Jan Vroege he wrote a seminal review in this area [4]. Henk once said that 'one can only truly develop one colloidal model system in one's career' and in his case this must be that of gibbsite platelets. Initially Henk's group pursued another polymorph of aluminium hydroxide, boehmite, which forms rod-like particles [5], which already displayed nematic liquid crystal phases. The real breakthrough came when the same precursors treated the produced gibbsite platelets slightly differently. These reliably form a discotic nematic phase [6] and, despite the polydispersity in their diameter, a columnar phase [7]. A theme encompassing a wide range of soft matter systems is that of colloidal dynamics and phase transition kinetics. Many colloidal systems have a tendency to get stuck in metastable states, such as gels or glasses. This is a nuisance if one wishes to study phase transitions, but it is of great practical significance. Such issues feature in many of Henk's publications, and with Valerie Anderson he wrote a highly cited review in this area [8]. Henk Lekkerkerker has also invested significant effort into the promotion of synchrotron radiation studies of colloidal suspensions. He was one of the great supporters of the Dutch-Belgian beamline 'DUBBLE' project at the ESRF [9]. He attended one of the very first experiments in Grenoble in 1999, which led to a Nature publication [7]. He was strongly involved in many other experiments which followed and also has been a member of the beam line board. The most recent synchotron data are reported in this issue and Henk

Petukhov, Andrei; Kegel, Willem; van Duijneveldt, Jeroen

2011-05-01

424

EDITORIAL: Focus on Plasma Medicine  

NASA Astrophysics Data System (ADS)

'Plasma Healthcare' is an emerging interdisciplinary research topic of rapidly growing importance, exploring considerable opportunities at the interface of plasma physics, chemistry and engineering with life sciences. Some of the scientific discoveries reported so far have already demonstrated clear benefits for healthcare in areas of medicine, food safety, environmental hygiene, and cosmetics. Examples include ongoing studies of prion inactivation, chronic wound treatment and plasma-mediated cancer therapy. Current research ranges from basic physical processes, plasma chemical design, to the interaction of plasmas with (i) eukaryotic (mammalian) cells; (ii) prokaryotic (bacteria) cells, viruses, spores and fungi; (iii) DNA, lipids, proteins and cell membranes; and (iv) living human, animal and plant tissues in the presence of biofluids. Of diverse interests in this new field is the need for hospital disinfection, in particular with respect to the alarming increase in bacterial resistance to antibiotics, the concomitant needs in private practices, nursing homes etc, the applications in personal hygieneand the enticing possibility to 'design' plasmas as possible pharmaceutical products, employing ionic as well as molecular agents for medical treatment. The 'delivery' of the reactive plasma agents occurs at the gaseous level, which means that there is no need for a carrier medium and access to the treatment surface is optimal. This focus issue provides a close look at the current state of the art in Plasma Medicine with a number of forefront research articles as well as an introductory review. Focus on Plasma Medicine Contents Application of epifluorescence scanning for monitoring the efficacy of protein removal by RF gas-plasma decontamination Helen C Baxter, Patricia R Richardson, Gaynor A Campbell, Valeri I Kovalev, Robert Maier, James S Barton, Anita C Jones, Greg DeLarge, Mark Casey and Robert L Baxter Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N2 and O2 gas mixture M K Singh, A Ogino and M Nagatsu Degradation of adhesion molecules of G361 melanoma cells by a non-thermal atmospheric pressure microplasma H J Lee, C H Shon, Y S Kim, S Kim, G C Kim and M G Kong The acidification of lipid film surfaces by non-thermal DBD at atmospheric pressure in air A Helmke, D Hoffmeister, N Mertens, S Emmert, J Schuette and W Vioel Reduction and degradation of amyloid aggregates by a pulsed radio-frequency cold atmospheric plasma jet D L Bayliss, J L Walsh, G Shama, F Iza and M G Kong The effect of low-temperature plasma on bacteria as observed by repeated AFM imaging Ren Pompl, Ferdinand Jamitzky, Tetsuji Shimizu, Bernd Steffes, Wolfram Bunk, Hans-Ulrich Schmidt, Matthias Georgi, Katrin Ramrath, Wilhelm Stolz, Robert W Stark, Takuya Urayama, Shuitsu Fujii and Gregor Eugen Morfill Removal and sterilization of biofilms and planktonic bacteria by microwave-induced argon plasma at atmospheric pressure Mi Hee Lee, Bong Joo Park, Soo Chang Jin, Dohyun Kim, Inho Han, Jungsung Kim, Soon O Hyun, Kie-Hyung Chung and Jong-Chul Park Cell permeabilization using a non-thermal plasma M Leduc, D Guay, R L Leask and S Coulombe Physical and biological mechanisms of direct plasma interaction with living tissue Danil Dobrynin, Gregory Fridman, Gary Friedman and Alexander Fridman Nosocomial infections-a new approach towards preventive medicine using plasmas G E Morfill, T Shimizu, B Steffes and H-U Schmidt Generation and transport mechanisms of chemical species by a post-discharge flow for inactivation of bacteria Takehiko Sato, Shiroh Ochiai and Takuya Urayama Low pressure plasma discharges for the sterilization and decontamination of surfaces F Rossi, O Kylin, H Rauscher, M Hasiwa and D Gilliland Contribution of a portable air plasma torch to rapid blood coagulation as a method of preventing bleeding S P Kuo, O Tarasenko, J Chang, S Popovic, C Y Chen, H W Fan, A Scott, M Lahiani, P Alusta, J D Drake and M Nikolic A two-dimensional cold atmospheric plasma jet array for uniform treatment of large-area

Morfill, G. E.; Kong, M. G.; Zimmermann, J. L.

2009-11-01

425

Verochka Zingan or recollections from the Physics Department of the Moscow University  

NASA Astrophysics Data System (ADS)

The author recollects his studentship during 70-th years at the Physics Department of the Moscow University. He was graduated from the theoretical Physics Department in 1977. The Rectors of the University that times were I.G. Petrovskii, R.V. Khokhlov and A.A. Logunov. The dean of the Physics Department was V.S. Fursov. As a particular event a meet with the former prime-minister of the USSR A.N. Kosygin is reported. Between professors mentioned throughout the recollections are A.I.Kitaigorodskii, Ya. B. Zel'dovich, D.D. Ivanenko, A.A. Sokolov, A.A. Vlasov, V.B. Braginsky, I.M. Ternov, L.A. Artsimovich, E.P. Velikhov and other, including that which became University professors later. A great number of colleagues from the Physics, Chemistry, Phylological and Historical Departments of the Moscow University are mentioned. Particularly, the students which entered the group 113 in 1971 and finished the group 601 in 1977 are listed. The recollections include 5 parts. Persons cited throughout the paper: A.N. Kosygin, A.S. Golovin, V. Kostyukevich, I.M. Ternov, E.G. Pozdnyak, A. N. Matveev, V.P. Elyutin, V.V. Kerzhentsev, 113 academic group (1971), V. Topala, E.A. Marinchuk, P.Paduraru, A.I. Kitaygorodski, A. Leahu, S. Berzan, B. Ursu, I. Coanda (Koade), M. Stefanovici, O. Bulgaru, A. Iurie-Apostol, A.S. Davydov, M.I. Kaganov, I.M. Lifshitz, Ya. B. Zel'dovich, A.Zhukov, A.I. Buzdin, N.S. Perov, V. Dolgov, P. Vabishchevich, A.A. Samarskii, V. Makarov, Irina Kamenskih, A.A. Arsen'ev, L.A. Artsimovich, A.A. Tyapkin, B.M. Pontecorvo, D.I. Blokhintsev, I.G. Petrovskii, R.V. Khokhlov, V.N. Rudenko, A.A. Sokolov, D.D. Ivanenko (Iwanenko), A.A. Vlasov, V.N. Ponomarev, N.N. Bogolyubov, N.N. Bogolyubov (Jr), V.Ch. Zhukovskii, Tamara Tarasova, Zarina Radzhabova (Malovekova), V.Malovekov, Tatiana Shmeleva, Alexandra C.Nicolescu, Tatiana Nicolescu, Rano Mahkamova, Miriam Yandieva, Natalia Germaniuk (Grigor'eva), E. Grigor'ev, A. Putro, Elena Nikiforova, B. Kostrykin, Galia Laufer, K. Laufer, Yu. El'nitskii, Gh. Nemtoi, Yu. Oprunenko, N.N. Semenov, Varun Sahni, A.A. Starobinskii, Liusea Burca, Serge Rollet, Tatyana Davydova, Zinaida Uglichina (Khafizova), T.Filippova, V.S. Filippov, Vera Zingan (Stefanovici), B.A. Gaina, E.F. Gaina, Valeri Gaina, A. Kirnitskii, M. Kavalerchik, Margarita Kavalerchik, Mark Rainis, L.I. Sedov, D. Mangeron, S. Taltu (Coanda), Z. Sali(Chitoroaga, Kitoroage), Raisa M. Gorbachova, Maria Bulgaru, S. Pavlichenko, Nadezhda Shishkan, A.N. Matveev, N.Ya. Tyapunina, D.F. Kiselev, V.A. Petukhov, N.Ch. Krutitskaya, G.N. Medvedev, A.A. Shishkin,I.A. Shishmarev,A.G. Sveshnikov, A.B. Vasil'eva, A.G. Yagola, I.I. Ol'hovskii, V.V. Kravtsov, V.V.Petkevich, V.I. Grigor'ev, V.S. Rostovskii, V.V. Balashov, B.I. Spasskii, V.D. Krivchenkov, M.B. Menskii, V.Ya. Fainberg, V.G. Kadyshevskii, B.K. Kerimov, V.A. Matveev, I.A. Kvasnikov, D.V. Gal'tsov, V.R. Khalilov, G.A. Chizhov,I.A. Obukhov, V.N. Melnikov, A.A. Logunov, A.N. Tavkhelidze,Yu.S. Vladimirov, N.F. Florea (Floria), B.A. Lysov, V.D. Kukin, 601-academic group (1977), A.R. Khokhlov, P.L. Kapitza, S.P. Kapitza, Ion C. Inculet, Ion I. Inculet,W. Bittner, Nikolay Florea (Floria), M.M. Heraskov, N.V. Sklifosovskii, N.N. Bantysh-Kamenskii, N.D. Zelinskii, Olga Crusevan (Krushevan), Eugenia Crusevan (Krushevan),L.S. Berg, I. Buzdugan (Buzdyga),S.G. Lazo, M.K. Grebenchya (Grebencea), V.T. Kondurar (Conduraru), E.A. Grebenikov, K.F. Teodorchik, V.A. Albitzky, M.V. Nazarov, Tatiana Nazarova, V. P. Oleinikov, O.V. Bolshakov, D.M. Nikolaev, V. Afanas'ev, Olga Tatarinskaya, Yu.V. Karaganchou, B.A. Volkov, V.K. Turta, S. Varzar, C. Sochichiu, V.B. Braginsky, V.S. Fursov, L.I. Brezhnev, V.I. Sobolev (INP MSU), V.A. Smirnov (INP MSU), L.D. Landau, M.A. Leontovich, A.G. Loskutova, Yu.M. Loskutov, N.S. Akulov, V.B. Gostev, A.R. Frenkin, N.N. Kolesnikov, A. Vasil'ev, V.N. Tsytovich, Ya.A. Frenkel, N.V. Mitskievich, E.A. Grebenikov, A.N. Prokopenya, A. Einstein, L.I. Sedov, A.N. Kolmogorov, V.I. Arnold, G.I.Popov, R.Z. Sagdeev, A.A. Kokoshin, A.E. Marinchuk, D.V. Gal'tsov, V.I. Petukhov, S.I. Vacaru,

Gaina, Alex

426

Obituary: John Beverley Oke, 1928-2004  

NASA Astrophysics Data System (ADS)

John Beverley (Bev) Oke passed away of heart failure early on 2 March 2004 at his Victoria, B.C. home. Bev's insatiable scientific curiosity led to fundamental contributions in many areas of stellar and extragalactic astronomy, including the development of advanced instrumentation for the largest optical telescopes and the mentoring of scores of grateful students and colleagues. Bev Oke was born in Sault Ste. Marie, ON, Canada on 23 March 1928, the son of Lyla Parteshuk and the Rev. C. Clare Oke. He entered the University of Toronto in 1945 to study physics with a steadily increasing fraction of astronomy, receiving his BA in 1949. Summer employment at the David Dunlap Observatory (DDO, 1948) and at the Dominion Observatory (Ottawa, 1949, 1950) sealed his interest in astronomy as a career. For his MA thesis (1950, Toronto), performed under theoretician Ralph Williamson, he made interior models of the Sun, and was proud to have proved that the proton-proton cycle was indeed the source of solar energy. Upon entering Princeton University he worked with Martin Schwarzschild on stellar interiors models and Lyman Spitzer on interstellar lines. A lifelong friendship with Alan Sandage began during Bev's second year while Alan was a post-doc at Princeton. During Bev's third year he spent three months in Pasadena with Lyman obtaining data for his thesis on Of stars. While in Pasadena he began a second life-long collaboration with Jesse Greenstein, an astronomer whose approach to science Bev deeply respected. In the small field of astronomy in that era, Bev wrote to DDO Director Jack Heard indicating the nearing completion of his PhD studies and his interest in a position. This led to a lectureship at the University of Toronto (1953-1956), followed by an Assistant Professorship (1956-1958). Bev's interest in instruments began at this time, when he built a device to convert photographic density to intensity, and worked with DDO engineer-machinist Jerry Longworth to implement one of the first two photoelectric scanners ever built. His main interests at the time were the classification of the thousands of stellar spectra in the DDO archives, and studies of Cepheids using his new spectrum scanner. At a Halloween party in 1954 he met Nancy Sparling. Together they initiated a life partnership factually punctuated by their August, 1955 marriage and the arrival of their children, Christopher (1957), Kevin (1958), Jennifer (1961) and Valerie (1966). Their home was notable to all for the deep aura of familial love and joy in the pursuit of knowledge and accomplishments. In winter 1957-58 Jesse Greenstein invited Bev to join Cal Tech, where he became an Associate Professor (1958) and then Professor (1964); during the period 1970-1978 he was Hale Observatories Director. With the large telescopes at Mount Wilson and Mount Palomar, astronomy there could aspire to be the best in the world, but this required instrumentation of the highest capabilities. Bev soon began to contribute in a major way to their instrumentation excellence following examples established, among others, by Ira Bowen and Horace Babcock. His began by improving the DC amplifiers then in use; constructing a high-spectral-resolution, scanning spectrophotometer; designing vacuum Dewars for astronomical applications; creating pulse counting systems for photoelectric devices; and building the innovative 32-channel spectrum scanner for the Palomar 5-m telescope that was completed in 1968. Bev built instruments to advance astronomy and to satisfy his wide-ranging curiosity about nature. With the first single-channel spectrum scanner he built at Cal Tech he played a key role in the discovery of the redshift of 3C273. Using his multi-channel spectrometer with students and colleagues, he pursued a highly successful quest to establish accurate spectral-energy distributions for diverse classes of stars and galaxies, based upon rigorous calibration against physical standards. Through this painstaking work he enabled the advances of astronomers worldwide for subsequent generations and extend

Hesser, James Edward

2004-12-01