Sample records for valerie ooka pang

  1. Mapping Regulations to Industry-Specific Taxonomies Chin Pang Cheng

    E-print Network

    Stanford University

    Mapping Regulations to Industry-Specific Taxonomies Chin Pang Cheng Stanford University Dept multiple sources of regulations from different government agencies. Industry practitioners, unlike legal organization systems. To help browsing of regulations by industry practitioners, we propose to map regulations

  2. Modeling of Web Robot Navigational Patterns PangNing Tan

    E-print Network

    Kumar, Vipin

    languages, such as Perl 1 also known as Web crawler, spider or worm. and Python, have built-in libraryModeling of Web Robot Navigational Patterns Pang­Ning Tan Department of Computer Science UniversityÆcult to ignore the impact of Web robots on both commercial and institu- tional Web sites. Not only do Web robots

  3. The Devil and Packet Trace Anonymization Ruoming Pang

    E-print Network

    Paxson, Vern

    The Devil and Packet Trace Anonymization Ruoming Pang , Mark Allman , Vern Paxson,¶ , Jason Lee involved in preparing traces for release. Indeed, "the devil Computer Communication Review, January 2006 in § 3.4.) While such devil-ish considerations can be readily dealt with by brusquely scrubbing detail

  4. Relating Taxonomies with Regulations Chin Pang Cheng, Jiayi Pan

    E-print Network

    Stanford University

    Relating Taxonomies with Regulations Chin Pang Cheng, Jiayi Pan Stanford University Dept. of Civil government regulations and codes of practices, which are not always known to the industry practitioners. Although regulations and codes are now in digital forms and are often available online, it remains

  5. JOHN VALERY WHITE EXECUTIVE VICE PRESIDENT AND PROVOST

    E-print Network

    Hemmers, Oliver

    JOHN VALERY WHITE EXECUTIVE VICE PRESIDENT AND PROVOST UNIVERSITY OF NEVADA, LAS VEGAS (UNLV) John), effective July 1, 2012. Prior to being appointed to this position, John was the second dean of UNLV's William S. Boyd School of Law. John Valery White joined the Boyd School of Law from Louisiana State

  6. Plasmacytoma-associated neuronal glycoprotein, Pang, maps to mouse chromosome 6 and human chromosome 3

    SciTech Connect

    Mock, B.A.; McBride, O.W.; Kozak, C.A. [NIH, Bethesda, MD (United States)] [and others] [NIH, Bethesda, MD (United States); and others

    1996-06-01

    A new member of the immunoglobulin/fibronectin superfamily of adhesion molecules, Pang (plasmacytoma-associated neuronal glycoprotein), was recently isolated from a plasmacytoma. In previous studies, Pang was found to be normally expressed in the brain and ectopically activated by intracisternal A-type particle long terminal repeats in plasmacytomas. In this study, Pang was initially mapped to mouse Chr 6 by somatic cell hybrid analysis and further positioned on the chromosome between Wnt7a and Pcp1. Southern blot analysis of human-rodent somatic cell hybrids together with predictions from the mouse map location indicate that human PANG is located at 3p26. 13 refs., 1 fig., 1 tab.

  7. 78 FR 36642 - Proposed Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-18

    ...Proposed Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity: Comment Request AGENCY: Veterans...information technology. Title: VA Loan Electronic Reporting Interface (VALERI) System. OMB Control Number: 2900-0021....

  8. 75 FR 33898 - Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-15

    ...Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity Under OMB Review AGENCY: Veterans...SUPPLEMENTARY INFORMATION: Title: VA Loan Electronic Reporting Interface (VALERI) System. OMB Control Number: 2900-0021....

  9. 75 FR 17832 - Proposed Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-07

    ...Proposed Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity: Comment Request AGENCY: Veterans...information technology. Title: VA Loan Electronic Reporting Interface (VALERI) System. OMB Control Number: 2900-0021....

  10. 78 FR 59099 - Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-25

    ...Agency Information Collection (VA Loan Electronic Reporting Interface (VALERI) System) Activity Under OMB Review AGENCY: Veterans...SUPPLEMENTARY INFORMATION: Title: VA Loan Electronic Reporting Interface (VALERI) System. OMB Control Number: 2900-0021....

  11. Establishing fine-grained sediment budgets for the Pang and Lambourn LOCAR catchments, UK

    NASA Astrophysics Data System (ADS)

    Walling, D. E.; Collins, A. L.; Jones, P. A.; Leeks, G. J. L.; Old, G.

    2006-10-01

    SummaryAn integrated approach to data collection, combining the use of 137Cs measurements, sediment source fingerprinting, bed sediment surveys and conventional river monitoring, has been successfully employed to establish the fine-grained sediment budgets of two lowland groundwater-fed catchments in the UK. Gross surface erosion is higher on cultivated land (Pang: 55 263 t yr -1 or 507 t km -2 yr -1; Lambourn: 79 997 t yr -1 or 437 t km -2 yr -1) than on pasture (Pang: 1960 t yr -1 or 140 t km -2 yr -1; Lambourn: 1425 t yr -1 or 95 t km -2 yr -1) in both study areas and a substantial proportion of the mobilized sediment is sequestered within the fields (Pang: 28 058 t yr -1 or 228 t km -2 yr -1; Lambourn: 55 575 t yr -1 or 281 t km -2 yr -1) and between the individual fields and the river channel network (Pang: 28 672 t yr -1 or 233 t km -2 yr -1; Lambourn: 24 782 t yr -1 or 125 t km -2 yr -1). The sediment contribution from banks and subsurface sources is relatively low and typically ca. 5 t yr -1 in the Pang and ca. 11 t yr -1 in the Lambourn, representing only about 1% of the suspended sediment output from each study catchment. The mean level of fine-grained sediment storage in the main channel system is equivalent to 38% (Pang) and 21% (Lambourn) of the respective mean annual suspended sediment yields of the two catchments. The estimated sediment delivery ratio for both study catchments is ca. 1%.

  12. AppScale Design and Implementation Navraj Chohan Chris Bunch Sydney Pang

    E-print Network

    Krintz, Chandra

    AppScale Design and Implementation Navraj Chohan Chris Bunch Sydney Pang Chandra Krintz Nagy Technical Report Number 2009-02 January 27th, 2009 Abstract We present the design and implementation of App. In the spirit of Eucalyptus, we have designed and implemented an open source research framework, called App

  13. Dominating Sets in Directed Graphs Chaoyi Pang a, Rui Zhang b

    E-print Network

    Zhang, Rui

    Dominating Sets in Directed Graphs Chaoyi Pang a, Rui Zhang b Qing Zhang a Junhu Wang c a a minimal dominating set of a directed graph after the insertion or deletion of a set of arcs. Earlier results have either focused on the study of the properties that minimum (not minimal) dominating sets

  14. Impact of Layout on 90nm CMOS Process Parameter Fluctuations Liang-Teck Pang, Borivoje Nikolic

    E-print Network

    Nikolic, Borivoje

    Impact of Layout on 90nm CMOS Process Parameter Fluctuations Liang-Teck Pang, Borivoje Nikolic University of California, Berkeley, USA Abstract A test chip has been built to study the effects of layout magnitude of WID and D2D variations, its spatial correlation, and the impact of layout styles. The chip

  15. Measuring Anonymity with Relative Entropy Yuxin Deng 1 , Jun Pang 2 , Peng Wu 3

    E-print Network

    Deng, Yuxin

    Measuring Anonymity with Relative Entropy Yuxin Deng 1 , Jun Pang 2 , Peng Wu 3 1 The University@lix.polytechnique.fr Abstract. Anonymity is the property of maintaining secret the iden­ tity of users performing a certain action. Anonymity protocols often use random mechanisms which can be described probabilistically

  16. Xilin Yang, Hemanshu Pota, Matt Garratt, Valery Ugrinovskii Heave Motion Prediction for Maritime Operations of UAVs

    E-print Network

    Pota, Himanshu Roy

    Xilin Yang, Hemanshu Pota, Matt Garratt, Valery Ugrinovskii Heave Motion Prediction for Maritime-helicopter approaches and landing guidance systems. INTRODUCTION The increasing demand for maritime flight operations

  17. Oxidation of Carbon Nanotubes by Singlet O2 Siu-Pang Chan,1

    E-print Network

    Gong, Xingao

    recent theoretical studies on the chemisorption of singlet O2 on the walls of carbon nano- tubes, with an activation barrier as low as 0.61 eV for the (8, 0) tube. Our results raise the possibility that carbonOxidation of Carbon Nanotubes by Singlet O2 Siu-Pang Chan,1 Gang Chen,1,2 X. G. Gong,3,1,2 and Zhi

  18. Software Agents for Dynamic Supply Chain Management Tom Wagner and Valerie Guralnik Honeywell Laboratories

    E-print Network

    Wagner, Thomas

    Software Agents for Dynamic Supply Chain Management Tom Wagner and Valerie Guralnik Honeywell Laboratories 3660 Technology Drive, MN65-2600 Minneapolis, MN 55418¡ wagner tom, guralnik valerie, phelps john on coordinating the activities of loosely coupled distributed entities, e.g., raw material suppliers, shippers

  19. STS-84 Post Landing - Valery Ryumin greets wife Elena Kondakova

    NASA Technical Reports Server (NTRS)

    1997-01-01

    KENNEDY SPACE CENTER, FL - Veteran cosmonaut Valery Ryumin greets his wife, STS-84 Mission Specialist Elena V. Kondakova, with some flowers after the Space Shuttle orbiter Atlantis lands on KSC's Runway 33. STS-84 was the sixth docking of the Space Shuttle with the Russian Space Station Mir. The nine-day STS-84 mission was Kondakova's second space flight, but her first on the Space Shuttle. She spent 169 days in space as flight engineer of the 17th main mission on Mir from October 1994 to March 1995. Her husband is now director of the Mir-Shuttle program for Russia.

  20. Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132

    E-print Network

    Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132 adjustments. The amount of computation involved is usually considerable, and recycling provides a less computer intensive alternative. Recycling consists of using repeatedly the same samples drawn from

  1. Rethinking the conceptual foundations of habitat fragmentation Raphael K. Didham, Valerie Kapos and Robert M. Ewers

    E-print Network

    Hansen, Andrew J.

    , Valerie Kapos and Robert M. Ewers R. K. Didham, (raphael.didham@uwa.edu.au), School of Animal Biology, The Univ. of Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia, and CSIRO Ecosystem

  2. `Feature' Interactions Outside a Telecom Domain Lynne Blair 1 , Gordon Blair 1 , Jianxiong Pang 2 , Christos Efstratiou 2

    E-print Network

    Blair, Lynne

    `Feature' Interactions Outside a Telecom Domain Lynne Blair 1 , Gordon Blair 1 , Jianxiong Pang 2 the reader to the series of workshops in Feature Interactions in Telecommunications (and Software) Systems, e]. In an earlier position paper [Blair00], we describe some interaction problems arising from Internet

  3. A Robust Panel Extraction Method for Manga Xufang Pang, Ying Cao, Rynson W.H. Lau, and Antoni B. Chan

    E-print Network

    Lau, W. H. Nynson

    A Robust Panel Extraction Method for Manga Xufang Pang, Ying Cao, Rynson W.H. Lau, and Antoni B, au- tomatic panel extraction for manga, i.e., Japanese comics, can be especially challenging, largely. In this paper, we propose a ro- bust method for automatically extracting panels from digi- tal manga pages. Our

  4. Within-river nutrient processing in Chalk streams: The Pang and Lambourn, UK

    NASA Astrophysics Data System (ADS)

    Jarvie, Helen P.; Neal, Colin; Jürgens, Monika D.; Sutton, Elizabeth J.; Neal, Margaret; Wickham, Heather D.; Hill, Linda K.; Harman, Sarah A.; Davies, Jennifer J. L.; Warwick, Alan; Barrett, Cyril; Griffiths, Jim; Binley, Andrew; Swannack, Natalie; McIntyre, Neil

    2006-10-01

    SummaryThis work examines baseflow nutrient concentrations and loads along two rural Chalk streams, the Pang and Lambourn. Soluble reactive phosphorus (SRP) and boron (B) concentrations in these streams were heavily influenced by point-source inputs and the effects of downstream flow accretion and dilution. Unlike B (which is chemically conservative), SRP loads were also strongly influenced by in-stream processing resulting in uptake of SRP, particularly immediately downstream of sewage effluent discharges, where rates of SRP uptake were highest. For the upper River Pang, up to 80% of SRP loads were lost within 4 km downstream of Compton sewage treatment works (STW) and on the River Lambourn up to 55% of SRP loads were lost within 1.6 km downstream of East Shefford STW. In contrast, nitrate (NO 3) concentrations at sites along the Pang and Lambourn were largely controlled by groundwater inputs and plant uptake during periods of high photosynthetic activity in spring and summer and silicon (Si) by diatom uptake in April/May. There were net gains in NO 3 loads along the river reaches, as a result of volumetric increases in groundwater discharge, and, compared with SRP, the role of in-stream processing of NO 3 appeared low. Examination of SRP exchange by bed sediment and uptake of SRP into algal biofilms indicated that biofilms accounted for only a very small percentage of in-stream P-uptake, but that bed sediment SRP-exchanges had a more important control on baseflow SRP concentrations and loads. Point source P remediation at East Shefford STW, by removal of P from final effluent (P-stripping), resulted in 70-90% reductions in river-water SRP loads. After introduction of P-stripping at East Shefford STW, bed sediments immediately downstream of the STW switched from being net sinks to net sources of SRP. Our results show that, in the immediate aftermath of P-stripping, bed sediment SRP-release was responsible for a 30 ?g-P l -1 rise in river-water SRP along this reach. While this increase in SRP concentration, as a result of bed sediment SRP release, is potentially ecologically significant, it is small in relation to the increase in SRP concentrations from effluent prior to P-stripping, which resulted in increases in SRP concentration of up to 500 ?g-P l -1. There was a six-month lag between the introduction of P-stripping at East Shefford STW and bed sediment EPC 0 recovering to equilibrium levels with the overlying river water (and thus negligible SRP release). Recovery of bed sediments to equilibrium levels is likely to have occurred as a result of winnowing and removal of high-EPC 0 sediment and delivery of lower EPC 0 sediment from upstream. Under higher/more variable flow conditions and greater rates of in-channel sediment erosion/delivery, more rapid recovery of bed sediment EPC 0 levels following P-stripping might be expected.

  5. Image denoising using regularized Butterworth wavelet frames Amir Z. Averbuch Valery A. Zheludev

    E-print Network

    Averbuch, Amir

    Image denoising using regularized Butterworth wavelet frames Amir Z. Averbuch Valery A. Zheludev]). Denoising performance is improved when overcomplete expansions of images such as non-decimated wavelet is based on diverse library of tight and semi-tight wavelet frames. Unlike majority of current denoising

  6. Multiple sources of lead in soils from a Hawaiian chronosequence Valerie Monastraa,*,1

    E-print Network

    Derry, Louis A.

    Multiple sources of lead in soils from a Hawaiian chronosequence Valerie Monastraa,*,1 , Louis A Received 16 July 2003; accepted 29 April 2004 Abstract We report lead isotopic ratios and concentrations and likely contain some anthropogenic lead of Asian origin. Older soils have undergone extensive leaching

  7. RuleBased System Testing with Control and Data Flow Dr. Valerie Barr \\Lambda

    E-print Network

    Barr, Valerie

    to guide and assess the testing of a rule­based system. An expert system is an encoding of an expert of a rule­based expert system is to provide a number of test cases with known results, obtaining a measureRule­Based System Testing with Control and Data Flow Techniques Dr. Valerie Barr \\Lambda Department

  8. TRUBAC: Testing Expert Systems with RuleBase Coverage Valerie Barr \\Lambda

    E-print Network

    Barr, Valerie

    TRUBAC: Testing Expert Systems with Rule­Base Coverage Measures Valerie Barr \\Lambda Department unfamiliar with expert systems may wish to look at Appendix A for a introduction to rule­based systems the knowledge stored within the expert system is correct. The usual method for dynamic test of a rule­based

  9. Advances in PAHs/nitro-PAHs fractioning Aurea Andrade-Eiroa,* Valerie Leroy and Philippe Dagaut

    E-print Network

    Paris-Sud XI, Université de

    Advances in PAHs/nitro-PAHs fractioning Aurea Andrade-Eiroa,* Valerie Leroy and Philippe Dagaut hydrocarbons (nitro-PAHs) and polycyclic aromatic hydrocarbons (PAHs). Unlike what usually occurs under (about 1 bar), dipole molecules (nitro-PAHs) elute much faster than non-polar organic molecules (PAHs

  10. Synchronization-Free Parallel Collision Detection Pipeline Quentin Avril Valerie Gouranton Bruno Arnaldi

    E-print Network

    Paris-Sud XI, Université de

    engineering...), video games and haptic applications. Virtual e-mail: quentin.avril@irisa.fr e-mail: valerie faster on a new generation of processors without any code modification. To have better management. Software, libraries and any piece of code must be written and specially adapted to take advantage

  11. BALANCE PROPERTIES OF ARNOUX-RAUZY WORDS VALERIE BERTHE, JULIEN CASSAIGNE, AND WOLFGANG STEINER

    E-print Network

    Paris-Sud XI, Université de

    BALANCE PROPERTIES OF ARNOUX-RAUZY WORDS VAL´ERIE BERTH´E, JULIEN CASSAIGNE, AND WOLFGANG STEINER Abstract. The paper deals with balances and imbalances in Arnoux-Rauzy words. We provide sufficient conditions for C-balancedness, but our results indicate that even a char- acterization of 2-balanced Arnoux

  12. Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132

    E-print Network

    Nonparametric Bootstrap Recycling Val'erie Ventura, Department of Statistics, Baker Hall 132. The amount of computation involved is usually considerable, and recycling provides a less computer intensive alternative. Recycling consists of using repeatedly the same samples drawn from a recycling distribution G

  13. FRACTAL TILES ASSOCIATED WITH SHIFT RADIX SYSTEMS VALERIE BERTHE, ANNE SIEGEL, WOLFGANG STEINER, PAUL SURER,

    E-print Network

    Paris-Sud XI, Université de

    FRACTAL TILES ASSOCIATED WITH SHIFT RADIX SYSTEMS VAL´ERIE BERTH´E, ANNE SIEGEL, WOLFGANG STEINER to fractal shapes, such as the classical Rauzy fractal and the twin dragon. These fractals turned out a collection of fractal tiles with shift radix systems. We show that for certain classes of parameters r

  14. Valerie Njie Executive Director/Senior Vice-President, Bidwell Training Center, Inc.

    E-print Network

    Sibille, Etienne

    and Colleges (ACCSC). Valerie was influenced by her mother, grandmother and other African-American women: University of Pittsburgh African American Alumni Council (Pittsburgh Affiliate President ), University WQED TV/Duquesne Light African American Leadership Award for Education; Pitt African American Alumni

  15. A review of "The Renaissance of Lesbianism in Early Modern England." by Valerie Traub 

    E-print Network

    Mario Digangi

    2003-01-01

    ? and its introduction?seems to promise. Valerie Traub. The Renaissance of Lesbianism in Early Modern England. Cambridge: Cambridge University Press, 2002. xvi + 492 pp. + 33 illus. $80.00 cloth. $29.00 paper. Review by MARIO DIGANGI, LEHMAN COLLEGE...

  16. Palindromes and twodimensional Sturmian Val'erie Berth'e \\Lambda , Laurent Vuillon y

    E-print Network

    Vuillon, Laurent - Raffalli, Christophe

    Palindromes and two­dimensional Sturmian sequences Val'erie Berth'e \\Lambda , Laurent Vuillon y Abstract This paper introduces a two­dimensional notion of palindrome for rect­ angular factors of double sequences: these palindromes are defined as centrosym­ metric factors. This notion provides

  17. ON THE PALINDROMIC AND PRIMITIVE WIDTHS OF A FREE VALERY BARDAKOV, VLADIMIR SHPILRAIN, AND VLADIMIR TOLSTYKH

    E-print Network

    Shpilrain, Vladimir

    ON THE PALINDROMIC AND PRIMITIVE WIDTHS OF A FREE GROUP VALERY BARDAKOV, VLADIMIR SHPILRAIN width of F n :) Similarly, inner automorphisms from Aut(F n ) determined by palindromic words in F n { in Aut(F n ): Palindromic words generate F n ; and this again raises the question of whether

  18. Adhesion of Sputtered Nickel Films on Polycarbonate Xueqiang Qian, Xiaolu Pang, Kewei Gao, Huisheng Yang, Jie Jin, and Alex A. Volinsky

    E-print Network

    Volinsky, Alex A.

    Adhesion of Sputtered Nickel Films on Polycarbonate Substrates Xueqiang Qian, Xiaolu Pang, Kewei, 2013; published online December 3, 2013) Nickel films were deposited by radio frequency magnetron and their influence on the critical load between sputtered nickel films and polymer substrate were studied by means

  19. A map-based algorithm for controlling low-dimensional chaos Valery Petrov, 80 Peng, and Kenneth Showalter@

    E-print Network

    Showalter, Kenneth

    A map-based algorithm for controlling low-dimensional chaos Valery Petrov, 80 Peng, and Kenneth-604.5 (Received 17 December 1991; accepted 5 February 1992) A simple proportional-feedback algorithm method offers advantages for control of systems in which more complicated algorithms might

  20. Intermittent outgassing through a non-Newtonian fluid Thibaut Divoux, Eric Bertin, Valerie Vidal and Jean-Christophe Geminard

    E-print Network

    Boyer, Edmond

    Intermittent outgassing through a non-Newtonian fluid Thibaut Divoux, Eric Bertin, Val´erie Vidal of the intermittent dynamics of a gas flowing through a column of a non-Newtonian fluid. In a given range with an exponent 3/2. A Newtonian fluid flowing through a non-Newtonian material is alike to present different

  1. Quantitative study of amplitude noise effects on dynamical localization Daniel A. Steck, Valery Milner, Windell H. Oskay, and Mark G. Raizen

    E-print Network

    Raizen, Mark G.

    Quantitative study of amplitude noise effects on dynamical localization Daniel A. Steck, Valery described in this paper are performed on a second-generation appara- tus, based on cold cesium atoms, which

  2. Tube-wave Effects in Cross-Well Seismic Data at Stratton Field Valeri Korneev, Lawrence Berkeley National Laboratory, Jorge Parra, South-West Research Institute,

    E-print Network

    Korneev, Valeri A.

    Tube-wave Effects in Cross-Well Seismic Data at Stratton Field Valeri Korneev, Lawrence Berkeley are the tube waves generated in the source well and later converted into laterally propagating waves through the reservoir in gas/water saturated layers, which convert back to tube- waves in the receiver well. The tube

  3. Imaging and monitoring with Virtual Sources on a synthetic 3D dataset from the Middle East Valeri Korneev* Lawrence Berkeley National Laboratory; Andrey Bakulin, Jorge Lopez, Shell International

    E-print Network

    Korneev, Valeri A.

    Imaging and monitoring with Virtual Sources on a synthetic 3D dataset from the Middle East Valeri in deviated observation wells below a 3D model with extremely heterogeneous overburden typical of Middle East. No knowledge of the velocity model between surface shots and receivers is required. Many Middle East fields

  4. Curriculum Vitae: VALERI A KORNEEV

    E-print Network

    Korneev, Valeri A.

    : Geophysics, Vol. 73, No 1, 1-7. Bakulin, A.V. and V.A. Korneev, 2008, Acoustic signatures of cross-flow Annual International Meeting, SEG. Bakulin, A.V. and V. A. Korneev, 2008, Acoustic signatures of cross-flow

  5. Attack-Resistant Frequency Counting Valerie King

    E-print Network

    Saia, Jared

    have already been developed in systems such as Earlybird [34] and Autograph [21]. These systems work well in practice. In fact, Netsift, a company based on the technology of the Earlybird system-07-1-0532 grant. 1 Both Earlybird and Autograph make use of Rabin fingerprinting and the technique of breaking

  6. Ondelettes et Imagerie Medicale Valerie Perrier(1)

    E-print Network

    Perrier, Valerie

    Mod´elisation et de la Cognition de l'IMAG, Institut de l'Ing´enierie de l'Information de Sant classification [6], l'outil utilis´e est la d´ecomposition sur bases d'ondelettes d'une fonction (bases orthonorm applications de la transform´ee en ondelettes continue se trouve dans [5]. A une fonction donn´ee, cette

  7. Ying Feng Pang e-mail: ypang@vt.edu

    E-print Network

    Thole, Karen A.

    generation of an integrated power electronics module IPEM was used as the design target of this research work Engineering, Center for Power Electronics Systems, Virginia Polytechnic Institute and State University for Power Electronics Systems, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061

  8. Dr. VALERIE B. BARR Professor of Computer Science

    E-print Network

    Barr, Valerie

    departmental research and educational activities FACULTY APPOINTMENTS September 2004 ­ present Professor Union Visiting Research Scholar Columbia University September 1996 ­ August 2000 Assistant Professor Hofstra Holyoke College September 1989 ­ May 1991 Teaching Asst. & Lecturer Rutgers University January 1987

  9. Applying Reliability Engineering to Expert Systems \\Lambda Valerie Barr

    E-print Network

    Barr, Valerie

    Science Hofstra University Hempstead, NY 11550 vbarr@magic.hofstra.edu Abstract Often a rule­based system prediction of system behavior in actual use. Introduction Given a rule­base and a set of test cases of the system are actually tested. We, in fact, have no in­ formation about a section of the rule­base

  10. Welcome to Wayne Valerie M. Parisi, MD, MPH, MBA

    E-print Network

    Finley Jr., Russell L.

    Assistant Dean Medical Eval & Edu Research Patrick Bridge Assistant Dean Student Affairs Kertia Black Dean Graduate Programs Robert Pauley Assistant Dean Continuing Medical Education David Pieper Assistant in 1868 as the Detroit College of Medicine · Of 130 medical schools in the US ­ 3rd highest medical

  11. The Fuzzy Ant Valeri Rozin and Michael Margaliot

    E-print Network

    Margaliot, Michael

    is a crucial problem in the design of autonomous robots. Thus, lessons from biological behavior may inspire of the resulting math- ematical model, as studied using both simulations and rigorous anal- ysis, is congruent with the behavior actually observed in nature. keywords: Linguistic modeling, social insects, mass foraging

  12. Valerie Wilson -Training Technology Coordinator Valerie joined NC State in 2010, and currently coordinates the Human Resources business systems and

    E-print Network

    management and reporting, and process improvement. Her industry experiences include manufacturing (Siemens coordinates the Human Resources business systems and web technologies related to training administration Energy & Automation and NORTEL), health care (A4 Health Systems/Misys and Imonics/BMG), mortgage banking

  13. SenSec: Mobile Security through Passive Sensing Jiang Zhu, Pang Wu, Xiao Wang, Joy Zhang

    E-print Network

    Tague, Patrick

    to provide active authentication (such as a strong password), or disable certain features of the mobile and convenient authentication is an essential re- quirement for a mobile device and its applications. Today mobile banking apps. Because the gesture patterns are so different between you two, the SenSec system

  14. Advancing to a Black Walnut (Juglans nigra) Ideotype Kejia Pang and Charles H. Michler

    E-print Network

    in growth (DBH, height, and crown expansion), quality (straightness), phenological characteristics (leaf of diameter at breast height (DBH), height, and crown dimensions; 2). Leaf flush dates; 3). Nut production of 25 black walnut clones in 2009 and 2010 2009 2010 4. Crown expansion 0 0.5 1 1.5 2 2.5 3 3.5 4 55 130

  15. Contested Nationalisms and Propaganda: Birth Pangs of a Malaysian Nation, 1957-1969

    E-print Network

    Gan, Cheong Soon

    2012-01-01

    communication until television ownership and broadcastingtrained in communications. Radio broadcasting, on the otherBroadcasting in the Malay world : radio, television, and video in Brunei, Indonesia, Malaysia, and Singapore, [Communication and

  16. Room temperature ferromagnetism in sputtered Zn1 -xCrxO thin films Xiaolu Pang a

    E-print Network

    Volinsky, Alex A.

    (TM) (e.g., Ti, V, Cr, Mn, Fe, Co, Ni and Cu), including TM-doped III­V [2­5], II­VI [6­8] or group IV. Sato and Katayama-Yoshida [10] theoretically demonstrated that V, Cr, Fe, Co and Ni doped ZnO exhibits ferromagnetism from the secondary phases or precipitates in DMSs. The only ferromagnetic Cr oxide is CrO2 with TC

  17. Finding Spatio-Temporal Patterns in Earth Science Data * Pang-Ning Tan+

    E-print Network

    Kumar, Vipin

    and Engineering, Army HPC Research Center University of Minnesota {ptan, steinbac, kumar@cs.umn.edu} ++ NASA Ames-temporal patterns from Earth Science data. The data consists of time series measurements for various Earth science existing ecosystem models (e.g. Net Primary Production). The ecological patterns of interest include

  18. Cathodic electrolytic deposition of zirconia films X. Pang, I. Zhitomirsky*, M. Niewczas

    E-print Network

    Niewczas, Marek

    on metals, graphite and carbon fibers [2,5,8]. The electrodeposition of zirconia is under investigation electrodeposition of composite zirconia-poly(diallyldimethylammonium chloride) (PDDA) films was performed from Zr; Composite film; Crystallization; Nanoparticles 1. Introduction Cathodic electrolytic deposition

  19. Coffee for morning hunger pangs. An examination of coffee and caffeine on appetite, gastric emptying, and energy intake.

    PubMed

    Schubert, Matthew M; Grant, Gary; Horner, Katy; King, Neil; Leveritt, Michael; Sabapathy, Surendran; Desbrow, Ben

    2014-12-01

    Coffee is one of the most widely consumed beverages in the world and has a number of potential health benefits. Coffee may influence energy expenditure and energy intake, which in turn may affect body weight. However, the influence of coffee and its constituents - particularly caffeine - on appetite remains largely unexplored. The objective of this study was to examine the impact of coffee consumption (with and without caffeine) on appetite sensations, energy intake, gastric emptying, and plasma glucose between breakfast and lunch meals. In a double-blind, randomised crossover design. Participants (n?=?12, 9 women; Mean?±?SD age and BMI: 26.3?±?6.3 y and 22.7?±?2.2?kg•m(-2)) completed 4 trials: placebo (PLA), decaffeinated coffee (DECAF), caffeine (CAF), and caffeine with decaffeinated coffee (COF). Participants were given a standardised breakfast labelled with (13)C-octanoic acid and 225?mL of treatment beverage and a capsule containing either caffeine or placebo. Two hours later, another 225?mL of the treatment beverage and capsule was administered. Four and a half?hours after breakfast, participants were given access to an ad libitum meal for determination of energy intake. Between meals, participants provided exhaled breath samples for determination of gastric emptying; venous blood and appetite sensations. Energy intake was not significantly different between the trials (Means?±?SD, p>?0.05; Placebo: 2118?±?663?kJ; Decaf: 2128?±?739?kJ; Caffeine: 2287?±?649?kJ; Coffee: 2016?±?750?kJ); Other than main effects of time (p?<0.05), no significant differences were detected for appetite sensations or plasma glucose between treatments (p?>?0.05). Gastric emptying was not significantly different across trials (p?>?0.05). No significant effects of decaffeinated coffee, caffeine or their combination were detected. However, the consumption of caffeine and/or coffee for regulation of energy balance over longer periods of time warrant further investigation. PMID:25218717

  20. DUAL USE OF LEDS: SIGNALING AND COMMUNICATIONS IN ITS Grantham Pang, Chi-ho Chan, Hugh Liu, Thomas Kwan

    E-print Network

    Pang, Grantham

    -brightness, long life expectancy, high tolerance to humidity, low power consumption and minimal heat generation, is generally gradual and predictable and they have been proven to have long life expectancy, high tolerance to humidity and minimal heat generation. A summary of the LED performance is [8]. The life expectancy

  1. Collapse limit states of reinforced earth retaining walls M. D. BOLTON* and P. L. R. PANG7

    E-print Network

    Bolton, Malcolm

    insuffisance de frottement peuvent ttre reproduites de sorte qu'elles fonds I'objet de calculs d and the international conference on soil reinforcement in Paris in 1979 testified to the rate of exploitation

  2. Vibroseis Monitoring of San Andreas Fault in California Valeri Korneev and Robert Nadeau

    E-print Network

    Korneev, Valeri A.

    argued for the propagation of fault-zone guided waves (FZGW) within a SAF zone that is 100 to 200 m wide amplitude tomographic inversion for SAF using microearthquakes, shows clearly that FZGW are significantly of characteristically repeating microearthquakes. The mechanism for low FZGW attenuation in the zone is possibly due

  3. A review of "The Renaissance of Lesbianism in Early Modern England." by Valerie Traub

    E-print Network

    Mario Digangi

    2003-01-01

    ?s exploration of ?the potential for female erotic agency from within the confines of patriarchal ideology? (125) to a consideration of female erotic agency outside of marriage. Like the pudica (a naked woman protecting her genitals with her hand) found...

  4. Introduction: Hydrogen isotopes as environmental recorders Valery J. Terwilligera,b,c,d

    E-print Network

    Paris-Sud XI, Université de

    of soil water into plants-- during transpiration in the leaves where much of photosynthesis will take fractionations in water are affected by humidity (Craig and Gordon, 1965; Dongmann et al., 1974) and result

  5. Conflict on a Communication Channel Valerie King Jared Saia Maxwell Young

    E-print Network

    Saia, Jared

    , and PayPal, severed ties with the website Wikileaks [42, 62]. In retaliation, the Anonymous group]. Surprisingly, the web pages of both Wikileaks, and all the companies that were attacked by Anonymous emerged relatively unscathed despite the fact that Wikileaks suffered a significant attack on its financial

  6. Leslie Roche, Lorien Jasny, Mark Lubell, Bethany Cutts, Emily Kachergis, Justin Derner, Valerie Eviner, Kenneth Tate

    E-print Network

    Tate, Kenneth

    . Riparian/Meadow Health and Wildlife 4. Recreation and Carbon Sequestration WYOMING 1. Livestock Production. Wildlife, Recreation, Carbon Sequestration #12;Characterizing On-Ranch Grazing Strategies 3 `California

  7. The Accuracy of GBM GRB Locations Michael S. Briggs , Valerie Connaughton , Charles A. Meegan

    E-print Network

    California at Berkeley, University of

    of the response of the detector, either in direction or energy, and imperfect modeling of scattering of radiation-ray sources using the relative rates in the twelve NaI detectors. The location algorithm is described. This method is subject to both statistical and systematic errors. Three types of locations are produced

  8. Dynamic Adaptation of Broad Phase Collision Detection Algorithms Quentin Avril Valerie Gouranton Bruno Arnaldi

    E-print Network

    Paris-Sud XI, Université de

    ..), video games and haptic applications. Virtual environments and 3D objects are constantly evolving. multi-cores architectures. So, software, libraries and any piece of code must be written and specially

  9. Talking to Learn Physics and Learning to Talk Physics Danielle B. Harlow & Valerie K. Otero

    E-print Network

    Colorado at Boulder, University of

    , in an experiment in which they attached a small fan (providing a constant strength force) to a low friction cart about how the world works from a science perspective, they also learn to talk science [3]. They develop necessary to predict with confidence that if a fan unit (which provides a constant force) is placed on a low-friction

  10. BALANCE PROPERTIES OF ARNOUX-RAUZY WORDS VALERIE BERTHE, JULIEN CASSAIGNE, AND WOLFGANG STEINER

    E-print Network

    BALANCE PROPERTIES OF ARNOUX-RAUZY WORDS VAL´ERIE BERTH´E, JULIEN CASSAIGNE, AND WOLFGANG STEINER Abstract. The paper deals with balances and imbalances in Arnoux-Rauzy words. We provide sufficient conditions for C-balancedness, but our results indicate that even a char- acterization of 2-balanced Arnoux

  11. Wavelet based acoustic detection of moving vehicles Amir Averbuch Valery Zheludev Neta Rabin and Alon Schclar

    E-print Network

    Averbuch, Amir

    noises are present. It is done via analysis of its acoustic signature against an existing database a construction of a training database of acoustic signatures signals emitted by vehicles using the distribution of false alarms. This processing is done against an existing database of recorded acoustics signals

  12. Coverage statistics for sequence census methods Steven N. Evans, Valerie Hower and Lior Pachter

    E-print Network

    Evans, Steven N.

    estimates for the read cov- erage in a whole genome shotgun (WGS) sequencing experiment via the Poisson can be used to infer those of the original molecules. The DNA fragments are identified by sequencing are compared to the genome, leading to a coverage function that records, at each site, the number of sequenced

  13. FRACTAL TILES ASSOCIATED WITH SHIFT RADIX SYSTEMS VALERIE BERTHE, ANNE SIEGEL, WOLFGANG STEINER, PAUL SURER,

    E-print Network

    FRACTAL TILES ASSOCIATED WITH SHIFT RADIX SYSTEMS VAL´ERIE BERTH´E, ANNE SIEGEL, WOLFGANG STEINER to fractal shapes, such as the classical Rauzy fractal and the twin dragon. These fractals turned out a collection of fractal tiles with shift radix systems. We show that for certain classes of parameters r

  14. UNIVERSITE PAUL VALERY MONTPELLIER III Arts et Lettres, Langues et Sciences Humaines et Sociales

    E-print Network

    Paris-Sud XI, Université de

    des Capacités Humaines et des Conduites de Santé Laboratory Dynamics of Human Abilities & Health Behaviors 4, boulevard Henri IV, 34000 Montpellier tel-00758984,version1-29Nov2012 #12;3 TITLE: This exploratory work is a study for teachers for 5-year-old children in a reception class, about an elaboration

  15. Mobile and Ubiquitous Computing Evaggelia Pitoura, Marios Dikaiakos, Valerie Issarny, and Nuno Preguica

    E-print Network

    Pallis, George

    in wireless networking. In "New Bounds on the Competitiveness of Randomized Online Call Control in Cellular algorithms, networking, soft- ware architectures and data management. Topic 14 covers all such aspects. In "Controlling Concurrency in Mobile Computing Environments with Broadcast-based Dissemination", J. M. Monteiro

  16. Seismic velocity changes caused by an overburden stress Valeri Korneev1

    E-print Network

    Korneev, Valeri A.

    of the increase in rock density, but rather with some chemical reactions and solid precipitation. However that results from geo- logic sedimentation processes or by a system of fractures with a preferable orientation stresses can have a tectonic or artificial (laboratory) source. However, the effect of overburden pressure

  17. Jairo Pedraza on HIV in Latin America. Interview by Valerie Michele Hoskins.

    PubMed

    Pedraza, J

    1998-10-01

    Jairo Pedraza, a native of Columbia, is an AIDS activist who participates in many organizations, and who has a particular interest in the international issues surrounding HIV/AIDS. Pedraza, like the late Dr. Jonathan Mann, believes that the availability of treatment for AIDS has become an economic issue. In Latin America, the lack of funding for treatment, the minimal involvement by government and religious groups, and the stigmatization of homosexuals has hindered implementation of an effective prevention program. Women in Honduras and injection drug users in Argentina are among the rising populations of people with AIDS in Latin America. Health care systems similar to Medicaid exist in these countries, but not everyone has access to them, nor do they have adequate access to follow-up testing. Other subjects discussed with Jairo Pedraza are the complications experienced by individuals who wish to seek medical treatment in the U.S. and the status and ethics of clinical trials being conducted in Latin American countries. In spite of limited support from their governments, many communities in Latin American countries have come together to effectively prevent the spread of HIV. PMID:11365910

  18. Synthesis of a Novel Chiral Binaphthyl Phospholane and Its Application in the

    E-print Network

    Zhang, Xumu

    V. 1998, 98, 2405. (2) (a) Noyori, R.; Takaya, H. Acc. Chem. Res. 1990, 23, 345. (b) Ohkuma, T.; Ooka, H.; Hashiguchi, S.; Ikariya, T.; Noyori, R. J. Am. Chem. Soc. 1995, 117, 2675. (c) Doucet, H.; Ohkuma, T.; Murata, K.; Yokozawa, T.; Kozawa, M.; Katayama, E.; England, A. F.; Ikariya, T.; Noyori, R. Angew. Chem

  19. Institute of Industrial Science, The University of Tokyo Chiba Experiment Station

    E-print Network

    Tokyo, University of

    -source Heat Pump System Kato & Ooka Lab. http://venus.iis.u-tokyo.ac.jp/ MMHP A Multiple-source and Multiple-use Heat Pump system (MMHP system) connects multiple heat sources (solar heat, ground source, etcInstitute of Industrial Science, The University of Tokyo Chiba Experiment Station 2013-2014 #12

  20. Polarizing beam splitters constructed of form-birefringent multilayer gratings Rong-Chung Tyan, Pang-Chen Sun and Yeshayahu Fainman

    E-print Network

    Fainman, Yeshaiahu

    . By combining the form birefringence effect of a high spatial frequency grating with the resonant reflectivity) with the resonant reflectivity of a multilayer structure. In the next section we first describe intuitively the anisotropic spectral reflectivity (ASR) characteristics of a high spatial frequency multilayer binary grating

  1. Virus-mediated chemical changes in rice plants impact the relationship between non-vector planthopper Nilaparvata lugens Stål and its egg parasitoid Anagrus nilaparvatae Pang et Wang.

    PubMed

    He, Xiaochan; Xu, Hongxing; Gao, Guanchun; Zhou, Xiaojun; Zheng, Xusong; Sun, Yujian; Yang, Yajun; Tian, Junce; Lu, Zhongxian

    2014-01-01

    In order to clarify the impacts of southern rice black-streaked dwarf virus (SRBSDV) infection on rice plants, rice planthoppers and natural enemies, differences in nutrients and volatile secondary metabolites between infected and healthy rice plants were examined. Furthermore, the impacts of virus-mediated changes in plants on the population growth of non-vector brown planthopper (BPH), Nilaparvata lugens, and the selectivity and parasitic capability of planthopper egg parasitoid Anagrus nilaparvatae were studied. The results showed that rice plants had no significant changes in amino acid and soluble sugar contents after SRBSDV infection, and SRBSDV-infected plants had no significant effect on population growth of non-vector BPH. A. nilaparvatae preferred BPH eggs both in infected and healthy rice plants, and tended to parasitize eggs on infected plants, but it had no significant preference for infected plants or healthy plants. GC-MS analysis showed that tridecylic aldehyde occurred only in rice plants infected with SRBSDV, whereas octanal, undecane, methyl salicylate and hexadecane occurred only in healthy rice plants. However, in tests of behavioral responses to these five volatile substances using a Y-tube olfactometer, A. nilaparvatae did not show obvious selectivity between single volatile substances at different concentrations and liquid paraffin in the control group. The parasitic capability of A. nilaparvatae did not differ between SRBSDV-infected plants and healthy plant seedlings. The results suggested that SRBSDV-infected plants have no significant impacts on the non-vector planthopper and its egg parasitoid, A. nilaparvatae. PMID:25141278

  2. The Dark Side of the Web: An Open Proxy's View Vivek S. Pai, Limin Wang, KyoungSoo Park, Ruoming Pang, and Larry Peterson

    E-print Network

    Pai, Vivek

    The Dark Side of the Web: An Open Proxy's View Vivek S. Pai, Limin Wang, KyoungSoo Park, Ruoming with other resources on the Web. While such interaction can easily attract clients and traffic, our expe, deployed on PlanetLab, uses a network of caching Web proxy servers to intelligently dis- tribute and cache

  3. Seismic imaging of oil production rate Valeri A. Korneev, Dmitry Silin, Lawrence Berkeley National Laboratory, Berkeley, California

    E-print Network

    Korneev, Valeri A.

    National Laboratory, Berkeley, California Gennady M. Goloshubin, University of Houston, Texas, Viacheslav principles of filtration theory and elasticity. In particular, the derivation includes a dynamic version is about 17-18%. From the 15 operating wells, 7 produced oil and 6 produced water. The other two wells

  4. Can we predict who will benefit from computer-based phonetic training? Valerie Hazan, Yoon Hyun Kim

    E-print Network

    Fujimoto, Hiroshi

    workshop on speech technology in language learning (STiLL) in 1998. Computer- based training can be applied or rate of learning during training. 2. Method 2.1. Participants Participants were 25 British English phonetic contrast (Korean lenis-aspirated contrast) or to the degree of learning following computer

  5. EDITORIAL: Special issue in honour of Professor Valery V Tuchin’s contribution to the field of biomedical optics

    NASA Astrophysics Data System (ADS)

    Wang, Ruikang K.; Priezzhev, Alexander V.; Fantini, Sergio

    2005-08-01

    This special issue of Journal of Physics D: Applied Physics covers some of the applied physics currently being addressed by light source researchers. Most of these papers originate from presentations made at the 10th International Symposium on the Science and Technology of Light Sources, held in Toulouse, France, on 18--22 July 2004. The conference attracted about 400 participants from all over the world. Abstracts of all papers, including extended abstracts of invited papers, were published in the conference book Light Sources 2004 (Institute of Physics Conference Series 182) edited by G Zissis. The full papers published in this issue reflect the wide-ranging nature of research on light sources. These collected full papers survived our rigorous journal review process and they report completed, previously unpublished, pieces of work. This is a research field that has seen many major contributions over the last hundred years; nevertheless it continues to produce new sources and important improvements to existing types. It is evident from these papers just how crucial are the materials used for light sources. Numerous recent lamp developments have depended critically on new or improved materials. Ten or more of the papers are concerned explicitly with materials: for example, an environmentally important and challenging area of research is to find a viable alternative to the use of mercury, particularly in fluorescent lamps. This is difficult because a substitute for Hg in general lighting must match the remarkable efficiency of Hg, or risk doing harm to the environment through increased energy consumption. Large-scale computation of the properties of both high- and low-pressure discharge lamps has become indispensable. A good example is in the paper by Derra et al, which is the first major review of an important lamp type. The lamp of interest is a mercury arc used in data projectors, operating with an arc gap of approximately 1 mm at more than 100 bar pressure. Most of the information needed for design is not accessible experimentally. Computer models were essential tools in many aspects of development, including finding out how the highly stressed materials could be used in ways that ensured acceptable life. Short-arc metal-halide lamps are used for producing white light in commercial premises, but they present numerous challenges to developers. Exceedingly complex chemistry, the many emitters and absorbers, the lack of symmetry, and the increasing influence of electrodes as the arc is shortened—all these pose many design problems that are being tackled with increasing success with the help of computer models. This special issue has many papers that deal with electrode issues, with special emphasis on the experimental verification of model predictions. Radiation transport also continues to be a major issue in constructing realistic discharge models. A number of papers tackle this in a simplified manner, whilst a new ray-tracing scheme offers hope of a realistic calculation of radiation in the complicated short-arc metal-halide lamps mentioned above. Light-emitting diodes are now having a major impact on some areas of lighting; two papers in this issue reflect that trend. The group of papers in this special issue will surely provide an important resource for those researching new and improved lamps.

  6. Grain boundary energies and cohesive strength as a function of geometry Valerie R. Coffman and James P. Sethna

    E-print Network

    Sethna, James P.

    are used by finite element cohesive zone models CZM , which simulate fracture initiation at interfaces.1 extract grain boundary energies and cohesive laws of grain boundary fracture in two dimensions form of the fracture toughness near the discontinuities at high symmetry grain boundaries using our

  7. Supplementary Material: Recursive Deep Models for Semantic Compositionality

    E-print Network

    review excerpts from the Rotten Tomatoes website originally collected and published by Pang and Lee (2005 for Sentiment Annotation Pang and Lee's dataset assumes the snippets marked as "fresh" by the Rotten Toma

  8. Role accord and job satisfaction of county agricultural agents in Texas 

    E-print Network

    Miller, Robert Allen

    1965-01-01

    ROLE ACCORD ASD JC'9 SATISFACTIO't 0; COCRTY AXCCULSML A Z?l5 IR T~~A 3 Robert A Hiller 3ubaitted to the Graduate College of Texas AQ University in ~el fglfiliaent of the requirements for the degree of A'~its 1 "~$ ~or Bob)eats 3ooka1ogr ROLE... ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1 . ~ , 8 II THEORETICAL FMENOHX ~ ~ ~ e ~ ~ ~ ~ ~ o ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ o ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 15 III PROCEDURE e ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 18 IV ROLE DEFINITION...

  9. Radar Subsurface Imaging by Phase Shift Migration Hui Zhang1, Wolf-Stefan Benedix1, Dirk Plettemeier1, Valerie Ciarletti2

    E-print Network

    Paris-Sud XI, Université de

    Radar Subsurface Imaging by Phase Shift Migration Algorithm Hui Zhang1, Wolf-Stefan Benedix1, Dirk the phase shift migration based Syn- thetic Aperture Radar (SAR) is described and applied on radar imaging for dual polarized ground penetrating radar system (GPR). Conventional techniques for SAR imaging focusing

  10. Non Ribosomal Peptides : A monomeric puzzle Yoann DUFRESNE1, Valerie LECL `ERE2, Philippe JACQUES2, Laurent NO E1 and Maude PUPIN1

    E-print Network

    Noé, Laurent

    , Laurent NO ´E1 and Maude PUPIN1 1 LIFL, UMR USTL/CNRS 8022, INRIA Lille-Nord Europe, 59655 Villeneuve d'Ascq, France Yoann Dufresne : yoann.dufresne@etudiant.univ-lille1.fr, {maude.pupin, laurent.noe}@univ-lille1.fr 2 ProBioGEM (UPRES EA 1026), Universit´e Lille Nord de France, USTL, Polytech-Lille/IUTA, 59655

  11. Time-lapse changes in tube and guided waves in cross-well Mallik experiment Andrey Bakulin, Shell International Exploration and Production Inc, Valeri Korneev*, Lawrence Berkeley

    E-print Network

    Korneev, Valeri A.

    Time-lapse changes in tube and guided waves in cross-well Mallik experiment Andrey Bakulin, Shell-well seismic data from the Mallik experiment and demonstrate time-lapse changes in tube and guided waves sensitivity of tube and guided waves to small production-related changes and their feasibility for reservoir

  12. To cite this document: Budinger, Valerie and Cherrier, Olivier and Morlier, Joseph and Lachaud, Frdric Damage location method for thin composites structures -application

    E-print Network

    Mailhes, Corinne

    : AST 2013 4th International Workshop on Aircraft System Technologies, 23-24 Apr 2013, Hamburg, Germany. Open Archive Toulouse Archive Ouverte (OATAO) OATAO is an open access repository that collects the work damage indicators and on the acoustic attenuation level to localize damage. One of the main advantages

  13. Charles M. Ankenbrandt 1 , Giorgio Apollinari 2 , M. Atac 1 , Bruno Autin 3 , Valerie I. Balbekov 1 , Vernon D. Barger 4 ,

    E-print Network

    McDonald, Kirk

    Han 12 , Ady Hershcovitch 11 , Colin Johnson 3 , Carol Johnstone 1 , Stephen A. Kahn 11 , Bruce J Lissauer 11 , Laurence Littenberg 11 , Chang­guo Lu 14 , Alfredo Luccio 11 , Kirk T. McDonald 14 , Alfred D. McIntur# 8 , Frederick E. Mills 1 , Nikolai Mokhov 1 , Alfred Moretti 1 , David V. Neu#er 1 , King

  14. To cite this document: SELVA Pierre, CHERRIER Olivier, BUDINGER, Valerie, LACHAUD, Frdric, MORLIER. Joseph.Smart EMI monitoring of thin composite structures. In: 16th

    E-print Network

    Mailhes, Corinne

    health monitoring (SHM) method for in-situ damage detection and localization in carbon fibre reinforced be used as a tool to predict the in-plane position of a single damage in a laminated composite plate. 1 distinct advantages such as the ability to detect incipient damage, use of non-intrusive piezoelectric

  15. Utility and limitations of GPS-Interferometric Reflectometry in vegetation sensing Clara C. Chewa, Eric E. Smallb, Kristine M. Larsonc, Valery U. Zavorotnyd

    E-print Network

    Larson, Kristine

    , reflectometry, soil Abstract The utility of bistatic radar remote sensing using GPS.zavorotny@noaa.gov #12;2 Keywords: radar, remote sensing, vegetation, global positioning system SNR data to changes in both soil moisture and vegetation is presented

  16. Hue discrimination, unique hues and naming Romain, Bachy1

    E-print Network

    Alleysson, David

    ;Val´erie, Bonnardel1 1 Department of Psychology, The University of Winchester, Winchester, SO22 4NR Corresponding : Valerie.Bonnardel@winchester.ac.uk The Hue Discrimination Curve (HDC) that characterizes´er^ome Dias, David Alleysson, and Val´erie Bonnardel, "Hue discrimination, unique hues and naming," J. Opt

  17. University Faculty Senate Meeting Friday April 23, 2010

    E-print Network

    Fernandez, Eduardo

    , Pierre- Philippe Beaujean, William Bosshardt, Ernest Andrew Brewer, Valerie Bryan, Philippe D'Anjou, Lester Embree, Mary Faraci, Penelope Fritzer, Joseph Furner, Stuart Galup, Peggy Goldstein, Anthony

  18. Spring 2008 Dean's List College of Agriculture and Life Sciences* College of Liberal Arts

    E-print Network

    Wurtele, Eve Syrkin

    Brenda Janning Timothy Poterucha Christopher Baldon Cory Janssen* Valerie Prescher Gary Beck Mark Jensen Nicole Rutscher* Rhonda Berry Kelli Kilgore Tiffany Schallau Kevin Bieniek Laura Kleinschmidt Laura

  19. A smooth dual gap function to a class of quasivariational inequalities

    E-print Network

    algorithms, * *see for instance Noor, Noor, Rassias [22], Fukushima & Pang [10], Luo & Tseng [17.2.4. This method is used by Fukushima[9] for variational inequality problems and is also applicable to quas

  20. Sergei V. Adamovich Department of Developmental and

    E-print Network

    New Jersey, University of Medicine and Dentistry of

    -defined rehabilitation settings clearly cannot provide for such massed supervised training. Computerized robot, 2000; Reikensmayer et al., 2000; Volpe et al., 2000; Krebs et al., 2003) and wrist (Reinkensmayer, Pang

  1. The Learning Principal[R]. Volume 5, Number 2

    ERIC Educational Resources Information Center

    Crow, Tracy, Ed.

    2009-01-01

    "The Learning Principal" is an eight-page newsletter published eight times a year. It focuses on the important and unique work of school principals. This issue includes: (1) Data Analysis Is a Courageous Look in the Mirror (Valerie von Frank); (2) Q&A: Opening Doors, Opening Minds (Valerie von Frank); (3) Focus on NSDC's [National Staff…

  2. 10.1101/gad.1632708Access the most recent version at doi: 2008 22: 627-639Genes & Dev.

    E-print Network

    Forbes, Douglass

    R. Brown, Caleb J. Kennedy, Valerie A. Delmar, Douglass J. Forbes and Pamela A. Silver. Kennedy,1,3 Valerie A. Delmar,2 Douglass J. Forbes,2 and Pamela A. Silver1,4 1 Department of Systems. In the budding yeast, Saccharomyces cerevisiae, a nucleolar-proximal region has also been shown to cluster

  3. The Learning Principal[R]. Volume 4, Number 8

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    "The Learning Principal" is an eight-page newsletter published eight times a year. It focuses on the important and unique work of school principals. This issue includes: (1) Efficacy Can Overcome Classroom Barriers (Valerie von Frank); (2) Q & A: Leadership, Learning Communities Change School Culture (Valerie von Frank); (3) Focus on NSDC's…

  4. Higher Education Graduate Certificate

    E-print Network

    Rock, Chris

    ://www.educ.ttu.edu/ Graduate Faculty Dr. Dimitra Jackson Dr. Stephanie J. Jones Dr. Valerie Paton Dr. Colette M. Taylor COE Room 304 dimitra.jackson@ttu.edu stephanie.j.jones@ttu.edu valerie.paton@ttu.edu colette problems in this process, please contact Dr. Colette Taylor, program coordinator, at colette

  5. Google Earth Blog: Great collection of resources for the Fukushima power plant

    NSDL National Science Digital Library

    Valery Hronusov

    This Google Earth blog entry features a single network link from Valery Hronusov devoted to the Fukushima power plant. The file is packed with information about the plant -- photo overlays, 3D buildings, photos, videos and more.

  6. Sickle Cell Clinics, Contacts, and Resources

    MedlinePLUS

    ... Israel Medical Center Valerie Fund Children's Center 201 Lyons Avenue L5 Newark, NJ 07112-2094 (973) 926- ... need JavaScript enabled to view it Dr. Charles H. Packman, Adult Hematologist Telephone: (704) 355-3165; FAX: ( ...

  7. The structure of energy levels in ¹?²RU

    E-print Network

    Bouttchenko, Sviatoslav Olegovich

    1998-01-01

    of the ' Ru which agree well with predictions from other models. To my parents, Dasha, Giulia, Valery, Basia, Veronica, Krys, Basel, Uthra and Linda. ACKNOWLEDGMENTS My acknowledgments go to Drs. Shalom Shlomo and Haydeh Dejbaksh for their continuous...

  8. T h u r s d a y, M a r c h 1 4 , 2 0 1 3 , 8 p m M a n d e v i l l e A u d i t o r i u m University of California San Diego Division of Arts and Humanities Department of Music

    E-print Network

    Buckingham, Michael

    Cruz Symphony (1980-1982). #12;FLUTE Sarah Carmona (piccolo) Valerie Chereskin Jennifer Davis Deborah Dahl Joseph De Nava (Bass Clarinet) Jaime Alex Duran Ana Friede Stephanie Gates Laura Hawkins Jay Kahn

  9. Heden vol vertroebelde feiten Marc Cogen niet koosjer genoeg voor UGent Dat zou nooit gebeurd zijn, mocht hij

    E-print Network

    `ValerieTiberius`Desmet vormgeving Joost`JohnLocke'Vanderdeelen (chefLay-out&Verdeling) redactie Ans`AnnBradstreet'Debruyne,Bart`Roland Barthes'Bruneel(chefWetenschapa.i.), Charlotte`CharlottePerkinsGilman'De

  10. International Toys in Space: Jump Rope - Duration: 53 seconds.

    NASA Video Gallery

    Cosmonaut Valery Korzun attempts jumping rope in microgravity. He decides to adapt the activity by taking out the "jumping part," but the act of spinning the rope around him still proves difficult....

  11. Heavy Quarkonium Production at sqrt{s_{NN}} = 200 GeV

    E-print Network

    Cervantes, Matthew

    2012-12-12

    . Au Kim Vong, Dr. Zhonghai Liu, Dr. Eunsin Lee and Grace, Dr. Noam Erez, Dr. Richard Arnowitt, Dr. Valery Pokrovsky, Dr. Ronald Bryan, Robert Burch, David Carson Fuls, Lucas Naveira, Sandi Smith, Thomas Weimar, Shuai Yang, Sergio Dagach, Michael...

  12. DRAFT COMMITTEE REPORT RENEWABLE ENERGY PROGRAM

    E-print Network

    DRAFT COMMITTEE REPORT RENEWABLE ENERGY PROGRAM 2010 ANNUAL REPORT Authors Madeleine Meade Project Manager Tony Gonçalves Office Manager Renewable Energy Office Valerie Hall This report was prepared by the California Energy Commission Renewables Committee as part of Renewable Energy

  13. University Faculty Senate Meeting Friday February 19, 2010

    E-print Network

    Fernandez, Eduardo

    , William Bosshardt, Philippe D'Anjou, Ernest Andrew Brewer, Doug Broadfield, Valerie Bryan, Eric Chiang, Anthony Guneratne Jerry Haky, Mike Harris, Fred Hoffman, Mehdi Kaighobadi, Kathryn Keller, David Kumar

  14. University Faculty Senate Meeting Friday January 22, 2010

    E-print Network

    Fernandez, Eduardo

    , William Bosshardt, Philippe D'Anjou, Ernest Andrew Brewer, Doug Broadfield, Valerie Bryan, Eric Chiang, Marshall DeRosa, Lester Embree, Deborah Floyd, Penelope Fritzer, Joseph Furner, James Gray, Anthony

  15. Quantum Mechanics 1 for graduate students

    E-print Network

    Course 606 Quantum Mechanics 1 for graduate students Fall 2010 Instructor Valery Pokrovsky 1 electromagnetic field. Gauge invariance. Landau levels. 7. Semiclassical approximation. 8. Quantum mechanics. Scattering. The main textbook is E. Merzbacher, Quantum Mechanics, third edition, Wiley. Additional

  16. I. ASCRC General Education Form Group V Literary & Artistic Studies

    E-print Network

    Vonessen, Nikolaus

    Senate Office Please type / print name Signature Date Instructor Valerie Hedquist Phone / Email 4607://www.umt.edu/facultysenate/gened/GEPreamble_final.htm Discussion of artists, artworks, critics and theories from the 1960's to the present. Introduction to major

  17. Central European University Department of Mathematics and its Applications

    E-print Network

    this Ph.D Thesis to, First, in honor and thanksgiving to my Lord God Almighty, His Only Son Jesus-Christ children (in Christ): Bien, Ben, Larissa, Valery, Ra¨issa, Manuel, Mary, .... i #12;Acknowledgments I would

  18. STEM Education at the University of Colorado at Boulder Congressional Briefing, Otero and Finkelstein, 12 Aug 2010 1

    E-print Network

    Finkelstein, Noah

    STEM Education at the University of Colorado at Boulder Congressional Briefing, Otero, Engineering, Mathematics (STEM) at the University of Colorado Boulder Valerie Otero and Noah Finkelstein) Higher education & research #12;STEM Education at the University of Colorado at Boulder Congressional

  19. Near-Ultrahigh Pressure Processing of Continental Crust: Miocene Crustal Xenoliths

    E-print Network

    Hacker, Bradley R.

    BRADLEY HACKER1 *, PETER LUFFI2 , VALERY LUTKOV3 , VLADISLAV MINAEV3 , LOTHAR RATSCHBACHER4 , TERRY PLANK5. Fax: 805 893 2314. E-mail: hacker@geol.ucsb.edu # The Author 2005. Published by Oxford University

  20. CoWSAMI: Interface-Aware Context Gathering in Ambient Intelligence

    E-print Network

    Boyer, Edmond

    Athanasopoulos a Apostolos Zarras a, Valerie Issarny b Evaggelia Pitoura a Panos Vassiliadis a aDept. of Computer: Corresponding author. Email addresses: dathanas@cs.uoi.gr (Dionisis Athanasopoulos), zarras@cs.uoi.gr (Apostolos

  1. The Role of Software Architecture in Constraining Adaptation in Component-based Middleware Platforms

    E-print Network

    Platforms Gordon S. Blair1 , Lynne Blair1 , Valérie Issarny2 , Petr Tuma3 , Apostolos Zarras2 1 Distributed, Rocquencourt - BP 105, 78153 Le Chesnay Cédex, France. {Valerie.Issarny,Apostolos.Zarras}@inria.fr 3

  2. The Labor Market for Individuals with Advanced Degrees in

    E-print Network

    Lewis, Robert Michael

    ......................................................................................................... 46 #12;2 Tables and Charts TABLE 1: INSTITUTIONS WITH NATIONAL LIBRARY OF MEDICINE FUNDING contribute to this report. Thank you to Dr. Valerie Florance at the National Library of Medicine for her

  3. CALIFORNIA ENERGY FOURTH EDITION

    E-print Network

    CALIFORNIA ENERGY COMMISSION EXISTING RENEWABLE FACILITIES PROGRAM FOURTH EDITION GUIDEBOOK MARCH RENEWABLE ENERGY OFFICE Valerie Hall Deputy Director EFFICIENCY, RENEWABLES & DEMAND ANALYSIS DIVISION #12 to apply for and receive production incentives from the Existing Renewable Facilities element of the Energy

  4. ELIGIBILITY THIRD EDITION

    E-print Network

    CALIFORNIA ENERGY COMMISSION RENEWABLES PORTFOLIO STANDARD ELIGIBILITY THIRD EDITION. Geesman Jeffrey Byron Melissa Jones Executive Director Heather Raitt Technical Director RENEWABLE ENERGY OFFICE Mark Hutchison Office Manager RENEWABLE ENERGY OFFICE Valerie Hall Deputy Director EFFICIENCY

  5. Multiple Compressive Projection Measurement for Stepped Frequency Radar

    E-print Network

    Boyer, Edmond

    , Technische Universität Dresden, Germany, Email: Yun.Lu1@tu-dresden.de LATMOS/CNRS/IPSL/UVSQ, 78280 Velizy, France, Email: Valerie.Ciarletti@latmos.ipsl.fr Abstract--In modern communication and measurement sys

  6. 2009Integrated energy PolIcy rePort

    E-print Network

    Bill Pfanner Sarah Pittiglio Peter Puglia richard ratliffe Ivin rhyne Paul richins carol robinson randy carol greenwood Karen griffin valerie Hall nancy Hassman Mark Hesters John Hingtgen david Hungerford

  7. January 7, 2014 The Valley Health System Appoints Board of Governors

    E-print Network

    Hemmers, Oliver

    , whose practice is associated with MDVIP, a concierge medical practice; and secretary/treasurer Valerie; Michael Gunter, MD, family medicine physician and Chief of Staff, Summerlin Hospital; Peter Scully, MD

  8. Redescription of Platynaspis flavoguttata (Gorham) (Coleoptera, Coccinellidae) and notes on nomenclature of Platynaspis kapuri Chakraborty & Biswas

    PubMed Central

    2014-01-01

    Abstract Platynaspis flavoguttata (Gorham) (Coleoptera: Coccinellidae) is redescribed and the male genitalia are illustrated for the first time. It is also recorded from Sri Lanka for the first time. Platynaspis bimaculata (Hoang, 1983) is a new junior synonym of Platynaspis bimaculata Pang & Mao, 1979 (new synonym). Platynaspis kapuri Chakraborty & Biswas, 2000, the replacement name for Platynaspis bimaculata Pang & Mao, 1979 established by Ukrainsky (2007), is also the new replacement name for Platynaspis bimaculata (Hoang, 1983), as both are junior homonyms of Platynaspis bimaculata Weise, 1888 besides being synonyms. Platynaspis hoangi Ukrainsky (2007) is an unnecessary replacement name for Platynaspis bimaculata (Hoang). PMID:25057247

  9. Multi-Method Dispatch Using Multiple Row Displacement

    E-print Network

    Szafron, Duane

    Multi-Method Dispatch Using Multiple Row Displacement Candy Pang, Wade Holst, Yuri Leontiev,wade,yuri,duane}@cs.ualberta.ca Abstract. Multiple Row Displacement (MRD) is a new dispatch tech- nique for multi-method languages-receiver projection. MRD uses comparable space to the other techniques, but has faster dispatch performance. 1

  10. Great Question! Question Quality in Community Q&A Sujith Ravi

    E-print Network

    Cortes, Corinna

    }@gmail.com Abstract Asking the right question in the right way is an art (and a science). In a communityGreat Question! Question Quality in Community Q&A Sujith Ravi Bo Pang Vibhor Rastogi Ravi Kumar question-answering setting, a good question is not just one that is found to be use- ful by other people

  11. TESL Reporter, Vol. 3, Nos. 1-4.

    ERIC Educational Resources Information Center

    Pack, Alice C., Ed.

    Four issues of "TESL Reporter" are presented. Contents include the following articles: "Feedback: An Anti-Madeirization Compound" by Henry M. Schaafsma; "Using the Personal Pronoun 'I' as a Compound Subject" by G. Pang and D. Chu; "The Consonant'L' in Initial and Final Positions" by Maybelle Chong; "Sentence Expansion for the Elementary Level" by…

  12. Host-foraging success of three species of Trichogramma (Hymenoptera: Trichogrammatidae) in a simulated retail environment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Three species of trichogrammatid egg parasitoids (Trichogramma deion Pinto and Oatman, T. ostriniae Pang and Chen, and T. pretiosum Riley) were evaluated as potential biological control agents for the Indianmeal moth (Plodia interpunctella (Hübner)) on retail shelves under laboratory conditions. A s...

  13. Incremental linear discriminant analysis for evolving feature spaces in multitask pattern recognition problems

    Microsoft Academic Search

    Masayuki Hisada; Seiichi Ozawa; Kau Zhang; Nikola Kasabov

    2010-01-01

    In this paper, we propose a new incremental linear discriminant analysis (ILDA) for multitask pattern recognition (MTPR) problems in which a chunk of training data for a particular task are given sequentially and the task is switched to another related task one after another. The Pang et al.'s ILDA is extended such that a discriminant space of the current task

  14. What is Katipunan? KATIPUNAN is the name given to the

    E-print Network

    Pilipino sa Unibersidad ng Hawai'i (Confraternity of students taking Filipino courses at the University. What are the objectives of Katipunan? 1. Kapatiran ng mga estudyanteng nag-aaral ng Pilipino sa. Paghikayat sa mga estudyanteng gamitin ang Pilipino sa mga usapan, pagsulat, at iba pang gawain sa labas ng

  15. Poster Printing Tips Systems Biodynamics Lab, UCSD

    E-print Network

    Hasty, Jeff

    Poster Printing Tips Systems Biodynamics Lab, UCSD Revision 1.0 Wyming Lee Pang February 28, 2006 #12;Poster Printing Tips Rev. 1.0, WLP · DO NOT use Microsoft Powerpoint. Although the status quo for making posters, the initial benefits in ease of use and application familiarity will be far overshadowed

  16. Infants and Toddlers: Discovering and Exploring the Outdoors

    ERIC Educational Resources Information Center

    Honig, Alice Sterling

    2005-01-01

    Babies' interest in the outer world develops very slowly. During the first half year or so, babies are strongly tuned in to themselves. They feel hunger pangs when they need to be fed. Their skin is fragile, and they need help maintaining their body temperature in cold weather. This article discusses outside interests, safe exploration, animal…

  17. Quantitative Study of the Dynamic Tumor-Endothelial Cell Interactions through an Integrated Microfluidic Coculture System

    E-print Network

    Huang, Yanyi

    Microfluidic Coculture System Chunhong Zheng, Liang Zhao, Gui'e Chen, Ying Zhou, Yuhong Pang, and Yanyi Huang* College of Engineering and Biodynamic Optical Imaging Center (BIOPIC), Peking University, Beijing 100871 and angiogenesis. We developed a novel microfluidic device to assess the cell-cell interaction quantitatively

  18. An Abrupt Decrease in the Late-Season Typhoon Activity over the Western North Pacific*

    E-print Network

    Hawai'i at Manoa, University of

    An Abrupt Decrease in the Late-Season Typhoon Activity over the Western North Pacific* PANG-CHI HSU 18 February 2014) ABSTRACT In 1995 an abrupt shift in the late-season (October­December) typhoon cyclone energy of the late-season typhoons during the 1995­2011 epoch decreased significantly, compared

  19. , , 210093. 1977 , 1980

    E-print Network

    He, Bingsheng

    and Operations Re- search XX, Springer Verlag, 1975. [2] S. Boyd and L. Vandenberghe, Convex Optimization] M.C. Ferris and J.S. Pang, Engineering and economic applications of complementarity problems, SIAM, Mathematical Pro- gramming 66, 137-144, 1994. [6] B.S. He, Solving a class of linear projection equations

  20. Quality-Controlled Motion-Compensated Interpolation

    E-print Network

    Girod, Bernd

    results in spatial artifacts especially in video frames with high motion. In the case of lowQuality-Controlled Motion-Compensated Interpolation Mina Makar, Derek Pang, Yao-Chung Lin and Bernd and power-sensitive applications. One way to reduce encoding complexity is to drop frames at the encoder

  1. Search for the Decay KL 0 Kazunori Hanagaki

    E-print Network

    Fermilab

    . In particular, I would like to thank Y.B. Hsiung, Y.W. Wah, B. Winstein, and T. Yamanaka who proposed. Nguyen, M. Pang, R.E. Ray, P. Shanahan, R. Tschirhart, and T. Yamanaka. I really appreciate the kindness. I really appreciate the supports for such a study. Finally, I would like to thank Taku Yamanaka

  2. The Application of Clustering to Earth Science Data: Progress and Challenges

    E-print Network

    Minnesota, University of

    The Application of Clustering to Earth Science Data: Progress and Challenges Michael Steinbach Pang for some land areas, and still other clusters may represent potentially new Earth science phenomena. Although this application of clustering to Earth science data has proven useful, many challenges remain

  3. A Collaborative Web Service Platform for AEC Supply Chain

    E-print Network

    Stanford University

    A Collaborative Web Service Platform for AEC Supply Chain Chin-Pang Jack Cheng*§ , Kincho H. Law collaborative communication for AEC supply chain. Using web portal technology, the web-based platform can-based supply chain platform in managing material delivery and facilitat- ing online collaboration. Key words

  4. With sponsorship and support fromWith sponsorship and support fromWith sponsorship and support from Science/AAAS

    E-print Network

    Napp, Nils

    2001 Paul Ning-Man Cheng BCTPolyU BCT-100 BCT BCT-100 BCT-100 BCT-100 45 BCTI/II BCT-100 Way Kuo21 1649 200910 Stella W. Pang IEEEAVSESC 2011 20 7 DNA MEMS 1648 www.cityu.edu.hk Michael I. Kotlikoff - #12;Paul Kim-Ho Chu APSAVSIEEEHKIE 3 500 1712 650104 1400 100Es

  5. With sponsorship and support fromWith sponsorship and support fromWith sponsorship and support from Science/AAAS

    E-print Network

    Napp, Nils

    SFDA HPV 10 www.bio-cancer.org BCT2001 Paul Ning-Man Cheng BCTPolyU BCT-100 BCT BCT-100 Way Kuo21 1649 2009 10 Stella W. Pang IEEEAVSESC 2011 20 7 DNA MEMS 1648 www.cityu.edu.hk Michael I. Kotlikoff - #12;Paul Kim-Ho Chu APSAVSIEEEHKIE 3 500 1712 650104 1400 100

  6. The reduction effects of mangrove forest on a tsunami based on field surveys at Pakarang Cape, Thailand and numerical analysis

    Microsoft Academic Search

    Hideaki Yanagisawa; Shunichi Koshimura; Kazuhisa Goto; Toyohiko Miyagi; Fumihiko Imamura; Anat Ruangrassamee; Charlchai Tanavud

    2009-01-01

    Using an integrated approach including satellite imagery analysis, field measurements, and numerical modeling, we investigated the damage to mangroves caused by the 2004 Indian Ocean tsunami at Pakarang Cape in Pang Nga Province, Thailand. Comparing pre- and post-tsunami satellite imagery of the study area, we found that approximately 70% of the mangrove forest was destroyed by the tsunami. Based on

  7. Origins and Early Development of the Nonlinear Endogenous Mathematical Theory of the Business Cycle: Part I - The Setting

    Microsoft Academic Search

    V. Ragupathy; K. Vela Velupillai

    2011-01-01

    We study the emergence of the nonlinear, endogenous, theory of the business cycle, in mathematical modes, within the framework of a macroeconomic theory, which was itself going through its own formal 'birth pangs' at the same time, in the same years. The first part of the story begins in 1928 and ends, with the publication of Yasui's classic on Kaldor,

  8. Origins and Early Development of the Nonlinear Endogenous Mathematical Theory of the Business Cycle

    Microsoft Academic Search

    2012-01-01

    We study the origins of the nonlinear, endogenous, theory of the business cycle, in mathematical modes, within the framework of a macroeconomic theory, which was itself going through its own formal «birth pangs» at the same time, in the same years. The first part of the story begins in 1928 and ends, with the publication of Yasui’s classic on Kaldor,

  9. 77 FR 8736 - Pasteuria nishizawae

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-15

    ...action, and future prospects. FEMS Microbiology Ecology 61:197-213. 5. Noel GR...Journal of Systematic and Evolutionary Microbiology 55:1681-1685. 9. Sayre RM, Wergin...Heterodera and Globodera. Research in Microbiology 14:551-564. 10. Pang L,...

  10. Hindawi Publishing Corporation EURASIP Journal on Advances in Signal Processing

    E-print Network

    Kingsbury, Nick

    -Tree Wavelet Polar Matching and Rao-Blackwellised Particle Filter Sze Kim Pang, James D. B. Nelson, Simon J-Blackwellised Particle Filter (RBPF) for the sequential inference. Computer simulations demonstrate the ability of the position and velocity of the vehicle in grid coordinates, and to be robust against temporary occlusions

  11. VOLUME 77, NUMBER 8 P H Y S I C A L R E V I E W L E T T E R S 19 AUGUST 1996 Two-Channel Kondo Lattice: An Incoherent Metal

    E-print Network

    Jarrell, Mark

    Lattice: An Incoherent Metal Mark Jarrell,1 Hanbin Pang,1 D. L. Cox,2,3 and K. H. Luk4 1 Department is finite. We label our model system in this phase an "incoherent metal." We discuss the relevance of our results for concentrated heavy fermion metals with non-Fermi-liquid behavior. [S0031-9007(96)00886-1] PACS

  12. Horton overland flow contribution to runoff on unpaved mountain roads: A case study in northern Thailand

    Microsoft Academic Search

    Alan D. Ziegler; Thomas W. Giambelluca; Ross A. Sutherland; Thomas T. Vana; Mike A. Nullet

    2001-01-01

    Two indirect methods are used to detect evidence of intercepted subsurface flow (ISSF) by the road prism in the Pang Khum Experimental Watershed (PKEW) in northern Thailand. During the 12-month study period we failed to observe a soil moisture change that corresponds with ISSF being generated by the water table rising above the road surface. In support of the soil

  13. Wifi-Reports: Improving Wireless Network Selection with Collaboration

    E-print Network

    Fisher, Kathleen

    Wifi-Reports: Improving Wireless Network Selection with Collaboration Jeffrey Pang Carnegie Mellon.mccoy@colorado.edu Srinivasan Seshan Carnegie Mellon University srini@cmu.edu ABSTRACT Wi-Fi clients can obtain much better access. To address this problem, this paper presents Wifi-Reports, a collaborative service that provides

  14. Can Boltzmann Soliton Star Exist?

    NASA Astrophysics Data System (ADS)

    Su, Rukeng; Chen, Xuelei; Pan, Rongshi

    1992-12-01

    The fermion soliton stars suggested by Lee and Pang are extended to finite temperature. The degeneracy temperature TD above which the fermion soliton star will become a Boltzmann soliton star is given. We prove that the Boltzmann soliton star cannot exist, because it is unstable.

  15. Physical properties of a soliton black hole at finite temperature

    NASA Astrophysics Data System (ADS)

    Pan, Rong-Shi; Su, Ru-Keng

    1992-03-01

    It is shown that the nontopological scalar black hole suggested by Friedberg, Lee, and Pang is dynamically stable at finite temperature. The heat capacity of a scalar soliton black hole is positive. The physical properties of a scalar black hole at finite temperature are discussed.

  16. On QPCCs, QCQPs and Completely Positive Programs

    E-print Network

    2014-10-17

    Jong-Shi Pang. Department of Industrial and Systems Engineering, University of Southern California, Los ... With increasingly many documented applications in diverse engineering fields, the MPCC ...... based on the programs' KKT conditions that are lifted along with the feasible region of the ..... Naval Research. Logistics ...

  17. Michael Steinbach Department of Computer Science and Engineering telephone: 612-626-7503

    E-print Network

    Minnesota, University of

    Michael Steinbach Department of Computer Science and Engineering telephone: 612-626-7503 University, and Michael Steinbach, Computational Approaches for Protein Function Prediction, to be published in the Wiley Book Series on Bioinformatics, Fall 2007. 2. Pang-Ning Tan, Michael Steinbach, and Vipin Kumar

  18. Jointly present a singular event: for one day, leaders of developed and developing economies will convene

    E-print Network

    O'Mahony, Donal E.

    how do States, investors and ngos bring about a change in the culture of justice? n What are keys | 11:00 ­ 17:30 | Dublin, irelanD RECEPTION SPONSOR Trinity College Dublin School of Law COOPERaHon.Mrs.JusticeDenham,Chief Justice of Ireland Panelists: KinKeongPang,Permanent Secretary, Ministry of Law, Singapore Jernej

  19. Measuring Anonymity with Relative Entropy Yuxin Deng1

    E-print Network

    Deng, Yuxin

    Measuring Anonymity with Relative Entropy Yuxin Deng1 , Jun Pang2 , Peng Wu3 1 The University@lix.polytechnique.fr Abstract. Anonymity is the property of maintaining secret the iden- tity of users performing a certain action. Anonymity protocols often use random mechanisms which can be described probabilistically

  20. (This is a sample cover image for this issue. The actual cover is not yet available at this time.) This article appeared in a journal published by Elsevier. The attached

    E-print Network

    addressed and the possibilities for using control system communication protocols to link real-time to integrate simulation using ESP-r within real-time EMCS operation to enhance control capabilities. However A framework for simulation-based real-time whole building performance assessment Xiufeng Pang*, Michael Wetter

  1. Improving Building Performance at Urban Scale with a Framework for

    E-print Network

    LBNL-6303E Improving Building Performance at Urban Scale with a Framework for Real-time Data Performance at Urban Scale with a Framework for Real-time Data Sharing Xiufeng Pang, Tianzhen Hong*, Mary Ann operation, urban scale. Abstract This paper describes work in progress toward an urban- scale system aiming

  2. Process Analysis of Non-Graded Rural Schools in Sweden. Outline of an Evaluation Project.

    ERIC Educational Resources Information Center

    Andrae, Annika; Dahllof, Urban

    The Process Analysis of Non-Grading (PANG) project evaluates the planned experiments with non-graded upper grades in communities with few pupils in Sweden. The main objectives is an analysis of the possibilities and difficulties that will appear through the new frame situation concerning realization of achievement goals and social goals. Six…

  3. Java Therapy: Web-Based Robotic Rehabilitation

    E-print Network

    Reinkensmeyer, David J.

    Java Therapy: Web-Based Robotic Rehabilitation David J. Reinkensmeyer, Clifton T. Pang, Jeff A performance, allowing users and their caregivers to assess rehabilitation progress via the Web. 1 are developing robotic devices, termed "rehabilitators", that physically interact with people to stimulate

  4. Research on Data Structures of Wireless Data Acquisition Instrument for Amusement Ride

    Microsoft Academic Search

    Jianping Ye; Linxiang Shi; Chenxi Guan; Yuan Xiao

    2009-01-01

    Based on ARM9 RSIC CPU AT91SAM9260 and WinCE, the wireless data acquisition instrument for amusement ride was designed and developed. According to Ping-Pang mechanism, two buffers are created to save real-time sampling data in turns and the full buffer is saved to SD card between sampling timeslot. When data acquisition instrument begins to sample, the sampling start time is saved

  5. Suction recirculation and its effects upon axial-flow pump power consumption 

    E-print Network

    Prince, Tony M.

    1983-01-01

    UNIVERSITY OF BEIRUT; Chairman of Advisory Committee: Dr. William Pang Experiments have been performed to investigate the effects of inlet area reduction on the onset of backflow and on the associated power consumption in axial-flow pumps.... The experiments were conducted for two different pump speeds and five different inlet areas for flowrates ranging from fully open to shutoff. Pump power consumption, head and overall efficiency were determined for different flowrates. Variation of power...

  6. Set # Name Size (Towne) Forward Reverse Probe Author Date Citation 1 TRL11, IRL11 ? ? ? ? ? ? ? ? GTACACGCACGCTGGTTACC GTAGAAAGCCTCGACATCGC Markoulatos 2001 JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2001, p. 44264432

    E-print Network

    ATAGGAGGCGCCACGTATTC Bai 1997 Clinical Chemistry 43:10 p1843-1849 15 gB-A T A P O R I M B Bai 1997 Bai 1997) 335-342 UL55&56 / gB 14 gB-B A P 320 TACCCCTATCGCGTGTGTTC CCTCCTATAACGCGGCTGTA Bai 1997 Clinical Chemistry 43:10 p1843-1849 14 TACCCCTATCGCGTGTGTTC CCTCCTATAACGCGGCTGTA Pang 2003 JOURNAL OF CLINICAL

  7. Case Study of Continuous Commissioning in an Office Building

    E-print Network

    Pang, X.; Zheng, B.; Liu, M.

    2006-01-01

    ICEBO2006, Shenzhen, China Building Commissioning for Energy Efficiency and Comfort, Vol.VI-9-3 Case Study of Continuous Commissioning? in an Office Building Xiufeng Pang Bin Zheng Mingsheng Liu Graduate Student Graduate... Student Professor of Architectural Engineering, PhD, PE Energy Systems Laboratory, University of Nebraska-Lincoln 1110 So. 67th St, Omaha, NE 68182 Abstract? The case study building is a two-story office facility with total floor area of 31000...

  8. VAV System Optimization through Continuous Commissioning in an Office Building 

    E-print Network

    Cho, Y.; Pang, X.; Liu, M.

    2007-01-01

    building. ICEBO, Pittsburgh, PA. Figure 21. Post-CC hot water supply temperature and outside air temperature (January 7~10, 2007) 3. Zheng B, Liu M, and Xiufeng Pang, 2005. Continuous Commissioning ® of an Office Building. ICEBO, Pittsburgh, PA.... Energy savings 4. Cui Y, and Mingsheng Liu, 2005. Continuous Commissioning ® in an Aged Office Building. ICEBO, Pittsburgh, PA. After implementation of optimal CC ® control schedules in this building, the energy requirements are reduced...

  9. Case Study of Continuous Commissioning in an Office Building 

    E-print Network

    Pang, X.; Zheng, B.; Liu, M.

    2006-01-01

    Commissioning? Guidebook: Maximize Building Energy Efficiency and Comfort. [2] Dong D, and Mingsheng Liu, 2005. Continuous Commissioning? of a single fan dual duct system in an office building. ICEBO, Pittsburgh, PA. [3] Zheng B, Liu M, and Xiufeng... Pang, 2005. Continuous Commissioning? of an Office Building. ICEBO, Pittsburgh, PA. [4] Cui Y, and Mingsheng Liu, 2005. Continuous Commissioning? in an Aged Office Building. ICEBO, Pittsburgh, PA. [5] Yuill DP, Redmann NK and M Liu, 2003...

  10. VAV System Optimization through Continuous Commissioning in an Office Building

    E-print Network

    Cho, Y.; Pang, X.; Liu, M.

    2007-01-01

    VAV System Optimization through Continuous Commissioning ® in an Office Building YoungHum Cho Xiufeng Pang Mingsheng Liu Graduate Student Graduate Student Professor of Architectural Engineering, PhD, PE Energy Systems Laboratory.... References 1. Liu M, Claridge D, and D Turner, 2002. Continuous Commissioning ® Guidebook: Maximize Building Energy Efficiency and Comfort. 2. Dong D, and Mingsheng Liu, 2005. Continuous Commissioning ® of a single fan dual duct system in an office...

  11. Gordon Gay Group 

    E-print Network

    Unknown

    2011-08-17

    system (Gay & Howard, 2000). This array of cultural and linguistic diversity can be overwhelming to teachers, particularly those who have not had meaningful interactions with people different from themselves and for those who have not had... diverse learners (Milner, 2005; Ukpokodu, 2004). Unfamiliar groups, cultures, traditions and languages can produce anxiety and prejudicial behaviors to those who do not understand them or to those that perceive them as a threat (Gay, 2003). Pang...

  12. Soliton stars at finite temperature

    NASA Astrophysics Data System (ADS)

    Cottingham, W. N.; Vinh Mau, R.

    1991-05-01

    We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature Tc ~ 100-200 MeV, a first order phase transition occurs leading to the formation of soliton stars with some characteristics similar to those considered by Lee and Pang but with much smaller mass and size. When they cool to their cold configuration their mass ~ 10-6 Msolar.

  13. Soliton stars at finite temperature

    Microsoft Academic Search

    W. N. Cottingham; R. Vinh Mau

    1991-01-01

    We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature Tc ~ 100-200 MeV, a first order phase transition occurs leading to the formation of soliton stars with some characteristics similar to those considered by Lee and Pang but with much smaller

  14. Soliton stars at finite temperature

    Microsoft Academic Search

    W. N. Cottingham; R. Vinh Mau

    1991-01-01

    We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature {ital T}{sub {ital c}}{similar to}100--200 MeV, a first-order phase transition occurs leading to the formation of soliton stars with characteristics similar to those considered by Lee and Pang but with a much

  15. Soliton stars at finite temperature

    Microsoft Academic Search

    W. N. Cottingham; R. Vinh Mau

    1991-01-01

    We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature Tc~100-200 MeV, a first-order phase transition occurs leading to the formation of soliton stars with characteristics similar to those considered by Lee and Pang but with a much smaller mass and size.

  16. Oecologia (2004) 140: 577585 DOI 10.1007/s00442-004-1620-5

    E-print Network

    Rosenheim, Jay A.

    2004-01-01

    . David D. Limburg . Ramana G. Colfer . Valerie Fournier . Cynthia L. Hsu . Teresa E. Leonardo . Erik H trophic level, suppressing herbi- J. A. Rosenheim (*) . D. D. Limburg . R. G. Colfer . V. Fournier . C. L Farms, P.O. Box 2357 Salinas, CA, 93902, USA Present address: V. Fournier USDA ARS Western Cotton

  17. The Future Energy and GHG Emissions Impact of Alternative Personal

    E-print Network

    The Future Energy and GHG Emissions Impact of Alternative Personal Transportation Pathways in China://globalchange.mit.edu/ Printed on recycled paper #12;The Future Energy and GHG Emissions Impact of Alternative Personal Paul N. Kishimoto, Sergey Paltsev and Valerie J. Karplus Report No. 231 September 2012 China Energy

  18. Cell Growth and Size Homeostasis in Proliferating Animal Cells

    E-print Network

    Lahav, Galit

    Cell Growth and Size Homeostasis in Proliferating Animal Cells Amit Tzur,1 * Ran Kafri,1 * Valerie there is an intrinsic mechanism for coordinating growth and the cell cycle in metazoan cells. We examined cell size distributions in populations of lymphoblasts and applied a mathematical analysis to calculate how growth rates

  19. Conversation Currents: Create Partnerships, Not Programs

    ERIC Educational Resources Information Center

    Allen, JoBeth; Kinloch, Valerie

    2013-01-01

    This "Conversation Currents" features JoBeth Allen and Valerie Kinloch discussing their thoughts and experiences working with families and communities. Allen bases her comments on the belief that programs have to be adaptable to many different constituencies and demographics, and so must be recreated every year with every teacher and…

  20. Associate ProfessorThe Department of African American and African Diaspora Studies (AAADS) and the Department of History at Indiana University seek to hire a scholar of

    E-print Network

    Indiana University

    ) and the Department of History at Indiana University seek to hire a scholar of twentieth-century African American Grim at vgrim@indiana.edu or by mail to Dr. Valerie Grim, Chair, Department of African American and African Diaspora Studies, Indiana Univer- sity, Memorial Hall East-Room M29, Bloomington, IN 47405

  1. Sponsored by The Center for Research in Mathematics and Science Education and the San Diego County Office of Education

    E-print Network

    Ponce, V. Miguel

    Sponsored by The Center for Research in Mathematics and Science Education and the San Diego County Office of Education Joseph S. Krajcik and Valerie Otero Supporting Science Teachers in Utilizing Model Free parking is adjacent to the building Joseph S. Krajcik, Professor, Science Education, Associate

  2. Conceptualising Hy-Bivalent Subjectivities to Facilitate an Examination of Australian Government Mutual Obligations Policies

    ERIC Educational Resources Information Center

    Edwards, Jan

    2006-01-01

    This paper illustrates how the work of feminist theorists Valerie Walkerdine, Helen Lucey and June Melody, Beverly Skeggs, and Nancy Fraser were used together to examine the lived effects of Australian government Mutual Obligations policies. As "active" welfare policies, Mutual Obligations construct particular relations between themselves and…

  3. Tools for Schools. Volume 12, Number 4, May-June 2009

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    This newsletter is published four times a year. It offers articles on school improvement, organizational planning, training, and managing change. This issue contains: (1) Link Up & Learn: Use Technology to Create a Personal Learning Network to Connect with Experts and Mentors Everywhere (Valerie von Frank); (2) NSDC Tool: Get Connected with…

  4. Tools for Schools. Volume 13, Number 1, August-September 2009

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    This newsletter is published four times a year. It offers articles on school improvement, organizational planning, training, and managing change. This issue contains: (1) Leadership Teams Create Lasting Change (Valerie von Frank); (2) NSDC Tool: Force-Field Analysis; (3) NSDC Tool: Identify Your Internal and External Foci; (4) NSDC Tool: Assess…

  5. Marginal formations of the last Kara and Barents ice sheets in northern European Russia

    E-print Network

    Ingólfsson, Ólafur

    Marginal formations of the last Kara and Barents ice sheets in northern European Russia VALERY I): Marginal formations of the last Kara and Barents ice sheets in northern European Russia. Boreas, Vol. 28, pp. 23­45. Oslo. ISSN 0300-9483. Glacial landforms in northern Russia, from the Timan Ridge

  6. Empire, Religious Freedom, and the Legal Regulation of "Mixed" Marriages in Russia*

    E-print Network

    Ahmad, Sajjad

    Empire, Religious Freedom, and the Legal Regulation of "Mixed" Marriages in Russia* Paul W. Werth. Petersburg, Russia); LVIA Lietuvos Valstybes Istorijos Archyvas (Vilnius, Lithuania). 1 Highlighting only, Converging Worlds: Religion and Community in Peasant Russia, 1861­1917 (DeKalb, IL, 2003); Valerie Kivelson

  7. Survey of the Mutagenicity of Surface Water, Sediments, and Drinking Water from the Penobscot Indian Nation.

    EPA Science Inventory

    Survey of the Mutagenicity of Surface Water, Sediments, andDrinking Water from the Penobscot Indian NationSarah H. Warren, Larry D. Claxton,1, Thomas J. Hughes,*, Adam Swank,Janet Diliberto, Valerie Marshall, Daniel H. Kusnierz, Robert Hillger, David M. DeMariniNational Health a...

  8. STS-91: Flight Crew Meets with Family and Friends at Launch Complex 39A

    NASA Technical Reports Server (NTRS)

    1998-01-01

    The crew (Commander Charles J. Precourt, Pilot Dominic L. Pudwill Gorie, Mission Specialists Wendy B. Lawrence, Franklin R. Chang-Diaz, Janet L. Kavandi and Valery Victorovitch Ryumin) take time from their busy schedule to chat with friends and family, at a distance. They also pose for group and single pictures.

  9. LETTER OPEN doi:10.1038/nature13424

    E-print Network

    Kasper25 , Masaomi Kato26 , Thomas C. Kaufman17 , Robert R. Kitchen1,2 , Erik Ladewig27 , Julien LagardeWhirter29 , Gennifer Merrihew9 , David M. Miller29 , Ali Mortazavi30,31 , Rabi Murad30,31 , Brian Oliver32,14 , Valerie Reinke25 , Alexandre Reymond22 , Garrett Robinson7 , Anastasia Samsonova33,34 , Gary I. Saunders21

  10. Comments on episodic superposition of memory States.

    PubMed

    Lambert-Mogiliansky, Ariane

    2014-01-01

    This article develops a commentary to Charles Brainerd, Zheng Wang and Valerie F. Reyna's article entitled "Superposition of episodic memories: Overdistribution and quantum models" published in a special number of topiCS 2013 devoted to quantum modelling in cognitive sciences. PMID:24259305

  11. International Conference on Computer Systems and Technologies -CompSysTech'10 Integration of Neural Networks and Expert Systems for Time Series

    E-print Network

    Mustakerov, Ivan

    of Neural Networks and Expert Systems for Time Series Prediction Ventsislav Nikolov, Valeri Bogdanov and its integration with an existing CLIPS related system is presented .A backpropagation neural network expertize requirements and allowing for complete automation. Key words: Neural Network, Expert System, Rule

  12. A Methodology for Using Assistive Sketch Recognition For Improving a Person’s Ability to Draw

    E-print Network

    Dixon, Daniel M.

    2010-07-14

    , Valerie Taylor December 2009 Major Subject: Computer Science iii ABSTRACT A Methodology Using Assistive Sketch Recognition for Improving a Person?s Ability to Draw. (December 2009) Daniel Meyer Dixon, B.S., Texas A&M University Chair... Page ABSTRACT......................................................................................................................iii? DEDICATION...

  13. El Sueno Americano, Es Para Todos: An Analysis of the Rhetoric toward Latinos in the Presidential Campaigns of Bill Clinton and George W. Bush, 1992-2000

    E-print Network

    Campos, Kristina M.

    2010-01-14

    OF PHILOSOPHY Approved by: Chair of Commite, Leroy G. Dorsey Commite Members, James Arnt Aune Valerie Balester Kurt Riter Head of Department, Richard L. Stret August 2009 Major Subject: Communication iii ABSTRACT El Sue?o Americano... ABSTRACT.......................................................................................................... iii DEDICATION....................................................................................................... v ACKNOWLEDGEMENTS...

  14. 9 September 2013 Award-Winning Children's Literature @ Your Education Library!

    E-print Network

    Abolmaesumi, Purang

    is for Zamboni. Sleeping Bear, 2002. Juv GV847.25N36 2002 2002 Coulman, Valerie. Illus. by Rogé Girard. When PigsNicoll, Sylvia. Bringing Up Beauty. Maxwell Macmillan, 1994. Juv PS8575.N57B75 1994 1995 McGaw, Laurie. Polar

  15. Theme: Data Collection, Management, Access and Visualisation Subtheme: Internet and Access to Data

    E-print Network

    Dwyer, Ned

    1 Theme: Data Collection, Management, Access and Visualisation Subtheme: Internet and Access IN IRELAND Ned Dwyer, Liz O'Dea, Valerie Cummins Coastal and Marine Resources Centre, ERI, University College will be easily accessible via an Internet browser, therefore enabling experts and general users to identify

  16. Replication of Association between ADAM33 Polymorphisms and Psoriasis

    E-print Network

    Paris-Sud XI, Université de

    Replication of Association between ADAM33 Polymorphisms and Psoriasis Vale´rie Siroux1, the first gene identified in asthma by positional cloning, have been recently associated with psoriasis the opportunity to attempt to replicate the association between ADAM33 and psoriasis in 2002 individuals

  17. Proposals Submitted FY13 Awards Received, FY13 Expenditures FY13 College/Center No.

    E-print Network

    Alabama in Huntsville, University of

    Sponsor Maximum Amount* James Miller ISED ALSDoEd $2,700,000 Phillip Farrington ISE NASA/MSFC $654,750 Rahul Ramachandran ITSC NASA/SSC $531,158 John Gregory SGC NASA/GSFC $375,000 Valerie Connaughton CSPAR Consortium: Development of a Novel Telescope for Very High-Energy Gamma-Ray Astrophysics Development

  18. Opportunities for Smart & Tailored Activity Coaching Harm op den Akker

    E-print Network

    Twente, Universiteit

    and Development Telemedicine group h.opdenakker@rrd.nl Randy Klaassen University of Twente Human Media Interaction.j.a.opdenakker@utwente.nl Valerie M. Jones University of Twente Telemedicine group v.m.jones@utwente.nl Hermie J. Hermens Roessingh Research and Development Telemedicine group h.hermens@rrd.nl Abstract This short paper describes how

  19. LCO2000 volution du roman Hiver 2015 Professeur : Barbara Agnese

    E-print Network

    Parrott, Lael

    indépendante, 1887) Paris, Garnier Flammarion 2001. - James JOYCE, Ulysses (1922). Ulysse. Trad. fr, de S connu de « flux de conscience » est le monologue de Molly Bloom dans l'Ulysse, Joyce comme Schnitzler, Joyce, Svevo, Woolf, Valery Larbaud, Faulkner, etc. Le syllabus sera distribué lors de la première

  20. Electronic Communication: Themes from a Case Study of the Deaf Community

    E-print Network

    Grinter, Rebecca Elizabeth

    the space of electronic communication (e.g. instant messaging, short message service, email) by DeafElectronic Communication: Themes from a Case Study of the Deaf Community Valerie Henderson-Summet1 teenagers in the greater Atlanta metro area. We discuss differences and similarities between deaf

  1. Cost Center Department Mail Alt Dept Records Analyst UC Assoc Dir UC Dept Mgr H 1009312 UCPath Expense Reimbursement 929312 Almeida,Evelyn S Lippuner,Elisabeth A Lippuner,Elisabeth A

    E-print Network

    Leistikow, Bruce N.

    1009730 PM&R - Physical Therapy 929730 Almeida,Evelyn S Condrin,Michael P Adame,Valerie Renee H 1009731 PM H 1009392 Enzyme Replacement Therapy 939392 Almeida,Evelyn S Condrin,Michael P Werner,Marlene M H Almeida,Evelyn S Robinson,Carol A Sundberg,Diana C H 1009666 PM&R - Hand Therapy 929666 Almeida

  2. Arch. Rational Mech. Anal. 162 (2002) 137177 Digital Object Identifier (DOI) 10.1007/s002050200194

    E-print Network

    Theil, Florian

    2002-01-01

    transformations in shape-memory alloys. The model uses the deformation and phase-indicator function as basic- formations (PT) in certain elastic materials, like martensitic PT in shape-memory alloys. In fact Theil & Valery I. Levitas Elastic materials which allow for PT (like single or poly-crystalline shape

  3. What Was Life? Answers from Three Limit Biologies Author(s): Stefan Helmreich

    E-print Network

    Polz, Martin

    revision for "Extreme: Histories and Economies of Humanness Inside Outerspaces," at the American: The Global Politics of Reproduction, ed. Faye D. Ginsburg and Rayna Rapp (Berkeley, 1995); Valerie Hartouni-1896/11/3704-0006$10.00. All rights reserved. 671 #12;diversity, bioprospecting, biosecurity, biotransfer, and molecularized

  4. Teaching Assistants Department of Chemistry

    E-print Network

    He, Chuan

    student. Dr. Vera Dragisich Dr. Valerie Keller Dr. Meishan Zhao Department Executive Officer Organic ChemGuide for Teaching Assistants Department of Chemistry The University of Chicago #12;© 2012 Department of Chemistry, The University of Chicago (2nd edition) #12;i Preface Welcome to the Chemistry

  5. Advanced Review Greenland climate change: from

    E-print Network

    Bhatt, Uma

    Advanced Review Greenland climate change: from the past to the future Val´erie Masson-Delmotte,1 cores in and around Greenland allow us to place the current trends in regional climate, ice sheet lake sediments in southern Greenland document major environmental and climatic conditions during

  6. A Human Performance Modeling System for Process Safety Operations

    E-print Network

    Harputlu, Emrah 1986-

    2013-01-02

    , I would like to thank Valerie Green for her continuous help and patience with me and to Donna Startz and Tricia Hasan for their help. I would also like to thank Clementina Ramirez Marengo for her precious help and being next to me throughout my...

  7. Teachers Teaching Teachers (T3)[TM]. Volume 4, Number 7

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    "Teachers Teaching Teachers" ("T3") focuses on coaches' roles in the professional development of teachers. Each issue also explores the challenges and rewards that teacher leaders encounter. This issue includes: (1) Learning Cycle Spins Individuals into a Team (Valerie von Frank); (2) NSDC Tool: The Professional Teaching and Learning Cycle; (3)…

  8. Forum on the Future of Academic Medicine: Final Session--Implications of the Information Revolution for Academic Medicine.

    ERIC Educational Resources Information Center

    Iglehart, John

    2000-01-01

    Summarizes two speeches. William W. Stead offers three scenarios illustrating typical future interactions of consumers with a medical system based on informatics and information technology and then considers implications for academic medicine. Valerie Florance discusses a program that is exploring ways medical schools and teaching hospitals can…

  9. Statistics Glossary: Design of Experiments & ANOVA

    NSDL National Science Digital Library

    Eastor, Valerie

    This site, created by authors Valerie Eastor and John H. McColl, lists definitions of key terms related to experimental design and ANOVA. Some of these include factorial, blocking, interaction, experimental design, treatment, variance testing, placebo, and many others. This site is part of the "Statistics Glossary" for the STEPS project (Statistical Education through Problem Solving).

  10. Crossing Boundaries: Collaborative Solutions to Urban Problems. Selected Proceedings of the National Conference on Urban Issues (1st, Buffalo, New York, November 11-13, 1994).

    ERIC Educational Resources Information Center

    Koritz, Douglas, Ed.; And Others

    Selected papers are presented from a national conference on urban issues. They are: (1) "Collaboration as a Social Process: Inter-Institutional Cooperation and Educational Change" (Charles F. Underwood and Hardy T. Frye); (2) "Mobilizing the Village To Educate the Child" (Valerie Maholmes); (3) "Pathways to Teaching: An Urban Teacher Licensure…

  11. ECOLOGY AND BEHAVIOR Population Dynamics and Within-Plant Distribution of the Mite

    E-print Network

    Rosenheim, Jay A.

    flagelliseta (Acari: Eriophyidae) on Papaya in Hawaii VALERIE FOURNIER,1, 2, 3, 4 , JAY A. ROSENHEIM,1 JACQUES & Barbosa on papaya, Papaya carica L. (Caricaceae), in Hawaii to quantify 1) patterns of seasonal abundance, 2) its distribution across different vertical strata of the papaya canopy, and 3) shifts in its use

  12. Oct. 26Nov. 1, 2011 wayne.edu/today

    E-print Network

    Baskaran, Mark

    establishing universal cervical- length screening, the use of progesterone gel to prevent preterm birth, as demonstrated through ultrasound screening, cut the rate of preterm birth by as much as 45 percent. Dean Valerie: Seeing my children grow into happy, confident, kind people. Personal goal: To get my Ph.D. before my

  13. Dendrochronologia 28 (2010) 161171 ORIGINAL ARTICLE

    E-print Network

    Esper, Jan

    2010-01-01

    spiciformis from the miombo woodland in south central Africa Vale´rie Troueta,Ã, Jan Esperb,c , Hans Beeckmand, Royal Museum for Central Africa, B-3080 Tervuren, Belgium Received 21 April 2009; accepted 1 October the seasonally dry miombo woodland in south central Africa. Between 9 and 34 stem discs were collected from three

  14. Effects of Changes in Arctic Lake and River Ice Terry Prowse, Knut Alfredsen, Spyros Beltaos, Barrie R. Bonsal,

    E-print Network

    Vincent, Warwick F.

    critical climate thresholds for lake ecosystems are those affecting the area and volume of standing waterEffects of Changes in Arctic Lake and River Ice Terry Prowse, Knut Alfredsen, Spyros Beltaos, Valery Vuglinsky, Katey M. Walter Anthony, Gesa A. Weyhenmeyer Abstract Climatic changes to freshwater

  15. Reyt et al.: Dynamic causal modelling and physiological confounds: A functional MRI study of vagus nerve stimulation Dynamic causal modelling and physiological confounds: A

    E-print Network

    Paris-Sud XI, Université de

    of vagus nerve stimulation SEBASTIEN REYT 1,4,+ , CHLOE PICQ 2,3,4,+ , VALERIE SINNIGER 2 , DIDIER@ujf-grenoble.fr Running Title: DCM of Vagus Nerve Stimulation in fMRI Revision NIMG-10-406 April 2010 inserm-00498678 study of vagus nerve stimulation 2 Abstract Dynamic Causal Modelling (DCM) has been proposed to estimate

  16. BOISE STATE UNIVERSITY Summer 2014

    E-print Network

    Barrash, Warren

    Home High School. The program offers Disciplinary Lens Courses CLASS INFORMATION All classes-free (800) 824-7017, ext. 5. ADVISING Contact Valerie Marsh, Mountain Home Program Coordinator, at (208) 828 information and to download the Background Check Form, please go to boisestate

  17. Fine-scale mapping of the 5q11.2 breast cancer locus reveals at least three independent risk variants regulating MAP3K1

    E-print Network

    Glubb, Dylan M.; Maranian, Mel J.; Michailidou, Kyriaki; Pooley, Karen A.; Meyer, Kerstin B.; Kar, Siddhartha; Carlebur, Saskia; O'Reilly, Martin; Betts, Joshua A.; Hillman, Kristine M.; Kaufmann, Susanne; Beesley, Jonathan; Canisius, Sander; Hopper, John L.; Southey, Melissa C.; Tsimiklis, Helen; Apicella, Carmel; Schmidt, Marjanka K.; Broeks, Annegien; Hogervorst, Frans B.; van der Schoot, C. Ellen; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A.; Peterlongo, Paolo; Barile, Monica; Capra, Fabio; Couch, Fergus J.; Olson, Janet E.; Hallberg, Emily; Vachon, Celine; Giles, Graham G.; Milne, Roger L.; McLean, Catriona; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; See, Mee-Hoong; Cornes, Belinda; Cheng, Ching-Yu; Ikram, M. Kamran; Kristensen, Vessela; Norwegian Breast Cancer Study; Zheng, Wei; Halverson, Sandra L.; Shrubsole, Martha; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Tchatchou, Sandrine; Devilee, Peter; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Van Asperen, Christi J.; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J.; Lissowska, Jolanta; Czene, Kamila; Klevebring, Daniel; Darabi, Hatef; Eriksson, Mikael; Hooning, Maartje J.; Hollestelle, Antoinette; Martens, John W.M.; Collée, J. Margriet; Hall, Per; Li, Jingmei; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Cross, Simon S.; Reed, Malcolm W.R.; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Shah, Mitul; Ghoussaini, Maya; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K.; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Tang, Anthony; Hamann, Ute; Torres, Diana; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Olswold, Curtis; Slager, Susan; Toland, Amanda E.; Yannoukakos, Drakoulis; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Hou, Ming-Feng; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Pita, Guillermo

    2014-01-08

    , 135 Valerie Gabo rie a u, 136 Paul Brenn a n, 136 Jame s McKa y, 136 Curtis Olswo ld, 76 Susa n Slage r, 76 Aman da E. Tolan d , 137 Drako u lis Yan no u ka ko s, 138 Chen - Ya n g She n , 139 - 141 Pei - E i W u, 139, 141 Jyh - Che rng Yu...

  18. JANUARY/FEBRUARY 2005, VOL. 81, No. 1 --THE FORESTRY CHRONICLE 133 Tree crown ratio models for multi-species and multi-layered

    E-print Network

    British Columbia, University of

    JANUARY/FEBRUARY 2005, VOL. 81, No. 1 -- THE FORESTRY CHRONICLE 133 Tree crown ratio models, Valerie LeMay2 and Stephen J. Mitchell3 ABSTRACT The ratio of live crown length to tree height (crown dense stands and for very tall trees where the base of live crown is obscured. Models to predict CR from

  19. VOLUMETRIC PARTICLE MODELING A Dissertation

    E-print Network

    Keyser, John

    VOLUMETRIC PARTICLE MODELING A Dissertation by BRENT MICHAEL DINGLE Submitted to the Office of DOCTOR OF PHILOSOPHY May 2007 Major Subject: Computer Science #12;VOLUMETRIC PARTICLE MODELING, Valerie Taylor May 2007 Major Subject: Computer Science #12;iii ABSTRACT Volumetric Particle Modeling

  20. California Energy Commission STATE ENERGY PROGRAM

    E-print Network

    Rillera, Clean Energy Business Financing Program Valerie T. Hall Deputy Director Energy EfficiencyCalifornia Energy Commission STATE ENERGY PROGRAM GUIDELINES SECOND EDITION ADOPTED BY THE CALIFORNIA ENERGY COMMISSION FEBRUARY 10, 2010 CEC-150-2009-004-CMF-REV1 American Recovery and Reinvestment

  1. California Energy Commission STATE ENERGY PROGRAM

    E-print Network

    Building Targeted Measure Program Larry Rillera, Clean Energy Business Financing Program Valerie T. HallCalifornia Energy Commission STATE ENERGY PROGRAM GUIDELINES PROPOSED THIRD EDITION SECOND EDITION PROPOSED TO ADOPTED BY THE CALIFORNIA ENERGY COMMISSION AUGUST 6, FEBRUARY 10, 2010 CEC-150-2009-004-CMF

  2. CBITG Past Trainees YEARS OF APPOINTMENT TRAINEE ADVISOR CO-ADVISOR DEPARTMENT

    E-print Network

    Thomas, David D.

    -2007 White, Brian R Wagner Truhlar MedChem 2005-2007 DeGraw, Amanda Distefano Barany Chem 2005, Gene Bobby Arriaga Thomas Chem 2002-2004 Erickson, Aimee R Taton Distefano Chem 2002-2003 Buck-Rodriguez, Veronica Distefano Arriaga Chem 2009-2011 Kramlinger, Valerie Murphy Georg BMBB 2009-2011 Wawrzyn

  3. Gary Perry, Ph.D. Interim Provost & Chief Academic O cer

    E-print Network

    Fernandez, Eduardo

    Gary Perry, Ph.D. Interim Provost & Chief Academic O cer Heather Coltman, D.M.A. Dean, Dorothy F. Schmidt College of Arts & Letters Daniel Gropper, Ph.D. Dean, College of Business Rosalyn Carter, Ph.D. Dean, College for Design & Social Inquiry Valerie Bristor, Ph.D. Dean, College of Education Mohammad

  4. Reid Rosnick/DC/USEPA/US 07/06/2010 09:15 AM

    E-print Network

    .xls" deleted by Reid Rosnick/DC/USEPA/US] Val ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Valerie Daigler U

  5. CEHS Technology Committee Strategic Plan March 1, 2012

    E-print Network

    Farritor, Shane

    and Communication Disorders Paul Erickson - Information Services Cody Hollist - Child Youth and Family Studies - Educational Psychology Valerie Crook - Design Center William Latta, Teaching - Learning, and Teacher Education. Technology promotes and supports the excellence and innovation of faculty members, students, and staff

  6. Analysis of Over 10,000 Cases Finds No Association between Previously-Reported Candidate Polymorphisms and Ovarian

    E-print Network

    Salzman, Daniel

    Polymorphisms and Ovarian Cancer Outcome Kristin L. White1, Robert A. Vierkant2, Zachary C. Fogarty2, Bridget Lester22, Weiva Sieh21, Valerie McGuire21, Joseph H. Rothstein21, Argyrios Ziogas20, Jan Lubiski19 of Public Health and Primary Care, University of Cambridge, Cambridge, UK. 7Cancer Division, Queensland

  7. The Davis Botanical Society Presents The Dean Ranch at the Sutter Buttes

    E-print Network

    Ferrara, Katherine W.

    The Davis Botanical Society Presents The Dean Ranch at the Sutter Buttes Saturday, April 6, 2013, 7:30 am to 5:30 pm Trip leaders: Marcel Rejmanek & Valerie Layne The Sutter Buttes rise abruptly from." The Dean Ranch comprises about 1200 acres near the center of the Buttes. Spring can bring spectacular

  8. Acta Orcologica 19 (I) (1998) 37-46 / 0 Elsevier, Paris Plant competition and slug herbivory: effects on the yield

    E-print Network

    Rodríguez, Miguel Ángel

    1998-01-01

    : effects on the yield and biomass allocation pattern of Poa annua L. Miguel A. Rodriguez `,2,*, Valerie K be different depending on competition from biomass allocation pattern of Poa annua L. (Gra- neighbouring plants parts of P annua showed significantly greater bio- mass in mixed than in pure stands, and in low

  9. Acoustic detection and classification of river boats Amir Averbuch a,

    E-print Network

    Averbuch, Amir

    Acoustic detection and classification of river boats Amir Averbuch a, , Valery Zheludev a , Pekka September 2010 Available online 13 October 2010 Keywords: Hydro-acoustic signature Wavelet packet Best acoustic signature against an existing database of recorded and processed acoustic signals. We characterize

  10. Deliverable D3.1 CHOReOS Middleware Specification

    E-print Network

    Paris-Sud XI, Université de

    Contractual Delivery Date : 1/10/2011 Contributing WP : WP3 Author(s) : Apostolos Zarras (UOI), Nikolaos Version Changes Author(s) 1.0 Outline Apostolos Zarras, Valerie Issarny, Nikolaos Georgantas, Fabio Kon, Hugues Vincent 1.1 First input from WP3 partners on ** sections Apostolos Zarras, Dionysis Athanasopoulos

  11. KSC-03PD-1455

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., works on an experiment found during the search for Columbia debris. Mike Casasanto, also with ITA, looks on. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  12. KSC-03PD-1450

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto is one of the scientists recovering experiments found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  13. KSC-03PD-1453

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., works on an experiment found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  14. The Learning System. Volume 4, Number 8

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    "The Learning System" is a newsletter designed for superintendents and central office staff with professional learning responsibilities. This issue includes: (1) Principal-Coaches Transform Teachers and Schools (Valerie von Frank); (2) District Leadership: Delve into NSDC's [National Staff Development Council's] New Definition of Professional…

  15. The Learning Principal[R]. Volume 5, Number 1

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    "The Learning Principal" is an eight-page newsletter published eight times a year. It focuses on the important and unique work of school principals. This issue includes: (1) Framework "for" Improvement: Effective School Leadership Translates into Increased Student Learning (Valerie von Frank); (2) Q & A: Instructional Leader Creates Culture of…

  16. Teachers Teaching Teachers (T3)[TM]. Volume 5, Number 2

    ERIC Educational Resources Information Center

    Crow, Tracy, Ed.

    2009-01-01

    "Teachers Teaching Teachers" ("T3") focuses on coaches' roles in the professional development of teachers. Each issue also explores the challenges and rewards that teacher leaders encounter. This issue includes: (1) Sharpening Skills for Our Century (Valerie von Frank); (2) Lessons from a Coach: First, I Assess How Teachers Learn (Julie…

  17. VOLUME 76, NUMBER 18 P H Y S I C A L R E V I E W L E T T E R S 29 APRIL 1996 Nonlinear Control of Dynamical Systems from Time Series

    E-print Network

    Showalter, Kenneth

    of Dynamical Systems from Time Series Valery Petrov and Kenneth Showalter* Department of Chemistry, West the stable and unstable states using a nonlinear control sur- face constructed from time series. For a one is used di- rectly to construct the control law as a multidimensional surface in the time-delayed space

  18. Nonlinear prediction, filtering, and control of chemical systems from time series

    E-print Network

    Showalter, Kenneth

    Nonlinear prediction, filtering, and control of chemical systems from time series Valery Petrov. The construction of these surfaces from time series and their use is demonstrated with a simple chemical model on the development of linearized mod- els from time series.1 Linear control techniques for low- dimensional chaotic

  19. 25 Year Medallion Dr Avery Andrews

    E-print Network

    Botea, Adi

    Professor Desmond Ball Mrs Barbara Bankovsky Dr Richard Barz Professor Peter Bellwood Professor Michael Bessell Mr Christopher Blake Mr Gabriel Bloxham Professor Philip Board Mr John Boyd Dr Valerie Braithwaite Richard Loy Professor Barry Luther- Davies Dr Margot Lyon Ms Anne MacKenzie Mr Kerry McAndrew Mr Ian Mc

  20. Spline-based frames in the space of periodic signals Amir Averbuch1

    E-print Network

    Averbuch, Amir

    #12;Implicitly, this resilience is utilized in signal/image restoration, which is based on the prior assumption that a frame expansion of a given signal/image is sparse. In principle, only part of the samplesSpline-based frames in the space of periodic signals Amir Averbuch1 Pekka Neittaanm¨aki2 Valery

  1. Distribution in a Single Address Space Operating System

    E-print Network

    Anderson, Richard

    Distribution in a Single Address Space Operating System Jeff Chase, Val'erie Issarny, and Hank Levy The recent appearance of architectures with flat 64­bit virtual addressing opens an opportunity to reconsider the way our operating systems use virtual address spaces. We are building an operating system called Opal

  2. UNIVERSIDAD AUTNOMA DE ZACATECAS "FRANCISCO GARCA SALINAS"

    E-print Network

    EN FÍSICA PRESENTA: MARÍA DE GUADALUPE CALDERA CABRAL ASESOR DR. VALERI V. DVOEGLAZOV 15 de Abril de familia, a mi papá José Germán Caldera Perales, a mi mamá María del Refugio Cabral Álvarez y a mis hermanas María Libertad Caldera Cabral y Gabriela Alejandra Caldera Cabral por siempre creer que podía

  3. Queer Theory & Race Spring 2012 Directed Reading Course

    E-print Network

    Doyle, Robert

    in Victorian America (Oxford, 1986) · Eve Sedgwick, Between Men: English Literature and Male Homosocial Desire:2 (2002): 93-115 · Eve Sedgwick, "Shame, Theatricality, and Queer Performativity" in Touching Feeling" in The Queer Art of Failure (Duke, 2011) · David Halperin and Valerie Traub, "Beyond Gay Pride" in Gay Shame

  4. The Process of Designing Task Features

    ERIC Educational Resources Information Center

    Bauer, Malcolm

    2014-01-01

    Malcolm Bauer, from Education Testing Services, provides his comments on the Focus article in this issue of "Measurement" entitled : "How Task Features Impact Evidence from Assessments Embedded in Simulations and Games" (Russell G. Almond, Yoon Jeon Kim, Gertrudes Velasquez, Valerie J. Shute). Bauer begins his remarks by noting…

  5. FREEZING WATER CLEANING A POSSIBLE IMPROVEMENT IN SRF CAVITY RINSING*

    E-print Network

    ERL 10-3 FREEZING WATER CLEANING ­ A POSSIBLE IMPROVEMENT IN SRF CAVITY RINSING* Valery Shemelin rinsing (HPR) is a necessary stage of SRF cavity preparation [1] because it provides cleaner, field the traditional HPR are at hand in any SRF lab, a simple cooling down of the cavity before rinsing can

  6. Multigrid Method for a Global Hall Conductor in the Earth's Ionosphere

    E-print Network

    Multigrid Method for a Global Hall Conductor in the Earth's Ionosphere Valeri V. Denissenko Since conductivity is an asymmetric tensor in the ionosphere the elliptical operators of the boundary value problems elements, multigrid method 1 Introduction Mathematical models of ionospherical electric field are boundary

  7. The magazine for College of Fine Arts and Communication alumni and friends Mr. Michael Curtis Aho & Mr. Joe A. Esparza

    E-print Network

    Mr. Richard W. Armstrong Dr. Charles H. Ashford, Jr. Mr. William H. Axness Mr. & Mrs. Lee F. Ball Dr Caspar Drs. William & Diane Castle Mr. & Mrs. Victor E. Chap Mr. Henry Lee Cherry, Jr. Chowan Arts. William B. Cox Drs. Carson & Valerie Cox Michael Crane Dr. & Mrs. E. G. Crawford, Jr. Dr. & Mrs. Richard W

  8. Hotel Spik, Gozd Martuljek, Slovenia 6 to 10 June 2001

    E-print Network

    Cufar, Katarina

    Meer GROWTH AND MORTALITY IN AN OLD GROWTH HIGH ELEVATION BEECH STAND Harald Bugmann, Christof Bigler Schmidt, Valerie Trouet DATING OF ROCK FALL BY SCAR ANALYSES REACTIONS OF Fagus sylvatica AND Picea abies, accompanying tower, separately standing bell tower, house of the beadle, and St Peter church

  9. KSC-03PD-1461

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto (foreground), Instrumentation Technology Associates, Inc., examines one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  10. Melanoma Education Symposium September 22, 2012 | 8 a.m.-12 p.m. | Auditorium E & F

    E-print Network

    Myers, Lawrence C.

    Melanoma Education Symposium September 22, 2012 | 8 a.m.-12 p.m. | Auditorium E & F Norris Cotton.m. Breakfast and Registration 8:30-8:40 a.m. Welcome - Keynote Valerie Guild - President, AIM at Melanoma 8:40-9:10 a.m. 2012 Melanoma Landscape Marc S. Ernstoff, MD, Director Melanoma Program, Norris Cotton Cancer

  11. The 2012 Honors Symposium Friday, February 24

    E-print Network

    Saidak, Filip

    :00-3:50 Panel II-A: Elm Room Hip-Hop, Power, and Sexuality Valerie G. Whitley, ""Fight the Power," But are we Really?" Yasmeen Chism, "Gender and Sexuality in Hip-Hop" Jazzmin Yvonne Moore, "The Upside: Turning

  12. Annual Level Donald Aoki

    E-print Network

    Wang, Hai

    Annual Level Donors Donald Aoki William F. Ballhaus Jr. Walter Barrett Solomon Benzimra Valerie Hassan Sonny Astani Doris Atteberry Walter Babchuk Dwight Baum Judith Ann Baum Dale Allen Beckstead Randy. Gisbrecht Ahmad Gramian Richard Grey Rudolf W. Gunnerman Chanresh Gupta Vinod K. Gupta Arthur Hamlin Hadley

  13. UCSF School of Dentistry Global Oral Health Symposium 2012 Program 1 John D.B. Featherstone

    E-print Network

    Yamamoto, Keith

    and endometrial cancer. Abstract: Sir Richard Doll, one of the first people to identify the link between lung Sciences 1.15 ­ 2.05 Valerie Beral, AC, DBE, FRS, MRCP Director, Cancer Epidemiology Unit, University Cigarette Smoking: The Major Preventable Risk Factor for Chronic Periodontitis 4:30 ­ 4.55 Panel Discussion

  14. A COMPARISON OF FPGA PLATFORMS THROUGH SAR/ATR ALGORITHM IMPLEMENTATION

    E-print Network

    Nelson, Brent E.

    are being developed. One such application is the ability to automatically identify objects in radar images to search for objects in Synthetic Aperture Radar (SAR) images. The algorithms require more computational to my wife Valerie for clearing the way and helping both technically and otherwise to finish this work

  15. Obituary: Ronald N. Bracewell, 1921-2007

    Microsoft Academic Search

    Vahé Petrosian

    2009-01-01

    Ronald N. Bracewell, Professor Emeritus (since 1991) of Electrical Engineering at Stanford University, and a true renaissance man of science, died of a heart attack on 12 August 2007 at his home. Ron Bracewell was born in Sydney, Australia, on 22 July 1921, one of the two sons of Cecil and Valerie Bracewell. He graduated from the University of Sydney

  16. Third Edition CEC-300-2007-004-CMF

    E-print Network

    .B. Blevins Executive Director Heather Raitt Technical Director RENEWABLE ENERGY OFFICE Mark Hutchison Office Manager RENEWABLE ENERGY OFFICE Valerie Hall Deputy Director EFFICIENCY, RENEWABLES, AND DEMAND ANALYSIS;Abstract The Consumer Education Program provides grants and contracts to promote renewable energy and help

  17. Changes in the French defence innovation system: New roles and capabilities for the Government Agency for Defence

    E-print Network

    Boyer, Edmond

    1 Changes in the French defence innovation system: New roles and capabilities for the Government@gredeg.cnrs.fr **Paris Dauphine University, IMRI, valerie@merindol.net Abstract: Defence innovation systems: the state (the client and the government agency) and the systems integrators. Technological

  18. The Learning System. Volume 4, Number 6

    ERIC Educational Resources Information Center

    von Frank, Valerie, Ed.

    2009-01-01

    Ensuring quality teaching in every classroom across an entire system of schools--that's what a district leader's job is all about. A district leader's challenges are unique so "The Learning System" was created with that in mind. This issue contains: (1) Competing Values Form Obstacles to Change: Deep Conversations Uncover Invisible Goals (Valerie

  19. CALIFORNIA ENERGY CALIFORNIA'S STATE ENERGY

    E-print Network

    CALIFORNIA ENERGY COMMISSION CALIFORNIA'S STATE ENERGY EFFICIENT APPLIANCE REBATE PROGRAM INITIAL November 2009 CEC-400-2009-026-CMD Arnold Schwarzenegger, Governor #12;#12;CALIFORNIA ENERGY COMMISSION Program Manager Paula David Supervisor Appliance and Process Energy Office Valerie T. Hall Deputy Director

  20. University Senate Diversity Committee 2007-08 Report I. Distinguished Diversity Enhancement Awards: There were 10 applicants and 5

    E-print Network

    Jones, Michelle

    those protected by law (e.g., learning styles, economic status)? We plan to begin these activities Council Co-Chaired by Dr. Valerie Lee and Dr. Georgina Dodge reviewed the annual College Diversity Reports and completed an integrated report on College and Unit movement towards enhancing diversity across

  1. See reverse side for Contents and ordering information Catalog no. 90364, June 2011, 831 pp.

    E-print Network

    Boas, David

    properties of tissue · Describes the various forms of spectroscopy and its applications in medicine. NEW!See whatyou're m issing. SIGN UP NOW forEXCLUSIVE em ailoffers atwww.crcpress.com FEATURES · An in Optical Properties, Alexey N. Bashkatov, Elina A. Genina, and Valery V. Tuchin II. Spectroscopy

  2. Surface-to-tunnel seismic tomography studies at Yucca Mountain, Nevada

    E-print Network

    Korneev, Valeri A.

    Surface-to-tunnel seismic tomography studies at Yucca Mountain, Nevada Roland Gritto, Valeri A. [1] A surface-to-tunnel seismic survey was conducted to estimate fracture intensity and distribution) tunnel, respectively. Numerical modeling showed that the first arrival P waves are mainly propagated

  3. W I N T E R 2 0 1 2www.ucd.ie/ucdtoday 7.MindtheHealth

    E-print Network

    Muldoon, Zorica Nedovic Budic, Valerie Norton, Clár Ní Bhuachalla, Caroline O'Connor, Eilis O'Brien, Aidan, Nerys Williams, Agnieszka Wisniewska, Orla Wrynn. Produced by: Eilis O'Brien, Lisa Flannery, Dominic O'Sullivan, Elaine Quinn, Bairbre Redmond, Helen Sheridan, Mark Simpson, Harutyun Shahumyan, Fiona

  4. A U T U M N 2 0 1 4www.ucd.ie/ucdtoday 5.Alooktothe

    E-print Network

    Pollastri, Gianluca

    , Valerie Norton, Eilis O'Brien, Caroline O'Connor, Claire O'Connell, Tracy O'Donoghue, Rosalind Pan, Elaine Timlin, Ben Tonra, Anthony Ventresque, Aoife Whelan, Micéal Whelan Produced by: Eilis O'Brien, Lisa Flannery, Dominic Martella Design: Loman Cusack Design Print: Fine Print Thanks to: Diarmaid Ferriter, Pat

  5. A U T U M N 2 0 1 2www.ucd.ie/ucdtoday 5.UCDstudents

    E-print Network

    'Connell, Caroline O'Connor, Eilis O'Brien, Conall O'Morain, Rosalind Pan, Elaine Quinn, Bairbre Redmond, Colin Scott Whelan, John White, Orla Wrynn. Produced by: Eilis O'Brien, Lisa Flannery, Dominic Martella Design: Loman, Dominic Martella, John McCafferty, Zorica Nedovic Budic, Valerie Norton, Clár Ní Bhuachalla, Claire O

  6. The Economic, Energy, and GHG Emissions Impacts of Proposed 20172025 Vehicle Fuel

    E-print Network

    The Economic, Energy, and GHG Emissions Impacts of Proposed 2017­2025 Vehicle Fuel Economy-2025 Vehicle Fuel Economy Standards in the United States Valerie J. Karplus* and Sergey Paltsev* Abstract associated with year-on-year increases in new vehicle fuel economy targets of 3%, 4%, 5%, or 6%, which

  7. http://jbr.sagepub.com Journal of Biological Rhythms

    E-print Network

    Allada, Ravi

    . To whom all correspondence should be addressed: Valerie L. Kilman, Center for Sleep and Circadian Biology of Neurobiology and Physiology and Center for Sleep and Circadian Biology, Northwestern University, Evanston, Illinois Abstract Cell-autonomous feedback loops underlie the molecular oscilla- tions that define

  8. Controlling the proportion of falsely-rejected hypotheses when conducting multiple tests with climatological data

    E-print Network

    with climatological data Val´erie Ventura 1 Department of Statistics and the Center for the Neural Basis of Cognition #12;Abstract The analysis of climatological data often involves statistical significance testing to spatially correlated data, which are common in climatology. The most straightforward method for controlling

  9. Looking for a few good crew members to join Expedition: Isle Royale 2012

    E-print Network

    Looking for a few good crew members to join Expedition: Isle Royale 2012 Upper Peninsula Youth day backpacking adventure in Isle Royale National Park. A FUN and FREE way to get involved or online at: http://iri.mtu.edu/education For more information, contact Valerie Martin at Isle Royale

  10. Wie finanziere ich meine wissenschaftliche Karriere? Eine Informationsveranstaltung fr Nachwuchswissenschaftlerinnen und Nachwuchswissenschaftler

    E-print Network

    Hamburg,.Universität

    -Adenauer-Stiftung Frau Astrid Bothmann 10.35 Uhr Studienstiftung des deutschen Volkes Frau Valerie Donecke Frau Lena Schüch Frau Rieke Schäfer 10.55 Uhr Kaffeepause / Meeting Point im Foyer 11.15 Uhr Deutsche Bundesstiftung Umwelt Frau Dr. Hedda Schlegel-Starmann 11.45 Uhr Gerda Henkel Stiftung Frau Dr. Anna

  11. Universite Paris Diderot -Paris 7 Ecole Doctorale de Sciences Mathematiques de Paris Centre

    E-print Network

    Boyer, Edmond

    `ese de Doctorat Sp´ecialit´e : Math´ematiques Appliqu´ees Gregorio R. MORENO FLORES MOD`ELES DE POLYM- tratif : Val´erie Juv´e, Isabelle Mariage et Mich`ele Wasse. Cette th`ese a ´et´e partiellement financ

  12. "Bad Talk" Made Good: Language Variety in Four Caribbean British Children's Poets

    ERIC Educational Resources Information Center

    Lockwood, Michael

    2014-01-01

    This article looks at how four British-based poets born in the Caribbean exploit the rich language repertoire available to them in their work for children and young people. Following initial consideration of questions of definition and terminology, poetry collections by James Berry, John Agard, Grace Nichols and Valerie Bloom are discussed, with a…

  13. The Public Assault on America's Children: Poverty, Violence, and Juvenile Injustice. The Teaching for Social Justice Series.

    ERIC Educational Resources Information Center

    Polakow, Valerie, Ed.

    This collection of papers reveals the systemic violence, poverty, educational neglect, and social disregard that shape the lives of poor children in the United States. After an introduction, "Savage Policies: Systemic Violence and the Lives of Children" (Valerie Polakow), there are eight chapters: (1) "A Crucible of Contradictions: Historical…

  14. Parental Perspectives on Nurture Groups: The Potential for Engagement

    ERIC Educational Resources Information Center

    Taylor, Valerie M.; Gulliford, Anthea

    2011-01-01

    Nurture groups have been identified as supportive and potentially effective provision for young people with troubled patterns of social, emotional and behavioural development, and a specific literature has emerged in relation to understanding their functioning. The work outlined here derives from an exploratory study by Valerie Taylor, a senior…

  15. Now I Get What It Was Really Like: Reading Historical Fiction to Understand History

    ERIC Educational Resources Information Center

    Schwab, Watts

    2005-01-01

    Encouraging students to read historical fiction can lead to greater interest in historical events and fictionalizing history enables young people to feel what it is like to be there. "The Bear that Heard Crying" by Natalie Kinsey-Warnock, "A Lion to Guard Us" by Clyde Robert and "Meet Felicity: An American Girl (Book 1)" by Valerie Tripp are some…

  16. Defending Where the Attacker Isn't Peter Gutmann

    E-print Network

    Gutmann, Peter

    Cybercrime is a multibillion dollar industry Last year [2004] was the first year that proceeds from cybercrime were greater than proceeds from the sale of illegal drugs -- Valerie McNiven, US Treasury cybercrime advisor · (These figures are unreliable, but nevertheless it's a serious problem) But we've got

  17. Puerto Rico Weather Camp 2007-2012 Participants

    E-print Network

    Gilbes, Fernando

    Catalina Morales de Flores, Moca 8 Plaza Juan J. Patria La Torre Ramirez, San Sebastian 9 Reyes Julius Patria La Torre Ramirez, San Sebastian 10 Salas Efrain Manuel Mendez Liciaga, San Sebastian 11 Valcarcel. Carlos Gonzalez, Aguada 20 Garcia Erick Colegio San Benito, Mayaguez 21 Gonzalez Valerie Jaime A Collazo

  18. Higher Prices from Entry: Pricing of Brand-Name Drugs

    E-print Network

    Perloff, Jeffrey M.

    Higher Prices from Entry: Pricing of Brand-Name Drugs Jeffrey M. Perloff* Valerie Y. Suslow** Paul anti-ulcer drugs rose as new products entered the market. #12;Higher Prices from Entry: Pricing of Brand-Name Drugs When a new firm starts marketing a product that is spatially differentiated from

  19. Higher Prices from Entry: Pricing of Brand-Name Drugs

    E-print Network

    Perloff, Jeffrey M.

    Higher Prices from Entry: Pricing of Brand-Name Drugs Jeffrey M. Perloffa Valerie Y. Suslowb,* Paul or collusive game. We find support for our theory using data on brand-name entry in the anti-ulcer drug market; Pharmaceutical drugs #12;1. Introduction When a new firm starts marketing a product that is spatially

  20. Supported Employment Handbook: A Customer-Driven Approach for Persons with Significant Disabilities.

    ERIC Educational Resources Information Center

    Brooke, Valerie, Ed.; And Others

    This manual provides training information for implementing supported employment by using a customer-driven approach. Chapter 1, "Supported Employment: A Customer-Driven Approach" (Valerie Brooke and others), describes current best practices, a new customer-driven approach to supported employment, and the role of the employment specialist. Chapter…

  1. The Wiess School of Natural Sciences Degrees Offered: BA, BS, MA, PhD

    E-print Network

    Richards-Kortum, Rebecca

    Chemistry CHEM 430 Quantum Chemistry CHEM 495 Transition Metal Chemistry Additional Laboratory Co120 Chemistry The Wiess School of Natural Sciences Degrees Offered: BA, BS, MA, PhCuLtyfeLLow ValeryKhabashesku KristenKulinowski VisitingProfessor RaphaelLevine #12;Chemistry 121 chemistry

  2. Storage Techniques in Flash Memories and Phase-change Memories 

    E-print Network

    Li, Hao

    2010-10-12

    Major Subject: Computer Engineering STORAGE TECHNIQUES IN FLASH MEMORIES AND PHASE-CHANGE MEMORIES A Dissertation by HAO LI Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Anxiao Jiang Committee Members, Jianer Chen Jennifer Welch Alexander Sprintson Head of Department, Valerie E. Taylor August 2010 Major Subject: Computer Engineering iii ABSTRACT Storage Techniques...

  3. Brandon Reintjes, curator of art, Montana Museum of Art and Culture, 406-243-2019, brandon.reintjes@mso.umt.edu .

    E-print Network

    Vonessen, Nikolaus

    of Emma Hart, a painting that was listed in a 1787 inventory of the artist's studio, also will be part will be held from 4 to 7 p.m. Nov. 12 at MMAC, which is located in UM's Performing Arts and Radio/Television, in the Masquer Theatre of the PAR/TV Center. UM art history Professor Valerie Hedquist will give a lecture

  4. Non-Mimetic Simulation Games: Teaching Team Coordination from a Grounding in Practice 

    E-print Network

    Dugas Toups, Zachary Oliver

    2011-10-21

    for the degree of DOCTOR OF PHILOSOPHY August 2010 Major Subject: Computer Science Non-mimetic Simulation Games: Teaching Team Coordination from a Grounding in Practice Copyright 2010 Zachary Oliver Dugas Toups NON-MIMETIC SIMULATION GAMES: TEACHING TEAM... of Committee, Andruid Kerne Committee Members, Richard Furuta Charles D. Samuelson Scott Schaefer Head of Department, Valerie E. Taylor August 2010 Major Subject: Computer Science iii ABSTRACT Non-mimetic Simulation Games: Teaching Team Coordination...

  5. A novel approach to the study of conformality in the SU(3) theory with multiple flavors

    E-print Network

    Richard Brower; Anna Hasenfratz; Claudio Rebbi; Evan Weinberg; Oliver Witzel

    2014-10-16

    We investigate the transition between spontaneous chiral symmetry breaking and conformal behavior in the SU(3) theory with multiple fermion flavors. We propose a new strategy for studying this transition. Instead of changing the number of flavors, we lift the mass of a subset of the fermions, keeping the rest of the fermions near to the massless chiral limit in order to probe the transition. Dedicated to the 60th birthday of Academician Valery Rubakov.

  6. Soap Opera Video on Handheld Computers to Reduce Young Urban Women’s HIV Sex Risk

    Microsoft Academic Search

    Rachel Jones

    2008-01-01

    The purpose of this study was to develop a soap opera video, A Story about Toni, Mike, and Valerie, designed to communicate HIV risk reduction themes. The study evaluated viewing the video and responding to audio computer\\u000a assisted self-interview (ACASI) on a handheld computer. The sample was 76 predominately African American women, aged 18–29,\\u000a in sexual relationships with men. Data

  7. Exploring the biography and artworks of Picasso with interactive calendars and timelines 

    E-print Network

    Meneses, Luis

    2009-05-15

    , John Leggett Enrique Mallen Head of Department, Valerie Taylor August 2007 Major Subject: Computer Science iii ABSTRACT Exploring the Biography and Artworks of Picasso with Interactive Calendars and Timelines. (August 2007.... Richard Furuta for his extremely valuable advice, and for sharing his expertise and insights. Dr. Enrique Mallen gave me the opportunity to work with the Online Picasso Project, and I would like to thank him for his guidance and enthusiasm towards new...

  8. Comparison of motor-based versus visual sensory representations in object recognition tasks 

    E-print Network

    Misra, Navendu

    2005-11-01

    in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved by: Chair of Committee, Yoonsuck Choe Committee Members, Karen L. Butler-Purry Frank Shipman Head of Department, Valerie E. Taylor August 2005 Major Subject: Computer... other committee members, Dr. Karen Butler-Purry and Dr. Frank Shipman, for their guidance. Dr. Heather Bortfeld was very kind to attend my thesis defense and offer suggestions on improving my thesis. Finally, I would like to thank my parents...

  9. KSC-03PD-1456

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., examines closely the container containing one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  10. KSC-03PD-1462

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Valerie Cassanto, Instrumentation Technology Associates, Inc., and Dr. Dennis Morrison, NASA Johnson Space Center, analyze one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  11. KSC-03PD-1454

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., and Bob McLean, from the Southwest Texas State University, work on an experiment found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  12. KSC-03PD-1459

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Bob McLean, Southwest Texas State University; Valerie Cassanto, Instrumentation Technology Associates, Inc.; and Dennis Morrison, NASA Johnson Space Center, process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  13. KSC-03PD-1467

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, Instrumentation Technology Associates, Inc., studies one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

  14. KSC-03PD-1470

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Bob McLean, Southwest Texas State University, and Valerie Cassanto, Instrumentation Technology Associates, Inc., study one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  15. KSC-03PD-1452

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto and Bob McLean talk to a reporter about experiments found during the search for Columbia debris. Cassanto is with Instrumentation Technology Associates Inc. and McLean is with the Southwest Texas State University. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  16. KSC-03PD-1457

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto, with Instrumentation Technology Associates, Inc., and Bob McLean, from the Southwest Texas State University, transfer to a new container material from one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation.

  17. Jeannette M. Wing @ PCAST; Barbara Liskov keynote

    Microsoft Academic Search

    Jeannette M. Wing; Valerie Barr

    2011-01-01

    The Communications Web site, http:\\/\\/cacm.acm.org, features more than a dozen bloggers in the BLOG@CACM community. In each issue of Communications, we'll publish selected posts or excerpts.twitterFollow us on Twitter at http:\\/\\/twitter.com\\/blogCACMhttp:\\/\\/cacm.acm.org\\/blogs\\/blog-cacmJeannette M. Wing discusses her PCAST presentation about the importance of computer science and its impact. Valerie Barr shares highlights from Barbara Liskov's keynote at Grace Hopper.

  18. Connecting women and technology

    Microsoft Academic Search

    Valerie Barr

    2010-01-01

    The Communications Web site, http:\\/\\/cacm.acm.org, features more than a dozen bloggers in the BLOG@CACM community. In each issue of Communications, we'll publish excerpts from selected posts.twitterFollow us on Twitter at http:\\/\\/twitter.com\\/blogCACMGuest blogger Valerie Barr writes about highlights of the ninth Grace Hopper Celebration of Women in Computing Conference, including keynote speeches by Megan Smith and Francine Berman.

  19. Ho Ch'eng and Early Yüan Dynasty Painting in Northern China

    E-print Network

    Haufler, Marsha

    1986-01-01

    community by Hsiieh Yung-nien and Hsu Pang-ta.3 According to Yuan texts, Ho Ch'eng applied his brush to a variety of subjects, including figures, horses, buildings, and landscapes.4 Such versatility was not exceptional. Wai-kam Ho has taken note of a...) (Shanghai: Jen-min mei-shu ch'u-pan she, 1980), pp. 321-325. 5. Wai-kam Ho, Aspects of Chinese Painting from 1100 to 1350, in Wai-kam Ho et al., Eight Dynasties of Chinese Painting (Cleveland: The Cleveland Museum of Art in cooperation with Indiana...

  20. Building Pressure Control in VAV System with Relief Air Fan

    E-print Network

    Pang, X.; Liu, M.; Zheng, B.

    2005-01-01

    Building Pressure Control in VAV Systems with Relief Air Fan Xiufeng Pang, Mingsheng Liu, PhD, P.E., Bin Zheng University of Nebraska, Lincoln—ESL 1110 So. 67 th St, Omaha, NE, 68182 Abstract Building pressure control is critical....02 inch w.g. Moreover, undesirable “wind” occurred at the connection linking the east wing and the west wing, which was served by heat pump systems and had acceptable building pressure. DUCT PRESSURE SENOR BUILDING PRESSURE SENSOR VFD P P VFD 1st...

  1. Tone and point of view in Thackeray's Henry Esmond

    E-print Network

    Ellison, Gerald Vance

    1966-01-01

    - stantly, --something under two thousand pounds, --had no natural friends who could provide it, but must go utterly to the wall without it, Pondering over this sad condition of things just revealed to me, I met Thackeray between the two mounted heroes... thought with many a pang of shame and grief of st t* g d 1't y d't' . . . " (E d. p. 56). Th union of the young boy with his mother, a critical experience, as Ray points out, can be easily paralleled in Esmond: "She had come upon him as a Dea certe...

  2. Geology of a portion of the northern Kings Mountain belt, North Carolina 

    E-print Network

    Michie, Joanna

    1985-01-01

    GEOLOGY OF A PORTrON OP THE NORTHERN RINGS YOUNTAIN BELT NO&TH CAROLINA A Thesis by JOANNA NICHIF Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Hay... lep5 Yaior Subiect: Geology GEOLOGY OF A PORTION OF THE NORTHERN KINGS MOUNTAIN BELT, NORTH CAROLINA A Thesis by JOANNA MICHIE Approved as to style and content by: David W. Mohr (Chairman of Committee) J. Robert Butler (Member) John H. pang...

  3. The Compiled Works from Tibetan Sources [on the Lives of Shariputra and Maudgalyayana

    E-print Network

    1997-01-01

    nannies who nursed him with milk, curd, hutter. the fi'oth of the butter and other principle items because of which he grew up quickly like a water- lily. On attaining adolescence he learned alphabet (Yi-ge), arithmetic (Grangs), and astrology (r... /Tib: Rab-tu -'byung). But dPang-nas-skyes replied: "Oh Brahmans son!, for whom religiolls services and sacrificial rituals are performed. With pains taking effOlt, title of royal priesthood is at my palm. In addition, we are born to a class esteemed...

  4. Affinity binding of antibodies to supermacroporous cryogel adsorbents with immobilized protein A for removal of anthrax toxin protective antigen.

    PubMed

    Ingavle, Ganesh C; Baillie, Les W J; Zheng, Yishan; Lis, Elzbieta K; Savina, Irina N; Howell, Carol A; Mikhalovsky, Sergey V; Sandeman, Susan R

    2015-05-01

    Polymeric cryogels are efficient carriers for the immobilization of biomolecules because of their unique macroporous structure, permeability, mechanical stability and different surface chemical functionalities. The aim of the study was to demonstrate the potential use of macroporous monolithic cryogels for biotoxin removal using anthrax toxin protective antigen (PA), the central cell-binding component of the anthrax exotoxins, and covalent immobilization of monoclonal antibodies. The affinity ligand (protein A) was chemically coupled to the reactive hydroxyl and epoxy-derivatized monolithic cryogels and the binding efficiencies of protein A, monoclonal antibodies to the cryogel column were determined. Our results show differences in the binding capacity of protein A as well as monoclonal antibodies to the cryogel adsorbents caused by ligand concentrations, physical properties and morphology of surface matrices. The cytotoxicity potential of the cryogels was determined by an in vitro viability assay using V79 lung fibroblast as a model cell and the results reveal that the cryogels are non-cytotoxic. Finally, the adsorptive capacities of PA from phosphate buffered saline (PBS) were evaluated towards a non-glycosylated, plant-derived human monoclonal antibody (PANG) and a glycosylated human monoclonal antibody (Valortim(®)), both of which were covalently attached via protein A immobilization. Optimal binding capacities of 108 and 117 mg/g of antibody to the adsorbent were observed for PANG attached poly(acrylamide-allyl glycidyl ether) [poly(AAm-AGE)] and Valortim(®) attached poly(AAm-AGE) cryogels, respectively, This indicated that glycosylation status of Valortim(®) antibody could significantly increase (8%) its binding capacity relative to the PANG antibody on poly(AAm-AGE)-protien-A column (p < 0.05). The amounts of PA which remained in the solution after passing PA spiked PBS through PANG or Valortim bound poly(AAm-AGE) cryogel were significantly (p < 0.05) decreased relative to the amount of PA remained in the solution after passing through unmodified as well as protein A modified poly(AAm-AGE) cryogel columns, indicates efficient PA removal from spiked PBS over 60 min of circulation. The high adsorption capacity towards anthrax toxin PA of the cryogel adsorbents indicated potential application of these materials for treatment of Bacillus anthracis infection. PMID:25736504

  5. Continuous Commissioning® of an Office Building

    E-print Network

    Zheng, B.; Liu, M.; Pang, X.; Wang, J.; Hansen, K.

    2005-01-01

    Continuous Commissioning ® of an Office Building Bin Zheng Mingsheng Liu, Ph.D., P.E. Xiufeng Pang Jinrong Wang P.E. Ken Hansen P.E. Energy Systems Laboratory University of Nebraska-Lincoln Omaha Public Power District Abstract... Comparison 0 500 1,000 1,500 2,000 2,500 3,000 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec C ons um pt i on ( k W h ) Pre-CC (2003-2004) Post-CC (2004-2005) Figure 17: Electricity demand comparison References [1] Liu, M, 2003, “Variable Speed...

  6. The geomagnetic storm of 1910 May 18 and the tail of Halley's Comet

    NASA Astrophysics Data System (ADS)

    Yan, L.-S.; Li, Z.-Y.; Gu, S.-Y.

    1984-09-01

    On May 18, 1910, the Lu-Kia-Pang Observatory near Shanghai recorded a geomagnetic storm, but it was thought that this storm was not connected with the tail of Halley's comet. In the present paper, it is argued that this storm, rather than originating in some solar activity (coronal hole or solar flare), could have been the result of the interaction of the plasma tail of Halley's comet and the earth's magnetosphere. The time lag between the storm and the transit as calculated by Leuchner (1910) is given, and the characteristic features of cometary tails and the mechanisms by which they produce geomagnetic storms are analyzed.

  7. Soliton stars at finite temperature

    NASA Astrophysics Data System (ADS)

    Cottingham, W. N.; Vinh Mau, R.

    1991-09-01

    We investigate the properties of soliton stars in the Lee-Wick model when a temperature dependence is introduced into this model. It is found that at some critical temperature Tc~100-200 MeV, a first-order phase transition occurs leading to the formation of soliton stars with characteristics similar to those considered by Lee and Pang but with a much smaller mass and size. We study the evolution of these soliton stars with the temperature from the early Universe to the present time.

  8. Cosmic X-ray background and solitars.

    NASA Astrophysics Data System (ADS)

    Chiu, H.-Y.

    In this paper the authors has examined the observational consequences of a class of new astronomical objects proposed by Friedberg, Lee and Pang, called solitars which are degenerate vacuum states embedded with particles. A study is made to include finite temperature effect and pair creation. Quark is believed to be the only species that can exist in the interior of solitars. Massive quark solitars are primarily X-ray emitters and may account for the large unexplained thermal component of the cosmic X-ray background.

  9. Stability of excited bosonic stellar configurations

    NASA Astrophysics Data System (ADS)

    Jetzer, Ph.

    1989-05-01

    In this paper I study the problem of the dynamical stability of Bose star configurations which correspond to excited states. In particular I show that the eigenvalues of the pulsation equation, which governs the time evolution of the infinitesimal radial oscillations, are real. This, together with the theorem, proved by Lee and Pang, that for a configuration with critical central density ?crit the pulsation equation has a zero mode and the fact that for central densities much smaller than ?crit the lowest eigenvalue is positive, leads to the conclusion that the excited Bose star configurations are classically stable for central densities up to ?crit.

  10. Observable relic features of soliton stars from early Universe.

    NASA Astrophysics Data System (ADS)

    Chiu, Hong-Yee

    Nontopological soliton stars belong to a wide class of stable extended objects characterized by a conserved charge (such as the net number of particles). The author discusses the time evolution of one particular model due to Lee and Pang. Radiation from soliton stars mix with the black body background radiation of the Universe, and if not thermalized, it may cause a small distortion in the short wavelength end of the observed cosmic background radiation. These distortions may be observed as spatial inhomogeneities in the short wavelength end.

  11. China Forest Aboveground Biomass Estimation by Fusion of Inventory and Remote Sensing Data: 1st results from Heilongjiang Province and Yunnan Province

    NASA Astrophysics Data System (ADS)

    Pang, Y.; Li, Z.; Huang, G.; Sun, G.; Cheng, Z.; Zhang, Z.; Zhang, G.

    2013-12-01

    Forests play an irreplaceable role in maintaining regional ecological environment, global carbon balance and mitigating global climate change. Forest aboveground biomass (AGB) is an important indicator of forest carbon stocks. Estimating forest aboveground biomass accurately could significantly reduce the uncertainties in terrestrial ecosystem carbon cycle. LIDAR provides accurate information on the vertical structure of forests (Lefsky et al., 2007; Naesset et al., 2004; Pang et al., 2008). Combining airborne LiDAR and spaceborne LiDAR for regional forest biomass retrieval could provide a more reliable and accurate quantitative information in regional forest biomass estimate (Boudreau et al., 2008; Nelson et al., 2009; Pang et al., 2011; Saatchi et al., 2011). The Heilongjiang Province and Yunnan Province are rich in forest resources and suffers intensive forest management activities for timber products. The Heilongjiang Province is typical in temperate forest and the Yunnan Province contains multiple forest types including tropical forest. These two provinces also have good ground inventory system with thousands of permanent field plots. Two campaign consists of in-situ measurement, airborne Lidar data and spaceborne data fusion were designed and implemented. First results show that i). Both spaceborne lidar and forest inventory data are useful for AGB mapping at province level. ii). The combination of spaceborne lidar and forest inventory data gave better biomass estimation with less bias. iii). A pixel level bias mapping was also proposed and gave spatial explicit map of estimation uncertainties. This method will be investigated further with more reference data and tested in other area.

  12. Advances in Continuous Mass Measurement Technology: TEOM Mass Monitor at 30° C with a Nafion Dryer at Rural and Urban New York State Locations.

    NASA Astrophysics Data System (ADS)

    Schwab, J. J.; Felton, H. D.; Ambs, J.; Spicer, J.; Demerjian, K. L.

    2002-12-01

    The National Ambient Air Quality Standards (NAAQS) for particulate matter (both PM10 and PM2.5) are expressed in terms of mass concentrations in micrograms per cubic meter of air. While there is tremendous interest in measuring chemically speciated concentrations of PM, bulk mass concentration will clearly be the regulated quantity for the foreseeable future. With this in mind, it is critically important to establish the quality of data collected under current promulgated PM2.5 mass measurement techniques; to identify any significant sources of error associated with the techniques; as well as to evaluate newer technologies that are capable of measuring PM continuously and in real time. The well-known problems inherent in the measurement of ambient particulate matter include evaporation (and condensation) of semi-volatile compounds from (or onto) the collection medium; and the condensation and adsorption of reactive gases from the atmosphere. Recent work quantifying the sources of artifact errors for the Federal Reference Method (Pang, et al., 2002a; 2002b) showed significant evaporative losses from FRM filters. Similar losses are observed for the TEOM mass monitor, where evaporation of material from the filter head occurs at the default sensor temperature setting of 50° C. The TEOM SES (Sample Equilibration System) was developed to reduce the transient measurement errors reported by the TEOM instrument due to water vapor, the most abundant condensable gas in the atmosphere; and to allow instrument operation at temperatures lower than 50° C. The SES TEOM has been operated at a site in rural SW New York State (Addison, NY) for more than two years and at a site in Queens, New York City for more than a year. Each site also has a co-located standard TEOM (operated at 50° C without a Nafion dryer) and an FRM filter sampler. For these sites, the summer data from all three instruments agrees quite well, typically to better than 10%. Significant differences, on the order of 40% or more, are apparent during the winter months. We will present these year round data sets and draw conclusions on the status of continuous mass concentration measurements using the TEOM mass monitor. Pang, Y., Eatough, N. L., Wilson, J., and Eatough, D. J. (2002a) Effect of Semivolatile Material on PM2.5 Measurement by the PM2.5 Federal Reference Method Sampler at Bakersfield, California. Aerosol Sci. Technol. 36:289-299 Pang, Y., Eatough, N. L., and Eatough, D. J. (2002b) PM2.5 Semivolatile Organic Material at Riverside, California: Implications for the PM2.5 Federal Reference Method Sampler. Aerosol Sci. Technol. 36:277-288

  13. STS-96 FD Highlights and Crew Activities Report: Flight Day 01

    NASA Technical Reports Server (NTRS)

    1999-01-01

    On this first day of the STS-96 Discovery mission, the flight crew, Commander Kent V. Rominger, Pilot Rick D. Husband, and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette, and Valery Ivanovich Tokarev are seen performing pre-launch activities such as eating the traditional breakfast, crew suit-up, and the ride out to the launch pad. Also, included are various panoramic views of the shuttle on the pad. The crew is readied in the 'white room' for their mission. After the closing of the hatch and arm retraction, launch activities are shown including countdown, engine ignition, launch, and the separation of the Solid Rocket Boosters.

  14. Thermodynamics of MgB2 described by the weak-coupling two-band BCS model 

    E-print Network

    Mishonov, TM; Pokrovsky, Valery L.; Wei, HD.

    2005-01-01

    . 20 F. Bouquet, Y. Wang, I. Sheikin, P. Toulemonde, M. Eisterer, H. W. Weber, S. Lee, S. Tajima, and A. Junod, Physica C 385, 192 s2003d. 21 R. S Gonnelli et al., Phys. Rev. Lett. 89, 247004 s2002d. 22 L. Lyard et al., Phys. Rev. B 66, 180502sRd s...Thermodynamics of MgB2 described by the weak-coupling two-band BCS model Todor M. Mishonov,1,2 Valery L. Pokrovsky,3,4 and Hongduo Wei3 1Faculty of Physics, Sofia University ?St. Kliment Ohridski,? 5 James Bourchier Boulevard, BG-1164 Sofia...

  15. Special issue on Laser Biophotonics, dedicated to the seventieth birthday of V.V. Tuchin

    NASA Astrophysics Data System (ADS)

    Priezzhev, A. V.; Bashkatov, A. N.; Genina, E. A.

    2014-07-01

    Prominent Researcher and Educator, Honoured Scientist of the Russian Federation, Professor Valery V. Tuchin celebrated his seventieth birthday this year. V.V. Tuchin heads the Department of Optics and Biophotonics at N.G. Chernyshevsky Saratov State University and the Laboratory of Laser Diagnostics of Technical and Living Systems at the Institute of Precise Mechanics and Control of the Russian Academy of Sciences. He is a Vice-President of the Russian Photobiology Society. V.V. Tuchin is widely known for his achievements in optics of biological tissues, in developing methods of optical and laser measurements in biomedicine and nanobiophotonics, and in many other fields.

  16. Improving Processor Design by Exploiting Performance Variance 

    E-print Network

    Wang, Zhe

    2014-07-28

    OF PHILOSOPHY Chair of Committee, Daniel A. Jime´nez Committee Members, Paul V. Gratz Eun Jung Kim Valerie E. Taylor Head of Department, Nancy M. Amato August 2014 Major Subject: Computer Science Copyright 2014 Zhe Wang ABSTRACT Programs exhibit significant... in my research and con- tributed to this dissertation. First of all, I would like to thank my advisor Daniel A. Jime´nez. My interests in computer architecture started with me taking the CS5513 Computer Architecture class which was taught by Daniel...

  17. TREKisM Issue 31 

    E-print Network

    1983-01-01

    -Off TH,s 1 s A PC" CARTOoN StRIP. " SORRY. Tm:fusM Staff COORDINATOR & EDITOR: Vel Jaeger - 119 San J~cinto Rd, Oceanside, CA 92054 ph: (619) 439-8110 ASSO.CIATE EDITOR: Kim Knapp - 2232 Primrose Ave, #6, Vista CA 92083 ph: (619) 727... for those who prefer their crudities veiled. More than any-68 [Continued on page '13 ] ~ fJ S1JBS(;RIBERS Steve Acterman ·Valerie A. Alberti Joan Alkula , 4419 Phyliss Amason ·Linda Baker 5405 Park Ave., Garden Grove, CA 92645 13 Maritime Dr...

  18. KSC-03PD-1469

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida; Valerie Cassanto, Instrumentation Technology Associates, Inc.; and Dr. Dennis Morrison, NASA Johnson Space Center, process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

  19. KSC-03PD-1464

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida, and Valerie Cassanto, Instrumentation Technology Associates, Inc., process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

  20. KSC-03PD-1465

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida, and Valerie Cassanto, Instrumentation Technology Associates, Inc., process one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

  1. KSC-03PD-1466

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - From left, Barry Perlman, Pembroke Pines Charter Middle School in Florida, and Valerie Cassanto, Instrumentation Technology Associates, Inc., analyze one of the experiments carried on mission STS-107. Several experiments were found during the search for Columbia debris. Included in the Commercial ITA Biomedical Experiments payload on mission STS-107 are urokinase cancer research, microencapsulation of drugs, the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), and tin crystal formation. The latter was sponsored by the Pembroke Pines Charter Middle School.

  2. STS-96 Crew Training

    NASA Technical Reports Server (NTRS)

    1999-01-01

    The training for the crew members of the STS-96 Discovery Shuttle is presented. Crew members are Kent Rominger, Commander; Rick Husband, Pilot; Mission Specialists, Tamara Jernigan, Ellen Ochoa, and Daniel Barry; Julie Payette, Mission Specialist (CSA); and Valery Ivanovich Tokarev, Mission Specialist (RSA). Scenes show the crew sitting and talking about the Electrical Power System; actively taking part in virtual training in the EVA Training VR (Virtual Reality) Lab; using the Orbit Space Vision Training System; being dropped in water as a part of the Bail-Out Training Program; and taking part in the crew photo session.

  3. 'El escribirlo no parte de la osadía': Tradición y mímica en la loa para El divino Narciso de Sor Juana Inés de la Cruz

    E-print Network

    Benoist, Valé rie

    1999-10-01

    FALL 1999 73 "El escribirlo no parte de la osadía": Tradición y mímica en la loa para El divino Narciso de Sor Juana Inés de la Cruz Valerie Benoist Generalmente se le atribuye a Calderón de la Barca la transformación de la loa en un género... dramático autónomo sin reconocer el papel de Sor Juana Inés de la Cruz en este proceso. Sin embargo, como recuerda con mucho acierto Lee Daniel, Sor Juana compuso 18 loas y, junto con Calderón, fue la escritora que más participó en la modificación de la...

  4. STAG UK Newsletter Issue 24 

    E-print Network

    1977-01-01

    (:.lmont and thinl.': she's perceptivo to notic" tho similari tics between Kirk and Spock, and. Starsky and Hutch. UFOs This sub;ject has brought in a fair number of oommunts this timiJ, again. Valerie H8.rrison wri tos I saw something strange onco that wus r8... Horse' especially made an improssion on mo, and I passed it on to a couple of friends who also found it 14 intoresting and rathor eerie. Very briefly, tho thorne of tho book is that UFOs, together '1:i th every other strange phetlomlonon, including...

  5. Ponderable soliton stars

    NASA Technical Reports Server (NTRS)

    Chiu, Hong-Yee

    1990-01-01

    The theory of Lee and Pang (1987), who obtained solutions for soliton stars composed of zero-temperature fermions and bosons, is applied here to quark soliton stars. Model soliton stars based on a simple physical model of the proton are computed, and the properties of the solitons are discussed, including the important problem of the existence of a limiting mass and thus the possible formation of black holes of primordial origin. It is shown that there is a definite mass limit for ponderable soliton stars, so that during cooling a soliton star might reach a stage beyond which no equilibrium configuration exists and the soliton star probably will collapse to become a black hole. The radiation of ponderable soliton stars may alter the short-wavelength character of the cosmic background radiation, and may be observed as highly redshifted objects at z of about 100,000.

  6. Directional drill keys completion of South China Sea pipeline

    SciTech Connect

    Callnon, D. [Cherrington Corp., Sacramento, CA (United States); Weeks, K. [KRW Associates, Sacramento, CA (United States)

    1996-04-08

    Directional drilling laid dual 12-in. natural gas pipelines beneath a critical sea wall on Lantau Island, Hong Kong New Territories, to complete a 30-mile gas-pipeline crossing of the South China Sea. The project was part of Towngas Lantau construction for Hong Kong`s new Chek Lap Kok International Airport on the island. To avoid disturbing a newly installed sea wall at Ta Pang Po beach, NKK subcontracted parallel beach approaches to Cherrington Corp., Sacramento. Between July 11 and Aug. 2, 1995, Cherrington Corp. drilled and forward-reamed two, 20 in., 1,294-ft holes to pull back the twin pipelines. The project was completed during typhoon weather, high seas, strong currents, and logistical problems associated with operating in a remote uninhabited area. This paper reviews the design of the beach approach entries; staging and site preparations; drilling equipment used; and overall project operations.

  7. Insights from Melvin-Kerr-Newman spacetimes

    E-print Network

    Booth, Ivan; Palomo-Lozano, Alberto; Kunduri, Hari K

    2015-01-01

    We examine several aspects of black hole physics using the Melvin-Kerr-Newman (MKN) family of spacetimes. Roughly speaking these are black holes immersed in a distorting background magnetic field and unlike the standard Kerr-Newman (KN) family they are not asymptotically flat. Among other properties we see that their angular momentum and charge are bounded by horizon area in exactly the same way as KN and also that they obey the uniqueness theorems for extremal horizons: these properties are in accord with standard theorems but are seen to be satisfied in interesting and non-trivial ways. Horizon geometries are compared to KN horizons with equal area, charge and angular momentum. Finally we calculate the energy of these distorted black holes using the isolated horizon, Komar and recently proposed Gibbons-Pang-Pope procedures. Disagreements between these methods highlight the inherent ambiguities in attempting to define energy and other physical properties for a non-asymptotically flat spacetime.

  8. Penner's serotype 4 of Campylobacter jejuni has a lipopolysaccharide that bears a GM1 ganglioside epitope as well as one that bears a GD1 a epitope.

    PubMed Central

    Yuki, N; Taki, T; Takahashi, M; Saito, K; Tai, T; Miyatake, T; Handa, S

    1994-01-01

    The carbohydrate structures of lipopolysaccharides (LPSs) of Campylobacter jejuni strains belonging to Penner's serotypes (PEN) 1, 2, 4, 19, 23, and 36 were studied by thin-layer chromatography and immunostaining with several monoclonal antiganglioside antibodies. Anti-GM1 and anti-GD1a antibodies reacted with the LPSs of PEN 1, 4, and 19. Aspinall et al. (G. O. Aspinall, A. G. McDonald, T. S. Raju, H. Pang, A. P. Moran, and J. L. Penner. Eur. J. Biochem. 213:1017-1027, 1993) recently reported that the LPS of PEN 4 has a GD1a ganglioside-like structure rather than a GM1-like structure. We found that the LPS fraction of C. jejuni (PEN 4) has an LPS that bears a GM1 epitope as well as an LPS that bears a GD1a epitope. Images PMID:7513313

  9. Human trafficking: crime in our own backyard.

    PubMed

    McNulty, Melissa S

    2014-04-01

    Imagine for a moment being in a small, cold, dark, and dirty room. You haven't seen your family in months and you're not sure if you ever will again. When the drugs that you've given begin to wear off, you feel hunger pangs because you haven't eaten anything in more hours than you can count. You hear a door opening and are filled with paralyzing fear and dread. You are never quite sure who or what will greet you on the other side of that door. You may have to endure a brutal beating, you may be forced to take drugs, or you may be raped. PMID:24685757

  10. Ponderable soliton stars

    NASA Astrophysics Data System (ADS)

    Chiu, Hong-Yee

    1990-12-01

    The theory of Lee and Pang (1987), who obtained solutions for soliton stars composed of zero-temperature fermions and bosons, is applied here to quark soliton stars. Model soliton stars based on a simple physical model of the proton are computed, and the properties of the solitons are discussed, including the important problem of the existence of a limiting mass and thus the possible formation of black holes of primordial origin. It is shown that there is a definite mass limit for ponderable soliton stars, so that during cooling a soliton star might reach a stage beyond which no equilibrium configuration exists and the soliton star probably will collapse to become a black hole. The radiation of ponderable soliton stars may alter the short-wavelength character of the cosmic background radiation, and may be observed as highly redshifted objects at z of about 100,000.

  11. Anxiety sensitivity in bereaved adults with and without complicated grief.

    PubMed

    Robinaugh, Donald J; McNally, Richard J; LeBlanc, Nicole J; Pentel, Kimberly Z; Schwarz, Noah R; Shah, Riva M; Nadal-Vicens, Mireya F; Moore, Cynthia W; Marques, Luana; Bui, Eric; Simon, Naomi M

    2014-08-01

    Complicated grief (CG) is a bereavement-specific syndrome chiefly characterized by symptoms of persistent separation distress. Physiological reactivity to reminders of the loss and repeated acute pangs or waves of severe anxiety and psychological pain are prominent features of CG. Fear of this grief-related physiological arousal may contribute to CG by increasing the distress associated with grief reactions and increasing the likelihood of maladaptive coping strategies and grief-related avoidance. Here, we examined anxiety sensitivity (AS; i.e., the fear of anxiety-related sensations) in two studies of bereaved adults with and without CG. In both studies, bereaved adults with CG exhibited elevated AS relative to those without CG. In study 2, AS was positively associated with CG symptom severity among those with CG. These findings are consistent with the possibility that AS contributes to the development or maintenance of CG symptoms. PMID:25075646

  12. Effect of amiloride and spironolactone on renal tubular function and central blood pressure in patients with arterial hypertension during baseline conditions and after furosemide: a double-blinded, randomized, placebo-controlled crossover trial.

    PubMed

    Matthesen, Solveig K; Larsen, Thomas; Vase, Henrik; Lauridsen, Thomas G; Jensen, Janni M; Pedersen, Erling B

    2013-01-01

    This study demonstrates that the increased potassium content in the body seems to change both the blood pressure and renal tubular function. We wanted to test the hypotheses that amiloride and spironolactone induced potassium retention reduces ambulatory blood pressure (ABP) and central blood pressure (CBP) during baseline conditions and after furosemide and that the tubular transport via the epithelial sodium channels (ENaCs) and aquaporin-2 (AQP2) water channels was increased by furosemide in arterial hypertension. Each of three 28-day treatment periods (placebo, amiloride, and spironolactone) was completed by a 4-day period with standardized diet regarding calories and sodium and water intake. At the end of each period, we measured pulse wave velocity (PWV), central systolic blood pressure (CSBP), central diastolic blood pressure (CDBP), glomerular filtration rate (GFR), free water clearance (CH2O), fractional excretion of sodium (FENa) and potassium (FEK), urinary excretion of AQP2 (u-AQP2), urinary excretion of ?-fraction of the ENaC (u-ENaC?), and plasma concentrations of renin (PRC), angiotensin II (p-Ang II), and aldosterone (p-Aldo) at baseline conditions and after furosemide bolus. Ambulatory blood pressure and CBP were significantly lowered by amiloride and spironolactone. During 24-hour urine collection and at baseline, GFR, CH2O, FENa, FEK, u-AQP2 and u-ENaC? were the same. After furosemide, CH2O, FENa, FEK, u-AQP2, u-ENaC?, PRC, p-Ang II, p-Aldo, PWV and CDBP increased after all treatments. However, during amiloride treatment, FEK increased to a larger extent than after spironolactone and during placebo after furosemide, and CSBP was not significantly reduced. The increases in water and sodium absorption via AQP2 and ENaC after furosemide most likely are compensatory phenomena to antagonize water and sodium depletion. Amiloride is less effective than spironolactone to reduce renal potassium excretion. PMID:22966789

  13. Anthocyanin and Carotenoid Contents in Different Cultivars of Chrysanthemum (Dendranthema grandiflorum Ramat.) Flower.

    PubMed

    Park, Chang Ha; Chae, Soo Cheon; Park, Soo-Yun; Kim, Jae Kwang; Kim, Yong Joo; Chung, Sun Ok; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah; Park, Sang Un

    2015-01-01

    The flowers of twenty-three cultivars of Dendranthema grandiflorum Ramat. were investigated to determine anthocyanin and carotenoid levels and to confirm the effects of the pigments on the flower colors using high-performance liquid chromatography (HPLC) and electrospray ionization-mass spectrometry (ESI-MS). The cultivars contained the anthocyanins cyanidin 3-glucoside (C3g) and cyanidin 3-(3"-malonoyl) glucoside (C3mg) and the following carotenoids: lutein, zeaxanthin, ?-cryptoxanthin, 13-cis-?-carotene, ?-carotene, trans-?-carotene, and 9-cis-?-carotene. The cultivar "Magic" showed the greatest accumulation of total and individual anthocyanins, including C3g and C3gm. On the other hand, the highest level of lutein and zeaxanthin was noted in the cultivar "Il Weol". The cultivar "Anastasia" contained the highest amount of carotenoids such as trans-?-carotene, 9-cis-?-carotene, and 13-cis-?-carotene. The highest accumulation of ?-cryptoxanthin and ?-carotene was noted in the cultivar "Anastasia" and "Il Weol". Our results suggested that 'Magic", "Angel" and "Relance' had high amounts of anthocyanins and showed a wide range of red and purple colors in their petals, whereas "Il Weol', "Popcorn Ball' and "Anastasia" produced higher carotenoid contents and displayed yellow or green petal colors. Interestingly, "Green Pang Pang", which contained a high level of anthocyanins and a medium level of carotenoids, showed the deep green colored petals. "Kastelli", had high level of carotenoids as well as a medium level of anthocyanins and showed orange and red colored petals. It was concluded that each pigment is responsible for the petal's colors and the compositions of the pigments affect their flower colors and that the cultivars could be a good source for pharmaceutical, floriculture, and pigment industries. PMID:26083041

  14. An Analysis of Historical Records of Solar Variability, Volcanic Eruptions, and Climate Change in the Last Millennium

    NASA Astrophysics Data System (ADS)

    Pang, K. D.

    2003-12-01

    Studying past climate changes can help us better understand present natural variations and predict future trends. However, various reconstructions of the climate of the last 1000 years have given only broad similarities [Briffa, JGR 106, 2929, 2001]. The variances are partly due to uncertainties in the past radiative and aerosol forcing, and gaps in regional coverage. Another outstanding question is whether we are in a time similar to the Medieval Warm Period. From the frequencies of sunspot and aurora sightings, abundance of carbon-14 in the rings of long-lived trees, and beryllium-10 in the annual layers of polar ice cores, we have reconstructed the recent history of a variable Sun. In the past 1800 years the Sun has gone through nine cycles of changes in brightness. While these long-term changes account for less than 1% of the total irradiance, there is clear evidence that they affect the climate [Pang and Yau, Eos, 83, No. 43, 481, 2002]. We have analyzed Chinese historical weather records to fill the data void in this region. Reports of unseasonable cold are classified by the degree of severity: (1) Late (April-June) or early (July-Sept) killing frosts; (2) Bitter cold/heavy snowfall; and (3) heavy sustained snowfall, bitter cold with frozen wells, lakes, rivers, and icebound seas. The latter cases were often widespread and multi-year. All categories occurred most frequently during the coldest part of the Little Ice Age, with the coldest episodes in 1652-54, 1656, 1664, 1670-72, 1676-77, 1683, 1688-91, 1716 and 1718-19. They thus coincide with Maunder Minimum (1645-1715), when very few sunspots were seen-about one in ten years from China or Europe-indicative of a weakened Sun. There was only one Category 3 episode between the Maunder and Dalton Minima-in 1761, and two in the Dalton Minimum (1795-1825)-in 1796 and 1814-7. Analysis of proxy data has shown that the 1810's were among the coldest years in Europe [Briffa and Jones, in ``The Year Without a Summer,'' C.R. Harrignton, ed., 1992]. Large eruptions, of an unknown volcano in 1809 [Dai, JGR 96, 17361, 1991], at Mayon in 1814, and at Tambora in 1815, with the reduced solar luminosity seem to have been responsible. The Sun has slowly brightened since the Dalton Minimum. However, the climate of China remained cold through the 19th century, consistent with world climate trend [Bradley and Jones, Holocene 3, 367, 1993], possibly due to increased volcanic aerosol loading of the atmosphere [Sato, JGR 98, 22987, 1993]. In the 200 years prior to the Maunder Minimum, there was at least one other major planetwide volcanically forced cold episode-in 1453-54. The climate of China appears to have been warm during the Late 14th-Century Solar Maximum (1350-1410). We have found only one report of early killing frost-in May, 1993. It then turned cold during the Sporer Minimum (140-1590) [Pang and Yau, op. cit.]. Category 3 cold episodes occurred in 1453-54, 1513, 1569, and 1577-78. Lesser ones were also more common. The coldest was in 1453-54, due to a Tamboran class eruption that broke a big island in New Hebrides Arc in two, separated by a 12X6X1 km submarine caldera Kuwae. The volcanic chill was felt worldwide, with extensive reporting in China [Pang, Eos 74, No. 43, 196, 1993]. Reduced solar luminosity may have also contributed to the cold climate of that decade, as was the case in the 1810's. We conclude that the climate of China in the past 650 years generally follows world trend. The major forcing seems to have been changing solar luminosity, perturbed by frequent volcanic eruptions.

  15. [Activities of Colorado University

    NASA Technical Reports Server (NTRS)

    Snow, Theodore P.; Bierbaum, Veronica

    2003-01-01

    During the report period we completed several studies and embarked on a new set of laboratory experiments. We also hired a new post-doctoral Research Associate, Momir Stepanovic, who has gradually assumed leadership in the laboratory work. The other person involved has been graduate student Brian Eichelberger, who will complete his Ph.D. based on this work by late spring of this year. We have also continued to collaborate with our previous postdoctoral Research Associate, Valery Le Page, through a consulting arrangement. In the following sections we summarize work that has been completed and either in print, in press, or in final stages of preparation for publication; current work being carried out in the laboratory; and plans for the coming year. Work completed in 2002: 1. Modeling the physical and chemical states of PAHs in the diffuse interstellar medium. 2. Hydrogenation and charge states of polycyclic aromatic hydrocarbons in diffuse clouds. 3. Laboratory studies of chemical reactions involving carbon chain anions.

  16. STS-96 FD Highlights and Crew Activities Report: Flight Day 03

    NASA Technical Reports Server (NTRS)

    1999-01-01

    On this third day of the STS-96 Discovery mission, the flight crew, Commander Kent V. Rominger, Pilot Rick D. Husband, and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette, and Valery Ivanovich Tokarev are seen executing the very first docking with the International Space Station. Also shown are views of the docking taken from both the Unity and Discovery. Final preparation for the mission's space walk is also presented. Jernigan and Barry check the tools and the emergency rescue backpacks they will need for their space walk. Ochoa and Jernigan perform leak and pressurization checks and open the hatch to the Unity module. Ochoa and Takarev store docking targets and lights and check the hatch seals in the narrow passageway. Rominger and Husband remove and store four electronic boxes around the Unity module.

  17. Final Report: High Energy Physics Program (HEP), Physics Department, Princeton University

    SciTech Connect

    Callan, Curtis G. [Princeton University; Gubser, Steven S. [Princeton University; Marlow, Daniel R. [Princeton University; McDonald, Kirk T. [Princeton University; Meyers, Peter D. [Princeton University; Olsen, James D. [Princeton University; Smith, Arthur J.S. [Princeton University; Steinhardt, Paul J. [Princeton University; Tully, Christopher G. [Princeton University; Stickland, David P. [Princeton University

    2013-04-30

    The activities of the Princeton Elementary particles group funded through Department of Energy Grant# DEFG02-91 ER40671 during the period October 1, 1991 through January 31, 2013 are summarized. These activities include experiments performed at Brookhaven National Lab; the CERN Lab in Geneva, Switzerland; Fermilab; KEK in Tsukuba City, Japan; the Stanford Linear Accelerator Center; as well as extensive experimental and the- oretical studies conducted on the campus of Princeton University. Funded senior personnel include: Curtis Callan, Stephen Gubser, Valerie Halyo, Daniel Marlow, Kirk McDonald, Pe- ter Meyers, James Olsen, Pierre Pirou#19;e, Eric Prebys, A.J. Stewart Smith, Frank Shoemaker (deceased), Paul Steinhardt, David Stickland, Christopher Tully, and Liantao Wang.

  18. International Program and Local Organizing Committees

    NASA Astrophysics Data System (ADS)

    2012-12-01

    International Program Committee Dionisio Bermejo (Spain) Roman Ciurylo (Poland) Elisabeth Dalimier (France) Alexander Devdariani (Russia) Milan S Dimitrijevic (Serbia) Robert Gamache (USA) Marco A Gigosos (Spain) Motoshi Goto (Japan) Magnus Gustafsson (Sweden) Jean-Michel Hartmann (France) Carlos Iglesias (USA) John Kielkopf (USA) John C Lewis (Canada) Valery Lisitsa (Russia) Eugene Oks (USA) Christian G Parigger (USA) Gillian Peach (UK) Adriana Predoi-Cross (Canada) Roland Stamm (Germany) Local Organizing Committee Nikolay G Skvortsov (Chair, St Petersburg State University) Evgenii B Aleksandrov (Ioffe Physico-Technical Institute, St Petersburg) Vadim A Alekseev (Scientific Secretary, St Petersburg State University) Sergey F Boureiko (St.Petersburg State University) Yury N Gnedin (Pulkovo Observatory, St Petersburg) Alexander Z Devdariani (Deputy Chair, St Petersburg State University) Alexander P Kouzov (Deputy Chair, St Petersburg State University) Nikolay A Timofeev (St Petersburg State University)

  19. Quarantine security of bananas at harvest maturity against Mediterranean and Oriental fruit flies (Diptera: Tephritidae) in Hawaii.

    PubMed

    Armstrong, J W

    2001-02-01

    Culled bananas (dwarf 'Brazilian', 'Grand Nain', 'Valery', and 'Williams') sampled from packing houses on the islands of Hawaii, Kauai, Maui, Molokai, and Oahu identified specific "faults" that were at risk from oriental fruit fly, Bactrocera dorsalis (Hendel), infestation. Faults at risk included bunches with precociously ripened bananas, or bananas with tip rot, fused fingers, or damage that compromised skin integrity to permit fruit fly oviposition into fruit flesh. No Mediterranean fruit fly, Ceratitis capitata (Wiedemann), or melon fly, B. cucurbitae (Coquillett), infestations were found in culled banana samples. Field infestation tests indicated that mature green bananas were not susceptible to fruit fly infestation for up to 1 wk past the scheduled harvest date when attached to the plant or within 24 h after harvest. Recommendations for exporting mature green bananas from Hawaii without risk of fruit fly infestation are provided. The research reported herein resulted in a USDA-APHIS protocol for exporting mature green bananas from Hawaii. PMID:11233129

  20. KSC-03PD-1400

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto holds a piece of the Commercial ITA Biomedical Experiments payload that was carried on mission STS-107 and recently recovered. She is the daughter of John Cassanto of ITA, who is part of a recovery team transferring experiments to alternate containers. One of the experiments was the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), a Planetary Society-sponsored astrobiology experiment developed by the Israeli Aerospace Medical Institute and the Johnson Space Center Astrobiology Center, with joint participation of an Israeli and a Palestinian student. The recovery team also includes Eran Schenker of the Israeli Aerospace Medical Institute; David Warmflash of JSC, and Louis Friedman, executive director of the Planetary Society. The GOBBSS material will be sent to JSC where the science team will analyze the samples, studying the effects of spaceflight on bacterial growth.

  1. KSC-03PD-1399

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - Valerie Cassanto holds a piece of the Commercial ITA Biomedical Experiments payload that was carried on mission STS-107 and recently recovered. She is the daughter of John Cassanto of ITA, who is part of a recovery team transferring experiments to alternate containers. One of the experiments was the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS), a Planetary Society-sponsored astrobiology experiment developed by the Israeli Aerospace Medical Institute and the Johnson Space Center Astrobiology Center, with joint participation of an Israeli and a Palestinian student. The recovery team also includes Eran Schenker of the Israeli Aerospace Medical Institute; David Warmflash of JSC, and Louis Friedman, executive director of the Planetary Society. The GOBBSS material will be sent to JSC where the science team will analyze the samples, studying the effects of spaceflight on bacterial growth.

  2. STS-90 Pilot Scott Altman is suited up for launch

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-90 Pilot Scott Altman is assisted during suit-up activities by Lockheed Suit Technician Valerie McNeil from Johnson Space Center in KSC's Operations and Checkout Building. Altman and the rest of the STS-90 crew will shortly depart for Launch Pad 39B, where the Space Shuttle Columbia awaits a second liftoff attempt at 2:19 p.m. EDT. His first trip into space, Altman is participating in a life sciences research flight that will focus on the most complex and least understood part of the human body - - the nervous system. Neurolab will examine the effects of spaceflight on the brain, spinal cord, peripheral nerves and sensory organs in the human body.

  3. STS-111 Flight Day 1 Highlights

    NASA Astrophysics Data System (ADS)

    2002-06-01

    On Flight Day 1 of STS-111, the crew of Endeavour (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist) and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer) being transported to the International Space Station (ISS) are shown preparing for launch in the suit-up room of the crew quarters, and then shown heading to the shuttle. Following commencement of the countdown, the launch is then shown, with close-ups of the rocket nozzles as lift-off occurs. Endeavour is shown as it gains altitude, accelerates to 2400 mph, and drops its solid rocket boosters. The video ends with video of Endeavour's payload bay, having been opened after leaving Earth's atmosphere.

  4. KSC-03PD-1398

    NASA Technical Reports Server (NTRS)

    2003-01-01

    KENNEDY SPACE CENTER, FLA. - John Cassanto of ITA and his daughter Valerie stand next to the table holding the Growth of Bacterial Biofilm on Surfaces during Spaceflight (GOBBSS) experiment that was carried on mission STS-107 as part of the Commercial ITA Biomedical Experiments payload. He is part of a recovery team transferring experiments to alternate containers. GOBBSS was a Planetary Society-sponsored astrobiology experiment developed by the Israeli Aerospace Medical Institute and the Johnson Space Center Astrobiology Center, with joint participation of an Israeli and a Palestinian student. The recovery team also includes Eran Schenker of the Israeli Aerospace Medical Institute; David Warmflash of JSC, and Louis Friedman, executive director of the Planetary Society. The GOBBSS material will be sent to JSC where the science team will analyze the samples, studying the effects of spaceflight on bacterial growth.

  5. STS-111 Endeavour launch from Launch Pad 39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour clears the lightning mast as it hurtles into space on mission STS-111 to the International Space Station. Liftoff occurred at 5:22:49 p.m. EDT. The STS-111 crew includes Commander Kenneth Cockrell, Pilot Paul Lockhart, and Mission Specialists Franklin Chang-Diaz and Philippe Perrin (CNES), as well as the Expedition Five crew members Valeri Korzun, Peggy Whitson and Sergei Treschev. This mission marks the 14th Shuttle flight to the International Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program.

  6. STS-111 Endeavour launch from Launch Pad 39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - With clouds of smoke and steam rolling below, Space Shuttle Endeavour rises above them as it roars toward space on mission STS-111 to the International Space Station. Liftoff occurred at 5:22:49 p.m. EDT. The STS-111 crew includes Commander Kenneth Cockrell, Pilot Paul Lockhart, and Mission Specialists Franklin Chang-Diaz and Philippe Perrin (CNES), as well as the Expedition Five crew members Valeri Korzun, Peggy Whitson and Sergei Treschev. This mission marks the 14th Shuttle flight to the International Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program.

  7. STS-111 Endeavour launch from Launch Pad 39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Erupting from the clouds of smoke below, Space Shuttle Endeavour roars into space on mission STS-111 to the International Space Station. Liftoff occurred at 5:22:49 p.m. EDT. The STS-111 crew includes Commander Kenneth Cockrell, Pilot Paul Lockhart, and Mission Specialists Franklin Chang-Diaz and Philippe Perrin (CNES), as well as the Expedition Five crew members Valeri Korzun, Peggy Whitson and Sergei Treschev. This mission marks the 14th Shuttle flight to the International Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program.

  8. STS-111 Endeavour launch from Launch Pad 39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Clouds of smoke and steam billow across Launch Pad 39A as Space Shuttle Endeavour roars toward space on mission STS-111 to the International Space Station. Liftoff occurred at 5:22:49 p.m. EDT. The STS-111 crew includes Commander Kenneth Cockrell, Pilot Paul Lockhart, and Mission Specialists Franklin Chang-Diaz and Philippe Perrin (CNES), as well as the Expedition Five crew members Valeri Korzun, Peggy Whitson and Sergei Treschev. This mission marks the 14th Shuttle flight to the International Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program.

  9. STS-111 Endeavour launch from Launch Pad 39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- Space Shuttle Endeavour clears the lightning mast as it hurtles into space on mission STS-111 to the International Space Station. Liftoff occurred at 5:22:49 p.m. EDT. The STS-111 crew includes Commander Kenneth Cockrell, Pilot Paul Lockhart, and Mission Specialists Franklin Chang-Diaz and Philippe Perrin (CNES), as well as the Expedition Five crew members Valeri Korzun, Peggy Whitson and Sergei Treschev. This mission marks the 14th Shuttle flight to the International Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program.

  10. STS-111 Endeavour launch from Launch Pad 39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- Birds take flight as Space Shuttle Endeavour lifts off from Launch Pad 39A on mission STS-111 to the International Space Station. Liftoff occurred at 5:22:49 p.m. EDT. The STS-111 crew includes Commander Kenneth Cockrell, Pilot Paul Lockhart, and Mission Specialists Franklin Chang-Diaz and Philippe Perrin (CNES), as well as the Expedition Five crew members Valeri Korzun, Peggy Whitson and Sergei Treschev. This mission marks the 14th Shuttle flight to the International Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program.

  11. STS-111 Flight Day 09 Highlights

    NASA Technical Reports Server (NTRS)

    2002-01-01

    The STS-111 flight crew consists of Kenneth D. Cockrell, Commander, Paul S. Lockhart, Pilot, Franklin R. Chang-Diaz, Mission Specialist, Philippe Perrin, (CNES), Mission Specialist, Valery G. Korzun, (RSA), ISS Up, Peggy A. Whitson, ISS Up , Sergei Y. Treschev (RSC), ISS Up, Yuri I. Onufriyenko (RSA), ISS Down, Carl E. Walz, and Daniel W. Bursch (ISS) Down. The main goal on this ninth day of flight STS-111, is to replace the wrist roll joint of the Robotic Arm on the International Space Station. Live footage of the wrist roll joint replacement is presented. Paul Lockhart is the spacewalk coordinator for this mission. Franklin Chang-Diaz and Philippe Perrin, are responsible for replacing the wrist roll joint and performing maintenance activities. The spacewalk to repair this joint occurs outside the Space Station's Quest Airlock. The wrist roll joint was replaced successfully. The spacewalk took approximately 7 hours and 17 minutes to complete.

  12. Could the Ways in Which Animals Regenerate Hair and Feathers Lead to Clues for Restoring Human Fingers and Toes?

    NSDL National Science Digital Library

    APS Communications Office (American Physiological Society Communications Office)

    2012-05-10

    Press release - The latest issue of the journal Physiology contains a review article that looks at possible routes that unlock cellular regeneration in general, and the principles by which hair and feathers regenerate themselves in particular. The authors apply what is currently known about regenerative biology to the emerging field of regenerative medicine, which is being transformed from fantasy to reality.The Review is entitled Â?Physiological Regeneration of Skin Appendages and Implications for Regenerative MedicineÂ? and was written by Cheng-Ming Chuong, Randall B. Widelitz, Ping Wu, and Ting-Xin Jiang of the University of Southern California, and Valerie A. Randall of the University of Bradford. It appears in the current edition of Physiology, published by the American Physiological Society.

  13. Archives of American Mathematics Spotlight

    NSDL National Science Digital Library

    The Archives of American Mathematics (AAM) is a unit of the Dolph Briscoe Center for American History at the University of Texas at Austin. It is the only US archival repository dedicated solely to collecting and preserving the papers and records of mathematicians and mathematical organizations. On this site, visitors can read about the history of the AAM in an interview with Carol Mead, who is the chief archivist at the AAM. After that, visitors should go along to the Featured Collections area, which contains papers from over a dozen distinguished mathematicians including Paul Halmos, William Chinn, and Lawrence Biedenharn. One area that should not be missed is the Two Audio Collections. Here, visitors can listen to selected shows from the "Math Medley Program," which featured interviews with a range of mathematicians, including Sue White and Valerie DeBellis on the "Emotions of Mathematics."

  14. STS-91 Day 04 Highlights

    NASA Technical Reports Server (NTRS)

    1998-01-01

    On this forth day of the STS-91 mission, the flight crew, Cmdr. Charles J. Precourt, Pilot Dominic L. Pudwill Gorie and Mission Specialists Wendy B. Lawrence, Franklin R. Chang-Diaz, Janet L. Kavandi, and Valery Victorovitch Ryumin are awakened to the sounds of 'South Australia,' honoring Thomas who is a native of Adelaide in South Australia. The nine astronauts and cosmonauts aboard Discovery-Mir are spending their first full day of joint operations continuing the transfer of about four tons of logistical supplies and equipment. Much of the day is spent transferring water, scientific gear and other hardware between the two spacecraft. The crew members had transferred five bags of water to the Mir by the end of the day.

  15. STS-96 M.S. Ochoa checks out equipment at the SPACEHAB Facility

    NASA Technical Reports Server (NTRS)

    1999-01-01

    STS-96 Mission Specialist Ellen Ochoa gets a hands-on look at equipment at the SPACEHAB Facility. Members of the STS-96 crew are taking part in a bench review at SPACEHAB as part of familiarization activities for their upcoming mission. The crew also includes Commander Kent V. Rominger, Pilot Rick Husband and Mission Specialists Tamara E. Jernigan, Daniel Barry, Julie Payette and Valery Ivanovich Tokarev. Payette is with the Canadian Space Agency and Tokarev with the Russian Space Agency. Mission STS-96 is the second flight in construction of the International Space Station and will include the SPACEHAB. The 10-day mission is targeted for launch on May 24, 1999, at Launch Pad 39B.

  16. Urinary excretion of AQP2 and ENaC in autosomal dominant polycystic kidney disease during basal conditions and after a hypertonic saline infusion.

    PubMed

    Graffe, Carolina Cannillo; Bech, Jesper Nørgaard; Lauridsen, Thomas Guldager; Pedersen, Erling Bjerregaard

    2012-04-15

    Renal handling of sodium and water is abnormal in chronic kidney diseases. To study the function and regulation of the aquaporin-2 water channel (AQP2) and the epithelial sodium channel (ENaC) in autosomal dominant polycystic kidney disease (ADPKD), we measured urinary excretion of AQP2 (u-AQP2), the ?-subunit of ENaC (u-ENaC(?)), cAMP (u-cAMP), and prostaglandin E(2) (u-PGE(2)); free water clearance (C(H2O)); fractional sodium excretion (FE(Na)); and plasma vasopressin (p-AVP), renin (p-Renin), angiotensin II (p-ANG II), aldosterone (p-Aldo), and atrial and brain natriuretic peptide (p-ANP, p-BNP) in patients with ADPKD and healthy controls during 24-h urine collection and after hypertonic saline infusion during high sodium intake (HS; 300 mmol sodium/day) and low sodium intake (LS; 30 mmol sodium/day). No difference in u-AQP2, u-ENaC(?), u-cAMP, u-PGE(2), C(H2O), and vasoactive hormones was found between patients and controls at baseline, but during HS the patients had higher FE(Na). The saline caused higher increases in FE(Na) in patients than controls during LS, but the changes in u-ENaC(?), p-Aldo, p-ANP, p-BNP, p-Renin, and p-ANG II were similar. Higher increases in u-AQP2 and p-AVP were seen in patients during both diets. In conclusion, u-AQP2 and u-ENaC(?) were comparable in patients with ADPKD and controls at baseline. In ADPKD, the larger increase in u-AQP2 and p-AVP in response to saline could reflect an abnormal water absorption in the distal nephron. During LS, the larger increase in FE(Na) in response to saline could reflect a defective renal sodium retaining capacity in ADPKD, unrelated to changes in u-ENaC(?). PMID:22262484

  17. Do Changes in Muscle Architecture Affect Post-Activation Potentiation?

    PubMed Central

    Reardon, Danielle; Hoffman, Jay R.; Mangine, Gerald T.; Wells, Adam J.; Gonzalez, Adam M.; Jajtner, Adam R.; Townsend, Jeremy R.; McCormack, William P.; Stout, Jeffrey R.; Fragala, Maren S.; Fukuda, David H.

    2014-01-01

    The purpose of this randomized, cross-over design study was to examine the effect of three different muscle potentiation protocols on acute changes in muscle architecture and vertical jump performance. Eleven experienced, resistance trained men (25.2±3.6y) completed three potentiation squat protocols using moderate intensity (MI; 75%, 3 sets x 10 repetitions), high intensity (HI; 90%, 3 sets x 3 repetitions) and 100% (1RM; 1 set x 1repetition) of their 1RM. In addition, all participants completed a control session (CTL) in which no protocol was performed. During each testing session, muscle architecture and vertical jump testing were assessed at baseline (BL), 8min post (8P) and 20min post (20P) workout. Ultrasound measures included cross sectional area (CSA) and pennation angle (PANG) of both the rectus femoris (RF) and vastus lateralis (VL). Following each ultrasound measure, peak vertical jump power (PVJP) and mean (MVJP) power was assessed using an accelerometer. Magnitude based inferences were used to make comparisons between trials. The MI trial resulted in a likely greater increase from BL to 8P and 20P in RF-CSA and VL-CSA, while the HI trial resulted in a likely greater change from BL to 20P in both RF-CSA and VL-CSA. Meanwhile, changes in PVJP and MVJP for the MI trial was likely decreased at BL-8P and BL–20P, while the HI trial was shown to result in a likely or possible decrease compared to CTL at BL-8P and BL–20P, respectively. A likely negative relationship was observed between changes in VL-PANG and MVJP (r = -0.35; p , 0.018) at BL-8P, and between changes in PVJP and RF-CSA (r = -0.37; p , 0.014) at BL–20P. Results of this study were unable to demonstrate any potentiation response from the trials employed, however these protocols did result in acute muscle architectural changes. Key points Three squat protocols using moderate intensity (75% 1-RM; 3 sets x 10 repetitions), high intensity (90% 1-RM, 3 sets x 3 repetitions) and maximal intensity (100% 1RM; 1 set x 1repetition) were unable to potentiate jump height or jump power in experienced, resistance trained men. Experienced, resistance trained athletes who are not competitive may be limited in regards to potentiation due to a poor level of conditioning. Both the moderate and high intensity potentiation protocols stimulated acute changes in muscle architecture. Greater increases in the CSA of both the RF and VL muscles were noted. A different potentiation protocol may have elicited greater changes in muscle architecture. PMID:25178394

  18. Eclipses and the Olympics

    NASA Astrophysics Data System (ADS)

    Pang, K. D.; Yau, K. K.

    2000-12-01

    Like returns of Halley's comet the Olympic games occur periodically, though not as regularly in antiquity. Dates were also imprecise due to the chaotic calendars in use. Reported sightings of comets and eclipses can be used with game dates to help fix ancient events. However some reported darkening of the sun, e.g., after Julius Caesar's murder in 44 BC, was due to volcanic eruptions. A red comet, visible in daylight, first appeared during the games that year. It was also seen from China and Korea (Pang, Sciences 31, 30). Phlegon's ``Olympiads" (2nd century) says that Christ's crucifixion was in the 4th year of the 202nd Olympiad (AD 29-33), when a total solar eclipse occurred in the 6th hour. Only the Nov. 24, AD 29 eclipse over Asia Minor can match that, and Joel's prophecy (Acts 2, 14-21) that ``the sun will be turned to darkness and moon to blood." However it conflicts with ``the first day of Passover," as recorded by Mathew, Mark and Luke, i.e., full moon in early spring. Humphreys and Waddington (Nature 306, 743) have suggested meteorological darkening and the April 3, AD 33 lunar eclipse instead. Schaefer has questioned the eclipse's visibility from Jerusalem (31.46N, 35.14E). The six computations he cited gave dissimilar answers due to the imprecise rates of the secular lunar acceleration, and lengthening of the day used (Q.Jl.R.astr.Soc. 31, 53). Lunar laser ranging has since fixed the former at -26"/cen2. Analysis of ancient Chinese solar eclipse records, e.g., the April 21, 899 BC and April 4, AD 368 ``double dawns" over Zheng, has given us a delta T (in sec) = 30t2, where t is centuries before 1800 (Pang, Yau and Chou, in ``Dynamics of Ice Age Earth: A Modern Perspective," 1998). Our computations show that the moon rose over Jerusalem, with 1/3 still in the umbra and the rest in penumbra. Holdover meteorological darkening with long absorption air mass could have help reddened the moon also. Finally the first ``eclipse season" (the Aug. 21 lunar, and Sept. 6 solar, eclipses) were recorded in China in 776 BC, the year of the first Olympiad. A total solar eclipse (August 1, 2008) will occur during the 29th modern Olympiad (July 25-Aug. 10), with its path of totality ending in a spectacular ``double sunset" over Zheng, China (34.5N, 110E).

  19. Massive soliton stars

    NASA Technical Reports Server (NTRS)

    Chiu, Hong-Yee

    1990-01-01

    The structure of nontopological solutions of Einstein field equations as proposed by Friedberg, Lee, and Pang (1987) is examined. This analysis incorporates finite temperature effects and pair creation. Quarks are assumed to be the only species that exist in interior of soliton stars. The possibility of primordial creation of soliton stars in the incomplete decay of the degenerate vacuum in early universe is explored. Because of dominance of pair creation inside soliton stars, the luminosity of soliton stars is not determined by its radiative transfer characteristics, and the surface temperature of soliton stars can be the same as its interior temperature. It is possible that soliton stars are intense X-ray radiators at large distances. Soliton stars are nearly 100 percent efficient energy converters, converting the rest energy of baryons entering the interior into radiation. It is possible that a sizable number of baryons may also be trapped inside soliton stars during early epochs of the universe. In addition, if soliton stars exist they could assume the role played by massive black holes in galactic centers.

  20. Host-foraging success of three species of Trichogramma (Hymenoptera: Trichogrammatidae) in a simulated retail environment.

    PubMed

    Grieshop, Matthew J; Flinn, Paul W; Nechols, James R; Schöller, Matthias

    2007-04-01

    Three species of trichogrammatid egg parasitoids (Trichogramma deion Pinto & Oatman, Trichogramma ostriniae Pang & Chen, and Trichogramma pretiosum Riley) (Hymenoptera: Trichogrammatidae) were evaluated under laboratory conditions as potential biological control agents for the Indianmeal moth, Plodia interpunctella (Hübner) (Lepidoptera: Pyralidae), on retail shelves. A single shelving unit was used in each trial and a grid of sentinel egg disks was used to evaluate foraging success. The shelving consisted of pallet units with five shelves that were either bare or stocked with empty cereal boxes. In each replicate, approximately 500 female Trichogramma were released at the center of the shelving unit and allowed to forage for 48 h. Percentage of egg parasitism and percentage of host egg mortality were recorded after 7 d. Foraging success as well as the spatial pattern of parasitism differed significantly among the three Trichogramma species. Percentage of egg parasitism was approximately 4 times greater for T. deion than for T. ostriniae or T. pretiosum. The vertical distribution of parasitism by T. deion was also more uniform than for the other two species. In addition, the presence of packaging affected the foraging efficiency of T. ostriniae and T. pretiosum but not T. deion. Based on these findings, Trichogramma deion may be the best-suited candidate for augmentative biological control of P. interpunctella in retail stores, and a central release point of T. deion will likely provide adequate coverage of products on pallet-type shelving. PMID:17461088

  1. Complete Calabi-Yau metrics from Kahler metrics in D=4

    SciTech Connect

    Leston, Mauricio [Instituto de Astronomia y Fisica del Espacio (IAFE), Buenos Aires, Argentina Casilla de Correo 67 - Suc. 28 (C1428ZAA), Ciudad Autonoma de Buenos Aires (Argentina); Santillan, Osvaldo P. [Departamento de Matematica, FCEyN, Universidad de Buenos Aires, Buenos Aires - 2010 Ciudad Universitaria - Pabellon I - (C1428EGA), Buenos Aires (Argentina)

    2010-10-15

    In the present work, a family of Calabi-Yau manifolds with a local Hamiltonian Killing vector is described in terms of a nonlinear equation whose solutions determine the local form of the geometries. The main assumptions are that the complex (3, 0)-form is of the form e{sup ik{Psi}}, where {Psi} is preserved by the Killing vector, and that the space of the orbits of the Killing vector is, for fixed value of the momentum map coordinate, a complex 4-manifold, in such a way that the complex structure of the 4-manifold is part of the complex structure of the complex 3-fold. The family considered here include the ones considered in A. Fayyazuddin, Classical Quantum Gravity 24, 3151 (2007); O. P. Santillan, Classical Quantum Gravity 27, 155013 (2010); H. Lu, Y. Pang, and Z. Wang, Classical Quantum Gravity 27, 155018 (2010) as a particular case. We also present an explicit example with holonomy exactly SU(3) by use of the linearization introduced in A. Fayyazuddin, Classical Quantum Gravity 24, 3151 (2007), which was considered in the context of D6 branes wrapping a complex 1-cycle in a hyperkahler 2-fold.

  2. Osteology of Huabeisaurus allocotus (Sauropoda: Titanosauriformes) from the Upper Cretaceous of China

    PubMed Central

    D'Emic, Michael D.; Mannion, Philip D.; Upchurch, Paul; Benson, Roger B. J.; Pang, Qiqing; Zhengwu, Cheng

    2013-01-01

    Background The Late Cretaceous titanosauriform sauropod Huabeisaurus allocotus Pang and Cheng is known from teeth and much of the postcranial skeleton. Its completeness makes it an important taxon for integrating and interpreting anatomical observations from more fragmentary Cretaceous East Asian sauropods and for understanding titanosauriform evolution in general. Methodology/Principal Findings We present a detailed redescription of Huabeisaurus allocotus and a suite of anatomical comparisons with other titanosauriforms that demonstrate its validity via autapomorphies (e.g., division of some presacral vertebral laminae, reduced development of caudal ribs, the development of fossae relative to one another in caudal vertebral neural arches, high tibia-to-femur ratio). Huabeisaurus shares many features with other Cretaceous East Asian sauropods (e.g., pendant cervical ribs, anterior-middle caudal vertebrae with a nearly flat anterior centrum face and a concave posterior centrum face) that are absent in sauropods from other landmasses and strata, suggesting a close relationship among many of these forms within the clade Somphospondyli. Conclusions/Significance Restudy of Huabeisaurus provides further evidence for the existence of a clade of somphospondylans – Euhelopodidae – mainly found in the Cretaceous of East Asia. Euhelopodidae represents a fourth example of the evolution of narrow crowns within Sauropoda, along with diplodocoids, brachiosaurids, and advanced titanosaurs (lithostrotians). Despite being known from fewer species than Diplodocoidea, Brachiosauridae, or Lithostrotia, euhelopodids possessed a broader range of tooth shapes than any of these clades, suggesting that euhelopodids exemplified a comparably broad range of feeding strategies and perhaps diets. PMID:23936326

  3. Fermion frontiers in vector lattice gauge theories: Proceedings. Volume 8

    SciTech Connect

    NONE

    1998-11-01

    The inclusion of fermions into simulations of lattice gauge theories is very difficult both theoretically and numerically. With the presence of Teraflops-scale computers for lattice gauge theory, the authors wanted a forum to discuss new approaches to lattice fermions. The workshop concentrated on approaches which are ripe for study on such large machines. Although lattice chiral fermions are vitally important to understand, there is not technique at hand which is viable on these Teraflops-scale machines for real-world problems. The discussion was therefore focused on recent developments and future prospects for QCD-like theories. For the well-known fermion formulations, the Aoki phase in Wilson fermions, novelties of U{sub A}(1) symmetry and the {eta}{prime} for staggered fermions and new approaches for simulating the determinant for Wilson fermions were discussed. The newer domain-wall fermion formulation was reviewed, with numerical results given by many speakers. The fermion proposal of Friedberg, Lee and Pang was introduced. They also were able to compare and contrast the dependence of QCD and QCD-like SUSY theories on the number of quark flavors. These proceedings consist of several transparencies and a summary page from each speaker. This should serve to outline the major points made in each talk.

  4. The mechanism and properties of bio-photon emission and absorption in protein molecules in living systems

    NASA Astrophysics Data System (ADS)

    Pang, Xiao-feng

    2012-05-01

    The mechanism and properties of bio-photon emission and absorption in bio-tissues were studied using Pang's theory of bio-energy transport, in which the energy spectra of protein molecules are obtained from the discrete dynamic equation. From the energy spectra, it was determined that the protein molecules could both radiate and absorb bio-photons with wavelengths of <3 ?m and 5-7 ?m, consistent with the energy level transitions of the excitons. These results were consistent with the experimental data; this consisted of infrared absorption data from collagen, bovine serum albumin, the protein-like molecule acetanilide, plasma, and a person's finger, and the laser-Raman spectra of acidity I-type collagen in the lungs of a mouse, and metabolically active Escherichia coli. We further elucidated the mechanism responsible for the non-thermal biological effects produced by the infrared light absorbed by the bio-tissues, using the above results. No temperature rise was observed; instead, the absorbed infrared light promoted the vibrations of amides as well the transport of the bio-energy from one place to other in the protein molecules, which changed their conformations. These experimental results, therefore, not only confirmed the validity of the mechanism of bio-photon emission, and the newly developed theory of bio-energy transport mentioned above, but also explained the mechanism and properties of the non-thermal biological effects produced by the absorption of infrared light by the living systems.

  5. Structural and stratigraphic evolution of the East Georges Bank Basin, offshore Nova Scotia, Canada

    SciTech Connect

    Carswell, A.B. (Esso Canada Resources Ltd., Calgary, Alberta (Canada)); Koning, T. (Texaco Canada Petroleum, Inc., Calgary, Alberta (Canada)); Hibbs, D.C. (Conoco Canada Ltd., Calgary, Alberta (Canada))

    1990-05-01

    The East Georges Bank Basin is located offshore Nova Scotia on the southeastern Canadian continental shelf. The basin covers 2.5 million ac and is one of the last undrilled basins in North America. The geological interpretation is almost entirely based on 16,000 km of seismic data over the basin. Pertinent well control is limited to 10 wells on the US portion of the Georges Bank (West Georges Bank Basin) and two wells on the Scotian shelf. Seismic-stratigraphic analysis of this data has led to a structural and stratigraphic model for the basin. The basin formed during the Triassic when the landmass of Pange began separating along rift zones. A prominent Paleozoic basement high, the Yarmouth Arch separated the East Georges Bank Basin from the West Georges Bank Basin and had a dominant influence on sedimentation until the Middle Jurassic. Early synrift sequences consist of lacustrine clastics and shales. Marine incursions began in the late Triassic resulting in massive salt deposits that reflect the restricted extent of the basin and the arid Triassic and Early Jurassic climate. Further continental separation during the Early Jurassic resulted in deposition of carbonates and evaporites followed by Middle Jurassic continental shelf carbonates and deltaic sands. During the Middle Jurassic, major growth faulting and halokinesis was initiated by progradation of the deltaic sands. Post Middle Jurassic continental spreading in combination with changing climatic conditions resulted in a steady decline of carbonate sedimentation and dominance of clastic deposition throughout the remaining history of the basin.

  6. Measurement of microscopic coupling constants between atoms on a surface: Combination of LEEM observation with lattice model analysis

    NASA Astrophysics Data System (ADS)

    Akutsu, Noriko

    2014-12-01

    We present a method combining low-energy electron microscopy (LEEM) and lattice model analysis for measuring the microscopic lateral coupling constants between atoms on a surface. The calculated step (interface) stiffness in a honeycomb lattice Ising model with the nearest neighbor and the second nearest neighbor interactions (J1 = 93.8 meV and J2 = 9.38 meV) matched the experimental step quantity values on an Si(111)(1 × 1) surface reported by Pang et al. and Bartelt et al. based on LEEM measurements. The experimental value of step tension obtained by Williams et al. lies on the calculated step tension curve. The polar graphs of the step tension and a two-dimensional island shape at the temperature T = 1163 K also agree well with the experimental graphs reported by Métois and Müller. The close agreement between the LEEM observations and the lattice model calculations on a Si(111) surface suggests that our method is also suitable for measuring microscopic lateral coupling constants on the surface of other materials that are less well-studied than Si.

  7. Composite KRFM-ISM spectrum of Phobos (0.315-3.1 microns)

    NASA Astrophysics Data System (ADS)

    Bibring, J. P.; Ksanfomaliti, L. V.; Langevin, I.; Moroz, V. I.; Combes, M.; Grigor'ev, A. V.; Khatuntsev, I. V.; Nikol'Skii, Iu. V.; Zharkov, A. V.

    1992-09-01

    The spectrum of a portion of the Phobos surface was measured at the same points by two instruments (KRFM and ISM) on board the Phobos-2 mission in two ranges: 0.315-0.6 and 0.8-3.1 microns. An example of a spectrum based on data from both experiments obtained in the same locations is presented and discussed. It is substantially different from a previously published 'average' spectrum of Phobos Pang et al. (1978). There is no direct analogue to the presented spectrum among the known reflectivity spectra of meteorites and asteroids. The spectral reflectivity of the observed part of Phobos is like carbonaceous C1-C2 chondrites for the range below 0.6 micron, but not above 0.8 micron, where it shows a rise of reflectivity with wavelength even stronger than in the case of CM chondrites. No traces of the hydration band near 3 microns are visible. The nature of the surface layer is probably complicated, and it consists of inhomogeneous material.

  8. Solar wind-magnetosphere interaction during the possible encounter of Comet Halley's tail in 1910 inferred from mid-latitude geomagnetic field disturbances

    NASA Astrophysics Data System (ADS)

    Iyemori, T.; Araki, T.

    Geomagnetic disturbances from the period April to June 1910 are analyzed to detect the possible effects of the Comet Halley on the solar wind-magnetosphere interaction. Data from six midlatitude geomagnetic observatories are used to calculate the longitudinally symmetric (i.e., Dst) and asymmetric fields. An application of a linear prediction filter to separate the solar wind dynamic pressure effect on the disturbances from that of the ring current, suggests that there exists a compressional variation in the Dst on May 18 which is around or slightly earlier than the time of estimated cometary tail encounter. The normal-run magnetogram from Agincourt on the dayside and that from Lu-Kia-Pang on the nightside, also indicate rather strong (i.e., 30-40 nT) compressional variation. The disturbances characteristic to the solar wind-magnetosphere interaction under the southward IMF condition and that of the ring current development are seen during the period. These results suggest that the earth's magnetosphere had been affected by a dense cometary plasma tail with high dynamic pressure, though the solar wind-magnetosphere interaction typically observed under the southward IMF condition had been taking place during the encounter.

  9. Massive soliton stars

    NASA Astrophysics Data System (ADS)

    Chiu, Hong-Yee

    1990-05-01

    The structure of nontopological solutions of Einstein field equations as proposed by Friedberg, Lee, and Pang (1987) is examined. This analysis incorporates finite temperature effects and pair creation. Quarks are assumed to be the only species that exist in interior of soliton stars. The possibility of primordial creation of soliton stars in the incomplete decay of the degenerate vacuum in early universe is explored. Because of dominance of pair creation inside soliton stars, the luminosity of soliton stars is not determined by its radiative transfer characteristics, and the surface temperature of soliton stars can be the same as its interior temperature. It is possible that soliton stars are intense X-ray radiators at large distances. Soliton stars are nearly 100 percent efficient energy converters, converting the rest energy of baryons entering the interior into radiation. It is possible that a sizable number of baryons may also be trapped inside soliton stars during early epochs of the universe. In addition, if soliton stars exist they could assume the role played by massive black holes in galactic centers.

  10. A self-consistent evaluation of the rate constants for the production of the OI 6300 A airglow

    NASA Astrophysics Data System (ADS)

    Link, R.; McConnell, J. C.; Shepherd, G. G.

    1981-06-01

    The considered evaluation shows that the revised quenching rate of O(1D) by N2 in the thermosphere derived from the data of Hays et al. (1978) is k(N2) = 2.3 x 10 to the -11th cc/s, in excellent agreement with the laboratory results of Streit et al. (1976). The laboratory measurements of the O(1D) and O(1S) transition coefficients by Kernahan and Pang (1975) are consistent with the aeronomic results of Frederick et al. (1976), Kopp et al. (1977), Hays et al. (1978), and Rusch et al. (1978) and are in agreement with the theoretical calculations. The revised value of J(O2) = 1.5 x 10 to the -6th per s is in agreement with the observations of Heroux and Swirbalus (1976). The specific recombination rate of O2(+) leading to the production of O(1D) is alpha(1D) = 2.1 x 10 to the -7th cc/s at ionospheric electron temperatures, in good agreement with the laboratory measurement by Zipf (1970).

  11. Infection of rice plants by rice black streaked dwarf virus improves an egg parasitoid, Anagrus nilaparvatae (Hymenoptera: Mymaridae), of rice planthoppers.

    PubMed

    Xu, Hongxing; He, Xiaochan; Zheng, Xusong; Yang, Yajun; Tian, Junce; Lu, Zhongxian

    2014-10-01

    The effects of rice plants infected by rice black streaked dwarf virus (RBSDV) on the host preference, duration of immature stages, sex ratio, and adult longevity and parasitic capacity of an egg parasitoid, Anagrus nilaparvatae Pang et Wang, of rice brown planthopper, Nilaparvata lugens Stål, were evaluated. Tests of response to plant volatiles using an olfactometer showed that A. nilaparvatae preferred rice plants harboring rice brown planthopper eggs over plants free of rice brown planthopper eggs. However, both the response to plant volatiles and the host selectivity test showed no significant differences in host preference between RBSDV-infected plants and healthy plants when both contained rice brown planthopper eggs. The developmental duration at immature stage of the male A. nilaparvatae in rice brown planthopper eggs on RBSDV-infected rice plants was significantly prolonged, and the parasitic capacity of rice brown planthopper eggs was significantly increased in comparison with the A. nilaparvatae parasite in rice brown planthopper eggs on healthy rice plants. There were no significant differences between RBSDV-infected rice plants and healthy rice plants in other ecological fitness parameters, including the developmental duration of female adults, female percentage, and adult longevity of A. nilaparvatae. PMID:25199055

  12. Identifying Pathways for Improving Household Food Self-Sufficiency Outcomes in the Hills of Nepal

    PubMed Central

    Karki, Tika B.; Sah, Shrawan K.; Thapa, Resam B.; McDonald, Andrew J.; Davis, Adam S.

    2015-01-01

    Maintaining and improving household food self-sufficiency (FSS) in mountain regions is an ongoing challenge. There are many facets to the issue, including comparatively high levels of land fragmentation, challenging terrain and transportation bottlenecks, declining labor availability due to out-migration, and low technical knowledge, among others. Using a nonparametric multivariate approach, we quantified primary associations underlying current levels of FSS in the mid-hills of Nepal. A needs assessment survey was administered to 77 households in Lungaun (Baglung District), Pang (Parbat District), and Pathlekhet (Myagdi District), with a total of 80 variables covering five performance areas; resulting data were analyzed using Classification and Regression Trees. The most parsimonious statistical model for household FSS highlighted associations with agronomic management, including yields of maize and fingermillet within a relay cropping system and adoption of improved crop cultivars. Secondary analyses of the variables retained in the first model again focused primarily on crop and livestock management. It thus appears that continued emphasis on technical agricultural improvements is warranted, independent of factors such as land holding size that, in any case, are very difficult to change through development interventions. Initiatives to increase household FSS in the mid-hills of Nepal will benefit from placing a primary focus on methods of agricultural intensification to improve crop yields and effective technology transfer to increase adoption of these methods. PMID:26047508

  13. Understanding Sun-Climate Connection by Analysis of Historical Sunspot, Auroral and Weather Records

    NASA Astrophysics Data System (ADS)

    Pang, K. D.; Yau, K. K.

    2005-12-01

    Fifty years of galactic cosmic ray data show changes with the solar cycle. Deflection of the highly energetic particles from exploding supernovae by the solar wind and associated magnetic field also modulates cosmogenic radioisotope production high in the atmosphere. The same trends are seen in carbon-14 and beryllium-10 abundances from long-lived trees and polar ice cores, respectively. Total solar irradiances measured by satellite radiometers show a 0.1% variance over the last two solar cycles, with only a small effect on global temperatures. A longer view is obviously needed. During the Maunder Minimum (1645-1715) sunspots were rarely seen. Total solar irradiances, reconstructed from historical sunspot data, were 0.24% lower, correlating nicely with an estimated 0.5-degree drop in Northern Hemisphere surface temperatures during the Little Ice Age [Lean and Rind, J. Clim. 11, 3069, 1998]. A longer time series has been reconstructed from even earlier records. From the frequencies of sunspot and auroral sightings in East Asian and European chronicles, C-14 and Be-10 abundances we have reconstructed the recent history of a variable Sun. In the past 1800 years the Sun has gone through nine cycles of brightness change. Although these long-term changes were <1% they have clearly affected the climate [Pang and Yau, Eos 83, No. 43, 481, 2002]. We have also analyzed Chinese historical weather records for comparison. Reports of unseasonable cold are classified by their degree of severity: (1) Late (April-June) or early (July-Sept.) killing frosts; (2) Bitter cold/heavy snowfall; and (3) Heavy sustained snowfall, bitter cold with frozen wells, lakes, rivers and icebound seas. The latter cases were often widespread and multi-year. All categories occurred most often during Maunder Minimum. The Category 3 episodes were in 1652-54, 1656, 1664, 1670-72, 1676-77, 1683, 1688-91, 1716 and 1718-19. The coldest time 1670-1697 coincides with lows in aurora sightings and numerical model simulated temperatures, and highs in radioisotope production. There was only one Category 3 episode between the Maunder and Dalton Minima-in 1761 (due to a big eruption); and two in the Dalton Minimum (1795-1825)-in 1796 and 1814-17. The 1815 Tambora eruption, with the reduced solar luminosity, seem to have been responsible for the "year without summer" and long-cold spell. The Sun has brightened since the Dalton Minimum, but the climate of China stayed cold through the 19th century. However there were only two Category 3 episodes: in 1841 and 1877. The onset of global warming reduced that to just once in the 20th century: 1955. The climate of China seems to have been warm during the Late 14th-Century Maximum (1350-1410). We have found only one Category 1 episode: in 1393. It then turned cold during the Sporer Minimum (1410-1590). Category 3 episodes occurred in 1453-54, 1493, 1513, 1569, and 1577-78. The early 1453 great Kuwae eruption apparently deepened and prolonged the first [Pang, Eos 74, No. 43, 106, 1993; Simarski, Aramco World 47, No.6, 8, 1996]. We conclude that the climate of China in the past 650 years generally follows world trend. The major forcing seems to have been changing solar luminosity, as all but four severe weather episodes coincide with solar minimum. The exact mechanism remains unknown, but could have been increased cloudiness.

  14. Changes in urinary excretion of water and sodium transporters during amiloride and bendroflumethiazide treatment

    PubMed Central

    Jensen, Janni M; Mose, Frank H; Kulik, Anna-Ewa O; Bech, Jesper N; Fenton, Robert A; Pedersen, Erling B

    2015-01-01

    AIM: To quantify changes in urinary excretion of aquaporin2 water channels (u-AQP2), the sodium-potassium-chloride co-transporter (u-NKCC2) and the epithelial sodium channels (u-ENaC) during treatment with bendroflumethiazide (BFTZ), amiloride and placebo. METHODS: In a randomized, double-blinded, placebo-controlled, 3-way crossover study we examined 23 healthy subjects on a standardized diet and fluid intake. The subjects were treated with amiloride 5 mg, BFTZ 1.25 mg or placebo twice a day for 4.5 d before each examination day. On the examination day, glomerular filtration rate was measured by the constant infusion clearance technique with 51Cr-EDTA as reference substance. To estimate the changes in water transport via AQP2 and sodium transport via NKCC2 and ENaC, u-NKCC2, the gamma fraction of ENaC (u-ENaC?), and u-AQP2 were measured at baseline and after infusion with 3% hypertonic saline. U-NKCC2, u-ENaC?, u-AQP2 and plasma concentrations of vasopressin (p-AVP), renin (PRC), angiotensin II (p-ANG II) and aldosterone (p-Aldo) were measured, by radioimmunoassay. Central blood pressure was estimated by applanation tonometry and body fluid volumes were estimated by bio-impedance spectroscopy. General linear model with repeated measures or related samples Friedman’s two-way analysis was used to compare differences. Post hoc Bonferroni correction was used for multiple comparisons of post infusion periods to baseline within each treatment group. RESULTS: At baseline there were no differences in u-NKCC2, u-ENaC? and u-AQP2. PRC, p-Ang II and p-Aldo were increased during active treatments (P < 0.001). After hypertonic saline, u-NKCC2 increased during amiloride (6% ± 34%; P = 0.081) and increased significantly during placebo (17% ± 24%; P = 0.010). U-AQP2 increased significantly during amiloride (31% ± 22%; P < 0.001) and placebo (34% ± 27%; P < 0.001), while u-NKCC2 and u-AQP2 did not change significantly during BFTZ (-7% ± 28%; P = 0.257 and 5% ± 16%; P = 0.261). U- ENaC? increased in all three groups (P < 0.050). PRC, AngII and p-Aldo decreased to the same extent, while AVP increased, but to a smaller degree during BFTZ (P = 0.048). cDBP decreased significantly during BFTZ (P < 0.001), but not during amiloride or placebo. There were no significant differences in body fluid volumes. CONCLUSION: After hypertonic saline, u-NKCC2 and u-AQP2 increased during amiloride, but not during BFTZ. Lower p-AVP during BFTZ potentially caused less stimulation of NKCC2 and AQP2 and subsequent lower reabsorption of water and sodium.

  15. The Earth's Interaction With the Sun Over the Millennia From Analyses of Historical Sunspot, Auroral and Climate Records

    NASA Astrophysics Data System (ADS)

    Yau, K.

    2001-12-01

    A prolonged decrease in the Sun's irradiance during the Maunder Minimum has been proposed as a cause of the Little Ice Age ({ca} 1600-1800). Eddy [{Science} {192}, 1976, 1189] made this suggestion after noting that very few sunspots were observed from 1645 to 1715, indicative of a weakened Sun. Pre-telescopic Oriental sunspot records go back over 2200 years. Periods when no sunspots were seen have been documented by, {eg}, Clark [{Astron} {7}, 2/1979, 50]. Abundances of C 14 in tree rings and Be10 in ice cores are also good indicators of past solar activity. These isotopes are produced by cosmic rays high in the atmosphere. When the Sun is less active more of them are made and deposited at ground level. There is thus a strong {negative} correlation between their abundances and sunspot counts. Minima of solar activity in tree rings and a south polar ice core have been collated by, {eg}, Bard [{Earth Planet Sci Lett} {150} 1997, 453]; and show striking correspondence with periods when no sunspots were seen, centered at {ca} 900, 1050, 1500, 1700. Pang and Yau [{Eos} {79}, #45, 1998, F149] investigated the Medieval Minimum at 700, using in addition the frequency of auroral sighting7s, a good indicator of solar activity too [Yau, PhD thesis, 1988]; and found that the progression of minima in solar activity goes back to 700. Auroral frequency, C 14 and Be 10 concentrations are also affected by variations in the geomagnetic field. Deposition changes can also influence C 14 and Be 10 abundances. Sunspot counts are thus the only true indicator of solar activity. The Sun's bolometric variations (-0.3% for the Maunder Minimum) can contribute to climatic changes (\\0.5° C for the Little Ice Age)[{eg}, Lean, {GRL} {22}, 1995, 3195]. For times with no thermometer data, temperature can be estimated from, {eg}, Oxygen 18 isotopic abundance in ice cores, which in turn depends on the temperature of the ocean water it evaporated from. We have linked the Medieval Minimum to the cold spell, dated to {ca} 700 by Dansgaard [{Nature} {255}, 1974, 24]. Using records of advances and retreats of glaciers, previous researchers have linked it to a cold spell in the previous two centuries instead, thus requiring an offset in timescales. Our literature search has yielded more records of sunspot sightings, and established the fifth century as a minimum of solar activity, ending in a maximum at {ca} 500. These features and the minimum at 700 match contemporary deviations of atmospheric C 14 from a secular trend, due primarily to long-term changes in the strength of the Earth's magnetic moment [Stuiver, {Radiocarbon} {35}, 215]. Pang has shown that the climate of Eurasia was cold in the 5th century, due partly to volcanic cooling [{Eos} {80}, #46, 1999, F220]. Reduced solar luminosity may have contributed to that too. The cold apparently forced massive southward migrations of Teutonic and Asian barbarians into the Roman Empire, ending it in 476. Europe was plunged into the Dark Age, from which it did not recover until the climate warmed up again toward the end of the millennium. Finally, climate changes can also be produced by greenhouse warming, reorganization of ocean current systems "Dansgaard-Oeschger events," the Earth's orbital variations "Milankovitch effects," {etc}. Continued analysis of historical records, in conjunction with other proxy data, can help shed light on the nature of the Earth's interactions with the Sun, and the causes of past climate changes.

  16. Effects of intra- and interpatch host density on egg parasitism by three species of Trichogramma.

    PubMed

    Grieshop, Matthew J; Flinn, Paul W; Nechols, James R

    2010-01-01

    Host-foraging responses to different intra- and interpatch densities were used to assess three Trichogramma spp. (Hymenoptera: Trichogrammatidae) Trichogramma deion Pinto and Oatman, T. ostriniae Pang and Chen, and T. pretiosum Riley - as potential biological control agents for the Indian meal moth, Plodia interpunctella Hübner (Lepidoptera: Pyralidae). Single naïve females were allowed 6 h to forage in Plexiglas arenas with four different spatial arrangements of host eggs, nine single-egg patches), nine four-egg patches, 36 single-egg patches, and 36 four-egg patches. No significant differences were found among species in the number of patches parasitized. As expected, all three species parasitized the most eggs in the 36 four-egg patch treatment and the least in the nine single-egg patch treatment. T. deion parasitized significantly more eggs than T. pretiosum on the nine four-egg patches. T. ostriniae parasitized significantly more patches when intrapatch density was greater, regardless of interpatch density. In contrast, T. deion only parasitized more patches at the greater intrapatch density when the interpatch density was low. Patch density had no effect on T. pretiosum. The spatial pattern of parasitism was more aggregated for T. deion and T. ostriniae in the 36 four-egg patches treatment compared to the 36 single-egg patches treatment. Therefore, intrapatch density was more important than interpatch density for T. ostriniae, and potentially for T. deion, but not for T. pretiosum. T. deion may be the best candidate for augmentative biological control because it parasitized either slightly or significantly more eggs than the other two species in all four treatments. Furthermore, the pattern of parasitism by T. deion in the 36 four-egg patches treatment was the most aggregated among the three species, suggesting a more thorough searching pattern. In contrast, T. pretiosum had the least aggregated pattern of parasitism and therefore may have used a more random foraging pattern. PMID:20673123

  17. Effects of Intra- and Interpatch Host Density on Egg Parasitism by Three Species of Trichogramma

    PubMed Central

    Grieshop, Matthew J.; Flinn, Paul W.; Nechols, James R.

    2010-01-01

    Host-foraging responses to different intra- and interpatch densities were used to assess three Trichogramma spp. (Hymenoptera: Trichogrammatidae) Trichogramma deion Pinto and Oatman, T. ostriniae Pang and Chen, and T. pretiosum Riley — as potential biological control agents for the Indian meal moth, Plodia interpunctella Hübner (Lepidoptera: Pyralidae). Single naïve females were allowed 6 h to forage in Plexiglas arenas with four different spatial arrangements of host eggs, nine single-egg patches), nine four-egg patches, 36 single-egg patches, and 36 four-egg patches. No significant differences were found among species in the number of patches parasitized. As expected, all three species parasitized the most eggs in the 36 four-egg patch treatment and the least in the nine single-egg patch treatment. T. deion parasitized significantly more eggs than T. pretiosum on the nine four-egg patches. T. ostriniae parasitized significantly more patches when intrapatch density was greater, regardless of interpatch density. In contrast, T. deion only parasitized more patches at the greater intrapatch density when the interpatch density was low. Patch density had no effect on T. pretiosum. The spatial pattern of parasitism was more aggregated for T. deion and T. ostriniae in the 36 four-egg patches treatment compared to the 36 single-egg patches treatment. Therefore, intrapatch density was more important than interpatch density for T. ostriniae, and potentially for T. deion, but not for T. pretiosum. T. deion may be the best candidate for augmentative biological control because it parasitized either slightly or significantly more eggs than the other two species in all four treatments. Furthermore, the pattern of parasitism by T. deion in the 36 four-egg patches treatment was the most aggregated among the three species, suggesting a more thorough searching pattern. In contrast, T. pretiosum had the least aggregated pattern of parasitism and therefore may have used a more random foraging pattern. PMID:20673123

  18. Comparison of Three Amyloid Assembly Inhibitors: The Sugar scyllo-Inositol, the Polyphenol Epigallocatechin Gallate, and the Molecular Tweezer CLR01

    PubMed Central

    2012-01-01

    Many compounds have been tested as inhibitors or modulators of amyloid ?-protein (A?) assembly in hope that they would lead to effective, disease-modifying therapy for Alzheimer’s disease (AD). These compounds typically were either designed to break apart ?-sheets or selected empirically. Two such compounds, the natural inositol derivative scyllo-inositol and the green-tea-derived flavonoid epigallocatechin gallate (EGCG), currently are in clinical trials. Similar to most of the compounds tested thus far, the mechanism of action of scyllo-inositol and EGCG is not understood. Recently, we discovered a novel family of assembly modulators, Lys-specific molecular tweezers, which act by binding specifically to Lys residues and modulate the self-assembly of amyloid proteins, including A?, into formation of nontoxic oligomers by a process-specific mechanism (Sinha, S., Lopes, D. H., Du, Z., Pang, E. S., Shanmugam, A., Lomakin, A., Talbiersky, P., Tennstaedt, A., McDaniel, K., Bakshi, R., Kuo, P. Y., Ehrmann, M., Benedek, G. B., Loo, J. A., Klarner, F. G., Schrader, T., Wang, C., and Bitan, G. (2011) Lysine-specific molecular tweezers are broad-spectrum inhibitors of assembly and toxicity of amyloid proteins. J. Am. Chem. Soc.133, 16958–16969). Here, we compared side-by-side the capability of scyllo-inositol, EGCG, and the molecular tweezer CLR01 to inhibit A? aggregation and toxicity. We found that EGCG and CLR01 had comparable activity whereas scyllo-inositol was a weaker inhibitor. Exploration of the binding of EGCG and CLR01 to A? using heteronuclear solution-state NMR showed that whereas CLR01 bound to the two Lys and single Arg residues in A? monomers, only weak, nonspecific binding was detected for EGCG, leaving the binding mode of the latter unresolved. PMID:22860214

  19. Pre-Venus-Transit Dark Lunar Eclipse Reveals a Very Large Volcanic Eruption in 1761

    NASA Astrophysics Data System (ADS)

    Pang, Kevin

    2009-01-01

    Kepler's third law states Sun-planet distances in AU. International observations of the solar parallax during the 1761/1769 Venus transits gave us the first AU in miles. Benjamin Franklin promoted American participation in the project. While serving as Ambassador to France he observed that a "dry fog” from the 1783 Laki eruption in Iceland had obscured the Sun, and led to a cold summer and winter. Using Benjamin Franklin's method I analyzed photometric observations of the dark lunar eclipse made just before the 1761 Venus transit, ice core, tree ring, and Chinese weather data, and conclude that a very large previously unknown volcanic eruption in early 1761 had cooled the world climate. Observers worldwide found the 18 May 1761 totally eclipsed Moon very dark or invisible, e.g., Wargentin could not see the Moon for 38 minutes even with a 2-ft telescope (Phil. Trans. 52, 208, 1761-1762). Since the totally eclipsed Moon is illuminated only by sunlight refracted by the Earth's atmosphere, the obscuration must have been very severe. Ice cores from Greenland and Antarctica have large sulfuric acid contents in 1761-1762, precipitated from the global volcanic acid cloud (Zeilinski, J. Geophys. Res. 102, 26625, 1997). Frost-damaged rings in American bristlecone pines confirm that 1761 was very cold (LaMarche, Nature 307, 121, 1984). Contemporary Chinese chronicles report that heavy sustained snow fell from the Tropic of Cancer to the Yellow River. Wells and rivers froze, e.g., Taihu "Great Lake” and nearby Yangtze tributaries were not navigable. Innumerable trees, birds and livestock perished, etc. All observations are consistent with the above conclusion. Finally Benjamin Franklin's criteria for a climate-altering volcanic eruption are still universally used. Moreover his legacy continues to inspire climate researchers. See Pang, Eos 74, no. 43, 106, 1993; and as cited in "Earth in Balance,” Al Gore, p. 379, 1993.

  20. Obstetric Medical Book and Women's Childbirth in Qing Dynasty: The Case of the Treatise on Easy Childbirth.

    PubMed

    Yu, Yon Sil

    2015-04-01

    Ye Feng composed what was to become one of the most famous and widely-circulating medical works of the late imperial period, the Treatise on Easy Childbirth. Ye Feng proposed the idea of natural childbirth, When the correct moment for birth had arrived, the child would leave its mother's body as easily as "a ripe melon drops from the stem". He argued attempts to facilitate birth were therefore not only unnecessary, and female midwives artificial intervention was not required. However, this view is to overlook the pangs of childbirth, and women bear responsibility for the failure of delivery. So his views reflect the gender order in male-dominated. Also he constructed the negative image of the midwife and belittle her childbirth techniques. As a result, midwife are excluded from the childbirth field, male doctors grasp guardianship rights of the female body. Ye Feng declared that the key to safe and successful delivery could be summed up in just a few words: "sleep, endure the pain, delay approaching the birthing tub". This view must be consistent with the Confucian norms, women to export to equip the 'patience' and 'self-control'. These norms were exposed desire men want to monitor and control the female body, effect on consolidation of patriarchal family order. In sum, the discourse of "a ripe melon drops from the stem"and "sleep, endure the pain, delay approaching the birthing tub" comprised an important intellectual resource that male doctors drew on to legitimate themselves as superior overseers of women's gestational bodies. PMID:25985779

  1. [Meal replacement as a dietary therapy for weight control. Assessment in males and females with different degrees of obesity].

    PubMed

    Vidal-Guevara, Ma L; Samper, Ma; Martínez-Silla, G; Canteras, M; Ros, G; Gil, A; Abellán, P

    2004-01-01

    Obesity is a metabolic disorder characterized by an increase in the fat in adipose tissue above certain limits, manifested by morphological alterations and excess weight. This condition is one of the most significant epidemics of this century due to over-eating and the ease of access to food. On the other hand, the direct relationship between obesity and the greater risk of suffering cardiovascular disease, diabetes or cancer means that consumers are demanding products, whether medicines or foodstuffs, that will allow them to overcome this situation and improve both their physical appearance and their health. The goal of this project was to identify the efficacy and safety of a dietary product, a meal replacement, within the setting of a balanced hypocaloric diet established for weight loss. To this end, a total of 47 volunteers of both sexes between the ages of 23 and 58, all employees of the Hero España, S.A. company, took part in a test in which eleven of them acted as the "control group" and ate only the low-calorie diet while the rest formed a "problem group" and replaced one meal (with a minimum of 500 calories) with a 200-calorie meal replacement. Participants were subjected to anthropometric measurements, blood pressure testing and a blood chemistry analysis before and after the test period, as well as to weekly weight checks. Those individuals with the highest Body Mass Index showed a greater weight loss than those with a lower index. The volunteers did not note any hunger pangs until three hours after consumption of the meal replacement and the health-status parameters analyzed did not show any anomalous values. Therefore, it is concluded that the replacement product studied allows controlled weight loss over 3 weeks when accompanied by a balanced low-calorie diet and it also produces a sensation of fullness in those consuming it. PMID:15315111

  2. A numerical study on the density driven circulation in the Yellow Sea Cold Water Mass

    NASA Astrophysics Data System (ADS)

    Zhou, Chunyan; Dong, Ping; Li, Guangxue

    2015-06-01

    The circulation of Yellow Sea Cold Water Mass (YSCWM) in the Southern Yellow Sea is investigated using a diagnostic 2D MITgcm model. The resolution of the computational grid is 900 m in the horizontal and 2 m in the vertical where an initial temperature distribution corresponding to a typical measured Yellow Sea Cold Water Mass was applied. The existence of YSCWM that causes fluid density difference, is shown to produce counter-rotating cyclonic horizontal eddies in the surface layer: the inner one is anti-cyclonic (clockwise) and relatively weaker (8-10 cm s-1) while the outer one is cyclonic (anti-clockwise) and much stronger (15-20 cm s-1). This result is consistent with the surface pattern observed by Pang et al. (2004), who has shown that a mesoscale anti-cyclonic eddy (clockwise) exists in the upper layer of central southern Yellow Sea, and a basin-scale cyclonic (anticlockwise) gyre lies outside of the anti-cyclonic eddy, based on the trajectories and drifting velocities of 23 drifters. Below the thermocline, there is an anti-cyclonic (clockwise) circulation. This complex current eddy system is considered to be capable of trapping suspended sediments and depositing them near the front between YSCWM and the coastal waters off the Subei coast, providing an explanation on the sediment depth and size distribution of mud patches in the Southern Yellow Sea. Moreover, sensitive test scenarios indicate that variations of bottom friction do not substantially change the main features of the circulation structure, but will reduce the bottom current velocity, increase the surface current velocity and weaken the upwelling around the frontal area.

  3. The retinaldehyde reductase DHRS3 is essential for preventing the formation of excess retinoic acid during embryonic development

    PubMed Central

    Billings, Sara E.; Pierzchalski, Keely; Butler Tjaden, Naomi E.; Pang, Xiao-Yan; Trainor, Paul A.; Kane, Maureen A.; Moise, Alexander R.

    2013-01-01

    Oxidation of retinol via retinaldehyde results in the formation of the essential morphogen all-trans-retinoic acid (ATRA). Previous studies have identified critical roles in the regulation of embryonic ATRA levels for retinol, retinaldehyde, and ATRA-oxidizing enzymes; however, the contribution of retinaldehyde reductases to ATRA metabolism is not completely understood. Herein, we investigate the role of the retinaldehyde reductase Dhrs3 in embryonic retinoid metabolism using a Dhrs3-deficient mouse. Lack of DHRS3 leads to a 40% increase in the levels of ATRA and a 60% and 55% decrease in the levels of retinol and retinyl esters, respectively, in Dhrs3?/? embryos compared to wild-type littermates. Furthermore, accumulation of excess ATRA is accompanied by a compensatory 30–50% reduction in the expression of ATRA synthetic genes and a 120% increase in the expression of the ATRA catabolic enzyme Cyp26a1 in Dhrs3?/? embryos vs. controls. Excess ATRA also leads to alterations (40–80%) in the expression of several developmentally important ATRA target genes. Consequently, Dhrs3?/? embryos die late in gestation and display defects in cardiac outflow tract formation, atrial and ventricular septation, skeletal development, and palatogenesis. These data demonstrate that the reduction of retinaldehyde by DHRS3 is critical for preventing formation of excess ATRA during embryonic development.—Billings, S. E., Pierzchalski, K., Butler Tjaden, N. E., Pang, X.-Y., Trainor, P. A., Kane, M. A., Moise, A. R. The retinaldehyde reductase DHRS3 is essential for preventing the formation of excess retinoic acid during embryonic development. PMID:24005908

  4. Significant ELCAP analysis results: Summary report. [End-use Load and Consumer Assessment Program

    SciTech Connect

    Pratt, R.G.; Conner, C.C.; Drost, M.K.; Miller, N.E.; Cooke, B.A.; Halverson, M.A.; Lebaron, B.A.; Lucas, R.G.; Jo, J.; Richman, E.E.; Sandusky, W.F. (Pacific Northwest Lab., Richland, WA (USA)); Ritland, K.G. (Ritland Associates, Seattle, WA (USA)); Taylor, M.E. (USDOE Bonneville Power Administration, Portland, OR (USA)); Hauser, S.G. (Solar Energy Research Inst., Golden, CO (USA))

    1991-02-01

    The evolution of the End-Use Load and Consumer Assessment Program (ELCAP) since 1983 at Bonneville Power Administration (Bonneville) has been eventful and somewhat tortuous. The birth pangs of a data set so large and encompassing as this have been overwhelming at times. The early adolescent stage of data set development and use has now been reached and preliminary results of early analyses of the data are becoming well known. However, the full maturity of the data set and the corresponding wealth of analytic insights are not fully realized. This document is in some sense a milestone in the brief history of the program. It is a summary of the results of the first five years of the program, principally containing excerpts from a number of previous reports. It is meant to highlight significant accomplishments and analytical results, with a focus on the principal results. Many of the results have a broad application in the utility load research community in general, although the real breadth of the data set remains largely unexplored. The first section of the document introduces the data set: how the buildings were selected, how the metering equipment was installed, and how the data set has been prepared for analysis. Each of the sections that follow the introduction summarize a particular analytic result. A large majority of the analyses to date involve the residential samples, as these were installed first and had highest priority on the analytic agenda. Two exploratory analyses using commercial data are included as an introduction to the commercial analyses that are currently underway. Most of the sections reference more complete technical reports which the reader should refer to for details of the methodology and for more complete discussion of the results. Sections have been processed separately for inclusion on the data base.

  5. Color Variations Of Saturn's Small Satellites: The Ring Connection

    NASA Astrophysics Data System (ADS)

    Morrison, Sarah J.; Helfenstein, P.; Thomas, P.; Veverka, J.; Denk, T.

    2009-09-01

    We investigate color hetereogeneities among Pandora, Janus, Epimetheus, and Telesto in calibrated high resolution (<1.5 km/pixel) Cassini Imaging Subsystem (ISS) images over the UV3 (338 nm) , GRN (568 nm), IR3 (930 nm) broadband filters. The whole-disk color ratios show a progression with increasing distance from Saturn from Pandora to Telesto (and from the F-ring to the E-ring) . The mode UV3/IR3 ratio for Pandora is 0.5; for Janus and Epimetheus it is 0.6 and is 1.0 for Telesto. The systematic increase of blueness toward the E-ring may be a result of contamination by E-ring particles injected by the cryovolcanic plume eruptions from Enceladus (Pang et al. 1984, JGR 89, 9459-9470). All of these satellites exhibit subtle regional color variations that deviate no more than +/-0.2 from the modal ratio value. These variations may reflect different geologic compositional units or grain sizes. Telesto is the most uniform with ratio differences that are mostly less than +/- 0.04. Pandora has a UV3/IR3 ratio variation generally less than +/-0.12 that shows different material in parts of larger crater interiors. Janus has a latitudinal UV3/IR3 variation in which the south is redder than the north, which is consistent with VIMS observations of Janus (Filacchione et al. 2009, LPSC 40, 1780). Many crater rims on Epimetheus have UV3/IR3 ratios distinct from smoother surroundings.

  6. Drawing, Engraving, Photographing, Plotting, and Printing: Recent results in the historical study of visual representations

    NASA Astrophysics Data System (ADS)

    Hentschel, K.

    As an introduction, I survey the recent literature on nonverbal - in particular visual - representations in the history of astronomy and astrophysics, for which pictorial records form an integral part, and identify areas in need of more in-depth historical study. One example is Daston & Galison's distinction of three types of atlases: first (predominantly since the 18th century), the highly idealized `metaphysical' image; second (prevalent in the second half of the 19th century), the `mechanical' image ideally produced without human intervention; third (mostly in the 20th century), `typified' patterns, with corresponding upgrading of human skills for Gestalt recognition. Related to the second type of representation is the high cultural value of photography, welcomed then in the hope that henceforth `Nature herself' would be her own recorder, thus promising to do away with the problems of human bias and artistic limitations. Recent studies on research practice, e.g., in the mapping of spectra or astronomical image-processing, have shown, however, that human intervention still is present at many levels of the recording and printing process. Alex Pang's papers on Victorian representations of the solar corona and on astrophotography are discussed as trailblazing examinations of the interplay between observers and their photomechanical printing agents. My recent paper on the culture of visual representations in spectroscopic education and laboratory instruction is presented as an extension into the area of teaching and dissemination: how were spectroscopy students trained in stellar classification, or element identification? More generally: how are visual cultures, or image traditions, as Peter Galison puts it in Image and Logic (1997), formed and stabilized?

  7. Development of high quantum efficiency, flat panel, thick detectors for megavoltage x-ray imaging: a novel direct-conversion design and its feasibility.

    PubMed

    Pang, G; Rowlands, J A

    2004-11-01

    Most electronic portal imaging devices (EPIDs) developed to date, including recently developed flat panel systems, have low x-ray absorption, i.e., low quantum efficiency (QE) of 2%-4% as compared to the theoretical limit of 100%. A significant increase of QE is desirable for applications such as a megavoltage cone-beam computed tomography (MVCT) and megavoltage fluoroscopy. However, the spatial resolution of an imaging system usually decreases significantly with an increase of QE. The key to the success in the design of a high QE detector is therefore to maintain the spatial resolution. Recently, we demonstrated theoretically that it is possible to design a portal imaging detector with both high QE and high resolution [see Pang and Rowlands, Med. Phys. 29, 2274 (2002)]. In this paper, we introduce such a novel design consisting of a large number of microstructured plates (made by, e.g., photolithographic patterning of evaporated or electroplated layers) packed together and aligned with the incident x rays. On each plate, microstrip charge collectors are focused toward the x-ray source to collect charges generated in the ionization medium (e.g., air or gas) surrounded by high-density materials that act as x-ray converters. The collected charges represent the x-ray image and can be read out by various means, including a two-dimensional (2-D) active readout matrix. The QE, spatial resolution, and sensitivity of the detector have been calculated. It has been shown that the new design will have a QE of more than an order of magnitude higher and a spatial resolution equivalent to that of flat panel systems currently used for portal imaging. The new design is also quantum noise limited down to very low doses (approximately 1-2 radiation pulses of the linear accelerator). PMID:15587653

  8. Apollo-Soyuz Test Project (ASTP)

    NASA Technical Reports Server (NTRS)

    1974-01-01

    This artist's concept depicts the Apollo-Soyuz Test Project (ASTP) with insets of photographs of three U.S. astronauts (Thomas Stafford, Vance Brand, and Donald Slayton) and two U.S.S.R. cosmonauts (Alexei Leonov and Valeri Kubasov). The objective of the ASTP mission was to accomplish the first docking of a standardized international system, the U.S.'s Apollo spacecraft and the U.S.S.R.'s Soyuz spacecraft, in space. The Soyuz spacecraft was launched from the Baikonur Cosmodrome near Tyuratam in the Kazakh, Soviet Socialist Republic, at 8:20 a.m. (EDT) on July 15, 1975. The Apollo spacecraft was launched from Launch Complex 39B, Kennedy Space Center, Florida, at 3:50 p.m. (EDT) on July 15, 1975. The Primary objectives of the ASTP were achieved. They performed spacecraft rendezvous, docking and undocking, conducted intervehicular crew transfer, and demonstrated the interaction of U.S. and U.S.S.R. control centers and spacecraft crews. The mission marked the last use of a Saturn launch vehicle. The Marshall Space Flight Center was responsible for development and sustaining engineering of the Saturn IB launch vehicle during the mission.

  9. Artist's Concept of the Apollo-Soyuz Test Project

    NASA Technical Reports Server (NTRS)

    1974-01-01

    This artist's concept depicts the Apollo-Soyuz Test Project (ASTP), the first international docking of the U.S.'s Apollo spacecraft and the U.S.S.R.'s Soyuz spacecraft in space. The objective of the ASTP mission was to provide the basis for a standardized international system for docking of marned spacecraft. The Soyuz spacecraft, with Cosmonauts Alexei Leonov and Valeri Kubasov aboard, was launched from the Baikonur Cosmodrome near Tyuratam in the Kazakh, Soviet Socialist Republic, at 8:20 a.m. (EDT) on July 15, 1975. The Apollo spacecraft, with Astronauts Thomas Stafford, Vance Brand, and Donald Slayton aboard, was launched from Launch Complex 39B, Kennedy Space Center, Florida, at 3:50 p.m. (EDT) on July 15, 1975. The Primary objectives of the ASTP were achieved. They performed spacecraft rendezvous, docking and undocking, conducted intervehicular crew transfer, and demonstrated the interaction of U.S. and U.S.S.R. control centers and spacecraft crews. The mission marked the last use of a Saturn launch vehicle. The Marshall Space Flight Center was responsible for development and sustaining engineering of the Saturn IB launch vehicle during the mission.

  10. STS-111 Flight Day 8 Highlights

    NASA Astrophysics Data System (ADS)

    2002-06-01

    On Flight Day 8 of STS-111 (Space Shuttle Endeavour crew includes: Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist; International Space Station (ISS) Expedition 5 crew includes Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer; ISS Expedition 4 crew includes: Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer), the Leonardo Multi Purpose Logistics Module (MPLM) is shown from the outside of the ISS. The MPLM, used to transport goods to the station for the Expedition 5 crew, and to return goods used by the Expedition 4 crew, is being loaded and unloaded by crewmembers. Live video from within the Destiny Laboratory Module shows Whitson and Chang-Diaz. They have just completed the second of three reboosts planned for this mission, in each of which the station will gain an additional statutory mile in altitude. Following this there is an interview conducted by ground-based reporters with some members from each of the three crews, answering various questions on their respective missions including sleeping in space and conducting experiments. Video of Earth and space tools precedes a second interview much like the first, but with the crews in their entirety. Topics discussed include the feelings of Bursch and Walz on their breaking the US record for continual days spent in space. The video ends with footage of the Southern California coastline.

  11. STS-111 Flight Day 3 Highlights

    NASA Astrophysics Data System (ADS)

    2002-06-01

    On Flight Day 3 of STS-111, the crew of Endeavour (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist) and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer), begin their final approach towards the International Space Station (ISS). From cameras aboard the ISS, live video of Endeavour is shown as it approaches the station. The Orbiter is maneuvered slowly to a position for docking, and cameras from multiple angles show this process. As it is maneuvered, there are clear views of its payload bay, which includes the Leonardo MultiPurpose Logistics Module (MPLM) and the Mobile Base System (MBS), both of which will be installed on the ISS during this mission. In the final stages of the docking procedure there is close-up footage of Endeavour meeting the ISS's Pressurized Mating Adapter 2 on the Destiny Laboratory Module. Inside the ISS, the Expedition 4 crew (Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer), which will be replaced by the Expedition 5 crew, prepares for final docking. Crew members are shown transferring equipment from the Endeavour to the ISS, prior to a replay of the mating of the two crafts. In the replay, the hatch is shown being opened and the two newly arrived crews are greeted with excitement by Expedition 4 crewmembers. The video closes with footage of the Quest airlock used for EVA (extravehicular activity) egress, and the Canadarm 2 robotic arm.

  12. STS-113 Flight Day 6 Highlights

    NASA Astrophysics Data System (ADS)

    2002-11-01

    This video shows the activities of the STS-113 crew (Jim Wetherbee, Commander; Paul Lockhart, Pilot; Michael Lopez-Alegria, John Herrington, Mission Specialists) during flight day 6. Also shown are the Expedition 5 (Valeri Korzun, Commander; Peggy Whitsun, ISS Science Officer/Flight Engineer; Sergei Treschev, Flight Engineer) and Expedition 6 (Kenneth Bowersox, Commander; Donald Pettit, Nikolai Budarin, Flight Engineers) crews of the ISS (International Space Station). The primary activity of flight day 6 is the outfitting of the P1 (Port 1) Truss Structure. The suiting up and departure of Lopez-Alegria and Herrington through the ISS Quest airlock is shown. The departure is shown through sequential still video. The ISS CETA handrail cart is shown in use, as is a pistol-grip space tool. At the end of the EVA, the astronauts are shown cleaning up outside the ISS. The video also contains a Thanksgiving message about the importance of technological advances in spaceflight, and footage of the Moon disappearing behind the Earth's limb.

  13. STS-111 Flight Day 2 Highlights

    NASA Technical Reports Server (NTRS)

    2002-01-01

    On Flight Day 2 of STS-111, the crew of Endeavour (Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist) and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer), having successfully entered orbit around the Earth, begin to maneuver towards the International Space Station (ISS), where the Expedition 5 crew will replace the Expedition 4 crew. Live video is shown of the Earth from several vantage points aboard the Shuttle. The center-line camera, which will allow Shuttle pilots to align the docking apparatus with that on the ISS, provides footage of the Earth. Chang-Diaz participates in an interview, in Spanish, conducted from the ground via radio communications, with Cockrell also appearing. Footage of the Earth includes: Daytime video of the Eastern United States with some cloud cover as Endeavour passes over the Florida panhandle, Georgia, and the Carolinas; Daytime video of Lake Michigan unobscured by cloud cover; Nighttime low-light camera video of Madrid, Spain.

  14. STS-96 Mission Specialist Jernigan prepares to enter Discovery as part of TCDT activities

    NASA Technical Reports Server (NTRS)

    1999-01-01

    In the white room, an environmental chamber at Launch Pad 39B, Mission Specialist Tamara E. Jernigan (Ph.D.) gets ready to enter the orbiter Discovery. Helping her with her equipment are (left to right) Mike Birkenscher, Travis Thompson and James Davis. The STS-96 crew are taking part in Terminal Countdown Demonstration Test (TCDT) activities, which provide opportunities to inspect the mission payloads in the orbiter's payload bay, as well as simulated countdown exercises and emergency egress training. Other crew members are Commander Kent V. Rominger, Pilot Rick Douglas Husband, and Mission Specialists Ellen Ochoa (Ph.D.), Daniel Barry (M.D., Ph.D.), Julie Payette, who is with the Canadian Space Agency, and Valery Ivanovich Tokarev, who is with the Russian Space Agency. STS-96, scheduled for liftoff on May 20 at 9:32 a.m., is a logistics and resupply mission for the International Space Station, carrying such payloads as a Russian crane, the Strela; a U.S.-built crane; the Spacehab Oceaneering Space System Box (SHOSS), a logistics items carrier; and STARSHINE, a student-led experiment.

  15. STS-96 Mission Specialist Payette prepares to enter Discovery as part of TCDT activities

    NASA Technical Reports Server (NTRS)

    1999-01-01

    In the white room, an environmental chamber at Launch Pad 39B, STS-96 Mission Specialist Julie Payette, with the Canadian Space Agency, is helped with her flight suit before entering the orbiter Discovery. The crew are taking part in Terminal Countdown Demonstration Test (TCDT) activities, which provide opportunities to inspect the mission payloads in the orbiter's payload bay, as well as simulated countdown exercises and emergency egress training. Other crew members are Commander Kent V. Rominger, Pilot Rick Douglas Husband, and Mission Specialists Ellen Ochoa (Ph.D.), Tamara E. Jernigan (Ph.D.), Daniel Barry (M.D., Ph.D.) and Valery Ivanovich Tokarev, who is with the Russian Space Agency. STS-96, scheduled for liftoff on May 20 at 9:32 a.m., is a logistics and resupply mission for the International Space Station, carrying such payloads as a Russian crane, the Strela; a U.S.-built crane; the Spacehab Oceaneering Space System Box (SHOSS), a logistics items carrier; and STARSHINE, a student-led experiment.

  16. STS-96 Mission Specialist Ochoa prepares to enter Discovery as part of TCDT activities

    NASA Technical Reports Server (NTRS)

    1999-01-01

    In the white room, an environmental chamber at Launch Pad 39B, Mission Specialist Ellen Ochoa (Ph.D.) gets help with her equipment from Al Schmidt, Chris Menard and Travis Thompson before she enters the orbiter Discovery. The STS-96 crew are taking part in Terminal Countdown Demonstration Test (TCDT) activities, which provide opportunities to inspect the mission payloads in the orbiter's payload bay, as well as simulated countdown exercises and emergency egress training. Other crew members are Commander Kent V. Rominger, Pilot Rick Douglas Husband, and Mission Specialists Tamara E. Jernigan (Ph.D.), Daniel Barry (M.D., Ph.D.), Julie Payette, who is with the Canadian Space Agency, and Valery Ivanovich Tokarev, who is with the Russian Space Agency. STS-96, scheduled for liftoff on May 20 at 9:32 a.m., is a logistics and resupply mission for the International Space Station, carrying such payloads as a Russian crane, the Strela; a U.S.-built crane; the Spacehab Oceaneering Space System Box (SHOSS), a logistics items carrier; and STARSHINE, a student-led experiment.

  17. STS-113 Commander James Wetherbee after landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - STS-113 Commander James Wetherbee shakes hands with KSC Director Roy D. Bridges Jr. following landing at the Shuttle Landing Facility. From left are Kent Rominger, Deputy Director of Flight Crew Operations, Wetherbee, Dr. Daniel R. Mulville, NASA Associate Deputy Administrator, and Bridges. Commander Wetherbee earlier guided Space Shuttle Endeavour to a flawless touchdown on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The orbiter also carried the other members of the STS-113 crew, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  18. STS-113 Space Shuttle Endeavour after landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour is surrounded by vehicles from the landing convoy on runway 33 at the Shuttle Landing Facility at the conclusion of the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. The landing convoy's purpose is to safe the vehicle and provide support for the disembarking crew and experiments. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  19. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour's drag chute is unreefed as the orbiter lands on runway 33 at the Shuttle Landing Facility at the conclusion of the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. The landing convoy in the foreground is ready to approach and safe the vehicle after it comes to a full stop. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  20. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour touches down on runway 33 at the Shuttle Landing Facility (SLF) after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  1. STS-113 Space Shuttle Endeavour after landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour is surrounded by vehicles from the landing convoy on runway 33 at the Shuttle Landing Facility at the conclusion of the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. In the foreground is the Convoy Command Vehicle which is the command post for the Convoy Commander. The Convoy Commander is in communication with the orbiter and all of the landing convoy vehicles during the post-landing operations. The landing convoy's purpose is to safe the vehicle and provide support for the disembarking crew and experiments. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  2. STS-113 Endeavour on runway of SLF after landing

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - A technician, outlined against the setting sun, checks the main engines on Space Shuttle Endeavour on runway 33 at the Shuttle Landing Facility at the conclusion of the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. The landing convoy's purpose is to safe the vehicle and provide support for the disembarking crew and experiments. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  3. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- The drag chute trails Space Shuttle Endeavour after touch down on runway 33 at the Shuttle Landing Facility, bringing to a close the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  4. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- The drag chute on Space Shuttle Endeavour unfurls upon landing on runway 33 at the Shuttle Landing Facility, bringing to a close the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  5. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour's wheels make first contact with runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  6. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- The wheels of Space Shuttle Endeavour make contact with runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  7. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Seen through the lush Florida landscape, Space Shuttle Endeavour comes to a stop on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  8. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- Space Shuttle Endeavour is moments away from touch down on runway 33 at the Shuttle Landing Facility, bringing to a close the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. In the background is a KSC landmark: the Vehicle Assembly Building. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  9. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour touches down on runway 33 at the Shuttle Landing Facility (SLF) after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. In the background are two well known landmarks at KSC: the SLF's Mate/Demate Device (left) and the 525-foot-tall Vehicle Assembly Building. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  10. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour's drag chute deploys as the orbiter lands on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. In the background is a well known KSC landmark: the 525-foot-tall Vehicle Assembly Building. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  11. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- Space Shuttle Endeavour is moments away from touching down on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  12. STS-113 Space Shuttle Endeavour after landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour is surrounded by vehicles from the landing convoy, as the sun sets on runway 33 at the Shuttle Landing Facility at the conclusion of the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Under the orbiter, the Convoy Command Vehicle, the command post for the Convoy Commander, can be seen on the far side of the runway. The Convoy Commander is in communication with the orbiter and all of the landing convoy vehicles during the post-landing operations. The landing convoy's purpose is to safe the vehicle and provide support for the disembarking crew and experiments. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  13. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- Space Shuttle Endeavour makes its final approach to runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  14. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour's drag chute slows down the orbiter as it lands on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  15. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- The wheels of Space Shuttle Endeavour make contact with runway 33 at the Shuttle Landing Facility, bringing to a close the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  16. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour is moments away from touching down on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  17. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour's drag chute deploys as the orbiter lands on runway 33 at the Shuttle Landing Facility after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  18. STS-113 Space Shuttle Endeavour landing at KSC

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - Space Shuttle Endeavour touches down on runway 33 at the Shuttle Landing Facility (SLF) after completing the 13-day, 18-hour, 48-minute, 5.74-million mile STS-113 mission to the International Space Station. In the background is a well known KSC landmark: the 525-foot-tall Vehicle Assembly Building. Main gear touchdown was at 2:37:12 p.m. EST, nose gear touchdown was at 2:37:23 p.m., and wheel stop was at 2:38:25 p.m. Poor weather conditions thwarted landing opportunities until a fourth day, the first time in Shuttle program history that a landing has been waved off for three consecutive days. The vehicle carries the STS-113 crew, Commander James Wetherbee, Pilot Paul Lockhart and Mission Specialists Michael Lopez-Alegria and John Herrington, as well as the returning Expedition Five crew, Commander Valeri Korzun, ISS Science Officer Peggy Whitson and Flight Engineer Sergei Treschev. The installation of the P1 truss on the International Space Station was accomplished during the mission.

  19. STS-91 Mission Specialist Ryumin visits KSC to participate in the TCDT

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-91 Mission Specialist and Russian cosmonaut Valery Victorovitch Ryumin, arrives at Kennedy Space Center's Shuttle Landing Facility aboard a T-38 jet. He is here to participate in the Terminal Countdown Demonstration Test (TCDT), a dress rehearsal for launch. The STS-91 launch is targeted for June 2 with a launch window opening around 6:10 p.m. EDT. The mission will conclude Phase I of the joint U.S.-Russian International Space Station Program. Although it will be the ninth Shuttle docking with the Russian Space Station Mir, it will be the first Mir docking for the Space Shuttle orbiter Discovery. Ryumin is a veteran of three space flights and has logged 362 days in space. The STS-91 mission will also be the first flight for the new Space Shuttle super lightweight external tank. The STS-91 flight crew also includes Mission Commander Charles Precourt; Pilot Dominic Gorie; and Mission Specialists Wendy B. Lawrence; Franklin Chang-Diaz, Ph.D.; and Janet Kavandi, Ph.D. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living aboard Mir since January 25, 1998.

  20. STS-91 Mission Specialist Ryumin suits up for launch

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-91 Mission Specialist and Russian cosmonaut Valery Victorovitch Ryumin is outfitted with his ascent/reentry flight suit and helmet by two suit technicians in the Operations and Checkout (O&C) Building. The final suit fitting and checkout takes place prior to the crew walkout and transport to Launch Pad 39A. He has been director of the Russian Shuttle-Mir program and flight director for the Salyut-7 and Mir space stations and is a veteran of three space flights with a total of 362 days in space. This will be Ryumin's first visit to Mir. However, his experience with Russian spacecraft in orbit will prove extremely valuable as he helps the crew with Mir equipment transfer operations. He will also be assessing the condition of the station for the Russian space program. STS-91 is scheduled to be launched on June 2 with a launch window opening around 6:10 p.m. EDT. The mission will feature the ninth and final Shuttle docking with the Russian space station Mir, the first Mir docking for Discovery, the first on-orbit test of the Alpha Magnetic Spectrometer (AMS), and the first flight of the new Space Shuttle super lightweight external tank. Astronaut Andrew S. W. Thomas will return to Earth as a STS- 91 crew member after living more than four months aboard Mir.

  1. AMS undergoes a final weight and balance check in the SSPF

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Under the supervision of Boeing technicians, the Alpha Magnetic Spectrometer (AMS), a payload slated to fly on STS-91, is undergoing a final weight and balance check on the Launch Package Integration Stand in the Space Station Processing Facility (SSPF). Next, it will be placed in the Payload Canister and transported to Launch Complex 39A where it will be installed into Space Shuttle Discovery's payload bay. Weighing in at approximately three tons, the AMS is a major particle physics experiment that will look for cosmic antimatter originating from outside our galaxy. The data it gathers could also give clues about the mysterious 'dark matter' that may make up 90 percent or more of the universe. STS-91 is scheduled to be launched on June 2 with a launch window opening around 6:10 p.m. EDT. The mission will also feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, and the conclusion of Phase I of the joint U.S.-Russian International Space Station Program. The STS-91 flight crew includes Commander Charles Precourt; Pilot Dominic Gorie; and Mission Specialists Wendy B. Lawrence; Franklin Chang-Diaz, Ph.D.; Janet Kavandi, Ph.D.; and Valery Ryumin, with the Russian Space Agency. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

  2. STS-96 Crew Breakfast in O&C Building before launch

    NASA Technical Reports Server (NTRS)

    1999-01-01

    The STS-96 crew gathers in the early morning for a snack in the Operations and Checkout Building before suiting up for launch. Space Shuttle Discovery is due to launch today at 6:49 a.m. EDT. Seated from left are Mission Specialists Daniel T. Barry and Ellen Ochoa, Pilot Rick D. Husband, Mission Commander Kent V. Rominger, and Mission Specialists Julie Payette, Valery Ivanovich Tokarev, and Tamara E. Jernigan. Tokarev represents the Russian Space Agency and Payette the Canadian Space Agency. STS-96 is a 10-day logistics and resupply mission for the International Space Station, carrying about 4,000 pounds of supplies to be stored aboard the station for use by future crews, including laptop computers, cameras, tools, spare parts, and clothing. The mission also includes such payloads as a Russian crane, the Strela; a U.S.-built crane; the Spacehab Oceaneering Space System Box (SHOSS), a logistics items carrier; and STARSHINE, a student- involved experiment. It will include a space walk to attach the cranes to the outside of the ISS for use in future construction. Landing is expected at the SLF on June 6 about 1:58 a.m. EDT.

  3. STS-91 Commander Precourt addresses the media at the SLF

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-91 Mission Commander Charles J. Precourt (at microphone) talks to the media at Kennedy Space Center's Shuttle Landing Facility upon the crew's arrival aboard T-38 jets from Ellington Field, Texas, as part of final preparations for launch. The other crew members are, from left to right, Pilot Dominic Gorie and Mission Specialists Janet Kavandi, Ph.D.; Wendy B. Lawrence; Valery Ryumin, with the Russian Space Agency; and Franklin Chang- Diaz, Ph.D. STS-91 is scheduled to be launched on June 2 on Space Shuttle Discovery with a launch window opening around 6:10 p.m. EDT. The mission will feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, the conclusion of Phase I of the joint U.S.-Russian International Space Station Program, and the first flight of the new Space Shuttle super lightweight external tank. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

  4. STS-111 Liftoff From Launch Pad

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Aboard the Space Shuttle Orbiter Endeavour, the STS-111 mission was launched on June 5, 2002 at 5:22 pm EDT from Kennedy's launch pad. On board were the STS-111 and Expedition Five crew members. Astronauts Kenneth D. Cockrell, commander; Paul S. Lockhart, pilot, and mission specialists Franklin R. Chang-Diaz and Philippe Perrin were the STS-111 crew members. Expedition Five crew members included Cosmonaut Valeri G. Korzun, commander, Astronaut Peggy A. Whitson and Cosmonaut Sergei Y. Treschev, flight engineers. Three space walks enabled the STS-111 crew to accomplish mission objectives: the delivery and installation of a new platform for the ISS robotic arm, the Mobile Base System (MBS) which is an important part of the Station's Mobile Servicing System allowing the robotic arm to travel the length of the Station; the replacement of a wrist roll joint on the Station's robotic arm; and unloading supplies and science experiments from the Leonardo Multi-Purpose Logistics Module, which made its third trip to the orbital outpost. Landing on June 19, 2002, the 14-day STS-111 mission was the 14th Shuttle mission to visit the ISS.

  5. Human Embryology Animations

    NSDL National Science Digital Library

    O'Loughlin, Valerie

    One of the most impressive ways to learn about biology, particularly that which we seldom see, is through modeling. Dr. Valerie O'Loughlin and her colleagues at Indiana University have created this thoroughly impressive set of animations so that "students could better understand the complex processes that must occur in embryologic development." The site is arranged into five main areas, including: Cardiovascular Embryology, Development of the Head and Neck, Gastrointestinal Embryology, Development of the Limbs, and Urinary and Reproductive Embryology. However, the only two sections currently loaded with animations are the first two. Presumably, the rest are coming soon. Also, because these animations are part of a study of teaching efficacy, Dr. O'Loughlin asks that users participate in an optional survey. However, all animations can be accessed without taking part. As a great addition to the site, users are presented with a few questions regarding the anatomy which they are about to see, prior to viewing the animation. Undboutedly, this is related to the Indiana University course that these animations are a part of, but they serve as a great addition for visitors other than students, too.

  6. STS-91 Commander Precourt talks to Cosmonauts Kondakova and Ryumin at SLF

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-91 Mission Commander Charles Precourt (left) talks to Elena V. Kondakova and her husband, Valery Ryumin, a cosmonaut with the Russian Space Agency (RSA) and STS-91 mission specialist, at Kennedy Space Center's Shuttle Landing Facility (SLF). The STS-91 crew had just arrived at the SLF aboard T-38 jets in preparation for launch. Kondakova, also a cosmonaut with the RSA, flew with Commander Precourt as a mission specialist on STS-84 which launched on May 15, 1997. STS-91 is scheduled to be launched on June 2 on Space Shuttle Discovery with a launch window opening around 6:10 p.m. EDT. The mission will feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, the conclusion of Phase I of the joint U.S.- Russian International Space Station Program, and the first flight of the new Space Shuttle super lightweight external tank. The STS-91 flight crew also includes Pilot Dominic Gorie and Mission Specialists Wendy B. Lawrence; Franklin Chang-Diaz, Ph.D.; and Janet Kavandi, Ph.D. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

  7. STS-111 crew exits O&C building on way to LC-39A

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- The STS-111 and Expedition 5 crews hurry from the Operations and Checkout Building for a second launch attempt aboard Space Shuttle Endeavour. From front to back are Pilot Paul Lockhart and Commander Kenneth Cockrell; astronaut Peggy Whitson; Expedition 5 Commander Valeri Korzun (RSA) and cosmonaut Sergei Treschev (RSA); and Mission Specialists Philippe Perrin (CNES) and Franklin Chang-Diaz. This mission marks the 14th Shuttle flight to the Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program. On mission STS-111, astronauts will deliver the Leonardo Multi-Purpose Logistics Module, the Mobile Base System (MBS), and the Expedition Five crew to the Space Station. During the seven days Endeavour will be docked to the Station, three spacewalks will be performed dedicated to installing MBS and the replacement wrist-roll joint on the Station's Canadarm2 robotic arm. Endeavour will also carry the Expedition 5 crew, who will replace Expedition 4 on board the Station. Expedition 4 crew members will return to Earth with the STS-111 crew. Liftoff is scheduled for 5:22 p.m. EDT from Launch Pad 39A.

  8. STS-111 crew exits the O&C Building before launch

    NASA Technical Reports Server (NTRS)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - The STS-111 and Expedition 5 crews eagerly exit from the Operations and Checkout Building for launch aboard Space Shuttle Endeavour. It is the second launch attempt in six days. From front to back are Pilot Paul Lockhart and Commander Kenneth Cockrell; astronaut Peggy Whitson; Expedition 5 Commander Valeri Korzun (RSA) and cosmonaut Sergei Treschev (RSA); and Mission Specialists Philippe Perrin (CNES) and Franklin Chang-Diaz. This mission marks the 14th Shuttle flight to the Space Station and the third Shuttle mission this year. Mission STS-111 is the 18th flight of Endeavour and the 110th flight overall in NASA's Space Shuttle program. On mission STS-111, astronauts will deliver the Leonardo Multi-Purpose Logistics Module, the Mobile Base System (MBS), and the Expedition Five crew to the Space Station. During the seven days Endeavour will be docked to the Station, three spacewalks will be performed dedicated to installing MBS and the replacement wrist-roll joint on the Station's Canadarm2 robotic arm. Endeavour will also carry the Expedition 5 crew, who will replace Expedition 4 on board the Station. Expedition 4 crew members will return to Earth with the STS-111 crew. Liftoff is scheduled for 5:22 p.m. EDT from Launch Pad 39A.

  9. STS-91 Launch of Discovery from Launch Pad 39-A

    NASA Technical Reports Server (NTRS)

    1998-01-01

    The last mission of the Shuttle-Mir program begins as the Space Shuttle Discovery lifts off from Launch Pad 39A at 6:06:24 p.m. EDT June 2. A torrent of water is seen flowing onto the mobile launcher platform (MLP) from numerous large quench nozzles, or 'rainbirds,' mounted on its surface. This water, part of the Sound Suppression System, helps protect the orbiter and its payloads from damage by acoustical energy and rocket exhaust reflected from the flame trench and MLP during launch. On board Discovery are Mission Commander Charles J. Precourt; Pilot Dominic L. Gorie; and Mission Specialists Wendy B. Lawrence, Franklin R. Chang-Diaz, Janet Lynn Kavandi and Valery Victorovitch Ryumin. The nearly 10-day mission will feature the ninth and final Shuttle docking with the Russian space station Mir, the first Mir docking for the Space Shuttle orbiter Discovery, the first on-orbit test of the Alpha Magnetic Spectrometer (AMS), and the first flight of the new Space Shuttle super lightweight external tank. Astronaut Andrew S. W. Thomas will be returning to Earth as an STS-91 crew member after living more than four months aboard Mir.

  10. Expedition Crews Four and Five and STS-111 Crew Aboard the ISS

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Huddled together in the Destiny laboratory of the International Space Station (ISS) are the Expedition Four crew (dark blue shirts), Expedition Five crew (medium blue shirts) and the STS-111 crew (green shirts). The Expedition Four crewmembers are, from front to back, Cosmonaut Ury I. Onufrienko, mission commander; and Astronauts Daniel W. Bursch and Carl E. Waltz, flight engineers. The ISS crewmembers are, from front to back, Astronauts Kerneth D. Cockrell, mission commander; Franklin R. Chang-Diaz, mission specialist; Paul S. Lockhart, pilot; and Philippe Perrin, mission specialist. Expedition Five crewmembers are, from front to back, Cosmonaut Valery G. Korzun, mission commander; Astronaut Peggy A. Whitson and Cosmonaut Sergei Y. Treschev, flight engineers. The ISS recieved a new crew, Expedition Five, replacing Expedition Four after a record-setting 196 days in space, when the Space Shuttle Orbiter Endeavour STS-111 mission visited in June 2002. Three spacewalks enabled the STS-111 crew to accomplish additional mission objectives: the delivery and installation of the Mobile Base System (MBS), which is an important part of the station's Mobile Servicing System allowing the robotic arm to travel the length of the station; the replacement of a wrist roll joint on the Station's robotic arm; and unloading supplies and science experiments from the Leonardo Multi-Purpose Logistics Module, which made its third trip to the orbital outpost. The STS-111 mission, the 14th Shuttle mission to visit the ISS, was launched on June 5, 2002 and landed June 19, 2002.

  11. STS-96 Mission Highlights. Part 1

    NASA Technical Reports Server (NTRS)

    1999-01-01

    In this first part of a three-part video mission-highlights set, the flight of the STS-96 Space Shuttle Orbiter Discovery is reviewed. The flight crew consists of Kent V. Rominger, Commander; Rick D. Husband, Pilot; and Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette (Canadian), and Valery Ivanovich Tokarev (Russian). The primary goals of this mission were to work on logistics and resupply the International Space Station (ISS). This is the first flight to dock to the International Space Station. The primary payloads are the Russian cargo crane, known as STRELA, which the astronauts mount to the exterior of the Russian station segment, the SPACEHAB Oceaneering Space System Box (SHOSS), and a U.S. built crane called the ORU Transfer Device (OTD). Other payloads include the Student Tracked Atmospheric Research Satellite for Heuristic International Networking Equipment (STARSHINE), the Shuttle Vibration Forces Experiment (SVF), and the Orbiter Integrated Vehicle Health Monitoring - HEDS Technology Demonstration (IVHM HTD). The traditional pre-launch breakfast, being suited up, entry into the Shuttle, and views of the liftoff from several different vantage points are shown. In-flight footage includes views from the robot arm conducting a television survey of Discovery's payload bay and the flawless docking of the Unity module with the International Space Station. During the docking, camera views from both the ISS and Discovery are presented. These activities make up the first three Flight Days of STS-96.

  12. Understanding the Spectral Signature Characterization of Cropland Burning

    NASA Astrophysics Data System (ADS)

    Boren, E. J.; Boschetti, L.

    2014-12-01

    Accurate and reliable cropland burned area products are essential for aiding estimates of trace atmospheric gases and particles which influence atmospheric chemistry dynamics and air quality. Cropland residue burning has been estimated to account for approximately 8-11% of all global fires (Korontzi et al. 2006). Cropland residue burning is also a significant fraction of atmospheric emissions at the local level. Timely and accurate assessments of cropland fire activity are needed by local and regional administrators involved in carbon emission, human health, and air quality regulations. Remote sensing systems used for monitoring fire activity have significant detection uncertainty due to ambiguous spectral characteristics of cropland burning. The present research is focused on the quantitative characterization of the spectral signature of cropland burning by monitoring the spectral signal throughout the full growing, harvest, and burning periods. Field data collection was conducted in the southern Palouse region of Idaho and Washington. Reflectance was measured on a test area of spring wheat fields with an analytical spectral device (ASD) spectrometer. All the dates for field data collections are coincident with Landsat 8 overpasses, and the spatial sampling of field measurements were performed following the VALERI protocol for upscaling to 30 meter pixels (Baret et al. 2005).

  13. STS-91 Mission Specialist Ryumin practices slidewire basket procedures

    NASA Technical Reports Server (NTRS)

    1998-01-01

    STS-91 Mission Specialist Valery Ryumin, with the Russian Space Agency, reaches for a lever which releases a slidewire basket as Mission Commander Charles Precourt looks on during Terminal Countdown Demonstration Test (TCDT) training activities at the 195-foot level of Launch Complex 39A. The crew is practicing emergency egress procedures during the TCDT, a dress rehearsal for launch. STS-91 is scheduled to be launched on June 2 with a launch window opening around 6:10 p.m. EDT. The mission will feature the ninth Shuttle docking with the Russian Space Station Mir, the first Mir docking for Discovery, the conclusion of Phase I of the joint U.S.-Russian International Space Station Program, and the first flight of the new Space Shuttle super lightweight external tank. The STS-91 flight crew also includes Pilot Dominic Gorie and Mission Specialists Wendy B. Lawrence; Franklin Chang- Diaz, Ph.D.; and Janet Kavandi, Ph.D. Andrew Thomas, Ph.D., will be returning to Earth with the crew after living more than four months aboard Mir.

  14. STS-96 Post Flight Presentation

    NASA Technical Reports Server (NTRS)

    1999-01-01

    The Crew of STS-96 Discovery Shuttle, Commander Kent V. Rominger, Pilot Rick D. Husband, Mission Specialists Ellen Ochoa, Tamara E. Jernigan, Daniel T. Barry, Julie Payette, and Valery Ivanovich Tokarev, are shown narrating the mission highlights. Scenes include walk out to the transfer vehicle, and launch of the shuttle. Also presented are scenes of the start of the main engine, ignition of the solid rocket boosters, and the separation of the solid rocket boosters. Footage of Payette preparing the on-board camera equipment, while Barry and Jernigan perform routine checks of the equipment is seen. Also presented are various pictures of the shuttle in its orbit, the docking of the shuttle with the Mir International Space Station, and crewmembers during their space walk. Beautiful panoramic views of the Great Lake, Houston, and a combined view of Italy and Turkey are seen. The crew of Discovery is shown performing a juice ball experiment, tumbling, undocking, performing transfer operations, and deploying the STARSHINE educational satellite. The film ends with the reentry of the Discovery Space Shuttle into the Earth's atmosphere.

  15. STS-111 Flight Day 7 Highlights

    NASA Astrophysics Data System (ADS)

    2002-06-01

    On Flight Day 7 of STS-111 (Space Shuttle Endeavour crew includes: Kenneth Cockrell, Commander; Paul Lockhart, Pilot; Franklin Chang-Diaz, Mission Specialist; Philippe Perrin, Mission Specialist; International Space Station (ISS) Expedition 5 crew includes Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer; ISS Expedition 4 crew includes: Yury Onufrienko, Commander; Daniel Bursch, Flight Engineer; Carl Walz, Flight Engineer), this video opens with answers to questions asked by the public via e-mail about the altitude of the space station, the length of its orbit, how astronauts differentiate between up and down in the microgravity environment, and whether they hear wind noise during the shuttle's reentry. In video footage shot from inside the Quest airlock, Perrin is shown exiting the station to perform an extravehicular activity (EVA) with Chang-Diaz. Chang-Diaz is shown, in helmet mounted camera footage, attaching cable protection booties to a fish-stringer device with multiple hooks, and Perrin is seen loosening bolts that hold the replacement unit accomodation in launch position atop the Mobile Base System (MBS). Perrin then mounts a camera atop the mast of the MBS. During this EVA, the astronauts installed the MBS on the Mobile Transporter (MT) to support the Canadarm 2 robotic arm. A camera in the Endeavour's payload bay provides footage of the Pacific Ocean, the Baja Peninsula, and Midwestern United States. Plumes from wildfires in Nevada, Idaho, Yellowstone National Park, Wyoming, and Montana are visible. The station continues over the Great Lakes and the Eastern Provinces of Canada.

  16. Revisiting Lake Hämelsee: reconstructing abrupt Lateglacial climate transitions using state- of-the-art palaeoclimatological proxies

    NASA Astrophysics Data System (ADS)

    Engels, Stefan; Hoek, Wim; Lane, Christine; Sachse, Dirk; Wagner-Cremer, Friederike

    2015-04-01

    Lake Hämelsee (Germany) is one of the northernmost sites in NW Europe that has varved sediments throughout large parts of its Lateglacial and Early Holocene sediment sequence. Previous research on this site has shown its potential, in terms of chronological resolution and palaeoecological reconstructions, for reconstructing the abrupt transitions into and out of the Younger Dryas, the last cold period of the last glacial. The site was revisited during a 1-week summer school for Early Stage Researchers (2013), within the INTIMATE Example training and research project, supported by EU Cost Action ES0907. Two overlapping sediment sequences were retrieved from the centre of the lake during the summer school. These sediments have since formed the basis for follow-up research projects, which have sparked the collaboration of around 30 researchers in 12 laboratories across Europe. A chronological framework for the core has been composed from a combination of varve counting, radiocarbon dating and tephrochronology. Tephrostratigraphic correlations allow direct correlation and precise comparison of the record to marine and ice core records from the North Atlantic region, and other terrestrial European archives. Furthermore, the core is has been subjected to multiple sedimentological (e.g. XRF, loss-on-ignition), geochemical (e.g. lipid biomarkers, GDGTs) and palaeoecological (e.g. pollen, chironomids) proxy-based reconstructions of past environmental and climatic conditions. The results provide important insights into the nature of the abrupt climate transitions of the Lateglacial and Early Holocene, both locally and on a continental scale. The INTIMATE Example participants: Illaria Baneschi, Achim Brauer, Christopher Bronk Ramsey, Renee de Bruijn, Siwan Davies, Aritina Haliuc, Katalin Hubay, Gwydion Jones, Meike Müller, Johanna Menges, Josef Merkt, Tom Peters, Francien Peterse, Anneke ter Schure, Kathrin Schuetrumpf, Richard Staff, Falko Turner, Valerie van den Bos.

  17. List of participants at SIDE IV meeting, Tokyo, 27 November--1 December 2000

    NASA Astrophysics Data System (ADS)

    2001-12-01

    Mark J Ablowitz, Vsevolod Adler, Mark Alber, Said Belmehdi, Marco Boiti, Claude Brezinski, R Bullough, Y M Chiang, Theodore Chihara, Peter A Clarkson, Robert Conte, Adam Doliwa, Vladimir Dorodnitsyn, Mitsuaki Eguchi, Claire Gilson, Basil Grammaticos, Valeri Gromak, Rod Halburd, Koji Hasegawa, Jarmo Hietarinta, Ryogo Hirota, Xing Biao Hu, M Idzumi, J Inoguchi, Hiroya Ishikara, Mourad Ismail, Shin Isojima, Kenichi Ito, Yoshiaki Itoh, Masashi Iwasaki, Klara Janglajew, Michio Jimbo, Nalini Joshi, Kenji Kajiwara, Saburo Kakei, Masaru Kamata, Satoshi Kamei, Rinat Kashaev, Shingo Kawai, Taeko Kimijima, K Kimura, Anatol Kirillov, Koichi Kondo, Boris Konopelchenko, Martin Kruskal, Atsuo Kuniba, Wataru Kunishima, Franklin Lambert, Serguei Leble, Decio Levi, Shigeru Maeda, Manuel Manas, Ken-Ichi Maruno, Tetsu Masuda, J Matsukidaira, Atsushi Matsumiya, Shigeki Matsutani, Yukitaka Minesaki, Mikio Murata, Micheline Musette, Atsushi Nagai, Katsuya Nakagawa, Atsushi Nakamula, Akira Nakamura, Yoshimasa Nakamura, Frank Nijhoff, J J C Nimmo, Katsuhiro Nishinari, Michitomo Nishizawa, A Nobe, Masatoshi Noumi, Yaeko Ohsaki, Yasuhiro Ohta, Kazuo Okamoto, Alexandre Orlov, Naoki Osada, Flora Pempinelli, Spiro Pyrlis, Reinout Quispel, Orlando Ragnisco, Alfred Ramani, Jean-Pierre Ramis, Andreas Ruffing, Simon Ruijsenaars, Satoru Saito, Noriko Saitoh, Hidetaka Sakai, Paulo Santini, Narimasa Sasa, Ryu Sasaki, Yoshikatsu Sasaki, Junkichi Satsuma, Sergei Sergeev, Nobuhiko Shinzawa, Evgueni Sklyanin, Juris Suris, Norio Suzuki, Yukiko Tagami, Katsuaki Takahashi, Daisuke Takahashi, Tomoyuki Takenawa, Yoshiro Takeyama, K M Tamizhmani, T Tamizhmani, Kouichi Toda, Morikatsu Toda, Tetsuji Tokihiro, Takayuki Tsuchida, Yohei Tsuchiya, Teruhisa Tsuda, Satoru Tsujimoto, Walter Van Assche, Claude Viallet, Luc Vinet, Shinsuke Watanabe, Yoshihida Watanabe, Ralph Willox, Pavel Winternitz, Yasuhiko Yamada, Yuji Yamada, Jin Yoneda, Haruo Yoshida, Katsuhiko Yoshida, Daisuke Yoshihara, Fumitaka Yura, J Zagrodzinski, Alexei Zhedanov

  18. Atomically Precise Bottom-up Fabrication of Graphene Nanoribbons

    NASA Astrophysics Data System (ADS)

    Cai, Jinming

    2011-03-01

    Graphene nanoribbons (GNRs) -- narrow stripes of graphene -- are predicted to exhibit remarkable properties making them suitable for future electronic applications. Contrary to their two-dimensional (2D) parent material graphene, which exhibits semimetallic behavior, GNRs with widths smaller than 10 nm are predicted to be semiconductors due to quantum confinement and edge effects. Despite significant advances in GNR fabrication using chemical, sonochemical and lithographic methods as well as recent reports on the successful unzipping of carbon nanotubes into GNRs, the production of sub-10 nm GNRs with chemical precision remains a major challenge. In this talk, we will present a simple GNR fabrication method that allows for the production of atomically precise GNRs of different topologies and widths. Our bottom-up approach consists in the surface-assisted coupling of suitably designed molecular precursors into linear polyphenylenes and their subsequent cyclodehydrogenation, and results in GNRs whose topology, width and edge periphery are defined by the precursor monomers. By means of STM and Raman characterization, we demonstrate that this fabrication process allows for the atomically precise fabrication of complex GNR topologies. Furthermore, we have developed a reliable procedure to transfer GNRs fabricated on metal surfaces onto other substrates. It will for example be shown that millimeter sized sheets of crosslinked GNRs can be transferred onto silicon wafers, making them available for further processing, e.g. by lithography, prototype device fabrication and characterization. Coauthors: Pascal Ruffieux, Rached Jaafar, Marco Bieri, Thomas Braun, and Stephan Blankenburg, Empa, Swiss Federal Laboratories for Materials Science and Technology, 3602 Thun and 8600 Dübendorf, Switzerland; Matthias Muoth, ETH Zurich, Department of Mechanical and Process Engineering, 8092 Zurich, Switzerland; Ari P. Seitsonen, University of Zurich, Physical Chemistry Institute, 8057 Zurich, Switzerland; Moussa Saleh, Max Planck Institute for Polymer Research, 55124 Mainz, Germany; Ivan Shorubalko, Empa, Swiss Federal Laboratories for Materials Science and Technology, 3602 Thun and 8600 Dübendorf, Switzerland; Shuping Pang, Xinliang Feng, and Klaus Müllen, Max Planck Institute for Polymer Research, 55124 Mainz, Germany; and Roman Fasel, Empa, Swiss Federal Laboratories for Materials Science and Technology, 3602 Thun and 8600 Dübendorf, Switzerland and University of Bern, Department of Chemistry and Biochemistry, 3012 Bern, Switzerland.

  19. The Single Scattering Albedo of Martian Atmospheric Dust in the 290-500 nm Region

    NASA Astrophysics Data System (ADS)

    Wolff, M. J.; Bell, J. F.; Sohl-Dickstein, J.

    2002-12-01

    Despite multiple previous investigations, the detailed wavelength-dependence of Martian atmospheric dust absorption at ultraviolet (UV) and near-UV wavelengths is not particularly well-known. Several efforts have made some progress (e.g., Pang and Ajello, Icarus, 30, 63, 1977; Clancy et al., JGR, 100, 5251, 1995; Wolff et al., JGR, 104, 9027, 1999), but observational or instrumental constraints have severely limited the amount of detail retrievable. Ideally, one would observe an isolated dust signature with moderate spectral resolution and adequate spectral coverage. In essence, one would like to obtain data of a large-scale, optically-thick dust storm with a well-calibrated spacecraft-based spectrometer. Such a set of data has very recently been obtained, albeit somewhat fortuitously. Using the Hubble Space Telescope and the Space Telescope Imaging Spectrograph (STIS) instrument to perform high resolution imaging spectroscopy of Mars during the 2001 opposition, the combination of an electronics failure and an unusually early onset of a global dust storm, we have observations of Martian atmospheric dust with a minimal-to-undetectable surface contribution. Our 2001 observations utilized the G430L grating to cover 289 to 590 nm at 0.27 nm/channel. The STIS 0.2 arcec slit was pushbroom-scanned across the 13-16 arcsec diameter planet in ~70 adjacent steps, yielding a 3-dimensional image cube in 1024 wavelengths and at ~20x80 km spatial resolution per spectrum. This was done during four visits on 2001 August 9, 10, 14, and September 4 (LS=211°\\ to 227°). We will present the derived dust absorption spectra (i.e., single scattering albedo) which has resulted from our multiple-scattering, radiative transfer analyses of the STIS data. Our results will be compared to analogous efforts of Goguen et al. (personal communication, 2002) using nearly-contemporaneous observations in the 230-300 nm range (STIS/G230L). In addition, in order to better constrain the dust properties (e.g., size, shape) and subsequently isolate the single scattering albedo, our work includes retrievals from Mars Global Surveyor Thermal Emission Spectrometer observations (both the thermal infrared and solar-band channel).

  20. Phobos' Low Bulk Density: Evidence Against a Capture Origin?

    NASA Astrophysics Data System (ADS)

    Dalle Ore, C.; Pajola, M.; Lazzarin, M.; Roush, T. L.; Cruikshank, D. P.; Pendleton, Y. J.; Carli, C.; Bertini, I.; Magrin, S.; La Forgia, F.; Barbieri, C.

    2014-12-01

    Phobos' low density of 1.876 ± 0.02 g/cm3 (Andert et al., 2010, Witasse et al., 2013, Paetzold et al., 2013) supports its formation from a disk of debris (Peale 2007). The disk would either be a remnant of the formation of Mars (Safronov et al., 1986) or the result of a collision between Mars and a large body (Craddock 1994, 2011; Singer 2007). Within this scenario a large interior porosity would be responsible for the low density of the re-accreted material forming Phobos. Thermal emission spectra of Phobos suggest an ultramafic composition with the presence of phyllosilicates and feldspathoids in some regions (Giuranna et al., 2011), consistent with Phobos' in situ formation (Giuranna et al., 2011). However, the 0.3-4.0 ?m surface spectra taken from multiple areas of the body in more than 43 years of observations (Duxbury et al., 2013), show physical characteristics similar to low-albedo asteroids such as C-type (Masursky et al., 1972, Pang et al., 1980) or D-type (Murchie 1999, Rivkin et al., 2002, Lynch et al., 2007, Pajola et al., 2012). They argue in favor of an asteroidal capture scenario that could be explained by binary asteroid dissociation (Landis 2009) or by collisional capture in the Martian orbital region (Pajola et al., 2012). Finally recent work by Schmedemann et al., (2014) indicates Phobos' surface to be ~ 4.3 - 3.7 Ga, dating back to a period where there was an intensification in the number of impactors in the inner Solar System (Gomes et al., 2005), and supporting both the in-situ and the capture scenario. Pajola et al. (2013) match the surface reflectance of Phobos from 0.4 to 4.0 ?m with a mineralogical model composed of a mixture of Tagish Lake meteorite (TL) and Pyroxene Glass (PM80). Based on the published model, we adopted the weighted TL and PM80 densities to investigate if the low bulk density of Phobos could conform with these components reconciling both inner properties and surface spectra. While the TL density is available from measurements by Hildebrand et al. (2006), that of PM80 (Jager et al., 1994) has not been measured. In its stead, we have adopted density values of different pyroxene glasses from the literature (Karamanov and Pelino, 1999, and Smithsonian Physical Tables 1921) along with the density of mafic-rich glasses with VNIR spectra similar to PM80. We present our results.

  1. Modeling cell-matrix traction forces in Keratinocyte colonies

    NASA Astrophysics Data System (ADS)

    Banerjee, Shiladitya

    2013-03-01

    Crosstalk between cell-cell and cell-matrix adhesions plays an essential role in the mechanical function of tissues. The traction forces exerted by cohesive keratinocyte colonies with strong cell-cell adhesions are mostly concentrated at the colony periphery. In contrast, for weak cadherin-based intercellular adhesions, individual cells in a colony interact with their matrix independently, with a disorganized distribution of traction forces extending throughout the colony. In this talk I will present a minimal physical model of the colony as contractile elastic media linked by springs and coupled to an elastic substrate. The model captures the spatial distribution of traction forces seen in experiments. For cell colonies with strong cell-cell adhesions, the total traction force of the colony measured in experiments is found to scale with the colony's geometrical size. This scaling suggests the emergence of an effective surface tension of magnitude comparable to that measured for non-adherent, three-dimensional cell aggregates. The physical model supports the scaling and indicates that the surface tension may be controlled by acto-myosin contractility. Crosstalk between cell-cell and cell-matrix adhesions plays an essential role in the mechanical function of tissues. The traction forces exerted by cohesive keratinocyte colonies with strong cell-cell adhesions are mostly concentrated at the colony periphery. In contrast, for weak cadherin-based intercellular adhesions, individual cells in a colony interact with their matrix independently, with a disorganized distribution of traction forces extending throughout the colony. In this talk I will present a minimal physical model of the colony as contractile elastic media linked by springs and coupled to an elastic substrate. The model captures the spatial distribution of traction forces seen in experiments. For cell colonies with strong cell-cell adhesions, the total traction force of the colony measured in experiments is found to scale with the colony's geometrical size. This scaling suggests the emergence of an effective surface tension of magnitude comparable to that measured for non-adherent, three-dimensional cell aggregates. The physical model supports the scaling and indicates that the surface tension may be controlled by acto-myosin contractility. Supported by the NSF through grant DMR-1004789. This work was done in collaboration with Aaron F. Mertz, Eric R. Dufresne and Valerie Horsley (Yale University) and M. Cristina Marchetti (Syracuse University).

  2. Electron Acceleration in the Earth's Magnetotail Using Multi-Scale Simulations

    NASA Astrophysics Data System (ADS)

    Ashour-Abdalla, Maha; Lapenta, Giovanni; El-Alaoui, Mostafa; Walker, Raymond

    2014-05-01

    Magnetic reconnection in magnetized plasma represents a change in the topology of magnetic fields and is associated with a concomitant energization of charged particles that results from a conversion of magnetic energy into particle energy. Using data from the THEMIS and Cluster missions together with global and test particle simulations, we demonstrate that during a substorm on February 15, 2008 electrons are energized in two distinct regions: A low-energy population (up to a few keV) appears to arise in the diffusion region where particles are demagnetized and the magnetic topology changes. In addition a high-energy component that is energized by betatron acceleration arises within dipolarization fronts as they sweep toward the inner magnetosphere far from the diffusion region. This study concluded that particle energization is not associated solely with the conversion of magnetic to kinetic energy but, at least in the magnetosphere, also arises in conjunction with macroscopic flows. In a second substorm study, on March 11, 2008 we found that the test particle results compared favorably with observations only when we added a high-energy tail to the distribution function near the reconnection site. This implies that acceleration near the X-line was substantial and needs to be included. THEMIS and Cluster observations indicate that plasma waves are associated with the dipolarization fronts [1]. The test particle calculations are not self-consistent and do not include plasma waves. Therefore, to fully understand the processes that lead to electron acceleration throughout the near-Earth tail, we need to utilize a self-consistent kinetic approach that includes waves and electron acceleration near the neutral line along with large-scale dynamics. We present results from a model which couples the large scale magnetospheric processes and kinetic processes by developing a simulation approach in which a global MHD simulation is coupled with a particle in cell simulation. In this approach we couple the UCLA global MHD code [2] with the iPIC3D implicit particle in cell code [3]. We use a two dimensional version of iPIC3D to investigate the multi-scale nature of the electron energization during the February 15, 2008 substorm. In this multi-scale simulation the electric and magnetic fields show the quadrupolar signature of Hall-MHD which is absent in the resistive MHD simulation. Moreover the electrons move much faster than the ions especially at the separatrices and the inflow boundary. We note that during this event, just like in the case of the MHD, dipolarization fronts are formed mainly earthward of the neutral line. Finally, we find that electrons are energized near both the x-line and dipolarization fronts, but the energization is greater at the latter location. [1] Zhou, M., M. Ashour-Abdalla, X. Deng, D. Schriver, M. El-Alaoui, and Y. Pang (2009), THEMIS observation of multiple dipolarization fronts and associated wave characteristics in the near-Earth magnetotail, Geophys. Res. Lett., 36(20), L20107. [2] El-Alaoui, M. (2001), Current disruption during November 24, 1996, substorm, J. Geophys. Res., 106(A4), 6229-6245. [3] Markidis, S., G. Lapenta, and Rizwan-uddin (2010), Multi-scale simulations of plasma with iPIC3D, Math. Comput. Simulation, 80(7), 1509-1519.

  3. Discovery of a Large Volcanic Eruption in 1761 From Pre-Venus-Transit and Other Proxy Data, Using Benjamin Franklin's Method of Linking the 1783-1784 Cold Weather to the Laki Eruption

    NASA Astrophysics Data System (ADS)

    Pang, K. D.

    2006-12-01

    Observations of the 1761 and 1769 transits of Venus were crucial to the early development of American geoscience. Accurate longitude measurements were needed for that, the Mason-Dixon survey, the 1804-1806 Lewis and Clark expedition to Oregon, and the westward expansion of the new republic [Woolf, "The Transits of Venus: A Study of 18th Century Science," Princeton, 1959]. As founder of the American Philosophical Society Benjamin Franklin promoted the transit observations, and procured a large telescope for the Philadelphia group. While serving as ambassador to France he observed that a "dry fog" from the 1783 Laki eruption in Iceland had obscured the Sun, and suggested that as a cause of the unseasonably cold weather of that summer and winter. Although the longitude, solar parallax and Sun-Earth distance measurements have long since been improved on, observations of the dark lunar eclipse just before the June 6, 1761 transit are still valuable for identifying a very large volcanic eruption that spring, using Benjamin Franklin's method. Many observers worldwide, while making a final check on their clock/longitude, found the May 18, 1761 totally eclipsed Moon very dark or even invisible, e.g., Wargentin (Stockholm Observatory) could not see the Moon for 38 minutes even with a 2-ft telescope [Phil. Trans. 52, 208, 1761-1762]. Whereas the totally eclipsed Moon is illuminated only by sunlight refracted by the Earth's atmosphere, I conclude that it was severely obscured, thus meeting Benjamin Franklin's first condition. Ice cores from Greenland and Antarctica show a large sulfuric acid peak at 1762 [Crowley, Geophys. Res. Lett. 20, 209, 1993; and Karlof, J. Geophys. Res. 105, D10, 12471, 2000], also satisfying Benjamin Franklin's second condition that the obscuration be due to a "dry fog" (sulfuric acid mist). The weather of 1761-1762 was indeed very cold, as recorded in chronicles, and frost-damaged rings of North American bristlecone pines [LaMarche and Hirschboeck, Nature 307, 121, 1984]. Annual weather reviews in imperial, provincial and county histories in China have been examined. Unseasonable cold are classified by their degree of severity: (1) Late (April-June) or early (July-Sept.) killing frosts; (2) Bitter cold/heavy snowfall; and (3) Heavy sustained snowfall, bitter cold with frozen wells, lakes and rivers. The latter cases were often widespread and multi-year, with the coast icebound also. The weather of 1761-1762 was a "3." Heavy sustained snow fell over many sites from the Tropic of Cancer to the Yellow River. In the north wells and rivers froze. Taihu (Great Lake near Shanghai) and nearby rivers froze over and were not navigable. Innumerable trees, birds and livestock perished, etc. Whereas all three of Benjamin Franklin's conditions have been met I conclude that a very large volcanic eruption early in 1761 had a major impact on the Earth's climate. Its location is unknown, but was probably low- or mid-latitude, as sulfuric acid from the volcanic cloud settled onto both poles. Finally Benjamin Franklin's criteria for a climate-altering volcanic eruption are still universally used (the appearance of brilliant red twilight displays have since been added). Moreover his legacy continues to inspire climate researchers. See, for example, "Climatic Impact of the mid-15th-Century Kuwae Caldera Formation...," Pang, Eos 74, No. 43, 106, 1993; and as cited in "Earth in Balance," Al Gore, p. 379, Penguin, 1993. See also "Constantinople's Volcanic Twilight," Lynn Simarski, Aramco World 47, No. 6, 8-13, 1996.

  4. Long-Term Sun Climate Connections, Revealed by the Analyses of Historical and Other Proxy Records

    NASA Astrophysics Data System (ADS)

    Pang, K. D.; Yau, K.

    2004-12-01

    The Sun, once considered constant, actually goes through 11-year, decadal, centennial, and even longer cycles. Our analysis of historical sunspot and aurora records, carbon-14 and beryllium-10 abundances from long-lived trees and deep polar ice cores, respectively, shows that it has gone through nine long cycles in the past 1800 years. Although these changes amounted to <1% of the total irradiance there is clear evidence they produced corresponding changes in the climate [Pang and Yau, Eos, 83, No. 43, 481, 2002]. For example during the Maunder Minimum (1645-1715) sunspots were rarely seen (about once in ten years from Europe or China). Total solar irradiances, reconstructed from historical sunspot records, were 0.25% lower then. This correlates nicely with an estimated 0.5-degree drop in Northern Hemisphere summer surface temperatures during the Little Ice Age [Lean, GRL 22, 3195, 1995]. We have also analyzed Chinese historical weather records for comparison. Reports of unseasonable cold are classified by the degree of severity: (1) Late (April-June) or early (July-September) killing frosts; (2) Bitter cold/heavy snowfall; and (3) Heavy sustained snowfall, bitter cold with frozen wells, rivers and icebound seas. The latter cases were often widespread and multi-year. All categories occurred most frequently during the coldest part of the Little Ice Age. The Category 3 episodes were in 1652-54, 1656, 1664, 1670-72, 1676-77, 1683, 1688-91, 1716, and 1718-19. For example the Yangtze River and its lakes froze up to 3-4 times in 1650-1700. The coldest period thus coincides with the Maunder Minimum, and is consistent with general circulation model hindcast winter conditions for China [Shindell, Science, 294, 2149, 2001]. There was only one Category 3 episode between the Maunder and Dalton Minima--in 1761 (due to a large volcanic eruption); and two in the Dalton Minimum (1795-1825)--in 1796 and 1814-17. The Sun has gradually brightened since the Dalton Minimum. But the climate of China remained cold through the 19th century, as in the rest of the world, probably due to increased volcanic aerosol loading of the atmosphere [Sato, JGR 98, 22987, 1993]. The climate of China seems to have been warm during the Late 14th-Century Maximum (1350-1410). We have found only one Category 1 episode--in 1393. It then turned cold during the Sporer Minimum (1410-1590). Category 3 episodes occurred in 1453-54, 1493, 1513, 1569, and 1577-78. Lesser ones were also common. Some scientists suggest that the Little Ice Age actually began in the 13th Century, and is comprised of the Wolf (1280-1350), Sporer, Maunder, and Dalton Minima. It and the Little Climate Optimum make up a millennium-long cycle [Broecker, Natural History 101, 6, 4/1992]. The warm Classical Age and cool Dark Ages, the cold Iron Age (1st millennium BC), and warm Bronze Age (2nd and 3rd millennia BC) could be considered still earlier millennial cycles. These trends are generally consistent with carbon-14 deviations from its long-term variations. There is also some historical and archaeological evidence for the early trends, as rhinoceros and elephant herds were abundant along the Yellow River during the Shang dynasty (1600-1100 BC). The tropical fauna and flora have since disappeared, as North China gradually turned cold and arid. We conclude that the climate of China generally follows world trend. The major forcing seems to have been changing solar luminosity on a decadal to millennial timescale. Volcanic eruptions and changing ocean currents also frequently perturbed the climate.

  5. The Small Bodies Thermal Mapper: An Instrument for Future Missions to Study the Compositional and Thermal Properties of Phobos

    NASA Astrophysics Data System (ADS)

    Donaldson Hanna, Kerri; Bowles, Neil; Calcutt, Simon; Greenhagen, Benjamin; Glotch, Timothy; Edwards, Christopher

    2015-04-01

    The surface of Phobos holds many keys for understanding its formation and evolution as well as the history and dynamics of the Mars-Phobos system. Phobos has been the target for numerous flyby and sample return missions in the past (e.g. Rosetta [Pajola et al., 2012] and Phobos Grunt [Kuzmin et al., 2003]). Previous telescopic and spacecraft observations have revealed a surface that is compositionally heterogeneous [e.g. Pang et al., 1978; Pollack et al., 1978, Lunine et al., 1982; Murchie and Erard, 1996; Roush and Hogan, 2001; Rivkin et al., 2002; Giuranna et al., 2011; Fraeman et al., 2014] and with large variations in surface topography [e.g. Shi et al., 2011; 2012; Willner et al., 2014]. For any future sample return mission, remote sensing observations, in particular thermal infrared observations, will be key in characterising possible landing/sampling sites and placing returned samples into their geological context. The European Space Agency has identified Phootprint, a European sample return mission to Phobos, as a candidate mission of the Mars Robotic Exploration Preparation Programme 2 (MREP-2). Using this mission concept as a baseline, we have studied the options for a simple multichannel radiometer to provide thermal mapping and compositional remote sensing data. By mapping Phobos' diurnal thermal response, a thermal imaging instrument will provide key information on the nature of the surface and near sub-surface (the thermal inertia) and composition. These measurements will support visible imaging observations to determine landing sites that are compatible with the spacecraft's sampling mechanisms. Remotely sensed thermal maps of the surface will also prevent otherwise unpredictable thermal loads on the spacecraft due to variations in local topography and albedo. The instrument design resulting from this study, the Small Bodies Thermal Mapper (SBTM), is a compact multichannel radiometer and thermal imager. The SBTM is based on the Compact Modular Sounder (CMS) instrument currently flying on the UK's TechDemoSat-1 spacecraft in low Earth orbit. This gives a significant level of flight heritage with optimisations for the expected Phobos environment. The SBTM instrument uses a two-dimensional uncooled thermal detector array to provide imaging of Phobos. In addition, ten narrow-band infrared filters located around diagnostic mineral spectral features provide additional compositional discrimination. For the SBTM, the optimisations studied include options for the detector and filters required to cover the wide range of diurnal temperatures expected at Phobos (e.g. 130 to > 300 K) [e.g. Kuzmin et al., 2003]. Options studied include the use of a broadband micro bolometer array (e.g. http://www.ulis-ir.com/uploads/Products/PICO640E-041-BroadBand.pdf) or a thermopile detector [Foote et al., 1998] array. Optimisation of filter band passes for remote measurement of composition is also considered, based on mineral spectra measured under simulated Phobos environment [e.g. Glotch et al., 2014].

  6. Sensitivity analyses of a colloid-facilitated contaminant transport model for unsaturated heterogeneous soil conditions.

    NASA Astrophysics Data System (ADS)

    Périard, Yann; José Gumiere, Silvio; Rousseau, Alain N.; Caron, Jean

    2013-04-01

    Certain contaminants may travel faster through soils when they are sorbed to subsurface colloidal particles. Indeed, subsurface colloids may act as carriers of some contaminants accelerating their translocation through the soil into the water table. This phenomenon is known as colloid-facilitated contaminant transport. It plays a significant role in contaminant transport in soils and has been recognized as a source of groundwater contamination. From a mechanistic point of view, the attachment/detachment of the colloidal particles from the soil matrix or from the air-water interface and the straining process may modify the hydraulic properties of the porous media. Šim?nek et al. (2006) developed a model that can simulate the colloid-facilitated contaminant transport in variably saturated porous media. The model is based on the solution of a modified advection-dispersion equation that accounts for several processes, namely: straining, exclusion and attachement/detachement kinetics of colloids through the soil matrix. The solutions of these governing, partial differential equations are obtained using a standard Galerkin-type, linear finite element scheme, implemented in the HYDRUS-2D/3D software (Šim?nek et al., 2012). Modeling colloid transport through the soil and the interaction of colloids with the soil matrix and other contaminants is complex and requires the characterization of many model parameters. In practice, it is very difficult to assess actual transport parameter values, so they are often calibrated. However, before calibration, one needs to know which parameters have the greatest impact on output variables. This kind of information can be obtained through a sensitivity analysis of the model. The main objective of this work is to perform local and global sensitivity analyses of the colloid-facilitated contaminant transport module of HYDRUS. Sensitivity analysis was performed in two steps: (i) we applied a screening method based on Morris' elementary effects and the one-at-a-time approach (O.A.T); and (ii), we applied Sobol's global sensitivity analysis method which is based on variance decompositions. Results illustrate that ?m (maximum sorption rate of mobile colloids), kdmc (solute desorption rate from mobile colloids), and Ks (saturated hydraulic conductivity) are the most sensitive parameters with respect to the contaminant travel time. The analyses indicate that this new module is able to simulate the colloid-facilitated contaminant transport. However, validations under laboratory conditions are needed to confirm the occurrence of the colloid transport phenomenon and to understand model prediction under non-saturated soil conditions. Future work will involve monitoring of the colloidal transport phenomenon through soil column experiments. The anticipated outcome will provide valuable information on the understanding of the dominant mechanisms responsible for colloidal transports, colloid-facilitated contaminant transport and, also, the colloid detachment/deposition processes impacts on soil hydraulic properties. References: Šim?nek, J., C. He, L. Pang, & S. A. Bradford, Colloid-Facilitated Solute Transport in Variably Saturated Porous Media: Numerical Model and Experimental Verification, Vadose Zone Journal, 2006, 5, 1035-1047 Šim?nek, J., M. Šejna, & M. Th. van Genuchten, The C-Ride Module for HYDRUS (2D/3D) Simulating Two-Dimensional Colloid-Facilitated Solute Transport in Variably-Saturated Porous Media, Version 1.0, PC Progress, Prague, Czech Republic, 45 pp., 2012.

  7. The Geochemistry and Hydrography of Lake Tanganyika

    NASA Astrophysics Data System (ADS)

    Craig, H.

    2001-12-01

    John Edmond was a key member of the scientific group that participated in the two SIO expeditions on Lake Tanganyika, involved in both the water sampling on the lake and the operations in the potable chemical laboratory used ashore. Much of his data on the nutrient chemistry of the lake has been published in summary form (Limnol.Oceanog.1993). The present paper, which describes some of the other studies made on the lake, is dedicated to John, who was both a close personal friend and a brilliant colleague. Along the ~650 km length of the lake we occupied 18 stations and sampled the major inflowing streams. The CI concentration of the lake waters below ~150m (depth of the epilimnion) is constant (27.8ppm), so that temperature is the only hydrographic variable, and distinctive profiles occur in the two major deep basins (North & South, = NB and SB). In the NB from 100 to 1200m, T° C decreases smoothly to 400m, below which are two ~ isothermal layers extending down to a sharp discontinuity at 700m, followed by a decrease to an nderline{in-situ} minimum (23.32° C at 870m, the coldest water in Lake Tanganyika). The lower-most 300m of the profile is essentially adiabatic, with a bottom T = 23.32° C. The 700m T discontinuity is associated witha sharp cusp in methane concentration, which increases smoothly with depth from zero at the base of the mixed layer to 2.5 cc/kg at 700m, and then increases rapidly to 5.0 cc/kg at 1200m. In the SB, T decreases smoothly to 600m depth, below which is an almost isothermal layer to 1100m, followed by an ~ adiabatic gradient for 300m, to 23.40° C at 1400m. In this basin the CH4 profile is a smoothly continuous curve from 100-1200m, showing that the effective sill-depth between the two basins is at ~700m. Helium isotope profiles also show distinctive profiles in the two deep basins. In the NB, the 4He profile increases downward from atmospheric saturation to a smooth maximum at 450m (2.26 x saturation) and a 3He/4He ratio anomaly ? (3He) = -40% of atmospheric value). In the SB there is a similar though less marked He maximum at 900m. These extrema show the depths of injection of He from crustal sources, which in both basins has a 3He/4He ratio of 0.28 x atmospheric, close to the ratio in radiogenic helium. The He concentration requires a saturation T of 15° C at the present level of 773m above sealevel. If the deep water has not changed and was saturated at the present 23° C, the required lake level is ~250m below the present level. Co2 and 13C data show production of light CO2 at 220m, the depth of a ? (13C) minimum, and on the lake bottom where heavy CO2 is produced by CH4 production. Other data to be discussed as time permits include stable isotopes (D and 18O, enriched in deep water), 14C, tritium, 226Ra, 210Pb, and dissolved N2, Ne, and Ar. Our logistical work was supported by UNDP-FAO. G.W. Coulter (UNDP, Burundi), Ray Weiss (SIO), and Valerie Craig (SIO) participated in the expedition work at sea and on land.

  8. News and Announcements

    NASA Astrophysics Data System (ADS)

    1999-07-01

    New Source of Information from Advertisers The Journal has a new feature effective with the June 1999 issue. If you would like additional information about our advertisers or their products, the quickest and easiest way to get it is via JCE Online: go to http://jchemed.chem.wisc.edu click on Ad Index This will take you to the list of advertisers, each conveniently linked to their home page. When you do contact our advertisers, be sure to tell them that you saw their ad in the Journal of Chemical Education. This is important to them, and to us. JCE Software Receives Award The Journal recently received notice that JCE Software portion of JCE Online has been selected as a Links2Go Key Resource for the topic of chemistry software. According to Links2Go (www.links2go.com), JCE Software's home page is one of the top fifty most accessed online resources in the area of chemistry software (currently ranked 45). Thanks to all of you who have visited JCE Online and the JCE Software area to make this possible. If you haven't visited the site yet, you can go there directly (http://jchemed.chem.wisc.edu/JCESoft/index.html ) as well as via our JCE Online home page. You will be greeted with a short video of nitrogen triiodide exploding and be able to get a wealth of information about our latest releases, software, CD-ROMs/Video, student resources, materials for authors and software developers. You can see color graphics from our CD-ROMs, video, and software,... Actually, if you are familiar with our Catalog, this is much better. 1999 Welch Chemistry Prize Richard N. Zare, the Marguerite Blake Wilbur Professor of Natural Science at Stanford University, has been named the 1999 recipient of the Welch Award in Chemistry for his lifetime achievements in physical and analytical chemistry. Zare's interests focus on the development and application of lasers and other novel instruments to explore chemical frontiers, ranging from molecules to chemical processes, from the inside of cells to the inside of meteorites. Zare and colleague Andrew Alexander are contributors to the Journal's Viewpoints series, sponsored by the Camille and Henry Dreyfus Foundation: "Anatomy of Elementary Chemical Reactions", JCE, 1998, 75, 1105. The Welch Award in Chemistry has been given by the Welch Foundation since 1972 to honor lifetime achievements in the field. Zare will be honored and presented with a $300,000 prize and gold medallion during the Foundation's annual award banquet held in Houston in October. NEACT Conference: Chemistry of Materials and Material Science The 61st Summer Conference of NEACT, the New England Association of Chemistry Teachers, will be held from Monday, August 9, through Thursday, August 12, at Massachusetts Institute of Technology in Cambridge, MA. The four-day conference will feature an exploration of the chemistry of materials and material science and effective methods of presenting these in the classroom and laboratory. The keynote address is "Teaching Solid State Chemistry at MIT" by Ron Latanision of MIT's Department of Material Science. Other presentations include "Driving Force", James Livingston; "The Colorful Nanoworld", Moungi Bawendi; "Molecular Wire-Based Amplification in Chemical Sensors", Timothy Swager; "Putting Solids in the Foundation", Arthur Ellis, George Lisensky, and Karen Nordell; "Miracle Materials", Valerie Wilcox; "Teaching About Polymers to Chemistry Students", Richard Stein; and "Using Software in Teaching About Polymers to Chemistry Students", William Vining. There will be a selection of workshops on the conference theme as well. The conference is open to all. The program chairperson is Peter J. Nassiff, Science Department Chairperson at Burlington High School. For further information contact Nassiff at 80 Gregory Road, Framingham, MA 01701; email: pnassiff@massed.net. Call for Symposia, Papers, & Workshops: 16th BCCE The Web site for the 16th Biennial Conference on Chemical Education, July 30-August 3, 2000, at the Un

  9. Physical Biology : challenges for our second decade

    NASA Astrophysics Data System (ADS)

    Levine, Herbert

    2014-06-01

    It is quite an honor to be asked to become the third editor-in-chief of Physical Biology . I am following in the footsteps of Tim Newman, who served with energy and enthusiasm. Hopefully, the entire community fully appreciates his contributions to moving the field forward. Thank you, Tim! With the honor, however, goes a clear responsibility. Our journal has survived its birth pangs and emerged as a serious venue for publishing quality research papers using physical science to address the workings of living matter. With the support of scientists in this field and with the ongoing commitment of the IOP, we have successfully reached adolescence. Yet, there is clearly much room to grow and there are clear challenges in defining and maintaining our special niche in the publishing landscape. In this still-developing state, the journal very much mimics the state of the field of physical biology itself. Few scientists continue to question the relevance of physical science for the investigation of the living world. But, will our new perspective and the methods that come with it really lead to radically new principles of how life works? Or, will breakthroughs continue to come from experimental biology (perhaps aided by the traditional physicist-as-tool-builder paradigm), leaving us to put quantitative touches on established fundamentals? In thinking about these questions for the field and for the journal, I have tried to understand what is really unique about our joint endeavors. I have become convinced that living matter represents a new challenge to our physical-science based conceptual framework. Not only is it far from equilibrium, as has been generally recognized, but it violates our simple notions of the separability of constituents, their interactions and the resulting large-scale behavior. Unlike, say, atomic physicists who can do productive research while safely ignoring the latest developments in QCD (let alone particle physics at higher energies), we do not yet understand when the details of proteins and nucleic acids structure and function can be assumed constant when considering the cell. This problem is even more serious as we try to set higher sights and think of cells as constituents of tissue, organ and organism. Trying to understand higher-order biological systems is a bit like trying to play a board game where the pieces and rules are constantly changing, somehow in concert with what is happening at the scale of the game. Others will undoubtedly have their own view of what is really difficult and different about living systems. One of the roles of Physical Biology should therefore be to provide a needed forum to address some of these really difficult questions. Of course, most papers will operate with the safety-setting on, and will use established ideas in physics, either experimental or theoretical, to further our quantitative appreciation of living systems. These papers are without doubt an absolutely necessary part of the field, and we hope that our journal can serve as a home for the best of these. But, my real hope is that we can attract papers that really try to break new ground, that suggest ways in which the living world is not just an extremely messy example of the same phenomena that can be studied in non-biological contexts. Amazingly, this hope is actually shared by many leading biologists. In one of the most influential papers on cancer research in the past decades. Hanahan and Weinberg argue that 'one day, we imagine that cancer biology and treatment—at present, a patchwork quilt of cell biology, genetics, histopathology, biochemistry, immunology, and pharmacology—will become a science with a conceptual structure and logical coherence that rivals that of chemistry or physics.' We should take up the challenge, not just for cancer, and Physical Biology should help. Figuring out exactly how best to do this is now my responsibility, and I look forward to hearing from you and working with all of you, in order to make it happen.

  10. Verochka Zingan or recollections from the Physics Department of the Moscow University

    NASA Astrophysics Data System (ADS)

    Gaina, Alex

    The author recollects his studentship during 70-th years at the Physics Department of the Moscow University. He was graduated from the theoretical Physics Department in 1977. The Rectors of the University that times were I.G. Petrovskii, R.V. Khokhlov and A.A. Logunov. The dean of the Physics Department was V.S. Fursov. As a particular event a meet with the former prime-minister of the USSR A.N. Kosygin is reported. Between professors mentioned throughout the recollections are A.I.Kitaigorodskii, Ya. B. Zel'dovich, D.D. Ivanenko, A.A. Sokolov, A.A. Vlasov, V.B. Braginsky, I.M. Ternov, L.A. Artsimovich, E.P. Velikhov and other, including that which became University professors later. A great number of colleagues from the Physics, Chemistry, Phylological and Historical Departments of the Moscow University are mentioned. Particularly, the students which entered the group 113 in 1971 and finished the group 601 in 1977 are listed. The recollections include 5 parts. Persons cited throughout the paper: A.N. Kosygin, A.S. Golovin, V. Kostyukevich, I.M. Ternov, E.G. Pozdnyak, A. N. Matveev, V.P. Elyutin, V.V. Kerzhentsev, 113 academic group (1971), V. Topala, E.A. Marinchuk, P.Paduraru, A.I. Kitaygorodski, A. Leahu, S. Berzan, B. Ursu, I. Coanda (Koade), M. Stefanovici, O. Bulgaru, A. Iurie-Apostol, A.S. Davydov, M.I. Kaganov, I.M. Lifshitz, Ya. B. Zel'dovich, A.Zhukov, A.I. Buzdin, N.S. Perov, V. Dolgov, P. Vabishchevich, A.A. Samarskii, V. Makarov, Irina Kamenskih, A.A. Arsen'ev, L.A. Artsimovich, A.A. Tyapkin, B.M. Pontecorvo, D.I. Blokhintsev, I.G. Petrovskii, R.V. Khokhlov, V.N. Rudenko, A.A. Sokolov, D.D. Ivanenko (Iwanenko), A.A. Vlasov, V.N. Ponomarev, N.N. Bogolyubov, N.N. Bogolyubov (Jr), V.Ch. Zhukovskii, Tamara Tarasova, Zarina Radzhabova (Malovekova), V.Malovekov, Tatiana Shmeleva, Alexandra C.Nicolescu, Tatiana Nicolescu, Rano Mahkamova, Miriam Yandieva, Natalia Germaniuk (Grigor'eva), E. Grigor'ev, A. Putro, Elena Nikiforova, B. Kostrykin, Galia Laufer, K. Laufer, Yu. El'nitskii, Gh. Nemtoi, Yu. Oprunenko, N.N. Semenov, Varun Sahni, A.A. Starobinskii, Liusea Burca, Serge Rollet, Tatyana Davydova, Zinaida Uglichina (Khafizova), T.Filippova, V.S. Filippov, Vera Zingan (Stefanovici), B.A. Gaina, E.F. Gaina, Valeri Gaina, A. Kirnitskii, M. Kavalerchik, Margarita Kavalerchik, Mark Rainis, L.I. Sedov, D. Mangeron, S. Taltu (Coanda), Z. Sali(Chitoroaga, Kitoroage), Raisa M. Gorbachova, Maria Bulgaru, S. Pavlichenko, Nadezhda Shishkan, A.N. Matveev, N.Ya. Tyapunina, D.F. Kiselev, V.A. Petukhov, N.Ch. Krutitskaya, G.N. Medvedev, A.A. Shishkin,I.A. Shishmarev,A.G. Sveshnikov, A.B. Vasil'eva, A.G. Yagola, I.I. Ol'hovskii, V.V. Kravtsov, V.V.Petkevich, V.I. Grigor'ev, V.S. Rostovskii, V.V. Balashov, B.I. Spasskii, V.D. Krivchenkov, M.B. Menskii, V.Ya. Fainberg, V.G. Kadyshevskii, B.K. Kerimov, V.A. Matveev, I.A. Kvasnikov, D.V. Gal'tsov, V.R. Khalilov, G.A. Chizhov,I.A. Obukhov, V.N. Melnikov, A.A. Logunov, A.N. Tavkhelidze,Yu.S. Vladimirov, N.F. Florea (Floria), B.A. Lysov, V.D. Kukin, 601-academic group (1977), A.R. Khokhlov, P.L. Kapitza, S.P. Kapitza, Ion C. Inculet, Ion I. Inculet,W. Bittner, Nikolay Florea (Floria), M.M. Heraskov, N.V. Sklifosovskii, N.N. Bantysh-Kamenskii, N.D. Zelinskii, Olga Crusevan (Krushevan), Eugenia Crusevan (Krushevan),L.S. Berg, I. Buzdugan (Buzdyga),S.G. Lazo, M.K. Grebenchya (Grebencea), V.T. Kondurar (Conduraru), E.A. Grebenikov, K.F. Teodorchik, V.A. Albitzky, M.V. Nazarov, Tatiana Nazarova, V. P. Oleinikov, O.V. Bolshakov, D.M. Nikolaev, V. Afanas'ev, Olga Tatarinskaya, Yu.V. Karaganchou, B.A. Volkov, V.K. Turta, S. Varzar, C. Sochichiu, V.B. Braginsky, V.S. Fursov, L.I. Brezhnev, V.I. Sobolev (INP MSU), V.A. Smirnov (INP MSU), L.D. Landau, M.A. Leontovich, A.G. Loskutova, Yu.M. Loskutov, N.S. Akulov, V.B. Gostev, A.R. Frenkin, N.N. Kolesnikov, A. Vasil'ev, V.N. Tsytovich, Ya.A. Frenkel, N.V. Mitskievich, E.A. Grebenikov, A.N. Prokopenya, A. Einstein, L.I. Sedov, A.N. Kolmogorov, V.I. Arnold, G.I.Popov, R.Z. Sagdeev, A.A. Kokoshin, A.E. Marinchuk, D.V. Gal'tsov, V.I. Petukhov, S.I. Vacaru,

  11. Sensitivity of ocean model simulation in the coastal ocean to the resolution of the meteorological forcing

    NASA Astrophysics Data System (ADS)

    Chen, Feng; Shapiro, Georgy; Thain, Richard

    2013-04-01

    The quality of ocean simulations depends on a number of factors such as approximations in governing equations, errors introduced by the numerical scheme, uncertainties in input parameters, and atmospheric forcing. The identification of relations between the uncertainties in input and output data is still a challenge for the development of numerical models. The impacts of ocean variables on ocean models are still not well known (e.g., Kara et al., 2009). Given the considerable importance of the atmospheric forcing to the air-sea interaction, it is essential that researchers in ocean modelling work need a good understanding about how sensitive the atmospheric forcing is to variations of model results, which is beneficial to the development of ocean models. Also, it provides a proper way to choose the atmospheric forcing in ocean modelling applications. Our previous study (Shapiro et al, 2011) has shown that the basin-wide circulation pattern and the temperature structure in the Black Sea produced by the same model is significantly dependent on the source of the meteorological input, giving remarkably different responses. For the purpose of this study we have chosen the Celtic Sea where high resolution meteo data are available from the UK Met office since 2006. The Celtic Sea is tidally dominated water basin, with the tidal stream amplitude varying from 0.25m/s in the southwest to 2 m/s in the Bristol Channel. It is also filled with mesoscale eddies which contribute to the formation of the residual (tidally averaged) circulation pattern (Young et al, 2003). The sea is strongly stratified from April to November, which adds to the formation of density driven currents. In this paper we analyse how sensitive the model output is to variations in the spatial resolution of meteorological using low (1.6°) and high (0.11°) resolution meteo forcing, giving the quantitative relation between variations of met forcing and the resulted differences of model results, as well as identifying the causes. The length scales of most energetic dynamic features in both ocean and atmosphere are defined by the Rossby radius of deformation, which is about 1000 km (a typical size of a cyclone) in the atmosphere while only 10-20 km (a size of a mesoscale eddy) in a shallow sea. However sub-mesoscale atmospheric patterns such as patchiness in the cloud cover could result in smaller scale variations of both the wind and solar radiation hence creating a direct link of these smaller atmospheric features with the ocean mesoscale variability. The simulation has been performed using a version of POLCOMS numerical model (Enriquez et al, 2005). Tidal boundary conditions were taken from the Oregon State University European Shelf Tidal Model (Egbert et al, 2010) and the temperature/ salinity initial fields and boundary conditions were taken from the World Ocean Database (Boyer et al, 2004). The paper discusses what elements of the circulation and water column structure are mostly sensitive to the meteo-fields resolution. References Kara, A.B., Wallcraft, A.J., Hurlburt, H.E., Loh, W.-Y., 2009. Which surface atmospheric variable drives the seasonal cycle of sea surface temperature over the global ocean? Journal of Geophysical Research, Vol. 114, D05101. Boyer, .T, S. Levitus, H. Garcia, R. Locarnini, C. Stephens, and J. Antonov, T. Boyer, S. Levitus, H. Garcia, R. Locarnini, C. Stephens, and J. Antonov, 2004. Objective Analyses of Annual, Seasonal, and Monthly Temperature and Salinity for the World Ocean on a ¼ Grid. International Journal of Climatology, 25, 931-945. Egbert, G. D., S. Y. Erofeeva, and R. D. Ray, 2010. Assimilation of altimetry data for nonlinear shallow-water tides: quarter-diurnal tides of the Northwest European Shelf, Continental Shelf Research, 30, 668-679. Enriquez, C. E., G. I. Shapiro, A. J. Souza, and A. G. Zatsepin, 2005. Hydrodynamic modelling of mesoscale eddies in the Black Sea. Ocean Dyn., 55, 476-489. Georgy Shapiro, Dmitry Aleynik , Andrei Zatsepin , Valentina Khan, Valery Prostakishin , Tatiana Akivis , Vladimir Belokopytov , Ant

  12. List of Posters

    NASA Astrophysics Data System (ADS)

    List of Posters: Dark matter annihilation in the Galactic galo, by Dokuchaev Vyacheslav, et al. NEMO developments towards km3 telescope in the Mediterranean Sea. The NEMO project. Neutrino Mediterranean Observatory By Antonio Capone, NEMO Collaboration. Alignment as a result from QCD jet production or new still unknown physics at LHC? By Alexander Snigirev. Small-scale fluctuations of extensive air showers: systematics in energy and muon density estimation By Grigory Rubtsov. SHINIE: Simulation of High-Energy Neutrino Interacting with the Earth By Lin Guey-Lin, et al.. Thermodynamics of rotating solutions in n+1 dimensional Einstein - Maxwell -dilation gravity By Ahmad Sheykhi, et al.. Supernova neutrino physics with future large Cherenkov detectors By Daniele Montanino. Crossing of the Cosmological Constant Barrier in the string Inspired Dark Energy Model By S. Yu. Vernov. Calculations of radio signals produced by ultra-high and extremely high energy neutrino induced cascades in Antarctic ice By D. Besson, et al.. Inflation, Cosmic Acceleration and string Gravity By Ischwaree Neupane. Neutrino Physics: Charm and J/Psi production in the atmosphere By Liudmila Volkova. Three generation flavor transitions and decays of supernova relic neutrinos By Daniele Montanino. Lattice calculations & computational quantum field theory: Sonification of Quark and Baryon Spectra By Markum Harald, et al.. Generalized Kramers-Wannier Duality for spin systems with non-commutative symmetry By V. M. Buchstaber, et al.. Heavy ion collisions & quark matter: Nuclear matter jets and multifragmentation By Danut Argintaru, et al.. QCD hard interactions: The qT-spectrum of the Higgs and Slepton-pairs at the LHC By Guiseppe Bozzi. QCD soft interactions: Nonperturbative effects in Single-Spin Asymmetries: Instantons and TMD-parton distributions By Igor Cherednikov, et al.. Gluon dominance model and high multiplicity By Elena Kokoulina. Resonances in eta pi- pi- pi+ system By Dmitry Ryabchikov. Saturation effects in diffractive scattering at LHC By Oleg Selugin. A nonperturbative expansion method in QCD and R-related quantities By Igor Solovtsov. Z-scaling and high multiplicity particle Production in bar pp/pp & AA collisions at Tevatron and RHIC By Mikhail Tokarev. Scaling behaviour of the reactionsdd - > p? /3H and pd - > pd with pT at energy I-2 GeV By Yuri Uzikov. [ADS Note: Title formula can not be rendered correctly in ASCII.] CP violation, rare decays, CKM: Precision Measurements of the Mass of the Top Quark at CDF (Precision Top Mass Measurements at CDF) By Daniel Whiteson. Measurement of the Bs Oscillation at CDF By Luciano Ristori. The Bs mixing phase at LHCb By J. J. van Hunen. ATLAS preparations for precise measurements of semileptonic rare B decays By K. Toms. Hadron spectroscopy & exotics: Searches for radial excited states of charmonium in experiments using cooled antiproton beams By M. Yu. Barabanov. Retardation effects in the rotating string model By Fabien Buisseret and Claude Semay. Final results from VEPP-2M (CMD-2 and SND) By G. V. Fedotovich. Heavy Quark Physics: Prospects for B physics measurements using the CMS detector at the LHC By Andreev Valery. Heavy flavour production at HERA-B By Andrey Bogatyrev. B-Meson subleading form factors in the Heavy Quark Effective Theory (HQET) By Frederic Jugeau. Beyond the Standard Model: Monopole Decay in a Variable External Field By Andrey Zayakin. Two-Loop matching coefficients for the strong coupling in the MSSM By Mihaila Luminita. Test of lepton flavour violation at LHC By Hidaka Keisho. Looking at New Physics through 4 jets and no ET By Maity Manas. Are Preons Dyons? Naturalness of Three Generations By Das Chitta Ranjan. SUSY Dark Matter at Linear Collider By Sezen Sekmen, Mehmet Zeyrek. MSSM light Higgs boson scenario and its test at hadron colliders By Alexander Belyaev. Antiscalar Approach to Gravity and Standard Model By E. Mychelkin. GRID distributed analysis in high energy physics: PAX: Physics Analysis Design and Application on the GRID By Martin Erdmann

  13. EDITORIAL: Colloidal suspensions Colloidal suspensions

    NASA Astrophysics Data System (ADS)

    Petukhov, Andrei; Kegel, Willem; van Duijneveldt, Jeroen

    2011-05-01

    Special issue in honour of Henk Lekkerkerker's 65th birthday Professor Henk N W Lekkerkerker is a world-leading authority in the field of experimental and theoretical soft condensed matter. On the occasion of his 65th birthday in the summer of 2011, this special issue celebrates his many contributions to science. Henk Lekkerkerker obtained his undergraduate degree in chemistry at the University of Utrecht (1968) and moved to Calgary where he received his PhD in 1971. He moved to Brussels as a NATO fellow at the Université Libre de Bruxelles and was appointed to an assistant professorship (1974), an associate professorship (1977) and a full professorship (1980) in physical chemistry at the Vrije Universiteit Brussel. In 1985 he returned to The Netherlands to take up a professorship at the Van 't Hoff Laboratory, where he has been ever since. He has received a series of awards during his career, including the Onsager Medal (1999) of the University of Trondheim, the Bakhuys Roozeboom Gold Medal (2003) of the Royal Dutch Academy of Arts and Sciences (KNAW), the ECIS-Rhodia European Colloid and Interface Prize (2003), and the Liquid Matter Prize of the European Physical Society (2008). He was elected a member of KNAW in 1996, was awarded an Academy Chair position in 2005, and has held several visiting lectureships. Henk's work focuses on phase transitions in soft condensed matter, and he has made seminal contributions to both the theoretical and experimental aspects of this field. Here we highlight three major themes running through his work, and a few selected publications. So-called depletion interactions may lead to phase separation in colloid-polymer mixtures, and Henk realised that the partitioning of polymer needs to be taken into account to describe the phase behaviour correctly [1]. Colloidal suspensions can be used as model fluids, with the time- and length-scales involved leading to novel opportunities, notably the direct observation of capillary waves at a fluid-fluid interface [2]. Together with Remco Tuinier, Henk has recently completed a book in this area which is to appear later this year. A major theme in Henk's research is that of phase transitions in lyotropic liquid crystals. Henk, together with Daan Frenkel and Alain Stroobants, realized in the 1980s that a smectic phase in dispersions of rod-like particles can be stable without the presence of attractive interactions, similar to nematic ordering as predicted earlier by Onsager [3]. Together with Gert-Jan Vroege he wrote a seminal review in this area [4]. Henk once said that 'one can only truly develop one colloidal model system in one's career' and in his case this must be that of gibbsite platelets. Initially Henk's group pursued another polymorph of aluminium hydroxide, boehmite, which forms rod-like particles [5], which already displayed nematic liquid crystal phases. The real breakthrough came when the same precursors treated the produced gibbsite platelets slightly differently. These reliably form a discotic nematic phase [6] and, despite the polydispersity in their diameter, a columnar phase [7]. A theme encompassing a wide range of soft matter systems is that of colloidal dynamics and phase transition kinetics. Many colloidal systems have a tendency to get stuck in metastable states, such as gels or glasses. This is a nuisance if one wishes to study phase transitions, but it is of great practical significance. Such issues feature in many of Henk's publications, and with Valerie Anderson he wrote a highly cited review in this area [8]. Henk Lekkerkerker has also invested significant effort into the promotion of synchrotron radiation studies of colloidal suspensions. He was one of the great supporters of the Dutch-Belgian beamline 'DUBBLE' project at the ESRF [9]. He attended one of the very first experiments in Grenoble in 1999, which led to a Nature publication [7]. He was strongly involved in many other experiments which followed and also has been a member of the beam line board. The most recent synchotron data are reported in this issue and Henk